NZ749533A - Compounds and methods for modulating rna function - Google Patents

Abstract

The present invention provides compounds, compositions thereof, and methods of using the same.

Description

COMPOUNDS AND METHODS FOR MODULATING RNA FUNCTION CROSS-REFERENCE T0 RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. § 119(e) of US Provisional Application nos. 62/357,654, filed July 1, 2016, and ,487, filed February 1, 2017, the contents of all of which are incorporated herein in their entireties by reference.

CAL FIELD OF THE INVENTION The present invention relates to compounds and methods of use thereof for ting the biology of RNA transcripts to treat s diseases and conditions by the binding of such compounds to trans or cis three-way junctions. The invention also provides methods of identifying RNA transcripts that can form new three-way junctions stabilized by small molecule binders, thus rendering such three-way junctions druggable, and designing and screening drug candidates that will bind to RNA three—way ons.

BACKGROUND OF THE INVENTION Mammalian diseases are ultimately mediated by the transcriptome, while viruses and other ens depend on RNA for s aspects of infection, reproduction, and survival.

Insofar as messenger mRNA (mRNA) is part of the transcriptome, and all protein expression derives from mRNAs, there is the potential to intervene in protein-mediated diseases by modulating the expression of the relevant protein and by, in turn, modulating the translation of the corresponding upstream mRNA. But mRNA is only a small portion of the transcriptome: other transcribed RNAs also regulate cellular biology either directly by the structure and function of RNA ures (e.g., ribonucleoproteins) as well as via protein expression and action, including (but not limited to) miRNA, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, and pseudo-genes. RNA folds into secondary and tertiary structures in which portions of the nucleic acid form double-stranded segments through Watson-Crick base g while other segments remain unpaired (single-stranded). One common structure is a three-way on (3WJ). In this ce, the nucleic acid forms three double helices in a Y-shaped pattern, with the central point of intersection of the three helices termed the 3WJ. Small molecules can bind with high affinity to the 3WJ and stabilize this structure, thus affecting the function of the target RNA by altering its structural preferences and hence ting its downstream biological activity. However, the discovery and use of small molecules as ligands for RNA to treat RNA-mediated diseases has received little attention from the pharmaceutical industry.

Accordingly, targeting the RNA transcriptome and 3WJ in particular with small molecules represents an ed therapeutic approach to treat RNA-mediated diseases.

Furthermore, there remains a high, unmet need for improved treatments of RNA-mediated diseases, including mammalian diated diseases, viruses, tes, and microbes.

SUMMARY OF THE INVENTION The present invention provides compounds and s of use thereof for the modulation of the levels and/or activities of nucleic acid, e. g. RNA or DNA, les by drug- like small molecules, The present invention also provides methods of screening nucleic acid sequences for cis or trans sequence complementarity likely to form a 3WJ or likely to form a 3WJ in the ce of a disclosed compound. Furthermore, the present invention es methods of screening small molecules for binding to a 3WJ. The present invention takes advantage of 3WJ ion by identifying these structures and screening for small molecules that selectively bind them to stabilize the 3WJ in cells and animals. By stabilizing the 3WJ, the small molecule can modulate the stability or activity of the nucleic acid.

BRIEF DESCRIPTION OF THE FIGURES Figure 1A shows a fully complementary interaction between an miRNA and mRNA (i.e. the ces share full sequence complementarity and form a RNA-RNA duplex). Figure 1B shows an interaction in which the miRNA is splinted discontinuously across the flank region of the mRNA located at the base of the stem-loop element. This interaction creates a 3WJ at the base of the stem—loop element.

Figure 2 shows a flowchart g a hypothetical target RNA of interest to an or RNA to 3WJ-binding small molecules to lar mechanism in cells. Importantly, using the disclosed methods it is possible to begin with either a known RNA target and fy or/target pairs that form 3WJs using a bioinformatic screen, or perform a bioinformatic screen of the entire transcriptome to identify all effector/target pairs that form 3WJs, followed by selection of an effector/target RNA pair of interest. ing the remaining steps of the flowchart identifies small molecules that bind 3WJs on targets of high therapeutic value, thereby modulating the target to treat or ameliorate a disease or disorder.

Figure 3 shows exemplary effector RNA/target RNA pairings. For example, miRNA and mRNA could form a 3W1 in trans, priRNA could form a cis 3WJ, and so on.

Figure 4 shows the mechanism of 3WJ g a small molecule (represented by a triangle) with a stem-loop (3WJ) in the effector RNA. The RNA may or may not be bound to an RNA binding protein (RBP, represented by oval). Binding of the small molecule may (or may not) influence binding of any RBP that normally binds to the RNA/RNA duplex.

Figure 5 shows the mechanism of 3WJ binding a small molecule with a stem-loop (3WJ) in the target nucleic acid. The RNA may or may not be bound to an RNA binding protein (RBP; represented by oval). Binding of the small molecule may (or may not) influence binding of any RBP that ly binds to the RNA/RNA duplex.

Figure 6 shows two strategies for targeting trans-acting 3-way junctions. In one strategy (top), first one identifies a “natural” miRNA/mRNA pair that yields a 3WJ, then identifies small molecule ligands that lock in the miRNA/mRNA trans-regulatory structure to y the miRNA regulatory . Notably, the small molecule can thus act as either a ational agonist (amplify translation & n expression) or a translational antagonist (suppress translation & protein sion). In a second strategy (bottom), first one identifies “candidate” miRNA/mRNA pairs that will present a 3W]; then identifies SM ligands that lock in mRNA trans-regulatory structure to amplify the miRNA regulatory effect. Notably, the small molecule can thus act as either translational agonist (amplify translation & protein expression) or a translational antagonist (suppress translation & protein expression).

Figure 7 shows a scheme demonstrating how small molecules could act to stabilize trans-acting 3WJs. Using the sed methods, for example, one could ate ca. 1000 miRNAs with 20,000 mRNAs for 20,000,000 potential pairs — optionally with the simplifying assumption that each mRNA has only one hybridizable site. This catalog can be assembled without nce to the actual endogenous regulatory role of a given miRNA. Insofar as the small molecule can stabilize the ternary complex, this may render moot the contributions of Argonaute and/or RBPs to regulation of mRNA on.

Figure 8 shows exemplary binding modes of nding small molecules. Small molecules might bind the 3WJ only, the 3WJ plus g the major or minor groove nt to one base pair, the 3WJ plus binding the major or minor groove adjacent to one base pair in two separate duplexes, and so on.

Figure 9 shows the topology of 3WJs. Note: (A) X, Y, and Z vary independently as O, l, 2, 3, 4, 5, or 6. (B) Nucleotides in the loops that define the periphery of the 3WJ vary independently as A, C, G, or U. (C) Inside the cells those nucleotides may have undergone posttranscriptional modifications. (D) The stems are minimally 4 base pairs each, but can n bulges and loops. (E) The loop at the end of the stem-loop can vary from 3 on up.

Figure 10 shows a cis model system that may be used to understand a corresponding trans 3WJ system. Synthetic single-stranded RNA can recapitulate key binding events. It can link via 5’-to-3’ or 3’-to-5’. The length and structure of the linker will be selected to favor but not e 3WJ formation. Ligands that bind to 3WJs in the cis model must induce formation of ternary complex in the trans model. This format enables rapid and combinatoric selectivity screening. The binding free energy here is expected to be predictive of cellular outcome. Some features of this method: the structure to be analyzed is small — small enough to screen by NMR; easy to make; screenable via DEL (DNA encoded libraries); ically relevant — models the regulatory interaction of miRNA with its e mRNA; biologically specific — focus on single mRNA; immediate focus on one subsite, so one can design structure—informed displacement assays; inherent connection between target/subsite and biological function; and the potential for co-opting non-cognate miRNAs to tackle arbitrary mRNAs at arbitrary sites.

Figure 11 shows how the PEARL-seq method (Hook the Worm, or HTW; see USSN 62/289,671, which is hereby orated by reference) can reveal endogenous mRNA/miRNA pairs. WH = warhead moiety that reacts with proximate 2’-OH sites on an RNA after binding of a small molecule ligand that is covalently attached to the WH. Separate sequencing of RNA/RNA pairs such as mRNA reveals which nucleotides are proximate to each other and to the binding site of the HTW molecule under the assay conditions and/or in vivo.

Figure 12 shows exemplary triptycene scaffolds with l auxiliary (i.e. group e of binding to a nucleic acid feature, such as the major or minor groove, outside of the central cavity of the 3WJ).

Figure 13 shows exemplary triptycene scaffolds with 2 auxiliaries.

Figure 14 shows exemplary triptycene scaffolds with 3 auxiliaries.

Figure 15 shows ary trityl scaffolds with l auxiliary.

Figure 16 shows exemplary trityl scaffolds with 2 auxiliaries.

Figure 17 shows exemplary l-azabicyclooctane scaffolds with l auxiliary.

Figure 18 shows exemplary l-azabicyclooctane scaffolds with 2 auxiliaries.

Figure 19 shows exemplary trioxabicyclooctane scaffold with l auxiliary.

Figure 20 shows exemplary bicyclooctane scaffolds with 2 auxiliaries.

Figure 21 shows exemplary adamantane scaffolds with 2 auxiliaries.

Figure 22 shows exemplary adamantane scaffolds with 2 auxiliaries.

Figure 23 shows general molecular scaffolds that may bind the l cavity of 3WJs and also bind to double stranded RNA grooves by cting with exposed edges of base pairs when substituted with one or more functional groups or edge binders as bed in various embodiments herein.

Figure 24 shows structures of DNA groove binders that provide a variety of synthons for edge interactions.

Figure 25 shows structures of exemplary small molecule scaffolds that feature functional groups capable of base-pairing with c acid target 3WJs, as well as functional groups capable of binding ctions with edge features such as the minor groove.

Figure 26 shows pictorial representations and an exemplary compound structure of a designed small molecule that features a nucleobase capable of base-pairing with nucleic acid target 3WJs, as well as onal groups capable of g interactions with edge features such as the major or minor groove. H—bond donor and acceptor functionalities are spaced to optimize interactions (including sequence-specific interactions) with the stem of a nucleic acid stem-loop structure.

Figure 27 shows exemplary g modes for designed small molecules optimized for geometries of given nucleic acid junction ures. Binding focuses not only on the central cavity but also es “arms” that bind with stem structures away from the central cavity, optionally including functionality capable of binding in distant secondary loops, Figure 28 shows ary g modes for ed small molecules optimized for geometries of given nucleic acid duplexes that have one or more bulges (unpaired nucleotide(s)). Here, hydrogen bond donors and acceptors are spaced to interact with the duplex, such as in the major or minor groove, with one or more nucleobases placed to interact with the bulge(s).

Figure 29 shows exemplary binding modes for ed small molecules optimized for geometries of given nucleic acid duplexes that have one or more bulges (unpaired nucleotide(s)). Here, hydrogen bond donors and acceptors are spaced to interact with the duplex, such as in the major or minor groove, with one or more nucleobases placed to interact with the bulge(s).

Figure 30 shows exemplary g modes for designed small molecules optimized for geometries of given nucleic acid 3WJs. Here, hydrogen bond donors and ors are spaced to interact with one or more duplex arms protruding from the 3WJ, such as cting with the major or minor groove, with one or more nucleobases placed to interact with distant loops and a nucleobase (left structure) or chemical scaffold such as a compound of Formula I, II, etc. optionally placed for binding in the central cavity of the 3WJ (three rightmost ures).

Figure 31 shows a list of exemplary target mRNAs that, in certain embodiments, are down-regulated by a disclosed nd.

Figure 32 shows a list of exemplary target mRNAs that, in certain embodiments, are up-regulated by a disclosed nd.

Figure 33 shows structures of exemplary DNA groove binders that provide a variety of synthons for edge interactions.

Figure 34 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 35 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 36 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the t invention.

Figure 37 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present ion.

Figure 38 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 39 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 40 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 41 shows exemplary compound scaffolds, small les, and synthetic methods of preparing same, for use in the present invention.

Figure 42 shows exemplary compound scaffolds, small molecules, and tic methods of preparing same, for use in the present invention.

Figure 43 shows exemplary compound scaffolds, small les, and synthetic methods of preparing same, for use in the present invention.

Figure 44 shows exemplary compound lds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 45 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 46 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 47 shows exemplary compound scaffolds, small molecules, and synthetic methods of ing same, for use in the present invention. In (A), ribozymes were selected from a combinatorial library of random-sequence ther-anthracene conjugates by on with biotin maleimide and subsequent isolation of biotinylated molecules. (B) ary ure motif shared by most sequences. N = any nucleotide; N’ = nucleotide complementary to N. (C) Bimolecular cycloaddition catalyzed by D- or L-ribozymes. R1 = H or larger, R2 = ethyl or larger.

Figure 48 shows exemplary compound lds, small molecules, and tic methods of preparing same, for use in the present invention.

Figure 49 shows exemplary compound scaffolds, small molecules, and tic methods of preparing same, for use in the present invention.

Figure 50 shows exemplary compound scaffolds, small molecules, and synthetic methods of ing same, for use in the present invention. Cp = cyclopentadiene, cod = 1,5- cyclooctadiene; TBAF = tetra-n-butylammonium fluoride; THF = tetrahydrofuran.

Figure 51 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 52 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 53 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 54 shows exemplary compound scaffolds, small molecules, and tic methods of preparing same, for use in the present invention. The scheme on the left shows oxidative degradation of aryladamantanes to the corresponding carboxylic acids. Ans: 2- or 4- anisyl. Compound 16 was ed as a mixture of 2- and yl derivatives. The scheme on the right shows synthesis of rigid adamantine scaffolds 20, 21, and 22.

Figure 55 shows exemplary compound lds, small molecules, and synthetic methods of preparing same, for use in the present ion.

Figure 56 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 57 shows exemplary compound scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention. The compounds shown include results of a competition binding is with TCT8—4 RNA ce 1994, vol. 263). The chemical structures are shown for a series of tives used in competitive binding experiments with TCT8-4 RNA. The right column represents the affinity of the competitor relative to theophylline, Kd(c)/Kd(t), where Kd(c) is the individual competitor dissociation constant and Kd(t) is the competitive iation constant of theophylline. Certain data denoted by > are minimum values that were limited by the solubility of the competitor. Each experiment was carried out in duplicate. The average error is shown.

Figure 58 shows exemplary compound lds, small molecules, and synthetic methods of preparing same, for use in the present invention. See Lau, J. L. e1 61]., ACS Nano 2011, 5(10), 7722.

Figure 59 shows exemplary nd scaffolds, small molecules, and synthetic methods of preparing same, for use in the present invention.

Figure 60 shows exemplary compound scaffolds and small molecules, for use in the present invention, that bind various RNA aptamers taken from McKeague et al., Journal of Nucleic Acids, Volume 2012 (2012), Article ID 748913, 20 pages.

Figure 61 shows exemplary compound scaffolds, small molecules, and synthetic s of preparing same, for use in the present invention.

Figure 62 shows exemplary compound scaffolds, small molecules, and synthetic s of preparing same, for use in the present invention.

Figures 63A and B show a synthetic route for compound ARK—132.

Figures 64A-D show a synthetic route for compound ARK-134.

Figures 65A—C show a synthetic route for compounds ARK-135 and 6.

Figure 66 shows a tic route for compound ARK-188.

Figure 67 shows a synthetic route for compound ARK—190.

Figure 68 shows a synthetic route for compound ARK-191.

Figure 69 shows a synthetic route for compound ARK-195.

Figure 70 shows a synthetic route for compound ARK-197.

Figures 71A and B show a synthetic route for compounds based on the ribocil scaffold.

Figure 72 shows a calibration experiment to determine the dependence of fluorescence on the tration of 3W1 RNA ucts.

Figure 73 shows the results of a fluorescence quenching experiment of compounds Ark000007 and Ark000008 with two RNA 3WJ constructs at various concentrations.

Figure 74 shows likely structures for the following three RNA 3W1 constructs, with a putative binding site for small molecule s shown as a le: A) _1.0.0_SIB_3FAM (cis 3WJ with one unpaired nucleotide), B) Split3WJ.l_up_SIB + 2017/040514 Split3WJ.l_down_3FAM (trans 3WJ as 1:1 mix); and C) Split3WJ.2_up_5IB + WJ.2_down_3FAM (trans 3WJ as 111 mix).

Figure 75 shows fluorescence quenching data measuring interaction of compounds Ark0000013 and Ark0000014 with the following RNA constructs: A) RNA3WJ_1.0.0_5IB_3FAM (cis 3WJ with one unpaired nucleotide); B) Split3WJ.l_up_5IB + Split3WJ.1_down_3FAM (trans 3W] as 1:1 mix); and C) Split3WJ.2_up_5IB + Split3WJ.2_down_3FAM (trans 3WJ as l:l mix).

Figure 76 shows l shift data for compounds Ark000007 and Ark000008 tested with the 0.0_5IB_3FAM RNA uct. Data analysis shows significant effect for Ark000007 with melting temperature shift of ~5 C’C (i.e. from 61.2 °C to 65.6 C’C). In contrast, only a very small effect for Ark000008 was observed. These data suggest that the presence of Ark000007 increases stability of the 3WJ.

Figure 77 shows thermal shift data for Ark0000013 and Ark0000014 in the presence of _1.0.0_SIB_3FAM (cis 3W] with one unpaired nucleotide).

Figure 78 shows l shift data for Ark0000013 and Ark0000014 in the ce of Split3WJ. l_up_5TB+Split3WJ. l_down_3FAM.

Figure 79 shows thermal shift data for Ark0000013 and Ark0000014 in the presence of Split3WJ.2_up_5TB+Split3WJ.2_down_3FAM.

Figure 80 shows the ure of CPNQ, assigned proton resonances, NMR spectrum, and epitope mapping results.

Figure 81 shows the structure of HP-AC008002-E01, assigned proton resonances, NMR spectrum, and epitope mapping results. The scaled STD effect was plotted onto the molecule according to the preliminary assignments. The data suggests for both RNA constructs that protons of the pyridine ring are in closer proximity to RNA than the benzene ring. The aliphatic CH2 group could not be observed due to buffer signal overlap in that region.

Figure 82 shows the structure of HP-AC008001-E02, assigned proton resonances, NMR spectrum, and epitope mapping results. The scaled STD effect was d onto the molecule according to the preliminary assignments. The data suggest for both RNA constructs that aromatic protons closest to the heterocycle are in closer proximity to RNA protons.

Aliphatic proton resonances could not be ed by STD due to direct saturation artifacts/buffer signal overlap in that region (epitope mapping by WaterLOGSY).

Figure 83 shows the ure of HP-AT005003-C03, assigned proton resonances, NMR spectrum, and epitope mapping results. The scaled STD effect was d onto the molecule according to the preliminary assignments. Due to signal overlap no individual assignment of the CH2 groups was possible. The data suggest for both RNA constructs that protons of the furan moiety are in closer proximity to RNA protons than the phenyl. s 84A-E show steps for the production of Illumina small RNA-Seq library preparation using T4 RNA ligase l adenylated adapters. s 85A-E show steps for the production of Illumina small RNA-Seq library preparation using T4 RNA ligase l adenylated adapters.

Figure 86 shows PAGE analysis of RNA target sequences for use in DEL experiments. The gel lanes show: 1: HTTl7CAG in NMR buffer, 2: Before incubation with Neutravidin resin; 3: Supernatant after incubation with Neutravidin resin; 4: RNA after incubation with DEL compounds for 1 hour at RT. The RNA was recovered after heat release from the resin.

Figure 87 shows exemplary steps of a Surface Plasmon Resonance (SPR) method for use in the present invention.

Figures 88A and B shows exemplary steps of a Surface Plasmon Resonance (SPR) method for use in the present invention.

DETAILED PTION OF THE INVENTION The present invention es compounds and methods of use f for the modulation of the levels and/or activities of nucleic acid, e. g. RNA or DNA, molecules by drug- like small molecules. The present invention also provides methods of screening nucleic acid sequences for cis or trans sequence complementarity likely to form 3WJ or likely to form 3WJ in the presence of a sed compound. Furthermore, the present invention provides methods of screening small molecules for binding to 3WJ. The present invention takes advantage of 3WJ formation by fying these ures and screening for small molecules that selectively bind them to stabilize the 3WJ in cells and animals. By stabilizing the 3WJ, the small le can modulate the stability or activity of the nucleic acid.

In one , the present invention provides a compound or pharmaceutically acceptable salt thereof that selectively binds to and stabilizes a 3WJ. In some embodiments, the 3WJ is the product of cis interactions, i.e. results from ctions within the same nucleic acid, such as RNA, ce or . In some embodiments, the 3WJ is the product of trans interactions i.e. results from interactions within two or more nucleic acid, such as RNA-RNA, RNA-DNA, or DNA-DNA, sequences or strands. Thus, in a cis 3WJ, the sequences comprising the 3WJ are all within one nucleic acid molecule. In contrast, in a trans 3WJ, the sequences forming the 3WJ are derived from the interaction of two or three, most commonly two, different nucleic acid molecules. For e, in some cis 3WJ, sequences in the 5’ untranslated region (UTR) of a single mRNA transcript fold to form a 3WJ. In other embodiments, an exemplary trans 3WJ is a 3WJ formed between a microRNA (miRNA) and an mRNA.

A y of RNAs could be targeted for 3WJ formation and modulation by a small molecule that binds to the 3WJ. These e mRNA, long ing RNA (lncRNA), viral RNA, and microbial RNA. These will be referred to in this patent application as “targets”. One common use for this invention will be to target human mRNA in order to affect the level of the protein expressed by translation of that mRNA. Another use will be to target the s of RNA viruses to inhibit translation, block viral packaging, or inhibit other obligatory steps in the virus life cycle.

Small RNAs can act in trans to induce 3WJ formation. These RNAs will be referred to as “effectors”. In some embodiments, effectors are selected from various natural forms of small RNA such as miRNA, Piwi-interacting RNA (piRNA), and small nucleolar RNA (snoRNA). These small RNAs can base pair with a target such as mRNA in a manner that results in the ion of a 3WJ. The base pairing between the effector and target is often incomplete, meaning that the two sequences have some, but not complete, complementarity.

Perfect complementarity would result in the formation of a fully double-stranded structure that lacks a 3WJ. In order to form a 3WJ, the effector (e.g., a miRNA) and target (e. g., an mRNA) would generally form a stretch of base pairing of at least 4 nucleotides (nt) followed by a base- pairing stem of at least 4 nt and a loop of unpaired nt, followed by a second stretch of base pairing between the effector and target ces. The stem-loop can be formed either in the effector or the target RNA. ary 3WJ structures are shown in Figures 1, 7, and 9.

The process for the identification of the 3WJ first comprises a computational approach to predict the 3WJ. Sequence databases can be searched for homology using a program such as BLAST. In some embodiments, to identify effector miRNA to target mRNAs, a homology search is med between a library of miRNA and one particular mRNA of interest (or, in other embodiments, a known group of mRNAs ated with a particular miRNA, or, in other embodiments, all mRNAs are searched) using an annotated database such as the UC Santa Cruz Genome r. Public databases of miRNA are available (h_’g'_i_‘p_t__/_z'_3§f§gy_§§g_r_;;i__i__i;_h__;§§_e_._9;_rgg, hit}; ://mirdb . orgx’miRDBX’; http:f/muv .mi cram-a . org/microma/hom e. do; htt :.r"/mir1'arbase.mbc,i'ictucdu.tw htt 1/,"m ircancer htt :z’fwww 7 . ecu. ed u , . mi r2 di sease . ore“, htt 3:.flszumm.uniuheidei a’a signifiminvallifo’; ht”: :.I‘x’muv.targetscanorg). The effector1target identification search can be done by setting the parameters for the 3WJ including minimal base-pairing of the effector and target, minimal size of the stem and maximum size of the loop as well as the thermostability of the structure, Beyond this trans analysis, identification of cis 3WJs could be done by searching a nucleic acid database (e.g., ted mRNA) for the ability of individual RNAs to form 3WJs. 3WJs in nucleic acids form when, in a folded conformation, three double-helical “stems” converge and the stems are connected with one or two loops of varying length. These can be either “perfect” 3WJs in which all nucleotides in the junction take part in the base g or can be reduced-symmetry 3WJs where one or more nt at the junction n the three converging steps could be unpaired. The three positions — end of the first effectorztarget base pairing (x), base of the stem (y) and start of the second effectorztarget base g (y) — can have loops or bulges of unpaired nt (see Figure 9). In some embodiments, the loop lengths for X, y and z in the 3WJ formed by binding of the small molecule to the target nucleic acid are ndently selected from 0, l, or 2 nt. In some embodiments each loop is independently selected from 0, l, 2, 3, or 4 nt. In some embodiments each loop is 0 nt. In some embodiments each loop is 1 nt. In some embodiments each loop is 2 nt. In some embodiments one loop is 0 nt. In some embodiments one loop is 1 nt. In some embodiments one loop is 2 nt.

There have been reports of small molecules that bind to DNA and RNA 3WJs, stabilizing that 3D structure (as evidenced by elevation of the melting temperature). Formation of the 3WJ around the small molecule ligand has been reported for triptycenes with single- stranded nucleic acids (Barros & Chenoweth, Angew. Chem. Int. Ed 2014, 53, 13746 —13750; Barros & eth, Chem. Sci, 2015, 6, 4752—4755, Barros et al., Angew. Chem. Int. Ed. 2016, 55, 1—5), complementary hybridization of two strands around cocaine derivatives (Kent et al., Anal. Chem. 2013, 85, 9916-9923; Sharma & Heemstra, J. Am. Chem. Soc. 2011, 133, 12426—12429; Heemstra, Beilstez'n J. Org. Chem. 2015, 11, 720), and the convergence of three strands around symmetric metallic complexes (Phongtongpasuk et al., Angew.

Chem. Int. Ed 2013, 52, 11513 —11516, Oleksi et al., Angew. Chem. Int. Ed 2006, 45, 1227 — 1231).

Insofar as essentially all biology can be traced to the classes of targets under consideration, a broad scope of diseases can ially be addressed by this invention.

In one aspect of the present invention, certain small molecules bring together effector RNAs with regions of target nucleic acid, such as a target RNA, by inducing the formation of and stabilization of 3WJs without the assistance or participation of RNA-binding proteins (RBPs). Many /effector nucleic acid pairs have multiple potential 3W] interactions. Thus, small molecule ligands can be “programmed” to modulate the ical functions of essentially any targeted RNA in the cell. This recapitulates the original promise of antisense without the pharmaceutical limitations imposed by administration of exogenous oligonucleotides. ing Nucleic Acid 3WJs RNA plays varied and important roles in the cell. Messenger RNAs ) are transcribed from protein-encoding genes and are translated to proteins serving a wide range of functions. Since mRNAs adopt structural features such as 3WJs that are al for their function, some embodiments of the invention e compounds and methods in which one or more mRNAs are the target nucleic acid. In other embodiments, other types of RNA are a target nucleic acid. For example, mal RNA (rRNA) and transfer RNA (tRNA) function in translation. Noncoding RNAs (ncRNAs) are diverse and abundant, playing regulatory roles in many cellular processes. Long noncoding RNAs (lncRNAs) are RNAs of over 200 nt that do not encode proteins (Morris & Mattick, Nature s Genetics 2014, 15, 423-437; Mattick & Rinn, Nature Strucz‘. & M0]. Biol. 2015, 22, 5-7; Iyer et al., Nature Genetics 2015, 47, 199-208).

They can affect the expression of the protein-encoding mRNAs at the level of transcription, splicing, and mRNA decay. lncRNA can regulate transcription by recruiting epigenetic regulators that increase or se transcription by altering chromatin structure (Holoch & Moazed, Nat. Rev. Genetics 2015, 16, 71-84). lncRNAs are associated with a wide range of human diseases including cancer, inflammatory diseases, neurological diseases and cardiovascular disease. The targeted tion of lncRNA could yield, depending on the site of 3WJ formation, up-regulation or down-regulation of the expression of c genes and ns for therapeutic benefit. RNA secondary and ry structures, in particular 3WJs, are critical for these regulatory activities. Thus, the noncoding transcripts (the noncoding transcriptome) represent a large group of new therapeutic targets. Some exemplary RNA targets and diseases are described in greater detail below.

Targeting mRNA mRNAs are ribed in the s by RNA polymerase II. There are roughly ,000 mRNAs in humans. However, there is ntial complexity in that each mRNA can have several different isoforms that may vary in the 5’ start site, the length of the 3’ UTR, and the polyAdenylation (polyA) site usage. Many mRNAs also have a wide variety of alternative splice forms. Typical mRNAs have a cap at the 5’ end, a 5’ UTR, a range of exon and intron numbers, a 3’ UTR and a polyA sequence at the 3’ end. The concentration or “level” of the mRNA, and its resultant protein expression via translation, could be ted by small molecules that affect the structure of the mRNA, splicing ncy, stability (half-life) of the mRNA, transport of the RNA, and the efficiency of translation. 3WJ ion could be induced and stabilized in either the coding or noncoding elements to affect mRNA and protein levels.

Depending upon the therapeutic goal, the e could be either down-regulation or up- regulation. Accordingly, in some embodiments the present invention provides a method of altering the concentration of a target mRNA, comprising the step of contacting the target mRNA with a disclosed nd to form or stabilize a 3WJ comprising a portion of the target mRNA.

In some embodiments, forming or stabilizing a 3WJ sing a portion of the target mRNA affects the splicing efficiency, stability (e.g., half-life), transport, or efficiency of translation of the target mRNA. In some embodiments, the concentration of target mRNA is up—regulated‘ In some embodiments, the concentration of target mRNA is down-regulated. In some embodiments, the mRNA that is down-regulated is selected from those listed in Figure 31. In some embodiments, the mRNA that is up-regulated is selected from those listed in Figure 32. In some embodiments, the 3W] is cis. In some embodiments, the 3W1 is trans.

Within mRNAs, noncoding regions can affect the level of mRNA and protein expression. Briefly, these include (a) internal ribosome entry sites (IRES) and (b) upstream open reading frames (uORF) in the 5’ UTR that affect translation efficiency, (c) ic sequences that affect splicing efficiency and alternative splicing patterns, ((1) 3’ UTR sequences that affect mRNA and protein localization, and (e) elements in the body of the mRNA and/or the 3’ UTR that control mRNA decay and half-life. (Komar and Hatzoglou, Frontiers Oncol. 5:233, 2015; Weingarten-Gabbay ei al., Science 351:pii:aad4939, 2016, Calvo er al., Proc. Natl. Acad. Sci.

USA 106:7507-7512, Le Quesne ez‘ al., J. Paihol. 220:140-151, 2010; Barbosa et al., PLOS cs 9:e10035529, 2013). For example, nearly half of all human mRNAs have uORFs, and many of these reduce the translation of the main ORF. A vast number of single-nucleotide rphisms (SNPs) associated with humans are d in these noncoding regions of mRNA, suggesting that they have critical tory functions and their targeting by 3WJ formation could impact expression levels. Accordingly, in some embodiments the present invention provides a method of altering the concentration of a target mRNA, sing the step of contacting the target mRNA with a disclosed compound to form or stabilize a 3W] comprising a noncoding portion of the target mRNA. In some embodiments, the noncoding n of the target mRNA is selected from: an al ribosome entry site (IRES), upstream open reading frames (uORF) in the 5’ UTR, an intronic sequence that affects splicing efficiency and alternative splicing patterns, a 3’ UTR sequence that affects mRNA and protein localization, or an t in the body of the mRNA and/or the 3’ UTR that controls mRNA decay and half-life.

] In other embodiments, RNA structures in the 5’ UTR are targeted to inhibit translation. RNA ures such as hairpins in the 5’ UTR have been shown to affect translation. In some embodiments, the invention provides a method of modulating ribosome recognition and/or progression or inhibiting translation in order to decrease the production of a protein, comprising contacting an RNA ure in the 5’ UTR with a disclosed compound. In some embodiments, ribosome recognition and/or progression is modulated or translation is inhibited by formation or stabilization of a 3W] at or just upstream of the AUG at the start of translation.

The half-life of mRNA is tightly controlled in cells (Palumbo et al., Wiley Interdiscip.

Rev. RNA, 2015, 6, 327-336). The concentration of mRNA in cells is a product of tight regulation and the balance between transcription and mRNA decay. dual mRNAs have their own distinct half-lives, but degradation can be accelerated when mRNA is misprocessed or ation is blocked. The decay of individual mRNAs can be ated or inhibited by translational impairment, and, likewise, changes in the half-life of mRNA can alter translational efficiency (Roy & on, Trends Genet. 2013, 29, 9). mRNA stability and degradation can also be controlled by environmental stimuli and biological processes such as cell cycling, cell differentiation, and immune response. mRNA stability is conserved n cell types and s. A majority of human mRNAs exhibit half-lives of less than 8 hours, with a ntial proportion having half-lives of less than 4 hours. Formation and stabilization of a 3WJ in mRNA could significantly increase or decrease mRNA stability. Most mRNA decay takes place by processive 3’ to 5’ and 5’ to 3’ degradation of the RNA by exoribonucleases that degrade mRNA from its ends. These exoribonucleases degrade single-stranded, but not double- stranded, RNA. Accordingly, in some embodiments, the present invention provides a method of increasing the half-life of an mRNA or modulating the level of a protein regulated by the mRNA, comprising contacting the mRNA with a disclosed compound. In some embodiments, the compound induces the formation of or stabilizes a 3WJ in the mRNA, or between the mRNA and a complementary nucleic acid such as another RNA. Without g to be bound by theory, the presence of the 3WJ may block the exoribonuclease activity to increase the mRNA half-life and increase the resulting protein level of a protein that would be therapeutically beneficial. In some embodiments, a disclosed compound induces formation of a 3W] or izes a 3WJ in the 3’ UTR upstream of the polyA site. This may t a target mRNA from degradation. atively, a 3WJ is introduced in the 5’ UTR ed that it does not t translation.

Termination of mRNA transcripts can occur at different positions, thus forming mRNAs with distinct properties including alterative protein coding. mRNA processing occurs co-transcriptionally, such that slowdown of RNA polymerase II processivity is linked to 3’ end cleavage and polyadenylation. Protein—coding mRNAs of varying lengths can be created by alternative termination and polyA site usage. These distinct RNAs can have different half-lives, translational efficiencies or subcellular localization. In some embodiments, a disclosed compound binds to and/or stabilizes a 3WJ at a site of RNA polymerase II termination and/or polyA addition. In some embodiments, such 3WJ formation and/or stabilization alters the function of the mRNA.

One consideration for the selection of s and effectors is their relative expression levels. In some embodiments, the effector RNA concentration is similar to the target nucleic acid (e.g., a target mRNA) concentration. If the abundance of the target greatly exceeds the effector, then a functional impact on the RNA target is rendered more challenging. In certain embodiments, the relative concentration of the or:target nucleic acid in the biological system (e. g. subject’s whole body, , cell, nucleus, mitochondria, or cytoplasm) is n 100:1 to 1:100. In some embodiments, the ve concentration is 50:1 to 1:50, 25:1 to 1:25, :1 to 1:10, 5:1 to 1:5, 3:1 to 1:3, 2:1 to 1:2 or approximately 1:1. In some embodiments, the effector:target concentration is at least about 10:1. In some embodiments, the effector:target concentration is at least about 25:1. In on, in certain embodiments both RNAs are localized to the same compartment of the cell such that an interaction is more likely. While the subcellular distribution need not match precisely, it should not be exclusive. For example, the effector should not be exclusively nuclear while the target c acid is exclusively cytoplasmic.

Small les can be used to modulate splicing of pre-mRNA for therapeutic benefit in a variety of settings. One example is spinal muscular atrophy (SMA). SMA is a consequence of insufficient amounts of the survival of motor neuron (SMN) protein. Humans have two versions of the SMN gene, SMNl and SMN2. SMA patients have a mutated SMNl gene and thus rely solely on SMN2 for their SMN protein. The SMN2 gene has a silent mutation in exon 7 that causes inefficient splicing such that exon 7 is d in the majority of SMN2 transc1ipts, leading to the generation of a defective n that is rapidly degraded in cells, thus limiting the amount of SMN protein produced from this locus. A small molecule that promotes the efficient inclusion of exon 7 during the splicing of SMN2 ripts would be an effective treatment for SMA (Palacino et al., Nature Chem. Biol, 2015, 11, 511-517). Accordingly, in one , the t invention provides a method of identifying a small molecule that modulates the splicing, transcription, or cellular half-life of a target pre-mRNA to treat a disease or disorder, sing the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ in the target pre-mRNA, and identifying which small molecule(s) bind to the 3WJ and te the splicing, transcription, or cellular half-life of the target pre—mRNA to treat the disease or disorder. In some embodiments, the method further comprises fying the target pre-mRNA according to a disclosed ational survey. In some embodiments, the target pre-mRNA is capable of forming a 3WJ in the presence of an effector RNA such as an effector miRNA. In some embodiments, the small molecule binds to a trans 3WJ formed n the effector RNA and the target NA. In some embodiments, the small molecule binds to a cis 3WJ formed between ns of the target pre-mRNA. In some embodiments, the pre—mRNA is an SMN2 transcript. In some embodiments, the disease or disorder is spinal muscular atrophy (SMA).

Even in cases in which defective splicing does not cause the disease, alteration of splicing patterns can be used to correct the disease. Nonsense mutations leading to premature translational termination can be eliminated by exon skipping if the exon sequences are in—frame.

This can create a protein that is at least partially onal. One example of the use of exon skipping is the dystrophin gene in Duchenne ar dystrophy (DMD). A variety of different mutations leading to premature termination codons in DMD patients can be eliminated by exon skipping promoted by oligonucleotides (reviewed in Fairclough er al., Nature Rev. Gen, 2013, 14, 373-3 78). Small molecules that bind RNA structures and affect splicing are expected to have a similar effect. Accordingly, in one aspect, the present invention es a method of identifying a small le that modulates the splicing pattern of a target pre-mRNA to treat a disease or disorder, comprising the steps of: ingly, in one aspect, the present invention provides a method of identifying a small le that modulates the splicing pattern of a target pre—mRNA to treat a disease or disorder, sing the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ in the target pre—mRNA; and identifying which small molecule(s) bind to the 3WJ and modulate the splicing pattern of the target pre-mRNA to treat the disease or disorder. In some embodiments, the method further comprises identifying the target pre-mRNA according to a disclosed ational . In some embodiments, the target pre—mRNA is capable of forming a 3WJ in the presence of an effector RNA such as an effector miRNA. In some ments, the small molecule binds to a trans 3WJ formed n the effector RNA and the target pre-mRNA. In some embodiments, the small molecule binds to a cis 3WJ formed between ns of the target pre-mRNA. In some embodiments, the target pre-mRNA is a dystrophin gene transcript. In some embodiments, the small molecule promotes exon skipping to eliminate premature translational termination. In some embodiments, the disease or disorder is Duchenne muscular dystrophy (DMD).

The present invention contemplates the use of small molecules to up- or down- regulate the expression of specific proteins based on targeting 3WJs in their cognate mRNAs. ingly, the present invention provides methods of modulating the downstream protein expression associated with a target mRNA comprising the step of contacting the target mRNA with a small molecule disclosed herein that binds to or stabilizes a 3WJ in the target mRNA. In another aspect, the present invention provides a method of producing a small molecule that modulates the downstream protein expression ated with a target mRNA, comprising the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ in the target mRNA; and identifying which small molecule(s) bind to the 3WJ and modulate the ream protein expression associated with the target mRNA. In some ments, the method r comprises identifying the target mRNA ing to a disclosed computational survey. In some ments, the target mRNA is capable of forming a 3WJ in the presence of an effector RNA such as an effector miRNA. In some embodiments, the small molecule binds to a trans 3WJ formed between the effector RNA and the target mRNA. In some embodiments, the small molecule binds to a cis 3WJ formed between portions of the target mRNA. In some embodiments, modulation of the downstream protein expression associated with the target mRNA treats or ameliorates a disclosed disease or condition.

In some embodiments, the t invention provides a method of treating a disease or disorder mediated by mRNA, comprising the step of administering to a t in need thereof a small molecule disclosed herein.

Targeting Regulatory RNA The largest set of RNA targets comprises RNA that is transcribed but not translated into protein, termed “non-coding RNA”. Non-coding RNA is highly conserved and the many varieties of non—coding RNA play a wide range of regulatory ons. The term “non—coding RNA,” as used herein, includes but is not limited to micro-RNA (miRNA), long non-coding RNA (lncRNA), long intergenic non-coding RNA (lincRNA), Piwi-interacting RNA (piRNA), competing endogenous RNA ), and -genes. Each of these sub-categories of non- coding RNA offers a large number of RNA targets with significant therapeutic potential.

Accordingly, in one aspect, the present invention provides a method of producing a small molecule that modulates a regulatory function of a target ding RNA, comprising the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ in the target ding RNA; and identifying which small molecule(s) bind to the 3WJ and modulate the regulatory function of the target non-coding RNA. In some ments, the method further comprises identifying the target non-coding RNA according to a sed computational survey.

In some embodiments, the target non-coding RNA is capable of forming a 3WJ in the presence of an effector RNA such as an effector miRNA. In some embodiments, the small molecule binds to a trans 3WJ formed between the effector RNA and the target non-coding RNA. In some embodiments, the small molecule binds to a cis 3WJ formed between portions of the target non- coding RNA. In some embodiments, modulating the regulatory function of the target non- coding RNA treats or ameliorates a disease caused by a miRNA, lncRNA, lincRNA, piRNA, ceRNA, or pseudo-gene.

Targeting miRNA miRNAs are short double-strand RNAs that regulate gene expression (see Elliott & Ladomery, lar Biology of RNA, 2nd Ed.). Each miRNA can affect the expression of many human genes. There are nearly 2,000 miRNAs in humans. These RNAs regulate many biological processes, including cell entiation, cell fate, motility, survival, and function. miRNA expression levels vary between different tissues, cell types, and disease settings. They are ntly aberrantly expressed in tumors versus normal tissue, and their activity may play significant roles in cancer (for reviews, see Croce, Nature Rev. Genet. -714, 2009; Dykxhoom Cancer Res. 70:6401-6406, 2010). miRNAs have been shown to regulate oncogenes and tumor suppressors and themselves can act as oncogenes or tumor suppressors. Some have been shown to promote epithelial-mesenchymal transition (EMT) and cancer cell invasiveness and metastasis. In the case of oncogenic miRNAs, their inhibition could be an ive anti- cancer treatment. Accordingly, in one aspect, the present invention provides a method of producing a small molecule that modulates the activity of a target miRNA to treat a disease or disorder, comprising the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ comprising at least a portion of the target miRNA, and identifying which small molecule(s) bind to the 3WJ and modulate ty of the target miRNA to treat the disease or disorder. In some embodiments, the method further comprises identifying the target miRNA ing to a disclosed computational survey. In some embodiments, the target miRNA is capable of forming a 3WJ in the presence of an RNA to which it binds, such as an mRNA. In some embodiments, the small molecule binds to a trans 3WJ formed between the target miRNA and an RNA to which it binds. In some embodiments, the miRNA regulates an oncogene or tumor suppressor, or acts as an oncogene or tumor suppressor. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor.

In some embodiments, the target miRNA is an oncogenic miRNA such as 5, ~92, miR—l9, miR-Zl, or b (see Stahlhut & Slack, Genome Med. 2013, 5, 111). miR—155 plays pathological roles in inflammation, hypertension, heart failure, and cancer. In cancer, miR-155 triggers oncogenic cascades and sis resistance, as well as increasing cancer cell invasiveness. Altered expression of miR—lSS has been described in le cancers, ing staging, progress and treatment outcomes. Cancers in which miR-lSS over-expression has been reported include breast cancer, thyroid carcinoma, colon cancer, cervical , and lung cancer. It is reported to play a role in drug resistance in breast cancer. miR-17~92 (also called Oncomir-l) is a polycistronic 1 kb primary ript comprising miR—l7, 20a, 18a, 19a, 92-1 and l9b-1. It is activated by MYC. miR-19 alters the gene expression and signal transduction pathways in multiple hematopoietic cells, and it triggers leukemogenesis and lymphomagenesis. It is ated in a wide variety of human solid tumors and hematological cancers. miR—21 is an oncogenic miRNA that reduces the expression of multiple tumor suppressors. It stimulates cancer cell invasion and is associated with a wide variety of human cancers including breast, ovarian, cervix, colon, lung, liver, brain, gus, te, pancreas, and thyroid s. Accordingly, in some embodiments of the s described above, the target miRNA is selected from miR-155, miR-l7~92, miR—l9, miR-Zl, or miR—lOb. In some embodiments, the disease or disorder is a cancer selected from breast cancer, ovarian cancer, cervical cancer, thyroid carcinoma, colon cancer, liver cancer, brain , esophageal cancer, prostate cancer, lung cancer, leukemia, or lymph node cancer. In some embodiments, the cancer is a solid tumor.

Beyond oncology, miRNAs play roles in many other diseases including cardiovascular and metabolic diseases (Quiant and Olson, J. Clin. Invest. 123111-18, 2013; Olson, Science Trans. Med. 6: 239ps3, 2014, Baffy, J. Clin. Med. 4:1977-1988, 2015).

Many mature miRNAs are relatively short in length and thus may lack sufficient folded, three-dimensional structure to be targeted by small les. However, it is believed that the levels of such miRNA could be reduced by small molecules that bind a 3W1 comprising at least a portion of the primary transcript or the pre-miRNA to block the biogenesis of the mature miRNA. ingly, in some embodiments of the methods described above, the target miRNA is a primary transcript or RNA. lncRNA are RNAs of over 200 nucleotides (nt) that do not encode proteins (see Rinn & Chang, Ann. Rev. Biochem. 2012, 81, 145-166; (for reviews, see Morris and Mattick, Nature s Genetics 15:423-437, 2014, k and Rinn, Nature Structural & Mol. Biol. 22:5-7, 2015; Iyer et al., Nature Genetics 47(:199-208, 2015)). They can affect the expression of the n-encoding mRNAs at the level of ription, splicing and mRNA decay. Considerable research has shown that lncRNA can regulate transcription by recruiting epigenetic regulators that increase or decrease transcription by altering chromatin structure (e.g., Holoch and Moazed, Nature Reviews Genetics 16:71-84, 2015). lncRNAs are ated with human diseases including cancer, inflammatory diseases, neurological diseases and cardiovascular disease (for instance, Presner and Chinnaiyan, Cancer ery 1:391-407, 2011; Johnson, Neurobiology of Disease 46:245—254, 2012, Gutscher and Diederichs, RNA Biology 9:703-719, 2012, Kumar et al., PLOS Genetics 9:e1003201, 2013; van de voort et al., Frontiers in Molecular Neuroscience, 2013, Li et al., Int. J. Mol. Sci. 14118790-18808, 2013). The targeting oflncRNA could be done to up-regulate or down-regulate the sion of specific genes and ns for therapeutic benefit (e.g., Wahlestedt, Nature Reviews Drug Discovery 12:433-446, 2013; Guil and Esteller, Nature Structural & Mol. Biol. 19:1068—1075, 2012). In l, lncRNAs are expressed at lower levels relative to mRNAs. Many lncRNAs are physically associated with chromatin (Werner et al., Cell Reports 12, l-lO, 2015) and are ribed in close proximity to protein—encoding genes. They often remain physically associated at their site of transcription and act locally, in cis, to regulate the expression of a neighboring mRNA. lncRNAs regulate the expression of protein-encoding genes, acting at multiple ent levels to affect transcription, alternative splicing and mRNA decay. For example, lncRNA has been shown to bind to the epigenetic tor PRC2 to promote its recruitment to genes whose transcription is then sed via chromatin modification. lncRNA may form complex structures such as 3WJ that mediate their association with various regulatory ns. A small molecule that binds to these lncRNA structures could be used to modulate the sion of genes that are normally regulated by an individual lncRNA. The mutation and dysregulation of lncRNA is associated with human diseases, therefore, there are a multitude of lncRNAs that could be therapeutic targets.

Accordingly, in some embodiments of the methods described above, the target non-coding RNA is a lncRNA. In some embodiments, the lncRNA is associated with a cancer, inflammatory disease, neurological disease, or cardiovascular disease. In some embodiments, the method further comprises identifying the target lncRNA according to a disclosed computational survey.

In some embodiments, the target lncRNA is capable of forming a 3W] in the ce of an effector RNA such as an or miRNA. In some embodiments, the small molecule binds to a trans 3WJ formed between the effector RNA and the target lncRNA. In some embodiments, the small molecule binds to a cis 3WJ formed n ns of the target lncRNA.

One exemplary target lncRNA is HOTAIR, a lncRNA expressed from the HoxC locus on human chromosome 12. Its sion level is low (~100 RNA copies per cell). Unlike many lncRNAs, HOTAIR can act in trans to affect the expression of distant genes. It binds the epigenetic repressor PRC2 as well as the LSDl/CoREST/REST complex, another repressive epigenetic regulator (Tsai el al., Science 329, 689-693, 2010). HOTAIR is a highly structured RNA with over 50% of its nucleotides being involved in base pairing. It is frequently dysregulated (often up—regulated) in various types of cancer (Yao er all, Int. J. M0]. Sci. :18985-18999, 2014; Deng et al., PLOS One 9:e110059, 2014). Cancer patients with high expression levels of HOTAIR have a significantly poorer sis, compared with those with low sion levels. HOTAIR has been reported to be involved in the control of sis, proliferation, metastasis, angiogenesis, DNA repair, chemoresistance and tumor cell metabolism.

It is highly expressed in metastatic breast cancers. High levels of expression in primary breast tumors are a significant predictor of subsequent metastasis and death. HOTAIR also has been reported to be associated with esophageal squamous cell carcinoma, and it is a prognostic factor in colorectal , cervical cancer, gastric cancer and endometrial carcinoma. Therefore, HOTAIR-binding small molecules are novel anti-cancer drug candidates. Accordingly, in some embodiments of the methods bed above, the target non-coding RNA is HOTAIR. In some ments, the small molecule binds to a 3WJ in the HOTAIR structure. In some embodiments, the disease or disorder is breast cancer, esophageal squamous cell carcinoma, colorectal cancer, cervical cancer, c cancer, or endometrial carcinoma.

