NZ749002B2 - PCSK9 iRNA compositions and methods of use thereof - Google Patents

PCSK9 iRNA compositions and methods of use thereof Download PDF

Info

Publication number
NZ749002B2
NZ749002B2 NZ749002A NZ74900213A NZ749002B2 NZ 749002 B2 NZ749002 B2 NZ 749002B2 NZ 749002 A NZ749002 A NZ 749002A NZ 74900213 A NZ74900213 A NZ 74900213A NZ 749002 B2 NZ749002 B2 NZ 749002B2
Authority
NZ
New Zealand
Prior art keywords
car
rnai agent
nucleotides
annotation
double stranded
Prior art date
Application number
NZ749002A
Other versions
NZ749002A (en
Inventor
Anna Borodovsky
Klaus Charisse
Kevin Fitzgerald
Maria Frankkamenetsky
Rajeev G Kallanthottathil
Satyanarayana Kuchimanchi
Martin Maier
Muthiah Manoharan
Stuart Milstein
William Querbes
Kamenetsky Maria Frank
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Priority claimed from NZ709013A external-priority patent/NZ709013A/en
Publication of NZ749002A publication Critical patent/NZ749002A/en
Publication of NZ749002B2 publication Critical patent/NZ749002B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/312—Phosphonates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/343—Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533—Halogen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)

Abstract

The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the PCSK9 gene, and methods of using such RNAi agents to inhibit expression of PCSK9 and methods of treating subjects having a lipid disorder, such as a hyperlipidemia.

Description

PCSK9 iRNA COMPOSITIONS AND METHODS OF USE THEREOF Related Applications This application is a divisional application of New d Patent Application No. 709013, a New Zealand national phase entry application derived from International Patent Application No. , filed 5 December 2013, which claims priority to U.S.
Provisional ation No. 61/733,518, filed on 5 December 2012; U.S. Provisional Application No. 61/793,530, filed on 15 March, 2013; U.S. Provisional Application No. 61/886,916, filed on 4 r 2013; and U.S. Provisional Application No. 61/892,188, filed on 17 October 2013.
This application is also related to U.S. Provisional Application No. ,710, filed on 18 November 2011. The entire contents of each are incorporated herein by reference in their entirety.
Sequence Listing The instant ation contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on October 29, 2013, is named 121301-00420_SL.txt and is 2 bytes in size.
Background of the Invention Proprotein convertase subtilisin kexin 9 (PCSK9) is a member of the subtilisin serine protease family. The other eight mammalian subtilisin proteases, PCSK1-PCSK8 (also called PC1/3, PC2, furin, PC4, PC5/6, PACE4, PC7, and I-1) are proprotein convertases that process a wide variety of proteins in the secretory pathway and play roles in diverse biological processes (Bergeron, F. (2000) J. Mol. Endocrinol. 24, 1-22, Gensberg, K., (1998) Semin. Cell Dev. Biol. 9, 11-17, Seidah, N. G. (1999) Brain Res. 848, 45-62, Taylor, N. A., (2003) FASEB J. 17, 1215-1227, and Zhou, A., (1999) J. Biol. Chem. 214, 20748).
PCSK9 has been proposed to play a role in cholesterol metabolism. PCSK9 mRNA expression is down-regulated by dietary cholesterol feeding in mice (Maxwell, K. N., (2003) J.
Lipid Res. 44, 2109-2119), ulated by statins in HepG2 cells (Dubuc, G., (2004) Arterioscler. Thromb. Vase. Biol. 24, 1454-1459), and up-regulated in sterol regulatory element binding protein (SREBP) transgenic mice (Horton, J. D., (2003) Proc. Natl. Acad. Sci. USA 100, 12027-12032), r to the cholesterol biosynthetic enzymes and the low-density lipoprotein or (LDLR). Furthermore, PCSK9 missense ons have been found to be associated with a form of autosomal nt hypercholesterolemia a3) (Abifadel, M., et al. (2003) Nat. Genet. 34, 154-156, Timms, K. M., (2004) Hum. Genet. 114, 349-353, Leren, T. P. (2004) Clin. Genet. 65, 419-422). PCSK9 may also play a role in ining LDL cholesterol levels in the general population, because single-nucleotide polymorphisms (SNPs) have been associated with cholesterol levels in a Japanese population (Shioji, K., (2004) J. Hum. Genet. 49, 109-114).
Autosomal dominant hypercholesterolemias (ADHs) are monogenic diseases in which patients exhibit elevated total and LDL cholesterol levels, tendon xanthomas, and premature atherosclerosis (Rader, D. J., (2003) J. Clin. Invest. 111, 1795-1803). The pathogenesis of ADHs and a recessive form, autosomal recessive hypercholesterolemia (ARH) (Cohen, J. C., (2003) Curr. Opin. l. 14, 121-127), is due to defects in LDL uptake by the liver. ADH may be caused by LDLR mutations, which prevent LDL uptake, or by mutations in the protein on LDL, apolipoprotein B, which binds to the LDLR. ARH is caused by mutations in the ARH protein that are necessary for endocytosis of the LDLR-LDL complex via its interaction with clathrin. Therefore, if PCSK9 ons are causative in Hchola3 families, it seems likely that PCSK9 plays a role in receptor-mediated LDL uptake.
Overexpression studies point to a role for PCSK9 in controlling LDLR levels and, hence, LDL uptake by the liver (Maxwell, K. N. (2004) Proc. Natl. Acad. Sci. USA 101, 7100-7105, net, S., et al. (2004) J. Biol. Chem. 279, 48865-48875, Park, S. W., (2004) J. Biol. Chem. 279, 50630-50638). Adenoviral-mediated overexpression of mouse or human PCSK9 for 3 or 4 days in mice results in elevated total and LDL terol levels; this effect is not seen in LDLR knockout s ll, K. N. (2004) Proc. Natl. Acad. Sci. USA 101, 7100-7105, Benjannet, S., et al. (2004) J. Biol. Chem. 279, 48865-48875, Park, S. W., (2004) J. Biol. Chem. 279, 50630-50638). In addition, PCSK9 pression results in a severe reduction in hepatic LDLR protein, without affecting LDLR mRNA levels, SREBP protein levels, or SREBP protein r to asmic ratio.
While hypercholesterolemia itself is omatic, longstanding elevation of serum cholesterol can lead to atherosclerosis. Over a period of s, chronically elevated serum cholesterol contributes to formation of atheromatous plaques in the arteries which can lead to progressive stenosis or even complete ion of the involved arteries. In on, smaller s may rupture and cause a clot to form and obstruct blood flow ing in, for example, myocardial infarction and/or stroke. If the formation of the stenosis or occlusion is gradual, blood supply to the tissues and organs slowly diminishes until organ function becomes impaired.
Accordingly, there is a need in the art for effective treatments for PCSK9-associated diseases, such as a hyperlipidemia, e.g., hypercholesterolemia.
Summary of the Invention As described in more detail below, disclosed herein are compositions comprising RNAi agents, e.g., double-stranded iRNA agents, targeting PCSK9. Also disclosed are methods using the compositions of the invention for inhibiting PCSK9 expression and for treating pathologies related to PCSK9 expression, e.g., hypercholesterolemia.
Accordingly, in one aspect, the present invention provides a double stranded RNAi agent that ts the expression of Proprotein convertase subtilisin kexin 9 (PCSK9) in a cell, n said double stranded RNAi agent comprises a sense strand complementary to an antisense strand forming a double stranded region, wherein said nse strand comprises a region complementary to part of an mRNA encoding PCSK9, wherein each strand is independently 19 to 30 nucleotides in length, wherein said nse strand comprises at least 19 contiguous nucleotides of the nucleotide sequence 5’ – ACAAAAGCAAAACAGGUCUAG – 3’ (SEQ ID NO: 412) and said double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' np'-Na'-(X 'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z 'Z'Z')l-Na'- nq' 5' (III) wherein: i, j, k, and l are each ndently 0 or 1; p, p’, q, and q' are each independently 0-6; each Na and each Na' independently represents an oligonucleotide sequence comprising 0-25 tides, 2-20 of which are modified nucleotides, each sequence comprising at least two differently modified nucleotides, wherein the modified nucleotides are each independently selected from the group consisting of 2’-O-methyl, 2’-fluoro, and 2'- deoxythymidine (dT); each Nb and each Nb' independently ents an ucleotide ce comprising 0-10 nucleotides, 1-10 of which are modified nucleotides, wherein the modified nucleotides are each independently selected from the group consisting of 2’-O-methyl, 2’- fluoro, and xythymidine (dT); wherein the double stranded RNAi agent comprises at least one rothioate or methylphosphonate internucleotide linkage; np, np', nq, and nq', each of which may or may not be present, independently represents an overhang nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications on the nucleotides are 2’-O-methyl or 2’-fluro modifications, and wherein XXX is complementary to X’X’X’, YYY is complementary to Y’Y’Y’, and ZZZ is mentary to Z’Z’Z’; and wherein the sense strand is conjugated to at least one ligand which is one or more GalNAc derivatives attached through a bivalent or ent branched linker.
In another aspect, the present invention provides a pharmaceutical composition comprising the double stranded RNAi agent of the invention, and at least one pharmaceutically acceptable excipient.
In another aspect, the present invention provides an isolated cell containing the double stranded RNAi agent of the invention.
In another aspect, the present invention provides the use of the double stranded RNAi agent of the ion in the manufacture of a medicament for inhibiting PCSK9 expression in a cell, wherein the ment is formulated such that: (a) after the cell is contacted with the double stranded RNAi agent; and (b) after maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a PCSK9 gene, the expression of the PCSK9 gene in the cell is inhibited.
In another , the present invention provides the use of the double stranded RNAi agent of the invention in the manufacture of a medicament for treating a subject having a lipidemia mediated by PCSK9 expression.
Also disclosed herein are RNAi agents, e.g., double-stranded RNAi agents, e of inhibiting the expression of Proprotein Convertase 2B followed by page 3 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Subtilisin KeXin 9 (PCSK9) in a cell, wherein the double ed RNAi agent comprises a sense strand complementary to an antisense strand, n the antisense strand comprises a region mentary to part of an mRNA encoding PCSK9, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III): sense: 5' np —Na —(X X X) i—Nb —Y Y Y —Nb —(Z Z Z)J~ —Na — nq 3' antisense: 3' np'—Na'—(X'X'X’)k—Nb’—Y’Y'Y'—Nb’—(Z'Z'Z’)1—Na'— nq' 5' (III) i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0—6; each Na and Na' independently represents an oligonucleotide sequence sing 0— nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides; each Nb and Nb’ independently represents an oligonucleotide sequence comprising 0— 10 nucleotides which are either modified or unmodified or combinations thereof; each np, np', nq, and nq', each of which may or may not be present, independently represents an ng nucleotide; XXX, YYY, ZZZ, X’X'X’, Y'Y’Y’, and Z’Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; modifications on Nb differ from the modification on Y and modifications on Nb’ differ from the modification on Y'; and wherein the sense strand is conjugated to at least one .
In one embodiment, i is 0;j is 0; i is l;j is 1; both i andj are 0; or both i andj are 1.
In another embodiment, k is 0; l is 0; k is l; l is 1; both k and l are 0; or both k and l are 1.
In one embodiment, XXX is complementary to X’X’X’, YYY is mentary to Y’Y’Y’, and ZZZ is complementary to .
In one embodiment YYY motif occurs at or near the cleavage site of the sense strand.
In one embodiment, Y’Y’Y’ motif occurs at the ll, 12 and 13 positions of the antisense strand from the 5'—end.
In one embodiment, Y’ is 2’—O—methyl.
In one embodiment, formula (III) is represented by a (IIIa): sense: 5' np —Na —Y Y Y —Na - nq 3' antisense: 3' np/—Na/— Y’Y’Y’— Na/— nq/ 5' (111a).
In another embodiment, formula (III) is ented by formula (IIIb): sense: 5' np —Na —Y Y Y —Nb —Z Z Z —Na — nq 3' antisense: 3' np/—Na/— Y’Y’Y’—Nb/—Z’Z’Z’— Na/— nq/ 5' (IIIb) [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car wherein each Nb and Nb’ independently represents an oligonucleotide sequence comprising 1- ed nucleotides.
In yet another ment, formula (III) is represented by formula : sense: 5' np —Na —X X X —Nb —Y Y Y —Na — nq 3' antisense: 3' np/—Na/— X’X’X’—Nb/— Y’Y’Y’— Nae nq/ 5' (?le) wherein each Nb and Nb’ independently represents an ucleotide sequence comprising 1- modified nucleotides.
In one embodiment, formula (III) is represented by formula (IIId): sense: 5' np —Na —X X X— Nb —Y Y Y —Nb —Z Z Z —Na — nq 3' antisense: 3' np/—Na/— X’X’X’— Nb/—Y’Y’Y’—Nb/—Z’Z’Z’— Nae nq/ 5' (IIId) wherein each Nb and Nb’ independently ents an oligonucleotide sequence comprising 1- modified nucleotides and each Na and Na’ independently represents an oligonucleotide sequence comprising 2-10 modified nucleotides.
In one embodiment, the double—stranded region is 15—30 nucleotide pairs in length. In another embodiment, the double—stranded region is 17—23 nucleotide pairs in length. In yet another embodiment, the double—stranded region is 17—25 nucleotide pairs in length. In one embodiment, the double—stranded region is 23—27 nucleotide pairs in length. In another ment, the double—stranded region is 19—21 tide pairs in length. In another embodiment, the double—stranded region is 21—23 nucleotide pairs in length. In one embodiment, each strand has 15—30 nucleotides.
In one ment, the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2’—methoxyethyl, lkyl, 2’—O—allyl, 2’—C— allyl, 2’— ?uoro, 2’—deoxy, 2’—hydroxyl, and combinations thereof. In another embodiment, the modifications on the tides are 2’—O—methyl or 2’—?uoro modifications.
In one embodiment, the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In another embodiment, the ligand is O H H HO O AcHN O\/\/\n/N\/\/N OH : HO o H H AcHN \/\/\n/ \/\/ \n/V0%“ O 0 O HO O\/\/\n/N/\/\N o AcHN H H Done embodiment, the ligand is attached to the 3’ end of the sense strand.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car In one embodiment, the RNAi agent is conjugated to the ligand as shown in the following schematic wherein X is O or S. In a specific embodiment, X is O.
In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.
In one embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3’—terminus of one strand. In one ment, the strand is the antisense strand. In another embodiment, the strand is the sense .
In one embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 5’—terminus of one strand. In one embodiment, the strand is the nse strand. In another embodiment, the strand is the sense strand.
In one embodiment, the phosphorothioate or methylphosphonate intemucleotide e is at the both the 5’— and 3’—terminus of one strand. In one embodiment, the strand is the antisense strand.
In one embodiment, the base pair at the 1 position of the 5’—end of the antisense strand of the duplex is an AU base pair.
In one embodiment, the Y nucleotides contain a 2’—?uoro modification.
In one embodiment, the Y’ nucleotides contain a 2’—O—methyl cation.
In one embodiment, p’>0. In another embodiment, p’=2.
In one embodiment, q’=0, p=0, q=0, and p’ overhang nucleotides are complementary to the target mRNA. In another embodiment, q’=0, p=0, q=0, and p’ overhang nucleotides are non—complementary to the target mRNA.
In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.
In one embodiment, at least one np’ is linked to a neighboring nucleotide Via a orothioate e.
In one embodiment, all np’ are linked to neighboring nucleotides Via phosphorothioate linkajes.
In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table 1, Table 2, Table 9, Table 10, Table 12, and Figure 12.
In one embodiment, the RNAi agent is selected from the group consisting of AD- 53815, AD-56663, AD-56658, AD-56676, AD-56666, AD-57928, and AD-60212.
In another aspect, disclosed herein are RNAi agents, e.g., double ed RNAi agents, capable of inhibiting the expression of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) in a cell, wherein the double ed RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding PCSK9, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double ed RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' np'-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')l-Na'- nq' 5' (III) wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q' are each independently 0-6; each Na and Na' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either ed or unmodified or combinations thereof, each sequence sing at least two differently modified nucleotides; each Nb and Nb' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either modified or unmodified or combinations thereof; each np, np', nq, and nq', each of which may or may not be present independently represents an overhang nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each ndently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2?-O-methyl or 2?-fluoro modifications; cations on Nb differ from the modification on Y and modifications on Nb' differ from the modification on Y'; and wherein the sense strand is conjugated to at least one ligand.
In yet r aspect, disclosed herein are RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) in a cell, wherein the double ed RNAi agent comprises a sense strand mentary to an antisense strand, wherein the nse strand comprises a region complementary to part of an mRNA ng PCSK9, n each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' np'-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')l-Na'- nq' 5' (III) wherein: i, j, k, and l are each independently 0 or 1; each np, nq, and nq', each of which may or may not be present, independently represents an ng nucleotide; p, q, and q' are each independently 0-6; np' >0 and at least one np' is linked to a neighboring nucleotide via a phosphorothioate linkage; each Na and Na' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either modified or unmodified or combinations thereof, each ce comprising at least two differently modified nucleotides; each Nb and Nb' independently represents an oligonucleotide sequence sing 0- nucleotides which are either modified or unmodified or combinations thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three utive nucleotides, and wherein the modifications are 2?-O-methyl or 2?-fluoro modifications; modifications on Nb differ from the modification on Y and modifications on Nb' differ from the modification on Y'; and wherein the sense strand is conjugated to at least one ligand.
In a r aspect, disclosed herein are RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an nse strand, wherein the antisense strand comprises a region mentary to part of an mRNA encoding PCSK9, wherein each strand is about 14 to about 30 nucleotides in , wherein the double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' nse: 3' np'-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')l-Na'- nq' 5' (III) wherein: i, j, k, and l are each independently 0 or 1; each np, nq, and nq', each of which may or may not be present, independently represents an overhang nucleotide; p, q, and q' are each independently 0-6; np' >0 and at least one np' is linked to a neighboring nucleotide via a phosphorothioate linkage; each Na and Na' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either modified or unmodified or combinations thereof, each ce comprising at least two differently ed nucleotides; each Nb and Nb' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either modified or unmodified or combinations thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three utive nucleotides, and n the modifications are 2?-O-methyl or 2?-fluoro modifications; modifications on Nb differ from the modification on Y and modifications on Nb' differ from the cation on Y'; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
In another aspect, disclosed herein are RNAi agents, e.g., double stranded RNAi agents capable of inhibiting the expression of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an nse strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding PCSK9, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' np'-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')l-Na'- nq' 5' (III) i, j, k, and l are each independently 0 or 1; each np, nq, and nq', each of which may or may not be present, independently represents an overhang nucleotide; p, q, and q' are each ndently 0-6; np' >0 and at least one np' is linked to a neighboring nucleotide via a phosphorothioate e; each Na and Na' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides; each Nb and Nb' independently represents an oligonucleotide sequence comprising 0- 10 nucleotides which are either modified or unmodified or combinations thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2?-O-methyl or 2?-fluoro cations; modifications on Nb differ from the modification on Y and modifications on Nb' differ from the modification on Y'; n the sense strand comprises at least one phosphorothioate e; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives ed h a bivalent or trivalent ed linker.
In yet r aspect, disclosed herein are RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) in a cell, wherein the double stranded RNAi agent comprises a sense strand complementary to an nse strand, wherein the antisense strand ses a region complementary to part of an mRNA encoding PCSK9, wherein each strand is about 14 to about 30 nucleotides in length, n the double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -Y Y Y - Na - nq 3' antisense: 3' np'-Na'- Y'Y'Y'- Na'- nq' 5' (IIIa) wherein: each np, nq, and nq', each of which may or may not be present, independently represents an ng nucleotide; p, q, and q' are each independently 0-6; np' >0 and at least one np' is linked to a neighboring nucleotide via a orothioate linkage; each Na and Na' independently represents an oligonucleotide sequence comprising 0- nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides; YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, and wherein the modifications are 2?-O- methyl or 2?-fluoro modifications; wherein the sense strand comprises at least one phosphorothioate linkage; and wherein the sense strand is conjugated to at least one ligand, n the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent ed linker.
The present invention also provides cells, vectors, host cells, and pharmaceutical compositions comprising the double stranded RNAi agents of the invention.
In one ment, the present disclosure es RNAi agent ed from the group of RNAi agents listed in Table 1, Table 2, Table 9, Table 10, Table 12, and Figure 12.
In some embodiments, the RNAi agent is administered using a pharmaceutical composition.
In preferred embodiments, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered with a buffer solution, such as an acetate buffer, a e buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).
In one embodiment, the ceutical compositions further se a lipid formulation. In one embodiment, the lipid formulation comprises a LNP, or XTC. In another embodiment, the lipid formulation comprises a MC3.
In one aspect, disclosed herein are methods of inhibiting PCSK9 sion in a cell.
The methods include contacting the cell with an RNAi agent, e.g., a double ed RNAi agent, or vector of the invention; and maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a PCSK9 gene, thereby inhibiting expression of the PCSK9 gene in the cell.
In one embodiment, the cell is within a subject.
In one embodiment, the subject is a human.
In one embodiment, the PCSK9 expression is inhibited by at least about 30% 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%.
In another aspect, sed herein are methods of treating a subject having a disorder mediated by PCSK9 expression. The methods include administering to the subject a therapeutically ive amount of an RNAi agent, e.g., a double ed RNAi agent, or the vector of of the invention, thereby treating the subject.
In one embodiment, the subject is a human.
In one embodiment, the human has hypercholesterolemia.
In one embodiment, the RNAi agent, e.g., double stranded RNAi agent, is administered at a dose of about 0.01 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 50 mg/kg, about 10 mg/kg to about 30 mg/kg, about 10 mg/kg to about 20 mg/kg, about 15 mg/kg to about 20 mg/kg, about 15 mg/kg to about 25 mg/kg, about 15 mg/kg to about 30 mg/kg, or about 20 mg/kg to about 30 mg/kg.
In one embodiment, the RNAi agent, e.g., double stranded RNAi agent, is administered subcutaneously or intravenously.
In one ment, the RNAi agent is administered in a dosing regimen that includes a loading phase followed by a maintenance phase, wherein the loading phase comprises administering a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg five times a week, and wherein the maintenance phase comprises administering a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg once, twice, or three times weekly, once every two weeks, once every three weeks, once a month, once every two , once every three months, once every four months, once every five months, or once every six months.
In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group ting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, and once every about 96 hours.
In yet another aspect, sed herein are methods of treating hypercholesterolemia in a subject. The methods include administering to the subject a ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car therapeutically effective amount of an RNAi agent, 6.5)., a double ed RNAi agent, or the vector of the ion, y treating the subject.
In one embodiment, the subject is a primate or rodent. In another embodiment, the subject is a human.
In one embodiment, the RNAi agent, 6.5)., double ed RNAi agent, is stered at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. In another embodiment, the double stranded RNAi agent is administered at a dose of about 10 mg/kg to about 30 mg/kg.
In one embodiment, the RNAi agent, 6.5)., double stranded RNAi agent, is administered subcutaneously or intravenously.
In one embodiment, the RNAi agent is administered in a dosing regimen that includes a loading phase followed by a maintenance phase, wherein the loading phase comprises administering a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg five times a week, and wherein the maintenance phase comprises administering a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg once, twice, or three times weekly, once every two weeks, once every three weeks, once a month, once every two months, once every three months, once every four months, once every five months, or once every siX months.
In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals ed from the group consisting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, and once every about 96 hours.
In one ment, the methods further comprise determining an LDLR genotype or phenotype of the subject.
In one embodiment, administering results in a decrease in serum cholesterol in the subject.
In one ment, the methods further comprise determining the serum cholesterol level in the subject.
The present invention is further illustrated by the following detailed description and Brief Description of the Drawings Figure l is a graph depicting that there is a dose response effect with AD—48400 conjugated to GalNAc at all three dosages . AD—48399, conjugated to GalNAc, serves as a control.
Figures 2A and 2B are graphs depicting the in viva efficacy and duration of response for the indicated siRNAs.
Figure 3 is a Table showing the sequences of the sense (SEQ ID NOS 1633—1642, respeDly, in order of appearance) and antisense (SEQ ID NOS 1643—1652, respectively, in [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car order of appearance) stands of the duplexes analyzed for in viva efficacy and lead optimization.
Figure 4 is a graph depicting the results of the in viva cy assays for lead zation.
Figure 5 is a graph ing the results of the in viva dose response assays performed in PCSK9 trangenic mice. y—two hours after a single dose of 10 mg/kg, 3 mg/kg, 1 mg/kg, and 0.3 mg/kg of AD—57928, PCSK9 protein levels were determined by ELISA.
Figure 6 is a graph depicting the levels of PCSK9 protein in serum of PCSK9 transgenic mice after administration of AD—57928 in 5x2 mg/kg doses during the “loading phase” and 1x2 mg/kg or 2x2 mg/kg doses during the “maintenance phase”.
Figure 7 is a graph ing the levels of PCSK9 protein in serum of PCSK9 transgenic mice after administration of AD—57928 in 5xl mg/kg doses during the “loading phase” and lxl mg/kg or 2x1 mg/kg doses during the enance .
Figure 8 is a graph depicting the levels of PCSK9 protein in serum of PCSK9 transgenic mice after administration of AD—57928 in 5x0.5 mg/kg doses during the “loading phase” and lx0.5 mg/kg or 2x05 mg/kg doses during the “maintenance phase”.
Figure 9 is a graph ing the results of the in viva dose response assays performed in PCSK9 nic mice. Seventy—two hours after a single dose of 0.3 mg/kg of siRNAs, PCSK9 protein levels were determined by ELISA.
Figure 10 is a graph showing the amount of AD—57928 and AD—58895 per nanogram of liver of C57B6 wild—type mice after administration of a single dose of 1 mg/kg of AD— 57928 or AD—58895.
Figure ll is a graph showing the amout of AD—57928 and AD—58895 expressed as a % of theoretical amount in the liver of C57B6 wild—type mice after administration of a single dose of 1 mg/kg of AD—57928 or AD-58895.
Figure 12A is a Table depicting iRNA agents of the invention containing optimized sequences as compared to AD—57928 sequences. Figure 12A discloses the "Sense" sequences as SEQ ID NOS 1653—165 8, respectively, in order of appearance, and the "Antisense" sequences as SEQ ID NOS 1659—1664, respectively, in order of appearance.
Figure 12B is a graph g the IC50 values of the indicated iRNA agents.
Figure 13 is a graph showing the level of the indicated iRNA agents in the liver of wild—type mice following administration of a single 1 mg/kg dose of the indicated iRNA agent.
Figure 14A is a graph showing the amount of PCSK9 protein in the serum of non— human primates expressed as percent of PCSK9 remaining relative to pre—bleed levels of PCSK9 after administration of the indicated iRNA agents at qu5 + qwx3.
Figure 14B is a graph showing the te amount of PCSK9 protein in the serum of non—hum primates after administration of the indicated iRNA agents at qu5 + qwx3.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Figure 15 is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLC) in the serum of non—human primates expressed as a percent of LDL remaining relative to pre—bleed levels of LDL after administration of the indicated iRNA agents at qu5 + qwx3.
Figure 16A is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLC) in the serum of man primates expressed as a percent of the average amount of eed levels of LDL after administration of AD—57928 at 2 mg/kg, qlw and 1 mg/kg, 2xw.
Figure 16B is a graph showing the amount of PCSK9 protein relative to the pre—bleed amount in the serum of non—human primates after administration of AD—57928 at 2 mg/kg, qlw and 1 mg/kg, 2xw.
Figure 17A is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLC) in the serum of non—human primates expressed as a percent of the average amount of pre—bleed levels of LDL after administration of AD—57928 at 2 mg/kg, 2xw and a single 25 mg/kg dose. The last dose for the 2 mg/kg, 2xw group was day 36.
Figure 17B is a graph showing the amount of PCSK9 protein relative to the pre—bleed amount in the serum of non—human es after administration of AD—57928 at 2 mg/kg, 2xw and a single 25 mg/kg dose.
Figure 18 is a graph showing the amount of low y lipoprotein cholesterol (LDL or LDLC) in the serum of non—human es expressed as a percent of LDL remaining relative to pre—bleed levels of LDL after administration of the indicated iRNA agents at qu5 + qwx3.
Figure 19 is a graph g the amount of low density lipoprotein terol (LDL or LDLC) in the serum of non—human primates expressed as a percent of LDL remaining relative to pre—bleed levels of LDL after administration of the indicated iRNA agents at qu5 + qwx3.
Detailed Description of the Invention The present invention provides compositions comprising RNAi agents, 6.g. double— stranded iRNA agents, targeting PCSK9. Also disclosed are s using the compositions of the ion for inhibiting PCSK9 sion and for treating pathologies related to PCSK9 expression, 6.5)., hypercholesterolemia.
I. Definitions In order that the present invention may be more readily understood, certain terms are first d. In on, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are alntended to be part of this invention. ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an t” means one element or more than one element, e.g., a plurality of elements.
The term "including" is used herein to mean, and is used interchangeably with, the phrase ding but not limited to".
The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise.
As used herein, "PCSK9" refers to the proprotein convertase subtilisin kexin 9 gene or protein. PCSK9 is also known as FH3, HCHOLA3, NARC—l, or NARCl. The term PCSK9 includes human PCSK9, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI:299523249; mouse PCSK9, the amino acid and nucleotide sequence of which may be found in, for e, GenBank Accession No.
GI: 163644257; rat PCSK9, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. Glz77020249. Additional examples of PCSK9 mRNA sequences are readily available using, e.g., GenBank.
As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a PCSK9 gene, including mRNA that is a product of RNA processing of a primary transcription t.
As used herein, the term “strand comprising a sequence” refers to an oligonucleotide sing a chain of tides that is described by the sequence referred to using the standard nucleotide nomenclature.
"G," "C," "A" and "U" each generally stand for a nucleotide that contains e, cytosine, adenine, and uracil as a base, respectively. “T” and “dT” are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e. g., deoxyribothymine, 2’—deoxythymidine or thymidine. However, it will be understood that the term “ribonucleotide” or “nucleotide” or “deoxyribonucleotide” can also refer to a modified tide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties t substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without tion, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or e may be replaced in the nucleotide sequences of the ion by a nucleotide containing, for example, e.
Sequences comprising such replacement es are embodiments of the invention.
The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA—induced silencncomplex (RISC) pathway. iRNA directs the ce—specific degradation of [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., ts, the expression of PCSK9 in a cell, e. g., a cell within a t, such as a mammalian subject.
In one embodiment, an RNAi agent of the invention es a single stranded RNA that interacts with a target RNA sequence, e. g., a PCSK9 target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, it is ed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15 :485). Dicer, a ribonuclease— III—like enzyme, processes the dsRNA into 19—23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 3). The siRNAs are then incorporated into an RNA—induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188). Thus, in one aspect the ion relates to a single stranded RNA (siRNA) ted within a cell and which promotes the formation of a RISC complex to effect ing of the target gene, i.e., a PCSK9 gene.
Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above.
In another embodiment, the RNAi agent may be a single—stranded siRNA that is uced into a cell or organism to inhibit a target mRNA. Single—stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single—stranded siRNAs are generally 15—30 nucleotides and are chemically modified. The design and testing of single—stranded siRNAs are described in US. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150: 883—894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense tide ces described herein may be used as a single—stranded siRNA as described herein or as chemically modified by the methods bed in Lima et al., (2012) Cell 150;:883—894.
In another embodiment, an “iRNA” for use in the compositions, uses, and methods of the invention is a double—stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double—stranded RNA (dsRNA) le,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a x of ribonucleic acid molecules, having a duplex structure comprising two anti—parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” ations with respect to a target RNA, i.e., a PCSK9 gene. In some embodiments of the invention, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e. g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonIDotides, but as described in detail herein, each or both strands can also include one or [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car more non—ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with al cations; an RNAi agent may include substantial modifications at multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this ication and claims.
The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA les. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’—end of one strand and the 5’—end of the respective other strand forming the duplex structure, the connecting RNA chain is ed to as a “hairpin loop.” Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’—end of one strand and the 5’—end of the tive other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the st strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi agent may comprise one or more nucleotide overhangs.
In one embodiment, an RNAi agent of the invention is a dsRNA of 24—30 nucleotides that interacts with a target RNA sequence, e. g., a PCSK9 target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III clease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease—III—like enzyme, processes the dsRNA into 19—23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA—induced silencing complex (RISC) where one or more ses unwind the siRNA duplex, enabling the complementary antisense strand to guide target ition en, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188). As used herein, a otide overhang” refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of an RNAi agent when a 3'—end of one strand of the RNAi agent extends beyond the 5 '—end of the other , or vice versa. “Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNAi agent, i.e., no nucleotide overhang. A “blunt ended” RNAi agent is a dsRNA that is double—stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule. The RNAi agents of the invention include RNAi agents with nucleotide overhangs at one end (i.e., agents with one overhang and one blunt end) cDith nucleotide overhangs at both ends.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car The term “antisense strand” refers to the strand of a double stranded RNAi agent which includes a region that is substantially complementary to a target sequence (e.g., a human PCSK9 mRNA). As used herein, the term “region complementary to part of an mRNA encoding transthyretin” refers to a region on the antisense strand that is substantially complementary to part of a PCSK9 mRNA sequence. Where the region of complementarity is not fully mentary to the target sequence, the ches are most ted in the terminal s and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5’ and/or 3’ terminus.
The term “sense strand,” as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.
As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately nt to, the ge site.
In some embodiments, the cleavage site ically occurs at the site bound by nucleotides and ll of the antisense strand, and the cleavage region comprises nucleotides ll, 12 and As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide ce to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide sing the second tide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent ions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 500C or 700C for 12—16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. For example, a mentary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
Sequences can be “fully complementary” with respect to each when there is base— pairing of the nucleotides of the first nucleotide sequence with the nucleotides of the second tide sequence over the entire length of the first and second nucleotide sequences.
However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybricnion, while retaining the y to hybridize under the conditions most relevant to [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car their te ation. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer ucleotide comprises a ce of 21 nucleotides that is fully mentary to the shorter oligonucleotide, may yet be referred to as “fully complementary” for the purposes described herein.
“Complementary” sequences, as used herein, may also e, or be formed entirely from, non—Watson—Crick base pairs and/or base pairs formed from non—natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non—Watson—Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.
The terms “complementary,” “fully complementary” and “substantially complementary” herein may be used with respect to the base matching n the sense strand and the antisense strand of a dsRNA, or between the nse strand of a dsRNA and a target sequence, as will be understood from the context of their use.
As used herein, a polynucleotide that is “substantially complementary to at least part of ’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding PCSK9) including a 5’ UTR, an open g frame (ORF), or a 3’ UTR. For e, a polynucleotide is complementary to at least a part of a PCSK9 mRNA if the sequence is substantially complementary to a non—interrupted portion of an mRNA encoding PCSK9.
The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,77 4‘suppressing” and other similar terms, and includes any level of inhibition.
The phrase “inhibiting expression of a PCSK9,” as used herein, includes inhibition of expression of any PCSK9 gene (such as, e.g., a mouse PCSK9 gene, a rat PCSK9 gene, a monkey PCSK9 gene, or a human PCSK9 gene) as well as variants, (e.g., naturally occurring variants), or mutants of a PCSK9 gene. Thus, the PCSK9 gene may be a wild—type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the context of a cally manipulated cell, group of cells, or organism.
“Inhibiting expression of a PCSK9 gene” includes any level of inhibition of a PCSK9 gene, 6.57., at least partial suppression of the expression of a PCSK9 gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
The expression of a PCSK9 gene may be assessed based on the level of any variable associated with PCSK9 gene expression, e.g., PCSK9 mRNA level, PCSK9 protein level, or serum lipid levels. Inhibition may be assessed by a decrease in an te or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre—dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a l (such as, e.g., buffer only control or inactive agent control).
The phrase “contacting a cell with a double stranded RNAi agent,” as used herein, includes contacting a cell by any possible means. ting a cell with a double stranded RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into al contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a ion that will permit or cause it to subsequently come into contact with the cell. ting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. ting a cell in viva may be done, for example, by injecting the RNAi agent into or near the tissue Where the cell is located, or by ing the RNAi agent into another area, the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue Where the cell to be contacted is located. For e, the RNAi agent may contain and/or be d to a ligand, e.g., a GalNAc3 ligand, that directs the RNAi agent to a site of interest, e. g., the liver. Combinations of in vitro and in viva methods of contacting are also possible. In connection with the methods of the invention, a cell might also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.
A "patient" or "subject," as used herein, is intended to include either a human or non— human animal, preferably a mammal, e.g., a monkey. Most preferably, the subject or patient is a human.
A “PCSK9—associated disease,” as used herein, is intended to include any disease ated with the PCSK9 gene or protein. Such a disease may be caused, for example, by excess production of the PCSK9 protein, by PCSK9 gene mutations, by abnormal cleavage of the PCSK9 protein, by abnormal interactions n PCSK9 and other proteins or other endogenous or exogenous nces. Exemplary PCSK9—associated diseases include lipidemias, e.g., a hyperlipidemias, and other forms of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia and the pathological conditions associated with these disorders such as heart and circulatory diseases.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a t for treating a PCSK9 ated disease, is ient to effect treatment of the disease (6.5)., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by PCSK9 sion, the types of preceding or concomitant treatments, if any, and other dual characteristics of the patient to be treated.
“Prophylactically effective amount,” as used , is ed to include the amount of an RNAi agent that, when administered to a t who does not yet experience or display symptoms of a PCSK9—associated disease, but who may be posed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later—developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family y, genetic , the types of preceding or itant treatments, if any, and other individual characteristics of the patient to be treated.
A "therapeutically—effective amount" or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a able benefit/risk ratio applicable to any treatment. RNAi gents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
The term “sample,” as used herein, includes a collection of similar ?uids, cells, or tissues isolated from a subject, as well as ?uids, cells, or tissues present within a subject.
Examples of biological ?uids include blood, serum and l ?uids, plasma, cerebrospinal ?uid, ocular ?uids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or ?uids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, 6.57., hepatocytes). In preferred embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a e derived from a subject” refers to liver tissue (or subcomponents thereof) derived from the subject. 11. iRNAs of the ion Described herein are improved double—stranded RNAi agents which inhibit the expreDn of a PCSK9 gene in a cell, such as a cell within a subject, 6.57., a mammal, such as ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car a human having a lipid disorder, e.g., hypercholesterolemia and uses of such double—stranded RNAi agents.
The double—stranded RNAi agents of the ion include agents with chemical modifications as disclosed, for example, in US. Provisional Application No. 61/561,710, filed on November 18, 2011, the entire contents of which are incorporated herein by reference.
As shown herein and in Provisional Application No. 61/561,710, a superior result may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into a sense strand and/or antisense strand of a RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the cation pattern, if present, of the sense and/or nse strand.
The RNAi agent may be optionally conjugated with a GalNAc derivative ligand, for instance on the sense strand. The resulting RNAi agents present superior gene silencing activity.