] Another potential cancer target among lncRNA is MALAT-l tasis-associated lung adenocarcinoma transcript 1), also known as NEAT2 (nuclear-enriched abundant transcript 2) hner et 61]., Cancer Res. 73:1180-1189, 2013; Brown et 61]., Nat. ural &Mol. Biol. 21:633-640, 2014). It is a highly conserved 7 kb nuclear lncRNA that is localized in nuclear speckles. It is ubiquitously expressed in normal tissues, but is up-regulated in many cancers.

MALAT-l is a predictive marker for metastasis development in multiple cancers including lung cancer. It appears to function as a regulator of gene expression, potentially affecting transcfiption and/or splicing. MALAT—l knockout mice have no phenotype, indicating that it has d normal function. However, MALAT-l-deficient cancer cells are impaired in migration and form fewer tumors in a mouse aft tumor models. Antisense oligonucleotides (ASO) blocking MALAT-l prevent metastasis formation after tumor implantation in mice. Some mouse xenograft tumor model data indicates that MALAT-l knockdown by ASOs may inhibit both primary tumor growth and metastasis. Thus, a small molecule targeting MALAT-l is ed to be ive in inhibiting tumor growth and metastasis. Accordingly, in some embodiments of the methods described above, the target non- coding RNA is MALAT-l. In some ments, the small molecule binds to a 3W] in the MALAT-l structure. In some ments, the disease or disorder is a cancer in which MALAT-l is up-regulated, such as lung cancer.

In some embodiments, the present invention provides a method of treating a disease or disorder mediated by non-coding RNA (such as HOTAIR or MALAT-l), comprising the step of administering to a patient in need thereof a compound of the present invention. Such compounds are described in detail herein.

Targeting Toxic RNA [Repeat RNA! ] Simple s in mRNA often are associated with human disease. These are often, but not exclusively, repeats of three nucleotides such as CAG (“triplet repeats”) (for reviews, see Gatchel and Zoghbi, Nature Reviews Genetics 6:743-755, 2005; Krzyzosiak et al., Nucleic Acids Res. 26, 2012, Budworth and McMurray, Methods M01. Biol. 101013-17, 2013). Triplet repeats are abundant in the human genome, and they tend to undergo expansion over generations.

Approximately 40 human diseases are associated with the expansion of repeat sequences.

Diseases caused by triplet expansions are known as Triplet Repeat Expansion Diseases (TRED).

Healthy individuals have a le number of triplet repeats, but there is a threshold beyond which a higher repeat number causes disease. The threshold varies in different ers. The triplet repeat can be unstable. As the gene is inherited, the number of repeats may increase, and the condition may be more severe or have an earlier onset from generation to generation. When an individual has a number of repeats in the normal range, it is not expected to expand when passed to the next generation. When the repeat number is in the premutation range (a normal, but unstable repeat number), then the repeats may or may not expand upon ission to the next tion. Normal individuals who carry a premutation do not have the condition, but are at risk of having a child who has inherited a t repeat in the full mutation range and who will be affected. TREDs can be autosomal dominant, autosomal recessive or X-linked. The more common t repeat disorders are autosomal dominant.

The repeats can be in the coding or noncoding portions of the mRNA. In the case of repeats within noncoding regions, the repeats may lie in the 5' UTR, introns, or 3’ UTR ces. Some examples of diseases caused by repeat sequences within coding regions are shown in Table 1.

Table 1: Repeat Expansion Diseases in Which the Repeat Resides in the Coding Regions of mRNA Normal repeat e repeat Disease Gene Repeat number number “———36-250 DRPLA ATNl 49-88 SBMA SCAI —49-88 SCA2 —33-77 SCA3 —55-86 SCA6 —21-30 . Normal repeat se repeat Disease Gene Repeat number number SCA7 ATXN7 38-120 SCA17 m— 25-42 47-63 Some examples of diseases caused by repeat sequences within noncoding regions of mRNA are shown in Table 2.

Table 2: Repeat Expansion Diseases in Which the Repeat Resides in the ing Regions of mRNA location number number antlsense SCAlO ATXNlO ATTCT 800-4500 SCA12 PPPZRZB 5’UTR 66-78 C9FTD/ALS C9orf72 GGGGCC The toxicity that results from the repeat sequence can be direct consequence of the action of the toxic RNA itself, or, in cases in which the repeat expansion is in the coding ce, due to the toxicity of the RNA and/or the nt protein. The repeat ion RNA can act by sequestering al RNA—binding proteins (RBP) into foci, One example of a sequestered RBP is the Muscleblind family protein MBNLl. Sequestration of RBPs leads to defects in splicing as well as s in nuclear-cytoplasmic transport of RNA and ns.

Sequestration of RBPs also can affect miRNA biogenesis. These perturbations in RNA biology can profoundly affect neuronal function and survival, leading to a variety of neurological diseases.

Repeat sequences in RNA form secondary and tertiary structures that bind RBPs and affect normal RNA biology. One specific example disease is myotonic dystrophy (DMl; dystrophia myotonica), a common inherited form of muscle disease characterized by muscle weakness and slow relaxation of the muscles after contraction (Machuca-Tzili el 61]., Muscle Nerve 32:1-18, 2005). It is caused by a CUG expansion in the 3' UTR of the dystrophia myotonica protein kinase (DMPK) gene. This repeat-containing RNA causes the misregulation of ative splicing of several developmentally regulated ripts through effects on the splicing regulators lVfl3NL1 and the CUG repeat binding protein (CELFl) (Wheeler el al., e 325:336-339, 2009). Small molecules that bind the CUG repeat within the DMPK transcript would alter the RNA structure and prevent focus formation and alleviate the effects on these spicing tors. Fragile X Syndrome (FXS), the most common inherited form of mental retardation, is the consequence of a CGG repeat expansion within the 5’ UTR of the FMRl gene (Lozano el al., Inlraclable Rare Dis. Res. 3:134-146, 2014). FMRP is critical for the regulation of translation of many mRNAs and for protein trafficking, and it is an essential protein for synaptic development and neural plasticity. Thus, its deficiency leads to neuropathology. A small molecule targeting this CGG repeat RNA may alleviate the suppression of FMRl mRNA and FMRP protein expression. Another TRED having a very high unmet medical need is Huntington’s disease (HD). HD is a progressive neurological disorder with motor, cognitive, and psychiatric changes (Zuccato el al., Physiol Rev. -981, 2010). It is characterized as a poly-glutamine or polyQ disorder since the CAG repeat within the coding sequence of the HTT gene leads to a protein having a poly-glutamine repeat that appears to have detrimental effects on transcription, vesicle king, mitochondrial function, and some activity. However, the HTT CAG repeat RNA itself also demonstrates toxicity, including the sequestration of MBNLl protein into nuclear ions. One other c e is the GGGGCC repeat expansion in the C9orf72 (chromosome 9 open reading frame 72) gene that is prevalent in both familial temporal dementia (FTD) and familial amyotrophic lateral sis (ALS) (Ling el al., Neuron 79:416-438, 2013; Haeusler et al., Nature 507:195—200, 2014). The repeat RNA structures form nuclear foci that sequester critical RNA binding proteins. The GGGGCC repeat RNA also binds and sequesters RanGAPl to impair nucleocytoplasmic transport of RNA and proteins (Zhang el al., Nature 525:56-61, 2015). ively targeting any of these repeat expansion RNAs could add therapeutic benefit in these neurological diseases.

There is some evidence that triplet repeats adopt 3WJ structures, and as such are suitable targets for disclosed small les. Without wishing to be bound by , it is believed that the repeat nucleotide sequences in certain repeat diseases organize themselves into transient 3WJ such as slipped 3WJ formed by (CAG)-(CTG) repeats. Such 3WJ could be stabilized by small molecules of the present invention and their toxic effects decreased in order to treat a TRED such as those described above or in Tables 1 and 2. (See, e.g., Barros ez‘ al., Chem. Sci. 2015, 6, 4752-4755.) The present invention contemplates a method of treating a disease or disorder wherein aberrant RNAs themselves cause pathogenic s, rather than acting through the agency of protein expression or regulation of protein expression. In some embodiments, the disease or disorder is mediated by repeat RNA, such as those described above or in Tables 1 and 2. In some embodiments, the e or disorder is a repeat expansion disease in which the repeat resides in the coding regions of mRNA. In some ments, the disease or disorder is a repeat expansion e in which the repeat resides in the noncoding regions of mRNA. In some embodiments, the disease or disorder is selected from Huntington’s e (HD), dentatorubral-pallidoluysian atrophy (DRPLA), spinal-bulbar muscular atrophy (SBMA), or a spinocerebellar ataxia (SCA) ed from SCAl, SCA2, SCA3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, myotonic dystrophy (DMl or dystrophia myotonica), Friedreich’s Ataxia (FRDA), a spinocerebellar ataxia (SCA) selected from SCA8, SCAlO, or SCA12, or C9FTD (amyotrophic lateral sclerosis or ALS).

In some embodiments, the disease is amyotrophic lateral sclerosis (ALS), Huntington’s e (HD), frontotemporal dementia (FTD), ic dystrophy (DMl or phia myotonica), or Fragile X Syndrome.

In some embodiments, the present invention provides a method of treating a e or disorder mediated by repeat RNA, comprising the step of administering to a patient in need thereof a compound of the present invention. Such compounds are described in detail herein.

Also provided is a method of producing a small molecule that modulates the activity of a target repeat expansion RNA, comprising the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ in the target repeat expansion RNA; and identifying which small molecule(s) bind to the 3WJ and te the activity of the target repeat ion RNA. In some embodiments, the method further comprises identifying the target repeat expansion RNA according to a disclosed computational survey. In some embodiments, the target repeat expansion RNA is e of forming a 3WJ in the presence of an effector RNA such as an effector miRNA. In some embodiments, the small molecule binds to a trans 3WJ formed between the effector RNA and the target repeat expansion RNA. In some embodiments, the small molecule binds to a cis 3WJ formed between portions of the target repeat expansion RNA. In some embodiments, the repeat expansion RNA causes a e or disorder selected from HD, DRPLA, SBMA, SCAl, SCA2, SCA3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, DMl, FRDA, SCA8, SCAIO, SCA12, or C9FTD. In some ments, the small molecule is effective to treat or ameliorate the disease or disorder.

Other Target RNAs and Diseases/Conditions An association exists between a large number of onal RNAs and diseases or conditions, some of which are shown below in Table 3. Accordingly, in some embodiments of the methods described above, the target RNA is selected from those in Table 3. In some embodiments, the disease or disorder is selected from those in Table 3.

Table 3: Target RNAs and Associated Diseases/Conditions RNA Tar_et Indication A20 inflammatory diseases; liver failure; liver transplant ABCAl coronary artery disease ABCBl 1 Primary Biliary Sclerosis ABCB4 Primary Biliary Sclerosis ABCGS/8 coronary artery disease Adiponectin diabetes; y; metabolic syndrome AMPK diabetes ApoAl hypercholesterolemia ApoAS hypercholesterolemia ApoC3 chylomicronemia syndrome EEIIIIIIII-IIIIIIIIIIIIIIIIIIIIprostate cancer ARlnc-l prostate cancer ATXNl spinocerebellar ataxia 1 ATXN 1 O spinocereb ellar ataxia 10 ATXN2 ereb ellar ataxia 2 ATXN3 Soinocereb ellar ataxia 3 |||i||ATXN7 spinocereb ellar ataxia 7 ATXN8 spinocereb ellar ataxia 8 BACE] BCL2 cancer L CML BDNF gton's Disease |i|lRNA Tar_et tion Beta-catenin cancer cancer BRCAl cancer % cancer BTK cancer C9orl72 (ALS, FTD) ALS, FTD A spinocereb ellar ataxia 6 CD2 74 tumor immunology CD2 79 tumor immunology CD3zeta inflammation and autoimmune diseases CD4OLG inflammation CFTR Cystic Fibrosis cKIT GIST; mastocytoma CNTF macular ration Complement Factor H macular degeneration CRACMI inflammatory diseases; autoimmune disease; organ transplant CTLA4 cancer; inflammatory diseases DGAT2 NASH D102 dyslipidemia Dystrophin Duchenne Muscular Dystrophy; Becker's Muscular Dystrophy EGFR cancer EIF4E cancer EZH2 cancer Factor 7 hemophilia Factor 8 ilia Factor 9 hemophilia Fetal Hemoglobin sickle cell anemia; halassemia FLT3 FMR1 Fragile X Syndrome Foxp3 inflammation & autoimmune diseases in Friedreich's Ataxia HAlVIP/Hepcidin thalassemia; hereditary hemochromatosis mERZ cancer HIF- 1 a cancer HOTAIR cancer H Huntington’s Disease l—lVaHa rheumatoid arthritis IL- 1 7 inflammatory & autoimmune diseases IL-23 inflammatory & autoimmune diseases RNA Tar_et Indication IL-6 rheumatoid arthritis Ipfl/del diabetes KRAS cancer Laminin— l a Merosin-deficient congenital muscular dystrophy MDCAl LARGE Muscular Dystroglycanopathy Type B,6 LDLR hypercholesterolemia LINGOI neurodegeneration MALATl cancer MAX cancer MBNLl Myotonic phy MCLI cancer MECP2 Rett Syndrome Mertk Lupus miR-103 NASH miR-107 NASH miR- 1 0b GBM miR-155 ALS and others miR-21 solid tumors miR-221 ECC mTOR cancer MYO cancer Nanog neurological diseases neurofibromatosis z33 multiple sclerosis phenylketonuria PCSK6 hyoertension PCSK9 hypercholesterolemia PD-l cancer; inflammation PD-Ll cancer; inflammation PDKl/2 Polycystic kidney e PGC l -a/FNDC5 PGCl—a/FNDCS Progranulin ogical diseases PTB-lB diabetes PTEN cancer PTPN1 Type II diabetes r(AUUCU)‘:X13 SCAlO r(CAG “13 Huntington’s Disease r(CCUG)‘:Xp DM2 r(CGG exp FXTAS RNA Tar_et Indication r(CUG)‘”‘p DMl r(GGGGCC)exP c9ALS (familial) r(GGGGCC)eXp C9FTD Ras Cancer RORC autoimmune e RTN4 Neurodegeneration RTN4R Neurodegeneration Sarcospan ne ar phy Serca2a congestive heart failure SirT6 Cancer SMAD7 6U SMN2 Spinal Muscular Atrophy SNCA SORTl coronary artery disease U) D—t ry artery disease STAT3 Cancer STATS Cancer T-bet Cancer Thyroid Hormone Receptor beta dyslipidemia; NASH; NAFLD THVI-3 inflammatory diseases; cancer inflammatory disease TNFRSF1[A Osteoporosis TNFSF11 Osteoporosis TRIBI coronary artery disease TTpd Amyloidosis TWISTI Cancer Utrophin Duchenne Muscular Dystrophy Wnt Cancer Targeting Viral RNAs In an aspect of the invention, the compounds and disclosed methods are used to target a viral nucleic acid or a transcript thereof. In some ments, the virus has an RNA genome.

Both single-strand RNA and double-strand RNA s have double-stranded RNA sequences that may be selected as targets for modulation. For viruses such as HCV (Pirakitikulr et al., Mol.

Cell 2016, 61, 1-10) and HIV—1 (Lavender et al, PLOS Comp. Bio. 2015, 11), a substantial amount of RNA structural information exists, and 3WJs are present in the structures of the viral RNA genomes. Many viruses have RNA structures or c elements that are rarely found or not found in ian genomes. Thus, targeting these elements provides selective antiviral agents with minimal effect on host processes. These genetic elements include RNA sequences that mediate translation, such as IRES elements that are far more common and functionally significant in s than in the mammalian genome. Unique RNA sequences also can be essential for the packaging of the RNA into a virus particle. Accordingly, in some embodiments, the target nucleic acid is a viral RNA structure or genetic element rarely found in mammalian genomes or exclusively found in viral genomes. In some ments, the viral RNA structure or genetic element is an IRES element.

The disclosed compounds and s may be used to target virtually any virus, because every virus must produce RNA and thence proteins at some point in their life cycles. In some embodiments the virus is selected from a Group I (dsDNA viruses), Group II (ssDNA viruses), Group III (dsRNA viruses), Group IV ((+)sense RNA s), Group V ((-) sense RNA viruses), Group VI (RNA reverse transcribing viruses), Group VII (DNA reverse transcribing viruses) virus, or a subviral agent such as a satellite or viroid.

For additional target viruses, see, e. g. http://www.virology.net/Big_Virology/BVFamilyGroup.html. In addition to targeting viral RNA transcripts ning a 3WJ, mixed RNA/DNA s comprising viral nucleic acids may be ed. For example, viral genomic DNA interacts with endogenous RNA effectors to produce 3WJs from mixed RNA/DNA hybridization events. Accordingly, in some embodiments the target nucleic acid is a mixed RNA/DNA hybrid comprising genetic information from a virus such as those disclosed above, wherein the hybrid is e of forming or contains one or more 3W1s.

In some embodiments, the virus is an RNA virus (i.e., a virus having an RNA ) such as a flavivirus, for example Zika virus, West Nile virus, Dengue virus, Yellow Fever virus, or Japanese encephalitis (Shi (editor), Molecular Virology and Control of Flaviviruses, 2012, Caister ic Press). In some embodiments the virus is a coronavirus.

Coronaviruses are a family of single-strand (ss) RNA viruses that includes human pathogens such as SARS-causing virus SARS-CoV (Thiel, r), Coronaviruses: Molecular and Cellular Biology ([31 ed), 2007, r Academic Press). Other RNA viruses that may be treated by the present invention include Ebola virus. In some embodiments, one or more of the foregoing RNA viruses is targeted by small molecule-induced 3WJ formation and/or small molecule-mediated stabilization of the 3W] in order to block replication, translation or packaging of the viral RNA.

In some embodiments, the target RNA is the RNA viral genome of the viral pathogen and the effector RNA is an endogenous small RNA in the infected cell.

] In some embodiments, the virus is selected from a Group IV —stranded RNA virus such as Coxsackie virus, Norovirus, Measles virus, Hepatitis C virus, Zika virus, Ebola virus, Rabies virus, West Nile virus, Dengue virus, SARS coronavirus, or Yellow fever virus. In some ments, the virus is selected from a Coronavirus such as Avian infectious bronchitis virus, Bovine virus, Canine coronavirus, Feline infectious peritonitis virus, Human coronavirus 299E, Human coronavirus OC43, Murine hepatitis virus, Porcine epidemic diarrhea virus, Porcine hemagglutinating encephalomyelitis virus, e transmissible gastroenteritis virus, Rat coronavirus, Turkey coronavirus, Rabbit coronavirus, Torovirus, Beme virus, or Breda virus. In some embodiments, the virus is ed from a frlovirus, Marburg virus, or Ebola virus.

Microbial Nucleic Acid Targets Various other infectious agents provide suitable target nucleic acids. In some embodiments, the target nucleic acid is a bacterial nucleic acid. Nucleic acids such as RNA in pathogenic bacteria provide target sequences that are critical for the life cycle of the ens or affect the bacterial life cycle, nce, or pathogenicity and in some cases differ y in sequence and function from human RNAs. For e, the target bacteria may be a tuberculosis-causing bacteria.

Fungal and Parasitic s In some embodiments, the target nucleic acid is a fungal or parasitic nucleic acid, such as a malarial nucleic acid. Nucleic acids such as RNA in pathogenic fungi and parasites provide target sequences that are critical for the life cycle of the pathogens or affect the life cycle, virulence, or pathogenicity and in some cases differ greatly in sequence and function from human RNAs. miRNA as Effectors MicroRNA (miRNA) is a class of single-strand noncoding RNAs that are approximately 22 nucleotides (nt) in length (Friedman et al., Genome Res. 2009, 19, 92-105, Ghildiyal & , Nat. Rev. Genet. 2009, 10, 94-108; Ipsaro & Joshua-Tor, Nat. Struct. M0].

Biol. 2015, 22, 20-28; alde, Science 2015, 349, 380—3 82). They play important regulatory roles in repressing gene expression by functioning at the post-transcriptional level. They are well-conserved and are believed to be critical components in gene regulation across many species in plants and animals. Their “seed” sequence can interact with sequences in the 3’ slated region (UTR) of target mRNA, and less frequently, the 5’ end of mRNA. This base-pairing event leads to a se in the expression of the target gene by inducing degradation of the mRNA or by inhibiting translation of the mRNA into protein. miRNAs influence a wide range of biological processes including cell entiation, cell fate, motility, survival, and cell on. miRNAs can be associated with a variety of human diseases including cancer as well as metabolic, cardiovascular, neurological and inflammatory diseases (Croce, Nature Rev. Genet. 2009, 10, 704-714; Dykxhoorn Cancer Res. 2010, 70, 6401-6406; Quiant & Olson, J. Clin. Invest. 2013, 123, 11-18, Olson, Science Trans. Med. 2014, 6, 239ps3; Baffy, J. Clin. Med. 2015, 4, 988). In many settings, the alteration in miRNA expression is associated with human diseases.

Accordingly, in some embodiments the present invention provides a method of modulating the activity of a target miRNA or precursor or protein-bound complex or mRNA- or ncRNA-bound complex thereof, comprising contacting the target miRNA or precursor or protein-bound complex or mRNA- or ncRNA-bound complex thereof with a disclosed compound. miRNAs are expressed from their own distinct genes or are expressed within introns, or in some cases exons, of other genes. Most miRNAs are transcribed by RNA rase II, The y transcript containing the miRNA ce is known as a pri-miRNA. Pri-miRNAs have unique structural features that differ from other types of RNA, including a segment that folds to form a “hairpin” or stem-loop structure that is flanked by segments of a single-strand RNA. This double-stranded RNA structure can be recognized by the microprocessor complex that contains the RNA-binding n DGCR8 (DiGeorge Syndrome Critical Region 8) and the RNase III enzyme Drosha. DGCR8 orients the catalytic RNase 111 domain of Drosha to produce r hairpins from pri-miRNAs by cleaving RNA at approximately eleven nucleotides from the hairpin base (one helical double-strand RNA turn into the stem). The microprocessor complex cuts the RNA to generate a pre-miRNA of 60 to 70 nt. A single pri-miRNA can n one to six pre-miRNAs. The RNA itself has a distinct stem-loop structure. It interacts with Exportin-S and Ran GTPase, leading to its transport from the nucleus into the cytoplasm. In the cytosol, the miRNA-protein complex is ized by the RNase III enzyme Dicer that cleaves the pre-miRNA into a mature miRNA. The Dicer endoribonuclease interacts with 5’ and 3’ ends of the hairpin and cleaves the loop joining the 3’ and 5’ arms, ng a miRNA duplex. The final miRNA is an approximately 22 base pair duplex having 2 nt 3’ overhangs and 5’ phosphate groups. One strand of this mature miRNA is then loaded onto Argonaute (Ago) protein to form the RNA-Induced Silencing Complex (RISC). Members of the Ago protein family are central to RISC function. Ago proteins are needed for miRNA-induced silencing and contain two conserved RNA binding s — a PAZ domain that can bind the single stranded 3’ end of the mature miRNA and a PIWI domain that structurally resembles ribonuclease H and functions to ct with the 5’ end of the guide strand of the miRNA.

These proteins bind the mature miRNA and orient it for interaction with a target mRNA. Some Ago family members such as the human AgoZ cleave the RNA targets directly. Ago proteins also can recruit additional proteins to inhibit translation. Although either strand of the duplex may potentially act as a functional miRNA, only one strand is incorporated into the RISC complex with which the miRNA and its mRNA target ultimately ct. miRNA base pairs with its target mRNA, leading to decreased target mRNA levels or tion of its translation.

Induction of mRNA cleavage leading to mRNA decay appears to be the more common mechanism of inhibition of expression. Translational repression is less well understood than the induction of mRNA degradation. As noted above, a single miRNA can have many target mRNAs. Besides targeting mRNA, miRNAs also can target noncoding RNAs.

Thus, in some embodiments, the target miRNA is a precursor to a corresponding mature miRNA. In some embodiments, the target miRNA is a pri-miRNA. In some embodiments, the target miRNA is a pre—miRNA. In some ments, the target miRNA is an mRNA- or ncRNA-bound complex such as a mature miRNA bound to an mRNA or ncRNA whose activity it tes. In some embodiments, the target miRNA is associated with a disease or disorder such as cancer, a metabolic disorder, a cardiovascular er, a neurological disorder, or an inflammatory disease, In some embodiments, the compound up-regulates the activity of the target miRNA. In some embodiments, the compound down-regulates the activity of the target miRNA, In some ments, the down-regulation is via binding to a 3WJ in the target miRNA-mRNA or miRNA-ncRNA complex. In some embodiments, binding to the 3WJ inhibits translation of the mRNA. In some embodiments, binding to the 3WJ induces degradation of the mRNA or ncRNA.

] Also provided is a method of producing a small molecule that modulates the ty of a target miRNA or precursor or protein-bound complex or mRNA- or ncRNA-bound complex thereof, comprising the steps of: screening one or more small les disclosed herein for binding to a 3WJ in the target miRNA or sor or n—bound complex or mRNA- or ncRNA-bound x thereof; and identifying which small molecule(s) bind to the 3WJ and modulate the activity of the target miRNA or precursor or protein-bound x or mRNA- or ncRNA-bound complex thereof. In some embodiments, the method further comprises identifying the target miRNA or precursor or protein-bound complex or mRNA— or ncRNA- bound complex thereof according to a disclosed computational survey. In some embodiments, the target miRNA is an effector capable of forming a 3WJ with an mRNA or ncRNA which it regulates. In some embodiments, the small molecule binds to a trans 3WJ formed between the effector and the mRNA or ncRNA. In some embodiments, the small molecule binds to a cis 3WJ formed by a portion of the mRNA or ncRNA.

There are roughly 2000 miRNAs in the human genome. miRNAs can be expressed in a tissue-specific and cell-specific manner. Their expression can be affected by a variety of stimuli including hormones, cell stress, oncoproteins, cytokines and hypoxia. As stated above, aberrant miRNA expression can be associated with a wide variety of human es, and this aberrant miRNA expression is correlated with the dysregulation of the sion of their target genes.

Perfect base-pairing of the entire miRNA with target mRNA is rare in mammalian cells. It is believed that perfect or near perfect base pairing with the target mRNA promotes cleavage of the target RNA. A short stretch of nt in the 5’ end of the miRNA (“the seed”) s to be sufficient for airing to the target sequence in the mRNA. This base-pairing can comprise as few as 6 nt. The limited sequence complementarity needed for miRNA-mRNA interaction enables single miRNAs to regulate a large number of ripts. It has been documented that individual miRNA can affect the expression of well over 100 different mRNA, with estimates as high as 400 mRNA targets. Although the requirements for miRNA recognition of mRNA do not appear to be stringent, research has led to a description of rules that predict canonical miRNA targeting. Seed nucleotides 2-8 at the 5’ end of the miRNA are important for target recognition. Crystal structures of the Ago-miRNA complex (Schirle et al., Science 2014, 346, 608-613) suggest that the seed ce is positioned to initiate the interaction between the miRNA and its target mRNA. A t seed complementarity is considered to be canonical targeting, but ect or ed interactions are ed (reviewed in Seok et al., M0]. Cell, 2016, 39, 375-381). Thus, it appears that a variety of airing can be used to achieve miRNA-mRNA recognition. Non-canonical pairing can take place and may have biological consequences, It has been esized that these weaker, non-canonical, binding events could lead to less effective repression of expression and could, therefore, provide for a range of effectiveness in the repressive activity of miRNA. It even has been reported that human microRNA miR369-3 directs the association of Ago and FXRl ns with sequences in the 3’ UTRs of mRNA to increase translation, while another miRNA, Let—7, also can increase translation of target mRNAs upon cell cycle arrest (Vasudevan et al., Science 2007, 318, 1931- 1934). Therefore, it is demonstrated that miRNAs can have a wide range of effects in mammalian cells. Accordingly, in some embodiments, a sed compound binds to a 3WJ formed between a target miRNA and an mRNA or ncRNA that the miRNA regulates. In some embodiments, a sequence of nt in the 5’ end of the miRNA (the seed) is capable of base—pairing to a target sequence in the mRNA. In some embodiments, a sequence of nt in the 3’ end of the miRNA (the seed) is capable of base—pairing to a target sequence in the mRNA. In some embodiments the base—pairing comprises cal (Watson-Crick) base-pairing, for example between 75%, 80%; 85%; 90%; 95%, 98%; 99%; or all of the seed and its target sequence. In some embodiments, the airing comprises at least 6 nt. In some embodiments, the base- pairing comprises at least 7, 8, 9, 10, ll, 12, l3, l4, 15, or 20 nt. In some embodiments, the base-pairing comprises at least 25, 30, 35, 40, 45, 50, 75, or 100 nt.

The rapid and controlled turnover of mature miRNA is needed for rapid changes in miRNA expression s and resulting gene regulation. For example, the binding of miRNA to Ago protein in the cytoplasm is believed to ize the miRNA guide strand, while the opposite ger strand is degraded. Target ment also may stabilize the miRNA. Post- transcriptional modifications of the miRNA also can affect their half-lives in cells.

In some embodiments, the miRNA is an effector such that the miRNA recognizes a target sequence in an RNA such as an mRNA and bind in a manner which leads to the formation of a 3WJ. A described above, in some embodiments this 3WJ ses a stem-loop structure flanked on each side by sequences of base pairing between the miRNA and mRNA. The stem- loop can be formed by either the miRNA or mRNA. In some embodiments, a stable 3WJ is formed and degradation of the mRNA is not promoted. In some embodiments, there is not perfect complementarity (canonical base-pairing) between the miRNA seed (miRNA positions 2- 7 or 2-8 from the 5’ end) and the target mRNA. In some embodiments, the base pairing is just downstream of the seed or can overlap with the seed, but does not include the entire seed. For example, nt 5-10 of the miRNA could have perfect base pairing with the mRNA target, immediately followed by a formation of a stem-loop by the mRNA sequence, and then the miRNA could base pair perfectly with the mRNA over a stretch of 4-12 nt starting at miRNA nt 11,12,13 or 14. piRNA as Effectors Piwi-interacting RNA (piRNA) is the largest class of small ing RNA expressed in animal cells wed in Seto et al., Molecular Cell, 2007, 26, 603-609; Klattenhoff and Theurkauf, Development 2008, 135, 3-9, 2008). There may be 0 or more piRNAs in animal cells. These RNAs are 26-31 nt in length. piRNAs derive their name due to their interaction with piwi proteins. They are ed to be involved in gene silencing, but far less is known about the generation of piRNA and their mechanism of gene silencing relative to miRNA. Many piRNAs are antisense to transposons, therefore, the silencing of transposons may be a critical role of piRNAs. They are found to localize to both nuclear and cytosolic compartments of the cell. piRNAs are abundant in germ cells where they may play critical roles in germ cell pment and function. However, they also are abundant in a wide variety of mammalian somatic cells and tissues.

Accordingly, in some embodiments the present invention provides a method of modulating the activity of a target piRNA or precursor or protein-bound complex thereof, comprising contacting the target piRNA or sor or protein-bound complex thereof with a disclosed compound.

In some embodiments, the target piRNA is associated with a disease or disorder such as a disease involving aberrant germ cell development or function. In some embodiments, the nd up-regulates the activity of the target piRNA. In some embodiments, the compound down—regulates the activity of the target piRNA. In some embodiments, the egulation is via binding to a 3WJ in the target piRNA or precursor or protein-bound complex thereof. In some embodiments, binding to the 3W] induces degradation of the piRNA.

Also provided is a method of producing a small molecule that modulates the activity of a target piRNA or sor or protein-bound complex thereof, comprising the steps of: screening one or more small molecules disclosed herein for binding to a 3W1 in the target piRNA or precursor or protein-bound complex thereof; and identifying which small le(s) bind to the 3WJ and modulate the activity of the target piRNA or precursor or protein—bound complex thereof. In some embodiments, the method further comprises identifying the target piRNA or precursor or protein—bound complex thereof according to a disclosed computational survey. In some embodiments, the target piRNA is an effector capable of g a 3WJ with an RNA which it regulates. In some embodiments, the small molecule binds to a trans 3W] formed n the effector and the RNA which it tes. In some embodiments, the small molecule binds to a cis 3W1 formed by a portion of the piRNA. snoRNA as Effectors Small nucleolar RNAs (snoRNAs) are small RNAs that direct chemical modifications such as methylation or pseudouridylation of other RNAs such as mal RNAs, tRNAs, and small nuclear RNAs (snRNA) (reviewed in Bachellerie et al., Biochimie 2002, 84, 775-790; Jorjani et al., c Acids Res. 2016, May 12 [Epub ahead of print]). They are lly 70-90 nt in . 1740 snoRNAs have been identified. They are fairly abundant in mammalian cells.

To carry out RNA modifications, snoRNAs associate with proteins in a small nucleolar cleoprotein (snoRNP) complex. The snoRNA contains an antisense sequence of 10-20 nt complementary to the sequence surrounding the base targeted for modification. Most snoRNAs are encoded in the s of genes encoding proteins involved in ribosome synthesis or translation. They also can be located in intergenic regions, ORFs of protein coding genes, and in UTRs. They can be transcribed by either RNA polymerase II or III. The sequences of snoRNA are ved, but their expression levels differ dramatically between s.

Accordingly, in some ments the present invention provides a method of modulating the ty of a target snoRNA or precursor or protein-bound (such as a snoRNP) complex thereof, comprising contacting the target snoRNA or precursor or protein-bound complex thereof with a disclosed nd.

In some embodiments, the target snoRNA is associated with a disease or disorder such as a disease involving aberrant nucleic acid modification such as methylation or pseudouridylation. In some embodiments, the aberrantly modified nucleic acid is a mal RNA, a tRNA, or an snRNA. In some embodiments, the compound up-regulates the activity of the target snoRNA. In some embodiments, the compound down-regulates the activity of the target snoRNA. In some embodiments, the down-regulation is via binding to a 3WJ in the target snoRNA or precursor or protein—bound x thereof.

Also provided is a method of ing a small molecule that modulates the activity of a target snoRNA or precursor or protein—bound (such as a snoRNP) complex thereof, comprising the steps of: screening one or more small molecules disclosed herein for binding to a 3WJ in the target snoRNA or precursor or protein-bound (such as a snoRNP) complex thereof; and identifying which small molecule(s) bind to the 3WJ and modulate the activity of the target snoRNA or precursor or protein-bound complex thereof. In some embodiments, the method further comprises identifying the target snoRNA or precursor or protein—bound complex thereof according to a disclosed computational survey. In some ments, the target snoRNA is an effector capable of g a 3WJ with an RNA which it regulates. In some embodiments, the small le binds to a trans 3WJ formed between the effector and the RNA which it regulates. In some embodiments, the small molecule binds to a cis 3WJ formed by a portion of the snoRNA. 3. Methods ofIdentifying Target 3 WJs Computational Survey of Potential Effector/Target c Acid Interactions The present ion provides methods of identifying a potential target 3WJ in a nucleic acid. ation about nucleic acid three-dimensional structure is more challenging to obtain than proteins, and there exists a need for better methods for interrogating nucleic acid structure, particularly in vivo. Accordingly, in one aspect the present invention provides a method of identifying a target nucleic acid capable of g a cis or trans 3WJ, wherein g by a disclosed nd stabilizes the 3WJ, thus modulating the activity of the nucleic acid, for example to treat a disclosed disease or condition. In some embodiments, a provided method comprises as a first step g an in silico search that identifies potential ctions between effector RNAs and candidate target RNAs. In some embodiments, the search focuses on a target RNA selected based on prior knowledge of the value of targeting either that RNA itself or the protein that it expresses upon translation. The output of the search is a list of effector RNAs (such as small effector RNAs of, for example, 20-100 nt) that can hybridize with the target RNA such that a 3WJ can form. In other embodiments, a broader or even comprehensive, in silico search of all potential interactions between RNAs (as effectors) and all target RNAs in the cell is run. In some embodiments, the search is conducted initially without reference to any extant body of knowledge of the actual, known ical ons of the effector RNAs.

Rather, each effector RNA is treated essentially as a chemical without reference to its biological role.

In one aspect, the present invention provides a method of identifying a target nucleic acid capable of forming a 3WJ comprising the following steps: (a) providing one or more effector c acids (such as a human small RNA) comprising one or more energetically accessible stem-loop ures, (b) providing one or more target nucleic acids (such as a human mRNA) comprising one or more energetically accessible stem-loop structures, (c) screening for one or more effector/target nucleic acid hybridization ctions that accommodate a stem-loop ure such as a 3WJ in either the effector nucleic acid or the target nucleic acid, ((1) optionally, categorizing the resulting database of 3WJS comprising an effector nucleic acid and target nucleic acid by one or more of: (1) loop topology, (2) loop sequence, (3) stem- loop stability, and (4) identity of the nucleobases that impinge ly on the 3WJ cavity; and (e) optionally, cross-referencing the resulting database of possible 3WJs comprising an effector nucleic acid and target nucleic acid with available dge about the biological role and therapeutic cance of the target nucleic acids as well as available knowledge about the relative abundance and cellular location of effector nucleic acids such as small effector RNAs.

In step (a) above, in the case of effector miRNAs, in some embodiments a publicly ble database is used as a source of potential or miRNAs. In some embodiments, the database is selected from: (hit3:1","wwwmirbaseora, hit :x’x’mi rdb " "miRIifiBf . or htt 3 :.//www .miaroma. org/miminim/home , d o"7 hill}.SIZE}.itfiXaIlQQLEEZQswig; 12Iii:3111’5ziammnit;fiimsmtg; blil:?§.c’ii’félfl£.QEQIEEJAEEE lieideiherg(fie/apps/sz/minvalkZI"; or http:.I’z‘immvtargetscanorg). In some ments, the target c acid is human. In some embodiments, the target c acid is viral. In some embodiments, a database of viral genomes is used, such as that available at htt):f/wwwnchinlnrnih.gov/Genomex’viFuses/C In some embodiments, the target nucleic acid is ial. In some embodiments, the target nucleic acid is fungal. In some embodiments, the target nucleic acid is parasitic.

In step (a) above, in some embodiments, “energetically accessible” means that at least 0.1% of that miRNA in a living cell adopts (or is predicted to adopt) a given stem—loop structure.

In other embodiments, the threshold of “accessible” might be set at 0.1% to 1%, 1% to 10%, or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In some embodiments, to be included in the method above, such stem-loop needs to leave at least 4 tides upstream (5’) and at least 4 nucleotides downstream (3’) of the oop that can participate in hybridization with the target nucleic acid.

In step (b) above, in some ments, “energetically accessible” means that at least 0.1% of that miRNA in a living cell adopts (or is predicted to adopt) a given stem—loop structure, In other embodiments, the threshold of “accessible” might be set at 0.1% to 1%, 1% to 10%, or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In some embodiments, to be included in the method above, such stem-loop needs to leave at least 4 nucleotides upstream (5’) and at least 4 nucleotides downstream (3’) of the stem-loop that can participate in hybridization with the target nucleic acid.

In step (c) above, in some embodiments, the method es a compilation of all effector/target c acid pairs that create a 3W1 ying the constraints described above. In all three of the possible unhybridized inter-stem loops in a 3W], the lengths of those loops can vary ndently from O to 4 (or, in some embodiments, 0 to 2 or 0 to l), with any of the standard or post-transcriptionally modified nucleobases occupying those loop positions.

In some embodiments, pairings that engage therapeutically high-value target nucleic acids with relatively high-abundance small effector RNAs will be the focus of further study. The structure, dynamics, and ical significance of the selected key 3WJs can be characterized extensively using a wide range of established s described below.

In some embodiments, a 3WJ such as a 3WJ identified in the above computational screening methods, may be characterized by synthesizing the or nucleic acid (such as a small effector RNA) and its cognate target c acid using standard, commercially ble, machine-enabled synthetic s. In addition, in many ments, a single-stranded (“cis”) analog of a trans-3WJ is synthesized, in such embodiments, the two components can be linked either 5’—to-3’ or 3’-to-5’. The advantages of a single-stranded model include simplified assay formats and controlled stoichiometry in structural characterization.

Whether in trans or in cis, the model effector/target nucleic acid interacting pairs can be structurally characterized in detail using X-ray llography, cryo-EM (Binshtein & Ohi, Biochemistry 2015, 54, 3133-3141), NMR, circular dichroism, UV-vis spectroscopy, and MaP (Siegfried et al., Nature Methods 2014, 11, 959-973), and related methods that help to establish the detailed 3D structure and dynamics of the construct and thus, by implication, allow inference of the structure and dynamics of the congeneric trans pair in cells.

Building Binding Assays to Measure SM Binding to 3WJs One of the principal purposes in building the above cis and trans models is to screen for small molecules that will bind selectively and with high affinity into the cavities defined by the 3W1s. Many methods that are currently deployed for analogous screening of small molecules against n targets can be adapted to similar effect in 3WJs. In some embodiments, one of the following exemplary assays is used to measure small molecule binding to an effector/target nucleic acid 3WJ: NMR — NlVIR can be used to assess the binding of small molecules to biomolecules such as RNA. One key advantage of this method is that, if the ure of the target biomolecule can be observed during the screen, then the screen will yield not just the fact of molecular association between SM and RNA, but also the subsite and binding mode. Some of the disadvantages of NlVIR are that relatively high trations of ligand are required (uM to mM), meaning that high—affinity interactions are difficult to measure, and that the method is slow, thus permitting only limited hput. But these latter ms actually make NMR an ideal read-out in carrying out fragment screening, where high-concentration/low-affinity interactions are the focus and relatively few fragments (typically <5000) are usually ed in nt-based lead discovery. In some cases the atomic nucleus that is observed is 19F rather than s.

SPR — Surface plasmon resonance is a widely implemented method for assessing molecular associations. SPR requires that one component (the target RNA or the small molecule ligand) be covalently affixed to the surface and the plasmon resonance is measured in response to partner molecules added to the solution above the lized partner. On rates and off rates can be measured directly, affording equilibrium dissociation constants.

DELs — DNA—encoded libraries serve here as an example of a broader category of pull-down s. In DELs, a cis model of a key 3WJ would be modified with functional groups (e.g., biotin) that allowed facile pull-down (e.g., with streptavidin) after having been exposed to a homogeneous DNA-encoded library. Those small molecule ligands in the DEL that ate tightly with the 3WJ will also be pulled down when the 3WJ is pulled down and the identity of the ligands exposed using PCR and sequencing.

Chromophoric 3WJs — There are multiple reports of derivatizing RNAs such that two chromophores interact when proximal, leading to either activation or suppression of emission, which in turn relies upon the RNA assuming the correct conformation (in this case the anticipated 3WJ). Loop sequence, loop length, temperature, and other parameters can be optimized so that achieving the 3WJ conformation depends on the stabilizing ce of an added small molecule that binds into the 3WJ cavity. These assays are straightforward and can be run in geneous or homogeneous formats and allow screening of standard, commercially available ies of small molecules.

WO 06074 RNA Microarrays — One can immobilize a wide range of 3WJs onto a microarray — in effect an immobilized library of targets. The chromophore functionality described above can be incorporated so that when the surface-immobilized y of RNA (or other nucleic acid) targets is exposed to small molecules (singly or as mixtures), chromophoric change at c sites on the microarray indicate that that RNA (or other nucleic acid) is ligated and, more importantly, stabilized in the 3WJ conformation.

SM Microarrays — One can immobilize a wide range of small les onto a microarray. There is a broad literature on this topic and a commensurately broad range of immobilization techniques. In such microarrays, the identity of the SM is typically associated with its position in the microarray. Chromophoric 3W] models can then be exposed in to the rray and specific SM/3WJ interactions identified by the observation of the chromophore at specific sites on the microarray.

MS — Nucleic acids can be analyzed by a variety of liquid chromatography techniques. Chromatography of RNA in the presence of potential small molecule ligands would lead to bound small le ligands being d with the RNA as it passes through the chromatography media. Post-chromatographic separation of the ligand from the RNA will allow identification of the g ligands by mass spectrometry. If two ligands share the same mass (are isomers), there are numerous pathways to disambiguation.

Initial Screens of 3WJs — Initial screening of small molecules against the 3W] models will focus on three types of ies: (1) Compounds that are C3-symmetric or are variations on C3-symmetric scaffolds; (2) Compounds that are variations on reduced-symmetry scaffolds that still approximate the C3-symmetric congeners, and (3) A structurally diverse library. These scaffolds and exemplary ments thereof are described in detail below.

Structural Characterization of 3WJ/SM Complexes — Many therapeutically interesting RNA targets are large and only modestly structured, so detailed structural characterization is either not possible or not practical. However, targeting of 3WJs as in the present invention means that the target ucture modeled by the synthetic 3WJ is relatively small and its complexes with SMs may be characterized in detail. Methods of structural characterization e NMR, x-ray crystallography, cryo-EM, and CD. Such a detailed terization of a small molecule complexed with its target RNA provides nearly unprecedented opportunities for structure—based drug design against an RNA target.

Confirmation of Trans Effect In much of the foregoing the focus is on the cis (single-stranded) models. When the therapeutic targets are composed of a trans interaction n an effector RNA and a target RNA, then the single—stranded cis construct is studied out of convenience and any small molecule ligand needs to be demonstrated to bind to and stabilize the congeneric trans complex upon which the cis model is based. Put differently, it is essential that the selected small molecules identified via design or ing induce the formation of the intended effector/SM/target ternary complex.

Building Competitive Displacement Assays The screens bed above will identify small le leads against trans effector/target c acid 3WJs of interest. While exploration of the SAR from those leads to development candidates may be possible using the methods and techniques bed above, it is often important to develop assays where new molecules compete with a reference le for the same biologically essential subsite, in this case the cavity circumscribed by the 3W]. This assay format is often very high—throughput and focuses the screen to find molecules that share the same binding mode as the reference molecule. In some embodiments, such an assay complises the steps of: (l) identification of the initial small molecule for testing, described above and below, (2) modification of that small molecule, where necessary, to include a chromophoric read-out where displacement either activates or suppresses on and (3) concomitant modification, where necessary, of the nucleic acid target proximal to the binding site to orate a mentary chromophoric read-out.

Demonstration of Cellular Activity All of the foregoing takes place in relatively artificial biochemical settings. But the selected small molecules need to induce the formation of the ternary complex inside cells. rmore, the formation of that ternary complex needs to impact the stability, function, and/or translation of the targeted nucleic acid, e.g. RNA, which will in some embodiments is a pre- mRNA or mRNA. The demonstration that the required y complex as formed inside the cell can be readily achieved by making a tethered reagent, based on the ted , and performing seq or other affinity—based techniques on that ternary x.

] Impacting the functional career of a targeted RNA can be demonstrating using standard reporter gene assay methods. In some embodiments, the target nucleic acid, e.g. RNA sequence, is introduced into a Luciferase er vector or other standard reporter uct and the impact of the 3WJ and small molecule on the reporter expression is measured in cells. In cases in which the 3WJ and small molecule will affect the expression levels of the target, the levels of the RNA can be measured by quantitative RT-PCR and the level of protein measured by ELISA, Western blot or FRET assay. 2. Compounds and Embodiments Thereof In one aspect, the present invention provides compounds, and pharmaceutically acceptable compositions thereof, for use in modulating the activity of a target nucleic acid by binding to a 3WJ in the target nucleic acid or an effector/nucleic acid complex. Such compounds are effective for treating, preventing, or ameliorating a disease or condition associated with a target RNA, and for use in methods described herein.

Compounds that may be used in the present invention and methods of discovering such compounds (such as SHAPE-MaP, RING-MaP, and PEARL-seqTM (also known as Hook the Worm and Hook and Click methods) are described in US. Provisional Patent Application USSN 62/289,671, which is hereby incorporated by reference in its entirety.

Compounds of the present invention include those described generally herein, and are r illustrated by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise ted. For purposes of this invention, the al elements are identified in accordance with the ic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in “Organic Chemistry”, Thomas l, University Science Books, Sausalito: 1999, and “March’s Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, MB. and March, J John Wiley & Sons, New York: ., 2001, the entire contents of which are hereby incorporated by reference.

Small Molecules The design and synthesis of novel, small molecule ligands capable of g RNA represents largely untapped therapeutic potential. Certain small molecule ligands including ides (e.g., omycin, azithromycin), ids (e.g., berberine, palmatine), aminoglycosides (e,g., paromomycin, in B, kanamycin A), tetracyclines (e. g., doxycycline, oxytetracycline), theophyllines, and oxazolidinones (e.g., linezolid, tedizolid) are known to bind to RNA, paving the way for the search for small molecules as RNA targeting drugs. c dyes, amino acids, biological cofactors, metal xes as well as peptides also show RNA binding ability. It is possible to modulate RNAs such as riboswitches, RNA molecules with expanded nucleotide repeats, and viral RNA elements.

The terms “small molecule that binds a target RNA,” “small molecule RNA binder,” “affinity moiety,” or d moiety,” as used herein, include all compounds generally classified as small molecules that are capable of binding to a target RNA with sufficient affinity and specificity for use in a disclosed method, or to treat, prevent, or ameliorate a disease associated with the target RNA. Small molecules that bind RNA for use in the present invention may bind to one or more secondary or tertiary structure ts of a target RNA. These sites include RNA triplexes, 3WJs, 4WJs, parallel-Y ons, hairpins, bulge loops, pseudoknots, internal loops, and other higher-order RNA structural motifs described or referred to herein.

Accordingly, in some embodiments, the small molecule that binds to a target RNA is ed from a macrolide, alkaloid, aminoglycoside, a member of the tetracycline family, an oxazolidinone, an SMN2 ligand, ribocil or a related compound, an anthracene, or a triptycene. In some embodiments, the small molecule RNA binder is selected from paromomycin, a neomycin (such as neomycin B), a cin (such as cin A), linezolid, tedizolid, pleuromutilin, ribocil, NVS-SMl, anthracene, or triptycene. In some embodiments, the small molecule is selected from those shown in US. Provisional Patent Application USSN 62/289,671, which is hereby incorporated by reference in its entirety; or a pharmaceutically acceptable salt, isomer, or tautomer thereof. Further exemplary small molecules are described in detail below.