More ically, it has been surprisingly discovered that when the sense strand and antisense strand of the double—stranded RNAi agent are completely ed to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of an RNAi agent, the gene silencing acitivity of the RNAi agent was superiorly enhanced.
Accordingly, the ion provides double—stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., a Proprotein tase subtilisin kexin 9 (PCSK9) gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand.
Each strand of the RNAi agent may range from 12—30 nucleotides in length. For example, each strand may be between 14—30 nucleotides in , 17—30 nucleotides in length, 25—30 nucleotides in length, 27—30 nucleotides in length, 17—23 nucleotides in , 17—21 nucleotides in length, 17—19 nucleotides in length, 19—25 nucleotides in length, 19—23 nucleotides in length, 19—21 nucleotides in length, 21—25 nucleotides in length, or 21—23 tides in length.
The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 12—30 nucleotide pairs in length. For example, the duplex region can be between 14— nucleotide pairs in length, 17—30 nucleotide pairs in length, 27—30 tide pairs in length, 17 — 23 nucleotide pairs in , 17—21 nucleotide pairs in length, 17—19 nucleotide pairs in length, 19—25 nucleotide pairs in length, 19—23 tide pairs in length, 19— 21 nucleotide pairs in , 21—25 nucleotide pairs in length, or 21—23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
[Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car In one embodiment, the RNAi agent may contain one or more overhang regions and/or capping groups at the 3’—end, 5’—end, or both ends of one or both strands. The ng can be 1—6 nucleotides in length, for instance 2—6 nucleotides in length, 1—5 nucleotides in length, 2—5 nucleotides in length, 1—4 nucleotides in length, 2—4 nucleotides in length, 1—3 nucleotides in length, 2—3 nucleotides in length, or 1—2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non—base s.
In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2’— sugar modified, such as, 2—F, 2’—Omethyl, thymidine (T), 2‘—O—methoxyethyl—5—methyluridine (Teo), 2‘—O—methoxyethyladenosine (Aeo), 2‘—O—methoxyethyl—5—methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an ng sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
The 5 ’— or 3’— overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang (s) contains two tides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3’—end of the sense strand, nse strand, or both s. In one embodiment, this 3’— ng is present in the antisense strand. In one embodiment, this 3’—overhang is present in the sense strand.
The RNAi agent may contain only a single overhang, which can strengthen the erence activity of the RNAi, without affecting its overall stability. For example, the single—stranded overhang may be located at the 3'—terminal end of the sense strand or, alternatively, at the 3'—terminal end of the antisense . The RNAi may also have a blunt end, located at the 5’—end of the antisense strand (or the 3’—end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a tide overhang at the 3’—end, and the 5’—end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5’—end of the antisense strand and 3’—end overhang of the antisense strand favor the guide strand loading into RISC process.
In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5’end. The antisense strand ns at least one motif of three 2’—O—methyl modifications on three consecutive nucleus at positions ll, 12, 13 from the 5 ’end.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car In another embodiment, the RNAi agent is a double ended bluntmer of 20 tides in length, wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive nucleotides at ons 8, 9, 10 from the 5 ’end. The antisense strand ns at least one motif of three ethyl cations on three utive nucleotides at positions 11, 12, 13 from the 5 ’end.
In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5 ’end. The antisense strand contains at least one motif of three 2’—O—methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5 ’end.
In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’—F cations on three consecutive nucleotides at positions 9, 10, 11 from the 5 ’end; the antisense strand contains at least one motif of three 2’—O—methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide ng is at the 3’—end of the antisense strand. When the 2 nucleotide overhang is at the 3’—end of the antisense strand, there may be two phosphorothioate intemucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired tide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate intemucleotide linkages between the terminal three nucleotides at both the 5’—end of the sense strand and at the 5’—end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2’—O—methyl or ro, 6.57., in an ating motif.
Optionally, the RNAi agent further ses a ligand (preferably GalNAc3).
In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three ethyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1—4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 tide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent prefernally results in an siRNA comprising the 3’ end of the second strand, thereby [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car ed set by car reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.
In one embodiment, the sense strand of the RNAi agent ns at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand For an RNAi agent having a duplex region of 17—23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’—end.
Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 ons; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1St nucleotide from the 5’—end of the antisense strand, or, the count starting from the 1St paired nucleotide within the duplex region from the 5’— end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the .
The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the ; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA , the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three tides of the motif in the sense strand forms a base pair with at least one of the three tides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.
In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive tides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing cation” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing cation may occur at one end relative to the first motif which is at or near cleavage site on either side of the lead motif.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Like the sense strand, the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.
In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not e the first one or two terminal nucleotides at the 3’— end, 5’—end or both ends of the .
In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3’—end, 5’—end or both ends of the strand.
When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an p of one, two or three tides; two cations each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.
In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modification which can e one or more alteration of one or both of the non—linking phosphate oxygens and/or of one or more of the g phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar; ale replacement of the phosphate moiety with “dephospho” s; modification or replacement of a naturally occurring base; and replacement or modification of the —phosphate backbone.
As nucleic acids are polymers of subunits, many of the modifications occur at a on which is repeated within a nucleic acid, 6.57., a modification of a base, or a phosphate , or a non—linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, 6.57., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may cDoccur in a single strand region of a RNA. For example, a phosphorothioate [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car modification at a non—linking 0 position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5’ end or ends can be phosphorylated.
It may be possible, 6.5)., to e stability, to include particular bases in overhangs, or to e modified nucleotides or nucleotide ates, in single strand overhangs, 6.57., in a 5’ or 3’ overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some ments all or some of the bases in a 3’ or 5’ overhang may be modified, 6.57., with a modification described herein. Modifications can include, 6.5)., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, or , 2’—deoxy—2’—?uoro (2’—F) 2’—O—methyl modified instead of the ribosugar of the base and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target ce.
In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2’—methoxyethyl, 2’— O—methyl, 2’—O—allyl, 2’—C— allyl, 2’—deoxy, 2’—hydroxyl, or ro. The strands can contain more than one cation. In one embodiment, each e of the sense strand and antisense strand is ndently modified with 2’— O—methyl or ro.
At least two different modifications are typically present on the sense strand and nse strand. Those two modifications may be the 2’— O—methyl or 2’—?uoro modifications, or others.
In one embodiment, the Na and/or Nb comprise modifications of an alternating n.
The term “alternating motif’ as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one . The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of cation to the nucleotide, the alternating motif can be “ABABABABABAB. . .,” “AABBAABBAABB. . .,” “AABAABAABAAB. . .,” “AAABAAABAAAB. . .,” “AAABBBAAABBB. . .,” or “ABCABCABCABC. . .,” etc.
The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB. . .”, “ACACAC. . .” “BDBDBD. . .” or “CDCDCD. . .,” etc.
In one embodiment, the RNAi agent of the invention comprises the modification patterDr the alternating motif on the sense strand relative to the modification pattern for the [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car alternating motif on the antisense strand is d. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the nse strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5’—3’ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 5’—3’of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5’—3’ of the strand and the alternating motif in the antisenese strand may start with “BBAABBAA” from 5’—3’ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns n the sense strand and the antisense strand.
In one ment, the RNAi agent comprises the pattern of the alternating motif of 2'—O—methyl modification and 2’—F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'—O—methyl modification and 2’—F modification on the antisense strand initially, i.e., the 2'—O—methyl modified nucleotide on the sense strand base pairs with a 2'—F modified nucleotide on the antisense strand and vice versa.
The 1 position of the sense strand may start with the 2'—F cation, and the 1 position of the antisense strand may start with the 2'— O—methyl modification.
The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand interrupts the l modification pattern present in the sense strand and/or antisense strand. This interruption of the modification n of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or nse strand surprisingly enhances the gene silencing acitivty to the target gene.
In one embodiment, when the motif of three identical modifications on three consecutive nucleotides is introduced to any of the strands, the modification of the nucleotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is “. . .NaYYYNb. . .,” where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and “Na” and “Nb” represent a modification to the nucleotide next to the motif “YYY” that is different than the cation of Y, and where Na and Nb can be the same or ent modifications. Altnematively, Na and/or Nb may be present or absent when there is a wing modification present.
The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide e cation may occur on any nucleotide of the sense strand or antisense strand or both s in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand and/onisense strand; each internucleotide linkage modification may occur in an alternating [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car pattern on the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense , and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift ve to the alternating pattern of the internucleotide linkage cation on the antisense strand.
In one embodiment, the RNAi comprises a orothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage n the two nucleotides. Internucleotide linkage cations also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the ng nucleotides may be linked through orothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are ng nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. These terminal three nucleotides may be at the 3’—end of the antisense strand, the 3’—end of the sense strand, the 5’—end of the antisense strand, and/or the 5’end of the antisense strand.
In one ment, the 2 tide overhang is at the 3’—end of the antisense strand, and there are two phosphorothioate internucleotide linkages n the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’—end of the sense strand and at the 5 ’—end of the antisense .
In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the , or combinations thereof. The mistmatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (6.57., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar is can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is red over G:C; and I:C is preferred over G:C (I=inosine).
Mismatches, e.g., non—canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (AzT, A:U, G:C) pairings; and pairings which include a universal base are red over canonical pairings.
[Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’— end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., nonical or other than canonical pairings or gs which include a universal base, to promote the dissociation of the antisense strand at the 5’—end of the .
In one embodiment, the nucleotide at the 1 on within the duplex region from the ’—end in the antisense strand is ed from the group consisting of A, dA, dU, U, and dT.
Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’— end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’— end of the antisense strand is an AU base pair.
In one embodiment, the sense strand sequence may be represented by formula (I): ' np-Na-(X X X )i-Nb-Y Y Y -Nb-(Z Z Z )j-Na-nq 3' (I) wherein: i and j are each independently 0 or 1; p and q are each independently 0—6; each Na independently represents an oligonucleotide sequence comprising 0—25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb independently represents an oligonucleotide sequence comprising 0— 10 modified nucleotides; each np and nq independently represent an overhang nucleotide; wherein Nb and Y do not have the same modification; and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2’—F modified nucleotides.
In one embodiment, the Na and/or Nb se modifications of alternating pattern.
In one embodiment, the YYY motif occurs at or near the ge site of the sense . For example, when the RNAi agent has a duplex region of 17—23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (6.5).: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, ll, 10, 11,12 or ll, l2, 13) of — the sense strand, the count starting from the lSt nucleotide, from the 5’—end; or optionally, the count starting at the lSt paired nucleotide within the duplex region, from the 5’— end.
In one embodiment, i is l andj is 0, or i is 0 andj is l, or both i andj are l. The sense strand can therefore be represented by the following as: 5' np-Na-YYY-Nb-ZZZ-Na-nq 3' (lb); ' XXX—Nb—YYY—Na—nq 3' (Ic); or ' np-Na-XXX-Nb-YYY-Nb-ZZZ-Na-nq 3' (Id).
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car When the sense strand is ented by formula (Ib), Nb represents an oligonucleotide sequence comprising 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides. Each Na independently can represent an ucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
When the sense strand is represented as formula (Ic), Nb represents an oligonucleotide sequence sing 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides. Each Na can independently represent an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
When the sense strand is represented as formula (Id), each Nb independently represents an oligonucleotide sequence comprising 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides. Preferably, Nb is 0, l, 2, 3, 4, 5 or 6 Each Na can independently represent an ucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
Each of X, Y and Z may be the same or ent from each other.
In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula: ' YYY— Na—nq 3' (Ia).
When the sense strand is represented by formula (Ia), each Na independently can represent an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II): ' ’-(Z’Z’Z’)k-Nb’-Y’Y’Y’-Nb’-(X’X’X’)1-N’a-np’ 3' (11) wherein: k and l are each independently 0 or 1; p’ and q’ are each independently 0—6; each Na’ independently represents an oligonucleotide sequence comprising 0—25 modified nucleotides, each sequence comprising at least two differently ed nucleotides; each Nb’ independently represents an oligonucleotide sequence comprising 0— 10 modified nucleotides; each np’ and nq’ independently represent an ng nucleotide; wherein Nb’ and Y’ do not have the same modification; X’X’X’, Y’Y’Y’ and Z’Z’Z’ each independently represent one motif of three cal modifications on three consecutive nucleotides.
In one embodiment, the Na’ and/or Nb’ comprise modifications of alternating pattern.
The Y’Y’Y’ motif occurs at or near the cleavage site of the nse strand. For example, when the RNAi agent has a duplex region of l7—23nucleotidein length, the Y’Y’Y’ motifn occur at positions 9, 10, ll;lO, ll, 12; ll, l2, l3; l2, l3, l4 ; or l3, l4, 15 of the [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car antisense strand, with the count starting from the lSt nucleotide, from the 5’—end; or optionally, the count starting at the lSt paired nucleotide Within the duplex region, from the ’— end. Preferably, the Y’Y’Y’ motif occurs at ons ll, l2, 13.
In one ment, Y’Y’Y’ motif is all 2’—OMe modified nucleotides.
In one ment, k is l and l is 0, or k is 0 and l is l, or both k and l are l.
The antisense strand can therefore be represented by the following formulas: ' nqs-Na’-Z’Z’Z’-Nb’-Y’Y’Y’-Na’-nps 3' (IIb); ' nq~—Na’—Y’Y’Y’—Nb’—X’X’X’—nps 3' (IIc); or ' nq~-Na’- Z’Z’Z’-Nb’-Y’Y’Y’-Nb’- -Na’-np~ 3' (11d).
When the antisense strand is represented by formula (IIb), Nb, represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2— , 2—15, or 2—10 modified nucleotides.
When the antisense strand is represented as formula (IIc), Nb’ represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2— , 2—15, or 2—10 modified nucleotides.
When the antisense strand is represented as formula (IId), each Nb’ independently represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0—2 or 0 ed tides. Each Na’ independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides. Preferably, Nb is 0, l, 2, 3, 4, 5 or 6.
In other embodiments, k is 0 and l is 0 and the antisense strand may be ented by the formula: ' nps-Nas-Y’Y’Yl Nas-nq~ 3' (la).
When the antisense strand is represented as formula (IIa), each Na’ independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 ed nucleotides.
Each of X’, Y’ and Z’ may be the same or different from each other.
Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-methyl, 2’-O-allyl, 2’-C- allyl, 2’- hydroxyl, or ro. For example, each tide of the sense strand and antisense strand is independently modified with 2’—O—methyl or 2’—?uoro. Each X, Y, Z, X’, Y’ and Z’, in particular, may ent a 2’—O—methyl modification or a ro modification.
In one ment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and ll positions of the strand when the duplex region is 21 nt, the count starting from the lSt nucleotide from the 5’—end, or optionally, the count starting at the lSt paired nucleotide Within the duplex region, from the 5’— end; and Y represents 2’—F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as Wing [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’—OMe modification or 2’—F modification.
In one embodiment the antisense strand may contain Y’Y’Y’ motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1St nucleotide from the 5’—end, or optionally, the count starting at the 1St paired nucleotide within the duplex region, from the ’— end; and Y’ ents 2’—O—methyl modification. The antisense strand may additionally contain X’X’X’ motif or Z’Z’Z’ motifs as wing cations at the opposite end of the duplex region; and X’X’X’ and Z’Z’Z’ each independently represents a 2’—OMe modification or 2’—F modification.
The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (Ila), (IIb), (11c), and (11d), respectively.
Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by a (III): sense: 5' np —Na—(X X X), —Nb— Y Y Y —Nb —(Z Z Z)j—Na—nq 3' nse: 3' np’—Na’—(X’X’X’)k—Nb’—Y’Y’Y’—Nb’—(Z’Z’Z’)1—Na’—nq’ 5' (111) wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each ndently 0—6; each Na and Na, independently ents an oligonucleotide sequence comprising 0— modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb and Nb, independently represents an oligonucleotide sequence comprising 0— modified nucleotides; wherein each np’, np, nq’, and nq, each of which may or may not be present, independently represents an overhang nucleotide; and XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides.
In one ment, i is 0 andj is 0; ori is 1 andj is 0; or i is 0 andj is 1; or both i and j are 0; or both i andj are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.
Exemplary combinations of the sense strand and antisense strand g a RNAi duplex include the formulas below: ' np — Na —Y Y Y —Na—nq 3' ana—Nag—Y’Y’Y’ —Na’nq’ 5' ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car (Illa) ' np -Na -Y Y Y -Nb -Z Z Z -Na-nq 3' 3' np’—Na’—Y’Y’Y’—Nb’—Z’Z’Z’—Na’nq’ 5' (IIIb) ' np-Na- X X X -Nb -Y Y Y - Na-nq 3' 3' npg—Na’—X’X’X’—Nb’—Y’Y’Y’—Na’—nq’ 5' (IIIC) ' np -Na -X X X -Nb-Y Y Y -Nb- Z Z Z -Na-nq 3' 3' npa-Nay-X’X’XCNb’-Y’Y’Y’-Nb’-Z’Z’Z’-Na-nq’ 5' (IIId) When the RNAi agent is ented by formula (Illa), each Na independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
When the RNAi agent is represented by formula (IIIb), each Nb independently represents an ucleotide sequence comprising 1—10, 1—7, 1—5 or 1—4 modified tides. Each Na independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2— 10 modified nucleotides.
When the RNAi agent is represented as formula (IIIC), each Nb, Nb’ independently represents an oligonucleotide ce comprising O—lO, 0—7, O—lO, 0—7, 0—5, 0—4, 0—2 or 0modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
When the RNAi agent is ented as formula (IIId), each Nb, Nb’ independently represents an oligonucleotide sequence comprising O—lO, 0—7, O—lO, 0—7, 0—5, 0—4, 0—2 or 0modified nucleotides. Each Na, Na, independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides. Each of Na, Na’, Nb and Nb, independently comprises cations of alternating pattern.
Each of X, Y and Z in formulas (III), (Illa), , (IIIC), and (IIId) may be the same or different from each other.
When the RNAi agent is represented by formula (III), (Illa), (IIIb), (IIIC), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y’ nucleotides.
Alternatively, at least two of the Y tides form base pairs with the ponding Y’ nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y’ nucleotides.
When the RNAi agent is represented by formula (Illb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z’ nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z’ nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z’ nucleotides.
When the RNAi agent is represented as formula (IIIC) or (IIId), at least one of the X nucletnes may form a base pair with one of the X’ nucleotides. Alternatively, at least two [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car of the X nucleotides form base pairs with the corresponding X’ nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X’ nucleotides.
In one embodiment, the modification on the Y nucleotide is different than the modification on the Y’ nucleotide, the modification on the Z nucleotide is different than the modification on the Z’ nucleotide, and/or the modification on the X nucleotide is different than the modification on the X’ nucleotide.
In one embodiment, when the RNAi agent is represented by formula , the Na cations are 2’—O—methyl or 2’—?uoro modifications. In another embodiment, when the RNAi agent is represented by a (IIId), the Na modifications are 2’—O—methyl or 2’— ?uoro modifications and np’ >0 and at least one np’ is linked to a neighboring nucleotide a via orothioate e. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2’—O—methyl or 2’—?uoro modifications >0 and , np’ at least one np’ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is ated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In r embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2’—O—methyl or 2’—?uoro cations >0 and at , np’ least one np’ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one orothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a nt or trivalent branched .
In one embodiment, when the RNAi agent is represented by formula (IIIa), the Na modifications are 2’—O—methyl or 2’—?uoro modifications >0 and at least one np’ is linked , np’ to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non—cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
In one ment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by a (III), (IIIa), (IIIb), (IIIc), and , wherein the duplexes are connected by a linker. The linker can be cleavable or non—cleavable.
Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two ent target sites.
In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5’ end, and one or both of the 3’ ends and are [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two ent target sites.
Various publications describe multimeric RNAi agents that can be used in the methods of the invention. Such publications include W02007/091269, US Patent No. 7858769, W02010/141511, W02007/117686, W02009/014887 and W02011/031520 the entire contents of each of which are hereby incorporated herein by reference.
The RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide ts of a dsRNA agent can be replaced with another moiety, 6.57., a non—carbohydrate (preferably cyclic) r to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose ement modification t (RRMS).
A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, 6.g. fused rings. The cyclic carrier may be a fully saturated ring , or it may contain one or more double bonds.
The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two one attachment points” and (ii) at least one “tethering ment point.” A “backbone attachment point” as used herein refers to a functional group, 6. g. a hydroxyl group, or generally, a bond available for, and that is le for oration of the carrier into the backbone, 6.57., the phosphate, or modified ate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, 6. g. , a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e. g. monosaccharide, disaccharide, trisaccharide, accharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, 6.57., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the tuent ring.
The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is ed from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and n; preferably, the c group is selectDrom serinol backbone or diethanolamine backbone.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car In certain specific embodiments, the RNAi agent for use in the methods of the invention is an agent selected from the group of agents listed in Table l and Table 2.
These agents may further comprise a ligand.
A. s The double—stranded RNA (dsRNA) agents of the invention may optionally be conjugated to one or more ligands. The ligand can be attached to the sense strand, antisense strand or both s, at the 3’—end, 5’—end or both ends. For instance, the ligand may be conjugated to the sense . In red embodiments, the ligand is conjgated to the 3’— end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAc3: O H H HO O ACHN O\/\/\n/N\/\/N OH : HO o H H ACHN \/\/\n/ \/\/ “ O 0 O HO O\/\/\n/N/\/\N o ACHN H H In some embodiments, the ligand, e.g., GalNAc ligand, is attached to the 3’ end of the RNAi agent. In one embodiment, the RNAi agent is conjugated to the ligand, e.g., GalNAc ligand, as shown in the following schematic wherein X is O or S. In one embodiment, X is O.
A wide variety of entities can be coupled to the RNAi agents of the present invention.
Preferred es are ligands, which are coupled, preferably covalently, either directly or ctly via an intervening tether.
In preferred embodiments, a ligand alters the distribution, targeting or lifetime of the molecDinto which it is incorporated. In preferred embodiments a ligand provides an ation] car None set by car ation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car enhanced affinity for a selected , e.g., molecule, cell or cell type, compartment, receptor 6.57., a cellular or organ compartment, tissue, organ or region of the body, as, 6.57., compared to a species absent such a . s providing enhanced affinity for a selected target are also termed targeting ligands.
Some ligands can have endosomolytic properties. The endosomolytic ligands promote the lysis of the endosome and/or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic ligand may be a polyanionic peptide or peptidomimetic which shows pH—dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand assumes its active conformation at endosomal pH. The “active” conformation is that mation in which the endosomolytic ligand promotes lysis of the endosome and/or transport of the composition of the invention, or its ents, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic ligands include the GALA peptide (Subbarao et al., Biochemistry, 1987, 26: 2964-2972), the EALA peptide (Vogel et al., J. Am. Chem. 500., 1996, 118: 1581—1586), and their derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In one embodiment, the endosomolytic component may contain a chemical group (6.57., an amino acid) which will undergo a change in charge or protonation in response to a change in pH.
The endosomolytic component may be linear or branched.
Ligands can improve transport, hybridization, and specificity properties and may also improve nuclease resistance of the resultant natural or modified oligoribonucleotide, or a polymeric molecule comprising any combination of monomers described herein and/or natural or modified ribonucleotides.
Ligands in general can include therapeutic modifiers, 6.57., for enhancing uptake; stic compounds or reporter groups e.g., for monitoring distribution; cross—linking agents; and nuclease—resistance conferring moieties. l examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and e mimics.
Ligands can e a lly occurring substance, such as a protein (e.g., human serum albumin (HSA), low—density lipoprotein (LDL), high—density otein (HDL), or globulin); a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or tic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid, an ucleotide (e.g., an aptamer). Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L—aspartic acid, poly L—glutamic acid, styrene—maleic acid ide copolymer, poly(L— lactide—co—glycolied) copolymer, divinyl ether—maleic anhydride copolymer, N—(2— hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2—ethylacryllic acid), N—isopropylacrylamide rs, or polyphosphazine. Example of polyamines e: hylenimine, polylysine (PLL), spern‘n spermidine, polyamine, pseudopeptide—polyamine, peptidomimetic polyamine, [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, 6.5)., a , glycoprotein, lipid or protein, 6.5)., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N— acetyl—galactosamine, N—acetyl—gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, Vitamin B12, , an RGD peptide, an RGD e mimetic or an aptamer.
Other es of s include dyes, intercalating agents (e.g., acridines), cross— linkers (e.g., psoralene, mitomycin C), rins , texaphyrin, Sapphyrin), polycyclic aromatic arbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or a chelator (e.g., EDTA), ilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, l—pyrene butyric acid, dihydrotestosterone, l,3—Bis— O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, l, menthol, 1,3— propanediol, heptadecyl group, palmitic acid, myristic acid,O3—(oleoyl)lithocholic acid, 03— (oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG—40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, abeled markers, enzymes, haptens (e.g., biotin), transport/absorption facilitators (e.g., n, Vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine—imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
Ligands can be proteins, e.g., roteins, or peptides, e.g., les haVing a specific ty for a co—ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and e receptors. They can also include non—peptidic species, such as lipids, lectins, carbohydrates, Vitamins, cofactors, multivalent lactose, multivalent galactose, N—acetyl— galactosamine, N—acetyl—gulucosamine multivalent mannose, multivalent fucose, or aptamers.
The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.
The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, 6.57., by disrupting the cell’s microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, Vincristine, Vinblastine, cytochalasin, zole, japlakinolide, latrunculin A, phalloidin, lide A, indanocine, or myoserVin.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car The ligand can se the uptake of the oligonucleotide into the cell by, for e, activating an in?ammatory se. Exemplary ligands that would have such an effect include tumor necrosis factor alpha (TNFalpha), interleukin—1 beta, or gamma interferon.
In one aspect, the ligand is a lipid or lipid—based molecule. Such a lipid or lipid— based molecule preferably binds a serum protein, 6.5)., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, 6.5)., a non— kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid—based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum n, e.g., HSA.
A lipid based ligand can be used to modulate, e.g., control the binding of the ate to a target tissue. For example, a lipid or lipid—based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid—based ligand that binds to HSA less ly can be used to target the conjugate to the kidney.
In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non— kidney tissue. However, it is preferred that the affinity not be so strong that the HSA—ligand g cannot be reversed.
In another preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
In another aspect, the ligand is a moiety, 6. g. a vitamin, which is taken up by a target cell, 6.57., a erating cell. These are particularly useful for treating disorders characterized by ed cell proliferation, e.g., of the malignant or non—malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include B vitamins, e.g., folic acid, B12, ribo?avin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low density lipoprotein (LDL) and high—density lipoprotein (HDL).
In another aspect, the ligand is a cell—permeation agent, preferably a helical cell— permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a ylmimetic, invertomers, non—peptide or —peptide linkages, and use of D—amino acids. The l agent is preferably an helical agent, which preferably has a lipoplD and a lipophobic phase.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car The ligand can be a peptide or omimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of g into a defined three— dimensional structure similar to a natural peptide. The peptide or peptidomimetic moiety can be about 5—50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell tion peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e. 57., consisting ily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An ary hydrophobic MTS—containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: I).
An RFGF analogue (e. 57., amino acid sequence AALLPVLLAAP (SEQ ID NO: 2)) ning a hydrophobic MTS can also be a targeting moiety. The e moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 3)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 4)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage—display library, or one—bead—one— compound (OBOC) combinatorial y (Lam et al., , 354:82—84, 1991). Preferably the peptide or peptidomimetic tethered to an iRNA agent via an incorporated monomer unit is a cell ing peptide such as an arginine—glycine—aspartic acid (RGD)—peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to se stability or direct conformational properties. Any of the structural modifications described below can be utilized.An RGD peptide moiety can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5 139—43, 2002).
An RGD peptide can facilitate targeting of an iRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783— 787, 2001). Preferably, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD e can be linear or cyclic, and can be modified, e.g. or , glycosylated methylated to facilitate targeting to ic s. For example, a glycosylated RGD peptide can r an iRNA agent to a tumor cell expressing (xVB3 (Haubner et al. , Jour.
Nucl. Med., 42:326—336, 2001). Peptides that target markers enriched in proliferating cells can be used. For example, RGD containing peptides and peptidomimetics can target cancer cells, in particular cells that exhibit an integrin. Thus, one could use RGD peptides, cyclic peptides containing RGD, RGD peptides that include D—amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand.
Genera, such s can be used to control proliferating cells and angiogeneis. Preferred [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car conjugates of this type of ligand target PECAM—l, VEGF, or other cancer gene, e.g., a cancer gene described herein.
A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell—permeating e can be, for example, an a—helical linear peptide (e.g., LL—37 or Ceropin Pl), a disulfide ontaining peptide (6.57., or —defensin, B—defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR—39 or indolicidin).
A cell permeation peptide can also e a nuclear localization signal (NLS). For example, a cell permeation peptide can be a ite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV—1 gp4l and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717—2724, 2003).
In one embodiment, a targeting peptide can be an amphipathic a—helical peptide.
Exemplary amphipathic a—helical peptides include, but are not limited to, cecropins, lycotoxins, paradaxins, n, CPF, bombinin—like peptide (BLP), icidins, ceratotoxins, S. clava peptides, hagfish intestinal antimicrobial peptides (HFIAPs), ines, brevinins—2, dermaseptins, melittins, pleurocidin, HZA peptides, Xenopus peptides, esculentinis—l, and caerins. A number of factors will preferably be ered to maintain the integrity of helix stability. For example, a maximum number of helix ization residues will be utilized (e.g., leu, ala, or lys), and a minimum number helix destabilization residues will be utilized (e.g., proline, or cyclic monomeric units. The capping residue will be considered (for example Gly is an exemplary ing residue and/or C—terminal amidation can be used to provide an extra H—bond to ize the helix.
Formation of salt bridges between residues with opposite charges, ted by i i 3, or i i 4 positions can provide stability. For example, cationic residues such as lysine, arginine, homo—arginine, omithine or histidine can form salt bridges with the anionic residues glutamate or aspartate.
Peptide and peptidomimetic ligands include those having naturally occurring or modified peptides, e.g., D or L peptides; or, B, or y peptides; N—methyl peptides; azapeptides; peptides having one or more amide, i.e., e, linkages replaced with one or more urea, thiourea, carbamate, or sulfonyl urea linkages; or cyclic peptides.
The targeting ligand can be any ligand that is capable of targeting a specific or.
Examples are: , GalNAc, galactose, mannose, mannose—6P, clusters of sugars such as GalNAc cluster, mannose cluster, ose cluster, or an apatamer. A cluster is a combination of two or more sugar units. The targeting ligands also include integrin receptor s, Chemokine receptor ligands, transferrin, biotin, serotonin receptor s, PSMA, endothelin, GCPII, statin, LDL and HDL ligands. The ligands can also be based on c acid, 6.57., an r. The aptamer can be unmodified or have any combination of modifDions disclosed herein.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Endosomal release agents include oles, poly or oligoimidazoles, PEIs, peptides, fusogenic es, polycaboxylates, polyacations, masked oligo or poly cations or , acetals, polyacetals, ketals/polyketyals, orthoesters, polymers with masked or unmasked cationic or anionic charges, dendrimers with masked or unmasked cationic or anionic charges.
PK modulator stands for cokinetic modulator. PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Examplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, fen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple phosphorothioate linkages in the backbaone are also amenable to the present invention as ligands (e.g., as PK modulating ligands).
In addition, aptamers that bind serum components (e.g., serum proteins) are also amenable to the present invention as PK modulating s.
Other ligand conjugates amenable to the invention are described in US. Patent Applications USSN: 10/916,185, filed August 10, 2004; USSN: 10/946,873, filed September 21, 2004; USSN: 10/833,934, filed August 3, 2007; USSN: ,989 filed April 27, 2005 and USSN: 11/944,227 filed November 21, 2007, which are incorporated by reference in their entireties for all es.
When two or more ligands are present, the ligands can all have same properties, all have different ties or some s have the same properties while others have different properties. For example, a ligand can have targeting properties, have endosomolytic activity or have PK modulating properties. In a preferred embodiment, all the ligands have ent properties.
Ligands can be d to the oligonucleotides at various places, for example, 3’—end, ’—end, and/or at an al position. In preferred embodiments, the ligand is attached to the oligonucleotides via an intervening , 6.57., a carrier bed herein. The ligand or tethered ligand may be present on a monomer when the monomer is incorporated into the growing strand. In some embodiments, the ligand may be incorporated via coupling to a “precursor” monomer after the “precursor” monomer has been incorporated into the growing strand. For example, a monomer , 6.57., an amino—terminated tether (i.e., having no associated ligand), e.g., TAP—(CH2)HNH2 may be incorporated into a growing oligonucelotide strand. In a uent ion, i.e., after incorporation of the precursor monomer into the strand, a ligand having an electrophilic group, 6. g. a penta?uorophenyl ester or aldehyde group, can subsequently be attached to the precursor monomer by coupling the electrophilic groupDhe ligand with the terminal nucleophilic group of the precursor monomer’ s tether.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car In another example, a monomer having a al group suitable for taking part in Click Chemistry reaction may be incorporated, 6.57., an azide or alkyne terminated tether/linker. In a subsequent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having complementary chemical group, 6. g. an alkyne or azide can be attached to the precursor monomer by coupling the alkyne and the azide together.
For double— stranded oligonucleotides, ligands can be ed to one or both s.
In some embodiments, a double—stranded iRNA agent contains a ligand conjugated to the sense strand. In other embodiments, a double—stranded iRNA agent contains a ligand conjugated to the antisense strand.
In some embodiments, ligand can be conjugated to nucleobases, sugar moieties, or intemucleosidic linkages of nucleic acid les. Conjugation to purine nucleobases or derivatives thereof can occur at any position including, clic and exocyclic atoms. In some embodiments, the 2—, 6—, 7—, or 8—positions of a purine nucleobase are attached to a conjugate moiety. Conjugation to pyrimidine nucleobases or derivatives thereof can also occur at any position. In some ments, the 2—, 5—, and 6—positions of a pyrimidine base can be substituted with a conjugate moiety. Conjugation to sugar moieties of nucleosides can occur at any carbon atom. e carbon atoms of a sugar moiety that can be attached to a conjugate moiety include the 2', 3', and 5' carbon atoms. The 1' position can also be attached to a conjugate moiety, such as in an abasic residue. ucleosidic linkages can also bear conjugate moieties. For phosphorus—containing linkages (e.g., odiester, phosphorothioate, phosphorodithiotate, phosphoroamidate, and the like), the conjugate moiety can be ed directly to the phosphorus atom or to an O, N, or S atom bound to the phosphorus atom. For amine— or amide—containing internucleosidic es (e.g., PNA), the conjugate moiety can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.
Any suitable ligand in the field of RNA erence may be used, although the ligand is typically a carbohydrate e. g. monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.
Linkers that ate the ligand to the nucleic acid include those sed above.
For example, the ligand can be one or more GalNAc (N—acetylglucosamine) derivatives attached through a bivalent or trivalent branched linker.
In one embodiment, the dsRNA of the invention is conjugated to a bivalent and trivalent branched linkers include the structures shown in any of formula (IV) — (VII): [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car PZA-QZA-RZA ]YT2A_L2A q JP3A'Q3A'R3A A-L3A P2B_Q2B_R2B I TZB_LZB 2B \fP3B_Q3B_R3B ]3TT3B_L3B q q Formula (IV) a (V) PSA-QSA-RSA I T5A_L5A P4A_Q4A_R4A ]?T4A L4A qSA q P5B_Q5B_ SB ]—q5BT5B_L5B R 4B-R4B]7T4B-L4B PSC-QSC-RscliT5c_ 4B L5c q 5C Formula (VI) Formula (VII) wherein: qZA, qZB, q3A, q3B, q4A, q4B, q5A, q513 and q5C represent independently for each occurrence 0—20 and wherein the repeating unit can be the same or different; PZA,P2B,P3A,P3B,P4A,P413,PSA,P5B,PSC,TZA,T2B,T3A,T3B,T4A,T4B,T4A,TSB,T5C are each independently for each occurrence , CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH or CHzO; QZA, QZB, Q3A, Q3B, Q4A, Q4B, QSA, QSB, Q5C are independently for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), S02, N(RN), C(R’)=C(R”), CEC or C(O); RZA, RZB, R3A, R313, R4A, R413, RSA, RSB, R5C are each independently for each occurrence absent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(Ra)C(O), —C(O)—CH(Ra)—NH—, CO, CH=N—0, w:5,WMr>< v“ WW,S—WSWorheterocyclyl; LZA, LZB, L3A, L3B , L4A, L4B , L5ALSB and L5C ent the ligand; Le. each, independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and Ra is H or amino acid side chain.
Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the sion of a target gene, such as those of formula (VII): [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car PSA'QSA'RSALI5A T5A_L5A PSB-QSB-RSBSBTSB_L5B P5C_Q5C_R5C LITTSC-L5G Formula (VII) wherein LSA, L513 and L5C represent a monosaccharide, such as GalNAc tive.
Examples of le bivalent and ent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the following compounds: O H H HO O\/\/\n/N\/\/N [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car HO HOF§O§ ’°\/\o 0 NHAc H0 0\/\O/\/0 ko NHAc OH \\ HO NM OH HO O\/\O/\/0 Ho&/o\/\OI NHAc NHAc HO OH HO OH H O O HO O N 0M0 HO / HO OH NHAc NHAc O HO OH Howm/Wox NHACHO O O OH HO O\/\/\n/NH Hoé :‘o O\/\) NHAc O NHAc 0 H HO O\/\)I\N/\/\/\/N ACHN H \[01/ O OM /\/\/\/K| AcHN H \[g HO&wwo~ow ACHN H [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car &Q/O\/\)l\ ’\/\/\/NOO H HO N Tr ACHN H O HO OH HO N ACHN Hm To0 HO OH o O H o HO N O ACHN H In other embodiments, the RNAi agent for use in the methods of the invention is an agent selected from the group ting of AD—53815, AD—56663, AD—56658, AD—56676, AD—56666, AD-57928, and l2. 111. Delivery of an iRNA of the Invention The delivery of an iRNA agent of the invention to a cell 6.57., a cell within a subject, such as a human subject (6.57., a subject in need thereof, such as a subject having a lipid disorder, such as a hyperlipidemia) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitra or in viva. In viva delivery may also be med ly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in viva ry may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.
In general, any method of delivering a nucleic acid molecule (in vitra or in viva) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Bial. 2(5): 139—144 and WO94/02595, which are incorporated herein by reference in their entireties). For in viva delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non—specific effects, and accumulation of the delivered le in the target . The non—specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically stering the preparation. Local administration to a treatment site zes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, cular delivery of a VEGF dsRNA by itreal injection in cynomolgus monkeys (Tolentino, MJ., et al (2004) Retina 24: 132— 138) and subretinal injections in mice (Reich, 8]., et al (2003) Mal. Vis. 9:210—216) were bothdegerigion.n to prevent neovascularization in an experimental model of age—related macular In on, direct intratumoral injection of a dsRNA in mice reduces tumor [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car ation] car Unmarked set by car volume (Pille, J et al (2005) Mol. Ther.11:267—274) and can prolong survival of tumor— bearing mice (Kim, WJ., et al (2006) Mol. Ther. 14:343—350; Li, S., et al (2007) Mol. Ther. :515—523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dom, G., et al. (2004) Nucleic Acids ; Tan, PH., et al (2005) Gene Ther. 12:59—66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, GT., et al (2004) Neuroscience 129:521—528; r, ER., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270—17275; Akaneya,Y., et al (2005) J. Neurophysiol. 93:594—602) and to the lungs by intranasal administration (Howard, KA., et al (2006) Mol. Ther. 14:476—484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677—10684; Bitko, V., et al (2005) Nat. Med. 11:50—55). For stering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively red using a drug delivery system; both s act to prevent the rapid degradation of the dsRNA by endo— and exo—nucleases in vivo. Modification of the RNA or the pharmaceutical r can also permit targeting of the iRNA composition to the target tissue and avoid rable off—target s. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance ar uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J et al (2004) Nature 432: 173—178).
Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and e tumor regression in a mouse model of prostate cancer ara, J0., et al (2006) Nat.
Biotechnol. 24: 1005—1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic ry system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a e or micelle (see e.g.
Kim SH., et al (2008) Journal of Controlled Release 129(2): 107—1 16) that encases an iRNA.
The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic— iRNA complexes are well within the abilities of one skilled in the art (see e. g., Sorensen, DR., et al (2003) J.
Mol. Biol 327:761—766; Verma, UN., et al (2003) Clin. Cancer Res. 9:1291—1300; Arnold, AS et al (2007) J. Hypertens. 25: 197—205, which are incorporated herein by reference in their entirety). Some non—limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN., et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS., et al (2006) Nature 441:111—114), cardiolipin (Chien, PY., et al (2005) Cancer Gene Ther. 12:321—328; Pal, A., et al (2005) Int J. Oncol. 26:1087—1091), polyethyleneimine (Bonnet ME., et al arm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car , Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines ia, DA., et al (2007) m. Soc. Trans. 35 :61—67; Yoo, H., et al (1999) Pharm. Res. 16: 1799—1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and extrins can be found in US. Patent No. 7,427,605, which is herein incorporated by reference in its entirety.
A. Vector encoded iRNAs of the Invention iRNA targeting the PCSK9 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5—10; Skillern, A., et al., International PCT Publication No. WO 13, Conrad, International PCT Publication No.
WO 00/22114, and Conrad, US. Pat. No. 6,054,299). sion can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the ic construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non— integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid ann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression s can be co—introduced (e. g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure. iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. otic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such s are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex—planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell. iRNA expression plasmids can be transfected into target cells as a x with ic lipid carriers (e. g., Oligofectamine) or non—cationic lipid—based rs (e.g., Transit— TKOTM). Multiple lipid transfections for iRNA—mediated knockdowns targeting different s of a target RNA over a period of a week or more are also contemplated by the ion. Successful introduction of vectors into host cells can be monitored using various knowDethods. For e, transient transfection can be signaled with a reporter, such as a ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ?uorescent marker, such as Green scent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.
Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, ing but not limited to lentiviral vectors, moloney murine leukemia virus, eta; (c) adeno— ated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an ox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper—dependent or gutless adenovirus. Replication—defective viruses can also be ageous. ent vectors will or will not become incorporated into the cells’ genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of al replication, 6. g. EPV and EBV vectors. Constructs for the recombinant sion of an iRNA will lly require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.
Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc.) ient for expression of the iRNA in the desired target cell or tissue. The regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.
Expression of the iRNA can be precisely regulated, for e, by using an inducible tory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20—24). Such inducible expression s, suitable for the control of dsRNA expression in cells or in mammals e, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl—beta—Dl — thiogalactopyranoside . A person skilled in the art would be able to choose the appropriate tory/promoter sequence based on the intended use of the iRNA transgene.
Viral vectors that contain nucleic acid sequences encoding an iRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581—599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences ng an iRNA are cloned into one or more vectors, which facilitate delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291—302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to herapy. Other references illustrating the use of retroviral s in gene therapD'e: Clowes et al., J. Clin. Invest. 93:644—651 (1994); Kiem et al., Blood 83:1467— [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129—141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 1 14 (1993). Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in US.
Patent Nos. 520; 5,665,557; and 5,981,276, which are herein incorporated by reference. iruses are also contemplated for use in ry of iRNAs of the invention.
Adenoviruses are especially attractive vehicles, e. g., for delivering genes to respiratory lia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease.
Other targets for adenovirus—based delivery systems are liver, the l nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non—dividing cells. Kozarsky and , Current Opinion in Genetics and Development 3:499—503 (1993) present a review of irus—based gene therapy. Bout et al., Human Gene Therapy 5:3—10 (1994) trated the use of adenovirus vectors to er genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431—434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); ngeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775—783 (1995). A suitable AV vector for expressing an iRNA featured in the invention, a method for constructing the recombinant AV , and a method for delivering the vector into target cells, are described in Xia H et al. , Nat. Biotech. 20: 1006—1010.
Adeno—associated virus (AAV) vectors may also be used to ry an iRNA of the invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289—300 (1993); US. Pat. No. ,436,146). In one embodiment, the iRNA can be expressed as two te, complementary single—stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822—3826; US. Pat. No. 5,252,479; US.
Pat. No. 5,139,941; International Patent Application No. W0 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.
Another viral vector le for delivery of an iRNA of the on is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other s, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surfacDoteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AAV vectors can be made to target different cells by ering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), J Viral 76:791—801, the entire disclosure of which is herein incorporated by reference.
The pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is ed.
Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
V. Pharmaceutical Compositions of the Invention The present invention also includes pharmaceutical compositions and formulations which e the iRNAs of the ion. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as bed herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for treating a disease or disorder associated with the expression or activity of a PCSK9 gene, 6. g. a lipid er. Such pharmaceutical compositions are formulated based on the mode of delivery. One e is compositions that are formulated for ic administration via parenteral ry, e.g., by intravenous (IV) delivery. r example is compositions that are formulated for direct ry into the brain parenchyma, e.g., by infusion into the brain, such as by continuous pump infusion.
The ceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.
In the methods of the invention, the RNAi agent may be administered in a solution. A free RNAi agent may be administered in an unbuffered on, e. g., in saline or in water.
Alternatively, the free siRNA may also be administred in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In a red embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.
In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a d value, e.g., at the physiologic values of the human . Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non— metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some Dodiments, the agent for controlling the osmolarity of the solution is a salt. In [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.
The pharmaceutical compositions of the ion may be administered in dosages sufficient to inhibit expression of a PCSK9 gene. In general, a suitable dose of an iRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per am body weight of the recipient per day, lly in the range of about 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.
For example, the RNAi agent, 6.5)., dsRNA, may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges ediate to the recited values are also intended to be part of this invention.
In another embodiment, the RNAi agent, e.g., dsRNA, is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to aboutD-ng/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
For example, the RNAi agent, 6.5)., dsRNA, may be stered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, .5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
In another embodiment, the RNAi agent, e.g.,dsRNA, is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kaout 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, the dsRNA is administered at a dose of about g to about 30 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
For example, subjects can be administered a therapeutic amount of iRNA, such as about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5,15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
The pharmaceutical ition can be administered once daily, or the iRNA can be administered as two, three, or more sub—doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub—dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, 6.57., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a ular site, such as could be used with the agents of the present invention. In this ment, the dosage unit ns a corresponding multiple of the daily dose. ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day als, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bi—monthly.
The skilled artisan will appreciate that certain s can in?uence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single ent or a series of treatments. tes of effective dosages and in viva half—lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in viva testing using an appropriate animal model, as described elsewhere herein.
Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a bleeding er that would benefit from reduction in the expression of PCSK9. Such models can be used for in viva testing of iRNA, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, a mouse containing a transgene expressing human PCSK9.
The ceutical compositions of the present invention can be administered in a number of ways ing upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (6.57., by a transdermal patch), pulmonary, 6.57., by inhalation or insuf?ation of powders or aerosols, including by nebulizer; intratracheal, asal, mal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, 6.57., by intraparenchymal, intrathecal or intraventricular, administration.
The iRNA can be delivered in a manner to target a particular tissue, such as the liver (e.g., the hepatocytes of the liver). ceutical compositions and formulations for topical administration can include transdermal s, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional ceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as , liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. le lipids and liposomes e neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, stoylphosphatidyl cholirDMPC, rolyphosphatidyl choline) ve (e.g., dimyristoylphosphatidyl [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs can be complexed to lipids, in particular to ic .
Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, ic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl l— monocaprate, l—dodecylazacycloheptan—2—one, an acylcarnitine, an acylcholine, or a C1_20 alkyl ester (e. g., isopropylmyristate 1PM), yceride, diglyceride or pharrnaceutically acceptable salt thereof). Topical formulations are described in detail in US. Patent No. 6,747,014, which is incorporated herein by reference.
A. iRNA Formulations sing Membranous Molecular Assemblies An iRNA for use in the compositions and methods of the invention can be formulated for ry in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term ome” refers to a vesicle composed of amphiphilic lipids arranged in at least one r, e. 57., one bilayer or a ity of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the iRNA composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which lly does not include the iRNA composition, gh in some examples, it may. Liposomes are useful for the er and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally r to biological membranes, when mes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the iRNA are delivered into the cell where the iRNA can specifically bind to a target RNA and can mediate RNAi. In some cases the liposomes are also specifically targeted, e. g., to direct the iRNA to particular cell types.
A liposome containing a RNAi agent can be prepared by a variety of s. In one example, the lipid ent of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an athic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, lucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, e. g., by dialysis, to yield a liposomal preparation of RNAi agent.
If necessary a carrier compound that assists in condensation can be added during the condeDion reaction, e. g., by controlled addition. For example, the carrier compound can [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also adjusted to favor condensation.
Methods for ing stable cleotide delivery vehicles, which orate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary s described in Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413—7417, 1987; US. Pat. No. 4,897,355; US. Pat. No. 5,171,678; Bangham, et al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim.
Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 7, 1984. ly used techniques for preparing lipid aggregates of riate size for use as delivery es include sonication and freeze—thaw plus extrusion (see, e. g., Mayer, et al. Biochim. Biophys.
Acta 858: 161, 1986). Micro?uidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775: 169, 1984). These methods are readily adapted to packaging RNAi agent ations into liposomes.
Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic iposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980—985).
Liposomes which are pH—sensitive or negatively—charged, entrap nucleic acids rather than complex with it. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some c acid is entrapped within the aqueous interior of these liposomes. pH—sensitive liposomes have been used to r nucleic acids encoding the thymidine kinase gene to cell monolayers in culture.
Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269—274).
One major type of liposomal composition includes phospholipids other than naturally— derived phosphatidylcholine. l liposome itions, for e, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed ily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formeDom es of phospholipid and/or phosphatidylcholine and/or cholesterol.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Examples of other s to introduce liposomes into cells in vitr0 and in viva include US. Pat. No. 5,283,185; US. Pat. No. 5,171,678; WO 94/00569; WO 93/24640; WO 24; Felgner, J. Biol. Chem. 50, 1994; Nabel, Pr0c. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biachem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.
Non—ionic mal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non—ionic surfactant and cholesterol. nic mal formulations comprising NovasomeTM I (glyceryl dilaurate/cholesterol/polyoxyethylene—10—stearyl ether) and NovasomeTM ll (glyceryl distearate/cholesterol/polyoxyethylene—10—stearyl ether) were used to r cyclosporin—A into the dermis of mouse skin. Results indicated that such non—ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4(6) 466).
Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation mes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized mes are those in which part of the vesicle—forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMl, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, omyelin, or PEG—derivatized lipids, the enhanced circulation half—life of these sterically stabilized mes derives from a d uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).
Various mes comprising one or more glycolipids are known in the art.
Papahadjopoulos et al. (Ann. N. Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside GMl, galactocerebroside sulfate and phosphatidylinositol to improve blood half—lives of liposomes. These gs were expounded upon by Gabizon et al. (Pr0c.
Natl. Acad. Sci. U.S.A., 1988, 85, 6949). US. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside GM1 or a galactocerebroside sulfate ester. US. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising omyelin. Liposomes comprising 1,2—sn—dimyristoylphosphatidylcholine are disclosed in W0 97/13499 (Lim et al).
In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non—cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and cage used to deliver RNAi agents to macrophages.
[Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Further advantages of liposomes include: liposomes obtained from l phospholipids are biocompatible and radable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can t encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
A positively charged synthetic cationic lipid, N—[1—(2,3—dioleyloxy)propyl]—N,N,N— trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid—nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e. g., r, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413—7417, 1987 and US. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).
A DOTMA ue, 1,2—bis(oleoyloxy)—3—(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA—complexing vesicles.
LipofectinTM Bethesda Research Laboratories, rsburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell es, fuse with the plasma membrane, and efficiently deliver onal nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2—bis(oleoyloxy)—3,3— (trimethylammonia)propane (“DOTAP”) (Boehringer Mannheim, Indianapolis, Indiana) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.
Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as oxyspermylglycine oleoylamide ”) (TransfectamTM, a, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5—carboxyspermyl—amide S”) (see, e. g., US.
Pat. No. 678).
Another cationic lipid conjugate es derivatization of the lipid with cholesterol (“DC—Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. . 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in thenence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065 :8, 1991). For certain [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car cell lines, these liposomes containing conjugated cationic lipids, are said to t lower toxicity and provide more efficient transfection than the DOTMA—containing compositions.
Other cially available cationic lipid products include DMRIE and DMRIE—HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.
Liposomal formulations are particularly suited for topical stration, liposomes t several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin. In some implementations, liposomes are used for ring RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e. g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2,405—410 and du Plessis et al., Antiviral Research, 18, 1992, 259—265; Mannino, R. J. and Fould—Fogerite, S., hniques 690, 1988; Itani, T. et al. Gene —276. 1987; Nicolau, C. et al. Meth. Enz. 149:157—176, 1987; Straubinger, R.
M. and Papahadjopoulos, D. Meth. Enz. 101:512—527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851—7855, 1987).
Non—ionic liposomal systems have also been examined to determine their utility in the ry of drugs to the skin, in particular systems comprising non—ionic surfactant and cholesterol. Non—ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene—10—stearyl ether) and Novasome ll (glyceryl distearate/ cholesterol/polyoxyethylene—10—stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.
Liposomes that include iRNA can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, ersomes are a type of able liposomes.
Transferosomes can be made by adding e edge activators, usually surfactants, to a standard liposomal composition. ersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid es must pass through a series of fine pores, each with a diameter less than 50 nm, under the in?uence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self—optimizing (adaptive to the shape of pores, e.g., in the skin), self—repairing, and can frequently reach their s without fragmenting, and often self—loading.
[Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Other formulations amenable to the present ion are described in United States provisional application serial Nos. 61/018,616, filed January 2, 2008; 61/018,611, filed January 2, 2008; ,748, filed March 26, 2008; 61/047,087, filed April 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no , filed October 3, 2007 also describes formulations that are amenable to the present invention.
Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self—optimizing (adaptive to the shape of pores in the skin), self—repairing, frequently reach their targets without fragmenting, and often self—loading. To make transfersomes it is possible to add e edge—activators, usually surfactants, to a standard liposomal ition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome—mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum Surfactants find wide application in formulations such as ons (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations r, in ceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
If the surfactant molecule is not ionized, it is fied as a nonionic surfactant.
Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic tants include nonionic esters such as ne glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose , and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol lates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl es and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most ant members of thenonic surfactant class are the alkyl sulfates and the soaps.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants e quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is fied as amphoteric. Amphoteric surfactants e acrylic acid derivatives, substituted alkylamides, N—alkylbetaines and phosphatides.
The use of tants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
The iRNA for use in the methods of the invention can also be provided as micellar formulations. “Micelles” are defined herein as a particular type of lar assembly in which amphipathic les are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse ement exists if the environment is hydrophobic.
A mixed micellar formulation suitable for delivery through ermal nes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C3 to C22 alkyl sulphate, and a micelle forming compounds. ary micelle forming compounds include in, onic acid, ceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures f. The micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.
In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another , the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by on of the remaining micelle forming nds, with us mixing.
Phenol and/or m—cresol may be added to the mixed micellar composition to stabilize the fDulation and protect against bacterial growth. Alternatively, phenol and/or m—cresol [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car may be added with the micelle forming ients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.
For delivery of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i. 6., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, 6.5)., h a metered valve. The dispensed dose of pharmaceutical agent is led from the metered valve in a fine spray.
Propellants may include en—containing chloro?uorocarbons, hydrogen— containing ?uorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetra?uoroethane) may be used.
The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral es, it is often desirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.
B. Lipid particles iRNAs, e.g., dsRNAs of in the ion may be fully ulated in a lipid formulation, e.g., a LNP, or other c acid—lipid particle.
As used herein, the term "LNP" refers to a stable nucleic acid—lipid particle. LNPs contain a cationic lipid, a non—cationic lipid, and a lipid that ts ation of the particle (e.g., a PEG—lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following enous (iv) ion and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include "pSPLP," which include an encapsulated condensing agent—nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid— lipid les of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid—lipid particles and their method of preparation are sed in, e.g., US. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; US. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.
In one ment, the lipid to drug ratio (mass/mass ratio) (6.57., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50: 1, from about 1:1 to about 25: 1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part on invention.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car The cationic lipid can be, for example, N,N—dioleyl—N,N—dimethylammonium de (DODAC), N,N—distearyl—N,N—dimethylammonium bromide (DDAB), N—(I —(2,3— dioleoyloxy)propyl)—N,N,N—trimethylammonium chloride (DOTAP), N—(I —(2,3— dioleyloxy)propyl)—N,N,N—trimethylammonium chloride (DOTMA), N,N—dimethyl—2,3— dioleyloxy)propylamine (DODMA), 1,2—DiLinoleyloxy—N,N—dimethylaminopropane (DLinDMA), l,2—Dilinolenyloxy—N,N—dimethylaminopropane (DLenDMA), 1,2— leylcarbamoyloxy—3—dimethylaminopropane (DLin—C—DAP), 1,2—Dilinoleyoxy—3— (dimethylamino)acetoxypropane (DLin—DAC), 1,2—Dilinoleyoxy—3—morpholinopropane (DLin—MA), linoleoyl—3—dimethylaminopropane AP), linoleylthio—3— dimethylaminopropane (DLin—S—DMA), 1—Linoleoyl—2—linoleyloxy—3—dimethylaminopropane (DLin—2—DMAP), 1,2—Dilinoleyloxy—3—trimethylaminopropane chloride salt (DLin—TMA.Cl), 1,2—Dilinoleoyl—3—trimethylaminopropane chloride salt (DLin—TAP.Cl), 1,2—Dilinoleyloxy—3— (N—methylpiperazino)propane (DLin—MPZ), or 3—(N,N—Dilinoleylamino)—1,2—propanediol (DLinAP), —Dioleylamino)—1,2—propanedio (DOAP), 1,2—Dilinoleyloxo—3—(2—N,N— dimethylamino)ethoxypropane (DLin—EG—DMA), l,2—Dilinolenyloxy—N,N— dimethylaminopropane (DLinDMA), 2,2—Dilinoleyl—4—dimethylaminomethyl—[1,3]—dioxolane (DLin—K—DMA) or analogs thereof, (3aR,5s,6aS)—N,N—dimethyl—2,2—di((9Z,12Z)—octadeca— 9,12—dienyl)tetrahydro—3aH—cyclopenta[d][1,3]dioxol—5—amine (ALN100), (6Z,9Z,2SZ,312)— heptatriaconta—6,9,28,31—tetraen—19—yl ethylamino)butanoate (MC3), 1,1'—(2—(4—(2—((2— (bis (2—hydroxydodecyl)amino)ethyl)(2—hydroxydodecyl)amino)ethyl)piperazin— 1— yl)ethylazanediyl)didodecan—2—ol (Tech G1), or a mixture thereof. The cationic lipid can comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.
In another embodiment, the compound 2,2—Dilinoleyl—4—dimethylaminoethyl—[1,3]— dioxolane can be used to prepare lipid—siRNA nanoparticles. Synthesis of 2,2—Dilinoleyl—4— dimethylaminoethyl—[1,3]—dioxolane is described in United States provisional patent application number 61/107,998 filed on October 23, 2008, which is herein incorporated by reference.
In one embodiment, the lipid—siRNA particle includes 40% 2, 2—Dilinoleyl—4— dimethylaminoethyl—[1,3]—dioxolane: 10% DSPC: 40% Cholesterol: 10% DOMG (mole percent) with a particle size of 63.0 i 20 nm and a 0.027 Lipid Ratio.
The ionizable/non—cationic lipid can be an anionic lipid or a neutral lipid ing, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl—phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine , dioleoyl— phosphatidylethanolamine 4—(N—maleimidomethyl)—cyclohexane—l— carbonte (DOPE—mal), itoyl phosphatidyl ethanolamine (DPPE), [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car dimyristoylphosphoethanolamine (DMPE), distearoyl—phosphatidyl—ethanolamine (DSPE), 16—O—monomethyl PE, 16—O—dimethyl PE, 18—1 —trans PE, 1 —stearoyl—2—oleoyl— phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non—cationic lipid can be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.
The conjugated lipid that inhibits aggregation of particles can be, for example, a hyleneglycol (PEG)—lipid including, without tion, a PEG—diacylglycerol (DAG), a PEG—dialkyloxypropyl (DAA), a ospholipid, a PEG—ceramide (Cer), or a mixture thereof. The PEG—DAA conjugate can be, for example, a PEG—dilauryloxypropyl (Ciz), a PEG—dimyristyloxypropyl (Ci4), a PEG—dipalmityloxypropyl (Ci6), or a PEG— distearyloxypropyl (C]3). The conjugated lipid that prevents aggregation of les can be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
In some embodiments, the nucleic acid—lipid particle further includes cholesterol at, 6.57., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.
In one embodiment, the lipidoid ND98-4HCl (MW 1487) (see US. Patent Application No. 12/056,230, filed 3/26/2008, which is incorporated herein by reference), Cholesterol —Aldrich), and PEG—Ceramide C16 (Avanti Polar Lipids) can be used to e lipid— dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as s: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG—Ceramide C16, 100 mg/ml. The ND98, Cholesterol, and PEG—Ceramide C16 stock solutions can then be combined in a, 6.57., 42:48: 10 molar ratio. The ed lipid solution can be mixed with s dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35—45% and the final sodium acetate concentration is about 100—300 mM. Lipid— dsRNA nanoparticles typically form neously upon . Depending on the desired particle size distribution, the resultant rticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut—off) using, for example, a thermobarrel extruder, such as Lipex Extruder ern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential ?ow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
[Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ND98 Isomer | Formula 1 LNPOl formulations are described, 6.57., in International Application Publication No. , which is hereby incorporated by reference.
Additional exemplary lipid—dsRNA formulations are described in Table A.
Table A. cationic lipid/non-cationic ble/Cationic Lipid lipid/cholesterol/PEG-lipid conjugate siRNA ratio DLinDMA/DPPC/Cholesterol?DEG-CDMA l,2-Dilinolenyloxy-N,N-dimethylaminopropane (57.1/7.1/34.4/1.4) (DLinDMA) lipid:siRNA ~ 7:1 XTCDPPC/Cholesterol?DEG-cDMA 2,2-Dilinoleyldimethylaminoethyl-[1, 3] - 57.1/7.1/34.4/1.4 dioxolane (XTC) lipid:siRNA ~ 7:1 XTCADSPC/CholesterolPEG-DMG linoleyldimethylaminoethyl-[1, 3] - 57.5/7.5/31.5/3.5 dioxolane (XTC) lipid:siRNA ~ 6:1 XTCADSPC/CholesterolPEG-DMG 2,2-Dilinoleyldimethylaminoethyl-[1, 3] - 57.5/7.5/31.5/3.5 dioxolane (XTC) lipid:siRNA ~ 11:1 PC/CholesterolPEG-DMG 2,2-Dilinoleyldimethylaminoethyl-[1, 3] - 60/7.5/31/1.5, dioxolane (XTC) lipid:siRNA ~ 6:1 XTCADSPC/CholesterolPEG-DMG 2,2-Dilinoleyldimethylaminoethyl-[1, 3] - 60/7.5/31/1.5, dioxolane (XTC) lipid:siRNA ~ 11:1 XTCADSPC/CholesterolPEG-DMG linoleyldimethylaminoethyl-[1, 3] - 50/10/38.5/1.5 dioxolane (XTC) Lipid:siRNA 10:1 (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)- ALNlOO/DSPC/Cholesterol?DEG-DMG octadeca-9, 12-dienyl)tetrahydro-3aH- 50/10/38.5/1.5 cyclopenta[d] [1,3]dioxolamine (ALN 1 00) Lipid:siRNA 10:1 (6Z,9Z,282,3 1Z)-heptatriaconta—6,9,28,3 1- MC-3DSPC/Cholesterol/PEG-DMG , nyl 4-(dimethylamino)butanoate 50/10/38.5/1.5 (MC3) Lipid:siRNA 10:1 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 2-(4-(2-((2-(bis(2- Tech G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl) (2- 38.5/1.5 hydroxydodecyl)amino)ethyl)piperazin Lipid:siRNA 10:1 l)eth lazanedi l)didodecanol (Tech G1) XTCDSPC/Chol?DEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 MC3HDSPC/Chol?3EG-DMG 40/15/40/5 Lipid:siRNA: 11:1 PC/Chol?DEG-DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA: 11:1 MC3HDSPC/Chol?3EG-DMG 50/10/38.5/1.5 Lipid:siRNA: 7:1 MC3HDSPC/Chol?3EG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 MC3HDSPC/Chol?3EG-DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1 MC3HDSPC/Chol?3EG-DMG 50/10/35/5 Lipid:siRNA: 8:1 MC3HDSPC/Chol?3EG-DPG 50/10/38.5/1.5 siRNA: 10:1 C12-200/DSPC/Chol/PEG-DSG C12-200 50/10/38.5/1.5 Lipid:siRNA: 7: 1 XTCDSPC/Chol?DEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 DSPC: distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG—DMG: PEG—didimyristoyl glycerol (Cl4—PEG, or PEG—C14) (PEG with avg mol wt of 2000) PEG—DSG: PEG—distyryl glycerol (C18—PEG, or PEG—C18) (PEG with avg mol wt of 2000) PEG—CDMA: PEG—carbamoyl—l,2—dimyristyloxypropylamine (PEG with avg mol wt of 2000) LNP ilinolenyloxy—N,N—dimethylaminopropane (DLinDMA)) comprising formulations are described in International ation No. WO2009/127060, filed April 15, 2009, which is hereby incorporated by reference.
XTC comprising formulations are described, e.g., in US. Provisional Serial No. 6l/14DE6, filed January 29, 2009; US. Provisional Serial No. 61/156,851, filed March 2, [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 2009; US. Provisional Serial No. filed June 10, 2009; US. Provisional Serial No. 61/228,373, filed July 24, 2009; US. Provisional Serial No. 61/239,686, filed September 3, 2009, and International Application No. , filed y 29, 2010, which are hereby incorporated by reference.
MC3 comprising formulations are described, 6.57., in US. Publication No. 324120, filed June 10, 2010, the entire contents of which are hereby incorporated by reference.
ALNY—100 comprising formulations are described, e.g., International patent application number PCT/US09/63933, filed on November 10, 2009, which is hereby incorporated by reference.
C12—200 comprising formulations are described in US. Provisional Serial No. 61/175,770, filed May 5, 2009 and International Application No. PCT/US10/33777, filed May 5, 2010, which are hereby incorporated by reference.
Synthesis of ionizable/cationic lipids Any of the compounds, e.g., cationic lipids and the like, used in the nucleic ipid particles of the invention can be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. All tuents are as defined below unless indicated otherwise.
“Alkyl” means a straight chain or branched, noncyclic or , saturated tic hydrocarbon containing from 1 to 24 carbon atoms. Representative saturated ht chain alkyls e methyl, ethyl, n—propyl, n—butyl, n—pentyl, n—hexyl, and the like; while saturated branched alkyls include isopropyl, sec—butyl, yl, tert—butyl, isopentyl, and the like.
Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.
“Alkenyl” means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans s. entative straight chain and ed alkenyls include ethylenyl, propylenyl, 1—butenyl, 2—butenyl, isobutylenyl, 1—pentenyl, 2—pentenyl, 3—methyl—1—butenyl, 2—methyl—2—butenyl, 2,3—dimethyl— 2—butenyl, and the like.
“Alkynyl” means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent s. Representative straight chain and branched alkynyls include acetylenyl, yl, 1—butynyl, 2—butynyl, 1—pentynyl, 2—pentynyl, 3— —1 butynyl, and the like.
“Acyl” means any alkyl, alkenyl, or alkynyl wherein the carbon at the point of attachment is substituted with an oxo group, as defined below. For example, —C(=O)alkyl, — C(=O)alkenyl, and —C(=O)alkynyl are acyl groups.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car “Heterocycle” means a 5— to 7—membered monocyclic, or 7— to lO—membered bicyclic, cyclic ring which is either ted, unsaturated, or aromatic, and which ns from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms can be ally oxidized, and the nitrogen atom can be optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle can be attached via any heteroatom or carbon atom.
Heterocycles include heteroaryls as defined below. cycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, ydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.
The terms “optionally substituted alkyl”, “optionally substituted alkenyl”, “optionally substituted alkynyl”, “optionally substituted acyl”, and “optionally substituted heterocycle” means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (=0) two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, —CN, —ORx, —NRny, —NRxC(=O)Ry, —NRxSO2Ry, -C(=O)Rx, —C(=O)ORx, NRny, —SOnRx and —SOnNRny, wherein n is 0, l or 2, Rx and Ry are the same or ent and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents can be further tuted with one or more of oxo, n, —OH, —CN, alkyl, —ORx, heterocycle, —NRny, —NRxC(=O)Ry, —NRxSO2Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRny, -SOnRx and —SOnNRny.
“Halogen” means ?uoro, chloro, bromo and iodo.
In some embodiments, the methods of the invention can require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, T.W. et al., Wiley—Interscience, New York City, 1999). Brie?y, protecting groups within the context of this invention are any group that reduces or ates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments an ol protecting group” is used. An “alcohol protecting group” is any group which ses or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.
Synthesis ofFormula A In some embodiments, c acid—lipid particles of the invention are formulated using a cationic lipid of formula A: [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car where R1 and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted cyclic ring. In some embodiments, the cationic lipid is XTC (2,2—Dilinoleyl—4—dimethylaminoethyl—[l,3]—dioxolane). In general, the lipid of formula A above can be made by the following Reaction s l or 2, wherein all substituents are as defined above unless ted otherwise.
Scheme 1 Br OH 2 o NHR3R4 R1 R2 1 o N/ R4 R3 R X5 O R1 N// >LR2 5 R3/+ X 0 R1 FormulaA >4R2 Lipid A, where R1 and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone l and bromide 2 can be purchased or prepared according to methods known to those of ordinary skill in the art. on of l and 2 yields ketal 3. Treatment of ketal 3 with amine 4 yields lipids of formula A. The lipids of formula A can be converted to the corresponding ammonium salt with an organic salt of formula 5, where X is anion counter ion ed from halogen, hydroxide, phosphate, sulfate, or the like.
Scheme 2 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Bng—R1 + R2_CN —> O=< R2><R1 Alternatively, the ketone 1 starting material can be prepared according to Scheme 2.
Grignard t 6 and e 7 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 6 and 7 yields ketone 1. Conversion of ketone 1 to the ponding lipids of formula A is as described in Scheme 1.
Synthesis 0fMC3 Preparation of DLin—M—C3—DMA (i.e., (6Z,9Z,282,31Z)—heptatriaconta—6,9,28,31— tetraen—19—yl 4—(dimethylamino)butanoate) was as follows. A solution of (6Z,9Z,282,312)— heptatriaconta—6,9,28,31—tetraen—19—ol (0.53 g), 4—N,N—dimethylaminobutyric acid hydrochloride (0.51 g), 4—N,N—dimethylaminopyridine (0.61 g) and 1—ethyl—3—(3— dimethylaminopropyl)carbodiimide hloride (0.53 g) in dichloromethane (5 mL) was stirred at room ature ght. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic ons were dried over anhydrous ium sulphate, filtered and the solvent removed on a rotovap. The residue was passed down a silica gel column (20 g) using a 1—5% methanol/dichloromethane elution gradient. Fractions containing the purified product were combined and the solvent removed, yielding a colorless oil (0.54 g). Synthesis ofALNY-IOO Synthesis of ketal 519 [ALNY—100] was performed using the ing scheme 3: NHBOC NHMe NCsze .5NCbZMe NCsze ”“0 0504 LAH Cbz-OSu, NEtS + 514 516 515 517A 51713OH 0 PTSA 0 — — LAH, 1M THF 0 _ Me2N|'-- —MerzN""<:E o _ — o _ 519 518 Synthesis of 515 To a stirred suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in a two neck RBF (1L), was added a solution of 514 (10g, 0.04926mol) in 70 mL of THF slowly at 0 0C under nitrogen atmosphere. After complete addition, reaction e was warmD room temperature and then heated to re?ux for 4 h. Progress of the reaction was [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car monitored by TLC. After completion of reaction (by TLC) the mixture was cooled to 0 0C and quenched with careful on of saturated Na2SO4 solution. Reaction mixture was stirred for 4 h at room ature and filtered off. Residue was washed well with THF. The filtrate and gs were mixed and d with 400 mL dioxane and 26 mL conc. HCl and d for 20 s at room temperature. The volatilities were stripped off under vacuum to furnish the hydrochloride salt of 515 as a white solid. Yield: 7.12 g lH—NMR (DMSO, 400MHz): 5: 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).
Synthesis of 516 To a stirred solution of compound 5 15 in 100 mL dry DCM in a 250 mL two neck RBF, was added NEt3 (37.2 mL, 0.2669 mol) and cooled to 0 0C under nitrogen atmosphere.
After a slow addition of N—(benzyloxy—carbonyloxy)—succinimide (20 g, 0.08007 mol) in 50 mL dry DCM, reaction mixture was allowed to warm to room temperature. After completion of the reaction (2—3 h by TLC) mixture was washed successively with lN HCl solution (1 x 100 mL) and saturated NaHCO3 solution (1 x 50 mL). The organic layer was then dried over anhyd. Na2SO4 and the solvent was evaporated to give crude material which was purified by silica gel column chromatography to get 5 16 as sticky mass. Yield: llg (89%). lH—NMR (CDCl3, 400MHz): 5 = 7.36—7.27(m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2.60(m, 2H), 2.30-2.25(m, 2H). LC—MS [M+H] —232.3 (96.94%).
Synthesis of 51 7A and 51 7B The cyclopentene 5 l6 (5 g, 0.02l64 mol) was dissolved in a solution of 220 mL acetone and water (10: l) in a single neck 500 mL RBF and to it was added N—methyl morpholine—N—oxide (7.6 g, 0.06492 mol) followed by 4.2 mL of 7.6% solution of OsO4 (0.275 g, 0.00108 mol) in tert—butanol at room temperature. After completion of the reaction (~ 3 h), the mixture was quenched with addition of solid Na2SO3 and resulting mixture was stirred for 1.5 h at room temperature. on mixture was diluted with DCM (300 mL) and washed with water (2 x 100 mL) followed by saturated NaHCO3 (l x 50 mL) solution, water (1 x 30 mL) and finally with brine (lx 50 mL). Organic phase was dried over an.Na2SO4 and solvent was removed in vacuum. Silica gel column chromatographic purification of the crude material was ed a mixture of diastereomers, which were separated by prep HPLC.
Yield: — 6 g crude 5l7A - Peak-l (white solid), 5.13 g (96%). lH-NMR (DMSO, 400MHz): 5: 7.39—7.3l(m, 5H), , 2H), 4.78-4.73 (m, 1H), 4.48-4.47(d, 2H), 3.94-3.93(m, 2H), , 3H), 1.72- l.67(m, 4H). LC-MS - 266.3, [M+NH4 .5 present, HPLC—97.86%.
Stereochemistry confirmed by X—ray.
Synthesis 0f518 Using a procedure analogous to that described for the synthesis of compound 505, compDi 518 (1.2 g, 41%) was obtained as a colorless oil. lH—NMR (CDCl3, 400MHz): 8: [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 7.35—7.33(m, 4H), 7.30-7.27(m, 1H), 5.37-5.27(m, 8H), 5.12(s, 2H), 4.75(m,1H), 4.58- 4.57(m,2H), 2.78-2.74(m,7H), .00(m,8H), 1.96-1.91(m, 2H), 1.62(m, 4H), 1.48(m, 2H), 1.37-1.25(br m, 36H), 0.87(m, 6H). 8.65%. l Procedure for the Synthesis of Compound 519 A solution of compound 518 (1 eq) in hexane (15 mL) was added in a drop—wise fashion to an ice—cold on of LAH in THF (1 M, 2 eq). After complete addition, the mixture was heated at 400C over 0.5 h then cooled again on an ice bath. The mixture was carefully yzed with saturated aqueous Na2SO4 then filtered through celite and reduced to an oil. Column chromatography ed the pure 519 (1.3 g, 68%) which was obtained as a colorless oil. 13C NMR 8 = 130.2, 130.1 (X2), 127.9 (X3), 112.3, 79.3, 64.4, 44.7, 38.3, .4, 31.5, 29.9 (X2), 29.7, 29.6 (X2), 29.5 (X3), 29.3 (X2), 27.2 (X3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight for C44H80NO2 (M + H)+ Calc. 654.6, Found 654.6.
Formulations prepared by either the standard or eXtrusion—free method can be characterized in similar manners. For eXample, formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. le size and particle size distribution of lipid—nanoparticles can be ed by light scattering using, for eXample, a Malvem Zetasizer Nano ZS (Malvem, USA).
Particles should be about 20—300 nm, such as 40—100 nm in size. The particle size distribution should be al. The total dsRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye eXclusion assay. A sample of the formulated dsRNA can be incubated with an RNA—binding dye, such as Ribogreen (Molecular ) in the presence or absence of a formulation disrupting surfactant, e. g., 0.5% Triton—X100. The total dsRNA in the formulation can be determined by the signal from the sample ning the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the “free” dsRNA content (as measured by the signal in the absence of tant) from the total dsRNA content. Percent entrapped dsRNA is typically >85%. For LNP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. The suitable range is typically about at least 50 nm to about at least 110 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non—aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, ?avoring , diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are stered in conjuDon with one or more penetration enhancer surfactants and chelators. Suitable [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro—24,25—dihydro—fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, noic acid, oleic acid, lauric acid, ic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl l—monocaprate, l— lazacycloheptan—2—one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharrnaceutically acceptable salt f (6.57., ). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in ation with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. r penetration enhancers include yethylene—9—lauryl ether, polyoxyethylene—20—cetyl ether. DsRNAs featured in the invention can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or rticles. DsRNA compleXing agents include poly—amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; ized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; erivatized polyimines, ans, celluloses and starches.