In some embodiments, the present invention provides a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein: Rings A, B, and C are each, independently, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic aromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8—10 ed bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from en, oxygen, or ; each Y is independently CR or N, each R1 is independently -R, n, -CN, -OR, -N(R)2, -N02, -N3, -SR, or -L1-R6, each R2 is independently -R, halogen, -CN, -OR, -N(R)2, -N02, -N3, -SR, —L2-R6, or two R2 groups on the same carbon are optionally taken together to form =NR6, =NOR6, =0, or :8, each R3 is independently -R, halogen, -CN, -OR, -N(R)2, -NOz, —N3, -SR, or —L3-R6, each R6 is independently hydrogen or C1-6 alkyl optionally substituted with l, 2, 3, 4, 5, or 6 each R is independently hydrogen or an ally substituted group selected from C1-6 tic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic yclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5—6 membered monocyclic heteroaromatic ring having 1- 4 heteroatoms independently selected from nitrogen, , or sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, , or sulfur, each L1, L2, and L3 is independently a covalent bond or a C1-8 nt straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)—, -C(O)O-, -OC(O)—, , -C(O)N(R)—, -(R)NC(O)-, - OC(O)N(R)—, -(R)NC(O)O—, (O)N(R)—, -S-, —SO-, -SOz-, -S02N(R)-, -(R)NSOz-, - C(S)—, -C(S)O-, -OC(S)-, -C(S)N(R)—, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; m is 0,1, 2, 3, or 4; n is 0,1, 2, 3, or 4, and p is 0, 1, 2, 3, or4.

As defined generally above, Rings A, B, and C are each, independently, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated clic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5—6 membered monocyclic heteroaromatic ring having 1—4 heteroatoms ndently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, Ring A is a 3—8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some ments, Ring A is phenyl. In some embodiments, Ring A is an 8-10 membered ic aromatic carbocyclic ring. In some embodiments, Ring A is a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently ed from en, oxygen, or sulfur. In some embodiments, Ring A is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, Ring A is an 8- membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, , or sulfur.

] In some embodiments, Ring A is a 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, Ring B is a 3—8 membered saturated or partially rated monocyclic carbocyclic ring. In some embodiments, Ring B is phenyl. In some embodiments, Ring B is an 8-10 membered bicyclic aromatic yclic ring. In some embodiments, Ring B 2017/040514 is a 4—8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 atoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, Ring B is a 5-6 ed monocyclic heteroaromatic ring having 1—4 heteroatoms independently selected from nitrogen, oxygen, or . In some embodiments, Ring B is an 8- membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, Ring B is a 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some ments, Ring B is absent.

In some embodiments, Ring C is a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some ments, Ring C is phenyl. In some embodiments, Ring C is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, Ring C is a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently ed from nitrogen, oxygen, or sulfur. In some embodiments, Ring C is a 5-6 membered clic aromatic ring having 1—4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, Ring C is an 8- membered bicyclic heteroaromatic ling having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

] In some embodiments, Ring C is a 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

;In some embodiments, Rings A, B, and C are each, ndently, selected from: NR )3) 511333350 phenym 3:3 :11] :n m I? if? hm In some embodiments, Rings A, B, and C are each, independently, ed from: 3 x “130 5/5/ 3/ f/N \| 1,293,191 7 7 7 7 7 7 7 3 N f ‘2le “all? 5 o 0—\o / / N / g‘ a \NI 1 \NI In some embodiments, Ring A is selected from: phenyl, 11:13 In some embodiments, Ring B is selected from: phenyl, R13 1113 In some embodiments, Ring C selected from: phenyl, 13:13 ‘95 I I \ \ N In some embodiments, at least one of Ring A, B, or C is ‘1 N or at ] As defined generally above, each R1 is independently R, halogen, -CN, —OR, -N(R)2, - N02, -N3, -SR, or -L1-R6.

] In some ments, R1 is R. In some embodiments, R1 is halogen. In some embodiments, R1 is -CN. In some embodiments, R1 is -OR. In some embodiments, R1 is -N(R)2.

In some embodiments, R1 is -N02. In some embodiments, R1 is -N3. In some embodiments, R1 is -SR. In some ments, R1 is -L1-R6.

In some embodiments, R1 is hydrogen. In some embodiments, R1 is an optionally substituted C1.6 aliphatic group. In some embodiments, R1 is an optionally substituted 3-8 membered ted or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R1 is an ally substituted phenyl. In some embodiments, R1 is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R1 is an optionally substituted 4—8 membered saturated or partially unsaturated monocyclic cyclic ring having 1-2 heteroatoms independently selected from en, oxygen, or . In some embodiments, R1 is an optionally substituted 5—6 membered clic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

As defined generally above, each R2 is independently R, halogen, -CN, -OR, -N(R)2, - N02, -N3, -SR, or —L2-R6.

In some embodiments, R2 is R. In some embodiments, R2 is halogen. In some embodiments, R2 is -CN. In some embodiments, R2 is -OR. In some embodiments, R2 is —N(R)2.

In some embodiments, R2 is -N02. In some embodiments, R2 is -N3. In some embodiments, R2 is -SR. In some embodiments, R2 is —L2—R6.

In some embodiments, R2 is hydrogen. In some embodiments, R2 is an optionally substituted C1.6 aliphatic group. In some ments, R2 is an optionally substituted 3-8 membered saturated or partially unsaturated clic carbocyclic ring. In some embodiments, R2 is an optionally substituted . In some embodiments, R2 is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R2 is an 2017/040514 ally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R2 is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1—5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

As defined generally above, each R3 is independently R, halogen, -CN, -OR, -N(R)2, - N02, —N3, -SR, or -L3-R6.

In some embodiments, R3 is R. In some embodiments, R3 is halogen. In some embodiments, R3 is -CN. In some embodiments, R3 is -OR. In some embodiments, R3 is -N(R)2.

In some embodiments, R3 is -N02. In some embodiments, R3 is -N3. In some embodiments, R3 is -SR. In some embodiments, R3 is —L3-R6.

In some embodiments, R3 is hydrogen. In some embodiments, R3 is an optionally substituted C14, aliphatic group. In some embodiments, R3 is an optionally substituted 3-8 membered saturated or partially rated monocyclic carbocyclic ring. In some embodiments, R3 is an optionally substituted phenyl. In some embodiments, R3 is an ally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R3 is an optionally substituted 4-8 membered saturated or partially rated monocyclic heterocyclic ring having 1-2 atoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R3 is an optionally tuted 5-6 membered clic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R3 is an ally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

As defined generally above, each L1, L2, and L3 is ndently a nt bond or a C1-s bivalent straight or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally ed with -O—, -C(O)—, -C(O)O-, -, -N(R)-, - C(O)N(R)-, -(R)NC(O)—, N(R)-, -(R)NC(O)O-, (O)N(R)-, -S-, -SO-, —SOz-, - SOzN(R)—, -(R)NSOz-, —C(S)—, -C(S)O-, —OC(S)—, —C(S)N(R)—, -(R)NC(S)—, -(R)NC(S)N(R)-, or - Cy-.

In some embodiments, L1 is a covalent bond. In some embodiments, L1 is a C1-s bivalent straight or branched hydrocarbon chain. In some embodiments, L1 is a C1-8 bivalent straight or ed hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and ally replaced with -O-, —C(O)-, —C(O)O—, —OC(O)—, -N(R)—, -C(O)N(R)-, -(R)NC(O)-, N(R)—, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SOz—, -SOzN(R)-, - (R)NSOz-, -C(S)-, -C(S)O-, -, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-.

In some embodiments, L1 is a C1-6 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with - O-, -C(O)-, -N(R)-, -S—, -SO-, -SOz-, —SOzN(R)-, -(R)NSOz-, —C(S)—, or -Cy-, and each R is independently hydrogen, -CH2-phenyl, phenyl, C1-6 alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -CH2F, -CHF2, -CF3, -CH2CHF2, or -CH2CF3; or each R is independently hydrogen or methyl, or R is hydrogen.

In some embodiments, L2 is a covalent bond. In some embodiments, L2 is a C14; bivalent straight or branched hydrocarbon chain. In some ments, L2 is a C14; nt straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O—, -OC(O)-, -N(R)-, -C(O)N(R)-, —(R)NC(O)-, -OC(O)N(R)—, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S—, -SO—, -SOz—, —SOzN(R)—, - (R)NSOz-, -C(S)-, -, -OC(S)—, -C(S)N(R)-, (S)—, -(R)NC(S)N(R)-, or -Cy-.

In some ments, L2 is a C1.6 nt straight or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally replaced with - 0-, —C(O)-, —N(R)-, -S—, -SO-, -SOz—, —SOzN(R)-, -(R)NSOz-, -C(S)—, or -Cy-, and each R is ndently hydrogen, -CH2-phenyl, phenyl, C1-6 alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -CH2F, -CHF2, -CF3, -CH2CHF2, or -CH2CF3; or each R is independently hydrogen or methyl, or R is hydrogen.

In some embodiments, L3 is a covalent bond. In some embodiments, L3 is a C1-s bivalent straight or branched hydrocarbon chain. In some ments, L3 is a C1-8 bivalent straight or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and ally replaced with -O-, —C(O)-, —C(O)O—, —, , -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)—, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SOz—, -SOzN(R)-, - (R)NSOz—, -C(S)—, -C(S)O—, -OC(S)—, -C(S)N(R)—, —(R)NC(S)—, -(R)NC(S)N(R)-, or -Cy-.

In some embodiments, L3 is a C14, bivalent straight or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally replaced with - 0-, -C(O)-, -N(R)-, -S—, -SO-, -SOz-, -SOzN(R)-, -(R)NSOz-, , or -Cy-, and each R is independently hydrogen, -CH2-phenyl, phenyl, C1-6 alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -CH2F, -CHF2, -CF3, F2, or 3, or each R is independently hydrogen or ; or R is hydrogen.

As defined generally above, each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic cyclic ring having 1-3 heteroatoms ndently selected from nitrogen, oxygen, or sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic aromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, -Cy- is a nt optionally substituted 3-8 membered saturated or partially rated monocyclic carbocyclic ring. In some embodiments, -Cy- is an optionally substituted phenylene. In some embodiments, -Cy- is an optionally tuted 4-8 ed saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, - Cy- is an optionally tuted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from en, oxygen, or sulfur. In some embodiments, - Cy- is an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated cyclic ring having 1—5 heteroatoms independently selected from en, oxygen, or sulfur. In some embodiments, -Cy- is an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1—5 heteroatoms ndently selected from nitrogen, oxygen, or sulfur. 2017/040514 As defined generally above, each R6 is ndently hydrogen or Cm alkyl optionally substituted with l, 2, 3, 4, 5, or 6 halogens.

As defined generally above, m is O, 1, 2, 3, or 4. In some embodiments, m is O. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 0, l, 2, or 3. In some ments, m is O, 1, or 2. In some embodiments, m is l, 2, or 3.

As defined generally above, 11 is O, 1, 2, 3, or 4. In some embodiments, n is O. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is O, l, 2, or 3. In some embodiments, n is O, 1, or 2. In some embodiments, n is 1, 2, or 3.

As defined generally above, p is O, 1, 2, 3, or 4. In some embodiments, p is O. In some embodiments, p is 1. In some ments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is O, l, 2, or 3. In some embodiments, p is 0, 1, or 2. In some embodiments, p is 1, 2, or 3.

In some ments, a compound of Formula I is covalently , either directly or h a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In another aspect, the present invention provides a compound of Formula 11: 4% / / \ \ —\(R3)p or a pharmaceutically acceptable salt thereof, wherein each of R, R1, R2, R3, R6, L1, L2, L3, -Cy-, m, n, and p is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula II is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of a III: or a pharmaceutically acceptable salt thereof, wherein each of R, R1, R2, R3, R6, L1, L2, L3, -Cy-, m, n, and p is as defined above and described in ments herein, both singly and in combination.

In some embodiments, a compound of Formula 111 is covalently , either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present ion provides a compound of Formula IV: or a pharmaceutically acceptable salt thereof, wherein each of R, R1, R2, R3, R6, L1, L2, L3, -Cy-, m, n, and p is as defined above and described in embodiments herein, both singly and in combination.

In some ments, a compound of Formula IV is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

] In some embodiments, the present invention provides a compound of Formula V: or a pharmaceutically acceptable salt thereof, wherein each of R, R1, R2, R3, R6, L1, L2, L3, -Cy-, m, and p is as defined above and descfibed in embodiments herein, both singly and in combination.

In some ments, a compound of Formula V is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some ments, the present invention provides a compound of Formula VI: or a pharmaceutically able salt thereof, wherein each of R, R1, R2, R3, R6, L1, L2, L3, and - Cy- is as defined above and described in embodiments herein, both singly and in ation.

In some ments, a compound of Formula V1 is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula V: or a pharmaceutically acceptable salt thereof, wherein each of R, R1, R3, R6, L1, L3, -Cy-, m, and p is as defined above and described in embodiments herein, both singly and in combination, and X is -C(R)2-, -NR-, or -O-.

In some embodiments, a compound of Formula VII is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In r aspect, the present invention provides a nd of Formula VIII: VIII or a pharmaceutically acceptable salt thereof, wherein each of X, R, R1, R2, R3, R6, L1, L2, and L3 is as defined above and described in embodiments herein, both singly and in combination; and R4 is independently -R, halogen, -CN, -OR, —N(R)2, —N02, -N3, -SR, or -L3-R6.

In some embodiments, R4 is R. In some embodiments, R4 is halogen. In some embodiments, R4 is -CN. In some ments, R4 is -OR. In some embodiments, R4 is —N(R)2.

In some ments, R4 is -N02. In some embodiments, R4 is -N3. In some ments, R4 is -SR. In some embodiments, R4 is -L3-R6.

In some ments, R4 is hydrogen. In some ments, R4 is an optionally substituted C1.6 aliphatic group. In some embodiments, R4 is an optionally substituted 3-8 membered saturated or partially rated monocyclic carbocyclic ring. In some embodiments, R4 is an ally substituted phenyl. In some embodiments, R4 is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R4 is an optionally tuted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R4 is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, , or sulfur. In some embodiments, R4 is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R4 is selected from R, halogen, -CN, -OR, -N(R)2, -SR, C1-6 aliphatic, or —L4-R6, n L4 is a C1-6 bivalent straight or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally replaced with - 0-, -C(O)—, , -S—, -SO-, -SOz-, —C(S)-, or -Cy-; wherein the C1-6 tic group is optionally substituted with l, 2, or 3 groups independently selected from halogen, -CN, -N(R)2, - N02, -N3, =NR, =NOR, =0, :8, -OR, -SR, -SOzR, -S(O)R, -R, -Cy-R, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)2, -(R)NC(O)R, -OC(O)N(R)2, -(R)NC(O)OR, -N(R)C(O)N(R)2, - SOzN(R)2, -(R)NSOzR, -C(S)R, or -C(S)OR; and each R is independently hydrogen, -CH2- , phenyl, C1-6 alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -CH2F, -CHF2, - CF3, F2, or -CH2CF3; or each R is independently hydrogen or methyl, or R is hydrogen.

In some embodiments, L4 is a covalent bond. In some embodiments, L4 is a C1-8 bivalent straight or branched hydrocarbon chain. In some ments, L4 is a C1.s bivalent ht or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O—, -OC(O)-, -N(R)-, -C(O)N(R)-, —(R)NC(O)-, -OC(O)N(R)—, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S—, -SO—, -SOz—, -SOzN(R)—, - z-, -C(S)-, -, -OC(S)—, -C(S)N(R)-, -(R)NC(S)—, -(R)NC(S)N(R)-, or -Cy-.

In some embodiments, L4 is a C1.6 bivalent straight or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally replaced with - 0-, -C(O)-, -N(R)-, -S-, -SO-, -SOz-, -SOzN(R)-, -(R)NSOz-, -C(S)—, or -Cy-, and each R is independently hydrogen, -CH2-phenyl, phenyl, C1-6 alkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -CH2F, -CHF2, -CF3, -IF2, or -CH2CF3; or each R is ndently en or methyl, or R is hydrogen.

In some embodiments, a compound of Formula VIII is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In r aspect, the present invention provides a compound of Formula IX: or a pharmaceutically acceptable salt thereof, wherein each of R, R1, R2, R3, R4, R6, L1, L2, L3, L4 and -Cy— is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula IX is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some ments, the present invention provides a compound of Formula X: or a pharmaceutically acceptable salt thereof, wherein each of R, R3, R6, L3, and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some ments, a compound of a X is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In another aspect, the present invention provides a nd of Formula XI: z/ 2 kaRs or a ceutically acceptable salt thereof, wherein: each of Y, R, R1, R2, R3, R4, R6, L1, L2, L3, L4 and -Cy- is as defined above and described in embodiments herein, both singly and in combination, and Z is -C(R)2- or —O—.

In some embodiments, a nd of Formula X1 is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention es a nd of Formula XII: WO 06074 or a pharmaceutically acceptable salt thereof, wherein: each of R, R1, R2, R3, R4, R6, L1, L2, L3, L4 and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XII is covalently linked, either directly or through a linker such as L1, to at least one ure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XIII: XIII or a pharmaceutically acceptable salt thereof, n: each of R, R1, R2, R3, R4, R6, L1, L2, L3, L4 and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of a XIII is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In another , the present invention provides a compound of Formula XIV: or a pharmaceutically acceptable salt thereof, wherein: each of R, R1, R2, R3, R6, L1, L2, L3, and —Cy- is as defined above and described in embodiments herein, both singly and in combination; and W is -NR—, -O-, or -S-.

In some embodiments, a compound of Formula XIV is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In another aspect, the present invention provides a compound of Formula XV: RINJK/NH' or a pharmaceutically acceptable salt f, wherein: each of Y, R, R1, R2, R3, R6, L1, L2, L3, and -Cy- is as defined above and described in ments herein, both singly and in combination, except that one of R1 or R2 may be absent and replaced by Rs.

In some ments, a compound of Formula XV is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the t invention provides a compound of Formula XVI: RIN H A I N/>_<:N_R3 or a pharmaceutically acceptable salt thereof, wherein: each of R, R1, R2, R3, R6, L1, L2, L3, and —Cy- is as d above and bed in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XVI is covalently linked, either directly or h a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a nd of Formula XVII: R30 0 N 02W)thI /> N XVII or a ceutically acceptable salt thereof, wherein: each of R, R2, R3, R6, L2, L3, and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XVII is covalently linked, either directly or h a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XVIII: RIN1 N 2\ I/ 0 N XVIII or a pharmaceutically acceptable salt thereof, wherein: each of R, R1, R2, R3, R6, L1, L2, L3, and -Cy- is as defined above and described in embodiments herein, both singly and in ation.

In some embodiments, a compound of Formula XVIII is ntly linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XIX: RIN |H>/ 02W N 6'}; or a pharmaceutically acceptable salt thereof, wherein: each of R, R1, R3, R6, L1, L3, and -Cy- is as defined above and described in embodiments , both singly and in combination.

] In some embodiments, a compound of Formula XIX is covalently , either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XX: RIN H A | N-R3 O N R2 R or a pharmaceutically acceptable salt thereof, wherein: each of R, R1, R2, R3, R6, L1, L2, L3, and —Cy- is as defined above and described in ments herein, both singly and in combination.

In some embodiments, a compound of Formula XX is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In another aspect, the present invention provides a compound of a XXI: R2 R2 L5J\¥/RK5L5R1I or a pharmaceutically acceptable salt thereof, wherein: each R, R1, R2, R6, L1, L2, and -Cy- is as defined above and described in embodiments , both singly and in combination; L5 is CH2 or a single or a double bond; and R5 is absent or is -O'.

In some ments, a compound of Formula XXI is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XXII: XXII or a pharmaceutically acceptable salt thereof, wherein: each R, R1, R6, L1, and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XXII is covalently linked, either ly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the t invention provides a nd of a XXIII: R6,Cy Cy\ Re XXIII or a pharmaceutically acceptable salt thereof, wherein: each R, R6, and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

] In some embodiments, a compound of Formula XXIII is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XXIV: N+/O» /Cy Cy\ XXIV or a ceutically acceptable salt thereof, wherein: each R, R1, R6’ L1, and —Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XXIV is covalently linked, either directly or through a linker such as L1, to at least one ure shown in Figure 24 or 33 by any chemically feasible means.

In r aspect, the present invention provides a compound of Formula XXV: or a pharmaceutically acceptable salt thereof, wherein: each R, R1, R6’ L1, and —Cy- is as defined above and bed in embodiments herein, both singly and in combination.

In some ments, a compound of Formula XXV is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formulae , XXVI-b, XXVI-c, XXVI-d, or XXVI-e: o NH2 NH2 0 N:Ek N </ N H NH I </ I . NANH2 N ,N *0 lN/ILO NA0 H1 , H1 ”S” '1 '11 N N N N N F1 l?1 lRl [Q1 [Q1 XXVI-a XXVI-b XXVI-c XXVI-d XXVI-e or a diastereomer, or pharrnaceutically acceptable salt thereof, wherein: each R, R1, R6, L1, and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

] In some embodiments, a nd of Formulae XXVI-a, XXVI-b, XXVI-c, XXVI- d, or XXVI-e is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figmre 24 or 33 by any chemically feasible means.

In r aspect, the present invention provides a compound of Formula XXVII: NC“)--<CR2 R10: OH XXVII or a pharmaceutically acceptable salt thereof, wherein: each R, R1, R2, R6, L1, L2, and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XXVII is ntly linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any ally feasible means.

In r aspect, the present invention provides a compound of Formula XXVIII: OR10 OHOHO N(R2)2 XXVIII or a pharmaceutically acceptable salt f, wherein: each R, R1, R2, R3, R6’ L1, L2, L3 and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XXVIII is covalently linked, either directly or through a linker such as L1, to at least one ure shown in Figure 24 or 33 by any chemically le means.

In another aspect, the present invention provides a compound of Formula XXIX: N\ l \ NR R2 N\ / N N XXIX or a pharmaceutically acceptable salt thereof, wherein: each R, R1, R2, R3, R6, L1, L2, L3 and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of a XXIX is covalently linked, either directly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any ally feasible means.

In another aspect, the present invention provides a compound of a XXX: R2 NJ2 ‘\<: J(R3)p or a pharmaceutically acceptable salt thereof, wherein: each R, R1, R2, R3, R6, L1, L2, L3 and -Cy- is as defined above and described in embodiments herein, both singly and in combination; and JisN,O orC, andpis 1, 2, or3.

In some embodiments, a compound of Formula XXX is covalently linked, either ly or through a linker such as L1, to at least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of Formula XXXI: KM?» XXXI or a pharmaceutically acceptable salt thereof, wherein: each X, R, R2, R3, R6’ L1, L2, L3 and -Cy— is as defined above and described in embodiments , both singly and in combination.

In some embodiments, a compound of Formula XXXI is covalently linked, either directly or h a linker such as L1, to at least one least one structure shown in Figure 24 or 33 by any chemically feasible means.

In some embodiments, the present invention provides a compound of a XXXII: XXXII or a pharmaceutically acceptable salt thereof, n: each R, R2, R3, R6’ L1, L2, L3 and -Cy- is as defined above and described in embodiments herein, both singly and in combination.

In some embodiments, a compound of Formula XXXII is covalently linked, either directly or through a linker such as L1, to at least one least one structure shown in Figure 24 or 33 by any chemically feasible means.

Furthermore, it has now been found that certain compounds comprising a quinoline core, of which CPNQ is one, are capable of binding RNA. CPNQ has the following ure: ] Accordingly, in some embodiments, the small molecule ligand is ed from CPNQ or a pharmaceutically acceptable salt thereof. In other ments, the ligand is selected from a quinoline compound related to CPNQ, such as those provided in any one of Tables 5 or 6, below, or in any one of Figures 63—71, or a pharmaceutically acceptable salt thereof.

In some embodiments, CPNQ or a quinoline related to CPNQ is modified at one or more ble positions to e a hydrogen with a tether (-Tl- and/or -T2-), click-ready group (-RCG), or warhead (-R‘md), according to embodiments of each as described herein and in USSN 62/289,671, which is hereby incorporated by reference in its entirety. For example, CPNQ or a quinoline related to CPNQ may have one of the following formulae: O “/0 / N/fi / N N 1J\/N CI CI T T1 XXXIII XXXIV or a pharmaceutically able salt thereof; n Rm”l is optionally substituted with -RCG or -T2-RCG, and further optionally substituted with a pull—down group. The compound of formulae IX or X may further be optionally substituted with one or more optional substituents, as defined below, such as l or 2 optional substituents, The term “aliphatic” or atic , as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of ration, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle, 77 (L cycloaliphatic” or alkyl”), that has a single point of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-6 aliphatic carbon atoms. In some ments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, tic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic C3-C6 hydrocarbon that is completely ted or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

As used herein, the term “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one . As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some ments, a d bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from en, oxygen, or sulfur. Such bridged ic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or en atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups.

Additionally or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. ary bridged bicyclics include: £3.93 flyBflEB HNB;//o gig //NH ogr/NH \4 @@®®H“®~H°®~H®H @ ©©©$ SO The term “lower alkyl” refers to a C1-4 straight or branched alkyl group. ary lower alkyl groups are , ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

The term “lower haloalkyl” refers to a C1-4 straight or branched alkyl group that is substituted with one or more halogen atoms.

The term “heteroatom” means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of en, sulfur, phosphorus, or silicon; the quatemized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in 3,4-dihydro-2H—pyrrolyl), NH (as in pyrrolidinyl) or NR+ (as in N—substituted pyrrolidinyl)).

The term “unsaturated”, as used herein, means that a moiety has one or more units of unsaturation.

As used herein, the term ent C14; (or C1-6) saturated or unsaturated, straight or branched, hydrocarbon chain”, refers to bivalent ne, alkenylene, and alkynylene chains that are straight or branched as defined herein.

The term “alkylene” refers to a bivalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., —(CH2)n—, wherein n is a positive r, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted tic group.

The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a tuent. Suitable substituents include those described below for a substituted aliphatic group.

The term “halogen” means F, Cl, Br, or I.

The term “aryl” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or xyalkyl,” refers to monocyclic or bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present invention, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more omatic rings, such as indanyl, phthalimidyl, imidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.

The terms oaryl” and “heteroar—,” used alone or as part of a larger moiety, e. g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 7E ons shared in a cyclic array; and having, in addition to carbon atoms, from one to five atoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quatemized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, yl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, zinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms oaryl” and “heteroar—” as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring.

Nonlimiting es include l, isoindolyl, hienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, nolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H—quinolizinyl, olyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]—l,4-oxazin- 3(4110-one. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.

As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are used interchangeably and refer to a stable 5— to 7—membered monocyclic or 7—10—membered bicyclic heterocyclic moiety that is either saturated or partially rated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0—3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4— dihydro—2Hipyrrolyl), NH (as in pyrrolidinyl), or +NR (as in Nisub stituted pyrrolidinyl).

A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted.

Examples of such saturated or lly unsaturated heterocyclic radicals include, t limitation, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, dinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, droquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and lidinyl. The terms “heterocycle,” ocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or liphatic rings, such as indolinyl, 3Hiindolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be mono— or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.

] As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is ed to encompass rings having multiple sites of ration, but is not intended to include aryl or heteroaryl moieties, as herein defined.

As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each tutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position.

Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds. The term e,” as used , refers to compounds that are not substantially altered when ted to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the es disclosed herein.

Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen, —(CH2)0_4R°, —(CH2)0_4OR°, -O(CH2)0-4R°, —O— (CH2)0_4C(O)OR°; —(CH2)0_4CH(OR°)2; —(CH2)04SR°; —(CH2)0_4Ph, which may be substituted with R°; —(CH2)0_4O(CH2)0_1Ph which may be substituted with R0, —CH=CHPh, which may be tuted with R0, 0_4O(CH2)0_1-pyridyl which may be substituted with R0; —N02; —CN; —N3, -(CH2)o—4N(R°)2; —(CH2)0_4N(R°)C(O)R°; —N(R°)C(S)R°; —(CH2)o— 4N(R°)C(O)NR02; -N(R°)C(S)NR°2; —(CH2)o—4N(R°)C(O)OR°, — N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)NR°2; —N(R°)N(R°)C(O)OR°; —(CH2)0—4C(O)R°; — ; —(CH2)0_4C(O)OR°, —(CH2)0_4C(O)SR°, -(CH2)0_4C(O)OSiR°3; 0—4OC(O)R°, — OC(O)(CH2)0_4SR—, SC(S)SR°; —(CH2)o_4SC(O)R°; 04C(O)NR°2; —C(S)NR°2; — C(S)SR°, —SC(S)SR°, -(CH2)0_4OC(O)NR°2; (OR°)R°; —C(O)C(O)R°, — C(O)CH2C(O)R°; —C(NOR°)R°; -(CH2)0_4SSR°; —(CH2)04S(O)2R°, —(CH2)(HS(O)2OR°, — —4OS(O)2R°, —S(O)2NR°2; -(CH2)o—4S(O)R°; —N(R°)S(O)2NR°2; —N(R°)S(O)2R°, — N(OR°)R°; —C(NH)NR°2; —P(O)2R°; -P(O)R°2; -OP(O)R°2; —OP(O)(OR°)2; SiR°3; —(C1—4 straight or branched a1ky1ene)O—N(R°)2; or —(C14 ht or branched alkylene)C(O)O—N(R°)2, wherein each R0 may be substituted as defined below and is independently hydrogen, C1- 6 tic, , —O(CH2)0_1Ph, -CH2-(5-6 membered heteroaryl ring), or a 5—6—membered saturated, partially unsaturated, or aryl ring having 0—4 heteroatoms independently selected from nitrogen, , or sulfur, or, notwithstanding the definition above, two independent occurrences of R0, taken together with their intervening atom(s), form a 3—12—membered saturated, lly unsaturated, or aryl mono— or bicyclic ring having 0—4 atoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.

Suitable lent substituents on R0 (or the ring formed by taking two independent occurrences of RO together with their intervening atoms), are independently halogen, —(CH2)0_2R°, —(haloR°), —(CH2)0_2OH, 0_2OR', —(CH2)0_ 2CH(OR')2; —O(haloR'), —CN, —N3, —(CH2)0_2C(O)R', —(CH2)0_2C(O)OH, —(CH2)o—2C(O)OR', — (CH2)0_2SR°, —(CH2)0_2SH, 0_2NH2, —(CH2)0_2NHR°, —(CH2)0_2NR°2, —N02, , — OSiR'3, -C(O)SR', —(C1_4 straight or branched ne)C(O)OR°, or —SSR° n each R' is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently selected from C1_4 aliphatic, —CH2Ph, —O(CH2)0_1Ph, or a 5—6—membered saturated, partially unsaturated, or aryl ring having 0—4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.

Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =0, =S, =NNR*2, =NNHC(O)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =NOR*, —O(C(R*2))2_3O—, or —S(C(R*2))2_3S—, wherein each independent occurrence of R* is selected from hydrogen, C1_6 aliphatic which may be tuted as defined below, or an unsubstituted 5—6—membered saturated, partially unsaturated, or aryl ring having 0— 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: —O(CR*2)2_3O—, wherein each independent occurrence of R* is selected from hydrogen, C1—6 aliphatic which may be substituted as defined below, or an unsubstituted 5—6—membered saturated, lly unsaturated, or aryl ring having 0—4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

Suitable substituents on the aliphatic group of R* e halogen, — R', -(haloR°), -OH, —OR°, —O(haloR°), —CN, —C(O)OH, —C(O)OR°, —NH2, —NHR°, —NR°2, or —N02, wherein each R' is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1_4 aliphatic, —CH2Ph, —O(CH2)0_1Ph, or a 5—6— membered saturated, partially unsaturated, or aryl ring having 0—4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. ] le substituents on a substitutable nitrogen of an “optionally substituted” group include —Rl, —NRl2, —C(O)RT, —C(O)ORl, —C(O)C(O)Rl, — C(O)CH2C(O)RT, -S(O)2Rl, -S(O)2NRT2, —C(S)NRl2, —C(NH)NRT2, or —N(Rl)S(O)2Rl, wherein each R;r is independently hydrogen, C14 tic which may be substituted as defined below, unsubstituted —OPh, or an unsubstituted 5—6—membered saturated, partially unsaturated, or aryl ring having 0—4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of RT, taken together with their intervening atom(s) form an unsubstituted 3—12—membered saturated, lly unsaturated, or aryl mono— or bicyclic ring having 0—4 heteroatoms independently selected from nitrogen, oxygen, or .

Suitable substituents on the aliphatic group of RT are ndently halogen, — R', -(haloR'), —OH, —OR', oR'), —CN, —C(O)OH, —C(O)OR', —NH2, —NHR', —NR'2, or -N02, wherein each R' is tituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1_4 aliphatic, —CH2Ph, —O(CH2)0_1Ph, or a 5—6— membered saturated, partially unsaturated, or aryl ring having 0—4 heteroatoms independently selected from nitrogen, , or sulfur.

As used herein, the term “pharmaceutically able salt” refers to those salts which are, within the scope of sound medical judgment, le for use in t with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1—19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention e those derived from suitable nic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion ge.

Other pharmaceutically acceptable salts include adipate, te, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, onate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2—hydroxy—ethanesulfonate, ionate, e, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2—naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3—phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p—toluenesulfonate, undecanoate, valerate salts, and the like.

Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C14alkyl)4 salts. Representative alkali or alkaline earth metal salts include , m, ium, calcium, ium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and aryl ate.

Unless ise , structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present nds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the nds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures ing the replacement of hydrogen by deuteiium or tritium, or the replacement of a carbon by a 13C- or 14C-enriched carbon are within the scope of this invention.

Such compounds are useful, for example, as ical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention. In certain embodiments, a d moiety, R1, of a provided compound comprises one or more deuterium atoms.

As used herein, the term “inhibitor” is defined as a compound that binds to and/or modulates or inhibits a target RNA with measurable affinity. In certain embodiments, an inhibitor has an ICso and/or binding constant of less than about 100 nM, less than about 50 nM, less than about 1 uM, less than about 500 nM, less than about 100 nM, less than about 10 nM, or less than about 1 nM.

The terms “measurable y” and “measurably inhibit,” as used herein, mean a measurable change in a downstream biological effect between a sample comprising a compound of the present invention, or ition f, and a target RNA, and an lent sample comprising the target RNA, in the absence of said compound, or ition thereof.

The term “RNA” (ribonucleic acid) as used herein, means lly-occurring or synthetic oligoribonucleotides ndent of source (e.g., the RNA may be produced by a human, animal, plant, virus, or ium, or may be synthetic in ), biological context (e.g., the RNA may be in the nucleus, circulating in the blood, in vitro, cell lysate, or isolated or pure form), or physical form (e.g., the RNA may be in single-, double-, or triple-stranded form (including RNA-DNA hybrids), may include epigenetic modifications, native post- transcriptional modifications, artificial modifications (e.g., obtained by chemical or in vitro modification), or other modifications, may be bound to, e.g., metal ions, small molecules, proteins such as chaperones, or co-factors, or may be in a denatured, partially denatured, or folded state including any native or unnatural secondary or tertiary structure such as quadruplexes, hairpins, triplexes, three way junctions (3WJs), four way junctions (4WJs), parallel-Y junctions, ns, bulge loops, pseudoknots, and internal loops, etc., and any transient forms or structures adopted by the RNA). In some embodiments, the RNA is 20, 22, 50, 75, or 100 or more nucleotides in length. In some embodiments, the RNA is 250 or more nucleotides in length. In some embodiments, the RNA is 350, 450, 500, 600, 750, or 1,000, WO 06074 2,000, 3,000, 4,000, 5,000, 7,500, , 15,000, 25,000, 50,000, or more nucleotides in length.

In some embodiments, the RNA is between 250 and 1,000 nucleotides in length. In some ments, the RNA is a pre-RNA, pre-miRNA, or pretranscript. In some embodiments, the RNA is a non—coding RNA (ncRNA), messenger RNA (mRNA), micro-RNA (miRNA), a ribozyme, riboswitch, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, pseudo- gene, viral RNA, fungal RNA, parasitic RNA, or bacterial RNA. The term “target nucleic acid” or “target RNA,” as used herein, means any type of nucleic acid or RNA, respectively, having a secondary or ry structure capable of binding a small molecule compound described herein.

In some embodiments, the structure is a 3WJ that is bound to or stabilized by a disclosed compound or a 3WJ that is stabilized by the binding of the compound at another site on the target nucleic acid (e.g. RNA). All 3WJ structures are encompassed by the present invention without nce to their conformation or attendant tertiary interactions. For e, the 3WJ may be a cis 3WJ, a trans 3WJ, a parallel—Y junction, or r form of 3WJ. The target RNA may be inside a cell, in a cell , or in isolated form prior to contacting the compound.

The term “effector” or “effector nucleic acid,” as used , means a nucleic acid that binds to a target nucleic acid and regulates or modulates its activity. Exemplary effectors include small RNAs acting in trans to induce 3WJ formation. In some ments, ors are selected from various natural forms of small RNA such as miRNA, Piwi-interacting RNA (piRNA), and small nucleolar RNA (snoRNA). These small RNAs can base pair with a target such as mRNA in a manner that results in the formation of a 3WJ. The base pairing between the effector and target is often incomplete, meaning that the two sequences have some, but not complete, complementarity. Perfect complementarity would result in the formation of a fully double-stranded structure that lacks a 3WJ. In order to form a 3WJ, the effector (e.g., a miRNA) and target (e.g., an mRNA) would lly form a stretch of base pairing of at least 4 nucleotides (nt) followed by a base-pairing stem of at least 4 nt and a loop of ed nt, ed by a second stretch of base pairing between the effector and target sequences. The stem-loop can be formed either in the effector or the target RNA.

The term “cis 3WJ” or “cis three-way junction,” as used herein, refers to a 3WJ formed between portions of a single nucleic acid, such as a single strand of mRNA, precursor, or protein—bound complex thereof.

The term “trans 3WJ” or “trans three-way junction,” as used herein, refers to a 3WJ formed between two or more nucleic acids, such as an miRNA/mRNA complex sharing partial sequence complementarity. 4. General s ofProviding the Present nds The compounds of this invention may be prepared or isolated in general by synthetic and/or semi-synthetic methods known to those skilled in the art for analogous compounds and by methods described in detail in the Examples and Figures, herein. For example, various compounds of the present invention may be synthesized by reference to Figures 5-31 or 77-94 or 96 of US. Provisional Patent Application USSN 62/289,671, which is hereby incorporated by reference in its entirety.

In the schemes and chemical reactions depicted in the detailed description, Examples, and Figures, where a particular protecting group (“PG”), leaving group , or transformation ion is depicted, one of ordinary skill in the art will appreciate that other protecting groups, leaving groups, and transformation conditions are also suitable and are contemplated. Such groups and transformations are described in detail in March’s Advanced Organic Chemistry: Reactions, isms, and Structure, M. B. Smith and J . March, 5th Edition, John Wiley & Sons, 2001, Comprehensive Organic Transformations, R. C. Larock, 2““1 Edition, John Wiley & Sons, 1999, and Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3r01 edition, John Wiley & Sons, 1999, the entirety of each of which is hereby incorporated herein by nce.

] As used herein, the phrase “leaving group” (LG) includes, but is not limited to, halogens (e. g. fluoride, chloride, bromide, iodide), sulfonates (eg. mesylate, tosylate, esulfonate, brosylate, nosylate, e), ium, and the like.

] As used herein, the phrase “oxygen protecting group” includes, for example, carbonyl protecting groups, hydroxyl protecting groups, etc. Hydroxyl protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, T. W.

Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Examples of suitable hydroxyl protecting groups e, but are not limited to, , allyl , ethers, silyl ethers, alkyl ethers, arylalkyl ethers, and alkoxyalkyl ethers. es of such esters include formates, acetates, carbonates, and sulfonates. Specific examples include forrnate, benzoyl forrnate, chloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4- oxopentanoate, 4,4-(ethylenedithio)pentanoate, pivaloate thylacetyl), crotonate, 4- methoxy-crotonate, benzoate, p-benzylbenzoate, 2,4,6-t1imethylbenzoate, carbonates such as methyl, 9-fluorenylmethyl, ethyl, 2,2,2-trichloroethyl, 2-(t1imethylsilyl)ethyl, 2- (phenylsulfonyl)ethyl, vinyl, allyl, and p-nitrobenzyl. Examples of such silyl ethers e trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, propylsilyl, and other trialkylsilyl ethers. Alkyl ethers include methyl, benzyl, p-methoxybenzyl, 3,4- dimethoxybenzyl, trityl, t-butyl, allyl, and allyloxycarbonyl ethers or derivatives. alkyl ethers include acetals such as methoxymethyl, methylthiomethyl, (2-methoxyethoxy)methyl, benzyloxymethyl, beta-(trimethylsilyl)ethoxymethyl, and tetrahydropyranyl ethers. Examples of kyl ethers include benzyl, p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, and 2- and 4-picolyl.

Amino protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3r01 edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Suitable amino protecting groups include, but are not d to, aralkylamines, ates, cyclic imides, allyl amines, amides, and the like. Examples of such groups e t-butyloxycarbonyl (BOC), ethyloxycarbonyl, methyloxycarbonyl, trichloroethyloxycarbonyl, allyloxycarbonyl (Alloc), benzyloxocarbonyl (CBZ), allyl, phthalimide, benzyl (Bn), fluorenylmethylcarbonyl (Fmoc), formyl, acetyl, chloroacetyl, dichloroacetyl, trichloroacetyl, acetyl, roacetyl, benzoyl, and the like.

] One of skill in the art will appreciate that various functional groups present in compounds of the ion such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens and nitriles can be interconverted by ques well known in the art including, but not limited to ion, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. “March’s Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, MB. and March, J John Wiley & ., Sons, New York: 2001, the entirety of which is incorporated herein by reference. Such onversions may require one or more of the aforementioned techniques, and certain methods for synthesizing compounds of the invention are described below in the Exempliflcation and . Uses, Formulation inistration Pharmaceutically acceptable compositions ] According to another embodiment, the invention provides a composition comprising a compound of this invention or a pharmaceutically acceptable derivative thereof and a pharrnaceutically acceptable carrier, adjuvant, or vehicle. The amount of compound in compositions of this invention is such that is effective to measurably inhibit or te a target RNA, or a mutant thereof, in a biological sample or in a patient. In certain embodiments, the amount of compound in compositions of this invention is such that is effective to measurably inhibit or modulate a target RNA, in a biological sample or in a t. In certain embodiments, a composition of this invention is formulated for administration to a patient in need of such ition. In some ments, a composition of this invention is formulated for oral administration to a patient.

The term “patient,” as used herein, means an animal, ably a mammal, and most preferably a human.

The term “pharmaceutically acceptable carrier, nt, or vehicle” refers to a non- toxic carrier, adjuvant, or vehicle that does not destroy the pharmacological activity of the compound with which it is formulated. Pharmaceutically acceptable rs, adjuvants or vehicles that may be used in the compositions of this invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, um hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal , magnesium trisilicate, polyvinyl pyrrolidone, ose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene—block polymers, polyethylene glycol and wool fat.

A “pharmaceutically acceptable derivative” means any xic salt, ester, salt of an ester or other derivative of a compound of this invention that, upon administration to a recipient, is e of ing, either directly or ctly, a compound of this invention or an inhibitorily active metabolite or residue thereof.

Compositions of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, lly or via an implanted reservoir.

The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial ion or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally or intravenously. Sterile injectable forms of the compositions of this invention may be s or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.

The sterile injectable preparation may also be a sterile injectable on or suspension in a non- toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butanediol.

Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium.

For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the ation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil ons or suspensions may also contain a long-chain alcohol diluent or dispersant, such as carboxymethyl cellulose or similar dispersing agents that are commonly used in the formulation of pharrnaceutically acceptable dosage forms including emulsions and sions. Other commonly used surfactants, such as Tweens, Spans and other emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharrnaceutically acceptable solid, liquid, or other dosage forms may also be used for the es of formulation.

Pharmaceutically acceptable itions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, s suspensions or solutions. In the case of tablets for oral use, carriers commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful ts include lactose and dried cornstarch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, ng or coloring agents may also be added.

Alternatively, pharmaceutically acceptable compositions of this invention may be administered in the form of suppositories for rectal administration. These can be prepared by mixing the agent with a le non-irritating excipient that is solid at room temperature but liquid at rectal temperature and ore will melt in the rectum to release the drug. Such materials include cocoa butter, x and polyethylene glycols.

Pharmaceutically acceptable compositions of this invention may also be stered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. Topically-transdermal patches may also be used.

For l applications, ed pharmaceutically acceptable itions may be formulated in a le ointment containing the active component suspended or dissolved in one or more rs. Carriers for topical administration of compounds of this invention include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, ene glycol, polyoxyethylene, ypropylene compound, emulsifying wax and water. Alternatively, provided pharmaceutically acceptable itions can be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not d to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

For ophthalmic use, provided pharmaceutically acceptable compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic uses, the pharmaceutically acceptable compositions may be formulated in an nt such as petrolatum.

Pharmaceutically acceptable compositions of this invention may also be administered by nasal aerosol or inhalation. Such itions are prepared according to techniques wellknown in the art of pharmaceutical formulation and may be prepared as solutions in , employing benzyl alcohol or other suitable vatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other conventional solubilizing or dispersing agents.

Most preferably, pharmaceutically acceptable compositions of this invention are formulated for oral stration. Such formulations may be stered with or without food. In some ments, ceutically acceptable compositions of this invention are administered without food. In other embodiments, pharmaceutically acceptable compositions of this invention are administered with food.

The amount of compounds of the present invention that may be combined with the carrier materials to produce a composition in a single dosage form will vary depending upon the host treated, the particular mode of administration. ably, provided compositions should be formulated so that a dosage of between 0.01 - 100 mg/kg body weight/day of the inhibitor can be administered to a patient receiving these compositions.

It should also be understood that a specific dosage and treatment regimen for any particular patient will depend upon a variety of factors, ing the ty of the specific compound employed, the age, body weight, general health, seX, diet, time of administration, rate of excretion, drug combination, and the judgment of the treating physician and the severity of the particular disease being treated. The amount of a compound of the present invention in the composition will also depend upon the ular compound in the composition.

Uses of Compounds and Pharmaceutically Acceptable Compositions Compounds and compositions bed herein are generally useful for the modulation of a target RNA to retreat an RNA-mediated e or condition.

The activity of a compound utilized in this invention to modulate a target RNA may be assayed in vilro, in vivo or in a cell line. In vitro assays include assays that ine modulation of the target RNA. Alternate in vitro assays quantitate the ability of the compound to bind to the target RNA. Detailed conditions for assaying a compound utilized in this invention to modulate a target RNA are set forth in the Examples below.

As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of ms. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of c or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.

] Provided compounds are tors of a target RNA and are therefore useful for treating one or more disorders associated with or affected by (e.g., downstream of) the target RNA. Thus, in n embodiments, the present ion provides a method for treating an diated disorder comprising the step of administering to a patient in need thereof a compound of the present invention, or pharmaceutically acceptable composition thereof.

As used herein, the terms “RNA-mediated” disorders, diseases, and/or conditions as used herein means any disease or other deleterious condition in which RNA, such as an overexpressed, underexpressed, , misfolded, pathogenic, or ongogenic RNA, is known to play a role. ingly, another embodiment of the present invention s to treating or lessening the severity of one or more diseases in which RNA, such as an overexpressed, underexpressed, mutant, misfolded, pathogenic, or ongogenic RNA, is known to play a role.

In some embodiments, the t invention provides a method for treating one or more disorders, diseases, and/or conditions wherein the er, disease, or condition includes, but is not limited to, a cellular proliferative disorder.

Cellular Proliferatl've Disorders ] The present invention features methods and compositions for the diagnosis and prognosis of cellular proliferative disorders (e.g., cancer) and the treatment of these disorders by ting a target RNA. Cellular proliferative disorders described herein e, e.g., cancer, obesity, and proliferation-dependent diseases. Such ers may be diagnosed using methods known in the art. 2017/040514 Cancer ] Cancer includes, in one embodiment, without limitation, leukemias (e,g., acute ia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, c lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease or non-Hodgkin's disease), Waldenstrom's macroglobulinemia, le myeloma, heavy chain disease, and solid tumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, elioma, Ewing’s tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, ous gland carcinoma, papillary carcinoma, ary arcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, endroglioma, schwannoma, meningioma, melanoma, lastoma, and retinoblastoma).

In some embodiments, the cancer is melanoma or breast .

] Cancers includes, in another embodiment, without limitation, mesothelioma, hepatobilliary (hepatic and billiary duct), bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, gastrointestinal (gastric, colorectal, and duodenal), uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the , carcinoma of the vulva, Hodgkin's e, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the d gland, cancer of the yroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, cytic lymphomas, cancer of the bladder, cancer of the kidney or ureter, renal cell carcinoma, carcinoma of the renal pelvis, non hodgkins's ma, spinal axis tumors, brain stem glioma, pituitary adenoma, adrenocortical cancer, gall bladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma, or a combination of one or more of the foregoing cancers.

In some embodiments, the t invention es a method for treating a tumor in a patient in need thereof, sing administering to the patient any of the compounds, salts or pharmaceutical compositions described herein. In some ments, the tumor comprises any of the s described herein. In some embodiments, the tumor comprises melanoma cancer. In some embodiments, the tumor comprises breast cancer. In some embodiments, the tumor comprises lung cancer. In some embodiments the the tumor comprises small cell lung cancer (SCLC). In some embodiments the the tumor comprises non-small cell lung cancer (NSCLC).

In some embodiments, the tumor is treated by arresting further growth of the tumor.

In some embodiments, the tumor is treated by reducing the size (e.g., volume or mass) of the tumor by at least 5%, 10%, 25%, 50 %, 75%, 90% or 99% relative to the size of the tumor prior to treatment. In some embodiments, tumors are treated by reducing the quantity of the tumors in the patient by at least 5%, 10%, 25%, 50 %, 75%, 90% or 99% ve to the quantity of tumors prior to treatment.

Other Proliferative Diseases Other proliferative diseases include, e. g., obesity, benign prostatic hyperplasia, psoriasis, abnormal nization, lymphoproliferative disorders (e.g., a disorder in which there is abnormal proliferation of cells of the lymphatic system), c rheumatoid arthritis, arteriosclerosis, restenosis, and diabetic retinopathy. Proliferative diseases that are hereby incorporated by reference include those described in US. Pat. Nos. 5,639,600 and 7,087,648.

Inflammatory Disorders andDiseases Compounds of the invention are also useful in the treatment of inflammatory or allergic conditions of the skin, for example psoriasis, contact dermatitis, atopic itis, alopecia areata, erythema multiforma, itis herpetiformis, derma, vitiligo, hypersensitivity is, urticaria, bullous pemphigoid, lupus erythematosus, ic lupus erythematosus, pemphigus vulgaris, pemphigus eus, paraneoplastic pemphigus, epiderrnolysis bullosa acquisita, acne vulgaris, and other inflammatory or ic conditions of the skin. nds of the invention may also be used for the treatment of other diseases or conditions, such as diseases or conditions having an inflammatory component, for example, treatment of diseases and conditions of the eye such as ocular allergy, conjunctivitis, keratoconjunctivitis sicca, and vernal conjunctivitis, diseases affecting the nose including allergic rhinitis, and atory disease in which mune reactions are implicated or having an mune component or etiology, including autoimmune hematological disorders (e.g. tic anemia, aplastic anemia, pure red cell anemia and idiopathic thrombocytopenia), systemic lupus erythematosus, rheumatoid tis, polychondritis, scleroderma, Wegener granulamatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g. tive colitis and Crohn’s disease), irritable bowel syndrome, celiac disease, periodontitis, hyaline membrane disease, kidney disease, glomerular disease, alcoholic liver disease, multiple sclerosis, endocrine mopathy, Grave’s disease, sarcoidosis, alveolitis, c hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), n’s syndrome, keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial lung fibrosis, psoriatic arthritis, systemic juvenile idiopathic tis, cryopyrin-associated periodic me, nephritis, vasculitis, diverticulitis, interstitial cystitis, glomerulonephritis (with and t nephrotic syndrome, e. g. including idiopathic nephrotic syndrome or minal change pathy), chronic granulomatous disease, endometriosis, leptospiriosis renal disease, glaucoma, retinal disease, ageing, headache, pain, complex regional pain syndrome, cardiac rophy, musclewasting, catabolic disorders, obesity, fetal growth retardation, hyperchlolesterolemia, heart disease, chronic heart failure, elioma, anhidrotic ecodermal dysplasia, Behcet’s disease, incontinentia pigmenti, Paget’s disease, pancreatitis, hereditary periodic fever syndrome, asthma (allergic and non-allergic, mild, moderate, severe, bronchitic, and exercise-induced), acute lung injury, acute respiratory distress me, eosinophilia, hypersensitivities, anaphylaxis, nasal sinusitis, ocular allergy, silica induced diseases, COPD (reduction of damage, airways inflammation, bronchial hyperreactivity, remodeling or disease progression), ary disease, cystic fibrosis, acid-induced lung injury, pulmonary hypertension, polyneuropathy, cataracts, WO 06074 muscle inflammation in conjunction with systemic sclerosis, inclusion body is, myasthenia gravis, thyroiditis, n’s disease, lichen planus, Type 1 diabetes, or Type 2 diabetes, appendicitis, atopic dermatitis, asthma, allergy, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chronic graft rejection, colitis, conjunctivitis, Crohn’s disease, cystitis, dacryoadenitis, dermatitis, dermatomyositis, alitis, endocarditis, endometritis, enteritis, colitis, epicondylitis, epididymitis, fasciitis, fibrositis, gastritis, gastroenteritis, Henoch-Schonlein purpura, hepatitis, hidradenitis suppurativa, immunoglobulin A nephropathy, interstitial lung disease, laryngitis, mastitis, meningitis, myelitis myocarditis, myositis, nephritis, oophoritis, orchitis, is, otitis, pancreatitis, parotitis, pericarditis, peritonitis, pharyngitis, pleuritis, phlebitis, pneumonitis, pneumonia, polymyositis, tis, prostatitis, pyelonephritis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, tendonitis, tonsillitis, ulcerative colitis, uveitis, vaginitis, vasculitis, or is.

In some embodiments the inflammatory disease which can be treated according to the methods of this invention is an disease of the skin. In some embodiments, the inflammatory disease of the skin is selected from contact dermatitits, atompic dermatitis, alopecia areata, erythema multiforma, dermatitis herpetiformis, scleroderma, Vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, gus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, molysis bullosa acquisita, and other inflammatory or allergic conditions of the skin.

In some embodiments the atory disease which can be treated according to the methods of this invention is selected from acute and chronic gout, c gouty arthritis, psoriasis, psoriatic tis, rheumatoid arthritis, Juvenile rheumatoid arthritis, Systemic jubenile idiopathic arthritis , Cryopyrin Associated ic Syndrome (CAPS), and osteoarthritis.

In some embodiments the inflammatory disease which can be d according to the methods of this invention is a TH17 ed disease. In some embodiments the THl7 mediated disease is selected from Systemic lupus matosus, Multiple sclerosis, and inflammatory bowel disease (including Crohn’s disease or ulcerative colitis).

In some embodiments the inflammatory disease which can be treated according to the methods of this invention is selected from Sjogren’s syndrome, allergic disorders, osteoarthritis, conditions of the eye such as ocular allergy, conjunctivitis, keratoconjunctivitis sicca and vernal ctivitis, and diseases affecting the nose such as ic rhinitis.

Metabolic Disease In some embodiments the invention provides a method of treating a metabolic disease. In some embodiments the metabolic disease is selected from Type 1 diabetes, Type 2 diabetes, metabolic syndrome or obesity.

The compounds and compositions, according to the method of the t invention, may be administered using any amount and any route of administration effective for treating or lessening the ty of a cancer, an autoimmune disorder, a proliferative disorder, an inflammatory disorder, a neurodegenerative or ogical disorder, schizophrenia, a bone- related disorder, liver disease, or a cardiac disorder. The exact amount ed will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the infection, the particular agent, its mode of administration, and the like.

Compounds of the invention are ably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression "dosage unit form" as used herein refers to a physically discrete unit of agent appropriate for the patient to be d. It will be understood, however, that the total daily usage of the compounds and itions of the present invention will be decided by the ing physician within the scope of sound medical judgment. The specific effective dose level for any particular patient or organism will depend upon a variety of s including the disorder being treated and the severity of the disorder, the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of ion of the specific compound employed; the duration of the treatment, drugs used in combination or dental with the specific compound employed, and like factors well known in the medical arts. The term “patient”, as used herein, means an animal, preferably a mammal, and most preferably a human.

Pharmaceutically acceptable compositions of this invention can be administered to humans and other s orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, nts, or drops), bucally, as an oral or nasal spray, or the like, depending on the severity of the infection being treated. In certain embodiments, the compounds of the invention may be administered orally or parenterally at dosage levels of about 0.01 mg/kg to about 50 mg/kg and preferably from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic .

] Liquid dosage forms for oral administration include, but are not limited to, pharrnaceutically acceptable emulsions, microemulsions, ons, suspensions, syrups and elixirs. In on to the active nds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl te, propylene , 1,3-butylene glycol, dimethylformamide, oils (in ular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. s inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. able preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated ing to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a e injectable solution, sion or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally ed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating izing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

In order to prolong the effect of a compound of the present invention, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection.

This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends upon its rate of dissolution that, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in radable polymers such as polylactide- polyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. es of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues. itions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds of this ion with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient ature but liquid at body temperature and ore melt in the rectum or vaginal cavity and release the active compound.

Solid dosage forms for oral administration include capsules, s, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium ate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, n, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, c acid, certain silicates, and sodium ate, e) solution retarding agents such as paraffin, f) tion accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl e, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents.

Solid itions of a similar type may also be employed as fillers in soft and hard- fllled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain ying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner.

Examples of embedding itions that can be used include polymeric substances and waxes.

Solid itions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as e or milk sugar as well as high molecular weight polethylene glycols and the like.

The active compounds can also be in micro-encapsulated form with one or more excipients as noted above. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active nd may be d with at least one inert t such as sucrose, lactose or starch. Such dosage forms may also se, as is normal practice, additional substances other than inert diluents, e. g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a d manner.

Examples of embedding compositions that can be used e polymeric substances and waxes.

Dosage forms for topical or transdermal administration of a compound of this invention include nts, pastes, creams, s, gels, powders, solutions, sprays, inhalants or patches. The active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. Ophthalmic formulation, ear drops, and eye drops are also contemplated as being within the scope of this invention. onally, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body.

Such dosage forms can be made by ving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.

According to one embodiment, the invention relates to a method of modulating the activity of a target RNA in a biological sample comprising the step of contacting said biological sample with a compound of this invention, or a composition comprising said compound.

According to another embodiment, the invention relates to a method of modulating the activity of a target RNA in a biological sample comprising the step of contacting said biological sample with a compound of this invention, or a composition comprising said compound. In certain embodiments, the invention relates to a method of irreversibly inhibiting the ty of a target RNA in a biological sample comprising the step of contacting said biological sample with a compound of this invention, or a composition comprising said compound.

The term “biological sample”, as used herein, includes, without limitation, cell cultures or extracts thereof, biopsied material obtained from a mammal or extracts thereof, and blood, saliva, urine, feces, semen, tears, or other body fluids or extracts f, Another embodiment of the present invention s to a method of modulating the activity of a target RNA in a patient comprising the step of administering to said patient a compound of the t invention, or a composition comprising said compound.

According to another embodiment, the invention s to a method of inhibiting the activity of a target RNA in a t sing the step of stering to said t a compound of the present invention, or a composition comprising said compound. According to certain embodiments, the ion relates to a method of irreversibly inhibiting the activity of a target RNA in a patient sing the step of administering to said patient a compound of the present invention, or a composition comprising said compound. In other embodiments, the present invention provides a method for treating a disorder mediated by a target RNA in a patient in need thereof, comprising the step of administering to said patient a compound according to the present invention or ceutically able composition thereof. Such ers are described in detail herein.

EXEMPLIFICATION As ed in the Examples below, in certain exemplary embodiments, compounds are prepared according to the following general procedures and used in biological assays and other procedures described lly herein. It will be appreciated that, although the general methods depict the synthesis of certain compounds of the present invention, the following general methods, and other methods known to one of ordinary skill in the art, can be applied to all compounds and subclasses and s of each of these compounds, as described herein.

Similarly, assays and other analyses can be adapted according to the knowledge of one of ordinary skill in the art.

Example 1: nding Small Molecules Historical efforts to identify small molecule ligands that bind to RNA have focused on base-pairing or on canonical structural motifs in duplex RNA: intercalation between bases and/or groove binding. But these motifs do not support ive g of small les to specific RNAs. However, RNA folds into an enormous variety of complex tertiary structures that present s conducive to small molecule binding — small molecules that are complementary to the shape and electrostatics presented by those pockets. Insofar as the details of shape and ostatics reflect the underlying sequence of the RNA, small molecules can achieve selectivity, much as they do when binding protein pockets.

Indeed, there are now several reports of drug-like small molecules that bind to RNA, many of them proved (see Table 4 below).

Small Molecule Ligands by Class Though a range of small molecule chemotypes has been demonstrated to bind to folded RNA (Guan & Disney, ACS Chem. Biol. 2012 7, 73-86), hereby incorporated by reference, there are limited reports of high—throughput screening of large libraries (>105 compounds) to fy RNA-binding ligands. Accordingly there are also few reports of small molecules synthetically optimized for RNA binding. The t invention paves the path to a remedy for these deficiencies. Below is a table summarizing the broad chemotypes which have demonstrable RNA binding and will serve as the ng point to optimize and validate our screening , which will in turn enable the systematic screening of essentially all known chemotypes against RNA structures of therapeutic interest.

Table 4: RNA-binding Small Molecules -approve ac en eac e . .

Linezolid antibiotic ribosomal RNA 2007, 26, 393-402 FDA-approved Bacterial Leach et al. Mol. Cell Tedizolid antibiotic ribosomal RNA 2007, 26, 393-402 Bacterial Brodersen et al. Cell . FDA-approved Tetracycline antibiotic 30$ mal RNA 2000, 1 03, 1143-1154 FDA-approved Bacterial Fourmy et al. Science Aminoglyc051des, , antibiotics 16S mal RNA 1996, 274, 1367-1371 proved for Jenison et al. Science Theophylline Aptameric RNA COPD and asthma 1994, 263, 1425-1429 These discoveries revealed a molecular mechanism of action that was not pated.

The intentional design of small molecules that bind to folded RNA has been d only rarely e of substantial technical challenges, with one notable example being the design of cene-based ligands able to bind selectively to RNA three—way junctions (Barros et al., Angew. Chem. Int. Ed. 2014, 53, 13746-13750. Triptycene-based ligands will thus provide another chemotype with RNA binding ability to serve as another starting point in the described ing methods.

The s provide many exemplary scaffolds and specific target compound genera, which may be ed or altered using methods known in the art.

As shown in Figure 8 (top right structure), while tripartite scaffolds represent a promising platform for binding 3WJs, they do not need to be symmetric, as the 3WJ will itself not usually be ric. In the pictured example, the triangle, square, and pentagon stand for cyclopropyl, cyclobutyl, or cyclopentyl, and may be substituted with the various nucleic acid binding groups disclosed herein.

Example 2: Synthesis of Warhead Type IA Scheme: Synthesis of Warhead Type IA Triphosgene, Dioxane, RT 6h 0 Step-1 NAG O H Warhead_Type_1A MW 207 2,4-dioxo-1,4-dihydro-2H-benzo[d][1,3]oxazinecarb0xylic acid, Warhead Type IA.

To a solution of oterephthalic acid (2.0 g, 11.05 mmol) in 1,4—Dioxane (160 mL) was added triphosgene (3.28 g, 11.05 mmol) at room temperature. The resulting reaction mixture was stirred for 6 h at room temperature. The reaction mixture was poured in DM water (400 mL) and extracted with ethyl acetate (3 X 150 mL). The organic layers were combined, washed with brine and concentrated under d pressure to afford Warhead_Type_1A (2.2 g, 96.2%) as an off white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.67 ppm (1H, broad), 11.89 ppm (1H, broad), 8.03-8.01 ppm (1H, d), 7.73-7.68 ppm (2H, m). MS (ESI—MS): m/z calcd for C9H5N05 [MH]' , found 206.17.

Example 3: Synthesis of d Type 1B Scheme: Synthesis of Warhead Type 1B O 0 K2003' DMS KOH, THF, 0/ Acetone Water OH ’ HO NH2 Step--1 Step-2 NH 0 0 l (A) (1) MW: 223.08 ( ) MW: 195.05 Step3 Triphosgene Dioxane RT HO NAG O l Warhead_Type-1 B MW 221 .03 1,4-dimethyl hylamino)benzene-1,4-dicarboxylate (1).

] To a solution of dimethyl 2—aminobenzene-1,4-dicarboxylate (10.0 g, 0.05 mol) in acetone (150 mL) was sequentially added potassium carbonate (19.8 g, 0.143 mol) and dimethylsulphate (18.1 g, 0.143mol) at room temperature. The resulting reaction mixture was stirred at 60 °C for 24h. The reaction e was slowly cooled to room temperature and diluted with water (200 mL). The resulted mixture was then extracted with ethyl acetate (4 x 750 mL).

The organic layers were combined, washed with brine and concentrated under reduced re to get crude 1 as a brown solid. The crude mixture was purified by column chromatography on silica gel (7% EtOAc/hexanes) to yield 1 (4.5g, 42%) as a pale yellow solid. MS (ESI—MS): m/z calcd for C11H13NO4 [MH]+ 224.08, found 2242. 2-(methylamino)benzene—1,4-dicarb0xylic acid (2).

To a solution of dimethyl hylamino)benzene-1,4-dicarboxylate (1) (4.5 g, 0.02 mol) in THF (100 mL) and water (50 mL) was added potassium hydroxide (3.4g, 0.06 mol) at room temperature. The ing reaction mixture was stirred at 70 °C for 4h. The reaction mixture was cooled to room temperature, diluted with water (200 mL) and ed using ium ate. The resulted mixture was then extracted with ethyl acetate (4 x 75 mL). The organic layers were combined, washed with brine and concentrated under d pressure to get crude 2 (3.0g, 76.33%) as a buff white solid. The crude mixture was used in next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 13.14 ppm (1H, s), 7.87-7.85 ppm (1H, d, J=8.0 Hz), 7.21—7.21 ppm (1H, d, J=1.6 Hz), 7.10—7.07 (1H, dd, J=8.0), 2.87 (1H, 5). MS (ESI- MS): m/z calcd for C9H9NO4 [MH]+ 196.05, found 196.21. 1-methyl-2,4-diox0-2,4-dihydro-1H-3,1-benzoxazine—7-carboxylic acid, Warhead Type 1B.

To a suspension of 2-(methylarnino) benzene-1,4-dicarboxylic acid (2) (3.0 g, 0.015 mol) in ydrofuran (90 mL) was added triphosgene (2.28 g, 0.076 mol) at room temperature. The resulting reaction mixture was stirred at 30 °C for 30 min. The reaction mixture was cooled to room temperature, diluted with water (50 mL) and extracted with ethyl acetate (3 x 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude Warhead Type 1B as a yellow solid. The crude mixture was purified by trituration using diethyl ether to yield Warhead Type 1B (31 g, 91.17%) as yellow solid. 1H NMR (400 MHz, DMSO-dg) 6 13.78 ppm (1H, s), .09 (1H, d, J=8.4), 7.82-7.80 (2H, m), 3.51 (3H, S). MS (ESI—MS): m/z calcd for C10H7N05 [MH]' 220.03, found onal warheads similar to this type include N—methylisatoic anhydride, 1- methylnitroisatoic anhydride, and 1—methylnitroisatoic ide. These are commercially ble.

Example 4: Synthesis of Warhead Type 2 Scheme: Synthesis of Warhead Type 2 o o o 0 Triphosgene CH3" K2003 BB“ OH , Dioxane O DMF In DCM O O o NH2 Step-1 \o m’go Step-2 \o ill/KO Step"? HO Iii/KO (1) (2) (3) MW: 193.03 MW: 207.05 MW: 193.03 Step-4 @Orm K2003 Acetone do 10% dec, H2 THF: EtOAc HO Q/ m0 o l O Warhead_Type 2A (4) MW: 341.08 MW: 251.04 7-meth0xy-2H-benzo[d] [1,3]0xazine—2,4(1H)—di0ne (1).

To a solution of 2-aminomethoxybenzoic acid (20 g, 119.73 mmol) in 1,4-dioxane (400 mL) was added triphosgene (17.8 g, 59.86 mmol) at room temperature. The resulting reaction mixture was d at room temperature for 6 h. The reaction mixture was poured in DM water (1 L) and extracted with ethyl acetate (3 X 350 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to afford 1 (20.5 g, 88%) as off White solid. 1H NMR (400 MHZ, DMSO-do) 5 11.66 ppm (1H, broad), 7.85—7.83 ppm (1H, d, J=8.8 Hz), 6.85-6.83 ppm (1H, dd, J=2.4, 6.4 Hz), 6.59-6.58 ppm (1H, d, J=2.4 Hz), 3.86 ppm (3H, s). MS (ESI—MS): m/z calcd for C9H7NO4 [MH]' , found 192.16. 7-meth0xy-l-methyl-ZH-benzo[d][1,3]0xazine-2,4(lH)—di0ne (2).

To a solution of 7-methoxy-2H-benzo[d][1,3]oxazine-2,4(1H)-dione (1) (20.5 g, 106.2 mmol) in N,N—dimethyl formamide (200 mL) was added K2C03 (14.65 g, 106.2 mmol) at room temperature and the ing reaction e was stirred for 10 min. To this, methyl iodide (18.08 g, 127.44 mmol) was added drop wise at room temperature. The reaction mixture was poured into DM water (1 L) and ted with ethyl acetate (3 X 350 mL). The organic layers were combined, washed with brine and concentrated under d pressure to get crude 2. The crude was purified by triturating with hexane to yield 2 (17.9 g, 93.23 %) as off white solid. The product was used in the next step without further purification. 1H NMR (400 MHz, DMSO-dp) 6 7.95-7.93 ppm (1H, d, J=8.4 Hz), 6.94-6.91 ppm (1H, dd, J=2.4, 6.4 Hz), 6.86-6.85 ppm (1H, d, J=2 Hz), 3.94 ppm (3H, s), 3.46 ppm (3H, s). MS (ESI—MS): m/z calcd for C10H9NO4 [MH]+ 208.05, found 208.2. 7-hydr0xy-l-methyl-ZH-benzo[d] [1,3]0xazine-2,4(1H)—dione (3).

To a solution of 7-methoxymethyl-2H-benzo[d][1,3]oxazine-2,4(1H)—dione (2) (10 g, 48.30 mmol) in dichloromethane (500 mL) at 0 oC, BBr3 (1 M solution in dichloromethane) (72.44 mL, 72.44 mmol) was added dropwise. The resulting reaction mixture was stirred at 0 °C for 1 h and slowly brought to room temperature and further stirred for 24 h. The reaction mixture was diluted with n-Hexane (500mL) and the residues ed were d. The collected solid was washed with n-Hexane (3 X 50mL) and dried under reduced pressure. The solid was further suspended in water (1 L) and extracted with dichloromethane (5 X 350mL).

The organic layers were combined, washed with brine and concentrated under reduced pressure to get 3 (7.9 g, 84.74 %) as a brown solid. 1H NMR (400 MHz, MeOD) 8 7.96-7.94 ppm (1H, d, J=8.8 Hz), 6.78-6.75 ppm (1H, dd, J=2, 64 Hz), 6.69-6.69 ppm (1H, d, J=2.4 Hz), 3.52 ppm (3H, s). MS (ESI—MS): m/z calcd for C9H7NO4 [MH]' 192.04, found 191.96.

Benzyl 2-((1-methyl-2,4-di0xo-1,4-dihydr0-2H-benz0[d][1,3]0xazin yl)0xy)acetate (4).

] To a on of 7-hydroxymethyl-2H-benzo[d][1,3]oxazine-2,4(1H)-dione (3) (7.9 g, 40.93 mmol) in acetone (800 mL) was added K2C03 (14.12 g, 5 mmol) and the reaction mixture was stirred for 20 min at room temperature. To this, benzylbromoacetate (11.251 g, 49.111 mmol) was added dropwise at room temperature and the resulting on mixture was further stirred for 5 h. The reaction mixture was filtered and residues collected were washed with acetone (3 X 20mL). The filtrate was concentrated under d pressure to afford a solid mass. The solid mass was dissolved in ethyl acetate (1 L) and washed with water (3 X 300mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 4. The crude mixture was purified by column chromatography on silica gel (20% EtOAc/n-Hexane) to yield pure 4 (0.39 g, 62.9 %) as a yellow oil. 1H NMR (400 MHz, DMso-d6) 5 7.94-7.92 ppm (1H, d, J=8.4 Hz), 7.38-7.35 ppm (5H, m), 6.95-6.92 ppm (1H, dd, J=2, 6.8 Hz), 6.87-6.87 ppm (1H, d, J=2 Hz), 5.23 ppm (2H, s), 5.14 ppm (2H, s), 3.40 ppm (3H, ). MS (ESI—MS): m/z calcd for NO6 [MH]+ 342.09, found 342.28. ] 2-((1-methyl-2,4-di0x0-1,4-dihydro-2H-benz0[d][1,3]0xazinyl)0xy)acetic acid, Warhead_type_2.

To a suspension of 10% Pd/C (dry basis) (1.25g, 5 % w/V) in a 1:1 mixture of THF: EtOAc (400 mL) was added a solution of Benzyl methyl-2,4—dioxo-1,4-dihydro-2H- benzo[d][l,3]oxazinyl)oxy)acetate (4) (6.5 g, 19.057 mmol) at room temperature. H2 gas was purged into the reaction mixture for 3 h at room temperature. The reaction mixture was filtered through a celite bed and the collected filtrate was concentrated under reduced pressure to afford crude d_type_2. The crude mixture was puiified by triturating with n—Hexane (3 X 20mL) to yield Warhead_type_2 (0.39 g, 62.9%) as an off white solid. 1H NMR (400 MHz, DMSO—ds) 5 13.25 ppm (1H, br s), 7.95—7.92 ppm (1H, d, J=8.4 Hz), .88 ppm (2H, m), 4.94 ppm (2H, s), 3.44 ppm (3H, s). MS (ESI—MS): m/z calcd C11H9N06 [MH]+ 252.04, found 252.47. 2017/040514 Example 5: Synthesis of ARK-1 (Ark000007) Scheme: Synthesis of ARK-1 o NHZ NHBoc 2 HO-S-OH ll HO O HO 0 0 H0 H0 Ho\%HO NH \% NHBOC NHZ 2 Amberlfle IRA-400, OH OH O NH 02, DMSO, H20 0 ,NHBoc 2 Si: § OmNHz DM water HO/m/ 70 °C,20 hrs. HO O O HO O —’ HO —> HO Ho SteP_1 NH NHBOC Step 2 0 012—1 0 OH O OH OH OH (1) (2) CI, pyridine Step-3 hrs.

HO 0 NHBoc HO NaNs, DMF o NHBOC OH NH; Hgo 0% NH TFA, MDC, 120 °c MW 2 NHBOC 0 HO 30 mins. 0H 3 hrs. 0H0 0 HEO NHBOC <— <— NHBoc H0 OH ””2 Step-5 0H0 Step-4 OmNHBoc O OH NHBoc HO 0 OH HO N3 0 NHBoc ARK-1 ”3 0 (4) OTIPBS Kanamycin A free base, 1.

In 250 mL beaker, kanamycin A monosulfate (5.0 g, 8.582 mmol) was dissolved in water (100 mL) and the ing aqueous solution was passed through Amberlite® 0 -OH form ion exchange resin. The free base was eluted using DM water and the fractions collected were lyophilized to obtain free base 1 (3.8g, 91%) as a white solid which was used without further purification. MS S): m/z calcd for C18H36N4011 [MH]+485.23, found 485.26. 1,3,6’,3”-tetra—N-(tert-butoxycarbonyl) kanamycin A, 2.

To a stirred solution of Kanamycin A free base (1) (3.7 g, 7.641 mmol) in DMSO (140 mL) and water (40 L) (180 mL) was added Boc anhydride (20g, 91.692 mmol) at room temperature and the resulting reaction mixture was heated at 70 °C for 20 h. After cooling to room temperature, an aqueous solution of NH4OH (30 mL) was added to the resulting reaction mixture, resulting in a precipitate. The precipitate was collected through filtration, washed with water (2 X 350 mL) and dried under reduced pressure to afford pure 2 (5.7 g, 84%) as a white solid. 1H N1VIR (400 MHz, DMSO-d6) 5 6.92 ppm (1H, s), 6.62 ppm (1H, s), 6.53-6.51 ppm (1H, d, J=6.8 Hz), 6.38 ppm (1H, s), 5.40 ppm (1H, broad s), 5.27 ppm (1H, broad s), 4.71 ppm (1H, broad s), 4.22 ppm (1H, broad s), 3.80-3.25ppm (15H, broad m), 3.07 ppm (1H, broad s), 1.82-1.75 ppm (1H, broad s), 1.37 ppm (36H, broad s); MS (ESI—MS): m/z calcd for C38H68N4019 [MH]+ 885.44, found 907.7 (M+Na adduct). 6”-(2,4,6-Triis0propylbenzenesulfonyl)-1,3,6’,3”-tetra-N-(tert-butoxycarbonyl) kanamycin A, 3.

To a stirred solution of 1,3,6’,3”-Tetra-N-(tert-butoxycarbonyl) kanamycin A (2) (2 g, 2.261 mmol) in pyridine (35 mL) was added a on of 2,4,6-triisopropylbenzenesulfonyl chloride (4.11 g, 13.567 mmol) in pyridine (4 mL) at room temperature. The resulting on mixture was d at room temperature for 20 h. After this, the reaction mixture was added ol (30 mL) and further stirred for 30 min. The reaction mixture was then poured into a cooled 10% HCl solution (400 mL) and extracted with ethyl acetate (4 x 200mL). The c layers were combined, washed with brine, dried using anhydrous Na2SO4 and concentrated under reduced pressure to get crude 3 as a yellow solid. The crude mixture was purified by column chromatography on silica gel (2% MeOH/chloroform) to get pure 3 (0.5 g, 73%) as a light yellow solid, MS (ESI—MS): m/z calcd for C53H90N4021S [MH]+ 1151.58, found 908.6 (M- TTPBS fragment +Na adduct). 6”-Azido-1,3,6’,3”-tetra-N-(tert—butoxycarb0nyl)kanamycin A, 4.

A 35 mL pressure vial was charged with 6”-(2,4,6-Triisopropylbenzenesulfonyl)— ,3”—tetra-N—(tert-butoxycarbonyl) kanamycin A (3) (0.5g, 0.434 mmol), NaN3 (0.565 g, 8.691 mmol), DMF (15 mL) at room temperature. The resulting reaction mixture was irradiated under microwave at 120 °C for 3 h. After g to room temperature, the reaction mixture was quenched with cold water (150 mL) and extracted with ethyl e (3 X 50 mL). The organic layers were combined, washed with brine, dried using anhydrous Na2804 and concentrated under reduced pressure to get crude 4 as brown oil. The crude mixture was purified by preparative HPLC using the following method to get pure 4 (0.11 g, 27%) as a light yellow solid. 1H NMR (400 MHz, CD3OD) 5 5.11—5.02 ppm (2H, t, J=9.6 Hz), 4.37—4.35 ppm (1H, d), 3.73-3.36 ppm (15H, m), 3.23-3.18 ppm (1H, t, J=9.2 Hz), 2.07-2.04 ppm (1H, d, J=13.2 Hz), 1.47—1.45 ppm (36H, br s). MS (EST-MS): m/z calcd for C38H67N7018 [MHTr , found 932.67 (M+Na adduct).

Method of preparative HPLC: W0 2018/006074 (A) 10 mM ammonium bicarbonate in H20 (HPLC grade) and (B) MeCNzlPA (90:10) (HPLC grade), using X-BRIDGE C18, 250*19mm,5Un with a flow rate of 19.0 mL/min and with the following gradient: ——E_ 17.00 "El.

——Efi- ——m_ 6”-Azid0-kanamycin A triflouroacetate salt, ARK-l-TFA SALT. 6”-Azido-1,3,6’,3”-tetra—N—(tert-butoxycarbonyl)kanamycin A, (4) , 0.121 mmol) was dissolved in 1:1 mixture of DCMzTFA (3.2 mL) and the resulting solution was stirred at room temperature for 30 min, The reaction e was concentrated under reduced pressure and triturated using diethyl ether to get pure ARK-l-TFA SALT (0.12 g, 102%) as a light yellow solid. 1H NMR (400 MHz, D20) 6 5.39-5.38 ppm (1H, d, J=3.6 Hz), 4.95—4.94 ppm (1H, d, J=3.2 Hz), 3.796-3.71 ppm (5H, m), 3.64-3.31 ppm (11H, m), .01 ppm (1H, q, J=14.4,9.2 Hz), .37 ppm (1H, m), 1.77—1.74 ppm (1H, q, J = 12.8 Hz), 1.09—1.02 ppm (1H, m). MS (ESI—MS): m/Z calcd for N7Olo+3TFA [MH]+ 509.24, found 510.4. HPLC retention time: 7.103 min. 6”-Azid0-kanamycin A hloride salt, ARK-l-HCl SALT (Ark000007). 6”-Azido-kanamycin A triflouroacetate salt, TFA SALT (0.12 g, 0.124 mmol) was dissolved in water (40 mL) and the resulting aqueous solution was passed through Amberlite® IRA-400 -OH form ion exchange resin. The free base was eluted using DM water and the fractions collected were lyophilized to obtain ARK-1 as a free base. The free base was ved in 0.01 N HCl (4 mL) and the resulting solution was lyophilized to obtain pure ARK— l-HCl-SALT (0.06g, 77%) as a yellow solid. 1H NMR (400 MHZ, D20) 6 5.41-5.40 ppm (1H, d, J=2.4 Hz), 4.96 ppm (1H, br s), 3.90-3.76 ppm (5H, m), 3.62—3.60 ppm (2H, d, J=8.8 Hz), 3.55— 3.19 ppm (10H, m, ), 3.07-3.01 ppm (1H, m), 2.41-2.38 ppm (1H, d, J: 12), 1.82-1.73 ppm (1H, q, J = 12.8 Hz), MS (ESI—MS): m/z calcd for C18H35N7Olo.3 HCl [MH]+ 510.24, found 510.2.

HPLC retention time: 14.897 min.

Example 6: Synthesis of ARK-7 (Ark0000013) Scheme: Synthesis of ARK-7 HCI, NaNo2 H20, KI w —> g/6 Step-3 | Q Zn(CN)2, DMF o Step-4 C Q/s NHZ CN CH3 (4) NaOH, MeOH,HZO HZNMNMNl-POC Step-5 (23) HOOC\A // / HATU, DIPEA CH i NH/Vl‘vj/VNHBDC ‘ DMF moor/:7 \(3 <(:OOH Step-6 HCI in e Step-7 ARK-7_HCI salt 2,7,15-trinitro-9,10-dihydro—9,10-[1,2]benzen0anthracene,1a.

Concentrated HNO3 (400 mL) was added se to triptycene (10 g, 39.3 mmol) at room temperature and the resulting reaction mixture was heated at 80 CC for 16 h. The resulting brown solution was allowed to cool to room temperature, poured into ice cold water (3 000 mL) and stirred for 30 min. The obtained precipitates were collected, washed with cold water, and then dried in air to get the crude mixture of 1a and 1b. The crude mixture was purified by flash column chromatography on silica gel (20% EtOAc/hexanes) to afford pure product 121 (2.23 g, 14.10%) as a white solid. la mp: >300 °C 1H NMR (400 MHz, CDC13) 6 837—836 ppm (3H, d, J=2 Hz), 8.08-8.06 ppm (3H, dd, J=8 Hz, J=2 Hz), 7.66-7.64 ppm (3H, d, J=8.4 Hz), 5.87 ppm (1H, S), 5.84 ppm (1H, s), 13C NMR (400 MHz, DMSO-dg) 150.24, , 145.76, 126.10, 122.60, 119.93, 52.18, 51.48, MS (ESI-MS): m/z calcd for C20H21N306 [MH]+ 390.06, No mass response observed. 1b mp: 178-180 °C 1H NMR (400 MHz, CDC13)6 8.36-8.35 ppm (3H, m), 8.09-8.06 ppm (3H, m), 7.69-7.65 ppm (3H, m), 5.86 ppm (1H, s), 5.85 ppm (1H, s) 13C N1V1R 150.93, ,145.72,145.33,144.92,125.97,122.54, 119.93, 55.33, 51.98, 51.74. 9,10—dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-triamine, 2.

To a solution of 2,7,15-trinitro-9,10-dihydro—9,10-[1,2]benzenoanthracene (1a) (2.23 g, 5.73 mmol) in THF (100 mL) was added Raney Nickel (1.0 g) and the resulted reaction mixture was cooled to 0 °C. Hydrazine hydrate (4 mL) was added to the ing mixture at 0 oC. The reaction mixture was stirred at 60 0C for 1 h. The resulting reaction mixture was allowed to cool to room temperature and filtered through celite eluting with THF. The filtrate was concentrated under reduced pressure to afford crude 2 (1.5 g, ) as a brown solid which was used without further purification. 1H NMR (400 MHz, CDC13) 6 709-707 ppm (3H, d, J=7.6 Hz), 6.75-6.75 ppm (3H, d, J=2 Hz), 6.29-6.27 ppm (3H, dd, J=7.6 Hz, J=2 Hz), m (1H, S), 5.02 ppm (1H, s), 5 ppm ( 6H, broad 5). MS (ESI—MS): m/z calcd for N3 [MH]+ 300.14, found 300.4. ] 2,7,15-trii0d0-9,10-dihydr0-9,10-[1,2]benzen0anthracene, 3.

In 100 mL round bottom flask, 9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triamine (2) (0.9 g, 3.01 mmol) was dissolved in concentrated hydrochloric acid (7.5 mL) and water (15 mL) and the resulting solution was cooled to 0 0C. To this, a solution of sodium nitrite (0.72 g, 10.5 mmol) in water (7.5 mL) was added se over 10 min and the resulting reaction mixture was stirred for 20 min at 0 0C. After this, a solution of potassium iodide (3.74 g, 22.58 mmol) in water (10 mL) was added drop wise to the reaction mixture at 0 °C and further stirred for 5 min. The reaction mixture was then slowly warmed to room temperature and heated at 80 CC for 2 h. After cooling to room temperature, the reaction mixture was diluted with water (50 mL) and extracted with dichloromethane (3 x 25 mL). The organic layers were combined, washed with saturated sodium bisulfate (3 x 30 mL), dried using anhydrous Na2SO4 and concentrated under reduced pressure to get crude 3 as a brown semisolid. The crude mixture was purified by flash column chromatography on silica gel (5% EtOAc/ hexanes) to get pure product 3 (0.57 g, 30.0%) as yellow solile NMR (400 MHz, CDC13) 6 7.74-7.73 ppm (3H, d, J=l.6 Hz), 7.39-7.36ppm (3H, dd, J=7.6 Hz, J=l.6 Hz), 7.66-7.64 ppm (3H, d, J=7.6 Hz), 5.3lppm (1H, S), 5.26 (1H, s). 9,10—dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-tricarbonitrile, 4.

To a on of2,7,15-triiodo-9,lO-dihydro-9,l0-[1,2]benzenoanthracene (3) (0.55 g, 0.87 mmol) in DMF (5 mL) was added zinc cyanide (0.33 g, 2.79 mmol) and the resulting reaction mixture was degassed with nitrogen gas for 20 min. To this, tetrakis (0.10 g, 0.1 mmol) was added and the resulting on mixture was stirred at 140 °C for 16 h, After g to room temperature, the reaction mixture was d through celite, quenched with cold water (20 mL) and extracted with romethane (3 x 30 mL). The c layers were combined, washed with brine, dried using anhydrous Na2SO4 and concentrated under reduced pressure to get crude 4 as a brown semisolid. The crude mixture was purified by flash column chromatography on silica gel (25% EtOAc/hexanes) to get pure product 4 (0.2 g, 70.0%) as light yellow solid. 1H NMR (400 MHZ, CDCl3) 8 74 ppm (3H, d, J=l.2 Hz), 7.39-7.36 ppm (3H, dd, J=7.6 Hz, J=l.6 Hz), 7.66-7.64 ppm (3H, d, J=7.6 Hz), 5.31 ppm (1H, S), 5.26 (1H, s). 9,10—dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-tricarb0xylic acid, 5.

To a solution of ihydro-9,10-[1,2]benzenoanthracene-2,7,15-tricarbonitrile (4) (0.40 g, 1.22 mmol) in MeOH (5 mL) was added 15% aqueous NaOH solution (5 mL, 18.24 mmol) at room temperature and the resulting reaction mixture was d at 60 °C for 16 h. After cooling to room temperature, excess of MeOH was removed under reduced pressure and the resulting mixture was poured in ice-cold water (50 mL). The pH of this aqueous solution was adjusted to ~2 using 1 N HCl and the residues obtained were collected through filtration to get crude 5 (0.30 g, 65.3%) as a white solid which was used without further purification. 1H NMR (400 MHz, MeOD) 5 8.12 ppm (3H, d, J=1.2 Hz), 7.79—7.77 ppm (3H, dd, J=7.6 Hz, J=l.6 Hz), 7.58-7.56 ppm (3H, d, J=4 Hz), 5.832ppm (2H, S), MS (EST-MS): m/z calcd for C12H2606 [MH]' 385.07, found 385.1.

Tert—butyl (3-((3-amin0propyl)(methyl)amin0)propyl)carbamate, 221.

To a solution of Nl-(3-aminopropyl)-Nl-methylpropane-1,3-diamine (5 g, 38.48 mmol) in THF (10 mL) at 0 CC was added Boc ide (1.50 g, 6.89 mmol) se over a period of 20 min and the resulting reaction mixture was stirred at room temperature for 16 h, THF was removed under reduced pressure and the resulting mixture was poured in water (50 mL). The aqueous mixture was extracted with ethyl acetate (3 x 30 mL). The organic layers were ed, washed with water, dried using anhydrous Na2804 and concentrated under reduced pressure to get pure 2a (1.3 g, 15.4 %) as a colorless oil. 1H NMR (400 MHz, O) 6 6.80- 6.79 ppm (1H, d, J=4 Hz), 3.17 (3H, broad s) 2.94-2.89ppm (2H, dd, J=12.4, 6 Hz), 2.51 ppm (2H, broad s), 2.28-2.21ppm (4H, m), 2.08-2.07 (2H, d, J=4 Hz), 1.50—1.44 ppm (4H, m), 1.37 (9H, 5); MS (ESI—MS): m/z calcd for C12H26N202 [MH]+246.21, No mass response observed.

N2,N7,N15-tris(3-((3-tert-butylcarbonylaminopropyl)(methyl)amin0)pr0pyl)—9,10- dihydro-9,10-[l,2]benzenoanthracene-2,7,1S-tricarboxamide, 6.

To a on of tert-butyl (3—((3-aminopropyl)(methyl)amino)propy1)carbamate (2a) (0.71 g, 2.91 mmol) in DMF (3 mL) was added 9,10-dihydro-9,10-[1,2]benzenoanthracene- 2,7,15-tricarboxylic acid (0.35 g, 0.91 mmol), HATU (1.1 g, 2.91 mmol), DIPEA (1.0mL, 5.82 mmol) and the resulting reaction mixture was stirred at room temperature for 2 h. The reaction mixture was poured in water (50 mL) and extracted with dichloromethane (3 x 25 mL). The organic layers were combined, washed with brine, dried using anhydrous Na2$O4 and concentrated under reduced pressure to get crude 6 as brown oil. The crude mixture was purified by preparative HPLC using the ing method to afford pure t 6 (0.2 g, 20.7%) as light yellow solid. 1H NMR (400 MHz, ds-DMSO) 5 840-837 (3H, t, J=5.2 Hz), 7.93 (3H, s) 7.55- 7.49ppm (6H, dd, J=16, 7.6 Hz ), 6.78 ppm (3H, broad s), 5.87 ppm (2H, broad s), 3.23-3.21 ppm (6H, m), 2.93-2.90 (6H, m), 2.30-2.22 (12H, m), 1.61-1.58 (6H, m), 1.50-1.46 (6H, m), 1.31 (27H, s). MS (ESI-MS): m/z calcd for (:591‘189l\l909[l\/H‘I]+ 1068.68, found 1068.9.

Method of preparative HPLC: (A) 10mM NH4HC03 in water (B) MeCN:MeOH:IPA :10), using WATERS X-BRIDGE C18 250mm*19 mm, 5.0 uM with the flow rate of 15.0 mL/min and with the ing gradient: "E!- —m_1000_ N2,N7,N15-tris(3-((3-aminopropy1)(methy1)amin0)pr0py1)—9,10-dihydr0-9,10- [1,2]benzenoanthracene-2,7,15-tricarboxamide, ARK-7.

To a solution of N2,N7,N15-tris(3-((3-tert- butylcarbonylaminopropy1)(methy1)amino)propyl)-9, 10-dihydro-9, 10-[1,2]benzenoanthracene- -tricarboxamide (6) (0.2 g) in 1,4-dioxane (5 mL) was added 4 M HCl in dioxane (1 mL) at room temperature and the resulting reaction mixture was stirred for 2 hours. The mixture was concentrated under d pressure to get pure hydrochloride salt of ARK-7 (0.072 g, 50.3%) as a light yellow solid. 1H NMR (400 MHz, D20) 6 7.70 ppm (3H, s), 7.42-7.40 ppm (3H, d, J:7.6 Hz), 7.34-7.32 ppm (3H, d, J: 8 Hz), 5.73 ppm (1H, s), 5.71 (1H, s), 3.34-3.30 ppm (6H, t), 3.23-3.03 ppm (12H, m), 2.97-2.93 ppm (6H, t), 2.76 ppm (9H, s), 2.06-1.92 ppm (12H, m), MS (ESI—MS): m/zcalcd for C44r165N903 [MH]+768.52, found 768.7. HPLC retention time: 4.277 Example 7: Synthesis of ARK-8 00014) ARK-8 (Ark0000014) ARK—8 was synthesized following the method for ARK—7 above to provide intermediate 5. This was then coupled with ediate 2a below and converted to ARK-8 as described below.

Tert—butyl (7-aminoheptyl)carbamate, 221.

] To a solution of heptane-1,7—diamine (5 g, 38.46mmol) in THF (10 mL) at 0 °C was added Boc anhydride (1.68 g, 7.69 mmol) dropwise over a period of 20 min and the resulting reaction mixture was stirred at room temperature for 16 h. THF was removed under reduced pressure and the resulting e was poured into water (50 mL). The aqueous mixture was extracted with ethyl acetate (3 x 25mL). The organic layers were combined, washed with water, dried using anhydrous NazSO4 and concentrated under reduced pressure to get pure 2a (1 g, 11.3 %) as a colourless oil. 1H NMR (400 MHz, CDC13) 6 6.80-6.77 (1H, t, J=5.2 Hz), 2.91-2.85 (2H, dd, , 6.8 Hz) .44ppm (2H, m), 1.36 ppm (11H, s), 1.31ppm (4H, s), 1.23 (6H, s), MS (ESI—MS): m/z calcd for C12H26N202 [l\/1H]Jr 231.20, found 231.5.

N2,N7,N15-tris(7-tert—butylcarbonylaminoheptyl)—9,10-dihydr0-9,10- [1,2]benzenoanthracene—2,7,15-tricarb0xamide, 6.

To a solution of Tert-butyl (7-aminoheptyl)carbamate (2a) (0.51 g, 2.24 mmol) in DMF (3 mL) was added ihydro-9,10-[1,2]benzenoanthracene-2,7,15-tricarboxylic acid (0.27 g, 0.70 mmol), HATU (0.85, 2.24 mmol), DIPEA (0.77 mL, 4.47 mmol) and the resulting reaction mixture was stirred at room temperature for 2 h. The reaction mixture was poured into water (50 mL) and extracted with romethane (3 x 25mL). The organic layers were combined, washed with brine, dried using anhydrous Na2804 and concentrated under reduced pressure to get crude 6 as a brown semisolid. The crude mixture was purified by flash column chromatography on silica gel (0.5% MeOH/chloroform) to afford pure product 6 (0.65 g, 91.5%) as light yellow solid. 1H NMR (400 MHz, DMSO) 5 8.34-8.32 (3H, d, J=8.8 Hz), 7.93 (3H, s) 7.53 ppm (6H, s), 6.75 ppm (3H,broad s), 5.87 ppm (1H, s), 5.76 ppm (1H, s), 3.20-3.14 (6H, d, J= 24 Hz), 2.29 (6H, s), 1.3? (27H, 5), 1.25—1.24 (30H, m),MS (ESI—MS): m/z calcd for C59H86N609 [MH]+1023.65, found 1045.5(M+23).

N2,N7,N15-tris(7-aminoheptyl)-9,lO-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15- tricarboxamide, ARK-8.

To a solution of N2,N7,N15-tris(7-tert-butylcarbonylaminoheptyl)-9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-tricarboxamide (6) (0.7 g) in oxane (5 mL) was added 4 M HCl in dioxane (3 mL) at room temperature and the ing reaction mixture was stirred for 2 hours. The mixture was concentrated under reduced pressure to get crude hydrochloride salt of ARK-8 as a yellow solid. The crude mixture was purified by ative HPLC using ing method to afford pure ARK-8_HCl salt (0.2 g, 40.5%)as a white solid. 1H NMR (400 MHz, D20) 6 7.62 ppm (3H, broad s), 7.13ppm (3H,broad s), 7.01 ppm (3H, broad s), 5.53ppm (1H, S), 5.2 (1H, s), 2.92ppm (6H, broad s), m (6H, broad s), 1.22ppm (6H, broad s), m (6H, broad s), 0.76ppm (6H, broad s), MS (ESI—MS): m/zcalcd for C44H62N603 [MH]+724.0, found 723.6. HPLC retention time: 4.947 min.

Method of preparative HPLC: (A) 0.05% HCl in water (B) MeCN:MeOH:IPA (65:25:10) (HPLC GR), using X SELECT FLUORO PHENYL COLUlVlN 250*19 mm, 5.0 nM with the flow rate of 22.0 mL/rnin and with the following gradient: ——m_ ——m_ Example 8: Synthesis of ARK-9 (Ark000015), ARK-10 (Ark000016), ARK-11 (Ark000017), and ARK-12 (Ark000018) ARK-9 m} _‘ g ‘ H: ‘~ N: 3‘ "6‘. / _ ,w“ ”\,xWW~ v N \r I M "3‘ ‘3 s :3 {3 5‘ g: mg Egg/IxM .

“I figs“? 3‘ N3?“ .. .

**‘ W‘ r 1» .‘ ”r N‘vwf ‘\?\at ("a “Nix“ “SJ““FNN’: 5> :3 s : Kama?“ \§ $5 ’ 2" K NR m,' «544" "in ‘3 (3 IN as (\v \ NH}? ARK-10 ARK-12 ARK-9 was prepared ously to ARK-7 above h compound 2. Compound 2 was then coupled with Boc—L-Lys(Boc)-OH as described below and then deprotected to provide ARK-9 (ARK-10 (ArkOOOOl6) was provided analogously by substituting Boc-D- Lys(Boc)—OH). In a similar way, ARK-11 (Ark000017) and ARK-12 (Ark000018) were provided by coupling with protected L or D-His amino acids.

Hexa-tert-butyl ((5S,5'S,5"S)—((9,10-dihydro-9,10-[1,2]benzenoanthracene—2,7,15 triyl)tris(azanediyl))tris(6-0xohexane—6,1,5-triyl))hexacarbamate, 3.

] To a solution of 9,10-dihydro-9,10—[l,2]benzenoanthracene—2,7,15-triamine (2) (0.1 g, 0.3344 mmol) in DMF (1 mL) were added Boc-L-Lys(Boc)-OH (0.37g, 1.07 mmol), HATU (0.406, 1.07 mmol) and DIPEA (0.258g, 2.006 mmol) at room temperature. The reaction mixture was stirred at room temperature for 60 min. The resulting on mixture was poured into ice- cold water. The obtained solid precipitate was collected by ion and dried under reduced pressure to afford crude 3 (0.38 g, 88.57%) as a white solid which was used without further ation. MS (ESI—MS): m/z calcd for C68H101N9015 [MH]+ 4, found 1185.0 (M-100). (2S,2'S,2"S)—N,N',N"-(9,10—dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(2,6-diamin0hexanamide), ARK-9.