Suitable compleXing agents include chitosan, N—trimethylchitosan, poly—L—lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p—amino), ethylcyanoacrylate), poly(ethylcyanoacrylate), utylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE—methacrylate, DEAE— hexylacrylate, DEAE—acrylamide, DEAE—albumin and DEAE—dextran, thylacrylate, polyhexylacrylate, poly(D,L—lactic acid), poly(DL—lactic—co—glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in US. Patent 6,887,906, US Publn. No. 20030027780, and US. Patent No. 6,747,014, each of which is incorporated herein by reference.
Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous ons which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or ents.
Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome—containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car liquids, self—emulsifying solids and self—emulsifying semisolids. Particularly preferred are formulations that target the liver when ng hepatic disorders such as hepatic oma.
The ceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such ques e the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
The compositions of the present ion can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be ated as suspensions in aqueous, non—aqueous or mixed media. s suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.
C. Additional Formulations The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in r in the form of droplets usually ing 0.1um in diameter (see 6.5)., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., ch NG., and Ansel HC., 2004, cott ms & Wilkins (8th ed.), New York, NY; ldson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 2, p. 335; Higuchi et al., in Remington's ceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems sing two immiscible liquid phases intimately mixed and sed with each other. In general, ons can be of either the water—in—oil (w/o) or the oil—in—water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water—in—oil (w/o) emulsion.
Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil—in—water (o/w) emulsion.
Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either the aqueous phase, oily phase or itself as a sDate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti— ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are sed of more than two phases such as, for example, in the case of oil—in—water—in—oil (o/w/o) and water—in—oil—in—water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not.
Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the al or continuous phase and maintained in this form h the means of emulsifiers or the ity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion—style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can y be classified into four categories: synthetic surfactants, naturally ing emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see 6.5)., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott ms & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, man, Rieger and Banker , 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hilic to the hydrophobic nature of the surfactant has been termed the hile/lipophile balance (HLB) and is a le tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and eric (see 6.5)., s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & s (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such tDthey can soak up water to form w/o emulsions yet retain their semisolid ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with tants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, lgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
A large variety of non—emulsifying materials are also included in emulsion formulations and contribute to the properties of ons. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as ccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, ymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal ons that stabilize ons by forming strong interfacial films around the dispersed—phase droplets and by increasing the ity of the external phase.
Since emulsions often contain a number of ingredients such as ydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p—hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent oration of the formulation. idants used can be free radical scavengers such as tocopherols, alkyl gallates, ted hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and in.
The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see 6.g.
Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott ms & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion ations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see 6. g. Ansel's Pharmaceutical Dosage Forms and Drug every s, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral—oil base laxatives, oil—soluble vitamins and high fat nutritive preparations are among the als that have commonly been administered orally as o/w emulsions. ii. Microemulsions In one embodiment of the present ion, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and hile which is a single optically isotropic and thermodynamically stable liquid solution (see 6.5)., s Pharmaceutical Dosage Forms and Drug ry Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott ms & s (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically microemulsions are systems that are prepared by first sing an oil in an aqueous surfactant on and then adding a sufficient amount of a fourth component, generally an intermediate chain—length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface—active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185—215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, actant and electrolyte. Whether the microemulsion is of the water—in—oil (w/o) or an oil— in—water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).
The phenomenological ch utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate mulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery s, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Block, in ceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to tional emulsions, mulsions offer the advantage of solubilizing water—insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
[Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car tants used in the preparation of mulsions include, but are not limited to, ionic surfactants, non—ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (M0310), hexaglycerol monooleate (P0310), hexaglycerol pentaoleate (P0500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (M0750), decaglycerol leate (S0750), decaglycerol eate (DA0750), alone or in combination with cosurfactants.
The cosurfactant, usually a short—chain alcohol such as ethanol, 1—propanol, and 1—butanol, serves to increase the interfacial ?uidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant les. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol—free self—emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ne glycol. The oil phase can e, but is not limited to, materials such as CapteX 300, CapteX 355, Capmul MCM, fatty acid esters, medium chain (C8—C12) mono, di, and tri—glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized ides, saturated polyglycolized C8—C10 glycerides, vegetable oils and silicone oil.
Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based mulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e. 57., US.
Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; ntinides et al., Pharmaceutical Research, 1994, 11, 1385—1390; Ritschel, Meth. Find. Exp. Clin.
Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant—induced tions in ne ?uidity and permeability, ease of preparation, ease of oral stration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., US. Patent Nos. 6,191,105; 7,063,860; 802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci, 1996, 85, 138—143). 0ften microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be ularly ageous when formulating labile drugs, peptides or iRNAs. Microemulsions have also been ive in the transdermal delivery of active components in both cosmetic and ceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.
Microemulsions of the present invention can also contain additional components and additiDsuch as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present ion. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories—— tants, fatty acids, bile salts, chelating agents, and non—chelating non—surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above. iii. Microparticles An RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray—drying, but may also be produced by other methods including lyophilization, evaporation, ?uid bed drying, vacuum drying, or a combination of these ques. iv. Penetration Enhancers In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of s. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs y cross cell membranes. It has been discovered that even non—lipophilic drugs can cross cell nes if the ne to be crossed is d with a penetration enhancer. In addition to aiding the diffusion of non—lipophilic drugs across cell membranes, penetration enhancers also e the permeability of lipophilic drugs.
Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non—chelating non—surfactants (see e. g., Malmsten, M. Surfactants and polymers in drug delivery, a Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of ation enhancers are described below in greater detail.
Surfactants (or "surface—active ") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for e, sodium lauryl sulfate, polyoxyethylene—9—lauryl ether and polyoxyethylene—20—cetyl ether) (see e. g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC—43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n—decanoic acid), myristic acid, palmitic acid, c acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1—monooleoyl—rac— glycein dilaurin, caprylic acid, arachidonic acid, ol 1—monocaprate, 1— [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car dodecylazacycloheptan—2—one, acylcarnitines, acylcholines, C1_20 alkyl esters thereof (e.g., , isopropyl and l), and mono— and di—glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., u, E., et al.
Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug r Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1—33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651- 654).
The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat—soluble vitamins (see 6.5)., Malmsten, M. tants and polymers in drug delivery, a Health Care, New York, NY, 2002; Brunton, r 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw— Hill, New York, 1996, pp. 934—935). s natural bile salts, and their synthetic derivatives, act as ation enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium late), glycholic acid (sodium glycocholate), eoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro—24,25—dihydro—fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene—9—lauryl ether (POE) (see 6.5)., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical s in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782—783; Muranishi, Critical Reviews in Therapeutic Drug Carrier s, 1990, 7, 1—33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes ith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most terized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315—339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (6.57., sodium salicylate, 5— methoxysalicylate and homovanilate), N—acyl tives of collagen, laureth—9 and o acyl derivatives of beta—diketones (enamines)(see e.g., e, A. et al., Excipient develDent for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, ation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1—33; Buur et al., J. Control Rel, 1990, 14, 43-51).
As used herein, non—chelating non—surfactant penetration enhancing nds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the tary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier s, 1990, 7, 1—33).
This class of penetration enhancers includes, for example, unsaturated cyclic ureas, l— and 1—alkenylazacyclo—alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non—steroidal anti—in?ammatory agents such as diclofenac sodium, indomethacin and butazone (Yamashita et al., J. Pharm.
Pharmacol., 1987, 39, 621—626).
Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as ctin (Junichi et al, US. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the ar uptake of dsRNAs. Examples of commercially available transfection reagents e, for example LipofectamineTM (Invitrogen; Carlsbad, CA), Lipofectamine 2000TM rogen; Carlsbad, CA), 293fectinTM rogen; Carlsbad, CA), CellfectinTM (Invitrogen; Carlsbad, CA), DMRIE—CTM (Invitrogen; Carlsbad, CA), FreeStyleTM MAX (Invitrogen; Carlsbad, CA), LipofectamineTM 2000 CD (Invitrogen; ad, CA), LipofectamineTM (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), OligofectamineTM (Invitrogen; ad, CA), OptifectTM (Invitrogen; ad, CA), X—tremeGENE Q2 ection Reagent (Roche; cherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent acherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, WI), TransFastTM Transfection Reagent (Promega; Madison, WI), foTM—20 Reagent (Promega; Madison, WI), foTM—50 Reagent (Promega; Madison, WI), DreamFectTM (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassa D1 Transfection t (New England Biolabs; Ipswich, MA, USA), LyoVecTM/LipoGenTM (Invitrogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTERTM transfection Reagent (Genlantis; San Diego, CA, USA ), Ribnt (Bioline; Taunton, MA, USA), ct (Bioline; Taunton, MA, USA), [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car UniFECTOR dge International; in View, CA, USA), SureFECTOR (B—Bridge International; Mountain View, CA, USA), or TM (B—Bridge International, in View, CA, USA), among others.
Other agents can be ed to enhance the penetration of the stered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2— pyrrol, , and terpenes such as limonene and menthone. v. Carriers Certain compositions of the present invention also incorporate r compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in viva processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory oirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4—acetamido—4'isothiocyano—stilbene— isulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115—121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177—183. vi. Excipients In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically able solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of stration in mind, so as to provide for the desired bulk, tency, etc., when combined with a c acid and the other components of a given pharmaceutical ition. Typical ceutical carriers include, but are not limited to, binding agents (e. g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e. g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e. g., magnesium stearate, talc, silica, colloidal silicon e, stearic acid, ic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl te, etc).
Pharmaceutically acceptable organic or inorganic excipients suitable for non— parenteral administration which do not deleteriously react with nucleic acids can also be used to fornate the compositions of the present invention. Suitable pharmaceutically acceptable [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car rs include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, e, magnesium stearate, talc, c acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
Formulations for topical administration of c acids can e sterile and non— sterile aqueous solutions, non—aqueous solutions in common solvents such as alcohols, or solutions of the c acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other le additives. Pharmaceutically able organic or inorganic excipients suitable for non—parenteral administration which do not deleteriously react with nucleic acids can be used.
Suitable pharmaceutically able excipients e, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous in, hydroxymethylcellulose, polyvinylpyrrolidone and the like. vii. Other Components The compositions of the present invention can onally n other adjunct components conventionally found in pharmaceutical compositions, at their art—established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically—active materials such as, for example, antipruritics, astringents, local anesthetics or anti—in?ammatory agents, or can contain additional materials useful in ally formulating various dosage forms of the compositions of the present invention, such as dyes, ?avoring agents, vatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with ary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for in?uencing c pressure, buffers, colorings, ?avorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the ation.
Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
The suspension can also contain stabilizers.
In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA nds and (b) one or more agents which function by a non—RNAi mechanism and which are useful in treating a bleeding disorder. Examples of such agents include, but are not lmited to an anti—in?ammatory agent, anti—steatosis agent, anti—viral, and/or anti—fibrosis agent. In addition, other substances commonly used to protect the liver, such as rin, can also be used in conjunction with the iRNAs described herein. Other agents useful for treating liver diseases include telbivudine, entecavir, and protease inhibitors such as telaprevir and other disclosed, for example, in Tung et al., US. Application [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Publication Nos. 2005/0148548, 2004/0167116, and 2003/0144217; and in Hale et al., US.
Application Publication No. 2004/0127488.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental s, 6.57., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio n toxic and therapeutic effects is the therapeutic index and it can be sed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred.
The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to e a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., ing a decreased concentration of the ptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half—maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.
In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in ation with other known agents effective in treatment of pathological processes ed by PCSK9 expression. In any event, the administering physician can adjust the amount and timing of iRNA stration on the basis of results observed using rd measures of efficacy known in the art or bed herein.
IV. Methods For Inhibiting PCSK9 Expression The present invention provides methods of inhibiting expression of a Proprotein Convertase Subtilisin Kexin 9 (PCSK9) in a cell. The methods include ting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of the PCSK9 in the cell, y inhibiting expression of the PCSK9 in the cell.
Contacting of a cell with a double stranded RNAi agent may be done in vitro or in viva. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, 6.57., a human subject, with the RNAi agent. Combinations of in vitro and in viva methods of contacting are also le. Contacting may be direct or ct, as discussed above. Furthermore, contacting a cell may be accomplished via a ing ligand, inclucn any ligand described herein or known in the art. In red embodiments, the [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car targeting ligand is a carbohydrate moiety, 6.g. , a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a site of interest, e.g., the liver of a subject.
The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” egulating” and other similar terms, and includes any level of inhibition.
The phrase “inhibiting expression of a PCSK9” is intended to refer to inhibition of expression of any PCSK9 gene (such as, e.g., a mouse PCSK9 gene, a rat PCSK9 gene, a monkey PCSK9 gene, or a human PCSK9 gene) as well as variants or mutants of a PCSK9 gene. Thus, the PCSK9 gene may be a wild—type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the context of a genetically manipulated cell, group of cells, or organism.
“Inhibiting expression of a PCSK9 gene” includes any level of inhibition of a PCSK9 gene, 6.57., at least partial suppression of the expression of a PCSK9 gene. The expression of the PCSK9 gene may be assessed based on the level, or the change in the level, of any variable associated with PCSK9 gene expression, e.g., PCSK9 mRNA level, PCSK9 protein level, or lipid levels. This level may be assessed in an individual cell or in a group of cells, ing, for example, a sample derived from a subject.
Inhibition may be assessed by a decrease in an absolute or ve level of one or more variables that are ated with PCSK9 expression compared with a control level.
The control level may be any type of control level that is utilized in the art, e.g., a se baseline level, or a level ined from a similar t, cell, or sample that is ted or treated with a control (such as, 6.5)., buffer only control or ve agent l).
In some embodiments of the methods of the invention, expression of a PCSK9 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
Inhibition of the expression of a PCSK9 gene may be sted by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a PCSK9 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were present) such that the expression of a PCSK9 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)). In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRND control cells, using the following formula: [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car (mRNA in l cells) — (mRNA in treated cells) 0100% (mRNA in control cells) Alternatively, inhibition of the expression of a PCSK9 gene may be assessed in terms of a reduction of a parameter that is functionally linked to PCSK9 gene expression, 6.5)., PCSK9 protein expression, such as lipid levels, cholesterol levels, 6.5)., LDLc levels. PCSK9 gene silencing may be determined in any cell expressing PCSK9, either constitutively or by genomic engineering, and by any assay known in the art. The liver is the major site of PCSK9 expression. Other significant sites of sion include the pancreas, kidney, and intestines.
Inhibition of the expression of a PCSK9 protein may be manifested by a ion in the level of the PCSK9 protein that is expressed by a cell or group of cells (6.5)., the level of protein expressed in a sample derived from a t). As explained above for the assessment of mRNA suppression, the inhibiton of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.
A control cell or group of cells that may be used to assess the inhibition of the expression of a PCSK9 gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to ent of the subject with an RNAi agent.
The level of PCSK9 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of PCSK9 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the PCSK9 gene. RNA may be extracted from cells using RNA extraction ques including, for e, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing cleic acid hybridization include nuclear run—on assays, RT—PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 5), rn ng, in situ hybridization, and microarray is.
In one embodiment, the level of expression of PCSK9 is determined using a nucleic acid probe. The term "probe", as used herein, refers to any molecule that is capable of selectively binding to a specific PCSK9. Probes can be synthesized by one of skill in the art, or derived from appropriate ical preparations. Probes may be ically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
Isolated mRNA can be used in hybridization or amplification assays that include, but are nchited to, Southern or Northern analyses, polymerase chain reaction (PCR) analyses [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car and probe arrays. One method for the ination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can ize to PCSK9 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and ted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as ellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of PCSK9 mRNA.
An alternative method for determining the level of expression of PCSK9 in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for e mRNA in the sample, e.g., by RT—PCR (the experimental embodiment set forth in Mullis, 1987, US. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc.
Natl. Acad. Sci. USA 88:189—193), self sustained sequence replication lli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173—1177), Q—Beta Replicase (Lizardi et al. (1988) Bio/Fechnology 6:1197), rolling circle ation (Lizardi et al., US. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In ular aspects of the invention, the level of expression of PCSK9 is determined by quantitative ?uorogenic RT—PCR (i. 6., the TaqManTM System).
The expression levels of PCSK9 mRNA may be monitored using a membrane blot (such as used in hybridization is such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See US. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of PCSK9 expression level may also se using nucleic acid probes in on.
In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the Examples presented herein.
The level of PCSK9 protein expression may be determined using any method known in the art for the measurement of n levels. Such methods e, for example, electrophoresis, ary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), iffusion tography, ?uid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, ?ow cytometry, immunodiffusion (single or double), immunoelectrophoresis, n blotting, radioimmunoassay (RIA), enzyme—linked immunosorbent assays (ELISAs), immunuorescent assays, electrochemiluminescence assays, and the like.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car The term “sample” as used herein refers to a tion of similar ?uids, cells, or tissues ed from a subject, as well as ?uids, cells, or tissues present Within a subject.
Examples of biological ?uids include blood, serum and l ?uids, plasma, lymph, urine, cerebrospinal ?uid, , ocular ?uids, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or ?uids or cells Within those organs. In certain embodiments, samples may be derived from the liver (6.5)., Whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In preferred embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In r embodiments, a “sample derived from a subject” refers to liver tissue derived from the t.
In some embodiments of the methods of the invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site Within the subject. The inhibition of expression of PCSK9 may be assessed using measurements of the level or change in the level of PCSK9 mRNA or PCSK9 protein in a sample derived from ?uid or tissue from the specific site Within the subject. In preferred embodiments, the site is sthe liver. The site may also be a subsection or up of cells from any one of the aforementioned sites. The site may also include cells that express a particular type of receptor.
V. Methods for Treating 0r Preventing a PCSK9-Associated Disease The present invention also provides methods for ng or preventing diseases and conditions that can be modulated by down regulating PCSK9 gene expression. For example, the itions described herein can be used to treat lipidemia, 6.57., a hyperlipidemia and other forms of lipid imbalance such as hypercholesterolemia, riglyceridemia and the pathological conditions associated with these disorders such as heart and circulatory diseases.
Other diseases and conditions that can be modulated by down ting PCSK9 gene expression include lysosomal e diseases including, but not limited to, n—Pick disease, Tay—Sachs disease, Lysosomal acid lipase deficiency, and Gaucher Disease. The methods include administering to the subject a therapeutically effective amount or prophylactically effective amount of an RNAi agent of the invention. In some embodiments, the method includes administering an effective amount of a PCSK9 siRNA to a t having a heterozygous LDLR genotype.
The effect of the decreased PCSK9 gene preferably results in a se in LDLc (low density lipoprotein cholesterol) levels in the blood, and more particularly in the serum, of the mammal. In some embodiments, LDLc levels are decreased by at least 10%, 15%, 20%, 25%, %, 40%, 50%, 60%, 70%, 80%, 90% or more, as compared to pretreatment levels.
[Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car As used herein, a ct" includes a human or non—human animal, preferably a vertebrate, and more preferably a mammal. A subject may e a transgenic organism.
Most preferably, the subject is a human, such as a human suffering from or predisposed to developing a PCSK9—associated disease.
In some ments of the s of the invention, PCSK9 expression is decreased for an extended duration, 6.57., at least one week, two weeks, three weeks, or four weeks or longer. For example, in certain instances, expression of the PCSK9 gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA agent described herein. In some embodiments, the PCSK9 gene is suppressed by at least about 60%, 70%, or 80% by administration of the iRNA agent. In some embodiments, the PCSK9 gene is suppressed by at least about 85%, 90%, or 95% by administration of the double—stranded oligonucleotide.
The RNAi agents of the invention may be administered to a subject using any mode of administration known in the art, including, but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof. In preferred embodiments, the agents are administered subcutaneously.
In some embodiments, the administration is via a depot ion. A depot injection may release the RNAi agent in a consistent way over a prolonged time period. Thus, a depot ion may reduce the frequency of dosing needed to obtain a desired effect, 6.g. , a d inhibition of PCSK9, or a therapeutic or prophylactic effect. A depot injection may also e more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred ments, the depot injection is a subcutaneous injection.
In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In n embodiments, the pump is a aneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.
Other modes of administration include epidural, erebral, intracerebroventricular, nasal administration, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreal, and pulmonary. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.
The method includes administering an iRNA agent, 6.5)., a dose sufficient to depress DDCSK9 mRNA for at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days; and [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car optionally, administering a second single dose of dsRNA, wherein the second single dose is administered at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days after the first single dose is administered, thereby ting the sion of the PCSK9 gene in a subject.
In one embodiment, doses of iRNA agent of the invention are administered not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week. In another embodiment, the administrations can be maintained for one, two, three, or six months, or one year or longer.
In another embodiment, administration can be provided when Low Density Lipoprotein cholesterol (LDLc) levels reach or surpass a predetermined minimal level, such as greater than 70mg/dL, 130 mg/dL, 150 mg/dL, 200 mg/dL, 300 mg/dL, or 400 mg/dL.
In general, the iRNA agent does not activate the immune system, 6.57., it does not increase cytokine levels, such as TNF—alpha or IFN—alpha levels. For example, when measured by an assay, such as an in vitro PBMC assay, such as described herein, the increase in levels of TNF—alpha or pha, is less than 30%, 20%, or 10% of control cells treated with a control dsRNA, such as a dsRNA that does not target PCSK9.
For example, a subject can be administered a therapeutic amount of an iRNA agent, such as 0.5 mg/kg, 1.0 mg/kg, 1.5 mg/kg, 2.0 mg/kg, or 2.5 mg/kg dsRNA. The iRNA agent can be administered by enous infusion over a period of time, such as over a 5 minute, minute, 15 , 20 minute, or 25 minute period. The administration is repeated, for example, on a regular basis, such as biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less nt basis. For example, after administration biweekly for three months, administration can be repeated once per month, for six months or a year or longer. Administration of the iRNA agent can reduce PCSK9 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 10%, at least 15%, at least %, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 % or at least 90% or more.
Before administration of a full dose of the iRNA agent, ts can be administered a smaller dose, such as a 5%> on reaction, and monitored for adverse effects, such as an allergic reaction, or for elevated lipid levels or blood pressure. In another e, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF—alpha or INF—alpha) .
A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of e status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, %, 40%, 50% or more can be tive of effective treatment. Efficacy for a given iRNA agentDe invention or formulation of that iRNA agent can also be judged using an ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car mental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.
In one embodiment, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, n about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 30 mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.
In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about ll mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg. In one embodiment, iRNA agent is administered at a dose of about 25 mg/kg.
The dose of an RNAi agent that is administered to a subject may be tailored to e the risks and benefits of a particular dose, for example, to achieve a desired level of PCSK9 gene suppression (as assessed, 6.57., based on PCSK9 mRNA suppression, PCSK9 protein expression, or a reduction in lipid levels) or a desired therapeutic or prophylactic effect, while at the same time avoiding undesirable side effects.
In some embodiments, the RNAi agent is administered in two or more doses. If desired to facilitate repeated or frequent ons, implantation of a ry , e.g., a pump, semi—permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be ble. In some embodiments, the number or amount of subsequent doses is dependent on the ement of a desired effect, e.g., the suppression of a PCSK9 gene, or the achievement of a therapeutic or prophylactic , e.g., reducing reducing a symptom of hypercholesterolemia. In some embodiments, the RNAi agent is administered according to a schedule. For example, the RNAi agent may be administered once per week, twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced administrations, e.g., hourlDery four hours, every six hours, every eight hours, every twelve hours, daily, every [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car ation] car ionNone set by car [Annotation] car Unmarked set by car 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In other embodiments, the schedule involves closely spaced strations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (6.57., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer time period (6.5)., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the RNAi agent is not administered. In one embodiment, the RNAi agent is initially administered hourly and is later administered at a longer interval (6.g. , daily, weekly, biweekly, or monthly). In r embodiment, the RNAi agent is initially stered daily and is later administered at a longer interval (6.57., weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a specific embodiment, the RNAi agent is stered once daily during a first week, followed by weekly dosing starting on the eighth day of administration. In another ic embodiment, the RNAi agent is administered every other day during a first week followed by weekly dosing ng on the eighth day of administration.
In one embodiment, the iRNA agent is administered two times per week. In one embodiment, iRNA agent is administered two times per week at a dose of 1 mg/kg. In another embodiment, iRNA agent is administered two times per week at a dose of 2 mg/kg.
In one embodiment, the iRNA agent is administered once every two weeks. In one embodiment, iRNA agent is administered once every two week at a dose of 1 mg/kg. In another ment, iRNA agent is administered once every two week at a dose of 2 mg/kg.
In one embodiment, the iRNA agent is administered once a week. In one embodiment, iRNA agent is administered once a week at a dose of 0.5 mg/kg. In one embodiment, iRNA agent is administered once a week at a dose of 1 mg/kg. In another embodiment, iRNA agent is administered once a week at a dose of 2 mg/kg.
In some embodiments, the RNAi agent is stered in a dosing regimen that includes a “loading phase” of closely spaced strations that may be followed by a “maintenance phase”, in which the RNAi agent is administred at longer spaced intervals. In one embodiment, the loading phase comprises five daily administrations of the RNAi agent during the first week. In another embodiment, the maintenance phase comprises one or two weekly administrations of the RNAi agent. In a further embodiment, the maintenance phase lasts for 5 weeks. In one embodiment, the loading phase comprises administration of a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg five times a week. In another embodiment, the maintenance phase comprises administration of a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg once, twice, or three times weekly, once every two weeks, once every three weeks, once a [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car month, once every two months, once every three months, once every four months, once every five months, or once every six months.
Any of these schedules may optionally be repeated for one or more ions. The number of iterations may depend on the achievement of a desired effect, e.g., the ssion of a PCSK9 gene, and/or the achievement of a therapeutic or prophylactic effect, e.g., reducing serum terol levels or reducing a symptom of hypercholesterolemia.
In further embodiments, administration of a siRNA is administered in combination an additional therapeutic agent. The siRNA and an additional therapeutic agent can be administered in combination in the same composition, e. g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.
Examples of additional therapeutic agents include those known to treat an agent known to treat a lipid disorders, such as hypercholesterolemia, atherosclerosis or dyslipidemia. For example, a siRNA featured in the invention can be stered with, e.g., an HMG—CoA reductase inhibitor (e.g., a statin), a fibrate, a bile acid trant, niacin, an antiplatelet agent, an angiotensin converting enzyme inhibitor, an ensin II receptor antagonist (e.g., losartan potassium, such as Merck & Co. 's Cozaar®), an acleoA terol acetyltransferase (ACAT) inhibitor, a cholesterol absorption inhibitor, a cholesterol ester transfer n (CETP) tor, a microsomal ceride transfer protein (MTTP) tor, a cholesterol modulator, a bile acid modulator, a peroxisome proliferation activated receptor (PPAR) agonist, a gene—based therapy, a composite ar protectant (e.g., AGI—lO67, from Atherogenics), a glycoprotein Ilb/IIIa inhibitor, aspirin or an aspirin— like compound, an IBAT inhibitor (e.g., 8—8921 from Shionogi), a squalene synthase tor, or a monocyte chemoattractant protein (MCP)—I inhibitor. Exemplary HMG—CoA reductase inhibitors include atorvastatin (Pfizer's Lipitor®/Tahor/Sortis/Torvast/Cardyl), pravastatin (Bristol—Myers Squibb 's Pravachol, Sankyo's Mevalotin/Sanaprav), simvastatin 's Zocor®/Sinvacor, Boehringer Ingelheim's Denan, Banyu's Lipovas), lovastatin (Merck's Mevacor/Mevinacor, s Lovastatina, Cepa; Schwarz Pharma's Liposcler), ?uvastatin tis' Lescol®/Locol/Lochol, Fujisawa's Cranoc, Solvay's Digaril), cerivastatin 's Lipobay/GlaxoSmithKline's Baycol), rosuvastatin (AstraZeneca' s Crestor®), and pitivastatin (itavastatin/risivastatin) (Nissan Chemical, Kowa Kogyo, Sankyo, and Novartis). Exemplary fibrates include, e.g., brate (e.g., Roche's Befizal®/Cedur®/Bezalip®, Kissei's Bezatol), clofibrate (e.g., Wyeth's Atromid—S®), fenofibrate (e.g., Foumier's Lipidil/Lipantil, 's Tricor®, Takeda's Lipantil, generics), gemfibrozil (e.g., Pfizer' s Lopid/Lipur) and ciprofibrate (Sanofi—Synthelabo's Modalim®).
Exemplary bile acid sequestrants include, e.g., cholestyramine ol—Myers Squibb's an® and Questran LightTM), colestipol (e.g., Pharmacia's Colestid), and colesevelam (Genzne/Sankyo's WelCholTM). Exemplary niacin therapies include, e.g., immediate release ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car formulations, such as Aventis' Nicobid, Upsher—Smith's Niacor, Aventis' Nicolar, and Sanwakagaku's Perycit. Niacin extended release formulations include, e.g., Kos Pharmaceuticals' Niaspan and Upsher—Smith's SIo— Niacin. Exemplary antiplatelet agents include, e.g., aspirin (e.g., Bayer's aspirin), clopidogrel (Sanofi—Synthelabo/Bristol—Myers Squibb's Plavix), and ticlopidine (e.g., Sanofi—Synthelabo's Ticlid and Daiichi's Panaldine).
Other n—like nds useful in combination with a dsRNA targeting PCSK9 include, e.g., Asacard (slow—release aspirin, by Pharmacia) and Pamicogrel (Kanebo/Angelini Ricerche/CEPA). Exemplary angiotensin—converting enzyme inhibitors e, e.g., ramipril (e.g., Aventis' Altace) and enalapril (e.g., Merck & Co.'s Vasotec). Exemplary acyl CoA cholesterol transferase (AC AT) tors e, e. g., avasimibe (Pfizer), e?ucimibe (BioMsrieux Pierre Fabre/Eli Lilly), CS—505 (Sankyo and , and SMP—797 (Sumito).
Exemplary cholesterol absorption inhibitors include, e.g., ezetimibe (Merck/Schering—Plough Pharmaceuticals Zetia®) and Pamaqueside (Pfizer). Exemplary CETP inhibitors include, e.g., Torcetrapib (also called CP—529414, Pfizer), JTT—705 (Japan Tobacco), and CETi—I (Avant Immunotherapeutics). Exemplary microsomal triglyceride transfer protein (MTTP) inhibitors include, e.g., implitapide (Bayer), R—103757 (Janssen), and CP—346086 r). Other exemplary cholesterol tors include, e. g., NO— 1886 (Otsuka/TAP ceutical), C1— 1027 (Pfizer), and WAY— 135433 (Wyeth—Ayerst).
Exemplary bile acid modulators include, e.g., HBS—107 (Hisamitsu/Banyu), Btg—5 11 (British Technology Group), BARI—1453 (Aventis), S—8921 (Shionogi), 3 (Pfizer), and AZD— 7806 (AstraZeneca). Exemplary peroxisome proliferation activated receptor (PPAR) ts include, e.g., tesaglitazar 2) (AstraZeneca), Netoglitazone (MCC— 555) (Mitsubishi/ Johnson & Johnson), GW—409544 (Ligand Phamiaceuticals/GlaxoSmithKline), GW—501516 (Ligand Pharrnaceuticals/GlaxoSmithKline), LY—929 (Ligand Pharmaceuticals and Eli , LY— 465608 (Ligand Pharmaceuticals and Eli Lilly), LY—518674 (Ligand Pharmaceuticals and Eli Lilly), and MK—767 (Merck and Kyorin). Exemplary gene—based therapies include, 6. g. , AdGWEGF 121.10 (GenVec), ApoAl (UCB Pharma/Groupe Fournier), EG—004 (Trinam) (Ark Therapeutics), and ATP —binding cassette orter— Al (ABCAl) (CV Therapeutics/Incyte, Aventis, . Exemplary Glycoprotein Ilb/IIIa inhibitors include, e.g., roxifiban (also called DMP754, Bristol—Myers Squibb), Gantofiban (Merck KGaA/Yamanouchi), and Cromafiban (Millennium Pharmaceuticals). Exemplary ne synthase tors include, e.g., BMS— 1884941 (Bristol—Myers ), CP—210172 (Pfizer), CP—295697 r), CP—294838 (Pfizer), and TAK—475 (Takeda). An exemplary MCP—I inhibitor is, e.g., RS—504393 (Roche Bioscience). The anti—atherosclerotic agent BO— 653 (Chugai Pharmaceuticals), and the nicotinic acid derivative Nyclin (Yamanouchi Pharmacuticals) are also appropriate for administering in combination with a dsRNA featured in tion. Exemplary combination therapies suitable for administration with a dsRNA [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car targeting PCSK9 include, e.g., advicor (Niacin/lovastatin from Kos Pharmaceuticals), amlodipine/atorvastatin r), and ezetimibe/simvastatin (e.g., Vytorin® 10/10, 10/20, /40, and 10/80 tablets by Merck/Schering—Plough Pharmaceuticals). Agents for treating hypercholesterolemia, and suitable for stration in combination with a dsRNA targeting PCSK9 include, 6.5)., lovastatin, niacin Altoprev® Extended—Release s (Aner Labs), lovastatin Caduet® Tablets r), amlodipine besylate, atorvastatin m Crestor® Tablets (AstraZeneca), rosuvastatin calcium Lescol® Capsules (Novartis), atin sodium Lescol® (Reliant, Novartis), ?uvastatin sodium Lipitor® Tablets (Parke—Davis), atorvastatin calcium Lofibra® Capsules (Gate), Niaspan Extended—Release Tablets (Kos), niacin Pravachol Tablets (Bristol—Myers Squibb), pravastatin sodium TriCor® Tablets (Abbott), fenofibrate Vytorin® 10/ 10 Tablets (Merck/Schering—Plough Pharmaceuticals), ezetimibe, simvastatin WelCholTM Tablets (Sankyo), velam hydrochloride Zetia® Tablets (Schering), ezetimibe Zetia® Tablets (Merck/Schering—Plough Pharmaceuticals), and ezetimibe Zocor® s (Merck).
In one embodiment, an iRNA agent is administered in combination with an ezetimibe/simvastatin combination (e.g., Vytorin® (Merck/Schering—Plough Pharmaceuticals)). In one embodiment, the iRNA agent is administered to the patient, and then the additional therapeutic agent is administered to the patient (or vice versa). In another embodiment, the iRNA agent and the additional therapeutic agent are administered at the same time.
In another aspect, the ion features, a method of cting an end user, 6.57., a caregiver or a subject, on how to administer an iRNA agent described herein. The method includes, optionally, providing the end user with one or more doses of the iRNA agent, and instructing the end user to administer the iRNA agent on a regimen described , thereby instructing the end user.
In one aspect, the invention provides a method of treating a patient by selecting a patient on the basis that the patient is in need of LDL lowering, LDL lowering without lowering of HDL, ApoB lowering, or total cholesterol lowering. The method includes administering to the patient a siRNA in an amount ient to lower the patient's LDL levels or ApoB levels, e.g., without substantially lowering HDL levels.
Genetic predisposition plays a role in the development of target gene associated diseases, e.g., hyperlipidemia. Therefore, a t in need of a siRNA can be identified by taking a family history, or, for example, screening for one or more genetic markers or variants. Examples of genes ed in hyperlipidemia e but are not limited to, 6.57., LDL receptor (LDLR), the roteins (ApoAl, ApoB, ApoE, and the like), Cholesteryl ester transfer protein (CETP), Lipoprotein lipase (LPL), hepatic lipase , Endothelial lipase (EL), LecithinXholesteryl acyltransferase (LCAT). ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car A care provider, such as a doctor, nurse, or family member, can take a family history before prescribing or administering an iRNA agent of the invention. In addition, a test may be performed to determine a geneotype or phenotype. For e, a DNA test may be med on a sample from the patient, 6.5)., a blood sample, to identify the PCSK9 genotype and/or phenotype before a PCSK9 dsRNA is administered to the patient. In r embodiment, a test is performed to identify a related pe and/or phenotype, e.g., a LDLR genotype. Example of genetic variants with the LDLR gene can be found in the art, 6.57., in the ing publications which are incorporated by reference: za et al (2005) Am JEpidemiol. l5;l6l(8):7l4-24; Yamada et al. (2008) JMed Genet. Jan;45(l):22-8, Epub 2007 Aug 31; and Boes et al (2009) Exp. Gerontol 44: 136-160, Epub 2008 Nov 17.
VI. Kits The present invention also provides kits for using any of the iRNA agents and/or performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, 6.57., instructions for ting expression of a PCSK9 in a cell by contacting the cell with the RNAi agent(s) in an amount effective to inhibit expression of the PCSK9. The kits may optionally further se means for ting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of PCSK9 (e.g., means for measuring the inhibition of PCSK9 mRNA or TTR protein). Such means for measuring the inhibition of PCSK9 may comprise a means for obtaining a sample from a subject, such as, 6.57., a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods ed in the invention, suitable methods and materials are described below. All publications, patent applications, s, and other references mentioned herein are incorporated by reference in their entirety. In case of con?ict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLES Matens and Methods ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car The following materials and methods were used in the Examples. cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Bi0systems, Foster City, CA, Cat #4368813) A master mix of 2ul 10X Buffer, 0.8ul 25X dNTPs, 2ul Random primers, lul Reverse Transcriptase, 1 ul RNase inhibitor and 3.2ul of H20 per reaction was added into lOul total RNA. cDNA was generated using a Bio—Rad C—lOOO or S—lOOO thermal cycler (Hercules, CA) through the following steps: 25°C 10 min, 37°C 120 min, 85°C 5 sec, 4°C hold.
Cell culture and transfecti0ns Hep3B, HepG2 or HeLa cells (ATCC, as, VA) were grown to near con?uence at 37°C in an here of 5% C02 in recommended media (ATCC) supplemented with % FBS and glutamine (ATCC) before being released from the plate by trypsinization. For duplexes screened in 96—well format, transfection was carried out by adding 44.75 ul of Opti— MEM plus 0.25ul of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778—150) to 5 ul of each siRNA duplex to an individual well in a 96—well plate. The mixture was then incubated at room temperature for 15 minutes. Fifty ul of complete growth media without antibiotic containing ~2 xlO4 cells were then added to the siRNA mixture. For duplexes screened in 384—well format, 5ul of Opti—MEM plus 0. lul of Lipofectamine x (Invitrogen, Carlsbad CA. cat # 13778—150) was mixed with 5ul of each siRNA duplex per an individual well. The mixture was then incubated at room temperature for 15 minutes ed by on of 40ul of complete growth media t antibiotic containing ~8 xlO3 cells. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at lOnM and 0. lnM final duplex concentration and dose response experiments were done using 8 X 5—fold serial dilutions starting from 2nM.
Free uptake transfection Five ul of each GalNac conjugated siRNA in PBS was combined with 3X104 freshly thawed cryopreserved Cynomolgus monkey hepatocytes (In Vitro Technologies— Celsis, Baltimore, MD; lot#JQD) resuspended in 95ul of In Vitro Gro CP media (In Vitro Technologies— , Baltimore, MD) in each well of a 96—well plate or 5ul siRNA and 45 ul media containing l.2xlO3 cells for 384 well plate format. The mixture was ted for about 24 hours at 37°C in an here of 5% C02. siRNAs were tested at multiple trations between 500 and 0.lnM for single dose ments and using 8 X 5 —fold serial dilutions starting from 500nM for dose response ments.