The crude product hexa-tert-butyl ((5S,5'S,5"S)—((9,10—dihydro—9,10- [1,2]benzenoanthracene-2,7,15 triyl)tris(azanediyl))tris(6-oxohexane-6,1,5-triyl))hexacarbamate (3) (0.3 g, 0.234 mmol) obtained from previous step was suspended in 4 M HCl in dioxane and stirred at room temperature for 2 h. The resulting on mixture was concentrated under reduced pressure to afford crude ARK-9 hydrochloride salt as a white solid. The crude product was purified by preparative HPLC using the method shown below to afford pure salt of ARK-9 (0.19 g, 46.91%) as a White solid. The pure salt of ARK—9 was dissolved in DM water (4 mL) and passed through Amberlite® [RA-400 -OH form ion ge resin. The free base was eluted using DM water and the fractions collected were lyophilized to obtain free base (0.15 g) as a white solid. The free base (0.05 g) was treated with aqueous 1 N HCl (3 mL) and lyophilized the material to generate hydrochloride salt of ARK-9 (0.05 g, 83.33%) as a white solid. 1H NMR (400 MHz, D20) 5 7.56-7.55 ppm (3H, d, J=1.6 Hz), .39 ppm (3H, d, J=8.0 Hz), 7.01-6.99 ppm (H, dd, J=8 Hz, J=1.6 Hz), 5.62 ppm (1H, S), 5.59 ppm (1H, s), 4.01—3.98 ppm (3H, t), 2.88-2.84 ppm (6H, t), 1.90-1.86 ppm (6H, m), 1.61-1.57 ppm (6H, 3), 1.40-1.36 ppm (6H, m), MS (ESI—MS): m/z calcd for C22H27N502 [MH]+684.4, found 684.7. HPLC retention time: 5.092 Method of preparative HPLC: (A) 0.1% TFA in water and (B) MeCN:MeOH:IPA (65:25:10) (HPLC grade), using X SELECT FLUORO PHENYL COLUMN 250 X 19 mm, 5.0 um with the flow rate of 12.0 mL/min and with the following gradient: ——E_ "El. —m_m- —m_m- Synthesis of ARK-10 (Ark000016): ] Hexa-tert-butyl ((5R,5'R,5"R)—((9,10-dihydro—9,10-[1,2]benzenoanthracene— 2,7,15-triyl)tris(azanediyl))tris(6-0xohexane—6,1,5-triyl))hexacarbamate, 3.

To a solution of 9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15-triamine (2) (0.3 g, 1.00 mmol) in DMF (5 mL) was added Boc—D—Lys(Boc)—OH (1.1 g, 3.210 mmol), HATU (1.2 g, 3.210 mmol) and DIPEA (0.774 g, 6.00 mmol) at room temperature. The reaction mixture was stirred at room temperature for 60 min. The resulting reaction mixture was poured into ice-cold water. The obtained solid precipitates were collected by filtration and dried under reduced pressure to afford crude 3. The crude mixture was purified by preparative HPLC using following method to afford pure 3 (0.25 g, 19.53%) as a white solid. MS (ESI—MS): m/z calcd for C68H101N9015 [MH]+ 1283.74, found 1185.0 (M-lOO; tection of one Boc group).

] Method of preparative HPLC: (A) 10 mM um bicarbonate in water (HPLC grade) and (B) ACN: MeOH: IPA (65:25:10) (HPLC GR), using X BRIDGE 30mm*5um with a flow rate of 28.0 mL/min and with the following gradient: __E_ "El. (2R,2'R,2"R)—N,N',N"-(9,10-dihydro-9,10-[1,2]benzenoanthracene—2,7,15- tris(2,6-diamin0hexanamide), ARK-10.

] The crude product hexa-tert-butyl ((5R,5'R,5"R)—((9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(6—oxohexane-6, 1,5-triyl))hexacarbamate (3) (0.25g, 0.1947mmol) obtained from previous step was suspended in 4 M HCl in dioxane and stirred at room temperature for 2 hours. The resulting on mixture was concentrated under reduced re to afford crude ARK—10 hydrochloride salt as a white solid. The crude product was purified by preparative HPLC using the method shown below to afford pure salt of ARK-10 (0.14 g, 26.41%) as a white solid. The pure salt of ARK-10 was dissolved in DM water (4 mL) and passed through Amberlite® IRA-400 -OH form ion exchange resin. The free base was eluted using DM water and the fractions collected were lized to obtain free base (0.07g) as a white solid. The free base (0.07 g) was treated with aqueous 1 N HCl (3 mL) and lyophilized to generate hydrochloride salt of ARK-10 (0.085g, 92.39%) as a light brown solid. 1H NMR (400 MHz, D20) 6 754—753 ppm (3H, d, J=2 Hz), 7.38-736 ppm (3H, d, J=8.0 Hz), 6.99-6.97 ppm (3H, dd, J=8 Hz, J=2 Hz), 5.60 ppm (1H, S), 5.56 (1H, s), 3.99-3.96 ppm (3H, t), 2.86-2.82 ppm (6H, t), 1.89-1.82 ppm (6H, m), 1.61-1.53 ppm (6H, m), 1.40-1.34 ppm (6H, m). MS S): m/z calcd for C22H27N502 [MH]+ 684.4, found 684.6. HPLC retention time: 6.393 min.

Method of preparative HPLC: (A) 0.1% TFA in water (HPLC grade) and (B) MeCN: MeOH: [PA (65:25: 10) (HPLC GR), using X SELECT PFP C18,250*19 mm, Sum with the flow rate of 15.0mL/min and with the following gradient: __I!_ ——m_ __E_ __E_ ——m_ Synthesis of ARK-11 and ARK-12.

] Tri—tert—butyl ((2S,2'S,2"S)—((9,10—dihydr0-9,10-[1,2]benzenoanthracene—2,7,15- triyl) tris (azanediyl) )tris (3-(1H-imidazolyl)0xopropane—1,2-diyl))tricarbamate.

To a stirred solution of 9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15—triamine (2) (0.3 g, 1.0 mmol) in DMF (6 mL) was added Boc—L-Histidine (0.82g, 3.2 mmol), HATU (1.22g, 3.2 mmol), and DIPEA (0.8g, 62 mmol) at room temperature. The resulting on mixture was d overnight at room ature. The reaction mixture was poured in ice-cold water and residues obtained were collected through filtration, dried under reduced pressure to get crude 3 (0.65g, 65%) as light brown solid which was directly used in the next step without ation. MS (ESI—MS): m/z calcd for (:531‘1621\I1209[lVH‘I]+ 1011.15, found 1011.9. (2S,2'S,2"S)—N,N',N"-(9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(2-amin0(1H-imidaz01yl)pr0panamide) hloride, _HCl Salt.

To a stirred solution of tri—tert-butyl ((2S,2'S,2"S)—((9,lO—dihydro-9,10- [1,2]benzenoanthracene-2,7,15-triyl) tris (azanediyl))tris (3-(1H-imidazolyl)—l-oxopropane- 1,2-diyl))tricarbamate (3) (0.65g, 0.643 mmol) in dichloromethane (8 mL) was added 4N HCl in Dioxane (5 mL) at 0 °C. The resulting reaction mixture was stirred at room temperature for 3h.

The reaction mixture was concentrated under reduced pressure to get crude ARK—11. The crude mixture was purified by preparative HPLC using following method to afford pure product ARK- 11_TFA salt , 64.42%) as colorless viscous oil. The ARK—11_TFA salt was dissolved in methanol (10 mL). To this, r bound tetraalkylammonium carbonate and the resulting mixture was stirred at room temperature for 30 min. The mixture was filtered through celite and the resulting filtrate was concentrated under reduced pressure to get ARK-11_Free base. The free base was dissolved in 0.01 N HCl (10 mL) and resulting solution was lyophilized to obtain pure ARK-11_HCl salt (0.16g, 61.06%) as white solid. 1H NMR (400 MHZ, D20) 5 8.56 ppm (3H, s), 7.51 ppm (3H, s), .31 ppm (6H, m), 6.93-6.91 ppm (3H, s), 561-558 ppm (2H, s), 4.26 ppm (3H, s), 3.36-3.34 ppm (6H, m), 3.21 ppm (2H, s), MS S): m/z calcd for C38H33N1203 [MI-I]+ 7108, found 7122. HPLC retention time: 5770 min.

Method for preparative HPLC: ] (A) 0.1% TFA in water (HPLC grade) and (B) 10% IPA in acetonitrile (HPLC grade), using WATERS X-BRIDGE C18, 250mm*30mm*5um with the flow rate of 35.0mL/min and with the following gradient: _Efl__10.0 ] Tri-tert—butyl ((2R,2'R,2"R)—((9,10-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15- triyl) tris (azanediyl)) tris (3-(1H-imidazolyl)—1-0xopropane—1,2-diyl))tricarbamate.

To a stirred solution of 9,lO-dihydro-9,10—[1,2]benzenoanthracene—2,7,15-triamine (2) (0.25 g, 0.84 mmol) in DMF (6 mL) was added Boc-D-Histidine (0.68g, 2.67 mmol), HATU (1.01 g, 2.67 mmol), DTPEA (0.69g, 5.35 mmol) at room ature. The resulting reaction mixture was stirred over night at room temperature. The reaction mixture was poured in ice-cold water and residues obtained were collected through filtration, dried under reduced pressure to get crude 3 (0.75g, 88.9%) as white solid which was ly used in the next step without ation. MS (ESI-MS): m/z calcd for C53H62N1209[1V1H]+ 1011.48, found 1011.6. (2R,2'R,2"R)-N,N',N"-(9,10-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15- triyl)tris(2-amino(1H-imidazoly1)propanamide) hydrochloride, ARK-12_HC1 Salt.

To a stirred solution of tri-tert-butyl ((28,2‘S,2"S)-((9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl) tris (azanediy1))tris (3-(1H—imidazol-4—y1)—1-oxopropane- 1,2-diyl))tricarbamate (3) (0.75 g, 0.742 mmol) in dichloromethane (8 mL) was added 4N HCl in Dioxane (5 mL) at 0 °C. The resulting reaction mixture was stirred at room temperature for 3 h.

The reaction e was concentrated under d pressure to get crude . The crude mixture was purified by preparative HPLC using following method to afford pure product ARK- 12_TFA salt (0.70 g, 72.53%) as white solid. The pure salt of ARK-12 was dissolved in DM water (4 mL) and passed h Amberlite® IRA-400 -OH form ion exchange resin. The free base was eluted using DM water and the fractions collected were lyophilized to get free base (0.06 g) as a white solid. The free base (0.06 g) was dissolved in aqueous 1 N HCl solution (3 mL) and lyophilized the material to generate hydrochloride salt of ARK-12 (0.07 g, 10.16%) as a white solid. 1H NMR (400 MHZ, D20) 5 8.54 ppm (3H, s), 7.50 ppm (3H, s), 7.37-7.35 ppm (3H, d, J=8 Hz), 7.28 ppm (3H, S), 6.90-6.88 ppm (3H, dd, J=7.6 Hz), 5.59 ppm (1H, s), 5.56 ppm (1H, s), 4.25—4.22 ppm (3H, t, J=7.2 Hz ), 3.33—3.31 ppm (6H, d, J:7.2 Hz). MS (ESI—MS): m/zcalcd for C38H38N1203 [MH]+711.32, found 684.6. HPLC retention time: 6.347 min.

Method for preparative HPLC: 0.1% TFA in water (HPLC grade) and (B) 10% IPA in acetonitrile (HPLC , using WATERS X-BRIDGE C18, 250mm*30mm*5ttm with the flow rate of 35.0mL/min and with the following gradient: Example 9: Synthesis of ARK-77 and ARK-77A (Ark000033 and Ark000034) Scheme: Synthesis of Int-13 @1102 $00 BOC NosyhN NosykN N NH HATU DMF \/\ /\/ 1 l l / ‘ ° \ _. ”Wowfl ”_. ”AWN “3 ARK-20 0 Step _10 Step .11 TFA salt 0 MW:232.17 <10) (11) MW: 555.21 MW: 455.16 BocHNMg 0 BocHNM WNf" (12) N (\3 MW: 1531.81 ARK-18 .

MW: 1094.66 ”°5Y' enol, Step -13 K2003,ACN 60°C meo\ (13) Tert—butyl(2-(2-((ZS,4S)azid0-N-methyl((2- henyl)sulfonyl)pyrrolidinecarboxamido) ethoxy)ethyl)(methyl)carbamate, 10.

To a solution of ARK-20 (2.0 g, 8.614 mmol) in N,N—dimethylformamide (40 mL) were sequentially added (28,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidinecarboxylic acid (2.34 g, 6.89 mmol), HATU (2.62 g, 6.89 mmol) and N,N—diisopropylethylamine (3.33 g, .84 mmol) at room temperature. The ing reaction mixture was stirred for l h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl acetate (3 >< 100 mL). The organic layers were combined, washed with brine and trated under reduced pressure to get crude 10 (3.5 g, 91.6 %) as brown semisolid. The crude mixture was used in next step without further purification. MS (ESI—MS): m/z calcd for C22H33N7OgS [MH]+ , found 573.43(M+18, water adduct). (2S,4S)—4-azido-N-methyl-N-(Z-(Z-(methylamino)ethoxy)ethyl)—1-((2- nitrophenyl)sulf0nyl) pyrrolidine—2-carb0xamide_TFA Salt, 11.

To a solution of tert—butyl (2-(2-((2S,4S)—4-azido—N—methyl((2— nitrophenyl)sulfony1)pyrrolidine—2-carboxamido) ethoxy)ethy1)(methy1)carbamate (10) (3.5 g, 6.30 mmol) in dichloro methane (30 mL) was added trifluoro acetic acid (3.15 mL, 31.52 mmol) at room temperature. The resulted reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered through celite bed and filtrate thus collected was concentrated under d re to get crude 11 (4.3 g, quantitative yield) as a brown oil which was used in next step without further purification. MS S): m/z calcd for C17H25N706STFA [MH]+ 456.16, found 45632, Tri—tert—butyl (((9-(3-((2-(2-((2S,4S)—4-azido—N-methyl((2- nitrophenyl)sulf0nyl)pyrrolidine—2-carboxamid0)eth0xy)ethyl)(methyl)amin0)—3- 0x0propyl)—9,10-dihydr0-9,10[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8- 0x00ctane—8,1-diyl))tricarbamate, 12.

To a solution of (2S,4S)—4-azido-N-methyl-N-(2-(2-(methylamino)ethoxy)ethy1)—1- ((2-nitrophenyl)sulfonyl) pyrrolidinecarboxamide_TFA Salt (11) (1.25 g, 2.19 mmol) in N,N— dimethylformamide (30 mL) were sequentially added 3-(2,7,15-tris(8-((tertbutoxycarbonyl )amino)octanamido)—9,10—[1,2]benzenoanthracen-9(1OH)—y1)propanoic acid (ARK-18) (2.0 g, 1.83 mmol), HATU (0.833 g, 2.192 mmol) and N,N—diisopropylethylamine (0.942 g, 7.31 mmol) at room temperature. The resulting reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl acetate (3 X 100 mL). The c layers were ed, washed with brine and trated under reduced pressure to get crude 12. The crude mixture was purified by column chromatography on silica gel (3.2% methanol/chloroform) to yield 12 (2.3 g, 82.17 %) as a dark yellow solid. MS S): m/z calcd for C79H113N13016S [MH]+ 1532.81, found 1433.19 (M- 100, one Boc group fell off). rt—butyl (((9-(3-((2-(2-((2S,4S)—4—azid0-N-methylpyrrolidine—Z- carboxamido)eth0xy)ethyl) (methyl)amino)—3-ox0pr0pyl)—9,10-dihydro- 9,10[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl)) tris(8-0x00ctane—8,1- diyl))tricarbamate, 13.

To a solution of tri-tert-butyl (((9-(3-((2-(2—((2S,4S)—4-azido—N—methyl-l-((2- nitrophenyl)sulfonyl) pyrrolidine—2-carboxamido)ethoxy)ethyl)(methyl)amino)oxopropyl)- 9,10-dihydro-9,10[l,2] benzenoanthracene-2,7, 1 5-triyl)tris(azanediyl))tris(8-oxooctane-8, 1 - diyl))tricarbamate (12) (2.2 g, 1.44 mmol) in acetonitrile (30 mL) were sequentially added potassium carbonate (0.99 g, 7.18 mmol) and thiophenol (0.44 mL, 4.31 mmol) at room temperature. The resulted reaction e was stirred at 80 0C for 2 h. The reaction mixture was d through celite bed and the collected filtrate was concentrated under reduced pressure to get crude 13 as yellow oil. The crude mixture was subjected to reverse phase chromatography to yield 13 (1.1 g, 56.88%) as a light yellow solid. The yellow solid was further subjected to preparative HPLC d mentioned below) purification ed by lyophilization to yield pure 13 (0.41g, 52.17%) as a white amorphous powder. MS (ESI—MS): m/z calcd for C73H110N12012 [MH]+ 1347.84, found 8.

Method for preparative HPLC: (A) 10 mM NH4HC03 IN WATER (HPLC GRADE) and (B) 100% Acetonitrile (HPLC GRADE) in water (HPLC GRADE), using X-BRIDGE C18, 250mm*30mm*5um with the ing flow rate and gradient: rate —__m_ ———m_ Scheme: Synthesis of ARK-77 0 BOCHNM w HO i I 6 o T BOCHNW/jerHg QNEx/MNHBOC Warhead-1B N\ HATU DIPEA DMF \NfOH —» TH) Step -14 i1 0 (13) 0‘, MW: 1346.86 0 (14) 0 MW: 1549.86 HCI in dioxane Step -15 ARK-77_HCI salt MW: 1249.70 Tri—tert—butyl (((9-(3-((2-(2-((2S,4S)—4-azido-N-methyl(1-methyl-2,4-dioxo-1,4- dihydro-ZH-benzo [d] [1,3]0xazine—7-carbonyl)pyrrolidine—2- amid0)eth0xy)ethyl)(methyl)amino)—3-oxopropyl)—9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,l5-triyl)tris(azanediyl))tris(8-0x00ctane—8,1-diyl))tricarbamate, To a solution of tri-tert-butyl (((9-(3—((2-(2-((ZS,4S)—4—azido—N—methylpyrrolidine-Z- amido)ethoxy)ethyl) (methyl)amino)-3 -oxopropyl)—9,10-dihydro- 9,10[1,2]benzenoanthracene-2,7,15-t1iyl)tris(azanediyl)) tris(8-oxooctane—8,1-diyl))tricarbamate (13) (0.2 g, 0.148 mmol) in N,N—dimethylformamide (8 mL) were sequentially added l-methyl- 2,4-dioxo—2,4-dihydro-1H—3,1-benzoxazine—7-carboxylic acid ad_type_1B) (0.039 g, 0.178 mmol) and HATU (0.068 g, 0.178 mmol) at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N—diisopropylethylamine (0.038 g, 0.297 mmol) was added dropwise and the resulted reaction mixture was further stirred for 30 minutes at room temperature. The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice- cold water (3 X 30mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 25 °C to get crude 14. The crude mixture was purified by preparative HPLC d mentioned below) followed by lization to yield 14 (0.12g, 52.17%) as a white amorphous powder. MS (ESI—MS): m/z calcd C83H115N13016 [MH]+ 1550.86, found 2 (M-100, one Boc group fell off).

Method for ative HPLC: (A) 100% Acetonitrile (HPLC GRADE) and (B) 100% Tetrahydrofuran (HPLC GRADE), using SUNFIRE SILICA, 150mm*19mm*5um with the flow rate of 19.0mL/min and with the following gradient: N,N',N"-(9-(3-((2-(2—((2S,4S)azido-N-methyl(1-methyl-2,4-di0xo-1,4- dihydro-2H-benz0 [d] [1,3]oxazinecarb0nyl)pyrrolidinc carboxamido)eth0xy)ethyl)(methyl)amino)—3-0xopropyl)—9,10-dihydr0-9,10- [1,2]benzenoanthracene-2,7,15—triyl)tris(8-amin00ctanamide), _HCl salt.

To a solution of tri—tert-butyl (((9-(3—((2-(2-((2S,4S)—4-azido—N—methyl-l-(1-methyl- 2,4-dioxo- l ,4-dihydro-2H-benzo[d] [ l ,3]oxazine—7-carbonyl)pyrrolidine carboxamido)ethoxy)ethyl)(methyl)amino)—3 -oxopropyl)—9, 10-dihydro-9, 10- [1,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8-oxooctane-8,1-diyl))tricarbamate (14) (0.079 g, 0.051 mmol) in 1,4-dioxane (3.0 mL) was added 4 M HCl in dioxane solution (1.5 mL) at room ature and the ing reaction mixture was stirred for 30 minutes under nitrogen atmosphere. During this, solid residue started to precipitate out. The suspension was further stirred for 30 minutes and finally allowed to stand at room temperature. The solid residues d to t on bottom of the flask. The solvent was decanted and the es left were triturated with acetonitrile (3 X 3 mL). Finally the solid was dried under reduced pressure at 25 °C to get pure ARK-77_HCl_Salt (0.054g, 69.28%) as a white amorphous powder. 1H NMR (400 MHz, DMSO-d6) 8 9.91 ppm (3H, broad), 8.09-8.03 ppm (1H, m), 7.90 ppm (8H, broad), 7.67 ppm (3H, broad), 7.37-7.33 ppm (2H, m), 7.29-7.27 ppm (3H, m), 7.23 ppm (3H, m), 5.38 ppm (1H, s), 5.01 ppm (1H, m), 4.86-4.79 ppm (1H, m), 4.31-4.23 ppm (1H, m), 4.09 ppm (1H, m), 3.79-3.64 ppm (4H, m), 3.48 ppm (14H, m), 3.44-3.40 ppm (4H, m), 3.18 ppm (1H, s), 3.08- 3.01 ppm (6H, m), 2.77-2.66 ppm (7H, m), 2.25 ppm (6H, broad s), 1.53 ppm (12H, broad s), 1.27 ppm (18H, broad 3). MS (ESI—MS): m/z calcd for C68H91N13010 [MH]+ 0, found 125 1 .48.

Scheme: Synthesis of A BocHNM/W O O NHO HO N’ko WNHg/SQ0 NH BocHNW BOCHN NHBoc H B NHLK/MNHBOC Warhead_1A °—— HATU, DIPEA, DMF \NfoH \(H Step -14 o “95H N: ” ° (13) o MW: 1346.86 0 (14) MW: 1535.84 HCI in dioxane Step -15 HzNWNHv HzNWNHuNfliA/WNHz MN”H H N\ o? \\/ ARK-77A_HCI salt MW: 1235.69 Tri-tert—butyl (((9-(3-((2-(2-((2S,4S)—4-azido(2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]0xazine—7—carb0nyl)—N-methylpyrrolidine—Z- carboxamido)ethoxy)ethyl)(methyl)amino)—3-oxopropyl)—9,1 0-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-0x00ctane—8,1-diyl))tricarbamate, To a solution of tri—tert-butyl (((9-(3-((2-(2—((2S,4S)azido—N—methylpyrrolidine-2— carboxamido)ethoxy)ethyl) (methyl)amino)-3 -oxopropyl)—9,10-dihydro- 9,10[1,2]benzenoanthracene-2,7,15-triy1)tris(azanediyl)) -oxooctane-8,1-diyl))tricarbamate (13) (0.156 g, 0.116 mmol) in N,N—dimethylformamide (6 mL) were sequentially added 2,4- dioxo—l,4-dihydro-2H—benzo[d][1,3]oxazinecarboxylic acid (Warhead_type_1A) (0.029 g, 0.139 mmol) and HATU (0.053 g, 0.139 mmol) at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N—diisopropylethylamine (0.03 g, 0.232 mmol) was added drop wise and the resulted reaction mixture was further stirred for 30 minutes at room temperature.

The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ld water (3 X 30mL). The organic layers were combined, washed with brine and concentrated under reduced re at 25 0C to get crude 14. The crude mixture was d by preparative HPLC using following method to yield pure 14 (0.093 g, 52.17 %) as a white ous powder. The prep- fraction was concentrated by reduced pressure at 25 °C under nitrogen atmosphere. MS (ESI— MS): m/z calcd C82H113N13016[1V1H]+ 4, found 1 (M—100, one Boc group fell off).

Method for preparative HPLC: (A) 100% Acetonitrile (HPLC GRADE) and (B) 100% Tetrahydrofuran (HPLC GRADE), using SUNFIRE SILICA, 150mm*19mm*5um with the following flow rate and following gradient: rate ———m- ———m_ ———m_ ———m_ ___m_ N,N',N"-(9-(3-((2-(2—((2S,4S)—4-azido(2,4—di0x0-1,4-dihydro-2H- benzo [d] [1,3]0xazine—7—carbonyl)—N-methylpyrrolidine—Z- carboxamid0)eth0xy)ethyl)(methyl)amino)—3-0xopropyl)—9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(8-amin00ctanamide), ARK-77A_HCI salt.

To a solution of tri-tert—butyl (((9-(3-((2-(2-((2$,4S)—4—azido-1—(2,4-dioxo-1,4- dihydro—2H-benzo[d][1,3]oxazinecarbonyl)—N—methylpyrrolidine carboxamido)ethoxy)ethyl)(methyl)amino)—3 -oxopropyl)—9,10-dihydro-9,10- [l,2]benzenoanthracene—2,7, l 5-triyl)tris(azanediyl))tris(8-oxooctane-8, l -diyl))tricarbamate (14) (0.06 g, 0.039 mmol) in 1,4-Dioxane (Dry) (3 ml) was added 4 M HCl in dioxane (1.2 mL) at room temperature and the resulting reaction e was stirred for 30 minutes under en atmosphere. The solid al was stable at the bottom of the flask and the solvent was decanted under inert atmosphere, then the solid material was triturating with acetonitrile (HPLC Grade) (3 X 3 mL). The remaining solid was concentrated by reduced pressure at 25 °C under en atmosphere to afford pure ARK-77A_HCl_Salt (0.054g, 69.28%) as a white amorphous powder. 1H NMR (400 MHz, DMso—dé) 5 12.04—11.95 ppm (1H, d), 9.91 ppm (3H, broad), 7.98-7.96 ppm (1H, m), 7.89 ppm (7H, broad), 7.71-7.67 ppm (3H, broad), 7.29—7.27 ppm (4H, d), 7.23 ppm (3H, broad), 5.38 ppm (1H, s), 503-501 ppm (1H, m), 4.86-4.79 ppm (1H, m), 4.30-4.23 ppm (1H, m), 4.07 ppm (1H, m), 3.76 ppm (1H, m), 3.35-3.44 ppm (2H, m), 3.17 ppm (1H, s), 3.08-3.04 ppm (5H, m), 2.99-2.84 ppm (1H, m), 2.79-2.68 ppm (7H, m), 2.25-2.23 ppm (6H, t), 1.53 ppm (12H, broad), 1.27 ppm (18H, broad). MS (ESI-MS): m/z calcd for C67H89N13010 [MH]+ 9, found 1238.46.

Example 10: sis of ARK-78 and ARK-78A (Ark000035 and Ark000037) : Synthesis of Int-13 o:é:o 0 $06 Nosyh N 0 ~ N / \/\O/\/ \/\NH \ Nosy|\ MF N N o N TFA MDC ‘ DlPEA W,” \/\O/\/ 3 —>‘ \NH\/o\/\o/\/N N3 ARK-21 309 0 519.340 Step -11 MW:276.37 (10) (11) MW: 599.18 MW: 499,18 Int-11 HATU, DMF / 6 DIPEA O BocHN/VVW BocHNWVYNHa Q WNHBOC —> O 0 NH step -12 ARK-18 WM MW: 109456 Ng’CCosyl0 (12) MW: 1575.84 J Thiophenol, K2003” ACN Step 13 60°C NfCfi: (13) MW: 1390.85 Tert—butyl (2-(2—(2-((ZS,4S)azido-N—methyl—1-((2- nitrophenyl)sulfonyl)pyrrolidine-Z-carboxamid0)eth0xy)eth0xy)ethyl)(methyl)carbamate, To a solution of ARK-21 (2.4 g, 8.68 mmol) in methylformamide (30 mL) were sequentially added (ZS,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidinecarboxylic acid (2.96 g, 8.68 mmol), HATU (3.96 g, 10.42 mmol) and N,N—diisopropylethylamine (3.36 g, 26.05 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl acetate (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under d pressure to get crude 10 (4.0 g, 76.9 %) as yellow Viscous liquid. The crude e was used in next step without further purification. MS S): m/z calcd for C24H37N7O9 S [MH]+ 600.18, found 617.5 (M+18). (2S,4S)—4-azido-N-methyl-N-(2-(2-(2-(methylamino)eth0xy)eth0xy)ethyl)—1-((2 nitrophenyl)sulfonyl)pyrrolidine-Z-carboxamide_TFA Salt, 11.

To a solution of tri—tert-butyl ((2R,2'R,2"R)—((9,lO-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(3—(1H-imidazol-4—yl)—1-oxopropane-1,2- diyl))tricarbamate (10) (4.0 g, 6.67 mmol) in dichloro methane (20 mL) was added trifluoro acetic acid (2.58 mL, 33.38 mmol) at room temperature. The resulted reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered through celite bed and filtrate thus collected was concentrated under reduced pressure to get crude 11 (7.5 g, Quantitative yield) as a brown oil which was used in next step without further purification. MS (ESI—MS): m/z calcd for C19H29N7O7 S [MH]+ 500.18, found 50031.

Tri—tert—butyl (((9-(1-((2S,4S)azid0((2-nitrophenyl)sulf0nyl)pyrr0lidin yl)—2,1 l-dimethyl-l,12-di0x0-5,8-dioxa-2,1 l-diazatetradecan-l4-yl)—9,10-dihydr0-9,10— [1,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, To a on of (2S,4S)azido-N-methyl-N—(2-(2-(2- (methylamino)ethoxy)ethoxy)ethyl)((2—nitrophenyl)sulfonyl)pyrrolidine—2-carboxamide_TFA Salt (11) (2.69 g, 4.38 mmol) in methylformamide (40 mL) were sequentially added 3- (2,7,15-tris(8-((tert-butoxycarbonyl)amino)octanamido)—9,10-[1,2]benzenoanthracen-9(10H)- yl)propanoic acid 8) (4.0 g, 3.65 mmol), HATU (1.67 g, 4.38 mmol) and N,N— diisopropylethylamine (1.41 g, 10.96 mmol) at room temperature. The ed reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice—cold water and extracted with ethyl acetate (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under d pressure to get crude 12. The crude mixture was purified by column tography on silica gel (4.3% methanol/chloroform) to yield 12 (4.7 g, 81.6 %) as a dark yellow solid. MS (ESI—MS): m/z calcd for C81H117N13017S [MH]+ 1576.84, found 1578.4. rt—butyl (((9-(1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,11-dimethyl-1,12-di0xo- ,8-dioxa-2,1l-diazatetradecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15- triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, 13.

To a solution of tri-tert-butyl (((9-(1—((ZS,4S)azido-l-((2- nitrophenyl)su1fonyl)pyrrolidinyl)-2, 1 1-dimethyl-1,12-dioxo-5,8-dioxa—2,1 1-diazatetradecan- -9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15—triyl)tris(azanediyl))tris(8-oxooctane- 8,1-diyl))tricarbamate (12) (4.7 g, 2.98 mmol) in acetonitrile (50 mL) were sequentially added potassium carbonate (2.06 g, 14.91 mmol) and thiophenol (0.92 mL, 8.95 mmol) at room temperature. The resulted reaction mixture was stirred at 80 0C for 2 h. The reaction e was filtered h celite bed and the collected filtrate was concentrated under d pressure to get crude 13 as yellow oil. The crude mixture was subjected to reverse phase chromatography to yield 13 (1.9 g, 45.8%) as a light yellow solid. The yellow solid was r subjected to preparative HPLC (method mentioned below) purification followed by lyophilization to yield pure 13 (0.34 g, 8.2 %) as a white amorphous powder. MS (ESI-MS): m/z calcd for C53H62N1209 [MH]+ 1391.86, found 1392.3.

Method for preparative HPLC: (A) 10mM NH4HC03 in water (HPLC grade) and (B) 100% acetonitrile (HPLC grade) in water (HPLC grade), using X-BRIDGE C18, 250mm*30mm*5um with the flow rate of .0 mL/min and with the following gradient: ——m_ Scheme: Synthesis of ARK-78 O BOCHN 0‘ G HomeO NH/6 BOCHNW Qo NHBOC 0 NH NHBoc O l O: Warhead_1 B ofo HATU, DIPEA, DMF H —> 0 Step -14 N 40 (13) 1 2 ° MW: 1390.86 0 (14) MW: 1593.88 Step _15 J HCI in e \N 1 O//k0 <0 ARK-78_HCI_SaIt MW: 129373 Tri—tert—butyl (((9-(1-((ZS,4S)azido(1-methyl-2,4-di0xo-1,4-dihydro-2H- benzo [d] [1,3]oxazine—7-carbonyl)pyrrolidin-2—yl)—2,1 l-dimethyl-l,12-di0x0-5,8-di0xa-2,1 1- diazatetradecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene—2,7,15- triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, 14.

To a solution of tri—tert-butyl tri-tert-butyl 1-((2S,4S)azidopyrrolidin-Z-yl)— 2,1 l-dimethyl-l,12-dioxo-5,8-dioxa-2,l l-diazatetradecan—l4-yl)—9, l 0-dihydro-9, 10- [l,2]benzenoanthracene—2,7,lS-triyl)tris(azanediyl)) tris(8-oxooctane-8,l-diyl))tricarbamate (13) (0.14 g, 0.1 mmol) in N,N—dimethylformamide (5 mL) were sequentially added l-methyl-2,4- 2,4-dihydro-lH-3,l-benzoxazinecarboxylic acid (Warhead_type_1B) (0.027 g, 0.12 mmol) and HATU (0.046 g, 0.12 mmol) at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N—diisopropylethylamine (0.026 g, 0.201 mmol) was added dropwise and the resulted reaction mixture was further stirred for 30 minutes at room ature. The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 X 30 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 25 °C to get crude 14 (0.1 g, 62.5%) as a light yellow solid which was used in the next step without further purification. MS (ESI-MS): m/z calcd 9N13017 [MH]+ 8, found 1496.61 (M-100).

N,N',N"-(9-(1-((ZS,4S)azid0(1-methyl-2,4-diox0-1,4-dihydro-ZH- benzo [d] [1,3]oxazine—7—carbonyl)pyrr01idin-2—yl)—2,1 l-dimethyl-l,12-di0x0-5,8-di0xa-2,1 1- etradecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-triyl)tris(8- aminooctanamide), ARK-78_HC1 salt.

To a solution of tri-tert-butyl (((9-(1-((2S,4S)azido(1-methyl-2,4-dioxo-1,4- dihydro—2H-benzo[d][1,3]oxazinecarbonyl)pyrrolidin—2-yl)—2, l 1-dimethyl-1,12—dioxo-5, 8- dioxa-2,1 1-diazatetradecanyl)-9,10—dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))t1is(8—oxooctane-8,1—diyl))tricarbamate (14) (0.067 g, 0.042 mmol) in 1,4- dioxane (3.0 mL) was added 4 M HCl in dioxane solution (1.5 mL) at room temperature and the resulted on mixture was stirred for 30 minutes under nitrogen atmosphere. During this, solid residue started to precipitate out. The suspension was r d for 30 minutes and finally d to stand at room temperature. The solid residues started to deposit on bottom of the flask. The solvent was decanted and the residues left were ated with acetonitrile (3 X 3 mL). Finally the solid was dried under reduced pressure at 25 °C to get pure ARK-78_HCl_Salt (0.045g, 76.3 %) as a white amorphous powder. 1H NMR (400 MHz, DMSO-d6) 5 9.91 ppm (3H, broad s), 8.11-7.97 ppm (1H, m), 7.89 ppm (8H, broad s), 7.66 ppm (3H, broad s), 7.37- 7.34 ppm (2H, broad s), 7.29-7.22 ppm (6H, m), 5.39 ppm (1H, s), 4.97 ppm (1H, m), 4.82 ppm (1H, m), 4.28 ppm (2H, m), 4.03 ppm (1H, m), 3.74 ppm (1H, m), 3.64 ppm (3H, broad s), 3.57 ppm (12H, broad s), 3.50-3.47 ppm (5H, m), 3.15-3.03 ppm (7H, m), 2.90-2.85 ppm (2H, (1), 275-272 ppm (7H, m), 2.25—2.23 ppm (6H, broad s), 1.54 ppm (12H, broad s), 1.27 ppm (17H, broad s). MS (ESI—MS): m/z calcd for C70H95N13011 [MH]+1294.73, found 1295.41.

Scheme: Synthesis of ARK-78A Warhead_1A HATU, DIPEA, DMF Step -14 (13) MW: 1390.86 (14) MW: 1579.88 Step -15 \ HCI in dioxane HZNMA/ENHv HZNWNHC/SQNEKNVVNHZ o‘/‘O Nfi/Oo o//kO/§o ARK-78A_HCI salt MW: 1279.71 “Hm—bu I 9' 1' 25:45 '4-azid0 2,4-di0x0-1,4-dih dr0-2H-y benzo [d] [1,3]oxazine—7-carbonyl)pyrr01idin-2—yl)—2,1 l-dimethyl-l,12-di0x0-5,8-di0xa-2,1 1- diazatetradecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene—2,7,15- tris(azanediyl))tris(8-0x00ctane-8,1-diyl))tricarbamate, 14.

To a solution of tri—tert-butyl (((9-(1—((2S,4S)—4-azidopyrrolidin-Z-yl)—2,1l-dimethyl— 1,12-dioxo-5,8-dioxa-2,l l-diazatetradecan-l4-yl)—9,lO-dihydro-9,10-[1,2]benzenoanthracene- -triyl)tris(azanediyl)) tris(8-oxooctane-8,l-diyl))tricarbamate (13) (0.075g, 0.05 mmol) in N,N—dimethylformamide (4 mL) were sequentially added oxo—1,4-dihydro-2H- benzo[d][1,3]oxazine-7—carboxylic acid (Warhead_type_1A) (0.013 g, 0.065 mmol) and 2017/040514 HATU (0.024 g, 0.065 mmol) at room temperature. The on mixture was stirred for 5 s. To this, N,N—diisopropylethylamine (0.014 g, 0.108 mmol) was added drop wise and the resulted reaction mixture was further stirred for 30 minutes at room temperature. The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 X 30mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 25 °C to get crude 14. The crude mixture was purified by preparative HPLC using following method to yield pure 14 (0.04g, 52 %) as a white amorphous powder. The prep- fraction was concentrated by reduced pressure at 25 °C under nitrogen atmosphere. MS (ESI- MS): m/z calcd for C84H117N13017 [MH]+ 1580.88, found 1481.75(M-100).

] Method for preparative HPLC: (A) 100% Acetonitrile (HPLC GRADE) and (B) 100% Tetrahydrofuran (HPLC , using SUNFIRE , 150mm*19mm*5um with the flow rate of 16.0mL/min and with the following gradient: N,N',N"-(9-(1-((2S,4S)—4-azido(2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]oxazine-7—carbonyl)pyrrolidinyl)-2,1 l-dimethyl-l,12-dioxo-5,8-di0xa-2,1 1- diazatetradecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene—2,7,15-triyl)tris(8- aminooctanamide), A_HC1 salt.

To a solution of tri—tert-butyl (((9-(1-((2S,4S)azido(2,4-dioxo-1,4-dihydro-2H- benzo[d][1,3]oxazine-7—carbonyl)pyrrolidinyl)—2, 1 1-dimethyl—1,12-dioxo-5,8-dioxa-2, 1 1- etradecanyl)—9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))t1is(8—oxooctane-8,1—diyl))tricarbamate (14) (0.04 g, 0.025mmol) in 1,4- Dioxane (AR Grade) (2 mL) was added 4 M HCl in dioxane (1 mL) at room temperature and the resulting reaction mixture was stirred for 30 minutes under nitrogen atmosphere. The solid material stable at the bottom of the flask, the solvent was decanted under inert atmosphere, the solid material was triturating with acetonitrile (HPLC Grade) (3 X 3 mL). The remaining solid was concentrated by reduced pressure at 25 °C under nitrogen atmosphere to afford pure ARK- 78A_HCl_Salt (0.032g, 91.43 %) as a white amorphous . 1H NMR (400 MHz, DMSO- d6) 5 11.99-11.95 ppm (1H, t), 9.91-9.90 ppm (3H, d), 8.01-7.94 ppm (1H, m), 7.87 ppm (8H, broad s), 7.66 ppm (3H, broad s), 7.32—7.22 ppm (7H, m), 7.16-7.11 ppm (1H, m), 5.39 ppm (1H, s), 4.99—4.95 ppm (1H, t), 4.83-4.82 ppm (1H, m), .22 ppm (1H, m), 4.15—3.98 ppm (1H, m), 3.76-3.71 ppm (1H, m), 3.64-3.61 ppm (4H, m), 3.52 ppm (2H, broad s), 3.34-3.32 ppm (2H, m), 3.15 ppm (2H, m), 3.10-3.03 ppm (7H, m), 2.89-2.86 ppm (1H, d), 2.76-2.72 ppm (7H, m), 2.26-2.23 ppm (6H, t), 1.53 ppm (12H, broad s), 1.27 ppm (17H, broad 3). MS (ESI—MS): m/z calcd for C69H93N13011 [MH]+.1280.71, found 1281.50.

Example 11: Synthesis of ARK-79 and ARK-79A 0036 and Ark000038) Synthesis of Int-13 11wN o=é:o ‘7 6N01 Nosyl\ 130C EEOC N 1 Nosyl\ N /N\flo/\/o\/\O/\/NH\ HATU, DMF N o N / WON \/\o/V N DIPEA 3TFA, MDC | —> —> /NH/\O/\/OV\O/\/N 3 ARK—22 Step .1 o (10) Step -11 MW:320.23 MW: 643.26 (11) MW: 543.21 Int-11 HATU, DMF DIPEA B HNWWNH $1 c NHWWNHBM —>Step -12 ARK-18 0:4 MW: 1094.66 Nosyl/N\/ ’Na (12) MW: 1619.87 Thiophenol, Step -13 KZCOSHACN 60°C /\/\/\/\H/ H110 ‘Na (13) MW: 1434.89 utyl S,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidin-2—yl)—2- methyloxo-5,8,11-trioxaazatridecanyl)(methyl)carbamate, 10. 2017/040514 To a solution of ARK-22 (3.1 g, 9.68 mmol) in N,N—dimethylformamide (40 mL) were sequentially added (2S,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidinecarboxylic acid (3.96 g, 11.62 mmol), HATU (4.414 g, 11.62 mmol) and isopropylethylamine (2.5 g, 19.36 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl acetate (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 10 (4 g, 64.2%) as yellow solid. The crude mixture was used in next step without further purification. MS (ESI-MS): m/z calcd for C26H411\I70108[l\/H‘I]+ 644.26, found 544.36 . (2S,4S)—4-azido-N-methyl((2-nitr0phenyl)sulfonyl)—N-(5,8,11-tri0xa azatridecanyl) pyrrolidinecarboxamide_TFA Salt, 11.

To a solution of tert—butyl S,4S)—4-azido((2-nitrophenyl)sulfonyl)pyrrolidin- 2-methyl—1-oxo-5,8,11-trioxaazatridecanyl)(methyl) carbamate (10) (3 g, 4.66 mmol) in dichloro methane (20 mL) was added trifluoro acetic acid (1.8 mL, 23.32 mmol) at room temperature. The resulted reaction mixture was stirred at room temperature for 2 h. The reaction e was filtered through celite bed and filtrate thus collected was concentrated under reduced pressure to get crude 11 (3.1 g, quantitative yield) as a dark yellow oil which was used without further purification. MS (ESI—MS): m/z calcd for C21H33N7OsSTFA [MH]+ 544.21, found 544.47.

Tri-tert—butyl (((9-(1-((2S,4S)azido((2-nitr0phenyl)sulfonyl)pyrr0lidin yl)—2,14—dimethyl-1,15-di0x0-5,8,11-tri0xa-2,14-diazaheptadecanyl)—9,10-dihydro-9,10- enzenoanthracene-2,7,l5-triyl)tris(azanediyl))tris(8-ox00ctane-8,1-diyl))tricarbamate, To a on of (2S,4S)—4-azido-N-methyl((2-nitrophenyl)sulfonyl)-N-(5,8,11- trioxaazatridecany1) pyrrolidinecarboxamide_TFA Salt (11) (2.88 g, 4.38 mmol) in N,N-dimethylformamide (40 mL) were sequentially added 3-(2,7,15-tris(8-((tert- butoxycarbonyl)amino)octanamido)—9,10-[1,2]benzenoanthracen—9(1OH)—yl)propanoic acid (ARK-18) (4.0 g, 3.65 mmol), HATU (1.67 g, 4.38 mmol) and N,N—diisopropylethylamine (2.36 g, 18.27 mmol) at room ature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl 2017/040514 acetate (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 12. The crude mixture was purified by column chromatography on silica gel (5.4% methanol/chloroform) to yield 12 (5.9 g, 99.7 %) as a dark yellow solid. MS (ESI-MS): m/z calcd for C83H121N13OISS [MH]+ 1620.87, found 1522.31(M- 100, one Boc group fell off).

Tri—tert—butyl (((9—(1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,14-dimethyl-1,15—di0xo- ,8,11-tri0xa-2,14-diazaheptadecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene- 2,7,15-triyl)tris(azanediyl))tris (8-0xooctane—8,1-diyl))tricarbamate, 13.

To a solution of tri-tert-butyl (((9-(1—((2S,4S)—4-azido-l-((2- nitrophenyl)sulfonyl)pyrrolidinyl)-2,l4-dimethyl-1,15—dioxo-5,8, 1 1-trioxa-2,14— diazaheptadecan-l7-yl)—9,10-dihydro-9,10-[1,2] benzenoanthracene—2,7, 15- triyl)tris(azanediyl))t1is(8-oxooctane-8,1—diyl))tricarbamate (12) (5.9 g, 3.64 mmol) in acetonitrile (60 mL) were sequentially added potassium carbonate (2.51 g, 18.21 mmol) and thiophenol (1.11 mL, 10.93 mmol) at room temperature. The resulted reaction mixture was stirred at 80 °C for 2 h. The reaction mixture was d through celite bed and the collected filtrate was concentrated under reduced pressure to get crude 13 as yellow oil. The crude mixture was subjected to reverse phase chromatography to yield 13 (1.9 g, 36.3%) as a light yellow solid.

The yellow solid was r subjected to preparative HPLC (method ned below) purification followed by lyophilization to yield pure 13 , 9.8%) as a white amorphous powder. MS (ESI—MS): m/z calcd for (:771‘11181\IIZOI4[IVE—I]+ 1435.89, found 1437.41.

Method for ative HPLC: (A) 100% Acetonitrile (HPLC GRADE) IN WATER (HPLC GRADE) and (B) lOmM 3 IN WATER (HPLC GRADE), using GRACE DENIL C18, 250mm*25mm*5um with the flow rate of 22.0 mL/min and with the following gradient: __IE_ WO 06074 Scheme: Synthesis of ARK-79 /\/\/\/\[/ 0 BocHNW BocHN ‘ | H000 N/V) NH C 6/ Q 0 NH6/6 o | BocHNM WNHBOC BocHNWl/ WNHBOC O NH 0 NH Warhead_1B HATU, DIPEA‘ DMF N\ —> /\/ H Step -14 of0 HMO "N3 0 (13) MW: 1434.89 O/ D/EO (14) MW: 1637.91 Step -15 HCI in dioxane 0/0 D ARK-79_HCI_SaIt MW: 1337.75 Tri—tert—butyl (((9-(1-((2S,4S)-4—azido(1-methyl-2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]oxazine—7—carb0nyl)pyrrolidin-2—yl)—2,14-dimethyl-1,15-di0x0-5,8,1 1-trioxa- iazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, 14.

To a solution of tfi-tert-butyl (((9-(1—((2S,4S)—4-azidopyrrolidin-Z-yl)—2,l4-dimethyl- 1,15-di0X0-5,8,ll-trioxa-Z,l4-diazaheptadecanyl)-9,lO-dihydro-9,10— [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris (8—oxooctane-8,l—diyl))tficarbamate (13) (0.1 g, 0.07 mmol) in N,N—dimethylformamide (4 mL) were sequentially added l-methyl-2,4- dioxo—2,4-dihydro-1H—3,1-benzoxazinecarboxylic acid (Warhead_type_1B) (0.039 g, 0.18 mmol) and HATU (0.018 g, 0.084 mmol) at room temperature. The reaction mixture was d for 5 minutes. To this, isopropylethylamine (0.018 g, 0.14 mmol) was added drop wise and the resulted reaction mixture was further stirred for 30 minutes at room temperature. The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 x 30 mL). The organic layers were ed, washed with brine and concentrated under reduced pressure at 25 °C to get crude 14. The crude mixture was purified by ative HPLC (method mentioned below) followed by lyophilization to yield 14 (0.053 g, 46.5%) as a white amorphous powder. MS (ESI—MS): m/z calcd C87H123N13018 [MH]+ 1638.91, found 1540.40 (M-100).

Method for preparative HPLC: (A) 100% Acetonitrile (HPLC GRADE) and (B) 100% Tetrahydrofuran (HPLC GRADE), using SUNFIRE SILICA, 250mm*19mm*5um with the flow rate of 15.0 mL/min and with the following gradient: ] N,N',N"-(9-(1-((2S,4S)azido(1-methyl-2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]oxazine-7—carbonyl)pyrrolidinyl)-2,14—dimethyl-1,15-di0x0-5,8,1 1-tri0xa- iazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15-triyl)tris(8- aminooctanamide), ARK-79_HCl salt.