Total RNA isolation using DYNABEADS mRNA Is0lati0n Kit (Invitrogen, part #.' 610-12) Cells were harvested and lysed in l50ul of Lysis/Binding Buffer then mixed for 5 minutes at 850rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the s). Ten microliters of magnetic beads and 80ul Lysis/Binding Buffer mixtuD/ere added to a round bottom plate and mixed for 1 minute. Magnetic beads were [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car captured using ic stand and the supernatant was removed without disturbing the beads.
After removing the supernatant, the lysed cells were added to the ing beads and mixed for 5 minutes. After removing the supernatant, magnetic beads were washed 2 times with 150ul Wash Buffer A and mixed for 1 minute. Beads were captured again and the supernatant removed. Beads were then washed with 15Oul Wash Buffer B, captured and the supernatant was removed. Beads were next washed with 150ul Elution Buffer, ed and the supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50ul of Elution Buffer was added and mixed for 5 minutes at 70°C. Beads were ed on a magnet for 5 minutes. Fifty ul of supernatant was removed and added to another 96—well plate.
For 384—well format, the cells were lysed for one minute by addition of 50ul Lysis/Binding buffer. Two ul of magnetic beads per well was used. The required volume of beads was aliquoted, captured on a magnetic stand, and the bead e solution was removed. The beads were then resuspended in the required volume of Binding buffer (25 ul per well) and 25 ul of bead suspension was added to the lysed cells. The lysate—bead mixture was incubated for 10 s on VibraTransaltor at setting #7 (UnionScientific Corp., Randallstown, MD). Subsequently beads were captured using a magnetic stand, the supernatant removed and the beads are washed once with 90ul Buffer A, followed by single washing steps with 90ul Buffer B and 100ul of Elution . The beads were soaked in each washing buffer for ~1 minute (no mixing involved). After the final wash step, the beads were resuspended in 15ul of elution buffer for 5 minutes at 70°C, followed by bead capture and the rembval of the supernatant (up to 8 ul) for cDNA synthesis and/or purified RNA storage (—20°C).
Real time PCR Two ul of cDNA was added to a master mix containing 0.5ul human GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E), 0.5ul human PCSK9 TaqMan probe (Applied Biosystems cat # Hs03037355_m1) for human cells or 0.5ul Cynomolgus GAPDH custom TaqMan Assay (150nM cyno GAP F primer—5’GCATCCTGGGCTACACTGA (SEQ ID NO: 5); 150nM cyno GAP R primer-5’-TGGGTGTCGCTGTTGAAGTC (SEQ ID NO: 6) 250nM cyno GAP probe- 5’-5HEX-CCAGGTGGTCTCCTCC-BHQ1-Q-3’ (SEQ ID NO: 7)), 0.5ul Cynomolgus PCSK9 custom TaqMan Assay (900nM cyno PCSK9 F primer 5’—ACGTGGCTGGCATTGCA (SEQ ID NO: 8); 900nM cyno PCSK9 R primer 5’— AAGTGGATCAGTCTCTGCCTCAA (SEQ ID NO: 9); 250nM cyno PCSK9 probe 5’- 6FAM—CATGATGCTGTCTGCCGAGCCG—BHQ1-Q-3’ (SEQ ID NO: 10)) for Cynomolgus cells and 5ul Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plate (Roche cat # 04887301001). Real time PCR was performed in a Roche LC480 Real Time PCR system (Roche) using the AACt(RQ) assay. Each duplex was tested in two [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car independent transfections and each transfection was assayed in ate, unless ise noted.
To calculate relative fold change, real time data were analyzed using the AACt method and normalized to assays med with cells transfected with lOnM AD— 1955, or mock transfected cells. For free uptake assays the data were normalized to PBS or GalNAc— 1955 (highest concentration used for experimental compounds) treated cells. IC50s were ated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD— 1955 over the same dose range, or to its own lowest dose.
The sense and antisense sequences of AD—l955 are: SENSE: 5 ’- cuuAchuGAGuAcuchAdedT—3’ (SEQ ID NO: ll); and ANTISENSE: 5’— UCGAAGuACUcAGCGuAAGdedT-3’ (SEQ ID NO: 12).
Table B: Abbreviations of nucleotide monomers used in nucleic acid ce representation Abbreviation 2’ —?uoro uanosine—3’— nhos nhorothioate 2’ —?uoro—5—meth luridine—3’— nhos nhate 2’ ?—u—oro5—meth luridine—3’---hoshorothioate ——methyluridine—3’——phosphorothioate Uridine—3’—phosphate [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Abbreviation (2H1 2’ uridine—3 ’ —ph0sphate 2'—O—meth ladenosine—3’ — nhos nhate 00 m 2'—O—methy1guanosine—3 ’ — orothioate (-P U) CLCLCLEC*€”’ 2'—deox th idine N—[tris(GalNAc—alky1)—amid0decanoy1)]—4—hydroxypr01in01 Hyp— (GalNAc-alk D3 2’ —O—meth0xyethy1adenosine—3 ’ —ph0sphate 2’ —O—meth0xyethy1adenosine—3 ’ —phosph0r0thi0ate 2’ —O—meth0xyethy1guanosine—3 ’ —ph0sphate 2’ —O—methoxyethy1guanosine—3’— phosphorothioate 2’ —O—methoxyethy1—5—methy1uridine—3 ’ —ph0sphate 2’ —O—methoxyethy1—5—methy1uridine—3 ’ — phosphorothioate 2’—O—meth0X eth 1—5—meth 1c —3’-h0s hate 2’—O—meth0X eth 1—5—meth 1c tidine—3’— hos horothioate 3‘—O—meth ladenosine—2‘— nhos nhate 3'—O—meth l—X lofuranos 1adenosine—2'—h0s hate 3‘—O—methy1cytidine—2‘—ph0sphate 3'—O—methy1—xylofuranosylcytidine—2'—phosphate 3‘—O—methy1uridine—2‘—ph0sphate 3'—O—methylxylouridine—2'—phosphate [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car iation tide(s) (Chd) 2'—O—hexadecyl—cytidine—3'—phosphate she) H drox eth l-nhoshorothioate Uhd) 2'—O—hexadec l—uridine—3'—-hos nhate T_n) Th midine— _l col nucleic acid (GNA) er Cn) C tidine— _l col nucleic acid (GNA) Chd) 2'—O—hexadec l—c —3'— hos hate Gn) 2'—O—hexadec l—c tidine—3'— hos hate Agn) Adenosine—glycol nucleic acid (GNA) '—phosphate mSCam) 2‘—O—(N—methylacetamide)—5—methylcytidine—3‘—phosphate mSCams) 2‘—O—(N—methylacetamide)—5—methylcytidine—3‘—phosphorothioate Tam) 2‘—O—(N—methylacetamide)thymidine—3‘—phosphate Tams) 2‘ —O— (N—methylacetamide)thymidine—3‘—phosphorothioate Aam) N—meth lacetamide)adenosine—3‘— nhos nhate Aams) 2‘—O—(N—meth lacetamide)adenosine—3‘— nhos nhorothioate Gam) Gams) U h) A h) Gyh) 2'—O—( l —hexyl—4—methylene— l ,2,3—triazolyl)—guanosine—3'—phosphate Cyh) 2'—O—( l —hexyl—4—methylene— l ,2,3—triazolyl)—cytidine—3'—phosphate Example 1. Synthesis of GalNAc-Conjugated Oligonucleotides A series of siRNA duplexes spanning the sequence of PCSK9 mRNA were designed, synthesized, and conjugated with a trivalent GalNAc at the 3—end of the sense strand using the techniques described above. The sequences of these duplexes are shown in Table 1.
These same sequences were also sized with various nucleotide modifications and conjugated with a trivalent GalNAc. The sequences of the modified duplexes are shown n Table 2.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car mnm mnm 26 55 2-5.2 «:33 mmv me nmm H Ln woo Hnm Nnm wnm vwm nwm won Hnn VNN mnn an vwn wwn awn mmw vmw mam Nam VmN mmN omN NMN wMN mMN OVN HVN NVN mVN EuN mVN EVN DuN wVN mVN omN HmN NmN mmN VmN mmN omN ES... wmcwmrc< UDOUDUUDOUUOUDO<DOUDUUD OODOOUO<UOUOODDUUD<OOU< OUOODDUUD<OOU<UUD DOO<DOU<UU<UU<UO<UDDUUD <UOOOUOOUUUUD<DOO<ODOOD OUUUUD<DOO<ODOODD OOUOOUUUUD<DOO<ODOODDUD OUOOUUUUD<DOO<ODOODDUD< UUD<DOO<ODOODDUD<OO<UOD O<ODOODDUD<OO<UOD<U<O<< DOODDUD<OO<UOD<U<O<<OOD DDU<<UOOOOD<U<OUDO<DOD< <<UOOOOD<U<OUDO<DOD<OUD OOOOD<U<OUDO<DOD<OUDUUD <U<OUDO<DOD<OUDUUDUUDO< OUDO<DOD<OUDUUDUUDO<OO< DO<DOD<OUDUUDUUDO<OO<O< OD<OUDUUDUUDO<OO<O<U<O< D<OUDUUDUUDO<OO<O<U<O<< OUU<DOOUUUOUUD<UDD<DOOD DUOO<UU<UUDUU<U<D<O<OO< UOO<UU<UUDUU<U<D<O<OO<D O<UU<UUDUU<U<D<O<OO<DUD wmcwmrc< $52 09.0 N.mmNmoH.< NdVNmOHLq HLq NdVNmOHLq NHmNmOHLq N.mmNmoH-< N.mmNmoH.< NKmNmOHLQ N.HmNmoH.< N.mmNmoH.< N.mmNmoH.< NdwNmoHLq NANNmOHLq NgnKNmoHLq NdNNmOHLQ NKNNmOHLQ NdNNmOHLQ NHwNmOHLq N.mwNmoH.< oH.< NKwNmOHLq NdwNmoHLq N.HmNmoH.< m Ln [\ H Ln RD [\ m Ln H H H H H H H N N I!H N N N N N m mooaosvom cwm ES... wmcwm 95608:: <OO<OU<DU<OUOOU<OO<OU DOUUD<OO<<UUOUODUOUU< <OODOUUD<OO<<UUOUODUO <OO<<ODUODOODOODOU<DU <UU<UDUU<D<OOOOUUOUUU <<UU<UDUU<D<OOOOUUOUU <O<<UU<UDUU<D<OOOOUUO D<O<<UU<UDUU<D<OOOOUU <UODUUD<O<<UU<UDUU<D< DDUDOD<UODUUD<O<<UU<U <UUDDUDOD<UODUUD<O<<U D<U<DU<OUDOD<UUUUODDO <OUD<U<DU<OUDOD<UUUUO <OO<OUD<U<DU<OUDOD<UU DU<OO<OO<OUD<U<DU<OUD DUUDU<OO<OO<OUD<U<DU< DUDUUDU<OO<OO<OUD<U<D DUDODUDUUDU<OO<OO<OUD DDUDODUDUUDU<OO<OO<OU <UU<D<<OD<OOUOOOUU<DO DUUDUD<DODOO<OODOODUU D<DODOO<OODOODU <O<DUUDUD<DODOO<OODOO om=o 350m wEmz wmcwm ?NVmOHHLq HéVmOHHLQ ?meoHHLq HHVmOHHLq HmeOHHLq ?meoHHLq Hdmmo??kx HHmmOHHLq ?kx Hemmo??kx ?mmmo??kx HKmmOHHLq ?wmmo??kx H.mmmo??-< Hdomo??kx HHomOHHLq ?NomoHHLq ?kx Héomo??kx ?momo??kx Hammo??kx HKomOHHLq ?womo??kx oEmF ?memmd< m-n_< H?ommmdxx ?mnmmm?z ?mwmmm?z H.Hmmmm-n_< Hdmmmmd< H.ommmm-n_< ?wommm?z Hénmmm?z ?owmmm?z H.Nmmmm-n_< H.Hmmmm-n_< H?mmmmdxx ?mommm?z ?mommm?z ?z H.memm-n_< H?wmmmdxx ?z H.Nmmmm-n_< ?wmmmm?z ?vwmmm?z [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Ha VNm wNm mNm Hmm mmm nmm wvm a now mnm mnm mnm me VHOH wHOH mNOH mNHH om: mm: an: NEH mn: t?m 2-5.2 «:33 Imam Iom Iom IHa IHa w?m INm INm Imm Ivm Ivm Imm Imm Imm mmm Iam NOOH NOHH wOHH mHHH mv?? omHH HmHH E me mmN ooN HoN NoN moN VmN mwN mwN an woN moN ONN HNN NNN mNN VNN mNN oNN NNN wNN mNN owN HwN NwN ES... wmcwmrc< UU<UUDUU<U<D<O<OO<DUDOD UUDUU<U<D<O<OO<DUDODOOD O<OO<DUDODOODUOD< <U<D<O<OO<DUDODOODUOD<D <D<O<OO<DUDODOODUOD<DOD <O<OO<DUDODOODUOD<DODUD O<DUDODOODUOD<DODUDU<UD UDODOODUOD<DODUDU<UDOOD OD<DODUDU<UDOODOOUUUDDD D<DODUDU<UDOODOOUUUDDD< ODUDU<UDOODOOUUUDDD<OUD OUUUDDD<OUDUUUODUUU<OD< UDDD<OUDUUUODUUU<OD<UU< UUUODUUU<OD<UU<ODOOUDO< UUODUUU<OD<UU<ODOOUDO<< DUUU<OD<UU<ODOOUDO<<OUD UU<OD<UU<ODOOUDO<<OUDUD UUDUUDOUUUDOOOUO<<OODOD UDOUUUDOOOUO<<OODODUDOD O<<OODODUDODUUOODUODDU< DUOO<UOUOU<UO<ODDO<UOOD UOO<UOUOU<UO<ODDO<UOODD OUOU<UO<ODDO<UOODDUUUDD UUODOOO<OD<DUUOO<UUDU<< UODOOO<OD<DUUOO<UUDU<<< OD<DUUOO<UUDU<<<D wmcwmrc< $52 09.0 N.mmNmOH.< N.mmNmOH.< NKmNmOHLq NdmNmOHLq NHommOHLq N.mommo?.< N.mommo?.< NKOmmOHLq o?.< NHHmmOHLq N.MHmmOH.< N.m?mmo?.< NKHmmOHLq o?.< NHNmmOHLq NMNmmOHLq N.mNmmOH.< HLq Lq NHmmmOHLq N.mmmmo?.< N.mmmmo?.< NKmmmOHLq N.mmmmo?.< NHmeOHLq NdemOHLq RD [\OOO‘A FIN") LG I\ O m m mmm <r<r<r <I' <I' LO LO Ln <U<O<DUUDUD<DOD D D DU<OUU<UD <00: DD D <3 ES... wmcwm OO<OOD <UU<U<O<DUUDUD<DODOO< D<UO<UU<U<O<DUUDUD<DO <D<UO<UU<U<O<DUUDUD<D O<UU<U<O<DUUDUD <O<U<D<UO<UU<U<O<DUUD <ODO<O<U<D<UO<UU<U<O< <UU<ODO<O<U<D<UO<UU<U <<<OOOUU<UU<ODO<O<U<D D<<<OOOUU<UU<ODO<O<U< <OUD<<<OOOUU<UU<ODO<O D<UDOOO<UOOO<OUD<<<OO DOOD<UDOOO<UOOO<OUD<< <UDOOD<UDOOO<UO OOD<UDOOO<U DU<OUU<UDOOD<UDOO <O<OUDDU<OUU<UDOOD<UD <U<UUDDUOUUU<OOOU<OO< <U<O<U<UUDDUOUUU<OOOU DO<<UO<UUOO<U<O<U<UUD <UUODU<<UDUODOUOUODUU <<UUODU<<UDUODOUOUODU <<OOO<<UUODU<<UDUODOU O<OODUUOO<D<UDUUU<U DO<OODUUOO<D<UDUUU< DO<OODUUOO<D<UDUUU 09.0 wmcwm ?ammo??kx Hdnmo??kx ??nmo??kx ?NnmoHHLq ?mnmo??kx Hénmo??kx ?mnmo??kx ?dnmo??kx HLq ?wnmo??kx ?mnmo??kx ?kx ??wmo??kx ?NwmoHHLq ?mwmo??kx Héwmo??kx ?mwmo??kx ?kx HmeOHHLq ?wwmo??kx ?mwmo??kx Hdmmo??kx ??mmo??kx ?NmmoHHLq ?mmmo??kx Hémmo??kx Hdnmmmdxx ?dnmmm?z H.Nwmmm.n_< ?wwmmm?z ?vmmmm?z ?mmmmmd< ?mmmmm?z ?mommm?z ??nmmm?z dxx ?mwmmm?z ?mwmmm?z ?mmmmm?z Hemmmmdxx ?oommm?z ?dommm?z H.Nnmmm.n_< ?wnmmm?z ?z Hdmmmmd< ?dmmmm?z H.Nonmm.n_< ?wonmm?z ?v?nmm?z H.0Nnmm.n_< H.wNnmm.Q< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car as” :. HIE: mmmeh m qNHH mNHH mNHH owHH HwHH NwHH ow?? meH mmNH mHmH wmm? va? ovv? nvv? wvv? va? onv? mom? mmm? NHoH v?o? mHoH NHoH mHoH VNoH wNoH :_H.mgm 2-5.2 mama: EIvaxmovxcnHNNHHHIIEaEEEEEEEaEEEEEE mwN va mwN wwN an wwN mwN omN HmN NmN mmN va mmN me nmN me mmN 00m How Now mom vom mom mom Rom mom ES... wmcwmrc< DOOO<OD<DUUOO<UUDU<<<D< OOO<OD<DUUOO<UUDU<<<D<< OD<DUUOO<UUDU<<<D<<OUUD O<UUDU<<<D<<OUUDD <UUDU<<<D<<OUUDDD DUUOO<UUDU<<<D<<OUUDDDD O<UUDU<<<D<<OUUDDDDUOOD UDU<<<D<<OUUDDDDUOODUO< UDUUUO<UUUU<OU<UO<UU<OD DOOUO<UOOUUODDO<< OOUUUDOUD<UOO<UOO<O<DO< DOODDO<<<UUOOUO<U<U<UUD O<<<UUOOUO<U<U<UUDOO<O< <<<UUOOUO<U<U<UUDOO<O<< <<UUOOUO<U<U<UUDOO<O<<< UO<U<U<UUDOO<O<<<UOOOOD DUUUUDUUDOD<OD<<UU<UOO< OUDO<UODUODOO<UO<<<U<U< <UUOD<<UODUOOD<UD<UO<U< DUUODUDUDO<UD<OOD U<<UDUUODUDUDO<UD<OODO< <<UDUUODUDUDO<UD<OODO<< UDUUODUDUDO<UD<OODO<<O< UUODUDUDO<UD<OODO<<O<O< DUDO<UD<OODO<<O<O<UOODD <UD<OODO<<O<O<UOODDDUD< wmcwmrc< $52 09.0 N.memOH.< NHmeOHLq NdemOHLq NHmmmOHLq N.mmmmo?.< N.mmmmo?.< NKmmmOHLq N.mmmmo?.< NHmmmOHLq N.mmmmo?.< o?.< NKmmmOHLq N.mmmmo?.< NHnmmOHLq N.mnmmo?.< N.mnmmo?.< NKnmmOHLq Ndnmmo?kx NmemOHLq N.mwmmo?.< N.mwmmo?.< NmemOHLq o?.< HLq N.mmmmo?.< N.mmmmo?.< N «1 LG I\ OHNMQ’LDKD 0‘; RD RD RD RD l\l\l\l\l\l\l\ l\ ES... wmcwm D<DDDO<OODUUOO<D<UDUU DD<DDDO<OODUUOO<D<UDU <OOUDD<DDDO<OODUUOO<D <<OOUDD<DDDO<OODUUOO< <<<OOUDD<DDDO<OODUUOO <<<<OOUDD<DDDO<OODUUO <UUO<<<<OOUDD<DDDO<OO DUO<UUO<<<<OOUDD<DDDO <UDOODUODOUDOOOODUOOO DDU<<UOOUUODUOUU<UDOO DU<DUDUUODUUOD<OU<OOO <OODODODUOUUOODDDU<<U DUDUU<OODODODUOUUOODD DDUDUU<OODODODUOUUOOD DDDUDUU<OODODODUOUUOO <UUUUODDDUDUU<OODODOD DUUODOODD<UD<U<OO<OOO DODODDDUODUU<UO<UODU< DODUOD<OD<UUO<UODD<UO DU<O<O<UOO<ODDO <ODU<O<O<UOO<OD DDU<UUD<ODU<O<O<UOO<O DUDDU<UUD<ODU<O<O<UOO DUDUDDU<UUD<ODU<O<O<U UDUDDU<UUD<ODU< UUODUDUDDU<UUD< 09.0 wmcwm ?mmmo??kx ?dmmo??kx HKmmOHHLq ?wmmo??kx ?mmmo??kx Hdomo??kx HHOmOHHLq ?NomoHHLq ?momo??kx ?vomo??kx ?momo??kx ?domo??kx HKOmOHHLq ?womo??kx ?momo??kx HdeOHHLq HHHmOHHLq ?NHmOHHLq HdeOHHLq HéHmOHHLq H.mHmOHH.< H.meOHH.< HKHmOHHLq H.meOHH.< H.mHmOHH.< HdeOHHLq H.Nmnmm.n_< ?wmnmm?z HKmmmmd< dxx ?monmmdxx H.m?nmm.n_< HHNnmmd< HKNnmmd< ?mmnmmd< ?mmnmm?z ?wmmmm?z ?vonmm?z ?d?nmm?z ?d?nmm?z H.NNnmm.Q< ?wNnmmd< Hémnmm?z ?ownmm?z ?mmmmm?z ?monmmdxx Ha?nmm?z HKHnmmd< H.MNnmm.Q< ?mNnmmd< ?mmnmmd< HHVNmmd/x [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car as” :. HIE: mmmeh m Omo? vwo? RmNH mmNH HVNH mom? oom? mHmH HNmH mNmH VNmH mNmH omm? Hmm? mmm? wmm? Nwm? oHON OOHN mHHN VNHN anN onN OONN VNNN HomN :_H.mgm 2-5.2 mama: EEEEEEaIHmHmmo0000C”HHHIINom? nom? wom? mom? mHmH onH omm? vmm? EEEaEEaE mom on Sum N?m m?m Eum m?m gm Bum w?m m?m ONm HNm NNm mNm VNm mNm wNm NNm wNm mNm 0mm Hmm Nmm mmm Vmm D OD cwm 000: O<UUD ES... OUUU<DO<UD UUUOOODOD OD D4003: wmcwmrc< <UU<<OOO<UDUUDOOD 0000033 DUU<<UUODUO<U<<<<UODUUD U<<UUODUO<U<<<<UODUUDO< <UUODUO<U<<<<UODUUDO<U< UU<O<UOOUUUOOODODD U<O<UOOUUUOOOD <UDUUU<U<O<D OU<OOD OD UUUUU<UDUUU<U<O<D UOODOUDUU<ODUOOOD OO<UU< OUO<< DOUO<<< DOUO<<<<UUUUU< DDOUO<<<<UUUUU<UDUUU<U< OUO<<<<UUUUU<UDUUU<U<O< UO<<<<UUUUU<UDUUU<U<O<D <UUUUU<UDUUU<U<O<DOUOOD UUUU<UDUUU<U<O<DOUOOD<< OUOOD< 20003 UUU<U<O<DOUOOD<<UOODUU< ODODUO<OOD ODUOD<UUUUDOOOU<U<OOD DUOOUOO<U<UO<UD O<UDUUOODOUDUU<ODUOOOD UUUO<UUUUO<UDUO<<<D DOODU< ODUUUDUUOODUOD<OODOUO<< UOD<OODOUO<<OO<UO<UOOD< DU<ODDUUDUOD UUDD<OOOUUOOOO<ODUUDUOD D O< 3 D< wmcwmrc< $52 09.0 NKmmmOHLq N.mmmmo?.< NHovaHLq N.movmo?.< N.movmo?.< NKovaHLq N.movmo?.< NHvaOHLq Nd?vmo?kx o?.< NKvaOHLq Nd?vmo?kx Lq NMNvaHLq N.vamOH.< NKNvaHLq NdemOHLq NHmvaHLq N.mmvmo?.< N.mmvmo?.< NKmvaHLq Ndmvmo?kx NHSVmOHLq o?.< N.mvvmo?.< Ndvvmo?kx 00 H N «1 LG I\ 00 OOH HOH NOH moH vo? moH 90H NOH wo? mo? o: H: N: m: <UU<OO<ODUUUDDOODUUOO D D <UUUUU<ODU<DOO <OO<UODD DU<OO<UOD DODU<OO<UOD DDUOU<<U<UUUOOOUUODUD DUDOD DDUOU<<U<UUUOOOUUODU 3000003 303 .3630: <UUOD cwm OO<UUOD 39.00303 ES... D D D 33 <UUOU<DUDOD 000453 D<UUOU<DUD <<UUUO<UD 3 OOO<ODOOOOOD OOO<ODOOOOOD D<UUOU<DUDOD wmcwm ODUO<UOOD D<UUOU<DUD 003003 DD 0000033 OOO<OD 3 D D D D<UUOU<DUDOD O 5003 30300400 DUOU<<U<UUUO DUOU DU D 0000 ODOOO<ODOOO OOO<ODOO ODOOO< O <UUDUO<U<U<UUDOUO<UOD OUUU<OOOOD<UO ODUUOUUO<<U<UUU OO<OU<UUOO<O DO<UU<<UUUO<UDOO<OU<U DDUOU<UUD<UO<UUOO<OOO DUOU<UUD< <UO<OO<<UDO<<<UOD<<OO <UO<OO<UDUUUUOOUUUD<< D<<<<DDDUO<ODUOOOODUO 09.0 wmcwm HHNmOHHLq ?NNmOHHLq H.MN@OHH.< HéNmOHHLq H.mNmOHH.< ?deoHHLq HKNmOHHLq H.wNmOHH.< H.mNmOHH.< Hdmmo??kx ??mmo??kx ?NmmoHHLq ?mmmo??kx Hémmo??kx ?mmmo??kx ?dmmo??kx HKmmOHHLq ?wmmo??kx ?mmmo??kx HdeOHHLq HHVmOHHLq ?NVmOHHLq ?mvwo??kx HéVmOHHLq ?kx HHVmOHHLq Hdonmmd< ?donmm?z H.N?nmm.n_< ?w?nmm?z H.¢Nnmm.n_< dxx ?z ?NVNmmd/x dxx HKonmmd< Hd?nmmdxx ?m?nmm?z m.Q< ??mnmmdxx HKmnmmd< ?m‘Kmmd/x ?mVNmmd/x ?mmnmm?z ??onmm?z H?onmmdxx ?mnnmm?z ?mnnmm?z ?mwnmm?z HéVNmmd/x Hdmnmmdxx H.Nonmm.n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car as” :. HIE: mmmeh m oNoN omoN mmwN VmwN mmwN ova vaN onN mmmN vmmN mmmN ommN nmmN mnom onom vwom ow?m Hw?m non ONNm HNNm NNNm mNNm ONmm HNmm NNmm :_H.mgm 2-5.2 mama: EaaaEaEEaEEaEaaEaaaaaaaaaa mmm wmm nmm mmm mmm 9mm Sum NVm mqm Sum mqm 9mm Bum me 9mm 0mm Hmm Nmm mmm me mmm wmm nmm mmm mmm omo ES... wmcwmrc< U<UUDUU<UOODUUDDUO<OOO< <ODO<U<UUUUOD<<<ODOOD<< O<OODOODDUUDUUODUUD<<O< <OODOODDUUDUUODUUD<<O<< OODOODDUUDUUODUUD<<O<<< DDUUDUUODUUD<<O<<OOOD<< ODUUD<<O<<OOOD<UD UO<UD<UUOOO<OD<O<OODUO< DUO<<<O<UUD<UUOD<O<DUOD UO<<<O<UUD<UUOD<O<DUOOD O<<<O<UUD<UUOD<O<DUOODD <<<O<UUD<UUOD<O<DUOODUD <<O<UUD<UUOD<O<DUOODUDD DOO<<<DO<O<UO<O<D<UOODD OO<<<DO<O<UO<O<D<UOODUD <D<UOODUUO<U<UO<D U<O<ODUOODDOOOUO<OODO<D <O<ODUOODDOOOUO<OODO<DD <UOO<UOODDUO<ODODODUODD O<UOODDUO<ODODODUODUUDD <UOODDUO<ODODODUODUUDDD UOODDUO<ODODODUODUUDDO< OODDUO<ODODODUODUUDDO<< O<O<UDDUOODDUOO<O<<O<<D <O<UDDUOODDUOO<O<<O<<DD O<UDDUOODDUOO<O<<O<<DO< wmcwmrc< $52 09.0 NHmvaHLq N.mmvmo?.< N.mmvmo?.< NKmvaHLq HLq N.mmmmo?.< NHmmmOHLq ?kx N.mmmmo?.< NHmvaHLq N.mmmmo?.< N.mmvmo?.< NKmmmOHLq o?.< NHnmmOHLq N.mmvmo?.< N?mvmo?kx N.mnmmo?.< o?.< NHDVmOHLq NKnmmOHLq N.mDVmOH.< Ndnmmo?kx N.mDVmOH.< NmemOHLq NKDVmOHLq SH m: 9: EH m: a: ONH HNH NNH mNH VNH mNH oNH NNH wNH mNH omH Hm? Nm? mm? Vm? mm mm nm? mm mm ES... wmcwm DUUUDUO<<OO<UUODOO<OO DD<UU<UDDD<UOOOODODU< DUDD<OO<UOO<OO<<UU<UU DDUDD<OO<UOO<OO<<UU<U DDDUDD<OO<UOO<OO<<UU< DD<UUUDDUDD<OO<UOO<OO <OD<UUUDDUDD<OO<UOO<O DUO<UUDUD<UDUUUOOD<OD <UO<DUD<UOOD<OODUDDDU <UUO<DUD<UOOD<OODUDDD <<UUO<DUD<UOOD<OODUDD <O<UUO<DUD<UOOD<OODUD <<O<UUO<DUD<UOOD<OODU <DUDUODUDU<DDDU <O<UUOD<DUDUODUDU<DDD <DUODODUOO<UUOD<DUDUO <DU<UUDUOUUU<<UUO<UDU <<DU<UUDUOUUU<<UUO<UD <<UO<U<U<UDUO<<UUODUU <<OO<UO<U<U<UDUO<<UUO <<<OO<UO<U<U<UDUO<<UU DU<<OO<UO<U<U<UDUO<<U DDU<<OO<UO<U<U<UDUO<< <DDUDDUDUUO<<UUO<<ODU <<DDUDDUDUUO<<UUO<<OD DU<DDUDDUDUUO<<UUO<<O 09.0 wmcwm ?wvmwo??kx ?meOHHLq Hdmmo??kx ??mmo??kx HHONOHHLQ ?NonoHHLq ?mono??kx ?NmmoHHLq ?vono??kx ?mmmo??kx ?mono??kx ?kx ?dono??kx HKONOHHLQ ?kx ?mmmo??kx ?dmmo??kx ?mono??kx HdHnoHHLq ?kx HHHNOHHLQ ?kx ?NHnoHHLq Hdmmo??kx ?m?KoHHLq ??mmo??kx ?wonmm?z Hennmmdxx ?ownmm?z ?dwnmm?z ?vowmm?z H.0mem.n_< ?d?wmm?z ?m‘Kmmd/x m.n_< ??mnmm?z d< HKmnmmd< ?mmwmmd< ?mmnmm?z ?mmnmm?z ?monmm?z ?monmm?z H.mowmm.n_< Ha?wmm?z ??wnmm?z HKmemd< H?wnmmdxx H.MNwmm.Q< ?z H.wNwmm.Q< H.Nmnmm.n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Eu :. HIE: mmmeh m. mNmm nnmm wnmm Nwmm wwmm mwmm ommm Nmmm Hmmm mem mmmm mem mmmm mmmm nmmm wmmm mmmm Comm Homm Nomm 55 2-5.2 «,de Homm mmmm mmmm Comm oomm nomm wmmm onmm momm NNmm Hmmm Nmmm mmmm mem mmmm mmmm nmmm wmmm mmmm Ome me Nwm mwm wow mom mom nwm wwm mwm onm Hnm Nnm mnm VNm mnm on». nnm wnm mnm owm me me me me me me ES... wmcwmrc< <UDDUOODDUOO<O<<O<<DO<< DODU<UDUUO<UUUDDUUUUDDD ODU<UDUUO<UUUDDUUUUDDOD UDUUO<UUUDDUUUUDDODODUD UUUDDUUUUDDODODUDOODUUD UUDDUUUUDDODODUDOODUUDD UDDUUUUDDODODUDOODUUDDD DODODUDOODUUDDUO< ODDO<U<OOO<OO<<UDUODOOD OOOODOOODDUODDUOD DUOOOODOOODDUODDUODUDOD UOOOODOOODDUODDUODUDOD< OOOODOOODDUODDUODUDOD<< GOODOOODDUODDUODUDOD<<< OODOOODDUODDUODUDOD<<<D DUODDUODUDOD<<<D< UODDUODUDOD<<<D<< OOODDUODDUODUDOD<<<D<O< OODDUODDUODUDOD<<<D<O<< DUODUDOD<<<D<O<<< DUODDUODUDOD<<<D<O<<<<< wmcwmrc< $52 09.0 N.mnvmo?.< N.mwmmo?.< NvamoHLQ N.mwvmo?.< N.mwvmo?.< Lq o?.< N.mwvmo?.< NHmvmoHLQ N.mmvmo?.< o?.< NKmvmoHLq N.mmvmo?.< NHommoHLQ N.mommo?.< N.mommo?.< NmemoHLQ NKOmmOHLQ N.mommo?.< NHHmmOHLq N.mwmmo?-< m.mwmmo?-< HH.mwmmoH-< HH.mwmmoH-< wH.mwmmoH-< o.mwmmo?.< ov? Su? Nv? mv? v3” m3” ov? Ema wv? mv? omH Hm? Nm? mm? Vm? mm? om? nm? wm? mm? om? 09H 09H 09H ow? 09H ES... wmcwm DDU<DDUDDUDUUO<<UUO<< <<<OOOO<<OOODUOO<ODO< <U<<OOOO<<OOODUOO<ODO <O<U<U<<OOOO<<OOODUOO <OO<UU<O<U<U<<OOOO<<O <<OO<UU<O<U<U<<OOOO<< <<<OO<UU<O<U<U<<OOOO< DUO<<OO<UU<O<U<U<<OOO <UU<UO<ODDUUDUUUDODU< <UO<<UO<<UUU<UUUUO<UU <U<O<UO<<UO<<UUU<UUUU D<U<O<UO<<UO<<UUU<UUU DD<U<O<UO<<UO<<UUU<UU DDD<U<O<UO<<UO<<UUU<U <DDD<U<O<UO<<UO<<UUU< D<DDD<U<O<UO<<UO<<UUU DD<DDD<U<O<UO<<UO<<UU DUD<DDD<U<O<UO<<UO<<U DDUD<DDD<U<O<UO<<UO<< DDDUD<DDD<U<O<UO<<UO< DDDDDUD<DDD<U<O<UO<<U om=o wEmz wmcwm H.NmmoHH.< H.¢HNOHH.< H.mmmo??.< H.meo??.< H.mwwo??.< H.mwwo??.< H??NOHHLQ HKmmOHHLQ H.wmmo??.< H.mmmo??.< ?onmo??xx ??nwo??é ?anoHHLq ?mnmo??xx H.¢N@OHH.< ?mnmo??xx H.@HNOHH.< ?dnmo??xx HanoHHLq ?wnwo??é HKHNOHHLQ v.vmmw??.< HKovaHLq N.oovw??.< ??.< H.mmmw??.< ?z Hémwmm?z ?vwnmm?z Hdnnmm?z ?dnnmm?z H.anmm.n_< ?z ?z HHVNmmd/x ?mmnmmd< ?mmnmm?z ?monmm?z ??nnmm?z H?nnmmdxx ?mwnmm?z ?mwnmm?z Hdowmmd< HwVNmmd/x Hémnmm?z ?z H.wowmm.n_< ?mnmmm?z ?dnmmm?z H?nmmm?z ?wnmmm?z ?mnmmm?z [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car wEmm t?m 2-5.2 mdmme wEmm HHHHHHHHHHHH HHH 000000000000000000000000 me 000000 mmmmmmmmmmmm me me me mmm me me me me me me me ES... wEmm wmcwmrc< wmcwmrc< $52 09.0 NH.mwmmoH-< mH.mwmmoH-< mH.mwmmoH-< ?mwmmo?é mH.mwmmoH-< OwammoHLq OwammoHLq n?mwmmo?kx w?mwmmo?kx HNdwmmoHLq HNdwmmoHLq m.mwmmo?.< mH.mwmmoH-< mH.mwmmoH-< mH.mwmmoH-< NN.mwmmoH-< n?mwmmo?kx n?mwmmo?kx o?kx n?mwmmo?kx n?mwmmo?kx n?mwmmo?kx n?mwmmo?kx n?mwmmo?kx n?mwmmo?kx n?mwmmo?kx 03 03 03 03 03 03 cm: 03 cm: 03 03 03 03 cm: 03 cm: 03 cm: 03 03 03 03 03 03 cm: 03 ES... wEmm wmcwm 09.0 wmcwm ?wovm??kx ?mHVmHHLq ?dNVmHHLq Hdovg?kx kx HdNVmHHLq HLq NdNVmHHLq HdHVmHHLq HHNVmHHLq Hdmvg?kx ?NmeHHLq ?m?umHHLQ Hémvg?kx ?d?vg?kx ?dmvg?kx HKHVmHHLq kx Hdmvg?kx HHDVmHHLq NdDVmHHLq m.~m¢m??.< HdSVmHHLq ?NmeHHLq Hdmvg?kx ?kx x295 wEmz ?owmmm?z ??wmmm?z H.Nwmmm.n_< ?mwmmm?z Héwmmm?z ?mwmmm?z ?dwmmm?z Ndwmmm?z HmemmAE ?wwmmm?z ?mwmmm?z Hdmmmmd< H.Hmmmm.n_< H.Nmmmm.n_< H.mmmmm.n_< ?vmmmm?z m.n_< m.n_< HKmmmmAE ?wmmmm?z m.n_< Hdoonmd< H.Hoonm.n_< H.Noonm.n_< H.moonm.n_< H.voonm.n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car m. momm oomm nomm t?m 2-5.2 «:33 mqmm Summ mqmm HHHHHHHHHHHH 000000000000000000000000 mmmmmm me me me me 000mmm me me me me Nwm mwm vwm ES... wmcwmrc< uozzuoauaoa<<<3<o<<<<u3 o::uo:u:o:<<<:<o<<<<uu: Dauoauzoz<<<3<o<<<<8u< wmcwmrc< $52 09.0 gggggaggggggaggEE maaaaaaaaaaaaaaaa55ER55555555EHEaEa ES... wmcwm 5333833335550: 50333833335552 38033383335550 om=o wmcwm EEEEEEEEEEEEEaEEEEEEEEE5E5 H.moonm.n_< H.woonm.n_< H.noonm.n_< H.woonm.n_< m.n_< ?o?onmdxx ???onmdxx H.N?onm.n_< Hd?onmdxx ?v?onm?z H.m?onm.n_< ?d?onm?z HKHonmd< ?w?onm?z ?m?onm?z H.0Nonm.n_< HHNonmd< H.NNonm.n_< H.MNonm.Q< H.¢Nonm.n_< H.mNonm.n_< H.wNonm.Q< HKNonmd< H.N?wmm.n_< ?w?wmm?z ?donmm?z [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Eu :. HIE: mmmeh m. mmmm onmm Hnmm VNmm mnmm onmm nnmm wnmm owmm mem Nwmm mwmm vwmm mwmm owmm nwmm wwmm mwmm ommm m?om ONom HNmm NNom 55 2-5.2 «,de Dumm mem mem Nmmm mmmm mem mmmm mmmm wmmm mmmm Comm Homm Nomm mmmm vomm mmmm mmmm nmmm womm nmmm wmmm mmmm 00mm mwm owm nwm wwm mwm 0mm Ham Nam mam vmm mam mam now mam mam How Nov mow mow Nov wow wow ES... wmcwmrc< UODUDOD<<<D<O<<<<UUU<O< <<<D<O<<<<UUU<O<< DUDOD<<<D<O<<<<UUU<O<U< OD<<<D<O<<<<UUU<O<U<OO< D<<<D<O<<<<UUU<O<U<OO<< <<<D<O<<<<UUU<O<U<OO<O< <<D<O<<<<UUU<O<U<OO<O<< <D<O<<<<UUU<O<U<OO<O<O< UUU<O<U<OO<O<O<U< O<<<<UUU<O<U<OO<O<O<U<< <<<<UUU<O<U<OO<O<O<U<<< <<<UUU<O<U<OO<O<O<U<<UD <<UUU<O<U<OO<O<O<U<<UOD <UUU<O<U<OO<O<O<U<<UOO< UUU<O<U<OO<O<O<U<<UOO<< UU<O<U<OO<O<O<U<<UOO<<< U<O<U<OO<O<O<U<<UOO<<<< <O<U<OO<O<O<U<<UOO<<<<< O<U<OO<O<O<U<<UOO<<<<<D DO<<<<O<DUDOO<U<<<<UO<< O<<<<O<DUDOO<U<<<<UO<<< <<<<O<DUDOO<U<<<<UO<<<< <<<O<DUDOO<U<<<<UO<<<<< DOO<U<<<<UO<<<<U< wmcwmrc< $52 09.0 N.mHmmOH.< N.mmmmo?.< NKHmmOHLq o?.< NKmmmoHLq NHNmmOHLq N.mmmmo?.< N.mNmmoH.< N.mNmmoH.< NKNmmOHLQ NHommoHLQ N.mowmo?.< N.mowmo?.< N.mNmmoH.< NHmmmoHLQ N.mmmmo?-< N.mmmmo?.< NKmmmoHLQ N.mmmmo?.< v.mmem-< ?mnwo??kx NHmeOHLQ NQmeOHLq HLQ NdemoHLq H.mNmmHH.< v3 mg mg R: mg mg o: H: N: m: v: m: a: n: w: a: ow? Hw? Nw? mw? vw? mw? ow? nw? nw? ES... wmcwm DUDOOODDDDUD<DDD<U<O< DDUDOOODDDDUD<DDD<U<O DODUDOOODDDDUD<DDD<U< DUUDODUDOOODDDDUD<DDD DUDOOODDDDUD<DD DUDUUDODUDOOODDDDUD<D DDUDUUDODUDOOODDDDUD< DUDUDUUDODUDOOODDDDUD DODUDUDUUDODUDOOODDDD UDUUDODUDOOODDD DDDODUDUDUUDODUDOOODD <ODDODUDUDUUDODUDOOOD <UODDODUDUDUUDODUDOOO DUUODDODUDUDUUDODUDOO DDUUODDODUDUDUUDODUDO DDDUUODDODUDUDUUDODUD DDDDUUODDODUDUDUUDODU DDDDDUUODDODUDUDUUDOD <DDDDDUUODDODUDUDUUDO DDUODDDDODUU<O<DUDDDD DDDUODDDDODUU<O<DUDDD DDDDUODDDDODUU<O<DUDD DDDDDUODDDDODUU<O<DUD DODDDDUODDDDODUU<O<DU om=o wEmz wmcwm HdmeHHLq HdNnoHHLQ HmeOHHLq H.NwmoHH.< HHNNOHHLQ H.mwwo??.< ?NNnoHHLQ ??.< HH.< H.mwmo??.