To a solution of tri-tert-butyl (((9-(1-((2S,4S)azido(1-methyl-2,4-dioxo-1,4- dihydro—2H—benzo[d][1,3]oxazinecarbonyl)pyrrolidin—2—yl)—2,l4-dimethyl-1,15—dioxo-5, 8,1 1- trioxa-2,14-diazaheptadecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8—oxooctane-8,1—diyl))tricarbamate (14) (0.035 g, 0.021 mmol) in 1,4- dioxane (3.0 mL) was added 4 M HCl in dioxane solution (1 mL) at room temperature and the resulted reaction mixture was stirred for 30 minutes under nitrogen atmosphere. During this, solid residue d to precipitate out. The suspension was r stirred for 30 minutes and finally allowed to stand at room ature. The solid residues started to deposit on bottom of the flask. The solvent was decanted and the residues left were triturated with acetonitrile (3 x 3 mL). Finally the solid was dried under reduced pressure at 25 °C to get pure ARK-79_HCI_Salt (0.025 g, 80.6%) as a white ous powder. 1H NMR (400 MHz, DMSO-d6) 6 9.89 ppm (3H, broad s), 8.10-8.08 ppm (1H, m), 7.89 ppm (9H, broad s), 7.66 ppm (3H, broad s), 7.38- 7.37 ppm (1H, d), 7.33—7.22 ppm (6H, m), 5.38 ppm (1H, s), 4.95-4.90 ppm (1H, m), 4.25 ppm (1H, m), 4.06 ppm (1H, m), 3.75 ppm (1H, m), 3.63-3.57 ppm (10H, d), 3.38-3.33 ppm (5H, m), 3.10-3.04 ppm (7H, m), 2.88-2.84 ppm (1H, d), 2.74-2.72 ppm (7H, broad s), 2.25-2.23 ppm (6H, t), 1.60-1.53 ppm (12H, (1), 1.27 ppm (18H, broad 3). MS (ESI—MS): m/Z calcd for C72H99N13012 [MH]+ 5, found 1339.55.

: Synthesis of ARK-79A Warhead_1A HATU, DIPEA, DMF Step -14 QNOMNS (13) MW: 1434.89 (14) MW: 1623.89 Step -15 HCI in dioxane 0:O1 030 ARK-79A_HCI_SaIt MW: 1323.74 Tri—tert—butyl (((9-(1-((ZS,4S)azid0(2,4-di0xo-1,4-dihydr0-2H- benzo [d] [1,3]oxazine—7—carbonyl)pyrrolidinyl)-2,14-dimethyl-1,15-di0x0-5,8,1 1-tri0xa- 2,14-diazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, 14.

] To a solution of tri—tert-butyl (((9-(1—((2S,4S)—4-azidopyrrolidinyl)—2,l4-dimethy1— 1,15-dioxo-5,8,l 1-trioxa—2, 14-diazaheptadecanyl)-9,lO-dihydro-9,10— [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris (8-oxooctane-8,1-diyl))tricarbamate (13) (0.2g, 0.139 mmol) in N,N—dimethylformamide (8 mL) were tially added 2,4-dioxo-1,4- dihydro—2H-benzo[d][1,3]oxazinecarboxylic acid (Warhead_type_1A) (0.035 g, 0.167 mmol) and HATU (0.064 g, 0.167 mmol) at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N—diisopropylethylamine (0.036 g, 0.279 mmol) was added dropwise and the resulted reaction mixture was further stirred for 30 minutes at room ature. The reaction e was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 X 30 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 25 0C to get crude 14. The crude mixture was purified by preparative HPLC using following method to yield pure 14 (0.04g, 17.7 %) as a off white amorphous powder. The prep- fraction was concentrated by reduced pressure at 25°C under en atmosphere. MS (ESI— MS): m/z calcd C36H121N13013 [MH]+ 1624.89, found 1525.76 (M—100; one Boc group fell off).

Method for preparative HPLC: (A) 100% Acetonitrile (HPLC GRADE) and (B) 100% Tetrahydrofuran (HPLC GRADE), using SUNFIRE , 150mm*19mm*5um with the flow rate of 18.0mL/min and with the following gradient: 98% A and 2% for 20 min.

N,N',N"-(9-(1-((2S,4S)azido(2,4-dioxo—1,4-dihydro-2H- benzo [d] [1,3]oxazinecarb0nyl)pyrrolidinyl)-2,1 thyl-1,15-di0x0-5,8,1 l-trioxa- 2,14-diazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15-triyl)tris(8- aminooctanamide), ARK-79A_HC1 salt.

To a solution of tri-tert-butyl (((9-(1-((2S,4S)azido(2,4-dioxo-1,4-dihydro-2H- benzo[d][1,3]oxazinecarbonyl)pyrrolidiny1)-2, ethy1-1,15-dioxo-5,8,1 l-trioxa-2,14- diazaheptadecan-l7-yl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-oxooctane-8,1-diyl))tricarbamate (14) (0.04 g, 0.024 mmol) in 1,4- Dioxane (Dry) (3 ml) was added 4 M HCl in dioxane (1.2 mL) at room temperature and the resulting reaction mixture was stirred for 30 minutes under nitrogen atmosphere. The solid al stable at the bottom of RBF, the solvent was decant under inert atmosphere, the solid material was tn'turating with acetonitrile (HPLC Grade) (3 X 3 mL). The remaining solid was trated by d pressure at 25 °C under nitrogen atmosphere to afford pure ARK- 79A_HCl_Salt (0.033 g, 94.28 %) as an off white amorphous powder. 1H NMR (400 MHz, 6) 5 11.97-11.95 ppm (1H, d), 9.90 ppm (3H, broad s), 802—798 ppm (1H, m), 7.88 ppm (8H, broad s), 7.66 ppm (3H, broad s), 7.32—7.22 ppm (7H, m), 7.16—7.08 ppm (1H, m), 5.39 ppm (1H, s), 496-491 ppm (1H, m), 4.80 ppm (1H, m), 4.28-4.20 ppm (1H, m), 4.05 ppm (1H, m), 3.75—3.73 ppm (1H, m), 3.64 ppm (3H, broad s), 3.57 ppm (11H, broad s), 3.54 ppm (2H, m), 3.39-3.38 ppm (2H, m), 3.34-3.32 ppm (3H, d), 3.16 ppm (2H, broad s), 3.08-3.02 ppm (8H, m), 2.87-2.83 ppm (1H, d), 2.76-2.68 ppm (7H, m), 2.27—2.23 ppm (6H, t), 1.60-1.53 ppm (12H, broad s), 1.27 ppm (18H, broad s). MS (ESI—MS): m/z calcd for C71H97N13012 [MH]+1324.74, found 1325.50. e 12: sis of ARK-80, ARK-89, ARK-125 (Ark000024, 027, and Ark000030) Scheme: Synthesis of Int-13 WONN o:é=o ‘3 Boo Nosyl\ Nosyk ‘ Boo N N N NH HATU.DMF l / WON ‘ DIPEA /NWONNQ‘N3 TFA,MDC —, l —>/NH/\0/\/NYQ‘N3l ARK-20 0 Step 40 Step .11 TFA salt 0 MW:232.17 (10) (11) MW: 555-21 MW: 455.16 NH BocHNM BucHNM 0 Int-11 s HATU,DMF, DIPEA BocHN/WWNH NH / o WNHBOC BocHNW a QNHWNHBOC —> 0 NH Step _12 N3 HN‘ 0“ NJ” (3 (12) ARK“ N \<o MW: 1531.81 MW: 1094.66 ””5“ Thiophenol, Step -13 KZCOZACN 60°C MNJ‘\ o <13) m o MW:1346.84 Tert—butyl (2-(2-((2S,4S)—4—azido-N-methyl((2- nitrophenyl)sulfonyl)pyrrolidinecarb0xamid0) ethoxy)ethyl)(methyl)carbamate, 10.

To a solution of ARK-20 (1.0 g, 4.307 mmol) in N,N—dimethylformamide (20 mL) were sequentially added (28,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidinecarboxylic acid (1.17 g, 3.44 mmol), HATU (1.96 g, 5.17 mmol) and N,N—diisopropylethylamine (1.67 g, 12.92 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and ted with ethyl e (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 10 (2.52 g, quantitative yield) as brown semisolid. The crude mixture was used in next step without further purification. MS (ESI—MS): m/z calcd for C22H33N708S [MH]+ 556.21, found 573.43 (M+18). (2S,4S)—4-azido-N-methyl-N-(Z-(Z-(methylamin0)eth0xy)ethyl)((2- nitrophenyl)sulf0nyl) pyrrolidine—2-carb0xamide_TFA Salt, 11.

To a solution of tri utyl (2-(2-((2S,4S)-4—azido-N—methyl((2- henyl)sulfonyl)pyrrolidinecarboxamido) ethoxy)ethyl)(methyl)carbamate (10) (2.5 g, 4.50 mmol) in dichloro methane (15 mL) was added trifluoro acetic acid (1.72 mL, 22.51 mmol) at room temperature. The resulted reaction mixture was stirred at room temperature for 2 h. The reaction e was filtered through celite bed and filtrate thus collected was concentrated under reduced pressure to get crude 11 (4.12 g, quantitative yield) as a brown oil which was used without further purification. MS S): m/z calcd for C17H25N706STFA [MH]+456.16, found 456.32.

Tri-tert—butyl (((9-(3-((2-(2-((2S,4S)-4—azido-N-methyl((2- henyl)sulf0nyl)pyrrolidine—2-carb0xamid0)ethoxy)ethyl)(methyl)amino)—3- 0x0pr0pyl)—9,10-dihydr0-9,10[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8- oxooctane-S,1-diyl))tricarbamate, 12.

To a solution of (2S,4S)—4—azido-N—methyl—N—(2-(2—(methylamino)ethoxy)ethyl)—1- trophenyl)sulfonyl) pyrrolidinecarboxamide_TFA Salt (11) (1.75 g, 3.07 mmol) in N,N-dimethylformamide (30 mL) were sequentially added 3-(2,7,15-t1is(8—((tert- butoxycarbonyl)amino)octanamido)—9,10-[1,2]benzenoanthracen-9(10H)—yl)propanoic acid (ARK-18) (2.8 g, 2.56 mmol), HATU (1.17 g, 3.07 mmol) and N,N-diisopropylethylamine (0.66 g, 5.12 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and ted with ethyl e (3 X 100 mL). The c layers were combined, washed with brine and concentrated under reduced pressure to get crude 12. The crude mixture was purified by column chromatography on silica gel (15% methanol/chloroform) to yield 12 (1.48 g, 37.8 %) as a dark yellow solid. MS (ESI-MS): m/z calcd for C79H113N13016S [lVlH]+ 1532.81, found 1433.19 (M— 100; one Boc group fell off). 2017/040514 Tri—tert—butyl (((9-(3-((2-(2-((2S,4S)azid0-N-methylpyrrolidine—Z- carboxamid0)eth0xy)ethyl) (methyl)amino)—3-oxopropyl)—9,10-dihydro- 9,10[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl)) tris(8-0x00ctane—8,1- diyl))tricarbamate, 13.

To a solution of tri-tert-butyl (((9-(3-((2-(2-((2S,4S)—4-azido—N—methyl-l-((2- nitrophenyl)sulfonyl) idine—2-carboxamido)ethoxy)ethyl)(methyl)amino)-3 opyl)- 9, 10-dihydro-9, 10[1,2] benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8-oxooctane-8,1— diyl))tricarbamate (12) (1.48 g, 0.97 mmol) in acetonitrile (15 mL) were sequentially added potassium carbonate (0.67 g, 4.83 mmol) and thiophenol (0.3 mL, 2.89 mmol) at room temperature. The resulted reaction mixture was stirred at 80 0C for 2 h. The reaction mixture was filtered h celite bed and the collected filtrate was concentrated under reduced pressure to get crude 13 as yellow oil. The crude mixture was subjected to reverse phase chromatography to yield 13 (0.76 g, 58.4 %) as a light yellow solid. MS (EST-MS): m/z calcd for C73H110N12012 [MH]+ 1347.84, found 1349.28.

: Synthesis of ARK-80 F F o BOCHNM F F o i\ r0 N o BOCHNWVYNH WNHBOC NHBoc o NH Wartype-Z \ Int-A ’ g N3 \ o Step-14 Nf ° °3w. 3 (13) och \° MW:1345.86 0 (14) 9.87 Step -15 jHCI in dioxane HzNMNHOO HzN/WWNH 3/6Q WNH; o NH N3\(\‘Y<\N_/‘OgN \ ofo o ARK-80_HC| salt MW: 1 O F F F 0 F F Hon” dfi; + EDCHCLTHF F F dig O N O —> O o ' F F 0 OH Step-A T50 ll“ Warhead-2 Warhead-2_lnt-A MW 417.03 Perfluorophenyl 2-((1-methyl-2,4-di0x0-l,4-dihydr0-2H-benz0[d][1,3]0xazin yl)oxy)acetate, Int-A.

To a solution of Warhead-2 (0.04 g, 0.17 mmol) in ydrofuran (1 mL) was added N—(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hloride (0.035 g, 0.17 mmol) at 0 °C under nitrogen atmosphere. The reaction mixture was stirred at 0 0C for 10 min. To this, a solution of pentafluorophenol (0.03 g, 0.17 mmol) in tetrahydrofuran (0.5 mL) was added dropwise at 0 0C under nitrogen atmosphere. The resulted reaction mixture was further stirred at 0 °C for 1 h. The reaction mixture was directly used in the next step without work up and isolation. MS (ESI—MS): m/z calcd C17H8F5NO6 [MH]+ 418.03, the compound did not show 2017/040514 mass response. Note: Intermediate-A was not isolated — the reaction mass was transferred as such to the next step reaction mass.

Tri—tert—butyl (((9-(3-((2-(2-((2S,4S)—4-azido-N-methyl(2-((1-methyl-2,4-dioxo- 1,4-dihydr0-2H-benzo[d] [1,3]oxazinyl)0xy)acetyl)pyrrolidine carboxamido)eth0xy)ethyl)(methyl)amino)—3-ox0propyl)—9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15—triyl)tris(azanediyl))tris(8-0xooctane—8,1-diyl))tricarbamate, To a solution of tri-tert-butyl (((9-(3—((2-(2-((2S,4S)—4-azido—N—methylpyrrolidine carboxamido)ethoxy)ethyl) (methyl)amino)-3 opyl)—9, l O-dihydro- 9, l0[l,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl)) tris(8-oxooctane-8, ))tricarbamate (13) (0.27 g, 0.17 mmol) in tetrahydrofuran (4 mL) was added pentafluorophenyl [(l—methyl- 2,4-dioxo-1,4-dihydro-2H-3,l-benzoxazinyl)oxy]acetate (Warhead_type_2) (0.071 g, 0.17 mmol) and the resulted reaction mixture was further stirred for 1h at room temperature. The reaction mixture was trated under reduced pressure to get crude 14 (0.38 g, Quantitative yield) as a yellow solid which was used in the next step without further ation. MS (ESI— MS): m/z calcd C34H117N13017 [lVIH]+ 1580.87, found 1482.29 (M—100; one Boc group fell off).

N,N',N"-(9-(3-((2-(2-((2S,4S)—4-azido-N-methyl(2-((1-methyl-2,4—dioxo-1,4- dihydro-ZH-benzo [d] [1,3]oxazinyl)oxy)acetyl)pyrrolidine—2— carboxamid0)eth0xy)ethyl)(methyl)amino)—3-oxopropyl)—9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,l5—triyl)tris(8-aminooctanamide), ARK-80_HC] salt.

To a solution of tri-tert-butyl (((9-(3-((2-(2-((2S,4S)azido-N—methyl-l-(2-((l- methyl-2,4-dioxo-l,4-dihydro-2H-benzo[d][l,3]oxazinyl)oxy)acetyl)pyrrolidine amido)ethoxy)ethyl)(methyl)amino)-3 -oxopropyl)—9, lO-dihydro-9, 10- [1,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8-oxooctane-8,l-diyl))tricarbamate, (14) (0.38 g, 0.025 mmol) in tetrahydrofuran (5.0 mL) was added 4 M HCl in dioxane solution (2 mL) at room temperature and the resulted reaction e was stirred for 4 h under en atmosphere. The reaction mixture was concentrated under reduced pressure to get crude ARK- 80_HCl_Salt as a yellow solid. The crude mixture was purified by preparative HPLC using ing method to get pure ARK-80_HCl salt (0.012 g, 3.6%) as a white amorphous powder. 1H NMR (400 MHz, DMSO-d6) 6 9.93-9.91 ppm (3H, broad s), 7.92-7.85 ppm (10H, broad s), 7.65 ppm (4H, broad s), 7.40 ppm (2H, broad 5), 727-7. 15 ppm (8H, m), .71 ppm (3H, m), 6.54 ppm (1H, s), 5.36 ppm (1H, s), 5.10-5.02 ppm (3H, m), 4.83 ppm (2H, m), 4.66-4.56 ppm (2H, m), 4.39—4.28 ppm (2H, m), 4.06-4.01 ppm (2H, m), 3.58-3.55 ppm (4H, m), 3.47-3.41 ppm (7H, m), 3.13-2.94 ppm (9H, m), 2.71-2.66 ppm (8H, m), 2.22 ppm (7H, broad s), .50 ppm (12H, d), 1.26 ppm (18H, 3). MS (ESI—MS): m/z calcd for C69H93N13011 [MH]+ 1280.71, found 1281.43.

Method for preparative HPLC: (A) 0.05% HCl IN WATER (HPLC GRADE) and (B) 100% Acetonitrile (HPLC GRADE), using X-BRIDGE, 250mm*19mm*5pm with the flow rate of 19.0mL/min and with the following gradient: __IE_ Scheme: Synthesis of ARK-89 0 BOCHNM 0:§/F 0 COOH \N HATU, DMF DIPEA S N3 \ f0 —> N meo (13> 5‘” '14 g 0 MW: 1346.86 W0 (14) MW: 1560.85 Step .15 l HCI in dioxane _HCI salt MW: 1260.70 Tri—tert—butyl (((9-(3-((2-(2-((ZS,4S)azido-l-(3-(4- (fluorosulfonyl)phenyl)pr0panoyl)—N-methylpyrrolidine—Z- amido)eth0xy)ethyl)(methyl)amino)—3-ox0propyl)—9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-0x00ctane—8,1-diyl))tricarbamate, To a solution of tri-tert-butyl (((9-(3—((2-(2-((2$,4S)—4-azido—N—methylpyrrolidine carboxamido)ethoxy)ethyl) (methyl)amino)-3 -oxopropyl)—9,10-dihydro- 9,10[1,2]benzenoanthracene-2,7,15-triy1)tris(azanediyl)) tris(8-oxooctane—8, 1-diyl))tricarbamate (13) (0.31 g, 0.23 mmol) in N,N—dimethylformamide (6 mL) were sequentially added 3-(4- (fluorosulfonyl)phenyl)propanoic acid (0.043 g, 0.18 mmol) and HATU (0.070 g, 0.18 mmol) at room temperature. The reaction mixture was stirred for 5 s. To this, N,N— diisopropylethylamine (0.036 g, 0.276 mmol) was added drop wise and the resulted reaction mixture was further stirred for 1h at room temperature. The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 x 30mL). The c layers were combined, washed with brine and concentrated under reduced pressure at 25 0C to get crude 14 2017/040514 (0.45 g, Quantitative yield) as a dark yellow solid which was used in the next step without further purification. MS (ESI—MS): m/z calcd C82H117FN120158[MH]+ 1561.85, found 1463.45 (M-100, one Boc group fell off).

N,N’N”-(9-(3-((2-(2-((2S,4S)—4-azid0(3-(4-(11u0r0sulfonyl)phenyl)pr0panoyl)— N-methylpyrrolidine—Z-carboxamido)eth0xy)ethyl)(methyl)amino)—3-ox0propyl)—9,10- dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-aminooctanamide), ARK-89_HC1 salt.

To a solution of tri-tert-butyl (((9-(3-((2-(2-((2S,4S)-4—azido-1—(3-(4- (fluorosulfonyl)phenyl)propanoyl)-N-methylpyrrolidine carboxamido)ethoxy)ethyl)(methyl)amino)—3 -oxopropyl)—9, 10-dihydro-9, 10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-oxooctane-8,1-diyl))tricarbamate (14) (0.45 g, 0.028 mmol) in 1,4-dioxane (5.0 mL) was added 4 M HCl in dioxane (2 mL) at room temperature. The resulting reaction mixture was stirred for 4 hours. The mixture was concentrated under reduced pressure to get crude ARK-89_HC1_Salt as a yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure ARK- 89_HCl salt (0.053g, 12.8 %) as a yellow solid. 1H NMR (400 MHz, DMSO-ds) 5 9.95 ppm (3H, broad s), .95 ppm (10H, m), 7.67-7.62 ppm (5H, m), 7.28-7.21 ppm (6H, m), 5.38 ppm (1H, s), 4.77 ppm (0.5H, m), .49 ppm (1H, m), 4.31—4.21 ppm (1H, m), .96 ppm (2H, m), 3.62-3.44 ppm (6H, m), 3.22-3.03 ppm (8H, m), 2.98-2.88 ppm (4H, m), 2.74-2.60 ppm (10H, m), 2.24-2.23 ppm (7H, t), .52 ppm (12H, d), 1.26 ppm (18H, 5). MS (ESI- MS): m/Z calcd for C67H93FN1209S [MH]+ 0, found 1262.31.

Method for preparative HPLC: (A) 0.05% HCl IN WATER (HPLC GRADE) and (B) 100% Acetonitrile (HPLC GRADE), using X-SELECT FP, 250mm* l9mm*5um with the following gradient: ——m_ _—m_ Scheme: sis of ARK-125 F /\/\/\/\H/ 0 1 BDCHN 028:0 0 NH 3 o O BOCHNWY 0 OW N HBoc WNHBDC O NH H HO 0 HATU,DMF H DIPEA ”Smufo Step -14 N ‘0 F028 (13) (14) MW: 1346.86 MW: 1532.81 Step -15 l HCI in dioxane HZNM HZNWNHU ‘0 fl) NH O NH’\/\/\/\/ 2 ARK-125_HCI salt MW: 5 Tri—tert—butyl (((9-(3-((2-(2-((2S,4S)—4-azid0(4-(fluorosulfonyl)benzoyl)—N- methylpyrrolidine—2-carb0xamid0)ethoxy)ethyl)(methyl)amino)—3-0xopropyl)—9,10- dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-0xooctane—8,1— diyl))tricarbamate, 14.

To a solution of tri-tert-butyl 3—((2-(2-((ZS,4S)—4-azido—N—methylpyrrolidine carboxamido)ethoxy)ethyl) (methyl)amino)-3 -oxopropyl)—9,10-dihydro- 9,10[1,2]benzenoanthracene-2,7,15-t1iyl)tris(azanediyl)) tris(8-oxooctane—8, 1-diy1))tricarbamate (13) (0.30 g, 0.22 mmol) in N,N—dimethylformamide (10 mL) were sequentially added 4- fluorosulfonylbenzoic acid (0.054 g, 0.27 mmol) and HATU (0.101 g, 0.27 mmol) at room temperature. The reaction mixture was d for 5 minutes. To this, N,N—diisopropylethylamine (0.079 g, 0.45 mmol) was added drop wise and the resulted reaction mixture was further stirred for 1h at room temperature. The on mixture was diluted by ethyl acetate (100 mL) and washed with ice—cold water (3 x 30 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 250C to get crude 14 (0.388 g, Quantitative yield) as a yellow semi—solid which was used in the next step without further purification. MS S): m/z calcd C80H113FNIZOISS [MH]+ 1532.81, found 1434.35 (M-100, one Boc group fell off).

N,N’,N”-(9-(3-((2-(2-((2S,4S)—4-azid0(4-(flu0rosulfonyl)benz0yl)—N- methylpyrrolidine—2-carb0xamid0)ethoxy)ethyl)(methyl)amino)—3-0xopropyl)—9,10- dihydro-9,10-[1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-aminooctanamide), ARK-125_HCI salt.

To a solution of tri-tert-butyl (((9—(3-((2-(2-((2S,4S)azido-l-(4- (fluorosulfonyl)benzoyl)—N—methylpyrrolidine-2—carboxamido)ethoxy)ethyl)(methyl)amino)—3- pyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8- oxooctane-8,1-diyl))t1icarbamate (14) (0.38 g, 0.0025 mmol) in 1,4-dioxane (5.0 mL) was added 4 M HCl in dioxane (2 mL) at room temperature and the resulting reaction mixture was stirred for 4 hours. The mixture was concentrated under reduced pressure to get crude ARK- l_Salt as a yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure ARK-125_HCl_Salt (0.110g, 33.0%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 6 9.96-9.93 ppm (3H, broad s), 8.24-8.21 ppm (2H, m), 7.97 ppm (8H, broad s), .82 ppm (2H, m), 7.71-7.68 ppm (3H, m), 7.32-7.19 ppm (6H, m), 5.38 ppm (1H, s), 5.05-5.01 ppm (1H, m), 4.87-4.80 ppm (1H, m), 4.30-4.20 ppm (1H, m), 3.89 ppm (18H, broad s), 370-355 ppm (5H, m), 3.48-3.38 ppm (3H, m), 3.18 ppm (1H, s), 308—304 ppm (6H, m), 2.79-2.68 ppm (7H, m), 2.25 ppm (6H, broad s), 1.54-1.52 ppm (12H, d), 1.26 ppm (18H, ). MS S): m/z calcd for C65H89FN1209$ [MH]+ 1233.65, found .

Method for preparative HPLC: (A) 0.05% HCl IN WATER (HPLC GRADE) and (B) 100% Acetonitrile (HPLC GRADE), using X-SELECT FP, 250mm*19mm*5um with the flow rate of 19.0 mL/min and with the following gradient: Example 13: sis of ARK-81, ARK-90, and ARK-126 0025, Ark000028, and Ark000031) Scheme: Synthesis of 13 mm.2 0:5:0 \/O\ANH; N HATU, DMF N NOSYI\N \N/wowo/VN 3 TFA, MDC ‘ DIPEA N —> i —> \NH'\/O\/\o/\/N 3 ARK-21 stgp.1o 50C 0 Step -11 MW:276.37 (10) (11) MW: 599.18 MW: 499.18 wNHv Int-11 HATU, DMF DIPEA NH / s o BocHNW\/\[r a Q WNHBOC ’ 0 NH Step -12 ARK-18 MW: 1094.66 N3 CNN“ MW:(1I§l5.84 Thiophenol, KZCOEHACN Step 13 j 60°C Nz’CC (13) MW: 139086 Tert—butyl (2-(2-(2-((ZS,4S)—4—azid0-N-methyl((2- nitrophenyl)sulfonyl)pyrrolidinecarboxamid0)ethoxy)eth0xy)ethyl)(methyl)carbamate, To a solution of ARK-21 (0.9 g, 3.04 mmol) in N,N-dimethylforrnamide (6 mL) were sequentially added (28,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidinecarboxylic acid (1.33 g, 3.91 mmol), HATU (1.4 g, 3.91 mmol) and N,N-diisopropylethylamine (0.85 g, 6.52 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room ature. The reaction mixture was poured in ld water and extracted with ethyl acetate (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 10 (1.5 g, 78.9%) as brown semisolid which was used in next step without further purification. MS (ESI—MS): m/z calcd for C24H37N709 S [MH]+ 600.18, found 617.5(M+18). (2S,4S)—4-azido-N-methyl-N-(Z-(Z-(2-(methylamino)eth0xy)eth0xy)ethyl)—1-((2 nitrophenyl)sulf0nyl)pyrrolidine—Z-carb0xamide_TFA Salt, 11.

To a solution of tri-tert-butyl((2R,2'R,2"R)—((9,10-dihydro-9,10- enzenoanthracene—2,7, l 5-triyl)tris(azanediyl))tris(3-(lH-imidazolyl)— 1 opane- 1 ,2- diyl))tricarbamate (10) (1.5 g, 2.5 mmol) in dichloro methane (10 mL) was added trifiuoro acetic acid (0.96 mL, 12.52 mmol) at room temperature. The ed reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered through celite bed and filtrate thus collected was concentrated under reduced pressure to get crude 11 (1.4 g, 91.50 %) as a brown oil which was used without further purification. MS (ESI—MS): m/z calcd for C19H29N7O7 S [MH]+500.18, found 500.31.

Tri-tert—butyl (((9-(1-((2S,4S)—4-azido((2-nitrophenyl)sulfonyl)pyrr0lidin-Z- yl)—2,1l-dimethyl-l,12—di0x0-5,8-di0xa-2,11-diazatetradecan-l4-yl)—9,10-dihydr0-9,10— [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-0x00ctane—8,1-diyl))tricarbamate, To a solution of (2S,4S)—4-azido—N—methyl-N-(2—(2-(2- lamino)ethoxy)ethoxy)ethyl)- l itrophenyl)sulfonyl)pyrrolidinecarboxamide_TFA Salt (11) (0.56 g, 0.91 mmol) in N,N-dimethylformamide (4 mL) were sequentially added 3- (2,7, l 5-tris(8-((tert-butoxycarbonyl)amino)octanamido)-9, l0-[1,2]benzenoanthracen-9( 1 0H)- yl)propanoic acid (ARK-18) (0.5 g, 0.46 mmol), HATU (1.44 g, 0.55 mmol) and N,N- diisopropylethylamine (0.12 g, 0.91 mmol) at room temperature. The resulted reaction e was stirred for l h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl acetate (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 12. The crude mixture was purified by column chromatography on silica gel (15% methanol/chloroform) to get 12 (0.6 g, 84.5%) as a brown solid. MS (ESI—MS): m/z calcd for C81H117N13017S [MH]+ 1576.84, found 1578.4.

Tri—tert—butyl (((9-(1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,11-dimethyl-1,12-di0xo- ,8-dioxa-2,1l-diazatetradecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15- triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, 13.

To a solution of rt-butyl (((9-(1—((ZS,4S)azido-l-((2- nitrophenyl)su1fonyl)pyrrolidinyl)-2, 1 1-dimethyl-1,12-dioxo-5,8-dioxa—2,1 1-diazatetradecan- 14-yl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15—triyl)tris(azanediyl))tris(8-oxooctane- 8,1-diyl))tricarbamate (12) (0.6 g, 0.38 mmol) in acetonitrile (10 mL) were sequentially added potassium carbonate (0.26 g, 1.90 mmol) and enol (0.12 mL, 1.14 mmol) at room temperature. The resulted reaction mixture was stirred at 80 0C for 2 h. The reaction e was filtered h celite bed and the collected filtrate was concentrated under reduced pressure to get crude 13 as yellow oil. The crude mixture was subjected to reverse phase chromatography to yield 13 (0.4 g, 84.9%) as a light yellow solid. MS (EST—MS): m/z calcd for C53HszN1209 [MH]+ 1391.86, found 1392.3. 2017/040514 Scheme: Synthesis of ARK-81 F: : :F 0 MN” F F do BDCHN y) 0W0 N’éo BOCHNW\/\gNH Wartype-Z BOCHNWNHC HBOC6 NH 6/60 0 ElocHN/VVW WNHBUC | 00 0 NH nt-A \N Step -14 o8 /\/ 8 o\/‘O o 0 fill d) \ N3 ”$0 a (13) MW: 1390.86 (14) mw- 1523 89 Step -15 HCI in dioxane MNH0 w Mme/$9 WNW HZN o 0 NH 0\ S o NZ/CéfoN H \ o ARK-81_HCI_Sa|t MW: 1323.74 o FjgF Ho‘n/\ dk + EDCHCLTHF O N O —> O F :IEE:)[:6Lrod o I F OH Step-A Warhead-2 d2-_lnt-A MW 417.03 Perfluorophenyl 2-((1-methyl-2,4-dioxo-1,4-dihydro-2H-benzo[d][1,3]0xazin yl)0xy)acetate, Int-A.

To a solution of Warhead-2 (0.048 g, 0.19 mmol) in tetrahydrofuran (1 mL) was added N—(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (0.037 g, 0.19 mmol) at 0 °C under nitrogen atmosphere. The reaction mixture was stirred at 0 °C for 10 min. To this, a solution of pentafluorophenol (0.036 g, 0.19 mmol) in tetrahydrofuran (0.5 mL) was added drop wise at O 0C under nitrogen here. The resulted reaction mixture was further stirred at 0 °C for l h. The reaction mixture was directly used in the next step without work up and isolation.

MS (ESI—MS): m/z calcd C17H8F5N06 [MH]+ 418.03, the compound did not show mass WO 06074 se. Note: Intermediate-A was not isolated — the reaction mass was transferred as such to the next step reaction mass.

] Tri—tert—butyl (((9-(1-((ZS,4S)azido(2-((1-methyl-2,4-di0xo-1,4-dihydro-2H- benzo [d] [1,3]oxazinyl)0xy)acetyl)pyrrolidinyl)—2,1 l-dimethyl-1,12-di0x0—5,8-di0xa- 2,11-diazatetradecanyl)—9,10-dihydr0-9,10—[1,2]benzenoanthracene—2,7,15- triyl)tris(azanediyl))tris(8-0x00ctane-8,1-diyl))tricarbamate, 14.

To a solution of (((9-(3-((2-(2-((ZS,4S)azido—N—methylpyrrolidine-2— carboxamido)ethoxy)ethyl) (methyl)amino)-3 -oxopropyl)—9, l 0-dihydro- 9, l0[l,2]benzenoanthracene-2,7, l l)tris(azanediyl)) tris(8-oxooctane-8, l-diyl))tricarbamate (13) (0.27 g, 0.19 mmol) in tetrahydrofuran (4 mL) was added solution of pentafluorophenyl [(l -methyl-2,4-dioxo- l ,4-dihydro-2H—3, l -benzoxazinyl)oxy]acetate (Warhead_type_2_lnt_A) (0.081 g, 0.19 mmol) and the resulted reaction mixture was stirred for l h at room temperature. The reaction mixture concentrated under reduced pressure to get crude 14 (0.3 g, 80.21 %) as brown solid which was used in the next step without further purification. MS (ESI-MS): m/z calcd C86H121N13018 [MH]+ 1623.89, found 1525.46 (M-100, one Boc group fell off). "-(9-(1-((ZS,4S)azido(2-((1-methyl-2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]0xazinyl)oxy)acetyl)pyrrolidinyl)—2, 1 l-dimethyl-l ,12-dioxo—5,8-dioxa- 2,11-diazatetradecanyl)—9,10-dihydr0-9,10-[1,2]benzenoanthracene—2,7,15-triyl)tris(8- aminooctanamide), ARK-81_HCl salt.

To a solution of tri-tert-butyl (((9-(1-((ZS,4S)azido-l-(2-((l-methyl-2,4-dioxo-l,4- dihydro-2H-benzo[d] [ l ,3]oxaziny1)oxy)acetyl)pyrrolidin-Z-yl)-2, l l-dimethyl-1,12-dioxo-5,8- 2,l l-diazatetradecan-l4-yl)-9, lO-dihydro-9, 10-[l,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))t1is(8-oxooctane-8,l-diyl))tricarbamate (14) (0.3 g, 0.0018 mmol) in ydrofuran (5.0 mL) was added 4 M HCl in dioxane solution (2 mL) at room ature and the ed reaction mixture was stirred for 4 h under nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure to get crude ARK-81_HCl_Salt as a yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure ARK-81_HCl salt (0.034g, 12.8%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 6 9.94 ppm (3H, br S), 7.79—7.86 ppm (8H, m), 7.66 ppm (2H, S), 7.43 ppm (1H, S), 7.31-7.18 ppm (7H, m), 6.88—6.82 ppm (1H, m), 6.78—6.76 ppm (1H, m), 5.38 ppm (1H, S), 5.11-5.02 ppm (1H, m), 4.80 ppm (1H, br S), 4.36-4.31 ppm (1H, m), 4.03-4.01 ppm (1H, m), 3.62-3.42 ppm (15H, m), 3.37-3.26 ppm (4H, m), 3.16 ppm (1H, s), 3.05-2.99 ppm (5H, m), 2.89 ppm (1H, s), 2.81— 2.71 ppm (7H, m), 2.24 ppm (6H, S), 1.53-1.52 ppm (12H, (1), 1.26 ppm (18H, S). MS (ESI— MS): m/z calcd for C71H97N13012 [MH]+1323.74, found 1325.4.

Method for ative HPLC: (A) 0.05% HCl in water (HPLC GRADE) and (B) 100% acetonitrile (HPLC GRADE), using X-SELECT C18, 250mm*19mm*5nm with the flow rate of /min and with the following gradient: __E_ ——m_ 2017/040514 Scheme: Synthesis of ARK-90 o:s:o BocHNM E: 0 NH BOCHNM 0 K O 6 COOH / BOCHNMVVYNHa 69I BocHNWNHC A/NHBOC HAd—ILJfiEiMF o NHWNHBOC —> \ Step -14 (N N\ o H X ofo o ,\/ o S SOZF \N N\ ‘0 hrs/Cf NH (13) o (14) N3 MW: 1390.86 MW: 1604.87 SIBP -15 HCI in dioxane H NMNHQ 2 o HzN/WNHCISQNswwNHz 0‘ SOZF ARK-90_HC| salt MW: 1304.72 Tri—tert—butyl (((9-(1-((2S,4S)—4—azido(3-(4- (fluorosulfonyl)phenyl)propanoyl)pyrrolidinyl)-2,1 l-dimethyl-1,12-diox0-5,8-di0xa-2,1 1- diazatetradecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-ox00ctane-8,1-diyl))tricarbamate, 14.

To a on of tri-tert-butyl 1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,11-dimethyl- 1, 12-dioxo-5,8-dioxa-2,1 1-diazatetradecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene- 2,7,15-triyl)tris(azanediyl))tris(8-oxooctane-8,1-diyl))tricarbamate (13) (0.4 g, 0.29 mmol) in N,N-dimethylformarnide (4 mL) were sequentially added 3-(4—(fluorosulfonyl)phenyl)propanoic acid (0.07 g, 0.29 mmol) and HATU (0.13 g, 0.35 mmol) at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N-diisopropylethylamine (0.08 g, 0.56 mmol) was added drop wise and the resulted reaction mixture was further stirred for 1h at room temperature.

The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice—cold water (3 X 30mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 250C to get crude 14 (0.4 g, 87%) as a brown solid which was used in the next step without further purification. MS (ESI—MS): m/z calcd for C84H121FN12016S [MH]+ 1605.88, found 1506.5 (M-100, one Boc group fell off). ”-(9-(1-((ZS,4S)azido(3-(4- (fluorosulfonyl)phenyl)pr0pan0yl)pyrrolidin-2—yl)—2,1l-dimethyl-1,12—di0x0-5,8-di0xa-2,11- diazatetradecanyl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-amin00ctanamide), ARK-90_HCl salt.

To a solution tri—tert-butyl (((9-(1-((2S,4S)—4-azido—1-(3-(4- (fluorosulfonyl)phenyl)propanoyl)pyrrolidinyl)-2, 1 1-dimethy1— 1 , 12-dioxo-5,8-dioxa-2,l 1- diazatetradecanyl)—9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))t1is(8-oxooctane-8,1—diyl))tricarbamate (14) (0.4 g, 0.0025 mmol) in 1,4- dioxane (5.0 mL) was added 4 M HCl in e (2 mL) at room temperature. The resulting reaction mixture was stirred for 4 hours. The mixture was concentrated under reduced pressure to get crude of ARK-90_HCl_Salt as yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure ARK-90_HCI salt (0.035 g, 7’. 11 %) as yellow solid. 1H NMR (400 MHz, DMSO) 5 9.89 ppm (3H, broad s), 8.03-8.00 ppm (2H, t), .56 ppm (5H, m), 7.29-7.20 ppm (6H, m), 5.33 (1H, s), 3.62-3.52ppm (6H, m) 3.49-3.44 ppm (3H, m), 3.44-3.02 ppm (6H, m), 3.05-2.99 ppm (8H, m), 2.93 ppm (3H, broad s),2.76-2.70 ppm (10H, m), 2.23(6H, s), 1519 (14H, s), 1.52 (21H, s). MS (ESI—MS): m/z calcd for C68H95FNIZOIOS [MH]+. 2, found 1306.3. HPLC retention time: 10.894 min.

Method for preparative HPLC: 0.05% HCl in water (HPLC grade) and (B) 100% itrile (HPLC grade), using WATERS X-BRIDGE C18, 250mm*30mm*5um with the flow rate of 35.0 mL/min and with the following gradient: "turn Scheme: Synthesis of ARK-126 F W o:é:o BocHN b 0 © NH 3 0 BocHNW/\g a QNHWNHBOC HO *0 o: HATU, DMF DIPEA of0 Step -14 N3fit)0N: (13) SOZF MW: 1390.86 (14) MW: 1576.84 Step -15 l HCI in dioxane HZN “ 0 WNH , g o HZN a QNHWNHz SOZF ARK-126_HCI_SaIt MW: 1276.68 Tri-tert—butyl (((9-(1-((ZS,4S)azido-l-(3-(4-(fluor0sulfonyl)benzoyl)pyrrolidin- 2,1l-dimethyl-1,12-di0x0-5,8-di0xa-2,1l-diazatetradecan-l4-yl)-9,10-dihydr0-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris(8-0xooctane—8,l-diyl))tricarbamate, To a solution of rt-butyl (((9-(1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,ll-dirnethyl- 1,12-dioxo-5,8-dioxa-2,1 l-diazatetradecan-l4-yl)-9, lO-dihydro-9, lO-[1,2]benzenoanthracene- 2,7,l5—triyl)tris(azanediyl))tris(8-oxooctane-8,l—diyl))tricarbamate (13) (011 g, 0.072 mmol) in N,N—dimethylformamide (4 mL) were sequentially added 4-fluorosulfonylbenzoic acid (0.018 g, 0.09 mmol) and HATU (0.033 g, 0.09 mmol) at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N—diisopropylethylamine (0.018 g, 0.14 mmol) was added drop wise and the resulted reaction mixture was further stirred for 1h at room temperature. The reaction mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 X 30 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 25 0C to get crude 14 (0.12 g, quantitative yield) as a yellow semi-solid which was used in the next step without further purification. MS (ESI—MS): m/z calcd for C82H117FN12016S [MH]+ 1577.84, found 1478.46(M-100, one Boc group fell off).

N,N’,N”-(9—(1-((2S,4S)—4-azid0(3—(4-(fluorosulfonyl)benzoyl)pyrrolidinyl)- 2,11-dimethyl-1,12-diox0-5,8-di0xa-2,1l-diazatetradecan-l4-yl)—9,10-dihydro-9,10- [1,2]benzenoanthracene-2,7,15—triyl)tris(azanediyl))tris(8-amin00ctanamide), ARK- 126_HCl salt.

To a solution of tri—tert-butyl (((9-(1-((2S,4S)-4—azido-l—(3-(4- (fluorosulfonyl)benzoyl)pyrrolidinyl)—2, 1 1-dimethyl-1,12-dioxo-5, 8-dioxa-2,1 1- diazatetradecan—14-yl)—9,10-dihydro-9,10—[1,2]benzenoanthracene—2,7,15- triyl)tris(azanediyl))tris(8-oxooctane-8,1-diyl))tricarbamate (14) (0.12 g, 0.0007 mmol) in 1,4- dioxane (5.0 mL) was added 4 M HCl in dioxane (2 mL) at room temperature and the resulting reaction mixture was stirred for 4 hours. The mixture was trated under reduced pressure to get crude ARK-126_HCI_Salt as a yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure 6_HCl_Salt (0.03 g, 28.57 %) as a yellow solid. 1H NMR (400 MHz, DMSO) 6 .91 ppm (3H, broad s), 826—813 ppm (2H, m), 7.87 ppm (9H, broad s), 7.78-7.76 ppm (1H, d), 7.67 ppm (3H, broad s), 7.29—7.22 ppm (6H, m), 5.39 ppm (1H, s), 5010-4969 ppm (0.5H, t), 4.86-4.82 ppm (0.5H, m), 4.72-4.60 ppm (1H, m), 4.44- 4.36 ppm (1H, m), 4.30-4.21 ppm (1H, m), 4.14-4.00 ppm (1H, m), 3.64-3.61 ppm (20H, m) 3.48-3.37 ppm (6H, m), .11 ppm (3H, m), 3.07-3.03 ppm (5H, m), .84 ppm (2H, broad s), 2.76 -2.68 ppm (7H, m), 2.26-2.23 ppm (6H, t), 1.53 ppm (12H, s), 1.27 ppm (18H, s).

MS (ESI—MS): m/z calcd for C67H93FN12OIOS [MH]+.1277.68, found 127835.

Method for preparative HPLC: (A) 0.05% HCl in water (HPLC grade) and (B) 100% Acetonitrile (HPLC , using SUFTRE C18, 150mm*19mm*5um with the flow rate of 19.0mL/min and with the ing gradient: __IE_ Example 14: Synthesis of ARK-82, ARK-91, and ARK-127 (Ark000026, Ark000029, and Ark000032) Scheme: Synthesis of 13 o:é:o ‘3 Nosy|\ BOO 53°C N ‘ Nosyl \ /Nv\O/\/O\/\O/\/NH\ HATU, DMF N o N N / wow \/\o/\/ DIPEA ‘ 3TFA, MDC \ I 3 o —> /NH/\o/\/OV\o/\/N ARK-22 Step .10 (10) Step -11 MW:320.23 MW: 643.26 (11) MW: 543.21 Bod-(NM WWNH NH Bod-1N u NHBoc BocHN E a O Int-11 6 HATU, DMF BocHNWVYNHa Q LVWNHBW —>DIPEA 0 NH Step -12 o‘fo o OH OH \Nf ARK-18 o:/ MW: 6 " NosyI/NO 'N; (12) MW: 7 Thiophenol, Step -13 K2003” ACN 60°C H110 N; (13) MW: 1434.89 Tert—butyl (1-((2S,4S)azido((2-nitr0phenyl)sulfonyl)pyrrolidin-Z-yl)—2- methyloxo-5,8,11-trioxaazatridecanyl)(methyl)carbamate, 10.

WO 06074 To a solution of ARK-22 (0.41 g, 1.281 mmol) in N,N—dimethylformamide (10 mL) were sequentially added (2S,4S)azido((2-nitrophenyl)sulfonyl)pyrrolidinecarboxylic acid (0.52 g, 1.54 mmol), HATU (0.584 g, 1.54 mmol) and N,N—diisopropylethylamine (0.33 g, 2.56 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture was poured in ice-cold water and extracted with ethyl e (3 X 100 mL). The organic layers were combined, washed with brine and concentrated under reduced pressure to get crude 10 (0.8 g, 97.2 %).as brown semisolid which was used in next step without further purification. MS S): m/z calcd for C26H41N7OIOS [MH]+ 644.26, found 544.36 (M-100). (2S,4S)—4-azido-N-methyl((2-nitr0phenyl)sulfonyl)—N-(5,8,11-tri0xa decanyl) pyrrolidinecarboxamide_TFA Salt, 11.

To a solution of tri— tert-butyl (1—((2S,4S)—4-azido—1-((2- nitrophenyl)sulfonyl)pyrrolidinyl)methyloxo-5 ,8, 1 1-trioxaazatridecan-13 -yl)(methyl) carbamate (10) (0.8 g, 1.24 mmol) in dichloro methane (10 mL) was added trifluoro acetic acid (0.48 mL, 6.21 mmol) at room temperature. The resulted reaction mixture was stirred at room temperature for 2 h. The reaction e was filtered through celite bed and filtrate thus collected was trated under reduced pressure to get crude 11 (1.05 g, Quantitative yield) as a brown oil which was used without r purification. MS (ESI—MS): m/z calcd for C21H33N7OsSTFA [MH]+ 544.21, found 544.47.

Tri-tert—butyl (((9-(1-((2S,4S)azido((2-nitr0phenyl)sulfonyl)pyrr0lidin yl)—2,14—dimethyl-1,15-di0x0-5,8,11-tri0xa-2,14-diazaheptadecanyl)—9,10-dihydro-9,10- [1,2]benzenoanthracene-2,7,l5-triyl)tris(azanediyl))tris(8-ox00ctane-8,1-diyl))tricarbamate, To a solution of (2S,4S)—4-azido-N-methyl((2-nitrophenyl)sulfonyl)-N-(5,8,11- trioxaazatridecanyl) pyrrolidinecarboxamide_TFA Salt (11) (0.65 g, 0.98 mmol) in N,N-dimethylformamide (4 mL) were tially added 3-(2,7,15-tris(8-((tert- butoxycarbonyl)amino)octanamido)—9,10-[1,2]benzenoanthracen—9(10H)—yl)propanoic acid (ARK-18) (0.9 g, 0.822 mmol), HATU (0.375 g, 0.98 mmol) and N,N—diisopropylethylamine (0.21 g, 1.64 mmol) at room temperature. The resulted reaction mixture was stirred for 1 h at room temperature. The reaction e was poured in ice-cold water and extracted with ethyl WO 06074 acetate (3 X 100 mL). The organic layers were ed, washed with brine and concentrated under reduced pressure to get crude 12. The crude mixture was purified by column chromatography on silica gel (1.5% methanol/chloroform) to get 12 (1.72 g, quantitative yield) as a brown solid which was used in the next step without further ation. MS (ESI—MS): m/z calcd for C83H121N13OISS [MH]+ 1620.87, found 1522.31 (M-100).

Tri—tert—butyl (((9-(1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,14-dimethyl-1,15—di0xo- -tri0xa-2,14-diazaheptadecany1)-9,10-dihydro-9,10-[1,2]benzenoanthracene- 2,7,15-triyl)tris(azanediyl))tris (8-0xooctane—8,1-diyl))tricarbamate, 13.

To a solution of tri-tert-butyl (((9-(1—((2S,4S)azido((2- nitrophenyl)sulfonyl)pyrrolidinyl)-2,l4-dimethyl-l,15—dioxo-5,8, l l-trioxa-2,14— diazaheptadecan-l7-yl)-9,10-dihydro-9,10-[1,2] benzenoanthracene—2,7, 15- triyl)tris(azanediyl))t1is(8—oxooctane-8,l—diyl))tricarbamate (12) (0.7 g, 0.43 mmol) in itrile (60 mL) were sequentially added potassium carbonate (0.29 g, 2.16 mmol) and thiophenol (0.13 mL, 1.296 mmol) at room temperature. The resulted on mixture was stirred at 80 °C for 2 h. The reaction mixture was filtered through celite bed and the collected filtrate was concentrated under reduced pressure to get crude 13 as yellow oil. The crude mixture was subjected to reverse phase chromatography to yield 13 (0.39 g, 62.9%) as a light yellow solid. The crude was purified by trituration with n—Pentane (to remove unreacted thiophenol) to get 13 (0.39 g, 62.9%) as a yellow solid. MS (ESI—MS): m/z calcd for C77H113N12014[1V1H]+ 1435.89, found 1437.41.