< ?mNnoHHLQ HéNNOHHLq ?mNnoHHLq HmeOHHLq H.wwmo??.< ?mwmo??kx H.0mmo??.< H.Hmoo??-< ?waoHHLq NDVNmeq ?anoHHLq H.mmmoHH.< ?vmmo??kx ?dNnoHHLQ ?mmmo??kx NMNmmHHLq H.Nnnmm.n_< H.¢Nwmm-n_< ?wnnmm?z ?vwnmm?z H.memm-Q< dxx ?mmwmmd< ?omnmm?z H.Nowmm-n_< m-n_< ?mmnmm?z H.Howmm-n_< HKowmmd< ?v?wmm?z H.0Nwmm-n_< H.memm-Q< H.Hmwmm-n_< H.Hmnmm-n_< dxx Hdovwv?z Hdmwmmd< H.mowmm-n_< H.mowmm-n_< ?m?wmmd< H.m?wmm.n_< ?d?mmm?z [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car wEmm t?m 2-5.2 mdmme wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow ES... wEmm wmcwmrc< wmcwmrc< $52 09.0 Hémmm??kx mdqmm??é mHmeHHLq HmemHHLq H.m?mm??.< ?demHHLq EmemOHLq VdemHHLq qumm??Lq Lq N.m?mm??.< NdemHHLq WmemOHLq mdqmm??é NH?meoHLq m.m¢mm??.< m.m?mm??.< H.wNmmHH.< m.m¢mmo?.< wdqmm??é m?mqmmo?kx vwvmm??é QmemOHLq Hdmmm??.< HLq HHmeHHLq nw? nw? l\ l\ 00 00 H nw? nw? nw? nw? nw? H nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? ES... wEmm wmcwm 09.0 wmcwm N.mmmm??.< Ndmmm??kx m.wmmm??.< ??.< m.mmmo??.< m.m~mm??.< ?kx NKmmmHHLq m.mmmm??.< N.NmeHH.< Lq HKNmmHHLq ?dmmm??kx N.wmmm??.< ?NmeHHLq NdemHHLq HHNmmHHLq NKNmmHHLq HKmmmHHLq N.mmmm??.< ?mvmm??kx NémeHHLq NdemHHLq H.mNmmHH.< ?wmmm??kx w.mmmo??.< x295 wEmz Ha?mmm?z H.N?mmm.n_< H.MHmmm.Q< ?v?mmm?z H.m?mmm.n_< ?d?mmm?z HKHmmmd< ?w?mmm?z ?m?mmm?z < HHNmmmd< H.NNmmm.Q< H.MNmmm.Q< H.¢Nmmm.n_< H.mNmmm.Q< H.wNmmm.Q< HKNmmmd< H.wNmmm.Q< H.mNmmm.Q< Hdmmmmd< ??mmmm?z H.Nmmmm.n_< ?z Hémmmm?z ?mmmmm?z ?dmmmm?z [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car t?m 2-5.2 mdmme wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow ES... wEmm wmcwmrc< wmcwmrc< $52 09.0 w?memoHLq m.m¢mm??.< HH.< ??.< a?memoHLq NHmeHHLq m?mqmmo?kx QmemHHLq N.NNmmHH.< ?NmmmHHLq ?ovwm??é qumm??Lq m?mqmmo?kx EmemHHLq HéNmmHHLq N.NmmmHH.< N.OmeHH.< VHmeHHLq n?mqmmo?kx ?memHHLq HHmmmHHLq ?mmmm??kx ?mnmm??kx NdemHHLq ?mmmm??kx HKmmmHHLq nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? nw? ES... wEmm wmcwm 09.0 wmcwm HémeHHLq N.memHH.< mdemHHLq NdemHHLq ?mmmm??kx m.mmmm??.< ?mvmm??kx NdemHHLq w.mmmo??.< m.m~mm??.< Emmmo??kx mdmmm??kx H.memHH.< Lq H.MNmmHH.< ?mmmm??kx N.mmmm??.< memmHHLq HHmeHHLq .< o?mmoo?? Hdmmm??.< Hémmm??kx .< NH.mmmoHH m.~¢mm??.< HLq ?dmmm??kx x295 wEmz HKmmmmAE ?wmmmm?z ?mmmmm?z ?ovwmm?z ??vwmm?z ?Nmemd< ?mvwmm?z Hémem?z ?mvwmm?z ?demm?z ?tnmmmdxx ?wvmwmmd< ?memmd< Hdmmmmd< ??mmmm?z H.Nmmmm.n_< ?mmmmm?z Hemmmmdxx ?mmmmm?z ?z HKmmmmAE ?wmmmm?z ?mmmmm?z m.n_< ?mommm?z Héommm?z [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car m. VNom mNom mNom 55 2-5.2 «:33 Noam moom moom wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow wow oi» oi» oi» oi» Him NE» NE» NE» NE» ES... wmcwmrc< <O<DUDOO<U<<<<UO<<<<U<D o<8=oo<u<<<<uo<<<<u< o<u<<<<uo<<<<u< o<8=oo<u<<<<uo<<<<u< wmcwmrc< $52 09.0 ERE555ER55ER55E55555E555ERE5E555NHmeOHLq EEaEE5555EEEHEE5%EH ES... wmcwm <DODDDDUODDDDODUU<O<D DODDDDUODDDDODUU<O< DODDDDUODDDDODUU<O DODDDDUODDDDODUU<O< 09.0 wmcwm m.m¢mm??.< Hemmm??kx ?wmmm??kx mévmm??kx ?dmmm??kx m.m¢mm??.< ?kx ?NnmmHHLq mdvmm??kx ?kx Hénmm??kx mkqmm??kx v.mmmm??.< v.NmeHH.< v.0NmmHH.< HKnmmHHLq ?kx ?kx Ndwmm??kx ?kx ?dmmm??kx HHHmmHHLq ?NwmmHHLq ?wmmm??kx Héwmm??kx Hdomm??kx ?wommm?z ?mommm?z Hdnmmm?z ?mnmmm?z Hénmmm?z ?wnmmm?z ?mnmmm?z ?owmmm?z ?mwmmm?z Héwmmm?z ?mwmmm?z ?wwmmm?z ?mwmmm?z Hdmmmm?z ?mmmmm?z ?vmmmm?z HHNwmmd< ?oommm?z ?z ?mommm?z ?dommm?z H?ommmdxx ??nmmm?z H.Nnmmm.n_< ?dnmmm?z H?nmmmdxx [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car m. 03m gm NVom t?m 2-5.2 «:33 ?g!Egg55ONom Hoom a5 3 a? 5:» win ES... wEmm c< UO<<<<U<DDO<<UDDUD<D<<< O<<<<U<DDO<<UDDUD<D<<<D <<<<U<DDO<<UDDUD<D<<<D< <<<U<DDO<<UDDUD<D<<<D<< <<U<DDO<<UDDUD<D<<<D<<< <<O<DUDOO<U<<<<UO<<<<U< wmcwmrc< $52 09.0 ER55ER55EHEH5%ER55EREE5E a E RS nm? ES... wEmm wmcwm DDD<D<O<<ODDU<<DODDDD <DDD<D<O<<ODDU<<DODDD D<DDD<D<O<<ODDU<<DODD DD<DDD<D<O<<ODDU<<DOD DDD<DDD<D<O<<ODDU<<DO DODDDDUODDDDODUU<O<DU 09.0 wmcwm Ea5 H.~Emm.o< 333.3 333.3 H.m?wmm.n_< ovamnm m.Nmem.Q< méw?mm?z mHHDmm Bonammdxx Bonammdxx [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car t?m 2-5.2 «:33 ES... wmcwmrc< wmcwmrc< $52 09.0 ES... wmcwm 09.0 wmcwm n.m:mm.n_< n.m:mm.n_< H.wHNmm.Q< H.NNNmm.Q< H.wNNmm.Q< HdmNmmd< m.n_< d< H.HHNmm.Q< m.Q< H.mHNmm.Q< H.MNNmm.Q< m.Hmem.Q< m.N:mm.Q< m.n:mm.n_< mdw?mmd< m.mw?mm.n_< m.mw?mm.n_< 1 1 7 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car ation] car Unmarked set by car 55 2-5.2 «:33 min ONv HEN << << << cwm O<3 O<3 O<3 O<3 U3 U3 U3 U3 ES... wmcwmrc< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< wmcwmrc< $52 09.0 ES... wmcwm 303333UU333303UU<O<3U 303333UU333303UU<O<3U 303333UU333303UU<O<3U 303333UO333303UU<O< 09.0 wmcwm m.m:mm.n_< H.NmNmm.n_< H.memm.Q< H.wHNmm.Q< HdNNmmd< ?vNNmmd< H.wNNmm.Q< H.mmNmm.n_< HKmNmmd< H.mONmm.n_< H.wONmm.n_< H.NHNmm.Q< HdHNmmd< HéHNmmd< HKNNmmd< HHmNmmd< m.wm?mm.n_< m.OONmm.n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car t?m 2-5.2 «:33 ES... wmcwmrc< <O<DUDOO<U<<<<UO<<<<U< <O<DUDOO<U<<<<UO<<<<U< <O<DUDOO<U<<<<UO<<<<U< <O<DUDOO<U<<<<UO<<<<U< wmcwmrc< $52 09.0 ES... wmcwm DODDDDUODDDDODUU<O<DU DODDDDUODDDDODUU<O<D UODDDDODUU<O< DODDDDUODDDDODUU<O<D 09.0 wmcwm m.m0~mm.n_< méo~mmd< m.n_< mHmHmmd< H.MHNmm.Q< HKHNmmd< H.HNNmm.Q< H.mNNmm.n_< H.mNNmm.n_< HémNmmd< H.memm.Q< H.H¢Nmm.n_< ?mv~mmd< HdmNmmd< H6¢Nmmd< N.mmNmm.n_< H.N¢Nmm.n_< H.mmNmm.n_< [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car t?m 2-5.2 «:33 << << << << cwm 3 O<3 3 O<3 O<3 O<3 O<3 O<3 O<3 O<3 ES...
U3 U3 U3 U3 U3 U3 U3 U3 U3 U3 wmcwmrc< <O<3U300<U<<<<UO<<<<U< OO<U<<<<UU<<<<U< <3U3UO<U<<<<UO<<<<U< OO<U<<<<UU<<<<U< <<UU<<<<U< <3U3UO<U<<<<UO<<<<U< <3U3UO<U<<<<UO<<<<U< <U<<<<UO<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< wmcwmrc< $52 09.0 ES... wmcwm 303333UO3333U3UU<O<3 303333UU333303UU<O<3U 303333UO3333U3UU<O<3 303333UO333303UU<O< 303333UU333303UU<U UU333303UU<U 3U3333UO333303UU<O< 303333UO3333U3UU<O<3 3U3333UO333303UU<O< 303333UO3333U3UU<O<3 303333UU333303UU<O<3U 303333UO3333U3UU<O<3 303333UO333303UU<O< O3333UO3333U3UU<U<3U3 3 3333U3UU<U<3U33 30 09.0 wmcwm H.memm.Q< HHmNmmd< H.memm.Q< H.0onm.Q< H.wVNmm.Q< HHVNmmAE H.NmNmm.n_< HKmNmmd< HHonmd< H.Nonm.Q< H.monm.Q< -Q< m?mm?mm -Q< a?mw?mm mdm?mmd< m.NmHmm.n_< HdVNmmd< H.¢¢Nmm.n_< [Annotation] car None set by car ation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car tau 2-5.2 «:33 cwm O<<<< ES... DUODDUODUDOD<<<D<O<<<<< 04503 wmcwmrc< OO<U<<<<U wmcwmrc< $52 09.0 ES... wmcwm DDDDDUD<DDD<U<O<UO<<U DDUODDDDODUU<O<DUDDDD 09.0 wmcwm n.NONmm.Q< m.mm?mm.n_< ?mVNmmd< HémNmmd< H.mmNmm.Q< ?vammAE NéonmAE H.mmNmm.n_< ?wNmnmd< ?mmwwm?z ?vmwwm?z ?mmwwm?z ?dmwwm?z HmewmAE ?wmwwm?z ?z Hdomwmd< H.Nomwm.n_< 1 2 1 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 55 2-5.2 «:33 cwm O<3 O<3 O<3 O<3 O<3 O<3 O<3 U3 U3 U3 U3 U3 U3 U3 ES... wmcwmrc< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< OO<U<<<<UU<<<<U< wmcwmrc< $52 09.0 ES... wmcwm UO333303UU<O< 303333UO333303UU<O< 303333UO333303UU<O< 303333UO333303UU<O< 303333UO333303UU<O< 303333UO333303UU<O< 303333UU333303UU<O<3U 09.0 wmcwm 1 22 [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car t?m 2-5.2 «:33 cwm O45 045 ES...
U3 U3 wmcwmrc< O<DUDOO<U<<<<UO<<<<U< OO<U<<<<UO<<<<U< OO<U<<<<UO<<<<U< DOO<U<<<<UO<<<<U< wEmm wmcwmrc< $52 09.0 DUO: cwm ES... DODDDDUODDDDODUU<O< DODDDDUODDDDODUU<O<DU DODDDDUODDDDODUU<O< D D wEmm wmcwm DODUU<O<DU om=o wEmz wmcwm 1 23 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' Trans Antisense Antisense Name Oligo «1 m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m N N N N N N N N N N N N N N N N N N Trans Sense Oligo Name Sense Duplex Name [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' <l' Trans Antisense Antisense Name Oligo Trans Sense Oligo Name Sense Duplex Name [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car t?m 2-5.2 «:33 ES... wmcwmrc< wmcwmrc< $52 09.0 ES... wmcwm 09.0 wmcwm ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 55 2-5.2 mdmme ES... wmcwmrc< wmcwmrc< $52 09.0 ES... wmcwm 09.0 wmcwm [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. ?oat£89538?:mEeOUSUb: 30853380523096303:so: $236303:mbmmUSE/Eo3&6: a$333825=BU_<UU_<3<H<MGN SEEOMEEUEo3mmSUu_o=u_<=u_o=b= 05355550:Sb?ogmbaém mbmbmbmumz?a£09630: $53”.3530£8§<£<E<£05a $58995?e?m??ogmégm $885EambmSummSmuse/305m 853me55%308505303 amsmmbmzmzmbsubmb555m a?om?<?<?<=beo?<£<£<mb?<m $33055simmz?a?oeagzm maom?oE<£<mb=m£3m5£855: wmcw?ucd. wEmz 0m=o N.mmNmOH-< N.mmNmOH-< N.HthOH-< NNwNmOH-< N.mH¢mOH-< m-< NNmNmOH-< H-< 858“. w>_um_w.. Im wmw mH m mI OH m mOHH EIwhoI«Kn mmw wmw NE» wmw mmw How Now m9» m9» wow wow wow «5.759636 wad: mad 3 wag—<30 POMS Soup.
ED 3 85:35 9 EOE/meb £03 Eon—u? mooaoéa 09.0 EoEu?<H< Bun—<30 PC 30 355 @2230£055Eobbmb?ogmb 05525£30386 wad/EuEEEUEOUSMS£865 GEEOEOHDUUO 833E?e/Eogbzgmzeusa 8::02382053923530336 @2253:US$389:mbmbmSub $22385=23:eesoysubmue?a 8:3U2555EUUEE<mb£oHo 8:33agoe?ambbbmb?aEEG omd?b?og?asgga£033me @253DMEMEMSMEEEMS955% E: E: PENGHOUUG E<uUG BEBE 09.0 355 wEmz H.N¢mOHH-< H.0mmOHH-< H.wmmOHH-< H.wmeHH-< H.¢hmOHH-< H.NmeHH-< H.mmeHH-< H-< H.mowOHH-< H.meOHH-< H.HNwOHH-< H.meOHH-< N?wmwmé‘ H.HmmOHH-< HH-< -358 H H H H .m wEmz 2%? x295 mwwmméd‘ omwmm-n_< H.Hmwmm-n_< H.wamm-n_< mmwmm-n_< «momméd‘ H.wmwmm-n_< H?mwmméd‘ H.wmwmm-n_< H.mmwmm-n_< H.oonmm-n_< H.HOhmm-n_< H.oo¢w¢-n_< H.wmwmm-n_< H?mwmméd‘ [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car u?ommzub 85:35 09.0 muGuSuumuG?D 3:335. $096345 $23630showaumE/Eozbzb?u: 38mm35023DSUEMSMEUSHE Eom?éosos?m?o333363:a aa?5535533233385a EOE:so?agu?umésiiu3 Um.382555353053230: mausb?ambé:mmmho?a3%?me mzmbubsNUEUUUEUEON m?omaemb??ueummuseusa?owbm 86533330:mmbquSUUEom $286£85meu?a?o?o?ibz 53333053:233325330: absb?oe?bmmso?uaemzmb: uNUHED$839555: mbsaumgegogue:a WEE/USEmammumbmbsa?omam 5836303230sum a532965sbmazmzmb?a?a Eomg??bubu8558253? wmcw?ucd. wEmz 0m=o N.mwNmOH-< N.mommOH-< N.HNmmOH-< N.mmmmOH-< N.HmNmOH-< OH-< 858“. w>_um_w.. CH ImImlm OHHH 09H HNSH I mm ON mm w mI h m OD» HE» ND» m5» #5» m5» oh» ND» why m5» oww 3:» Nww mww www mww www hww www mww wmd<mb?oEuE<£ wmd<£u?o 8:36 ED wad/?oat? 85:35 £09.83 09.0 355 84238505Ea?aob?o?a?og @2233?ngEtué?us?uamé 8::35350396530303090 Bug—o?o?o?oEu wag?ombeamus32023055»? @22303030538803:332mb @2253&5Uu_<mu_<u_ou_§o?<m5so @3596?ouzmbubbb?oeu£330 om:35333033966303:£25 $25385$033565.5382 8::USEo?03382323585 omd<?<=b£332053303330 ?own—«GU Eu wad/Eua32382895Hoe/$596 omg?o?o£59625533mb 8:333:P&EPSE£MSEMG 8::U”.out?ow”.3329360mea: om:3253&3:Uu.<u_ou_<mu_§o?<m5 ESPGSUGHEOMUSEO 30963399630303:a: 09.0 355 wEmz H?meHHé‘ H.mhmOHH-< H.mmeHH-< H.0mmOHH-< H.wmeHH-< H.whmOHH-< wEmz x295 H.wmwmm-o< H.mmwmm-o< H.0wwmm-o< H.NOhmm-n_< ?monmméd‘ H.h0hmm-o< m-o< m-o< H.0Hhmm-n_< ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 u?ummU?DuUmUm: 09.0 333330335mm?/Eo 3:335. 30358350:36323055: EUSEEOMEMSMMESUS£0335: $8396ngEouabzbgamémbm Eo?ow: ED: m?am?a?agag?z?o3038835: Stabs/Eu?esmmbeo?/‘mbzbg umbmmSmEmEmS253589.35; abmgogubzbmmg£383an: 82mmbgomb??mg?uoeowEmEm $285meSuSus?/E:Eo?amzm 82385eumzumgmb?:530m 303855585$953030: 9.323% E0353:Eogaaeusamz?omtum EUSUUEUEE<MNMGNUSUUSMSMG= a£336ancgzmmusmbyosa33m sambub$333305: 0eiéo??beugm mgsbeug?samba:355mb: $286305mbmumbsa?o?ogm wmcw?ucd. wEmz 0m=o N.m¢NmOH-< N.HwNmOH-< NNthOHé‘ N.mmNmOH-< N.mH¢mOH-< OH-< 858“. w>_um_w.. Ou mmm IHowImIm Ewww IMK NmHH ww?? wNSH Haw N9» m9» m9» 59» wmw oom Hom Nom mom wom mom mom pom mom mom @2230365BEBE/‘meb?ago wmd<£o wad: Eu $958636 ED £3 3496 85:35 EOE/#6596 mu_0mu_<mu_ou_<u6£3 :uGuOu. 09.0 £0 ECU? £405 355 E< FOP—Du? omd<£<?<=b£3&39_<u_3mu_3mu_o£o?a magg?o?usigso£0965&3 omngmba:Uu_<mbbu_<uusmu_o=u_§3 8:330303353025£0555 omgmzmuémbe:NUSSUSMEMEEUUE 8::Eu382mb3920969653: 8::samba:Egb?o?omb?o?o wags/3083:=U_P_P_o=u_umu_§o?: 835mb£30532903333030 muG 8:3U”.aubeu?o?seo?og:?ops @9255quEDUUUSUE<=E=EH< $25Faggot£5233»?ng 8:325aBEUEH/Eomb?omz 8:33%sz5552355582 omd<£u?<£<£o?u§3Eneamz?o obNEEDESEBEEME 09.0 355 wEmz H.m¢mOHH-< H.mmmOHH-< H-< H.mmeHH-< H.waOHH-< H.¢mmOHH-< wEmz x295 H?wwmméd‘ H.wwwmm-o< H.mwwmm-o< Hdhwmméd‘ H.thmm-o< éd‘ ?m?hmméd‘ Héhwmméd‘ ?whwmméd‘ [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. 3,5SUNSgagamaS?o?a?/EON m?um?oEu?d‘uzmmmb?nub EOmUm u?umub?dgnubumuzmzaouu?mu? m 2?ommu.<3u_ouU_<qumuuU_<uU6muGEDuUG2 E99:.532308335330: m?am?ogaube?smz?gomuogm =u_<mu_<mu_omaSmS?oeumSm wasSSUEUSHQMMUUUEDEma: 3.5mmbubemu?oummz?o309636: was@033:NSBMENUUSEEE ED§<E<E<£§Seaso?agom 3.5EumtEuUusmm?og?u?o?o: umbmmSuSuS??zEomS?/Eo?mum umbm?omb?oubum?oEoeambmzm soubmu?o?amb?oe? mmbm?o?u?ogus=U_<Eomu_<m5mu_o= a?imbBuy.:Uu_u=m?_0mu_<?<£<mu_<m 896$”.3£0Eo?iueoeo?agoei M53895=u_<mbaubmu_35£<m5m mgm?o?a?ag:mabmuesbmus5m wmcw?ucd. wEmz 0m=o N.mwmmOH-< N.mo¢mOH-< N.HN¢mOH-< N.m¢NmOH-< N?hmmo?d‘ N.HmmmOH-< 858“. w>_um_w.. 0 Ou hmm? HNEH 0H9“ mmm Emmm? mww? HHmH noImu @00H OHm SH SH m?m «Hm m?m w?m E?m w?m m?m ONm HNm NNm mNm «mm mNm wNm th mmm mmm wan—3&5 wmdDEDED ?own—0&3 85:35 Eggs/308322: 09.0 355 Eon—DUEOEOEUHO 9636336 8::mbgogib39203303030 842333359665303825 @925335333205532330 8:333:5355263333: 8::EOE/Eumb?oEEUEUE/Eo wad/EuE<£<mu_0mu_uu_uu_<5£03696 84253325338650230? @92353.333296%£255 mm:agombgomz?seog:3,3530 $22553neasaub?o?a?a?a ?oEu?o?o?u 8::Bomb£§<Ubbb?oubm5US 8::Paycmbmusg2053033330 5U:3590305386 8::Eu£95quu_:u_uu_<mEmu_o?<mu_u o3:3,3055552385USm5 8::mt303083962963330 omdamk/‘mb??b?egEo?ombys 09.0 355 wEmz HHH$OHT< H.meOHH-< H.mmwOHH-< HH-< H.0HwOHH-< H.wHwOHH-< wEmz x295 ?mmhmméd‘ ?wmhmméd‘ ?mmhmméd‘ éd‘ H.0wwmm-o< H.¢wwmm-o< ?wmhmméd‘ ?mmhmméd‘ H?wwmméd‘ [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car 85:35 09.0 u?Dmub?omUuUGumMUGmUGH/VGUG $63858£02»on 3:335. oE<=bum?<ub5&3:m £0: :muOmuUuSuUEo:mmSmEuUmUmEm a556abs/Euamazmz?éo?za E?mzsembubmm?a?a305$? 32830: 39.933388:953303033: am5§<mu_umu_omu_o=Ezmbeo?a?zm M58230386305£33330: $550NEH/3833033963236: 3.535£onaubumq?ub?oe?bm m?ommz?:mSmemwbg:£<£<E<m m??ub?oeo?um?o?ugo353% M53683:scamméso?/Eugm Same/EmPGNZMEEEMS£35m 36363030somUmz?/EUEEN umb§§<?<38mm39.396339% $353303:382333855: EommbPayomuemwmusgNEEDUEN m?<mmu_<ys=bmu_o=BEMEHEOQE wmcw?ucd. wEmz 0m=o N.m¢mmOH-< N.memOH-< N.hhmmOH-< N.mmmmOH-< N.h¢mmOH-< N.mwmmOH-< 858“. w>_um_w.. On E#02“ www? mama EmmNH 0mm Hmm Nmm mmm «mm mmm wmm hmm mmm mmm owm Sum Nwm mwm Sum mwm wwm Cum wwm mwm 8::£3a3330EUUEMEEESUU $22059653:39.203033630 8::53:3033832533030 wmd< £0 8:323: 85:35 :55?qu 09.0 3&3 355 Du? 8:3a:U”.o£<mbmbbbm6mb£oso 339696295£33330? 0329.825:SEE/53030530 2303052553:so amé?aEokob?ombuzg 842E:Esombssuz?ibgaUS @2530=U_<Uusmu_omu_<bu_omu_o£o£3m2 36303386333£25 8::EEEUGMGUUQBombs/3:30 8:33:33a:goeubzgo?u?ag 8:3£0Embgoeuusb3325:: 8530303:PS:§96£§<55 m3:30£86EDNUUEEEUEQE omdéo?omémbsou_<u_<£umu_3£<mu_o 8:355:35£05653??? $92335ab552253305 09.0 355 wEmz H.mmmOHH-< H.mowOHH-< HH-< H.meOHH-< H.wmmOHH-< H.¢O@OHH-< wEmz x295 H.thmm-o< ?mmhmméd‘ ?wmhmméd‘ ?mmhmméd‘ ?dmhmméd‘ H.mmwmm-n_< ?wmhmméd‘ ?mmhmméd‘ H.m¢hmm-o< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car 85:35 09.0 3:335. mm.:meo?ug?ommmzmbeu?:30: $93:POMSsomaSmS?/Eagm 82mgmu.o£<£<8£<3§<?o£om 30mNbEomEmEmSuamuomuégmzm ea?<8335£3£<m5m a?oaé?aeo?oSmémzeio?za 853555an3303033535: ma???buz??awaysmayors; a?ammb?agogmmgeo5330: :me3mamhoubmm?o?o£855: Eomg?ombgaméo3&25303 $285someEnummuamk?ue?gém $9.330EOEowesm?oeagoeagg $0355eagoagbegiz?? Eam?o?/E?bummzuz?o?o?om $282330gagg?g?i mm_<mmbmu_:=u_omu_<§=UE<E<£<E<m mm.ommu_<m5mu_<mu_<ummu_o£:£3036: 3930:5533»eueoe?ze? $2365?ambmmmzméngmb: wmcw?ucd. wEmz 0m=o N.Hm¢mOH-< N.hommOH-< N.HNmmOH-< N.hmmmOH-< NNDVmOHé‘ N.mm¢mOH-< 858“. w>_um_w.. On amwmm 5mNmm 0mm Hmm Nmm mmm «mm mmm wmm hmm mmm mmm owm Hum Nam mom «om mom mom hum mom mom @225£33:Poucusubsa?ay_< wan—Dog. @9585USP—030399033EDUUSED wmdDED 85:35 mu. 09.0 ouEu—umzmbmz 355 WU EDuquu—DEon—DUOJUEUEDED @953:a:m5NUGEUGSEGEEUGED 3255655323:so RENEEoEUUEEEUEUE963%? $95353333995965963035 mad/EueumzuzuzbbsosombmS @325NEE/Eaubbb?o?gamz ibeieea£03353: 8:323:35zbeubb??bmz?o wad/Eu—o£<£emu—<UUOuGu_<uUOuUOmu_<uUG 09553235e§<§§o£§o?< 8:35USUUEOEBEOMEED£35 @3235a:55329335530 $35=23:eiz?ssoEng/E33: mag??b?3359965595a: 8::=233e§<?<§oEEEEEU @223:soEueuaoucSmussamEmus 09.0 355 wEmz H.wwwOHH-< H.wthHH-< HH-< H.HmwOHH-< H.waOHH-< H.mwwOHH-< wEmz x295 H?whmméd‘ ?wwhmméd‘ Hdmhmméd‘ H.Hmhmm-o< éd‘ ?mwhmméd‘ H.thmm-o< ?mmhmméd‘ ?wmhmméd‘ [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. 53363255sm?os?z?ogm mmém?ombysmbUm:u_<mu_<=bmu_oeu= $835gownsEumm?omzmb‘?am¥<m auo?émuéeo?o:396355536: $5363:533:3:E<?.:m6mu_<m m?ommz?iugm??oEEEUN m?<m£<£o£35mm£u£<£§o£<m eugsmusube?ogm $536:meEsm?um¥<m9636£3 38E:53395?£<?§££<£§ mm_<muby_<mu_<uu_<mm£030£535: $330333:Bummso?/E/Eogz u?um?o?uub?ogEumEE/‘ED 33m $289.33:mbmmeusomb?umzs aubmzsga555330: 593033303:amSeumSuSmSm Eamsoeuegzm923330me m?<m£<mbubmkomu?o?/‘mzméuzm §<m£<?<=bEmm§<£<mb?<£<m asab55SUEEEOMEEE wmcw?ucd. wEmz 0m=o N.Hm¢mOH-< N.mw¢mOH-< Ndhwmo?d‘ N.mm¢mOH-< N.mm¢mOH-< N.m¢¢mOH-< 858“. w>_um_w.. On ammmm awam Ohm Hum th mum «hm mum ohm hum mum mum owm 33 Nwm mwm wwm mwm wwm hwm wwm mwm wmdDuEuU ng£5963:£0335 $95595Euessabbmzmbsog wad<£<?<£0 wad: mm:Emu—DPSUUSUUEOSUEOHOEDED wad:anon—OEDJEEDUUEOEDUWDED wad: wad/Emu. wad: EDUUS EDUUS ED Eo m5 PEN—oEgon—o?o?d‘mbu?‘ Don—<UU ESE—DPS £43 ED wmd<£oEDmu5uU5£ 85:35 ou—<U_<UUO ?own—£96 Eng—Eu DUU 09.0 Smog—0533030 £405 PG 355 FEED ob Eon—?o?umzmbm: mu_<uU_umu_<uU5 Ewan—umzmb 3030 wan—<33£0EDEu?ouOuOmEmuOmuOuUG 8::gaze:EUHEEBEHOMSE 8536959509635963:£355 omd<£<£o?o?<£o§oeu?o?oeo 8::Nbmu.oat»?NUEEEUENUE $25303:a:=b=u_<u§5=u_<£<?<£o $35aoso30556553033a: $35a:5MB35392323?sz 8::BEESeu=u_?_<6mu_§o?<mu_o 09.0 355 wEmz HH-< H.¢mwOHH-< H.NwwOHH-< ?cthHT< H.mmwOHH-< H.h¢wOHH-< wEmz x295 ?mmhmméd‘ H?mhmméd‘ ?wmhmméd‘ ?mmhmméd‘ ?owhmméd‘ H.mowmm-n_< éd‘ ?dwhmméd‘ ?wwhmméd‘ [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car ation] car ed set by car u?omEDEOEU 85:35 3.286eus?owabeago?oHoN 89.333363:$333093? EDSUMEUUUS8585:5305: m?om?o3630333355303? 8536:632ng Eo 09.0 3:335. mmbm?o?u?oeaum?o30963633: :mmu_<:u_<mu_<mu_<mu63 mmu_<mmu_om5EDMUGmUE/V‘mzuUGE/V‘?d‘m $2855MBsouab?oeuwo?za mmzmzmbub?mum Stab£05Eomwmzmzuzmb?? ???ibaomEUEEUEEEUm =58”.35335336£30335: mmbm?oeago?o3305339635: $353333:mmmS?o?/E?bg §<§<=SH<NU=BENSEESEE Emmy.amteu£<m§o?oea?o=bm $536NbEUUUUm3<£<mSHoe<m 05855553330530335: $933303:Bumgb?aga?agm 396353<£<3<m§<mbub£05m cd. wEmz 0m=o N.mhmmOH-< N.HmmmOH-< N?owmo?d‘ N.mm¢mOH-< N.memOH-< N.hhmmOH-< 858“. w>_um_w.. On ammom aHmNm 0mm Hmm Nmm mmm «mm mmm wmm 5mm mmm mmm How Now mow mom new wow wmd< wad/Eu. mbmzuzuz? 3 85:35 E DUES/“0533 P. 09.0 wSEE—<3emu—umz??gdg 355 £0 D¥<uk<mu<uko£< ESE—OEDEEQDUUEOEDED o2:853/3:Eou_<u_ouu_<ubmu_omu_o 8::5y.309.53028596330 $9259.85UWOUbbk/‘mbsombeu omd<3§§<£o?o§<£030.530 2:5e§<?<goNEEEEUUEUU $335303:P.3=u_uu_2<=u_:=u_§<mu_< @2553:so965580533530 @253:a:POMSESSUGEGUEHEUG 85mg.3abutenoususzmuemuc?o?o FEES @9230a:£35mSSSmmemme 8:335$:a:?a?ozz?aeu?ib $253396£36526PemEmbmb 8553.39.56;32863033332 @2230$823326:Eo?omz?o 8:3a3mtgmb?s?umzmbub?u 85335303:=5563§S§§ 09.0 355 wEmz HdHNOHHé‘ ?wHNOHHé‘ ?wNNOHHé‘ H.o¢wOHH-< ?mONOHHé‘ ?é‘ wEmz x295 H.H?wmm-o< H.N?wmm-o< H.m?wmm-o< H?whmméd‘ ?wwhmméd‘ ?dhhmméd‘ H.w?wmm-o< H??wmméd‘ Héhhmméd‘ ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car wucwzuwm 03.0 020035.. 0303233230&30303<UU_03_<N N303:333030mm3§03<3§<= =30m3<3<3<30=80033303330: m30min3030E03353330353% 3,5353:3<Eamm3<3§03<3<m a30m3<3<3<30e03<3<3<303<m m33m30333030333303330330 m3%.30300530033.033533% M33303:=83<¥35330E§3 0303530303503335303005a 300300303330:8003030323? 353233303<m§03<3§<30m 0333030mu.03<m,m3<y_<mu_030mu_<m 030m3<3<3<330m30335333% mm,§.mu_<3§05833mu_0mSUu_03_3= 0333033330303<3<§a =3<m3<3<3<3<8303030303<m =30m3<3<3<3.0sm3<u.<mu_<303<m Um.u_0§<303.03%530303.3033m 3530330303:3<3<m wmcw?ucd. wEmz 03.0 N.HmmmOH-< Hé. N.mwmmOH-< Ndhmmo?d. N.m?mmOH-< N.mmmmOH-< 858; w>_um_w.. 0a wwmm wowm mhmm mmNm ommm hmHN meN omNm mwmm hmmm .mem hwmm w?wm mhmm Homm mmmm wSHN .VHwN 0.6 :6 36 m?w .16 36 £6 56 $6 96 omw HNw NNw me «No me wmw hmw wmw me meD 0. 035 meD me< meD meD 035 EUEOEDHDE EU me<EquEDED E DE 3 EU Eu Eumu? E DE: ED D 0.5m”. Eo EOE/0E wucwzuwm 0”. 30050060. 250595053905 O”. 03.0 EEDEUEOEU DEN—0:06 E<MEOEUMEEE<E<ED Eu ED Eon—02m? 0.230 ED Eu 355 me<EoEDEDEOEEEDHDEUEOED E 3 EOE< 09530303035320533353030 095303:33303000<3<30=S=S 0253030303:3000230303030 033US3<303030303300230 mad<m003<3030300<b3033030 0223033830m.0u_<.03<3_03_0mu_< 092353523500223035802 095530303030553505333: UMUSEOEEEUEUEDHDED meDEDEDEOE/0033550233035ED EEEOE<HOEUED EuE<ED 0.233 E: EUEOEumSEEEDEOUEEU E<Eu Eo Eu E: E< Eu 03.0 355 wEmz H.wwwOHH-< H.wmwOHH-< H..VONOHH-< H.NHNOHH-< HH-< H.mwwOHH-< wEmz x2030 H.0Nwmm-n.< H.Hmwmm-n.< H.NNwmm-n.< H.memm-n.< Hémwmméd. H.Hwhmm-n.< H..thmm-n.< H.memm-n.< H.memm-n.< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. mzmSmaSgoeuuSsum 3968935auguaaea?aubeagom $3303:53:83:£:3:£<mu_3m E?mzuz?o?oNEE/3033’; ????b?:3025353233? ????bE?b?£33633? Eomeu?ueugos?355535a mm_<m3<mu_<£<mu_uUuEmmb?o??? 32E:mEmSmmeUSgag/Eb: ???ibBogumg?umzngm ???ibaomEUEEUEEEUm ???ibEmméum?ambmémuambm mméum?ambmémuambm ???ibBogumgmbmégmbm ???ibEmméum?ambmémuambm ???ibEmméum?ambmémuambm ???ibEmméum?ambmémuambm ???ibBogumg?umzngm ???ibEmmk?mg?ugngm ???ibEOMEUEEUEEEUm wmcw?ucd. wEmz 0m=o N.mh¢mOH-< N.mw¢mOH-< N.mommOH-< OH-< w.m¢mmOH-< OH-< 858“. w>_um_w.. On awwmm I amowm 0mm Hmw wa mmw «mo mmw wmw 5mm wmw mmw Sum Nww mww mww Duo www wad wad wad: Du? m5 £03430 DEGmEHOmU?E ED Eu?o 85:35 8495959553: Eon—Eu 09.0 WU 3.5m: 355 NC ou.<£<£<mu6mu_o Euu?z?umzmbub wan—DE:POE—oEDEDUSUSUUEOEU @9235323233055£333:a: 8:30£863353253032305 oma_<£<mu_o?o£<mu_9055mu_<musmu_< $35325533356595355:2 wad/Eua:Eeo?gbmb?agbmb @253:a:.595ESSUGEGUEHEUG @253:a:.595ESSUGEGUEHEUG @253:a:sb?aeaaoguzga PSSGPGUEMSUG 8:333:33:eaaoeugmgb o2=3:a:3Um39_29_oa£<m§u_u o?smgusam:3220:82me $32m:assumzzu?u?u?suummgb $253335.533seaoeusseib :99653220382525 $253295£2953220332625 09.0 355 wEmz H.mmwOHH-< HH$$OHT< H.mthHH-< H.0mwOHH-< N.0Nmm??-< H.mmmm??-< wEmz x295 H?whmméd‘ ?wwhmméd‘ ?mwhmméd‘ H.Hmwmm-o< H.wamm-n_< H.mmmw¢-o< H.mmwwm-o< H??wwméd‘ H.H¢wwm-o< [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. ???ibsawh?mgmbmémzmbm ???ib=63<Uw£<mb?<£<mbm mm8<mm8<z8u:80m8<umm8<m8um8<m8<m80m bsoHEE/‘Smémz?m mmzm?ibsoHEE/‘Smémz?m mmzm?ibsoHEE/‘Smémz?m ???ibso?<um£<mb?<£<mb< ???ib=EE<U§<£UE<E<5< E12mm:53033EEUMEEEUE: AsEEEEUEoH<Um£<£u?<£<mbm Ei?méeuBOWEUQESMENESm SEEHEUPGEEQESMENESm Ei?mzeusow/Um£<83<£<825 339.355Begum£<mb?<£<mbn< LEEEEUsomzumgmbmzmzmbm n<?<m?<=bsomzummz?mzmz?m n<?<m?<=bsomzummz?mzmz?m n<£<m?<=bsow/Um£<83<£<82c 3:335. wEmz 09.0 33mg: @338: h??wmmo?d‘ H.m?mm:-< -< m.m$m:-< H.Nmmm:-< N.Nmmm:-< H.¢Nmm:-< H.mmmm:-< H.ommm:-< N.ommm:-< H.wmmm:-< dommm?-< H.Hmmm:-< :-< N.Nmmm:-< H.¢mmm:-< 2238; 3:32 3 omo wa m3 3o m3 o3 So wmo m3 so So moo moo now 85:35 09.0 $55 8:29:5559695EEPGEUEEoEEU 83893838383889:33838038859580 om 838938383838893883889388859580 wm? @353:a:.595ESSUGEUEHEUG :BumSeaaoeug?/é madam:£25m:eaaoguzmza 8:33:a:eu?aeaaoeugmza @353:a:.595ESSUGEUEHEUG 8:33:a:POMSEaaozbgmésg 8:33:a:POMSEaaozbgmésg @353:a:POMSEaaozbgmésg madam:a:.53:EDSEEEHEO: madam:a:.53:EDSEEEHEO: 8:33:a:POMSeaaoeugméz? @253:a:POMSeaaoeugméz? 8:33:a:POMSeaaoeugméz? £35m:a:POMS9.29.0382mu.<=8 £35m:a:POMS9.29.0382mu.<=8 09.0 m 355 wEmz EE ??-< H?wmm??é‘ m.m$o:-< EEEEEéé H.mmmm:-< N.mmmm:-< m.m~mm:-< H.Rmm:-< -< H.mmmm:-< ~33: 33.: < < H.mmmm:-< N.mmmm:-< wEmz x295 ?mwwwméd‘ ?mmwwmd< H.m$om-o< H5393 H3393 33.993 -o< 38.993 $8.993 H3393 doéomd< H3393 H.Nm$m-o< d?oomd< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car mmu_<mmu_<:u6u_ 85:35 09.0 3:335. Sam?59633m£<mb?<mmmbm Sam?59633m£<mb?<mmmbm Sam?59633m£<mb?<mmmbm Sam?59633m£<mb?<mmmbm Sam?59633m£<mb?<mmmbm mmmmmziu??mzum?<mb?<mmmbm Sam?absmmzummu_<mbmu_<mmmbm Sam?absmmzummu_<mbmu_<mmmbm Sam?absmmzummu_<mbmu_<mmmbm smmzummzmb??mmbm Sam?absmmzummzmb??mmbm Sam?absmmzummzmb??mmbm ¥<38203.4%£<£um¥<¥<¥<mu6m mmu_<mmu_<:u6%EOE/Ummu_<mu6mu_<u_<u_<mu6m mmu_<mmu_<:u6%203.4%mu_<mu6mu_<u_<u_<mu6m mmu_<mmu_<:u6%EOE/Ummu_<mu6mu_<u_<u_<mu6m mmu_<mmu_<:u6u_Du_0mu_<ummu_<mu6mu_<u_<u_<mu6m Du.owu_<ummu_<mu6mu_<u_<u_<mu6m m??mézbuéo??m£<£u?<§<mbm 3:335. wEmz 09.0 H.o¢mm:-< N.o¢mm:-< :-< ¢.o¢mm:-< EEEE m.$mm:-< «.3mm:-< -< o?mm?-< H.w¢mm??-< Ndwmm?? m.w¢mm?? ¢.w¢mm?? < < < -<EE 2238; 3:32 3 8% 8mm 8mm 8% 8.3 momm 8.3 8.3 8% 8% 8% 8.3 mowm mowm mowm mowm mowm momm 8% wow 03 HS NS m3 «S m3 Eu Eu ME m3 oww wa Nww mww www 292?.