Scheme: Synthesis of ARK-82 BocHNW 0 F s F F F:::F O BocHNWfNH6/ Q WNHBOC owe/CELLOo 0 NH ‘6 ‘ o:( War type-2 Int-A 0f°H SteP -14 09/ ,, N HNO “3 mo ”Q MW: 143489 0%,}! o (14) MW: 1567,92 Step 45l HCI in e ARK-82_HCI_SaIt MW: 1367.76 Horomko F F: : :F o o F F + EDCHCLTHF F Grom’koF o F F o ' OH Step-A o I Warhead-2 Warhead-2_lnt-A MW 417.03 Perfluorophenyl 2-((1-methyl-2,4—di0x0-l,4-dihydr0-2H-benz0[d][1,3]0xazin )acetate, Int-A.

To a solution of Warhead-2 (0.055 g, 0.21 mmol) in ydrofuran (1 mL) was added N—(3-Dimethylaminopropyl)-N’—ethylcarbodiimide hydrochloride (0.047 g, 0.21 mmol) at 0 °C under nitrogen atmosphere. The reaction mixture was stirred at O 0C for 10 min. To this, a solution of pentafluorophenol (0.04 g, 0.21 mmol) in tetrahydrofuran (0.5 mL) was added drop wise at 0 °C under nitrogen atmosphere. The resulted on mixture was further stirred at 0°C for 1 h. The reaction mixture was directly used in the next step without work up and isolation.

MS (ESI-MS): m/z calcd C17HsF5N06 [MH]+ 418.03, the nd did not show mass response. Note: Intermediate-A was not isolated — the reaction mass was transferred as such to the next step reaction mass.

] Tri—tert—butyl (((9-(1-((2S,4S)azido(2—((1-methyl-2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]oxazin yl)0xy)acetyl)pyrrolidin-Z-yl)—2,l4-dimethyl-1,15-di0xo-5,8,1 1- trioxa-2,14-diazaheptadecanyl)-9,10-dihydr0-9,10—[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-0xooctane-8,1-diyl))tricarbamate, 14.

To a solution of tri-tert-butyl (((9-(1—((2S,4S)—4-azidopyrrolidinyl)—2,14-dimethyl- 1,15-dioxo-5,8,1 1-trioxa-2,14-diazaheptadecanyl)-9,10-dihydro-9,10- enzenoanthracene—2,7,15-triyl)tris(azanediyl))tris (8-oxooctane-8,1—diyl))t1icarbamate (13) (0.3 g, 0.21 mmol) in tetrahydrofuran (4 mL) was added solution of pentafluorophenyl [(1- methyl-2,4-dioxo-1,4-dihydro-2H—3,1-benzoxazin—7-yl)oxy]acetate (Warhead_type_2) (0.087 g, 0.21 mmol) and the resulted reaction mixture was stirred for 1 h at room temperature. The reaction mixture concentrated under reduced pressure to get crude 14 (0.54 g, Quantitative yield) as brown solid which was used in the next step without further ation. MS (ESI—MS): m/z calcd CssH125N13019 [MH]+ 1668.92, found 1570.41 (M-100, one Boc group fell off).

N,N',N"-(9-(1-((2S,4S)azido(2-((1-methyl-2,4-dioxo-1,4-dihydro-2H- benzo [d] [1,3]0xazinyl)oxy)acetyl)pyrrolidinyl)—2, 14-dimethyl-1 ,15-dioxo—5,8,1 1- trioxa-2,14-diazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(8-aminooctanamide), _HCl salt.

To a solution of rt-butyl (((9-(1-((2S,4S)—4-azido—1-(2-((1-methyl-2,4-dioxo-1,4- dihydro-2H-benzo[d][1,3]oxazin yl)oxy)acetyl)pyrrolidinyl)-2,14-dimethyl-1,15-dioxo- , 8,1 1-trioxa-2,14-diazaheptadecan-l7-yl)-9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15 - t1iyl)tris(azanediyl))t1is(8-oxooctane-8,1-diyl))tricarbamate (14) (0.54 g, 0.0032 mmol) in tetrahydrofuran (5.0 mL) was added 4 M HCl in dioxane solution (2 mL) at room temperature and the resulted reaction mixture was stirred for 4 h under nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure to get crude ARK-82_HCl_Salt as a yellow solid. The crude e was purified by preparative HPLC using following method to get pure ARK-81_HC1 salt g, 10.2%) as a yellow solid. 1H NMR (400 MHz, 6) 6 9.95 ppm (3H, br S), 7.99 ppm (8H, broad s), 7.90—7.88 ppm (2H, d), 7.66 ppm (3H, broad s), 7.46 ppm (2H, broad s), 7.33 ppm (2H, broad s), 7.28-7.25 ppm (5H, m), 7.23-7.21 ppm (2H, d), 6.89-6.85 ppm (1H, m), 6.78-6.76 ppm (1H, m), 6.55 ppm (2H, broad s), 5.38 ppm (1H, s), 5.12- .00 ppm (2H, m), 4.77 ppm (1H, m), 4.37-4.34 ppm (3H, m), 4.06-4.05 ppm (1H, m), 3.82 ppm (1H, m), 3.63-3.43 ppm (15H, m), 3.09-3.01 ppm (7H, m), 296-294 ppm (1H, d), 2.82-2.80 ppm (1H, d), .64 ppm (7H, m), 2.24 ppm (7H, broad s), 1.54-1.52 ppm (12H, (1), 1.26 ppm (18H, 5). MS (ESI—MS): m/Z calcd for C73H101N13013 [MH]+1368.76, found 137025.

Method for ative HPLC: (A) 0.05% HCl in water (HPLC GRADE) and (B) 100% acetonitrile (HPLC GRADE), using KINETEX BIPHENYL, 250mm*21.2mm*5pm with the flow rate of 20.0 mL/min and with the following gradient: __IE_ 2017/040514 Scheme: Synthesis of ARK-91 COOH HATU, DMF DIPEA Step -14 \NfOH 2.,” HD “3 (13) MW: 1434.89 \% $02F (14) MW: 1648.89 Step -15 j HCI in dioxane ARK-91_HCI_SaIt MW: 1348.74 Tri—tert—butyl (((9-(1-((2S,4S)—4—azid0(3-(4- (fluorosulfonyl)phenyl)propanoyl)pyrrolidin-2—yl)—2,14-dimethyl-1,15-diox0-5,8,1l-trioxa- 2,14-diazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-ox00ctane-8,1-diyl))tricarbamate, 14.

To a solution of tri-tert-butyl (((9-(1-((2S,4S)—4-azidopyrrolidin-Z-yl)—2,l4-dimethyl- l,15-dioxo-5,8,l l-trioxa-Z,14-diazaheptadecan—17-yl)-9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris (8-oxooctane-8,l-diyl))tricarbamate (13) (0.30 g, 0.21 mmol) in N,N-dimethylformamide (6 mL) were sequentially added 3-(4- (fluorosulfonyl)phenyl)propanoic acid (00.058 g, 0.25 mmol) and HATU (0.095 g, 0.25 mmol) 2017/040514 at room temperature. The reaction mixture was stirred for 5 minutes. To this, N,N- diisopropylethylamine (0.054 g, 0.42 mmol) was added dropwise and the ed reaction mixture was further stirred for 1h at room temperature. The on mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 x 30mL). The organic layers were combined, washed with brine and concentrated under reduced pressure at 25 °C to get crude 14 (0.55 g, quantitative yield) as a brown solid which was used in the next step without further purification. MS (ESI-MS): m/z calcd C86H125Fl\112()178[lVH‘I]+ 1649.89, found 1551.29 (M-100, one Boc group fell off).

N,N',N"-(9-(1-((2S,4S)azido(3-(4- (fluorosulfonyl)phenyl)pr0panoyl)pyrrolidinyl)-2,14-dimethyl-1,15—di0xo-5,8,11-tri0xa- 2,14-diazaheptadecanyl)-9,10-dihydr0-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8-aminooctanamide), _HCl salt.

To a solution rt-butyl (((9-(1-((2S,4S)azido—l-(3-(4-(fluorosulfonyl)phenyl) propanoyl)pyrrolidinyl)-2,l4—dimethyl—l,15-dioxo-5, 8,1 l-trioxa-2, l4-diazaheptadecan—l 7-yl)- 9,10-dihydro-9,l0-[1,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8-oxooctane-8,ldiyl ))tricarbamate (14) (0.55 g, 0.0033 mmol) in l,4-dioxane (9.0 mL) was added 4 M HCl in dioxane (4 mL) at room temperature. The resulting reaction mixture was stirred for 4 hours. The mixture was concentrated under reduced pressure to get crude of ARK-91_HCl_Salt as yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure ARK-91_HC] salt (0.09 g, 18.5 %) as yellow solid. 1H NMR (400 MHz, DMSO—d6) 8 9.94 ppm (3H, broad s), 8.04-8.00 ppm (2H, m), 7.96 ppm (6H, broad s), 7.66 ppm (4H, broad s), 7.62- 7.52 ppm (1H, m), 7.31-7.18 ppm (6H, broad s), 5.38 ppm (1H, s), 4.71-4.66 ppm (1H, m), 4.25 ppm (9H, m), 3.40-3.99 ppm (1H, m), .49 ppm (9H, m), 3.44-3.35 ppm (5H, m), 3.31-3.24 ppm (2H, m), 3.16-3.15 ppm (2H, m), .00 ppm (6H, m), 2.95-2.91 ppm (3H, m), 2.77-2.69 ppm (7H, m), .23 ppm (6H, t), 1.54-1.52 ppm (12H, d), 1.26 ppm (18H, broad s). MS (ESI—MS): m/z calcd for C71H101FN120118 [MH]+ 1349.74, found 8.

Method for preparative HPLC: (A) 0.05% HCl in water (HPLC GRADE) and (B) 100% acetonitrile (HPLC GRADE), using X-SELECT C18, 250mm*30mm,5um with the flow rate of 23.0mL/min and with the following gradient: 2017/040514 Scheme: Synthesis of ARK-127 a HNWNH‘ Exocr-Ir\1/\/\/\/\(r 09 C?» ,F /\/\/\/\/NH 0 H000 EUCHN/VWY Q EccHN U\/\/\/\/NHE°° g HWNHBDc O NH HATU, DMF DIPEA Step -14 NAB \ 0H \Nk/‘O ANf 0d, HN "N3 (13) \ MW: 9 0:350 F (14) MW: 1620,87 Step -15 l HCI in dinxane ARK-127_HCI_SaIt MW: 1320.71 tri-tert—butyl (((9-(1-((2S,4S)—4-azid0(4—(flu0r0sulfonyl)benzoyl)pyrrolidin yl)—2,14—dimethyl-1,15-di0X0-5,8,1 1-trioxa-2,14-diazaheptadecanyl)-9,10-dihydro-9,10- [1,2]benzenoanthracene-2,7,15-triyl)tris(azanediyl))tris(8-0x00ctane-8,1-diyl))tricarbamate, To a solution of tri-tert-butyl (((9-(1—((2S,4S)—4-azidopyrrolidin-Z-yl)—2, 14-dimethy1- 1,15-dioxo-5,8,1 l-trioxa-Z,14-diazaheptadecany1)-9,10-dihydro-9,10- [1,2]benzenoanthracene—2,7,15-triyl)tris(azanediyl))tris (8-oxooctane-8,1-diyl))tricarbamate (13) (0.05 g, 0.03 mmol) in N,N-dimethylformamide (2 mL) were sequentially added 4- fluorosulfonylbenzoic acid (0.09 g, 0.04 mmol) and HATU (0.016 g, 0.04 mmol) at room temperature. The on mixture was stirred for 5 minutes. To this, N,N—diisopropylethylamine (0.09 g, 0.14 mmol) was added drop wise and the ed reaction mixture was further stirred for 1h at room temperature. The on mixture was diluted by ethyl acetate (100 mL) and washed with ice-cold water (3 x 30mL). The organic layers were ed, washed with brine and concentrated under reduced pressure at 25 °C to get crude 14 (0.075 g, quantitative yield) as a yellow semi—solid which was used in the next step without further purification. MS (ESI—MS): m/z calcd C84H121FN12017S [MH]+ 1621.87, found 1523.47 (M-100, one Boc group fell off). 4-((2S,4S)—4—azid0-2—(methyl(12-methyl0x0(2,7,15-tris(8- aminooctanamido)—9,l0-[1,2]benzenoanthracen-9(10H)—yl)—3,6,9-trioxa azapentadecyl)carbamoyl)pyrrolidinecarbonyl)benzenesulfonyl fluoride, ARK-127_HCl salt.

To a on of tri-tert-butyl (((9-(1-((2S,4S)azido-l-(4- (fluorosulfonyl)benzoyl)pyrrolidinyl)—2,14-dimethyl-1,15-dioxo—5, 8,1 l—trioxa-2, 14- diazaheptadecan-l7-yl)—9,10-dihydro-9,10-[1,2]benzenoanthracene-2,7,15- triyl)tris(azanediyl))tris(8—oxooctane-8,1—diyl))tricarbamate (14) (0.075 g, 0.0005 mmol) in 1,4- dioxane (3.0 mL) was added 4 M HCl in dioxane (1 mL) at room temperature and the resulting on mixture was stirred for 4 hours. The mixture was concentrated under reduced re to get crude ARK-127_HC1_Salt as a yellow solid. The crude mixture was purified by preparative HPLC using following method to get pure ARK-127_HC1_Salt (0.014g, 21.2%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 9.89 ppm (3H, broad s), 8.26-8.22 ppm (1H, m), 8.16 ppm (1H, m), 7.89-7.85 ppm (9H, m), 7.75 ppm (1H, m), 7.69-7.66 ppm (3H, m), 7.29-7.22 ppm (5H, m), 5.38 ppm (1H, s), 4.99-4.87 ppm (2H, m), 4.39-4.38 ppm (1H, m), 4.28-4.16 ppm (1H, m), 4.05-4.02 ppm (1H, m), 3.81-3.74 ppm (1H, m), 3.64-3.52 ppm (9H, m), 3.38-3.28 ppm (7H, m), .99 ppm (8H, m), 2.76-2.65 ppm (8H, m), .23 ppm (5H, t), 1.54 ppm (11H, broad s), 1.27 ppm (18H, broad 5). MS (ESI—MS): m/z calcd for C69H97FN12OIIS [MH]+ 1321.71, found 1322.42.

Method for preparative HPLC: WO 06074 (A) 005% HCl in water (HPLC grade) and (B) 100% Acetonitrile (HPLC grade), using SUNFIRE C18, 250mm*l9mm*5um with the flow rate of 20.0mL/min and with the following gradient: __II_ ——m_ Example 15: ation of CPNQ Analogues and Other Quinoline—Based Ligands Exemplary small molecule ligands based on CPNQ and other quinoline scaffolds were prepared based on the tic schemes shown in s 63-71. Analytical data for the prepared compounds are shown below in Table 5.

Table 5: Analytical Data for CPNQ Analogues and Quinoline—Based Ligands Target Mol. HPLC HPLC LCMS LCMS ID Weight RT Purity RT Purity DMSO-d6: 6 9.04-9.03 ppm (1H, dd, J: 4, 1.6 Hz), 8.66-8.63 ppm (1H, J: 8.4, 1.2 Hz), 8.26-8.24 ppm (1H,d, J=8.4 Hz), 7.73-7.70 ppm (1H, dd, J: 8.4, 4 Hz), 7.53- 7.47 ppm (4H, m), 7.26-7.24 6.902 97.56/oo ppm (1H, d, J=8.4 Hz),3.96 ppm ARK-131 620.3 621.69 95.7860 min (2H, br s), 3.64 ppm (4H, brs), 3.51 ppm (3H, m), 3.43-3.39 ppm (2H, m), 3.30 ppm (2H, m), 3.23-3.18 ppm (4H, m), 2.99- 2.95 (3H, m), 2.89-2.79 ppm (5H, m), 1.38-1.37 ppm (9H, d, J=5.6 Hz). 6: 6 9.03 ppm (1H, br s), 8.76-8.74 ppm (1H, d, J=8.4 Hz), 8.21-8.19 ppm (1H, d, J=8 Hz), 7.74-7.72 ppm (1H, m),7.58-7.53 ppm (4H, m), 7.31- 7.30 ppm (1H, d, J=6 Hz), 4.67 7 792 ARK-137 654.26 655.64 min 97.73% 96.05% ppm (1H, br s), 4.28 ppm (1H, br s), 3.97-3.91 (1H, m), 3.71 ppm (3H, br s), 3.59 ppm (1H, br s), 3.46 ppm (1H, brs), 3.28-3.10 ppm (6H, m), 2.96-2.94 ppm (2H, br s), 2.79-2.68 ppm (5H, m), 1.39-1.35 ppm (9H, d, Mol. HPLC HPLC LCMS LCMS ID Weight RT Purity RT Purity J=15.2 Hz).

D20: 6 7.66-7.64 ppm (2H, d, J=7.6 Hz), .49 ppm (1H, t, J: 14.8, 7.6 Hz), 7.43-7.39 ppm (2H, t, J: 15.2, 7.6 Hz), 3.40- ARK-138 249.18 3.36 ppm (2H, m), 3.25-3.18 ppm (2H, m), 3.16-3.09 ppm (2H, m), 2.99-2.96 ppm (2H, t, J: 15.2, 7.6 Hz), 2.80 ppm (3H, s), 2.06-1.94 ppm (4H, m).

DMSO-d6: 6 9.05-9.04 ppm (1H, dd, J=4, 1.6 Hz), .65 ppm (1H, dd, J=8.4, 1.2 Hz), 8.28-8.25 ppm (1H, d, J=8.4 Hz), ARK-179 396.1 95.09% .71 ppm (1H, dd, J=8.8, 4.4 Hz), 7.57-7.51 ppm (4H, m), 7.26-7.24 ppm (1H, d, J=8.4 Hz), 3.94 ppm (2H, br s), 3.65 ppm (2H, br s), 3.21 ppm (4H, br s).

DMSO-d6: 6 9.04-9.03 ppm (1H, dd, J=4.4, 1.6 Hz), 8.65- 8.63 ppm (1H, dd, J=8.8, 1.6 Hz), 8.25-8.23 ppm (1H, d, J=8.4 Hz),7.73-7.70 ppm (1H, dd, ARK-180 380.13 381.39 67.91 96.24% 4.185 98.46% mln J=8.8, 4 Hz), 7.58-7.55 ppm (2H, m), .29 ppm (2H, m), 7.26- 7.24 ppm (1H, d, J=8.4 Hz), 3.93 ppm (2H, br s), 3.67 ppm (2H, br s), 3.19 ppm (4H, br s).

DMSO-d6: 6 9.04-9.03 ppm (1H, dd, J=4, 1.6 Hz), 8.65-8.63 ppm (1H, dd, J=8.8, 1.6 Hz), 8.25-8.23 ppm (1H, d, J=8.4 7.404 Hz),7.73-7.69 ppm (3H, m), ARK-181 440.04 441.4 97.43% 96.33% in 7.46-7.44 ppm (2H, dd, J=6.8, 1.6 Hz ), 7.26-7.23 ppm (1H, d, J=8.4 Hz), 3.94 ppm (2H, brs), 3.64 ppm (2H, brs), 3.21-3.17 , .

DMSO-d6: 6 9.04-9.03 ppm (1H, d, J=2.8 Hz), 8.67-8.65 ppm (1H, d, J=8.8 Hz), 8.26-8.24 ppm (1H, d, J=8.4 Hz), 7.74-7.71 ppm ARK-182 392.15 96.87% 99.00% (1H, dd, J=8.8, 4.4 Hz), 7.47- 7.44 ppm (2H, d, J=8.8 Hz), 7.26-7.24 ppm (1H, d, J=8.4 Hz), 7.03-7.01 ppm (2H, d, J: 8.4 Hz), 3.83-3.81 ppm (2H, d, J=6.4 Mol. HPLC HPLC LCMS LCMS ID Weight RT Purity RT Purity Hz), 3.19 ppm (4H, brs), 2.55 ppm (3H, 3)- DMSO-d6: 6 9.04-9.03 ppm (1H, dd, J=4, 1.2 Hz), 8.66-8.63 ppm (1H, dd, J=8.8, 1.6 Hz), 8.25-8.23 ppm (1H, d, J=8 Hz), 6.650m 7.73-7.70 ppm (1H, dd, J=8.4, 4 ARK-183 in Hz), 7.51-7.47 ppm(5H, br s), 7.26-7.24 ppm (1 H, dd, J=8.4 Hz), 3.95 ppm (2H, brs), 3.65 ppm (2H, br s), 3.20-3.19 ppm 4H, br s . 6: 6 .03 ppm (1H, dd, J=4, 2.8 Hz), 8.65-8.63 ppm (1H, d, J=8.4 Hz), 8.26-8.24 ppm (1H, d, J=8.4 Hz), 7.80-7.71 7 5:3 ARK-184 430.06 431.35 96.37% 98.88% ppm (3H, m), 7.51-7.48 ppm(1H, dd, J=8, 1.6 Hz), 7.26-7.24 ppm (1H, d, J=8.4 Hz), 3.94 ppm (2H, br s), 3.64 ppm (2H, br s), 3.22 (2H, 8), 3.16 ppm (2H, S).

DMSO-d6: 6 9.04-9.03 ppm (1H, dd, J=4, 1.6 Hz), 8.65-8.63 ppm (1H, dd, J=8.4, 1.6 Hz), 8.25-8.23 ppm (1H, d, J=8 Hz), 7.73-7.70 ppm (1H, dd, J=8.8, 7 010 ARK-185 369.09 397.45 96.30% 4.4 Hz), .54 ppm (2H, m), 7.52-7.50 ppm (1H, m), 7.46- 7.44 ppm (1H, m), 7.26-7.24 ppm (1H, d J=8.4 Hz), 3.95 ppm (2H, br s), 3.63 ppm (2H, br s), 3.23-3.17 ppm (4H, br d).

DMSO-d6: 6 9.00-8.99 ppm (1H, dd, J=4, 1.2 Hz), 8.52-8.50 ppm (1H, dd, J=8.4, 1.6 Hz), 8 050 8.23-8.21 ppm (1H, d, J=8.4 Hz), ARK-186 432.06 433.39 96.44% m n .79 ppm (4H, m), 7.64- 7.61 ppm (1H, dd, J=8.4, 4 Hz), 7.26-7.24 ppm (1H, d, J: 8 Hz), 3.24 ppm (8H, s).

DMSO-d6: 6 9.03-9.02 ppm (1H, dd, J=4.4, 1.6 Hz), 8.70 ppm (1H, br s), 8.26-8.24 ppm (1H, d, J=8 Hz), 7.71-7.68 ppm (1H, dd, J=8.8, 4.4 Hz), 7.56- ARK-187 426.11 97.61% 99.40% 7.51 ppm (4H, m), 7.39 ppm (1H, br s), 4.62-4.54 ppm (1H, br s), 4.13-4.10 ppm (1H, m), 3.87 ppm (1H, br s), 3.60-3.51 ppm (3H, m), 3.45-3.39 ppm (3H, br Weight HPLC HPLC LCMS RT Purity LgMS Purity s), 3.11 ppm (1H, br s).

DMSO-d6: 6 9.02-8.99 ppm (1H, dd, J=10.4, 3.2 Hz), 8.63- 8.61 ppm (1H, dd, J: 43.6, 8.4 Hz), 8.23-8.20 ppm (1H, m), 7.72-7.62 ppm (1H, m), 7.55- 7.47 ppm (3H, m), 7.41-7.39 ARK-189 98.36% ppm (1H, d, J=8 Hz), 7.28-7.23 ppm (1H, m), 3.93 ppm (1H, br s), 3.85-3.82 ppm (1H, t, J: 11.2, 5.6 Hz), 3.56-3.53 ppm (3H, m), 3.46-3.42 ppm (3H, m), 2.17 ppm (1H, br s), 2.01 ppm (1 H, br s).

DMSO-d6: 6 8.97-8.96 ppm (1H, d, J=2.8 Hz), 8.62-8.60 ppm (1H, d, J: 7.6 Hz), .09 ppm (1H,dd, J: 36, 8.8 Hz), ARK-190 408.1 409.16 6-5.75 97.92% 7.58-7.47 ppm (5H, m), 6.98- 6.81 ppm (1H, m), 4.92-4.78 ppm (1 H, m), 4.41-4.22 ppm (2H, m), 3.81 -3. 59 ppm (3H, m), DMSO-d6. 6 8. 96 ppm (1H, br s), 8.61 ppm (1H, brs), 8.20- 8.09 ppm (1H, m), 7.52 ppm ARK-191 408.1 409.21 65.14 (5H,br s), 6.98-6.82 ppm (1H, 98.38% 98.54% mln m), 4.92-4.78 ppm (1H, m), 4.41- 4.22 ppm (2H, m), 3.79-3.61 ppm , 2.14-2.09 ppm (2H, DMSO-d6: 6 8.66 ppm (1H, s), 8.06-8.04 ppm (1H, d, J=8.4 Hz), 7.87-7.82 ppm (2H, d, J=12.4, ARK-194 352.11 353.44 6-492 99.65% 99.38% mln 8.8 Hz), 7.59-7.51 ppm (5H, m), 3.85 ppm (4H br s), 3.76 ppm DMSO-d6: 6 7. 7 ppm (4H, m), 7.04-7. 00 ppm (1H t , 7.6 Hz), 6.45-6.42 ppm ARK-196 342.11 343.48 7'8.73 (2H, dd, J=8, 3.6 Hz), ,4.50-4.46 96.62% 95.57% mln ppm (2H, t, J=16.8, 8.4 Hz), 3.75 ppm (2H, br s), 3.46 ppm (2H, br s), 3.13-3.09 ppm (2H, t, J: 8.4 Hz), 3.03-2.97 ppm (4H, m).

Example 16: Exemplary Compound Data Additional data for compounds whose preparation is described above as well as ures of further exemplary compounds are provided in Table 6 below. 2017/040514 $5.0:— mmm_>_ cmELccoo — U|_n=._ 1x; wmfim wmdm mm.mm© 3. oode wwm wmdom E. oo.wNm wwm Sam— _0Iv <u_._.m 8.5335 5.56—5.30 «600 :2 Txm< N-xm< 65.2380 6:309:00 «Eu: Noooooxm< woooooxm< has—afioxm «3.? WEUJ wam. 38 UJn—I :9} mm. mm 3.8 sew-mm mm. vm >22 . mvm wow va wow “Cw—Gn— wv >22 No . moo wow mam wow a-GW <n_._.m 6T: “Ghana—Two @600 m- :0_ ¥m< 3?? UCSOQEOU 3562 ¥m< 888x? SS. i, 230205. DE 2E3 31,, Hie» «is, 2017/040514 AgvaQJ cow Nfimm 04;: g wwdm 0N.©m coumm ~52 vvdwv mm NQva Nww Ewan. >>_>_ Nmbov mm 5.0; Nww “.mm _OIN _OI_‘ “88.2.00 280 :o_ m-xm< mix/x 6:309:00 :ooooxmd~ N 2:52 woooo¥m< 230205.

PCT/U52017/040514 AgvaQJ 220m modm 04m: 3 cow vam ;u_am ‘52 Ewan. >>_>_ “.mm _OI© _0Im 00 280 :o_ Kim/x w-xm< 6:309:00 m v 2:52 wooooxm< woooo¥m< 230205. .. vmfim mvwm Qwomw Nmmo Ewan. >22 ww.mwo Nam <u_._.o .00 280 :o_ wo-m.xm< No-m.¥m< 6:38 m m «:82 :50 3008?? 5008?? .35.”,“““““ 230205. .5 \ AgvaQJ cow Risa 04;: g mmdm mafia coumm vodom 0 ~52 Nam _‘ .omw mac Ewan. >>_>_ wwdwo Nam wNo Nmo “.mm _OI© _OIm 00 280 o :o_ Txm< :-xm< 6:309:00 o N 2:52 5008?? 5008?? 230205. I‘ s~«~< WO 06074 PCT/USZOl7/040514 AgvaQJ mw.mm 04m: 3 cow 5.0m couam o ~52 _‘ .omw Nam @093. 005 Ewan. 35. wwd Nmo 005 E Wow: “.mm _OIm we". omma “88.2.00 280 N QLm :o_ Txm< Txm< 6:309:00 w 2:52 5008?? NNoooo¥m< 230205.

PCT/USZOl7/040514 AgvaQJ Nw.wm wmdm 04;: g 56¢ NE®m couam ‘52 90$; worm ow. me voN Ewan. 35. 90mg worm 0v. 5m voN “.mm 92“. ommn we“. ommn “88.2.00 wuoo:o_ ._-m v Txm< Txm< 6:309:00 xm< m mEaz 5008?? 230205.

AgvaQJ :Nm cow 04m: g Nada Nada coumm ‘52 ow. 5m voN demv .30 Ewan. 35. 0v. 5m voN Fwdov vvo “.mm 02“. mmmn _OI_‘ “88.2.00 wuoo:o_ m o Txm< Txm< 6:309:00 mEaz xm< wNooooxm< 230205.

AgvaQJ mvdm 04;: 3 <2 coumm ~52 Odom? m Ewan. >>_>_ mdwmw m “.mm _OIm “88.2.00 280 :o_ ow2m< 6:309:00 2:52 xm< 230205.

PCT/USZOl7/040514 AgvaQJ 54mm 04;: 3 <2 couam ~52 73”: F Ewan. >>_>_ oémmw r “.mm _0Im “88.2.00 280 :o_ Swim? 6:309:00 2:52 xm< 230205.

PCT/USZOl7/040514 AgvaQJ omdm 04;: 3 <2 couam ‘52 thl‘ o Ewan. >>_>_ Qwomw o “.mm _0Im “88.2.00 280 :o_ Nw-xm< 6:309:00 2:52 xm< 230205.

AgvaQJ wmbm 04;: g— coumm ~52 @6wa Nwmw Ewan. m.

. EN? Nwmm “.mm _0Im 00 280 :o_ mm2m< 6:309:00 2:52 NNooooxm< 230205.

PCT/USZOl7/040514 AgvaQJ oofim 04m: 3 <2 couam ‘52 0.9.: wNQN Ewan. 35. @602 wmov “.mm _0Im 00 280 :o_ om2m< 6:309:00 2:52 wNooooxm< 230205.

AgvaQJ @060 04;: 3 <2 coumm ‘52 7mm: a Ewan. >>_>_ odvmw m “.mm _OIm “88.2.00 280 :o_ aim/x 00 2:52 mNooooxm< 230205.

PCT/U52017/040514 AgvaQJ Nofim 04;: g— ;u_am ‘52 ”NE; m.

Ewan. >>_>_ wNMNw m. “.mm _0Im 00 280 mm :o_ Txm< 6:309:00 2:52 omooooxm< 230205. 2017/040514 AgvaQJ mwbm 04;: 3 <2 coumm ~52 70me w Ewan. >>_>_ QONNF w “.mm _OIm “88.2.00 280 mm :o_ Txm< 6:309:00 2:52 Fmooooxmd‘ 230205.

AgvaQJ wimm 04;: 3 <2 coumm ‘52 New: F Ewan. >>_>_ Nommw _. :56 _0Im “88.2.00 280 RN :o_ Txm< 6:309:00 2:52 ¥m< 230205.

AgvaQJ 22mm 04;: 3 <2 coumm ‘52 Tom»; m Ewan. >22 @6me m “.mm _OIm “88.2.00 280 :o_ NWXN?‘ 00 2:52 mmooooxm< 230205.

AgvaQJ dem 04m: 3 <2 coumm ~52 ovm Ewan. >>_>_ QOMNV “.mm _OIm 00 280 :o_ «KNEW—’4 6:309:00 2:52 vmooooxm< 230205.

AgvaQJ vodw 04;: g— coumm ‘52 Two: F Ewan. >>_>_ oémmw _. “.mm _0Im “88.2.00 280 :o_ wwim< 00 2:52 mmooooxm< 230205. 2017/040514 AgvaQJ omafi 04;: g— ;u_am ~52 Twig? o Ewan. >>_>_ Own? 0 “.mm _0Im “88.2.00 280 :o_ mwim< 6:309:00 2:52 omooooxm< 230205.

PCT/U52017/040514 AgvaQJ 22mm 04;: g— ;u_am ‘52 0.022. m Ewan. >>_>_ mdmNF w “.mm _OIm 00 280 :o_ <wNim< 6:309:00 2:52 Nmooooxm< 230205. 2017/040514 AgvaQJ Nwfim 04;: g— coumm ~52 v.3”: v Ewan. >>_>_ 04»wa v “.mm _OIm “88.2.00 280 :o_ <0N2m< 6:309:00 2:52 wmooooxm< 230205.

AgvaQJ “wowfimm 04;: g omfim o\o coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 grim/x mm :o_ Txm< 00 2:52 230205.

PCT/U52017/040514 AgvaQJ 04;: g ;u_am ~52 Ewan. >>_>_ “.mm “88.2.00 280 mm :o_ Txm< 6:309:00 2:52_ . , ’\ \Kin.“ii" PCT/U52017/040514 920.. o._n=._ 3 53am Es.

Ewan. is. “88.2.00 280 vm mm :o_ Txm< TvE< 00 2:52- 230205. \u—u—ue’ 2017/040514 fix; #8 $5.0:— .

UJn—I 3 ES $ cup—mm Es.

“Stan— is.

“Scam—.00 280 :2 022% 55?? UCSOQEOU «=82 (if \ c3“ 3.x z, ‘ .\ 2:00—05— AgvaQJ $08 04m: 3 $08 coumm ~52 NNNNM Ewan. >>_>_ mm.mvm “.mm _OIN 00 280 mm mm ow :o_ Txm< Txm< Txm< 6:309:00 2:52 mmooooxm< Z//(\\\/XI\\Z 23205. “ \x 2/{Xi/{KXZUm WO 06074 grim/x NV mv 3.

Txm< Txm< Txm< 230205. $920..0 9:: 3 seam Es.

Ewan. is. “.mm “Scam—.00 280 mv 0v t. :o_ Txm< Txm< Txm< 00 «:82 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “88.2.00 280 wv av om :o_ Txm< Txm< Txm< Swim/x 00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm 00 280 mm mm vm mm :o_ Txm< Txm< Txm< Txm< 6:309:00 2:52 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 om. mm mm mm :o_ Txm< Txm< Txm< Txm< 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “Scam—.00 280 oo Po No mm :o_ Txm< Txm< Txm< Txm< 00 2:52 230205.

WO 06074 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “Scam—.00 280 v0 mo ow :o_ Txm< Txm< Txm< 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm .00 280 no mm mo :o_ Txm< Txm< Txm< 6:309:00 «:82 230205. 2017/040514 AgvaQJ 04;: g ;u_am ~52 E25". 35. “.mm “Scam—.00 280 ow E NF :o_ Txm< Txm< Txm< 6:309:00 «:82 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “Scam—.00 280 mK vn mp :o_ Txm< Txm< Txm< 6:309:00 «:82 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “Scam—.00 280 ow N5 wn :o_ Txm< Txm< Txm< 00 «:82 230205.

AgvaQJ mm “wooiwm 04;: 3 £009. vwdm o\o coumm ‘52 ©va Ewan. 35. Town “.mm _OI_. “88.2.00 280 an om :o_ Txm< Txm< 6:309:00 2:52 230205.

AgvaQJ $mm©m Rhoda 04;: § mvfim $ Nwém o\o coumm >>_>_ mofimv Ewan. >>_>_ mfimmm “.mm _OI_‘ “88.2.00 280 $7¥m< mm :o_ Txm< 00 2:52 230205. 2017/040514 AgvaQJ $00? o\oww.wm 04m: 3 $09. ombm o\o coumm ‘52 Ewan. >>_>_ “.mm “88.2.00 280 mm vw :o_ Txm< Txm< 6:309:00 2:52 230205. 2017/040514 AgvaQJ 04;: § mom g . coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 mm om :o_ Txm< Txm< 6:309:00 2:52 230205. 2017/040514 920.. $ovdm . 8.8 “88.2.00 280 km mm :o_ Txm< Txm< 6:309:00 2:52 230205.

AgvaQJ o\onNm 04m: 3 $03 coumm ‘52 Ewan. >>_>_ “.mm 00 280 mm om :o_ Txm< Txm< 6:309:00 2:52 230205. 2017/040514 920.. $¢m.wm . 8.8 >>_>_ “88.2.00 280 Swim? No :o_ Txm< 6:309:00 2:52 230205. 2017/040514 AgvaQJ $wmdm 04;: g modm o\o coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 mm vm :o_ Txm< Txm< 6:309:00 2:52 230205. 2017/040514 §va3 $5.8 o._n=._ 5.A9 No.8 o\o Exam. Es.

Ewan. is. -___— :Nvm “88.2.00 wu0o:0_ 87x? 83$? 6:309:00 @EG 230205. “88.2.00 280 mm wm :o_ Txm< Txm< 00 2:52 230205.

ZOl7/040514 AgvaQJ 04;: g couam ~52 Ewan. >>_>_ “.mm “88.2.00 280 mm :o_ Txm< oom-xm_< 6:309:00 2:52 230205. ¢:\\\\m., \ 3%. 3K}. ‘ IE§ .

\ \.... AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm 00 280 :o_ Swim? 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ < momim? 6:309:00 2:52 230205.

PCT/U52017/040514 920.. 01E: :x. 55m Es.

Ewan. 35. “.mm 00 280 :o_ vomim< 6:309:00 2:52- 230205.

PCT/U52017/040514 AgvaQJ 04;: g ;u_am ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ moN-xm< ooN-xm< 00 2:52 230205.

WO 06074 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ Nomimd‘ 6:309:00 2:52 \xm,/xx /.n\“I ,8 \Mf? 238.05. may]. .rzK~\\. w /:::%. .Xa\>/,sx\\0fi »/ Ox P\.. mi v Y a 2x G \ZI “2.;{\2uvw\.zfW AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm 00 280 :o_ woN-xm_< 6:309:00 2:52 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ momim? 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 o :o_ aim/x 00 2:52_ 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm 00 280 :o_ :N-xm< 6:309:00 2:52- 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ NFNim/x 6:309:00 2:52 230205.

PCT/USZOl7/040514 AgvaQJ 04;: g couam ~52 Ewan. >>_>_ “.mm 00 280 m :o_ Kim/x 6:309:00 2:52 Mafia \ «9....

{K /Vtt§m« VAN.“ aim. 1m, Q w: 3 a“ \V\/ .V.:./\ 23205. W“ we... 3 .«W . “Ram w: MUM xxM»axx:xm:\wfifin‘x.1 ”xix \33, AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm 00 280 :o_ VFNENZ 6:309:00 2:52_ 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 m :o_ wNim/x 6:309:00 2:52_ 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ _< 6:309:00 2:52_ 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “88.2.00 280 N :o_ FN-¥N_< 00 2:52_ 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 m :o_ aim/x 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 m :o_ aim/x 00 2:52_ 230205.

WO 06074 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ CNNim/x 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ x 6:309:00 2:52 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ NNNim< 6:309:00 2:52_ 230205.

WO 06074 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ mmmim< 6:309:00 2:52 230205.

WO 06074 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ VNNim/x 6:309:00 2:52 230205.

AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ mNN-xm_< 00 2:52 230205. 2017/040514 AgvaQJ 04;: g coumm ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ ONNim/x 6:309:00 2:52 230205.

WO 06074 PCT/USZOl7/040514 AgvaQJ 04;: g couam ~52 Ewan. >>_>_ “.mm “88.2.00 280 :o_ NNNim< 6:309:00 2:52 230205.

Example 17: RNA Sequences Prepared The following RNA sequences were designed and prepared for use in testing compound binding (including verifying the ed binding mode or identifying the binding mode, when not known) and validating the methods of the t invention.

Table 7: RNA Sequences ed RNA Length Modifications Sequence (5' to 3') Designation (nt) GCUGCCGGGACGGGUCCAAGAUGGA CGGCCGCUCAGGUUCUGCUUUUACC UGCGGCCCAGAGCCCCAUUCAUUGC CCCGGUGCUGAGCGGCGCCGCGAGU CGGCCCGAGGCCUCCGGGGACUGCC GUGCCGGGCGGGAGACCGCCAUGGC GACCCUGGAAAAGCUGAUGAAGGCC Exon 1 of the UUCGAGUCCCUCAAGUCCUUCCAGC HTTmRNA AGCAGCAGCAGCAGCAGCAGCAGCA HTT.EXOn1.41 ww41CAG GCAGCAGCAGCAGCAGCAGCAGCAG repeats (HD CAGCAGCAGCAGCAGCAGCAGCAGC disease) AGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAACAG CCGCCACCGCCGCCGCCGCCGCCGC CGCCUCCUCAGCUUCCUCAGCCGCC GCCGCAGGCACAGCCGCUGCUGCCU CAGCCGCAGCCGCCCCCGCCGCCGC CCCCGCCGCCACCCGGCCCGGCUGU GGCUGAGGAGCCGCUGCACCGACC GCUGCCGGGACGGGUCCAAGAUGGA CGGCCGCUCAGGUUCUGCUUUUACC UGCGGCCCAGAGCCCCAUUCAUUGC CCCGGUGCUGAGCGGCGCCGCGAGU CGGCCCGAGGCCUCCGGGGACUGCC GUGCCGGGCGGGAGACCGCCAUGGC GACCCUGGAAAAGCUGAUGAAGGCC Exon 1 of the UUCGAGUCCCUCAAGUCCUUCCAGC HTTmRNA AGCAGCAGCAGCAGCAGCAGCAGCA HTT.Ex0n1.41 ww41CAG GCAGCAGCAGCAGCAGCAGCAGCAG CAG_5Bio s (HD CAGCAGCAGCAGCAGCAGCAGCAGC dbease) AGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAACAG CCGCCGCCGCCGCCGCCGC CGCCUCCUCAGCUUCCUCAGCCGCC GGCACAGCCGCUGCUGCCU CAGCCGCAGCCGCCCCCGCCGCCGC CCCCGCCGCCACCCGGCCCGGCUGU GGCUGAGGAGCCGCUGCACCGACC RNA L72?" Modifications Sequence (5‘t0 3') Designation GCUGCCGGGACGGGUCCAAGAUGGA CGGCCGCUCAGGUUCUGCUUUUACC UGCGGCCCAGAGCCCCAUUCAUUGC GCUGAGCGGCGCCGCGAGU CGGCCCGAGGCCUCCGGGGACUGCC GUGCCGGGCGGGAGACCGCCAUGGC Exon 1 ofthe GACCCUGGAAAAGCUGAUGAAGGCC HTT mRNA UUCGAGUCCCUCAAGUCCUUCCAGC HTT.Ex0n1.17 with 17 CAG AGCAGCAGCAGCAGCAGCAGCAGCA repeats GCAGCAGCAGCAGCAGCAGCAGCAA (healthy) CAGCCGCCACCGCCGCCGCCGCCGC CGCCGCCUCCUCAGCUUCCUCAGCC GCCGCCGCAGGCACAGCCGCUGCUG CCUCAGCCGCAGCCGCCCCCGCCGC CGCCCCCGCCGCCACCCGGCCCGGC UGUGGCUGAGGAGCCGCUGCACCGA GCUGCCGGGACGGGUCCAAGAUGGA CGGCCGCUCAGGUUCUGCUUUUACC UGCGGCCCAGAGCCCCAUUCAUUGC CCCGGUGCUGAGCGGCGCCGCGAGU CGGCCCGAGGCCUCCGGGGACUGCC GUGCCGGGCGGGAGACCGCCAUGGC Exon 1 ofthe GACCCUGGAAAAGCUGAUGAAGGCC HTT mRNA UUCGAGUCCCUCAAGUCCUUCCAGC on1.17 with 41 CAG AGCAGCAGCAGCAGCAGCAGCAGCA CAG_5Bio repeats GCAGCAGCAGCAGCAGCAGCAGCAA (healthy) CAGCCGCCACCGCCGCCGCCGCCGC CUCCUCAGCUUCCUCAGCC GCCGCCGCAGGCACAGCCGCUGCUG CCUCAGCCGCAGCCGCCCCCGCCGC CGCCGCCACCCGGCCCGGC UGUGGCUGAGGAGCCGCUGCACCGA Portion of the GCAGCAGCAGCAGCAGCAGCAGCAG 41CAG HTT CAGCAGCAGCAGCAGCAGCAGCAACA AG_3 RNA having GCCGCCACCGCCGCCGC WJ_SBio the 3-way junction Portion of the GCAGCAGCAGCAGCAGCAGCAGCAG HTT17CAG_in 17CAG HTT CAGCAACAGCCGCCACCGCCGCCGC ternalbulge_5B RNA having CGCCGCCGCCGCCU io the internal bulge 220AG_hairpi A hairpin CAGCAGCAGCAGCAGCAGCAGCAGC n_SBio consisting of a AGCAGCAGCAGCAGCAGCA pure stretch of RNA Length Modifications Sequence (5' to 3') Designation (nt) Portion of the GCAGCAGCAGCAGCAGCAGCAGCAG 41CAG HTT CAGCAGCAGCAGCAGCAGCAGCAACA HTT41CAG_3 RNA having ACCGCCGCCGC the 3-way junction Portion of the GCAGCAGCAGCAGCAGCAGCAGCAG 17CAG HTT CAGCAACAGCCGCCACCGCCGCCGC HTT17CAG_in RNA having CGCCGCCGCCGCCU ternalbulge the internal bulge A hairpin CAGCAGCAGCAGCAGCAGC 22CAG_hairpi consisting of a AGCAGCAGCAGCAGCAGCAGCAGCA n pure stretch of GCAGCAGCAGCAGCAG 22 CAGs GAGCCUAAAACAUACCAGAGAAAUCU Tetracycline Tetracycline GGAGAGGUGAAGAAUACGACCACCUA Aptamer binding RNA GGCUC 0.0.0 GGCACAAAUGCAACACUGCAUUACCA _0.0. 38 n Triptycene 3- UGCGGUUGUGCC Way Junction 0.0.0 GGCACAAAUGCAACACUGCAUUACCA Triptycene 3- UGCGGUUGUGCC RNA3WJ_0.0. 5' Iowa Black; Way on 0_5|B_3FAM 3' 6FAM with fluorophore & quencher 0.0.0 GGCACAAAUGCAACACUGCAUUACCA Triptycene 3- UGCGGUUGUGCC RNA3WJ_0.0. Way Junction 3' 6FAM 0_3FAM with fluorophore but no quencher 1.0.0 GGCACACAAUGCAACACUGCAUUACC Triptycene 3- AUGCGGUUGUGCC RNA3WJ_1 .o. 5' Iowa Black; Way Junction 0_5|B_3FAM 3' 6FAM with fluorophore & quencher _1 .1 .

' Iowa Black; 1.1.0 GGCACACAAUGCAACACUGCAUUGAC 0_5|B_3FAM 3' 6FAM Triptycene 3- CAUGCGGUUGUGCC Way Junction RNA Length Modifications ce (5' to 3') Designation (nt) with fluorophore & quencher 2.0.0 GGCACACGAAUGCAACACUGCAUUAC cene 3- CAUGCGGUUGUGCC RNA3WJ_2.0. 5' Iowa Black; Way Junction 0_5|B_3FAM 3' 6FAM with fluorophore & quencher 1.1.1 GGCACACAAUGCAACACUGCAUUGAC Triptycene 3- CAUGCGGUAUGUGCC RNA3WJ_1 .1 .

' Iowa Black; Way Junction 3FAM 3' 6FAM with fluorophore & 2.1.0 GGCACACGAAUGCAACACUGCAUUGA Triptycene 3- CCAUGCGGUUGUGCC RNA3WJ_2.1.

' Iowa Black; Way Junction 0_5|B_3FAM 3' 6FAM with fluorophore & quencher 3.0.0 GGCACACAGAAUGCAACACUGCAUUA Triptycene 3- CCAUGCGGUUGUGCC RNA3WJ_3.0. 5' Iowa Black; Way Junction 0_5|B_3FAM 3' 6FAM with fluorophore & quencher 0.0.0 GGCACAAAUGCAAC Triptycene 3- Split3WJ.1_up ' Iowa Black Way Junction _5IB split at first Ioop;5'end 0.0.0 ACUGCAUUACCAUGCGGUUGUGCC Triptycene 3- WJ.1_do 3' 6FAM Way Junction wn_3FAM split at first Ioop;3'end 0.0.0 GGCACAAAUGCAACACUGCAUUACCA Triptycene 3- U Split3WJ.2_up ' Iowa Black Way Junction _5IB split at second loop; 5' end RNA Length .. . . . , , 0.0.0 GCGGUUGUGCC prfvg’lflfh—Ado.

Triptycene 3- 11 3' 6FAM Way Junction - split at second loop;3'end Example 18: Fluorescence Quenching g Assay This assay will be used to test binding of compounds for RNA three way junction (such as a 38 nt construct). This is a fluorescence quenching assay ing FAM as fluorescence tag and Iowa Black as quencher. Tags are ed at the 3’ and 5’ end, tively. Stable formation of 3WJ upon compound binding would lead to ing of the FAM fluorescence due to close proximity of the Iowa Black tag. Assay readout: FAM (485 — 520 nm) Fluorescence Intensity.

Nucleic acid ons are ubiquitous structural motifs, occurring in both DNA and RNA. They represent important and sometimes transient structures in biological processes, such as replication and recombination, while also ing in triplet repeat expansions, which are associated with a number of neurodegenerative diseases. Nucleic acid junctions are ubiquitous in viral genomes and are important structural motifs in riboswitches. way junctions are key building blocks present in many nanostructures, soft materials, multichromophore assemblies, and aptamer-based sensors. In the case of aptamer based sensors, DNA three-way junctions serve as an ant structural motif.

This assay can serve as a part of the toolkit for discovering RNA-binding small molecules by testing binding to a 3WJ in the context of a controlled system with a readily observable t. PEARL-seq or other methods disclosed herein may then be used to further screen compounds.

Assay sample buffer used: 10 mM CacoK pH 7.2, 30 mM NaCl. Buffer preparation in Dnase / Rnase Free distilled water (Gibco Life Technologies).

Compound Preparation Tool compounds provided as dry powder are prepared as 50 mM stock solution in 100% dé-DMSO. Stock solutions of 50 mM concentration in ds-DMSO are stored at RT.

Hardware Sample plate: Greiner cat# 784076, black, 384 (Dilution plate: Greiner REF 781101, PS-Microplate, 384 well, . Fluorescence Intensity : Envision 1040285 Assay Protocol Assay Buffer preparation Daily fresh (10 ml): 1 ml 100 mM CacoK pH 7.2 and 0.3 ml 1 M NaCl filled up to 10 ml with Dnase / Rnase Free distilled water RNA preparation [RNA sample homogenization] Dilute the RNA 1:10 (final 10 uM) in Assay Buffer.