DUOUGUS 85:35 09.0 $55 @953:a:.595ESSUGEGUEHEUG omdamusassbmuseaaoeugmgb 33:eaaoeugmgb o9=3:a:3Um39_29_oa£<m§u_u o?smgusam:3220:82me $32m:assumzzu?u?u?suummgb @953:a:.595ESSUGEGUEHEUG omdamusasacmuseaaoeugmgb 8:333:33:eaaoeugmgb o9=3:a:3Um39_29_oa£<m§u_u o?smgusam:3220:82me o23m:===Um==u_9_9_o=8mm§b ?EDPOMSEng—DUGEUUUQMEPO wmdDMmDEDEUED:u_Du_3u_o:u_u?<u_ou_<:uG wmdDMUSED€9.95EDUSUGPGUUQUGUQPG wmdzmkaaz€9.95:u?u—DuGP—u?d‘uékd?b wmdDUGUSUSUS€9.95:u_Du_Du_o:uGuGu_<u_ou_<:uG EDUSUGPOUGEUGEW 96 mm ”59.92222965”.2956568303Po 09.0 N 355 wEmz hmmoo?-< N.mmmm:-< N.ommm:-< N.nmmm:-< EEEééEE m.ommm:-< m.nmmm:-< m.wmmm:-< m.mmmm:-< m.mmwOHH-< Ndwmm?? N.m¢mm?? Néwmm?? < < < mwmm??-<EE wEmz .95 Héoomd< dmmoomd< H.N$om-o< $3.993 38.993 dwéomd< Hemoomé‘ H.m$om-o< 33.993 Hé?wwméd‘ H.0Nwwm-n_< H.wmwwm-n_< -n_< ?wmwwmé< H.¢¢mwm-o< #8893 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car mm8<mm8<388 mm8<mm8<388 mm8<mm8<388 mm8<mm8<388 mm8<mm8<388 8<288 8<288 8< 85:35 380340 803.4% 803.4% 803.4% 803.4% D80m8<um D80m8<um :8 3:88 m8<m88 m8< m8< m8< m8< m8< m 09.0 £8 £8 £8 £8 £8 o8<8<8< 8E<8< 8E<8< m8< 3:335. o8<8<8< muG muG muG muG m m 8E<8<mbm 8E<8<mbm 8E<8<mbm m m EEEEUBegumEEUHEEEUN EEEEUBegum£<mbm§<2mbm SEE/Eb303Em£<m§9<£<mbm EEEEU303$Essumzmzmbm m8<mUGm REE/EaEomzumg?umzmzmbm REE/:38=U_omu_<ummu_<mbmu_<mu_<mbm 33025EoHEEEUHEEUN ???ibso?<um£<mb?<mmmbm ???ibso?<um£<£um§<mbm 3:335. wEmz 09.0 :-< N.m¢mm??-< m.m¢mm??-< H.Hmmm:-< H.mmmm:-< H.mmmm:-< H?mmm??é‘ H.mmmm??-< 22:8; 3332 3 moom mowm mowm EggEggEE-EE. 8mm moom moom mowm mowm E www mww wa mmw Eaa 8:29:5559695£2205on25 8 8388 @253:a:POMSPSSGEUEHEUG @3833: @9833: 3883838 :83 :83 38883 383838388838 POMS 85:35 :8 8533:5533 EOEU8E8<EU $2539559995eaaoeuy?ézao 28838028885028 88 8533:5533 09.0 3883888585 355 83802808502280 PO PO 23 £35m:a:POMS3956339.,‘3/‘96 @253:aa.53:3956339.,‘3/‘96 @253:a:amSeaaoeug?/Eu @253:a:Bumzeaaoeus?<=b @253:a:EUMSEDSEEUEMEEU PSSGEUUEEUG eaaoeugmweu @253:a:BumSeaaoeug?/é 8:33:55POMS3956339.,‘3/‘96 @253:32963:3956339.,‘3/‘96 09.0 355 wEmz OHH-< m.N¢mmHH-< m.m¢mm??-< m.¢¢mm??-< m.m¢mm??-< m.w¢mm??-< m?wmm??é‘ H.0mmm??-< H.Nmmm??-< H.¢mmm??-< H.wmmm??-< H.wmmm??-< H.0wmm??-< «.mmmm??é‘ iommm??é‘ H.3mm:-< H.8mm:-< wEmz x295 H.wmwwm-o< H.Nwwwm-o< ?wwwwmé< ?mhwwméd‘ ?whwwméd‘ H.mwwwm-o< ?wwwwmé< éd‘ H.mwwwm-o< ?mwwwmé< ?whwwméd‘ ?mhwwméd‘ Héwwwméd‘ ?mwwwmé< H.mmwwm-o< dwmoomd< déoomd< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car $335; 85:35 96340 09.0 3:335. ???ibso?<ummu_<8mu_<mu_<mbm SEE/‘5Emm?m?ambmzmz?om ???ibsm??mmé?ugngm REE/‘3augummémbmzmémbm maimgbaugummémbmzmémbm SEE/Eusomzummzmbmzmzmbm $238Emméum?ambmémuambm waistao??m£<mb?<m§<bm o??mMENUHEEEUN waist363Em£<m§9<£<mbm waistsow/Um£E<UE<£<£UN waist39ozumgmbmzmzmbm mu_<mu_umu_< £<mUm $355so?<um£<£u?<£<mbm o?<ummu_<mu_umu_<mmmbm waistso?<ummu_<mu_umw£<mu_% waistEOMEUEESHEEUN waistBogummmmbngmbm waistEOMSNEEUHEEUN waistsm??mmzmbmémzmbm wmcw?ucd. wEmz 0m=o H.mwmm??-< H.memHH-< H.memHH-< H.memHH-< H.Hmmm??-< H.mmmm??-< 858“. w>_um_w.. On amowm amowm «OK mOK «BK KOK wOK mOK 9K SK SK 2K SK BK SK 5K MSK 9K ONK HNK NNK mNK @3533 @3533 @253: ED ED ECU—93 FONS 95363: $25333 8:33: 8:33: 85:35 E 09.0 355 203323455 @253:a:.53:EDSESUUEMEEU @253:a:.53:eaao=u_ubu_<mu_<eu Du—Eo?u??oz?u ESSEEUUEHEDU @253:a:.595ESSUGEGUEHEUG 8:33:a:5333220382? madam:a:eumSeaagbuzmué eumSeaagbuzmué eazumu.39_2:u_o=u_uy_<?< 8:33:aneum=39_?_oe§<mu_< eaeu?aeaaosus/EE 8:33:33533322053? 8:33:assucmusaé?_o=b£<mw 8:33:555333220382? @253:£2963:95959655? @9533a:5653220382»: :53295959655? @253:a:5333229565? @253:a:eumu.:=U_P_:u_o=bu_uu_<mu_< 09.0 355 wEmz H.wwmm??-< H.NKmmHH-< H.¢Kmm??-< ¢.N¢mm??-< E H.¢wmm??-< H.wwmm??-< H.wwmm??-< H.0mmm??-< H.Nmmm??-< E wEmz x295 -o< H.0wwwm-o< H.mwwwm-o< é< H3893 H.wwam-o< H.wawm-o< ?wwwwmé< H.Hmwwm-o< H.mmwwm-o< H.R$m-o< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. ma?aBowd??/‘mbmzmémbm mamasEOMEUEEUHEEUN mm:530mb:m?<mbmd<£<mbm 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 3sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m wmcw?ucd. wEmz 0m=o H-< H.0me??-< H.NmeHH-< mH.awmaOH-< a.awmaOH-< OH-< 858“. w>_um_w.. On aSumm 5Summ «Nu mNh th hmh wmh awn omh Hmh th mmh wmh amp wmh hmh wmh amh own SK Nwh mwh wad:mu_: wad: wad: wad: wad: wad: wad: wad: wad: wad: wad: wad: wad: d: d: d: d: d: d: d: d: d: wad::u_: wad::u_: wad::u_: wad::u_: wad::u_: d: d: d: 3.53: @2533955333220382? @2533355333220332» d:d:md: d:d:md: d:d:md: : d:d:md: d:d:md: d:d:md: d:d:md: d:d:md: d:d:md: 3:853: 85:35 dd 3:556 3:556 3:556 3:556 3:556 3:556 3:556 3:556 3:556 d :dddu 09.0 355 :dodudddo; d<mdu memdumd<mdu memdumd<mdu memdumd<mdu memdumd<mdu memdumd<mdu memdumd<mdu memdumd<mdu memdumd<mdu $030938 dd?u?o?umzmu 35d:md:d:d<u6md0mdumd<£uc 35d:md:d:d<u6md0mdumd<£uc 35d:md:d:d<u6md0mdumd<£uc 35d:md:d:d<u6md0mdumd<£uc :d:d<u6md0mdumd<£uc :dd?u?o?umzmnu 09.0 355 wEmz H.wowm??-< N.owmm??-< H.H?wm??-< OHNHNOHHé‘ aHHNOHHé‘ H.mameH-< wEmz x295 H.wawwm-n_< H.wawm-n_< H.hwwwm-n_< HH.wowmm-n_< mm-n_< h.wowmm-n_< OH.wowmm-n_< H.ahawm-n_< m.mhawm-n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. 38E:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 3sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 3sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 3sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:5335M:£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m wmcw?ucd. wEmz 0m=o w.awmaOH-< a.awmaOH-< OH-< aOH-< mH.awmaOH-< w?.awmaOH-< 858“. w>_um_w.. OH HSumm aSumm SK awn wwh Duh wwh awn omh Hmh man man «an man wmh nah wmh amh own Hwh Nwh mwh wad: wad: wad: wad: wad: wad: wad: d: d: d: d: wad: wad: d: d: d: wad: wad: wad: wad: E:d:md:dd?u?o?umzmnu E:d:md:dd?u?o?umzmnu E:d:md:dd?u?o?umzmnu E:d:md:dd?u?o?umzmnu d: d: 3“5d: 3“5d: 3“5d: d: d: 2 2 mm.— 3:3 3:3 2 2 wan—3 3:3 3:3 @223: : 85:35 E: E: :u: 09.0 355 <UmemUMmmdu md:d:d<UmemUMmmdu md:d:d<UmemUMmmdu md:d:d<UmemUMmmdu md:d:d<UmemUMmmdu 3:3md::d:d<u6mm£umwmdu 3:3md::d:d<u6mm£umwmdu BEEUmmEUMmmU 3d:d<d0mm£umwmdu o2aaaEB:Ease/ENMNUMNEU o2aaaEB:Ease/ENMNUMNEU :3::u3mdDdeu—<d0mmwummmdu BESEEEUNMNUMEU :d3d<d0mmwummmdu 8:3a:335$:EEEUNENUEENU 8:3a:335$:EEEUNENUEENU 09.0 355 wEmz N.oo¢wHH-< HH-< ¢.oo¢w??-< m.oo¢wHH-< H.ao¢wHH-< N.ao¢wHH-< wEmz x295 N.mwawm-n_< m.mwawm-n_< «.mwawm-n_< m.mwawm-n_< m.hhawm-n_< N.whawm-n_< H.¢wawm-n_< N.¢wawm-n_< H.maawm-n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. :mqumu?3633”;szmu_<mu5mu6mu_<mu_<m :mqumu?3633”;szmu_<mu5mu6mu_<mu_<m :?ummu?Eumu??zm:mu_<mu5mu6mu_<mu_<m :mqumu?Eumu??nm:mu_<mu5mu6mu_<mu_<m E33:5335?£<?§££<£§ 38E:53395?£<?§££<£§ E33:5335?£<?§££<£§ E33:5335?£<?§££<£§ E33:5335?£<?§££<£§ 399955335»:EESNUGEEE 39955335M:EESNUGEEE E33:5335?£<?§££<£§ :?ummu?EUMUSUUSM:mu_<mu5mu6mu_<mu_<m :mbmmu?3633”;szmu_<mu5mu6mu_<mu_<m :?ummu?3633”;szmu_<mu5mu6mu_<mu_<m :?ummu?3633”;szmu_<mu5mu6mu_<mu_<m 35M:£<?§££<£§ 38E:53395?£<?§££<£§ E33:5335?£<?§££<£§ 35?£<?§££<£§ 3:335. wEmz 09.0 m?.mwmmOH-< mOH-< Hm.mwmmOH-< m.mwmmOH-< 2638: 86382 3382 2638: h?dwmmo?d‘ NNdwmmOH mmdwmmOH h?dwmmOH < < < 2238; 3:32 3 Summ Summ Summ Summ EEEEEEEE 3% 3% 3% Summ Summ Summ Summ Summ EEEEEEEE «on mow own hon won mop OR E NR mR «R mun own huh mun mun own 2K 2K 2K @9595 85:35 09.0 $55 wad:EDEDEEEDEDEUGFGEEOEPG wad:ED329525:u_Du_<quu6muOu_ou_<muG wmdDEDEDUGUSEUS:u_Du_<quu_ou_<uGu_ou_<muG wad:ED396525:u_Du_<uOmu_ou_<uGu_ou_<muG 035a:£29525=U_E<u_u£9<§ou_<mb 8::a:£3595=U_E<u_u£08mu_<mu_u 8::a:£3595=U_E<u_u£08mu_<mu_u 35$:eagmm?u??b 8::a:950953:eagmm?u??b 35$:aé??o?omzmb £35EDEEUNEEUHEU wmdDEDEDUJED:u_3u_<u6mu6mu6mu_<mu6 wmdDEDEDUJEDEEEUEOmUmsz wad:a:EDUUSED:u_Du_<quu6mquu_<muG wad:a:EDUUSED:u_Du_<quu6mquu_<muG wmdDEDEDUUSEDEEEUEOEUMmmu 8::a:335$:352%meng 095a:£3952=E<b£o£u?<mb 095a:a3ngeag?o?umémb o9aaa950953:eag?o?umémb 09.0 355 wEmz H.m?ww??-< ??-< H.HN¢@HH-< N.HN¢@HH-< E N.wN$:-< H.028: 3282 H.¢m¢w??-< N.¢m¢w??-< ?wmww: Ndmww: ?wmww: < < <E wEmz .95 H.mewm-o< H.mwmwm-o< é< N.wwmwm-o< m.ww$m-o< EEEEEE -o< H.$$m-o< H.om$m-o< H.Nmmwm-n_< N.Nmmwm-o< Hémmwméd‘ Némmwméd‘ H.wmmwm-o< H.823? EEEEEE [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. 38E:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 3sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 3sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38E:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m 38%:533sz£<£a£o£<£<m wmcw?ucd. wEmz 0m=o mN.awmaOH-< mN.awmaOH-< DwawmaOH-< aOH-< DwawmaOH-< mN.awmaOH-< 858“. w>_um_w.. OH HSumm aSumm 3K mwh wwh hwh wwh awn can Han man man wan man wan nah wan aah oow How Now mow wad: wad: wad: wad: wad: wad: wad: wad: wad: wad: E: E: E: E: E: E: E: wad: wad: wad: wad: wad: wad: wad: wad: wad: E E E:d:d:E:E: E E E E E :u. :u.
E E:E: E: E: E: E: wad:E:E:E:E:E:mquEumu_<Eu :u. :u. EE :dd:E: E:E:u_<u_: E:E: E: E:E: E:E: 2 E: E: E E E: E:E: E:E: E:E: E: E:E: m: :d:u_:E:E: :d:u_:E:E: E: E: :E:E: m: :d:u:E: :d:u_:E:E: EEEEEU Edd: Edd: 85:35 E EEEEE E E EEEU EEEU EEEU EEEU EEEU E E EEU EEEU EEEU EEU EEEU EEEU 09.0 355 EoEuH<Eu EoEuH<Eu EoEumd<Eu EoEumd<Eu EEEEOEuszu 025m? EoEumE EoEumE Eu EEUEOEUEEEU EEUEOEUEEEU EoEumd<Eu EoEuH<Eu uEumd<Eu EoEumd<Eu EoEuH<Eu EEEUmmEuszu memumd<mdu E:EE<UEOEUMmEu <mu Eu Eu 09.0 355 wEmz H.w¢¢w??-< H.a¢¢w??-< admww??é‘ H.Nm¢w??-< H.¢w¢w??-< H?www??é‘ wEmz x295 dwmonméd‘ ?mmonméd‘ H.haawm-n_< H.NOOhm-D< ?woonméd‘ H.wN0hm-n_< H.m?onm-o< éd‘ H.0H0hm-n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car 85:85 09.0 8:835. :mqumu?28633”;szm5<m53m50£<£<m ?3633”;szm5<m53m50m5<?<m :mbm?nzbmgugm:mu.<mu_Dmu_Omu_<mu_<m :muOmmu?28633”:szm5<m53m50£<£<m :?ummu?28633”;szm5<m53m50£<£<m 8585E858589.859.338 8585E858589.859.338 3885E85858$8559.58 3885E85858$855598 8585E85858E<m5£o£<£<m 8585E85858E<m5£o£<£<m 8585E85858?<m5m5£<£<m 8585£85858?<m5m5£<£<m 8:835. wEmz 09.0 mm.mwmmOH-< mm.mwmmOH-< D.mwmmOH-< h?dwmmo?d‘ h?dwmmOH 5.888 8.888 < < < 5.888;: 5.888;: 22:85 3332 3 Summ Summ Summ Summ Summ 38 38 EHEHEHEH 38 38 wow mow wow how wow 85:85 09.0 855 wad:EDUSUSUUSmu.D:u_Du_<quu_ou_<quu_<muG USUSEDEDEEEUEOEEOEPO wad:22285868533EEEUEOmUmsz @35332858685maee?u?o?umzmb @3533EDUUSEDEDEquMmUGUGEmUG :58355855558m5m§80:<88<:u 8:203 :58355855558m5m§80:<88<:u 8:203 :5835855558m5£280:<88<:u 8:203 888:2835558m5m§80:<88<:u 8583558855? 88558835558m5m§88588<:u 8583558855? 88558835558m5m§88588<:u 8855? :583:85m53558m5£280:<28<:u 88203 888:28353558m5£208:<88<:u 09.0 855 wEmz H.Hw¢w??-< H.mw¢w??-< H.ww¢w??-< H.ww¢w:-< Hdmww??é‘ 58883: N.88:-< @888: H.888: N.88:-< @8828 5882;: 5882;: wEmz x295 H.HNOhm-n_< ?wmonméd‘ ?moonméd‘ H.HHOhm-o< é< N.OOOhm-n_< m.OOOhm-n_< Hdoonméd‘ N.ooo$-o< 0803-3 5803-9: 5203-3 5803-3 ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car mmmmmgzb 85:35 09.0 3:335. ???ibBogumgmbmégmbm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm 333/36Begum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm 333/36aoHEEEEUME£8me _<uU_<u_<u_<mquu_< £<mmu6mm aoHEEEEUME£8me aoHEEEEUME£8me 333/36aoHEEEEUME£8me $9.9m.5ao?<£<£<mb?<§<m5mm $9.9m.5ao?<£<£<mb?<§<m5mm $9.9m.5ao?<£<£<mb?<§<m5mm $9.9m.5ao?<£<£<mb?<§<m5mm wmcw?ucd. wEmz 0m=o 858“. w>_um_w.. m?w HNw NNw me «mm me wmw hmw wNw me omw Hmw wa mmw wmw mmw @253:a:.595ESSUGEGUEHEUG @253:a:.595=U_P_P_o=u_u£<mu_<m=mb mg m3 m3 m3 2 aPom:Engagbuémzma? o23m:a336m:seawabuémzmab swag: @33ng magmas: @3393: swag: @33ng magmas: swag: @33ng ?ow: Bum: @3393: magmas: 85:35 09.0 355 83:83:28558 :u—DUSUGEUUEMUEQMG 2230333348sz sum::::u_02u6uU_<mu_<m:muG m32m:zzsbm::::u_o:UGUmMmm:muG sowszzzu?sbummgsmb 392236363mesz EUMJJJEOEUUEMUESMG sum::::u_02u6uU_<mu_<m:muG m32m:zzsbm::::u_o:UGUmMmm:muG sowszzzu?sbummgsmb 392236363mesz EUMJJJEOEUUEMUEQMG sum::::u_03u6uU_<mu_<m:muG m32m:zzsbm::::u_o:UGUmMmm:muG sowszzzu?sbummgsmb 09.0 355 wEmz wEmz x295 H.m?wmm-o< oiwmmhméd‘ m.Nmem-o< H.wHNmm-o< H.NNNmm-D< ation] car None set by car ation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car mmmmmzz 85:35 3.0340 09.0 muG 3:335. $9.9m.5ao?<£<£<mb?<§<m5mm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm ESE/Faso??m£<mbmu_<mu_<mmomm ESE/Faso??m£<mbmu_<mu_<mmomm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm 333/36sombtm£<mb?<£<mmbm$ mmmmmué?mb30340m?<mu6m?<£<mmu6mm Mm? £<mmu6mm mmmmmué?mb30340mmu_<mu_umw_<mu_<mmu_0mm mmmmmucqzmuo36340m?<mu6m?<?<mmu6mm mmmmmucqzmuo36340m?<mu6m?<?<mmu6mm mmmmmué?mb30340m?<mu6m?<£<mmu6mm é?mb30340m?<mu6m?<£<mmu6mm wmcw?ucd. wEmz 0m=o 858“. w>_um_w.. Ou Howm Howm Howm Howm Howm Howm Howm Howm Howm Howm wmw hmw wmw mmw oww Sum Nww mww Sum mww www Bum www mww omw Hmw 83%: @3393: 85:35 09.0 355 392236363mesz 8:33:a:POMSseamsbué??ab 8:33:a:.595=U_P_P_o=u_u£<mu_<m=mb 25mg:3.5=53:32203823335 m 33mg3.5=53:=U_P_P_o=u_u£<mu_<m=mb mm o?mSmMmSa:POMS32203323335 maxim:a:POMS32203823336 2:5?32203823336 :.595=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:POMSeau_ao=b£<mu_<m=mo 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 25mg:3.5=53:32203823335 m 33mg3.5=53:=U_P_P_o=u_u£<mu_<m=mb mm o?mSmMmSa:POMS32203323335 @2953:a:POMS32203323335 09.0 355 wEmz wEmz x295 H.mNNmm-n_< méwamm?? mdh?mméd‘ éd‘ mdw?mmé< m.mw?mm-o< m.mw?mm-o< m.mh?mm-o< H.Nmmmm-o< H.wmmmm-o< H.wHNmm-o< HdNNmmé< H.¢Nmmm-o< H.wNNmm-o< H.mmmmm-n_< HNmNmmé< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car 9&5 mm”.