Heat up the diluted RNA up to 90 0C for 5 min (sealed Eppendorf Tube).

Cool down the RNA probe slowly to RT. nd preparation Dilute the compounds to 800 uM in DMSO (Assay: 8 uM).

Sample preparation 71.2-78.4 uL Assay Buffer are pipetted into Greiner REF 781101, PS-Microplate, 384 (each well needed).

Add 0.8-8 uL of the RNA-Solution (100 mM).

] Add 08 [LL nd—Solution (800 mM).

Mix gently with Multi-Channel Pipette.

Final trations in the sample: 1—10 uM RNA, 8 uM compound, 1 % DMSO Thermal Shift measurement Li htC cler480 Pipet 25 uL Sample Solution into Greiner cat# 784076, black, 384 When sample transfer is finished put lid on top.

] Measure the 96 plate with the LightCycler480 (Channel: 485/520 nm).

Readout Software used was PerkinElmer Envision Manager. ——-_- ——-_- . Copy 2 of Protocol Name. -- F|_picogreen_fi|ter_LV_opt Picogreen_fi|ter_LV_opt _- 4000045 ——-_ ——-_ ——-_ —-_— ——-_ ——-_ Description. . X485 CWL=485nm BW=14nm DELFIA - Time-resolved Used with scence TRF Emission520 _— Filter type -_— . . M520 CWL=520nm BW=25nm . DELFIA - Time-resolved Results Calibration of the expected cence signal at various RNA trations in either CacoK or NaPO4 buffers was performed first. Experiments in buffers containing salt show distinct fluorescence quenching behavior. A calibration experiment for the CacoK buffer is shown in Figure 72. r s were ed for the NaPO4 buffer (results not shown).

First, two compounds (i.e. Ark000007 & Ark000008) were tested in the fluorescence quenching assay to assess concentration dependent influence on the cence signal. Only Ark000007 showed an increase of quenching effect vs. 3WJ_0.0.0_SIB_3FAM construct at conc. >5 uM (Figure 73). Remaining buffer and sample conditions did not show significant influence of the compound on the fluorescence .

The fluorescence quenching experiment was repeated for compounds Ark0000013 and Ark0000014 to measure binding with: A) RNA3WJ_1.0.0_SIB_3FAM (cis 3WJ with one unpaired nucleotide) B) Split3WJ.1_up_SIB -- Split3WJ.1_down_3FAM (trans 3WJ as 1:1 mix) C) Split3WJ.2_up_SIB -- Split3WJ.2_down_3FAM (trans 3W] as 1:1 mix) Likely structures for the sequences are illustrated in Figure 74, and the results of the experiments are shown in Figure 75. Both cmpds were tested at two concentration points in the fluorescence quenching assays to assess effect upon RNA constructs utilized in the study.

Ark000013 (curves associated with de 13 in the Figure) shows a significant concentration dependent effect upon all three RNA constructs used (least effect for cis 3W] and equal effects for trans 3WJs). The data suggest specific interaction of Ark000013 with the 3WJ constructs.

Ark000014 (de14) shows a smaller effect on the RNA constructs (Split3WJ_2 shows larger effect). The compound does appear to be interacting with the RNA target species.

Example 19: Thermal Shift Binding Assay Purpose: Test binding of nds for RNA three way junction (for example, a construct of 38 nt). Thermal shift assay based on established cence quenching assay utilizing FAM as fluorescence tag and Iowa Black as quencher. Tags were attached at the 3’ and ’ end, respectively. Stable formation of 3WJ upon compound binding would lead to quenching of the FAM fluorescence due to close proximity of the Iowa Black tag. l unfolding leads to se of fluorescence emission. Assay readout: FAM (465 — 510 nm) Thermal Shift.

This assay can serve as a part of the toolkit for discovering RNA-binding small molecules by testing binding to a 3WJ in the context of a controlled system with a readily observable readout. PEARL-seq or other methods disclosed herein may then be used to r screen compounds.

Assay sample buffer used: 10 mM CacoK pH 7.2, 30 mM NaCl. Buffer ation in Dnase / Rnase Free distilled water (Gibco Life logies).

Compound Preparation Tool compounds provided as dry powder are prepared as 50 mM stock solution in 100% ds-DMSO. Stock solutions of 50 mM tration in d6-DMSO are stored at RT.

Hardware Sample plate: Roche, Light Cycler480 Multiwell 6, white, REF 04729692001.

(Dilution plate: Greiner REF 781101, PS-Microplate, 384 well, clear). Thermal Shift device: Roche, Light Cycler480.

Assay Protocol Assay Buffer preparation Daily fresh (10 ml): 1 ml 100 mM CacoK pH 7.2 and 0.3 ml 1 M NaCl filled up to 10 ml with Dnase / Rnase Free distilled water.

RNA re aration NA sam le homo enization Dilute the RNA 1:10 (final 10 uM) in Assay Buffer.

Heat up the diluted RNA up to 90 0C for 5 min (sealed Eppendorf Tube).

Cool down the RNA probe slowly to RT. nd preparation Dilute the compounds to 800 uM in DMSO (Assay: 8 uM).

Sample preparation 78.4 uL Assay Buffer are pipetted into Greiner REF 781101, PS-Microplate, 384 (each well ).

Add 0.8 uL of the RNA-Solution (100 mM).

Add 0.8 uL Compound-Solution (800 mM).

Mix gentle with Multi-Channel Pipette.

Final concentrations in the sample: 1 uM RNA, 8 uM compound, 1% DMSO Thermal Shift measurement [LightCycler480] Pipet 20 uL Sample Solution into Roche, Light Cycler480 Multiwell Plate96, white, REF 04729692001.

When sample transfer is d, seal the plate with a clear l (part of REF 04729692001).

Centrifuge the plate with a table-top device to spin down the samples.

Measure the 96plate with the LightCycler480 el: 480/510 nm; ature: 41 — 91°C).

Analyse measurement-data with the MeltingCurveGenotyping Mode.

LightCycler480 LCS480 1.5.1.62 LightCycler ThermalShift Analysis Settings: ition mode: continuous; Ramp rate: 0.1 C°/sec; Acquisition: 6/C° Melt Curve Genotyping for All Samples Channel 480/510 nm Progam Name Program Stds Settings Auto-Group Sensitivity normal Temp Range 41 — 91°C Score 0.7 Res. 0.1 Curves are fitted with raw and normalized data.

Results Melting curves is show melting ature (Tm) of ~51 °C. Range of RNA concentrations was tested and assay window was determined (conc. range of 0.5 — 1 uM yields best results). The choice of buffer also affected the Tm. RNA constructs were tested under different buffer ions (especially in presence of salt) in the thermal shift assay. Increase of salt tration shows a tendency to increase melting ature. However, as seen already for the fluorescence quenching assay, this observation is strongly dependent on buffer conditions. CacoK with 30 mM salt at 1 uM RNA conc. was used to assess compound effects on 3WJ stability. RNA ucts were tested under different buffer conditions (especially in presence of salt) in the thermal shift assay. As expected, an increase of salt concentration shows a tendency to increase melting temperature. However, as seen already for the fluorescence quenching assay, this observation is strongly dependent on buffer conditions. The RNA construct was folded in ce of higher salt concentration and had a melting temperature of 61 oC rather than the 51 0C at lower salt concentration. These conditions were used for screening test compounds.

Compounds Ark000007 & Ark000008 were tested in the thermal shift assay with the 3WJ_0.0.0_5D3_3FAM RNA construct (Figure 76). Data analysis shows a significant effect for Ark000007 with melting temperature shift of ~5°C (i.e. from 61.2 0C to 65.6 0C). In contrast, only a very small effect for Ark000008 was observed. These data suggest that the presence of Ark000007 increases stability of the 3WJ.

Compounds 0013 and 0014 were also tested in the thermal shift assay against three RNA 3WJ constructs, A) RNA3WJ_1.0.0_5IB_3FAM (cis 3WJ with one unpaired nucleotide); B) Split3WJ.1_up_5IB + Split3WJ.1_down_3FAM (trans 3WJ as 1:1 mix); and C) Split3WJ.2_up_5IB + Split3WJ.2_down_3FAM (trans 3WJ as 1:1 mix).

When the compounds were tested with _1.0.0_5IB_3FAM, data analysis showed a significant effect for Ark000013 in the melting curves with a significantly lower fluorescence signal in presence of the nd (Figure 77).

Normalized data showed no proper melting curve in the presence of Ark000013 and the algorithm of data analysis software was unable to determine a meaningful melting point. A weaker effect was observed for 014, with a g temperature shift of ~3 °C (i.e. from 65.6 0C to 68.4 °C). The data suggest that the presence of Ark000013 increases stability of the 3W1 fold upon binding, whereas Ark000014 shows a much less pronounced effect. These results are in line with the cence quenching assay.

In the ce of the B) RNA above, Split3WJ.1_up_5IB+Split3WJ.1_down_3FAM, data analysis showed a significant effect for Ark000013, with a g ature shift of ~21 °C (i.e. from 37.5 0C to 58.2 C’C) (Figure 78). Only a minor effect was ed for Ark000014 with a melting temperature shift of only ~1 °C (i.e. from 37.5 0C to 38.8 0C). The data suggested that the presence of Ark000013 increased the stability of the 3W1 fold upon binding, s Ark000014 showed a much less pronounced effect. The 3WJ formed in trans from 2 RNA molecules shows a significantly lower ity than the cis folded 3WJ (in absence and presence of cmpd). Especially in absence of a compound, a stem-loop structure with a larger bulge is possibly the most populated conformation.

In the presence of the C) RNA above, Split3WJ.2_up_5IB+Split3WJ.2_down_3FAM, data analysis showed a significant effect for Ark000013, with a melting temperature shift of ~13 °C (i.e. from 44.0 °C to 56.9 C’C) (Figure 79). Only a minor effect was observed for Ark000014, with melting temperature shift of only ~1 oC (i.e. from 44.0 0C to 44.7 0C). The data suggest that the presence of Ark000013 increases the stability of the 3WJ fold upon g, whereas Ark000014 shows a much less pronounced effect. The trans 3WJs studied seem to show lower stability than the cis 3WJs, however, the Split_2 3WJ adopts a more stable conformation than Split_l (in absence of a compound). In the presence of a compound, the melting temperature for both trans 3WJ Split_l & Split_2 is similar, suggesting the formation of a 3WJ fold in the presence of the compound.

Ark0000013 and Ark0000014 were tested with a number of RNA constructs. The results are shown below in Tables 8 and 9. nd Ark000039 was also tested in the thermal shift assay vs. the cis folded RNA 3WJs at different RNA:ligand ratios (i.e. 1:1, 1:3). For construct 3WJ_0.0.0_5IB_3FAM the raw data shows no cant effect for Ark000039 in the melting curves (neither at equimolar trations nor 3x molar excess). Also, normalized data show no significant effect for cmpd Ark000039. It appears that Ark000039 does not significantly influence stability of the 3WJ fold and hence no indication of binding for Ark000039 was observed. The same lack of effect was noted in tests with sequences RNA3WJ_3.0.0_SIB_3FAM and RNA3WJ_1.0.0_5IB_3FAM.

Table 8: 0013 Thermal Shift Data 3WJ construct Meltinimitp [°C] ' Meltingciiigidp [°C] + Temp. Shift [°C] RNA3WJ_0.0.0_5|B_3FAM 61.2 84.1 24.2 RNA3WJ_1.0.0_5|B_3FAM 65.6 87.0 21.4 RNA3WJ_1.1.0_5|B_3FAM 63.3 85.5 22.2 RNA3WJ_1.1.1_5|B_3FAM 62.2 82.9 20.7 RNA3WJ_2.0.0_5|B_3FAM 62.2 84.3 22.1 RNA3WJ_2.1.0_5|B_3FAM 41.9 45.7 3.8 RNA3WJ_3.0.0_5|B_3FAM 62.0 83.7 21.7 Split3WJ_1 37.8 58.2 20.4 Splil3WJ_2 44.7 56.9 12.2 Table 9: Ark0000014 Thermal Shift Data 3WJ construct Me'tinixgap [°C] - Meltingctlfigdp [°C] + Temp. Shift [°C] RNA3WJ_0.0.0_5|B_3FAM 59.9 61.5 1.6 RNA3WJ_1.0.0_5|B_3FAM 65.6 68.1 2.5 RNA3WJ_1.1.0_5|B_3FAM 63.3 65.1 1.8 _1.1.1_5|B_3FAM 62.2 64.3 2.1 _2.0.0_5|B_3FAM 62.2 64.4 2.2 RNA3WJ_2.1.0_5|B_3FAM 41.9 42.0 0.1 RNA3WJ_3.0.0_5|B_3FAM 62.0 63.9 1 .9 Split3WJ_1 37.5 37.8 0.3 Split3WJ_2 44.3 44.0 -o.3 Table 10: Thermal Shift Data for onal Compounds Tested with RNA Sequence 0.0_SIB_FAM Compound Collaboration Remarks 007 ARK-1 61.2 65.6 ARK000008 ARK000009 ARK-3 62.3 62.9 ARK000010 ARK-4 61.6 61.4 ARK000011 ARK000012 ARK-6 N/A N/A N/A ARK000013 ARK-7 59.9 84.1 +24.2 ARK000014 ARK-8 59.9 61 5 +1.6 Enantiomer of target ARK-10, TFA Salt of ARK000015- same material is ARKO1 +17.6 registered as ARK000015-2 (ARK Enantiomer of target ARK-10, HCI Salt of ARK000015- same material is ARK02 +19.0 registered as ARK000015-1 (ARK Enantiomer of target ARK000016 ARK-10 62.5 83.8 +21.3 ARK000015 (ARK-9) Enantiomer of target ARK000017 ARK000018-1 (ARK-12) Enantiomer of target ARK000018 ARK000017-1 (ARK-11) Enantiomer of target ARK000022 ARKD 59.8 60.2 +0.4 ARK000023-1 (ARK Enantiomer of target ARK000023 ARK000022-1 (ARK ARK000019 ARK-14 60.3 60.0 ARK000021 ARK-16 59.5 40.5 LCMS carried out in a long 16 min run time ARK000024 ARK-80 60.4 60.7 +0.3 method hence HPLC is not ed separately. 025 ARK-81 60.6 50.4 LCMS carried out in a 2017/040514 Compound Collaboration Remarks .0 Code long 16 min run time method hence HPLC is LCMS carried out in a long 16 min run time ARK000026 ARK-82 59.7 60.9 I _\ N . method hence HPLC is not recorded tely.

LCMS carried out in a long 16 min run time ARK000027 ARK-89 59.7 83.4 +23.7 method hence HPLC is not recorded tely.

LCMS carried out in a long 16 min run time ARK000028 ARK-90 60.3 82.3 +22.0 method hence HPLC is not recorded separately.

LCMS carried out in a long 16 min run time ARK000029 ARK-91 60.2 63.2 + (A) O . method hence HPLC is not recorded separately.

LCMS carried out in a long 16 min run time ARK000030 ARK-125 60.0 64.8 +A . G) method hence HPLC is not ed separately.

LCMS carried out in a long 16 min run time ARK000031 ARK-126 60.0 84.1 +24.1 method hence HPLC is not ed separately.

LCMS carried out in a long 16 min run time ARK000032 ARK-127 60.1 75.1 +15.0 method hence HPLC is not recorded separately.

LCMS carried out in a long 16 min run time ARK000033 ARK-77 61.5 62.4 +O . (O method hence HPLC is not recorded separately.

LCMS carried out in a long 16 min run time ARK000034 ARK-77A 59.9 60.2 +0.3 method hence HPLC is not recorded separately.

ARK000039 ARK-138 61.5 60.3 Interestingly, hook and click compounds (PEARL-seq compounds) bearing ligand, tether, warhead, and click-ready group, such as ARKOOOO31 and ARKOOOO32, showed large thermal shift values of +24] and +150 C’C, indicating strong binding to the RNA target sequence.

Example 20: Ligand Observed NMR g Assay Purpose: Test direct binding of compounds for RNA three way junction (3WJ). This ligand observed NMR assay is used to test direct binding of compounds to an RNA target, for example a 38 nt synthetic RNA 3WJ and others as described below. Ligand observed assay was used for hit validation studies of single nds. Established experiments were eventually used to m group epitope mapping, described below.

Assay Reagents and Hardware Sample buffer: 10 mM Cacodylate, pH 7.1; 0.68 g [MW: 137.99 g/mol]; fill up to 500 ml with Millipore H20.

Compound Preparation Compound Stocks: Tool compounds provided as dry powder were prepared as 50 mM stock solution in 100% d6—DMSO. Test compounds ed as dry powder were ed as 50 mM stock solution in 100% ds-DMSO. Stock solutions of 50 mM concentration in d6' DMSO were stored at 4 oC.

Hardware Sample tube: NMR tube; Norell, article# ST500-7 for NMR sample ement NMR spectrometer: Bruker AVANCE6OO spectrometer ing at 600.0 1Vle for 1H. 5-mm z-gradient TXI Cryoprobe.

Assay Procedure RNA preparation [RNA sample homogenization] Dried RNA pellet is solubilized in sample buffer 10 mM Cacodylate pH 7.1.

] RNA aliquot at 200 uM (stock concentration) is denatured at 95 0C for 3 min and ooled on ice for 3 min.

Sample preparation 23 pL d6-DMSO are pipetted into a 1.5 mL eppendorf tube to ensure 5% ds-DMSO present in the sample as a locking agent.

Add 2 pL of each fragment (50 mM stock solution).

Add 450 pL assay buffer.

] Add 25 uL homogenized RNA stock solution of the RNA 3WJ (200 uM stock on).

] Sample is vortexed to ensure proper mixing and placed into NMR spectrometer to start measurement of the sample.

Final concentrations in the : 200uM each compound and 10 uM RNA target molecule.

NMR measurement Sample is placed into magnet and temperature adjusted to 288 K. Spectrometer frequency at 600 MHz is matched and tuned. Magnetic field is shimmed to homogenize magnetic field around the sample.

Proton 90° pulse is determined and water resonance ncy is adjusted to ensure maximal water suppression. The determined values are transferred to the NMR experiments that will be recorded for the respective sample.

Sequence of experiments includes a Proton lD experiment with a Watergate sequence for water suppression, a WaterLOGSY Y) and a 1D Saturation transfer difference (STD) experiment to test for direct binding of the compounds to the RNA.

Details ID Watergate experiment: For each lD WATERGATE spectrum a total of 8192 complex points in fl (1H) with 128 scans were acquired (experiment time 4 min.). The spectral width was set to 16.66 ppm. s WLOGSY experiment: For the WLOGSY-spectrum, a total of 1024 complex points in fl (1H) with 256 scans were acquired (experiment time 25 min.) The carrier frequency for 1H was set at the water resonance (~4.7 ppm). The spectral width was set to 16.66 ppm in the direct dimension (1H).

Details STD experiment: For the STD-spectrum, a total of 1024 complex points in fl (H) with 1024 scans were acquired iment time 65 min). The carrier frequency for 1H was set at the water resonance (~4.7 ppm). The al width was set to 16.66 ppm in the direct dimension (1H). For the on-resonance experiments saturation is set to 2.0 sec at a saturation frequency of -2500 Hz. For the off-resonance experiment tion frequency is set at 10200 Readout Software: TopspinTM version: 2.1 (October 24, 2007) Measurement mode: 1D Python scripts are used to s all recorded spectra in the assay setup, ing and deconvolution s.

Spectra were analyzed for direct binding signals of the compounds. Identified single compound hits were reported.

Ligand Observed NMR Binding Assay for CAG Repeat RNA Following the above procedure, various tool and test compounds were assayed for binding. In a first series of experiments, nds were tested for binding to 17CAG or 41CAG (sample was 3 uM in RNA). Compounds HP-AC008001-A08, HP-AC008002-A06, HP-AC008002-D10, and most of an l screen of 41 small molecule fragments did not show significant difference in binding signals for both RNA target species 17CAG and 41CAG.

However, several of the compounds did show significant changes in their signals in the presence of the two RNA target species.

Structure ID STD signal / | H HP-AT005003-C03 ct O N\/L QM/N\/N HP-AC008001-E02 distinct / HP-AC008002-E01 distinct N/ HP-AC008004-C07 weak N/fi / K/N ' N CPNQ d'Istlnct ARK0000013 was also tested in the NMR binding assay. Test Sample: 10 uM RNA3WJ_0.0.0_5IB_3FAM +/- 200 Ark000013. 1H 1D Watergate & WaterLOGSY spectra recorded of Ark000013 were used as a reference (Note: aromatic signals observed between 7.4 — 7.9 ppm and due to symmetry of the center triptycene scaffold all 9 protons are magnetically equivalent). In the presence of RNA a clear reduction of negative sign signals occured for the Ark000013 resonances. Data suggested binding of Ark000013 to the 3WJ RNA as the target s. STD experiments showed small signals that were sufficient to qualitatively confirm binding.

Epitope Mapping Epitope mapping was performed on a number of compounds. As a first e, compound CPNQ was analyzed at a concentration of 50 uM. A 1H 1D Watergate um with zoom to aromatic region of the spectrum was obtained. Preliminary ment of 1H resonances for this and the following examples was based on al shift distribution, coupling pattern and simulation of NMR spectrum (www.nmrdb.org). The structure of CPNQ, assigned proton resonances, NlVIR spectrum, and epitope mapping results are shown in Figure 80. Due to signal overlap no individual assignment of the piperazine ring system was possible. ions: 10 mM Tris pH 8.0, 5 mM DTT, 5% DMSO-ds; T = 288.1 K. Epitope mapping experiments were performed in the presence of 4lCAG and l7CAG ces using the STD mental conditions described above. In the case of CPNQ, data suggests for both RNA constructs the tendency that protons of the chlorophenyl moiety are in closer proximity to RNA than the nitroquinoline.

The same experiment was performed for compound 08002-E01 under similar conditions (see Figure 81). The scaled STD effect was plotted onto the molecule according to the preliminary assignments. The data suggests for both RNA constructs that protons of the pyridine ring are in closer proximity to RNA than the benzene ring. The aliphatic CH2 group could not be observed due to buffer signal overlap in that region.

The same experiment was performed for compound HP-AC00800l-E02 under similar conditions (see Figure 82). The scaled STD effect was plotted onto the molecule according to the preliminary assignments. The data suggest for both RNA constructs that ic protons t to the heterocycle are in closer proximity to RNA protons. Aliphatic proton resonances could not be assessed by STD due to direct saturation artifacts/buffer signal overlap in that region (epitope mapping by WaterLOGSY).

The same experiment was performed for compound HP-AT005003-C03 under similar conditions (see Figure 83). The scaled STD effect was plotted onto the molecule according to the preliminary assignments. Due to signal overlap no individual assignment of the CH2 groups was possible. The data suggest for both RNA constructs that protons of the furan moiety are in closer proximity to RNA protons than the phenyl.

NMR Competition ments Competition experiments were also performed. Test Sample: 2.5 uM 4lCAG RNA (476 nt) was combined with the following: 100 uM HP—AC008002-E01 (A); +/— 200 — 400 uM HP-ACOOSOOl—EOZ (B); and +/- 200 — 400 uM 05003-C03 (C). 1H lD Watergate & OGSY a ed of HP-AC008002—E01 are used as a reference. In the presence of itor (i.e. either HP-AT005003-CO3 or HP-ACOOSOOl—EOZ) the WaterLOGSY signals of HP-AC008002-E01 were still observed, even at a 1:4 ratio of compound vs. competitor. The experiments did not reveal any indication of itive behavior in the utilized compound mixtures. Data suggests that compounds do not compete for the same single binding site.

In a further experiment, as Test Sample 2.5 uM 4lCAG RNA (476 nt) was used in the presence of: 100 uM I-IP-ACOOSOOl-EOZ (B) or 100 uM HP-AT005003-C03 (C); +/- 200 — 400 uM HP-AC008002-E01 (A). 1H 1D Watergate and OGSY spectra recorded single cmpds were used as a reference. In the presence of a competitor (i.e. I-IP-AC008002-E01 (A)) the WaterLOGSY signals of HP-ACOOSOOl-EOZ (B) or HP-AT005003-CO3 (C) were still observed even at a 1:4 ratio of cmpd vs. competitor. Experiments did not reveal any indication of itive or in the utilized compound es. The data suggest that compounds do not compete for the same single binding site.

In a r experiment, as Test Sample: 2.5 pM 41CAG RNA (476 nt) was used in the presence of: 100 [AM HP-ACOOSOOl—EO2 (B) +/- 200 — 400 pM HP-ATOO5003-CO3 (C) 1H 1D Watergate & WaterLOGSY spectra recorded of single cmpd HP-ACOOSOOl-EO2 were used as a reference, In the presence of competitor (i.e. HP-AT005003-C03 (C)) the WaterLOGSY signals of HP-ACOOSOOl-EO2 (B) were still observed even at a 1:4 ratio of cmpd vs. competitor.

The experiments did not reveal any indication of competitive behavior in the utilized compound mixture. The data suggest that compounds do not compete for the same single binding site.

Example 21: Ligand Observed NMR Binding Assay for CAG Repeat RNA Purpose: Test direct binding of compounds for httmRNA (construct with 41 CAG repeats 474 nt) and others as described below. Ligand observed NMR assay to test direct binding of fragments to RNA target (e.g. construct with 41 CAG repeats 474 nt). Single compound hits were identified for further characterization by orthogonal assay (eg. surface plasmon resonance, SPR). Ligand observed assay was used for primary screen and deconvolution into single fragment hits. ished ments were eventually used for group epitope mapping.

CAG repeat expansions in protein coding portions of specific genes are fied as Category I repeat expansion diseases. Currently, nine ogic ers are known to be caused by an increased number of CAG repeats, typically in coding s of otherwise unrelated ns. During protein synthesis, the expanded CAG repeats are translated into a series of uninterrupted glutamine residues forming what is known as a utamine tract (“polyQ”).

This assay tests for direct binding of compounds to httmRNA and may be adapted for other repeat RNAs. Compounds are tested in pools (i.e. pool size of 12 fragments in each sample in the primary screen and smaller pool sizes during deconvolution and eventually single nd measurements).

Assay Reagents and Hardware Sample buffer: 10mM Tris-HCl, pH 8.0, 0.78g [MW: 157.56 g/mol]; 75 mM KCl, 2.79g [MW: 74.55 g/mol], 3 mM MgC12, 0.14g [MW: 95.21 g/mol], fill up to 500 mL with Millipore H20.

Compound Preparation Compound Stocks: nt library stock solutions are provided at 100 mM concentration in 100% d6-DMSO. Tool compounds provided as dry powder are ed as 100 mM stock on in 100% d6-DMSO. Stock solutions of 100 mM concentration in ds—DMSO are stored at 4°C.

Hardware Sample tube: NMR tube; Norell, e# ST500-7 for N1V[R sample measurement.

NMR spectrometer: Bruker AVANCE6OO spectrometer ing at 600.0 1Vle for 1H. 5-mm z-gradient TXI Cryoprobe.

Assay Procedure RNA preparation [RNA sample homogenization] Dried RNA pellet is solubilized in sample buffer 10 mM Tris-HCl pH 8.0, 75 mM KCl, 3 mM MgClz. RNA aliquot at 13.9 uM (stock concentration) is denatured at 95 °C for 3 min and snap-cooled on ice for 3 min, and refolded at 37 °C for 30 min.

Sample preparation 13-24 uL d6—DMSO are ed into an 1.5 mL orf tube to ensure 5% d6- DMSO t in the sample as a locking agent (depending on pool size of the prepared sample).

Add 1 “L of each fragment (100 mM stock solution).

Add 367 uL assay buffer.

Add 108 uL homogenized RNA stock solution of the httmRNA (13.9 [1M stock solution).

Sample is vortexed to ensure proper mixing and placed into NMR spectrometer to start measurement of the sample.

Final concentrations in the sample: 200 [1M each fragment and 3 [1M RNA target molecule.

NMR measurement Sample is placed into magnet and temperature adjusted to 288 K. Spectrometer frequency at 600 1Vle is matched and tuned. Magnetic field is shimmed to homogenize magnetic field around the sample.

Proton 90° pulse is determined and water resonance frequency is adjusted to ensure maximal water suppression. The determined values are transferred to the NMR ments that will be recorded for the tive sample.

Sequence of experiments includes a Proton 1D experiment with a Watergate sequence for water suppression, a WaterLOGSY (WLOGSY) and a 1D Saturation transfer ence (STD) experiment to test for direct binding of the compounds to the RNA.

Details for 1D Watergate experiment: For each 1D WATERGATE spectrum a total of 8192 x points in fl (1H) with 128 scans were acquired (experiment time 4 min.) The spectral width was set to 16.66 ppm. s WLOGSY experiment: For the WLOGSY-spectrum, a total of 1024 complex points in f1 (1H) with 256 scans were acquired (experiment time 25 min.) The carrier frequency for 1H was set at the water resonance (~4.7 ppm). The spectral width was set to 16.66 ppm in the direct dimension (1H).

Details STD experiment: For the STD—spectrum, a total of 1024 complex points in f1 (H) with 1024 scans were acquired (experiment time 65 min.) The carrier frequency for 1H was set at the water nce (~47 ppm). The spectral width was set to 16.66 ppm in the direct dimension (1H). For the on-resonance experiments saturation is set to 2.0 sec at a saturation frequency of -2500 Hz. For the off-resonance experiment saturation frequency is set at 10200 Software: TopspinTM version: 2.1 er 24, 2007) Measurement mode: 1D Python scripts were used to process all recorded spectra in the assay setup, screening and olution process. Spectra were analyzed for direct binding signals of the compounds. fied single compound hits were reported.

Example 22: Illumina Small RNA-Seq Library Preparation Using T4 RNA Ligase 1 Adenylated Adapters Purpose: Enable deep sequencing of a short synthetic RNA after treatment with SHAPE reagents or PEARL-seq compounds. The herein-described library preparation protocol describes a method to generate next generation sequencing libraries from small synthetic RNAs by ligating adapters to both ends. The ligation is required in order to allow cDNA synthesis from the ligated adapters — hence sequencing the whole target RNA. The technique represents one step in the process of SHAPE sequencing. SHAPE sequencing aims at analysing RNA secondary structure by ination of a mutation frequency after treatment with conformation selective SHAPE reagents.

Target name for this example: targetRNA ucleotide “RNA3WJ_0.0.0_noLa ”, sequence rGrGrCrArCrArArArUrGrCrArArCrArCrUrGrCrArUrUrArCrCrArUrGrCrGrGrUrU rGrUrGrCrC. Physiological role: Synthetic RNA oligonucleotide capable of g a three way junction secondary ure. Assay principle: 1) Ligation of 3’-adapter to target RNA; 2) Phosphorylation of 5’ end of target RNA; 3) lst and 2nd strand cDNA synthesis from ligated adapters; 4) oration and amplification of barcoded Illumina primers by PCR. Assay readout: Agarose Gel Electrophoresis, Sanger-sequencing.

Assay Reagents and Hardware — T4 RNA Ligase 2, truncated KQ (NEB #M0373 S) — 50% PEG8000 (supplied with NEB #M0373 S) — UT (Invitrogen) — T4 RNA Ligase 1 (ssRNA Ligase) (NEB #MO204 S) — 10 mM ATP (supplied with NEB #MO204S) — SuperScriptIII e Transcriptase (Invitrogen) — Phusion® Hot Start Flex DNA rase (NEB M0535) — MinElute Gel Extraction kit (Qiagen) — Quant-iT HS DNA assay kit (Inivtrogen) — 0.2 M Cacodylic acid 0.1 M Potassium Cacodylate pH 7.2 (CacoK-stock) stock final AdJusttosomIMImporeHo________________________________________________________________________________________________________ Storage4C _______________________________________________________________________ _____________________________________________________________________ mM CacoK pH 7.2 stock final 1 ml ECacoK pH 7.2 100 mM 10 mM eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee Buffer1 (10 mM CacoK pH 7.2; 30 mM NaCl) stock final .1..................mICacoKpH72....................................100mM ................................................. 03ml ...............................................................ENE?!.................................................... ....§7mIMIIIIp0reH20 ucleotides targetRNA oligonucleotide “RNA3WJ_0.0.0_noLab” (IDT custom synthese) ’ rGrGrCrArCrArArArUrGrCrArArCrArCrUrGrCrArUrUrArCrCrArUrGrCrGrGrUrUrGrU rGrCrC 3’ 3’ adapter DNA oligo rsal miRNA Cloning ” (NEB S1315S) ’ rAppCTGTAGGCACCATCAAT—NHz 3’ ’ adapter RNA oligo ’ rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC 3 ’ Reverse transcription primers: (NNNNNN indicates an 8 base “unique molecular identifier” tag) 1st strand synthesis Primer (P7 RT-Anti UCL) ’ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNATTGATGGTGC CTACAG 3’ 2nd strand synthesis Primer (P5 2nd strand) ’ TCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNGTTCAGAGTTCTACAGTCC GACGATC 3’ Library PCR amplification primers: All primers contain specific 8 nt index sequence tag (INDEX) required for library olution.

Several forward PCR primers ’ AATGATACGGCGACCACCGAGATCTACAC(INDEX)TCTTTCCCTACACGACGCTC TTCCGATCT 3’ l reverse PCR primers ’ CAAGCAGAAGACGGCATACGAGAT(INDEX)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATCT 3 ’ qPCR/ Sequencing Primers: Quanti qPCR 1_fw 5’ GATACGGCGACCACCGAG 3’ Quanti qPCR 1_rv 5’ GACGGCATACGAGAT 3’ Assay Procedure Preparation Dissolve target RNA with RNase free water to 100 uM.

Pipette 3 aliquots a 180 [.11 and additional small volume aliquots (5 ul). Storage: -80 ] For ligation, resuspend the lyophilized Universal miRNA Cloning Linker (UCL) in RNAse—free water to 100 uM stock concentration. In] UCL has a concentration of 100 pmol (100 uM).

] Adjust the adapter concentration to 10 pmol/pl (10 uM) with RNase-free water (1:10 dilution).

RNA Folding ] Dilute the dissolved target RNA 1:10 with Buffer l to get a 10 iiM solution for ligation.

Incubate at 90 0C for 5 min, cool down slowly to RT and store on ice. 3’ adapter ligation Denature the 3’ adapter (UCL) at 65 °C for 30 sec, immediately chill on ice.

Ligations are carried out with T4 RNA Ligase 2 in the absence of ATP.

] Setup the ligation reaction with: 1 in RNA 4 [1| 3’ adapter “Universal miRNA Cloning Linker” 2 “L 10x T4 RNA ligase buffer without ATP 4 pl PEG8000 0.5 “L RNase tor 0.5 “L T4 RNA ligase 2, truncated 8.5 pl RNase-free H20 — Ad 20 in — 1 in RNA 2 pl 3’ r “Universal miRNA Cloning Linker” 2 pL 10x T4 RNA ligase buffer without ATP 4 pl PEG8000 10 % (w/v) 0.5 pL RNase inhibitor 0.5 pL T4 RNA ligase 2, truncated .5 pl free H20 — Ad 20 in — 2 l“ RNA 2 pl 3’ adapter “Universal miRNA Cloning Linker” 2 pL 10x T4 RNA ligase buffer without ATP 4 pl 0 10 % (w/v) 0.5 pL RNase inhibitor 0.5 pL T4 RNA ligase 2, truncated 95 pl RNase-free H20 — Ad 20 iii — 4 in RNA 2 pl 3’ adapter “Universal miRNA Cloning Linker” 2 pL 10x T4 RNA ligase buffer without ATP 4 pl PEG8000 10 % (WM 0.5 pL RNase inhibitor 0.5 pL T4 RNA ligase 2, ted 75 pl RNase-free H20 — Ad 20 in — The reaction is incubated at 25 0C for 4 h or 18 OC overnight. Note: ligation reaction must be performed in the absence ofA TP. Heat inactivation: 65 °C 20 min. ’ adapter ligation Denature the 5’ adapter RNA oligo (10 pM, in RNase—free water) at 65°C for 30 sec, immediately chill on ice.

Add to 20 pl 3’ Adapter-RNA—Mix to: 4 bzw. 2 pl 5’ Adapter RNA oligo 20 pM 1 pL 10x T4 RNA ligase buffer 3 iii 10 mM ATP % (w/v) 2017/040514 ] The on is incubated at 25°C for 4 h or 18°C overnight. Heat inactivation: 65°C for 15 minutes. Note: the 3’ end of the small RNA has already been ligated to the 3’ adapter that has an amine group at the 3’ end, and could no longer take part in the ligation reaction; thus its 5’ end could be ligated to an RNA oligo in the presence of ATP.

Reverse transcription 11st strand cDNA synthesis] Mix and briefly centrifuge each component before use.

Combine the following in a 0.2-ml PCR tube: Adaooter-liated tar etRNA P7 RT-Anti UCL rimer2 M mM dNTP mix DEPC-treated waterto 20 pl Incubate at 65 °C for 5 min, then place on ice for at least 1 min.

Prepare the following cDNA Synthesis Mix, adding each ent in the indicated order. 10X RT buffer mM MgCIz 0-1 M DTT RNaseOUT (40 Uml) SuperScript ||| RT (200 U/pl) Add 20 ul of cDNA Synthesis Mix to each RNA/primer mixture, mix , and collect by brief centn'fugation. Incubate at: 50 min at 50 °C. Terminate the reactions at 85 °C for 5 min. Chill on ice. Collect the ons by brief centrifugation. cDNA synthesis reaction can be stored at —20 °C or used for PCR immediately. 2nd strand cDNA synthesis Prepare the following PCR Mix: 1st strand cDNA _— 10X PCR Buffer, -Mg P5 2nd strand primer 2 HM Taq DNA Polymerase (5 U/pL) RNase-free H20 ad 30 pl 4.9 ul— ] Place samples in PCR analyzer and execute the following cycling program: re: 95 CC, 3 min Annealing: 65°C 10 sec, Decrease 65°C—55°C at 041°C /sec Elongation: 72 °C 3 min Cool to 4 CC 00 Store at —20 0C until PCR enrichment.

PCR enrichment Prepare the following PCR Mix: —m-— Place samples in PCR analyzer and execute the following cycling program Initiation: Denature 98 °C, 30 Seconds Cycles: 1. Denature 98 °C, 10 Seconds 2. Annealing 72 0C, 20 Seconds* 3. Elongation 72 °C, 15 Seconds Final Extension 72 0C, 3 s Hold 4-10°C *To determine the optimal annealing temperature for a given set ers, use of the NEB Tm Calculator is highly recommended.

The remaining RT product can be stored at —20°C.

Readout Separate the PCR product on a 2% e gel using an appropriate molecular weight marker. Note: The accurate ligated and amplified Library has a size of 233 bases. Cut the band and gel-purify the product with Qiagen MinElute kit.

Subject the purified fragment to direct Sanger Sequencing (at a Provider of Choice) using either i qPCR 1_fw” or “Quanti qPCR 1_rv” primers. The steps and ces involved are shown in Figure 84.

Example 23: Alternate Procedure for Producing Illumina Small q Library An ate procedure for ing the desired RNA library was developed that included the further step of ligating the 5’ adapter to the target RNA. The principal steps of the alternate method were: 1) Ligation of 3’-adapter to target RNA; 2) Phosphorylation of 5’ end of target RNA; 3) Ligation of 5’-adapter to target RNA; 4) lst and 2nd strand cDNA synthesis from ligated adapters; 5) Incorporation and amplification of barcoded Illumina primers by PCR.

To effect this additional step, T4 Polynucleotide Kinase (NEB) was ed among the reagents. The additional phosphorylation step was performed as s: Phosphorylation with T4 Polynucleotide Kinase For non-radioactive phosphorylation, use up to 300 pmol of 5' termini pl 3' Adapter-RNA-Mix 200/400/800 pmol 4 pL 10x T4 RNA ligase buffer 1x (1mM DTT) 4 pl 10mMATP 1mM 3,6 pl DTT 0,1 M 9mM 1 pl T4 Polynucleotide Kinase 10 U 7,4 pl RNase-free H20 Ad 40 pl Incubate at 37 0C for 30 s. Fresh buffer is required for optimal activity (loss of DTT due to oxidation lowers activity).

Also, during the subsequent 5’ r ligation step, 40 pl phosphorylated 3’ Adapter-RNA-Mix instead of 20 pl was used.

The steps and sequences involved in two methods of production of the library are shown in Figures 85 and 86.

Example 24: ation and Immobilization of DELs (DNA-Encoded Libraries) Sequences HTT41CAG and HTTl7CAG were successfully synthesized and refolded after incubation for 2 h in the selection buffer described below. This was confirmed by native PAGE (results not shown). Native PAGE: Denatured at 95 0C for 3 min, snap cooled on ice for 3 min and refolded at 37 °C for 30 min (10 mM Tris-HCl, pH 8.0, 75 mM KCl, and 3 mM MgClz). About 50% of the RNA targets were immobilized on vidin resin. The RNA targets were stable under selection conditions after the following improvements: apply stain after gel electrophoresis. Decreasing the tration of ssDNA and Rnase inhibitor during immobilization also helped.

Selection Conditions DEL specif1cs: DEL Set 1 = 610 DEL libraries, 5.521 billion compounds in total; DEL Set 2 = 205 DEL libraries, 70 million compounds in total (sets screened separately) Selection rounds: 3-4 ion mode: Target immobilized ] e resin: Neutravidin resin Target amount: 100 pmol Immobilization buffer composition: NMR buffer, 0.1% Tween-20, 0.03mg/ml ssDNA, 2mM Vanadyl ribonucleoside complexes.

Selection buffer ition: 50 mM Tris-HCl (pH 8), 75 mM KCl, 3 mM or 10 mM MgClz, 0.1% Tween-20, 0.3mg/ml ssDNA, 20 mM Vanadyl ribonucleoside complexes.

Volume, temperature, and time: 100 uL, RT, 1 hour Wash Conditions Buffer composition: 50 mM Tris-HCl (pH 8), 75 mM KCl, 3 mM or 10 mM MgClz.

Number and volume: 2 X 200uL Temperature and time: RT, fast Elution Conditions: Elution mode: Heat elution Buffer composition: 50 mM Tris-HCl (pH 8), 75 mM KCl, 3 mM or 10 mM MgClz.

Volume, temperature, and time: 80 uL; 80 °C; 15 s.

Stability of the RNA complexes was confirmed by tion in the selection buffer for 2 h at room temperature. The refolded RNA was successfully immobilized on the resin.

RNA Flow . % of total Sample RNA Input (ng) RNA on resm (ng) Through (ng) lized HTT17CAG 2000 802.5 1197.5 60% HTT41CAG 500 138.5 361.5 72% sions: After decreasing the concentration of ssDNA and Rnase inhibitor during immobilization: 50% refolded HTTl7CAG was ed on vidin resin; after incubation with DEL compounds, refolded HTT17CAG was recovered from Neutravidin resin; the target is now ready for affinity selection.

Example 25: Surface n Resonance Experiments Figures 87 and 88 show possible methods of employing surface plasmon resonance (SPR) to screen ligands and hook and click constructs for binding to a target RNA of st.

SPR is especially useful for monitoring biomolecular interactions in real time. Typically, target species and unrelated control are immobilized to a sensor chip, then analytes unds/fragments) are flowed over the surface. Binding of the compound to target species results in increase of SPR signal (association . Washing away bound compound with buffer s in a decrease of SPR signal (dissociation phase). Fitting of sensorgrams recorded at ent compound concentrations is med to an appropriate interaction model. The method allows extraction of kinetic parameters (ka, kd 9 K13). Requirements/limitations e that the ka / kd values be in reasonable ranges; and the target size must not be too large (< 100 kDa). It is an excellent method to screen fragments and profile or validate hits. BC4000 may be used for primary screening (up to 4,000 data pts/week). Biacore T200 is suitable for hit profiling and validation.

In the PEARL-seq context, SPR allows monitoring binding of “hooks” to DNA/RNA aptamers. The target species is immobilized to sensor chip, analytes (i.e. hooks) are flowed over surface (association phase), DNA/RNA aptamer is flowed over surface (plateau phase), competitor compound is washed over surface (dissociation phase), thus ng binding data.

The requirements/limitations are that, again, ka/kd values must be in reasonable ranges and fitting for their respective purpose. Furthermore, the target size must be < 100 kDa. In addition, steps 1 and 2 need to be in place (tested first) in order to enable setup. A competitor with fitting affinity will also be needed.

With the goal of identifying interaction partners (RNA/DNA) that bind to capture RNA (3WJ), the ing steps are contemplated: Use biotinylated capture-RNA (bi03WJ) to fold into secondary structure; Allow binding of warhead triptycene ligands; Fish cting RNA/DNA‘s by covalent linking to warhead; Precipitate complexes via binding of bi03WJ to streptavidin beads; Wash and elute; and Library generation from eluate and sequencing.

] A protocol for smooth generation of cell lysates or RNA preps will be required. One exemplary protocol would involve the following steps: Preparation of RT-qPCR-ready cell lysates: MDCK-London cells in 24-well plates were washed once with PBS (1 mL/well). Cell lysatesare prepared by exposing cell monolayers to 200 mL/well of Cell-Lysis (CL) Buffer. The final formulation of CL Buffer consist of 10 mM Tris-HCl pH 7.4; 0.25% Igepal CA-630; and 150 mM NaCl. CL Buffer is freshly ed from appropriate stock solutions. All reagents are molecular biology grade and dilutions are made with DEPC-treated water (351721; Quality Biological; Inc). For certain experiments; CL Buffer also includes MgClz (M1028; Sigma) or RNasin Plus RNase Inhibitor (N2615; Promega). Cells are exposed for appropriate times (typically 5 min for CL Buffer). The resulting lysates are carefully collected without disturbing the cell monolayer ts and either analyzed ately or stored frozen. See, e. g. es et al.; “A simple; inexpensive method for preparing cell lysates suitable for downstream reverse transcription quantitative PCR,” Scientific Reports 4, Article : 4659 .

Simple Lysis buffer: using Igepal CA-63O and lSOmM NaCl; tes crude cell lysate, ns still everything (no polyA-enrichment or protein removal).

Different Protocols possible: smallRNA work/low: Adapter ligation; cDNA-synthesis; Library (small rs); or total RNA workflow: random primed w/wo RiboZero, standard library prep (normal clusters).

] While we have described a number of embodiments of this invention; it is apparent that our basic examples may be altered to provide other embodiments that utilize the compounds and methods of this invention. Therefore; it will be appreciated that the scope of this invention is to be defined by the ed claims rather than by the specific embodiments that have been represented by way of example.

Claims (10)

CLAIMS 1. We claim:

1. A method of modulating the ream protein sion associated with a target mRNA to treat a disease or disorder caused by the target mRNA, comprising the step of contacting the target mRNA with a compound that binds to a nucleic acid 3-way junction (3WJ) in the target mRNA, wherein the compound is of Formula I: (Rom or a ceutically acceptable salt thereof, wherein: Rings A, B, and C are each, independently, a 3—8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4—8 membered ted or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms ndently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered ic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; each Y is independently CR or N, each R1 is independently -R, halogen, -CN, -OR, -N(R)2, -NOz, -N3, -SR, or ; each R2 is independently -R, halogen, -CN, -OR, -N(R)2, -N02, -N3, -SR, —L2-R6, or two R2 groups on the same carbon are optionally taken together to form =NR6, =NOR6, =O, or =S; each R3 is independently -R, n, -CN, -OR, -N(R)2, -N02, -N3, -SR, or —L3-R6, each R6 is independently hydrogen or C1-6 alkyl optionally substituted with 1, 2, 3, 4, 5, or 6 halogens, each R is independently hydrogen or an optionally substituted group selected from C14, aliphatic, a 3—8 membered saturated or partially unsaturated monocyclic carbocyclic ring, , an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently ed from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1— 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered ic heteroaromatic ring having 1-5 heteroatoms ndently selected from nitrogen, , or ; each L1, L2, and L3 is independently a covalent bond or a C1-8 bivalent ht or branched hydrocarbon chain wherein l, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)—, -C(O)O-, -OC(O)—, -N(R)-, -C(O)N(R)—, -(R)NC(O)-, - OC(O)N(R)—, -(R)NC(O)O—, -N(R)C(O)N(R)—, -S-, —SO-, -SOz-, -SOzN(R)—, -(R)NSOz-, - C(S)—, -, -OC(S)-, -C(S)N(R)—, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; m is 0,1, 2, 3, or 4; n is 0,], 2, 3, or 4, and p is 0,1, 2, 3, or4.

2. The method of claim 1, wherein Ring A is pyridyl, Ring B is phenyl, and Ring C is phenyl.

3. The method of claim 1 or 2, wherein the target mRNA forms a 3WJ in the presence of an effector miRNA RNA and the nd of Formula I binds to a trans 3WJ formed between the effector RNA and the target mRNA.

4. The method of any one of claims 1-3, wherein the compound of Formula I binds to a cis 3WJ formed between portions of the target mRNA,

5. A compound of Formulae XXXIII or XXXIV: XXXIII XXXIV or a pharmaceutically acceptable salt thereof; wherein: T1 is a bivalent ing group; and Rm"d is a difying moiety that reacts selectively with a 2’—OH group of a target RNA to which the compound binds.

6. The compound of claim 5 or a pharmaceutically acceptable salt thereof, further comprising a click-ready group covalently bound to Rm”l or any other substitutable hydrogen.

7. The compound of claim 6, wherein the ready group is an azide.

8. The compound of claim 5 or 6, wherein Rm"d is selected from N-methylisatoic anhydride, l-methylnitroisatoic ide, or l-methylnitroisatoic anhydride.

9. The method of any one of claims 1-4, wherein the disease or disorder is selected from selected from Huntington’s disease (HD), dentatorubral-pallidoluysian atrophy ), spinal- bulbar muscular atrophy (SBMA), or a spinocerebellar ataxia (SCA) selected from SCAl, SCAZ, SCA3, SCA6, SCA7, SCA17, Fragile X Syndrome, myotonic dystrophy (DMl or dystrophia myotonica), Friedreich’s Ataxia (FRDA), a spinocerebellar ataxia (SCA) selected from SCA8, SCAlO, or SCA12, or C9FTD (amyotrophic lateral sclerosis or ALS).

10. The method of any one of claims 1-4, wherein the disease or disorder is selected from a viral, microbial, or fungal infection. WO 06074