E 9&3 023 o”. E o”. sb ESE/Fa 85:35 mmmmo<zuzo u a 9&0 o EOE/Um so??m 09.0 o<u<<<<u ou_<£<u_<u_<u_<£ mmu_<u_<£ 3:335. mmmmmué?mb30340mmu_<mu_umw_<mu_<mmu_0mm mmmmmzm:M63033m£<mbm?<£<m?umm mmmmé?MG30340mmu_<mu6m?<mu_<mmu6mmn_ o<u<<<<uo<<<<mum< m o<<<<mum< ou_<u_<u_<u_<mu6mm mmm ou_<u_<u_<u_<mu6mm mm mu_<mu6mu_<mu_<mmu6mm £<mbmu_<mu_<mmomm ESE/Faso??m£<mbmu_<mu_<mmomm ESE/Faso??m£<mbmu_<mu_<mmomm ESE/Faso??m£<mbmu_<mu_<mmomm SSH/EuBegum£<mb?<£<mmbmm wmcw wEmz “:5. 0m=o 858“. w>_um_w.. Ou Howm Howm oowm Howm mowm Howm Howm aIHowm wa mmw «mm mmw wmw hmw wmw mmw 83%: 85:35 09.0 :3:a:POMS3.296553322 355 2:5?32203823336 @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb 2230:222033048sz 8420:22302222028503 @3393336336856235 @3393336336856235 @353:a:POMS3.220553328m3 :3:a:POMS=U_P_Eo=b£<m§emBEE om: EMS3553:222055333?895 o9 5:553:eaaoeug?ie?xe895 madam a:5MB3220382312mwaSmé @253: Smé 09.0 355 wEmz wEmz H H.wommm-n_< H.NHNmm-n_< m m H m x295 mowmmé< H.0HNmm-n_< Nmm-n_< HHNNmmé< H.HmNmm-n_< memm-n_< m-n_< mowmm-n_< wowmméd‘ m.wmem-n_< m.HmHmm-n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Emimmuéeuso??m£<mbmu_<mu_<mmomm mar/Eb mar/Eb <Eu we memor/‘Eu 85:35 09.0 3:335. m 3Em0:35so??m£<mu_umu_<£<mmomm mAEm euso??m£<mu_umu_<£<mmomm m EOE/Um?<mb?<£<m?0wm mAEm EVE/Faso??m£<mbmu_<mu_<mmomm i EOE/Um?<mb?<£<m?0wm mAmEm< 363$EECHEEEUEQV m SSE/Euso?<ummu_<mbmu_<mu_<£587d 963$mmu_<mbmu_<mu_<mmbEms m mmEeuEGmEUw£<?GM€£<£ESmémm mmm wmcw wEmz “:5. 0m=o 2:8“. w>_um_w.. 85:35 09.0 355 @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb :5MB=U_P_P_o=u_u£<mu_<m=mb 09.0 355 wEmz .8330 H.mHNmm-n_< HHHNmmé< H.HNNmm-D< H.H¢Nmm-o< H.mwmmm-o< Hdmmmmé< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car 85:35 09.0 3:335. egum£<mb?<£<mmbmm awaitBegum£<mb?<£<mmbmm awaitBegum£<mb?<£<mmbmm awaitBegum£<mb?<£<mmbmm awaitBegum£<mb?<£<mmbmm maisbeo??m£<£u?<£<mmbmm Emabammzum£<mb?<£<mmbmm ambmzuémzum£<mb?<£<mmbmm ambmzuémzum£<mb?<£<mmbmm mmabBegum£<mb?<£<mmbmm mmabso??m£<mb?<£<mmbmm mmabso??m£<mb?<£<mmbmm MmmmsbEo??m£<mb?<£<m?0wm MmmmsbEo??m£<mb?<£<m?0wm MmmmsbEo??m£<mb?<£<m?0wm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm ESE/Faso??m£<mbmu_<mu_<mmomm wmcw?ucd. wEmz 0m=o 858“. w.. On aNoam 5mowm Howm mum ohm ppm mum mum oww wa Nww mww www mww www hww www mww 0mm Hmw wa mmw 85:35 09.0 355 @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.533322038233: @253:a:533322055??? @253:a:POMS=U_P_Eo=b£<mm_<m= @253:a:eu?aeaaoeugmam: @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:533322038233: @253:a:533322055??? @3533955333220539.?» @3533955333220539.?» @253:a:533322055??? @253:a:533322038233: @253:a:533322055??? @253:a:.533322038233: @353:a:POMS32203823338 @253:a:533322038233: 5sb?aeaaoacgmmg :POMSeaaoeugmzabm: 25MBa:5MB=U_P_Eo=u_§<mu_<=§=m_3 m 09.0 355 wEmz wEmz x295 ?wwmmméd‘ N.mmmmm-n_< H.N¢Nmm-o< H.mmmmm-o< H.wmmmm-o< H.w¢Nmm-o< H?mmmméd‘ -o< H?dw?mmé< m.NmHmm-n_< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Em<vmmk< mmmmmz 85:35 09.0 3:335. EuEON—<0m?<mu6m?<?<mmu6mm ? PG30340m?<£um?<£<m?umm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm Emimmuéeuso??m£<mbmu_<mu_<mmomm m Emimmuéeuso??m£<mbmu_<mu_<mmomm m Emimmuéeuso??m£<mbmu_<mu_<mmomm m Emimmuéeuso??m£<mbmu_<mu_<mmomm m Emimmuéeuso??m£<mbmu_<mu_<mmomm m Emimmuéeuso??m£<mbmu_<mu_<mmomm m SSH/EuBegum£<mb?<£<mmbmm ENE/EbBegumgmbmzmzmbmm mmmmzeuBegumgmbmzmzmmbm wmcw wEmz “:5. 0m=o 858“. w>_um_w.. Ou Howm Howm Howm Howm Howm Howm Howm Howm Howm Howm Howm Howm Howm «mm mmw wmw haw Hom mom mom mom mom m3 m3 m3 swag: swag: m2smazzzumszzsmauumMmmiEmuv @2393:Pom:Esoeuuémzmaemuv 2 2 swag: wmém: EUMJJJEOEUUEPESMG EUMJJJEOEUUEMUEQMG ?ow: 85:35 09.0 355 :u—DUSUGEUUEMUEQMG EUMJJJEOEUUEPESMG .92:ngPom:Esoeuuzmzmiemuv mmémzzzzumzzzzmzuumMmmiEmuv mmémzzzzumzzzzmzuumMmmiEmuv assumzzu?u?u?zuummgzmu @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb :POMS=U_P_P_o=b£<mu_<=mo @253:a:POMS=U_P_Eo=b£<mu_<m=uo 09.0 355 wEmz wEmz H H Emommméd‘ m.mmHmm-n_< H.m¢Nmm-n_< m-o< H.mmNmm-n_< m-o< N H x295 owwmméd‘ Suwmmé< wwwmméd‘ mmwmmé< -n_< H.mmwwm-n_< Hémwwméd‘ [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car mmmmm?< Axe Axe 85:35 09.0 3:335. SSH/EuBegum£<mb?<£<mmbmm m$2.5somzummzmbmzmzmbm PG30340mmu_<mu6mu_<mu_<mmmu6mm mmmmm?d?bEmm?d‘um£<mmbm¥<£<mmbmm mmmmm?d?bEmm?d‘um£<mmbm¥<£<mmbmm 33,3:5335M:mu_<m5mu_o£<§<mm amazmz?ibsm??zg?um??m MmmmsbEo??m£<mb?<£<m?0wm mamasso??mEmbmzmé?u?éms msEusow/Um?ambmua??quXEms MmmmsbEo??m£<mb?<£<m?0wm mamasso??mEmbmzmé?u?éms msEusow/Um?ambmua??quXEms SSH/EuBegum£<mb?<£<mmbmm m825sombtm£83332?ms cd. wEmz 0m=o 858“. w>_um_w.. pom mom mom 96 SH m5 m5 @253:a:.595ESSUGEGUEHEUG :.53:=U_P_P_o=u_u£<mu_<m=mb $355333: ED ED POPS POMS E E 85:35 09.0 EEOEUUEEExEm Baoiu?d‘?ixrcm 355 :POMS39596553335 8:33:a:POMS39596553335 $259.5a:POMSPéagbyam???o 8:3a:335$:=U_E<b£o£umu_<m§u aesbbz?ibeas?a EMSa:5MBaEabgbgixemoxxems 30?: 30?: mm EMSa:5MBaEabgbgixemoxxems mm EMSa:5MBaEabgbgixemoxxems mm 8:33:95363:=U_P_Eo=b£<m?em$ 5363:=U_P_Eo=b£<m?em$ 8:33:95363:=U_P_Eo=b£<m?em$ m8 wad: m8 09.0 355 wEmz wEmz x295 H.mmwwm-o< ?wmwwm?? H?mwwméd‘ H.wmwwm-o< H.mmwwm-o< Hdomwmé< H.Nomwm-o< ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85:35 09.0 3:335. SSH/EuBegum£<mb?<£<mmbmm mmmmzzbso??m£<mb?<£<m§xems £5: m 2525sow/Um?ambmua??quXEms mAxE $596so??m£<mu_umu_<£<mb?em< 255 SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm mamasso??mEmbmzmé?u??ms msEusow/Um?ambmua??quXEms m 3:335. wEmz 09.0 22:8; 3332 3 Ila m8 «mm IllIlaIla mam Ila 0mm 85:35 09.0 $55 8:33:35POMSeaaoeugmzaxemg 5POMSeaaoeugmzaxemg 8:33:35POMSeaaoeugmzaxemg 5POMSeaaoeugmzaxemg @953:a:POM.33220382332?m3 8:33:a:5MBPSEoPGEHEggg 25MBa:POMSaBaezucgmuaabs?v @9595a:POMSeaaoeugméeus?v SSE:a:POMSEaEoeugmzéus?g 25MBa:POMSeaaoeug?ib?ga o .9 w @253:a:533322055??? @253:a:533322055??? 09.0 355 wEmz wEmz x295 ll [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car 85:35 09.0 3:335. SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm Begum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm wmcw wEmz “:5. 0m=o 858“. w>_um_w.. 35339596322 wuc SSMSESEGMUSEEPQ wzuwm 2 09.0 355 253:a:5MB=U_P_P_o=b£<mu_<m§35 w 25MBa:POMS£22958653335 8:33:a:5MBSeoiu?E/E?s? w 38023336 w 39.209.339.356 w 25MBa:52mg:32203823335 w @253:a:aSUE:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:a2293:32203323335 8:33:3535963:32203823335 253:a::53EMS32203823335 w @253:2&553:=U_P_P_o=u_u£<mu_<m=mb omda?acmE:POMS3220553336 253223:3POMS32203823335 w 09.0 355 wEmz wEmz x295 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car wages wages mmmmEeu 85:35 09.0 3:335. Begum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm Begum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm SSH/383033m£<mb?<£<§uem$ mmmm?ibeo??m£<£u?<£<£uem$ mmmmmzeuEo??m£<£u?<£<£uem<z mmmmmzeuEmméum?ambmé?icmuwm sow/Ummu_<mbmu_<mu_<em$mcmm m mmmmméauEo??m£<£um¥<£cm<vmmbmm mmmmméauEOE/Um£<£um€m<v£<mmbmm sow/Ummu_<mbmu_<em§<mmbmm so??mmu_<mbemor<mu_<mmbmm m mmmmméauEOE/Um£<£cmuvm¥<£<mmbmm wmcw?ucd. wEmz 0m=o 858“. w.. madamemte:.53:=U_P_P_o=u_u£<mu_<m=mb 8:3223E:POMSseamsbué??ab was; 85:35 09.0 355 252mg:a:POMS32203823335 m omicmb?:a:.595=U_P_P_o=u_u£<mu_<m=mb 3E:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.595=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.595=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.595=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb 09.0 355 wEmz wEmz x295 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car wages auEOE/Umm?cm<vmbm¥<£<mmbmm wages wages Axe mmmmc< 85:35 09.0 3:335. sow/Ummu_<em<:umu_<mu_<mmomm m sow/UmAcm<r<mbmu_<mu_<mmu_u‘mm m sow/?gsmu_<mbmu_<mu_<mmomm m mama/ECEo?icmuvm£<mu_umu_<£<mmomm m EuEoc<ummu_<mu_u_u_<mu_<mmu6mm QEQEEUsow/Um?ambmzmzmmbmm m euso??m£<mbmu_<mu_<mmomm m sees0:35sow/Um?ambmzmzmmbmm mAxEm mmmmzzbso??m£<mb?<£<m§xems m mama/ECso??m£<mu_umu_<£<mm_u?em$ m wmcw wEmz “:5. 0m=o 2:8“. w>_um_w.. 85:35 09.0 355 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 09.0 355 wEmz wEmz x295 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car mmmzzb mmmmmzeuBegum?amb??uaiémuvm wages 85:35 09.0 EOE/Ummu.<mu6mu_<mu_<mu_u?xrcm<vn_ muambmzmuai? EEGaugum??b?gixe 3:335. £5: mm 87d m muxxems mmmmm 2525sow/Um?ambmua??quXEms mAxE o??m£<mu_umu_<£<mm_u?em$ mAxEm m825so??m£<mb?<£<m§xems 255 Lavmmmmmzeusow/Um?ambmzmzmmbmm Am 23vmmmmzeuso??m£<mbmu_<mu_<mmomm 3,3v$3,396Begum£<mb?<£<mmbmm 93wagessow/Um?ambmzmzmmbmm wmcw wEmz “:5. 0m=o 2:8“. w>_um_w.. 85:35 09.0 355 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb :.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 09.0 355 wEmz wEmz x295 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 8;QvmmmzeuBegum£<mb?<£<mmbmm mama/abs; 85:35 09.0 3:335. 3%vmmzeuBegum£<mb?<£<mmbmm 3row/um£<mbmu_<mu_<mmomm m mmm?iu;35so??m£<mbmu_<mu_<mmomm m mmmmmzeuEomzumgm€6E<£<mmbmm mmmmmué?u:u_0mu_<ummu_<mu6mw£<mmu6mm SSH/EuBegum£<mb?<£<mmbmm mmmmmué?u:u_0mu_<ummu_<mu6mw£<mmu6mm SSH/EuBegum£<mb?<£<mmbmm é?u:u_0mu_<ummu_<mu6mw£<mmu6mm SSH/EuBegum£<mb?<£<mmbmm mmmmmué?u:u_0mu_<ummu_<mu6mw£<mmu6mm SSH/EuBegum£<mb?<£<mmbmm mmmmmué?u:u_0mu_<ummu_<mu6mw£<mmu6mm Begum£<mb?<£<mmbmm é?u:u_0mu_<ummu_<mu6mw£<mmu6mm 333/36Begum£<mb?<£<mmbmm SSH/EuBegum£<mb?<£<mmbmm wmcw?ucd. wEmz 0m=o 858“. w.. £35m? £35m? @2395 8:25 85:35 09.0 355 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb 8:33:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb @253:a:.595=U_P_P_o=u_u£<mu_<m=mb @253:a:.53:=U_P_P_o=u_u£<mu_<m=mb o2=3:a:POMSeau_ao=b£<mu_<m=mo o2=3:a:POMSseamsbué??ab madam:a:POMS32203323335 madam:a:POMS32203323335 o23m:a:.53:=U_P_P_o=u_u£<mu_<m=mb o23m:a:.53:=U_P_P_o=u_u£<mu_<m=mb =33:32203323336 =33:32203323336 =33:eau_ao=b£<mu_<m=mo o23m:aa3mg.Dasusuezbyamzmab 8:33:95=53:32203823335 a:5::35563323335 09.0 355 wEmz wEmz x295 [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car wmm? 85:35 09.0 3:335. mmmmm¥<=kushamk<umm¥<m¥uc<mk<mm¥0mm mmmmc<369.92%mu_<mu_u_u_<mu_<mmu6mm mmmmc<369.92%mu_<mu_u_u_<mu_<mmu6mm wmcw?ucd. wEmz 0m=o cannon w>_um_w.. 85:35 09.0 09.0 355 wEmz wEmz x295 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car Example 2. In vitro and in vivo screening.
A subset of these duplexes was evaluated for efficacy in single dose free uptake assays in Cynomolgus monkey hepatocytes. , primary Cynomolgus monkey hepatocytes (PCH) were d with the ated modified siRNA duplexes at three concentrations, 500nM, lOOnM and lOnM. The lOOnM and lOnM free uptake assays were performed twice and the data are represented as average message remaining relative to control +/— the standard ion (SD). The 500nM screen was performed a single time. Table 3 shows the results of these assays.
Table 3. PCSK9 efficac screen b free untake in nrimar Cynomolgous monke hepatocytes.
DUPLEX ID PCH 500 nM PCH 100nM Avg PCH 10nM Avg PCH 100nM SD PCH 10nM SD AD—48399 1.08 1.03 AD—48399 0.97 0.95 AD—48399 . 0.98 AD—48399 . 1.00 AD—48399 AD—48399 AD—48400 AD—48400.4 AD—53649.1 AD—53650.1 AD—53651.1 52.1 AD—53653.1 AD—53654.1 AD—53656.1 AD—53657.1 AD—53658.1 AD—53659.1 AD—53660.1 AD—53661.1 AD—53663.1 AD—53664.1 AD—53665.1 AD—53666.1 AD—53667.1 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53668.1 1.03 1.17 69.1 AD—53670.1 AD—53671.1 AD—53672.1 AD—53674.1 AD—53675.1 76.1 77.1 AD—53678.1 AD—53679.1 AD—53680.1 AD—53681.1 AD—53682.1 AD—53683.1 AD—53684.1 AD—53685.1 AD—53687.1 AD—53688.1 AD—53689.1 AD—53690.1 AD—53691.1 AD—53692.1 AD—53693.1 AD—53694.1 AD—53695.1 AD—53696.1 AD—53697.1 AD—53698.1 AD—53699.1 AD—53700.1 AD—53701.1 AD—53702.1 AD—53703.1 AD—53704.1 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53705.1 1.00 0.11 0.15 AD—53706.1 07.1 08.1 AD—53709.1 AD—53710.1 AD—53711.1 AD—53712.1 AD—53713.1 AD—53714.1 AD—53715.1 AD—53716.1 AD—53717.1 AD—53718.1 AD—53719.1 AD—53720.1 AD—53721.1 AD—53722.1 AD—53723.1 AD—53724.1 AD—53725.1 AD—53726.1 AD—53727.1 AD—53728.1 29.1 .1 AD—53731.1 AD—53732.1 AD—53733.1 AD—53734.1 AD—53735.1 AD—53736.1 AD—53737.1 AD—53738.1 AD—53739.1 [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car AD—53740.1 0.86 0.92 0.97 AD—53741.1 AD—53742.1 AD—53743.1 44.1 AD—53745.1 AD—53746.1 AD—53747.1 AD—53748.1 AD—53749.1 AD—53750.1 AD—53751.1 AD—53752.1 AD—53753.1 AD—53754.1 AD—53755.1 AD—53757.1 AD—53758.1 AD—53759.1 AD—53760.1 AD—53761.1 AD—53762.1 AD—53763.1 AD—53764.1 AD—53765.1 AD—53766.1 AD—53767.1 AD—53768.1 AD—53769.1 AD—53770.1 71.1 AD—53772.1 AD—53773.1 AD—53774.1 AD—53776.1 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car AD—53777.1 0.67 0.68 0.74 0.11 0.01 AD—53778.1 AD—53779.1 AD—53780.1 AD—53781.1 AD—53782.1 AD—53783.1 AD—53784.1 AD—53785.1 AD—53786.1 AD—53787.1 AD—53788.1 AD—53789.1 AD—53790.1 AD—53791.1 AD—53792.1 AD—53793.1 AD—53794.1 AD—53795.1 AD—53796.1 AD—53797.1 AD—53798.1 99.1 AD—53800.1 AD—53801.1 AD—53802.1 AD—53803.1 AD—53804.1 AD—53805.1 AD—53806.1 AD—53807.1 AD—53808.1 09.1 AD—53810.1 AD—53811.1 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53812.1 0.22 13.1 AD—53814.1 AD—53815.1 AD—53816.1 17.1 18.1 AD—53819.1 .1 AD—53821.1 AD—53822.1 AD—53823.1 AD—53824.1 AD—53825.1 AD—53826.1 AD—53827.1 AD—53828.1 AD—53829.1 AD—53830.1 AD—53831.1 AD—53832.1 AD—53833.1 AD—53834.1 AD—53835.1 The modified and conjugated PCSK9 siRNA duplexes were also evaluated for efficacy by transfection assays in three human cell lines. PCSK9 siRNAs were transfected in three different cell lines, HeLa, Hep3B and HepG2 at two doses, lOnM and 0.1nM. The results of these assays are shown in Table 4 and the data are expressed as a fraction of the message remaining relative to l.
Figure 1 shows that there is a general reproducibility in the silencing activity of the PCSK9 duplexes between the free uptake assays and the transfection assays.
The IC50 values for selected duplexes by free-uptake in Cynomologous cells and by transfection in Hep3B cells are shown in Table 5.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Table 4 PCSK9 efficac screen b transfection in human cell lines DUPLEX ID Hela,10nM Hela, 0.1nM Hep3b,10nM Hep3b, O.lnM HepGZ,10nM HepGZ, 0.1nM AD—48399 AD—48399 AD—53652.1 AD—53653. 1 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53676.1 0.81 0.94 0.90 1.14 0.98 1.06 .0 oo O . O .0 o .0 oo o . o AD—53680.1 0.36 0 99 0 55 AD—53681.1 0.33 0.93 0.57 . .
O . U) |_| . U) o . U) l-‘ m .O N "‘ . on .0 .p l“ w AD—53688 1. 0.45 .
AD—53689.1 0.56 .0 u: AD—53690.1 0 45 0 79 0 53 AD—53691.1 0.82 1.03 0.91 .
O u: .0 N |—| U'I l“ ._. O L» .O N |_| U) |_| |_| . 0.57 l-‘ ._. o oo ._. U1 .0 U'I 0 .p .0 \l |_| . W “_18.
O .p 0 U1 .O w ._. oo .0 N l“ m o I—l O . U1 . . . o o oo .O 00 .0 L» O .p . 0 . U1 0 00 AD—53710 1. 0.66 AD—53711.1 0.40 O U) [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53712.1 0.47 0.99 0.51 0.94 0.62 0.97 .0 U) o . no H H .O nn .5 0 . 00 AD—53716.1 0.39 1 00 0 52 AD—53717.1 0.20 0.84 0.33 . .0 U1 0 . \l o no H . H o on . h O \l l“ m AD—53723 1. 0.28 . 24.1 0.18 .0 m ._. nn AD—53725.1 0 47 1 00 0 63 AD—53726.1 0. 19 1.01 0.42 .
H 00 .0 oo |—| nn 0 . H H H ._. nn .O no . 0.26 .0 nn l“ \l 0 . 0'1 .0 on .0 oo H U) l-‘ no 0 m 1.1 .p 0 no H \l .0 oo |—| no .0 I—l I—l U'I 0 . N H 00 . .
.O m .0 \l AD—53745 1. 0.46 AD—53746.1 0.13 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53747.1 0.29 1.08 0.54 0.77 0.50 1.07 .0 ._. o . o O |—| .0 w .0 ._. O . I—\ AD—53751.1 0.25 0 69 0 37 AD—53752.1 0.11 0.43 0.13 .
O . U) ._| U) 0 . N .0 m o no .0 I—l AD—53759 1. 0.61 .
AD—53760.1 0.05 .O N AD—53761.1 0 95 0 99 0 76 62.1 0.58 1.18 0.74 .0. I—l .0. U'I O O \l \l O CO 0....O U) . 0.30 0 w .0 ._. O L» O...O. 00 .0 N ._| 0'1 O |_| . U1 0 |—| .0 U1 “as 0 . U1 0 .p .0 u: . 0 O .p .0 U1 .O w 0 . \l .0 oo AD—53782 1. 0.56 AD—53783.1 0.16 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53784.1 0.15 0.71 0.27 0.72 0.25 0.80 .0 ._. o . no 0 oo .0 .p AD—53788.1 0.36 0 83 0 46 AD—53789.1 0.09 0.43 0.18 . o . ._. .0 ._. .0 m o oo O . \l .O N AD—53795 1. 0.08 .
AD—53796.1 0.07 .
AD—53797.1 0 10 0 43 0 16 AD—53798.1 0.04 0.31 0.09 . 0 U1 .0 \l 0 U1 .0 U1 0 . O .0 .p .0 U1 O N . 0.07 .0 ._. O . .p .O u: .0 \l .0 \l _0 U) .0 L» O L» .O O .0 o o on 0.2 .O N O N .0 ._.
O \l .o U) 0 \l o m .0 \l O . U) O N O N AD—53817 1. 0.26 AD—53818.1 0.12 0 U1 O I—\ ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53819.1 0.09 AD 53820 1— . 0.20 AD—53823.1 0.21 AD—53824.1 0.16 AD—53825 1. 0.05 AD—53826 1. 0.04 AD—53827 1. 0.40 AD—53830 1. 0.07 31.1 0.09 AD—53832.1 0 08 AD—53833.1 1 .04 . 0 AD 53835 1. 0.11 0.67 Table 5. PCSK9 IC50 values for selected duplexes by free uptake in Cynomologous monkey cells and b transfection in the He-3B human cell line. . 0.07 . 0.06 . 0.05 AD—53809 1. 0.05 AD 53821 1. 0.05 . 0.25 . 0.30 . 0.04 . 0.37 0.23 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD-48400 was also assayed for in viva efficacy in female mice carrying a human PCSK9 transgene ly inserted into the genome without disruption of the endogenous PCSK9 gene.
Brie?y, mice were injected subcutaneously with a single 20 mg/kg dose at Day 0, a single 100 mg/kg dose at Day 0, and five 20 mg/kg doses at Days 0, l, 2, 3, 4, and 5. Serum was collected at Days -6, -3, 0, l, 2, 3, 4, and 7 and the amount of PCSK9 protein was determined by ELISA assay. The results of these analyses are depicted in Figure 2 and show that there is a dose response effect with AD-48400 conjugated to GalNAc at all three dosages tested.
The six most efficacious duplexes ideintified by the in vitro screens described above, were ted for in viva efficacy and duration of response. Transgenic PCSK9 mice were ed at Days 0, l, 2, 3, and 4 with either 5 mg/kg or 25 mg/kg of AD-48400, AD-53830, AD— 53806, AD—53815, AD—53748, or AD-53798. Serum PCSK9 protein levels were ined by ELISA on Days -3, 0, l, 2, 3, 4, 8, ll. 15. 18, 22, 26, 31, and 36. The results are depicted in Figures 3A and 3B.
Example 3. Lead Optimization.
Based on the efficacy assays described in Example 2 above, PCSK9 siRNAs based on the parent sequences of 15 and AD-53806 with a y of chemical modifications were evaluated for efficacy in free uptake assays in primary Cynomolgous monkey hepatocytes (PCH) at 200nM, 20nM, 2nM, and 0.2nM. For all doses other than 0.2nM dose, assays were performed twice and data are expressed as the average fraction message remaining relative to control. The 0.2nM dose was assayed a single time. The results of these assays are shown in Table 6.
Table 6. Efficacy screens for lead optimization of AD-53815 and AD-53806 by free uptake in Cynomolgous monke he-atoc tes. t Duplex ID ZOOnM Avg 20nM Avg 2nM Avg 0.2nM—384 ZOOnM SD 20nM SD 2nM SD duplex 4053815 40538155 0.45 0.48 0.74 0.95 0.05 m 0.05 4053815 40538154 0.43 0.54 0.84 0.83 mm 0.10 AD—53815 AD—56633.1 0.33 0.52 0.82 0.88 0.04 0.01 0.10 AD—53815 AD—56617.1 0.40 0.65 0.91 1.06 0.03 0.02 0.03 0.52 0.61 0.87 1.05 0.03 m 0.21 0.50 0.62 0.87 1.05 m 0.13 0.17 0.45 0.71 0.92 1.03 0.03 0.02 0.03 0.47 0.70 0.04 0.04 mm 0.07 --m0.55 0.82 1.12 0.01 0.16 0.16 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53815 AD—56631.1 0.48 AD—53815 AD—56637.1 0.48 AD—53815 AD—56643.1 0.59 AD—53815 AD—56649.1 0.76 AD—53815 AD—56655.1 0.73 AD—53815 AD—56615.1 0.58 0.71 0.58 0.52 0.32 0.71 0.31 0.47 AD—53815 22.1 AD—53815 AD—56628.1 0.75 0.58 0.77 0.61 0.93 0.38 0.47 0.41 0.43 0.48 0.43 0.54 0.55 0.42 0.41 0.59 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car ed set by car AD—53815 AD—56632.1 0.60 AD—53815 AD—56638.1 0.68 AD—56644.1 0.84 AD—53815 AD—56650.1 0.86 AD—53815 AD—56656.1 0.53 AD—53815 AD—56662.1 0.55 0.76 0.81 0.84 0.88 0.80 0.45 0.35 AD—53815 AD—56669.1 AD—53815 AD—56674.1 0.44 0.52 0.43 0.55 0.45 0.35 0.62 0.74 0.39 0.41 0.57 0.58 0.38 0.51 0.32 0.45 0.31 0.55 0.54 0.75 0.50 0.74 m0.56 0.37 0.70 0.36 0.73 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53815 AD—56666.1 0.39 0.47 0.74 0.94 0.02 0.05 0.13 AD—56672.1 0.63 AD—53815 AD—56677.1 0.54 AD—53815 AD—56682.1 0.48 AD—53815 AD—56687.1 0.81 AD—56692.1 AD—53806 AD—53806.6 . 0.51 AD—53806 AD—53806.7 AD—53806 0.36 0.55 AD—53806 0.29 m 06 0.43 0.50 AD—53806 0.32 0.47 .
AD—53806 0.27 .57 0.72 AD—53806 0.55 0.67 0.81 AD—53806 0.34 0.54 0.71 AD—53806 0.38 0.53 0.74 AD—53806 0.50 0.62 0.82 AD—53806-m 0.72 0.89 AD—53806 0.74 0.89 1.14 AD—53806 0.91 1.05 1.02 06-m 0.57 0.83 AD—53806 0.33 0.51 0.83 AD—53806 0.27 0.58 .
AD—53806 0.41 m 0.81 AD—53806 0.37 0.47 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car AD—53806 AD—56980.1 0.47 0.54 AD—53806 AD—56980.2 m 0.55 AD—53806 AD—56984.1 0.41 0.63 AD—53806 AD—56984.2 0.32 0.58 AD—53806 AD—56987.1 0.37 0.63 AD—53806 AD—56987.2 0.33 0.59 0.57 0.54 AD—53806 AD—56988.1 AD—53806 AD—56988.2 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 0.63 AD—53806 0.89 06 0.42 AD—53806 0.59 AD—53806-m 0.54 AD—53806 0.68 AD—53806 0.78 AD—53806 0.74 AD—53806-m 0.48 AD—53806 0.47 AD—53806 0.56 AD—53806-m 0.58 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car AD—53806 AD—57008.1 0.68 0.75 0.91 1.13 0.02 0.03 0.15 AD—53806 AD—57014.1 0.80 AD—53806 AD—57020.1 0.51 AD—53806 AD—57020.2 0.37 AD—53806 AD—57026.1 0.34 AD—53806 AD—57003.1 0.76 06 AD—57016.1 AD—53806 99.2 AD—53806 06 .
AD—53806 0.41 m AD—53806 0.45 AD—53806 0.53 .
AD—53806 0.48 “ AD—53806 0.50 “ AD—53806 0.54 m AD—53806 0.70 AD—53806 0.48 AD—53806 0.45 . 40m 0.76 AD—53806 0.53 AD—53806 0.67 siRNAs With a variety of chemical modifications based on the parent sequences of AD- 53815 and AD-53806 were also screened for in vitro efficacy by ection in Hep3B cells at lOnM and 0.1nM. The results of this structure-activity relationship screen are shown in Table 7, and are expressed as the average fraction message remaining relative to control +/— SD.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Table 7. Efficacy screens for lead optimization of AD-53815 and AD-53806 by transfection in a human cells.
Parent duplex Duplex ID Trans 10nM Avg Trans 10nM SD Trans 0.1nM Avg Trans 0.1nM SD AD—53815 AD—53815.5 0.14 0.05 0.24 AD—53815 AD—53815.4 0.18 0.07 0.38 AD—53815 AD—56633.1 0.18 0.10 AD—53815 AD—56617.1 0.13 0.06 AD—53815 AD—56643.1 0.18 AD—56649.1 0.16 AD—53815 0.24 AD—53815 0.15 AD—53815 0.20 AD—53815 0.17 0.19 AD—53815 0.19 AD—53815 0.29 AD—53815 0.21 0.16 AD—53815 0.18 AD—53815 0.28 AD—53815 0.16 0.21 AD—53815 0.27 AD—53815 0.26 AD—53815 0.35 AD—53815 0.17 AD—53815 0.17 AD—53815 0.17 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car ation] car Unmarked set by car AD—53815 AD—56618.1 0.14 0.00 0.26 ND AD—53815 AD—56624.1 AD—53815 AD—56630.1 AD—53815 AD—56636.1 AD—53815 AD—56642.1 AD—53815 AD—56648.1 AD—53815 AD—56638.1 AD—53815 AD—56644.1 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car 85.1 0.14 0.02 0.28 ND AD—53815 AD—56690.1 AD—53815 AD—56694.1 AD—53815 AD—56659.1 AD—53815 AD—56665.1 AD—53815 71.1 AD—53815 AD—56672.1 AD—53815 AD—56677.1 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53815 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53806 75.1 0.24 0.09 0.32 0.12 AD—53806 AD—56975.2 AD—53806 AD—56983.1 AD—53806 AD—56983.2 AD—53806 AD—56983.3 AD—53806 AD—56983.4 AD—53806 AD—56980.2 AD—53806 AD—56984.1 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car AD—53806 92.2 0.22 0.10 0.30 0.14 AD—53806 AD—56994.1 06 AD—56994.2 AD—53806 AD—56996.1 AD—53806 AD—57001.1 AD—53806 AD—57007.1 AD—53806 AD—57014.1 AD—53806 AD—57020.1 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 AD—53806 [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car AD—53806 AD—57000.1 0.25 0.14 0.38 0.33 06 AD—57006.2 AD—53806 AD—57006.3 AD—53806 AD—57006.1 06 AD—57012.1 AD—53806 AD—57018.1 To determine whether any of the siRNAs from the in vitro SAR screen are more effective at silencing PCSK9 than the parent siRNA (AD-53815) PCSK9 transgenic mice were administered a single 3 mg/kg dose of the siRNAs shown in Figure 4, and 72 hours post-dosing, PCSK9 n levels were determined by ELISA assay. The results, shown in Figure 5, demonstrate that AD-57928 is surpringly effective at silencing PCSK9. Figure 6 shows that, not only does a single dose of AD-57928 effectively knock-down PCSK9 protein, but there is also a dose response using AD-57928.
Example 4. Split Dosing Study Using AD-57928 The ability of 28 to ss expression of PCSK9 protein was assessed by ing levels of human PCSK9 (hPCSK9) protein in serum of hPCSK9 transgenic mice following administration of AD-57928. AD-57928 was administered subcutaneously using six different dosing schedules that included a “loading phase” during the first week (one dose of 0.5 mg/kg, 1 mg/kg or 2 mg/kg daily for 5 subsequent days), followed by a “maintenance phase” (once or twice weekly dosing of either 0.5 mg/kg, 1 mg/kg or 2 mg/kg for 5 weeks), as is described in Table 8 below. The last dose was administered at day 38. Each dosing schedule was tested using a group of 3 mice that included two males and one female. A control group received injections with PBS.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Table 8. Dosin; Schedules for administration of AD-57928 AD-57928 AD-57928 AD-57928 AD-57928 Serum was collected 3 days prior to administration of the first dose and on days 1, 4, 7, , 14, 17, 21, 24, 28, 31, 35, 38, 42, 45, 52, 59 and 65 after the first dose. PCSK9 n levels in serum were assessed by ELISA assay. The results are shown in Figures 6, 7 and 8.
Reduced of hPCSK9 serum protein levels were observed 72 hours following the first dose, and were sustained through day 38. Administration of AD-57928 at the loading doses of 5X2 mg/kg, 5X1 mg/kg and 5X05 mg/kg resulted in ~90%, ~70% and ~60% reduction of hPCSK9 serum protein levels, respectively (see Figures 6-8). In the group dosed using the 2X maintenance dosing schedule, the reduced levels of hPCSK9 were sustained for 1 week longer than in the group dosed using the 1X maintenance dosing schedule, and returned to baseline 4 weeks after the last dose (see Figures 6-8). e 5. Phosphorothioate Titration In order to ine the effect of the number and position of phosphorothioate modifications on the ability of dsRNA to inhibit the sion of PCSK9, a number of siRNAs based on the parent sequences of AD-57928, AD-53806 and AD-53 830 as shown in Table 9 were prepared and tested. To determine whether any of the siRNAs are more effective at ing PCSK9 than AD-57928, PCSK9 transgenic mice were administered a single 0.3 mg/kg dose of the siRNA in Table 9, and 72 hours post-dosing, PCSK9 protein levels were determined by ELISA assay. The results, shown in Figure 9, demonstrate that AD-57928 is surpringly ive at silencing PCSK9. AD-58893, AD-58894, AD—58896, AD—58897, AD—58898 and AD-58899 were also able to silence PCSK9 as compared to the control.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Table 9. siRNAs used in nhos nhorothiate titration ex - t Sense ce Antisense Sequence Chemistry TOFFEE with 6 ngchqufoUqufnguUqung asCfsaAfaAfngaAfaacAngfquuAfgs PS, and 30Me on fL96 3S3 3'end of AS CfsuAngchqufoUqufnguUfuUngf asCfaAfaAfngaAfaacAngfquuAfgas TOFFEE with 3 L96 3 outer PS CfusAngchqufoUqufnguUfuUngf aCfsaAfaAfngaAfaacAngfquuAfgsa TOFFEE with 3 L96 3 inner PS CqungchfuGfoUqufnguUqungfL asCfsaAfaAfngaAfaacAngfquuAfgs TOFFEE with just 96 3S3 4 antisense PS CfsusAngchqufUfouUfnguUqung TOFFEE with just aCfaAfaAfngaAfaacAngfquuAfgaa fL96 2 sense PS CfsusAfsgAchqufoUqufnguUqufg asCfsasAfaAfngaAfaacAngfquuAfsg TOFFEE with 9 PS UfL96 sasa CfsusAfsgAchqufoUqufnguUqufg asCfsaAfaAfngsaAfaacAfngfquuAfs TOFFEE with UfL96 gsasa 10PS CfsusAfsgAchqufoUqufnguUqufsg asCfsaAfaAfngsaAfaacAfngfquuAfs TOFFEE with UfL96 gsasa 11PS CfsasAfngaGfaCfAfouUfanchuUqu asAfsaAfaGfanaAfa ugUchfnguUfgs 6PS version of fL96 csu AD—53806 UfsusUfquuAngfoCqufuUqufnguU asAfsngaAfaAchfggquuAngfaAfas 6PS version of fL96 gsu AD—53830 Example 6. Liver Drug Levels of AD-57928 and AD-58895 The goal of this study was to quantify siRNA levels in the liver of Wild-type mice in order to define appropriate conditions for drug level screening. The siRNAs used in the experiment were AD-57928 and 95 (that ed no decrease in PCSK9 protein level in Example 5). AD-58895 was used as a comparator to define timepoints at Which a ence in drug level re?ective of efficacy is observable.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car A total of 33 C57B6 female mice were used in the experiment (3 mice per group). These mice were administered a single subcutaneous dose of either AD-57928, AD-5 8895 or PBS as a control. Livers were collected at 4, 24, 48, 72, 96 and 168 hours post-dose. Duplicate tissue aliquots per sample were collected, and the concentration of siRNA in the liver was measured using a newly designed antisense sequence specific qRT-PCR assay. The measured amount of 28 and AD-58895 per gram of liver over time is shown in Figure 10, and the amount of AD-57928 and AD-58895 expressed as a percentage of total theretical dose is shown in Figure 11. The limit of detection (LOD) of the qRT-PCR assay was ~1 ng/ g of liver, and the assay showed good mance and accurate ates reproducibility. The results indicate that AD- 57928 is more stable in the liver and AD-58895 is less stable, and both can be detected across all timepoints. At 7 days post dose, the level of AD-57928 is >100 fold above the LOD of the qRT- PCR assay, and the level of 95 is >10 fold above LOD. The concentrations of AD- 57928 and AD-5 8895 differ on average >10 fold according to their ted stability and the ed efficacy. The timepoint between 72 and 120 hours post dose may be appropriate for siRNA tration based screens.
Example 7. Optimization of AD-57928 In order to enhance the in vivo activity and stability of AD-57928, additional iRNA agents based on the parent sequences of AD-57928 were ed and tested (Table 10; the " sequences in Table 10 are disclosed as SEQ ID NOS: 1653-1658, respectively, in order of appearance, and the "Antisense" sequences are disclosed as SEQ ID NOS: 1659-1664, respectively, in order of ance; the same sense and antisense ces disclosed in Table are also disclosed in Figure 12A).
The unmodified sense and antisense sequences for AD-60212 are: Sense — 5’— CUAGACCUGUTUUGCUUUUGU — 3’ (A—122088.3; SEQ ID NO:1665); and Antisense — 5’— ACAAAAGCAAAACAGGUCUAGAA — 3’(A—120190.19; SEQ ID NO: 1666).
In general, these compounds ned fewer 2’-fluro modifications and ?uoro-modified uridines were removed. The in vitro potency of these duplexes was tested by transfection of HeLa and Hep3b cells. As shown in Figure 12B, AD-59849, 28, and AD-60212 have IC50 values comparable to the parent (AD-57928).
The ability of these duplexes to persist in vivo in the liver was also determined by administering 1 mg/kg of each duplex to wild-type mice and determining the siRNA level by quantitative PCR. As depicted in Figure 13, all of the duplexes show greater tence in the liver than the parent duplex starting at the post-120 hours administration timepoint.
The ability of these duplexes to suppress expression of PCSK9 protein was also assessed in vivo by measuring levels of PCSK9 protein, LDL, HDL, total cholesterol (Tc), triglycerides ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car (Tgs), alanine minase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) in the serum of non-human primates (NHP). The presence of injection site reation was also monitored. The duplexes were administered using a dosing schedule that included a ng phase” during the first week (one dose of 2 mg/kg daily for 5 subsequent days, qu5), followed by a “maintenance phase” (three weekly doses of 2 mg/kg for 3 weeks, qwx3), as is described in Table 11 below.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car c< anmEEGaw??m?ib?iwi?os amamw??so:?uw??om?a??omw?a?w?0mm amamw??so:?uw??om?a??omw?a?w?0mm 03w?<£<?<?o???<§0% amamaa03w?<£<?<?o???<§0% swamw~<=£0:?uw??om?‘??ow?<?<w?omw 853% mmv: NONON T< H .383 omqswssssowssr?w?w?oowmwm <73: o35$:stao?beaewaoozmzméo o045%sassowwDEBBUEUow<mw<m5£0 omqswssssowsss?w?oowmwm ooqsmsssamsss?w?oowmwm 30 30 A?Dmw?Ds?Ds?o?DEaaUEUow<mw<m5$0 3853a mg: Sum H NH -< -< .2 9mm 2%? mm-Q< EEEEEEEa [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car ation] car Unmarked set by car Table 11. Dosin; Schedules Test Cumulative dose Dose Frequency Article - (mg/kg) AD-57928 qu5+qwx3, 8 doses qu5+qwx3, 8 doses qu5+qwx3, 8 doses 3 females qu5+qwx3, 8 doses qu5+qwx3, 8 doses I x3, 8 doses Blood: Days -9, -6, -3, 4, 7, 10, 14, 17, 21, 24, 28, 31, 35, 42, 49, 56, 63 (first dose, Day 1) Injection site observation: Yes Readouts: PCSK9 protein, LDL, HDL, Tc, Trigs, ALT, AST, ALP As shown in Figures 14A and 14B, all compounds except for 88 achieve greater than 80% PCSK9 silencing and individual animals in the 12 group achieve greater than 90% PCSK9 silencing. Figure 15 demonstrates that, in the absence of statins, all compounds except for AD-60688 achieve 60% LDL cholesterol lowering and individual animals in the AD- 59223 group achieve up to 77% LDL cholesterol ng. Surprisingly, and as depicted in Figure 18, the indicated agents maintained cholesterol lowering 46 days following the last dose of the ted agents. Even more singly, and as depicted in Figure 19, AD-60212 and AD-59849 maintain up to 60% LDL cholesterol lowering to at least day 120 (93 days after the final dose), longer than any effect ed for an RNAi agent in viva, indicating that, following a loading phase, these compounds may be administered at a frequency of once a month, once every two months, once every three months, once every four months, once every five months, or once every six months during the maintenance phase.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Example 8. Preparation of Additional ADBased PCSK9 Sequences Additional iRNA agents based on the parent sequences of 28 were ed (see Table 12, below) and tested in vitro for potency by transfecting HeLa and Hep3B cells with these agents. The IC50 values for these agents are shown in Table 13.
[Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car .Omm HOZ mowa wowa howa wowa mowa oawa aawa Nawa mawa wawa mawa wawa hawa mama mama ONwa ana NNwa pm 3:85 8:835. Sam:59633mmu_<mbmu_<£<mmcmm SEE/EC363$m£<mb?<£<mmbm= 3:8253033mmu_<mb?<mu_<mmbmm 59633mmu_<mbmu_<£<mmcmm 3:85£3033mmu_<mb?<mu_<mmbmm Emma:mt963$mmu_<mbmu_<£<mmcmm ESE:£09633m£<mb?<£<mmbmm NEEEmmu_<mbmu_<£<mmcmm mmmmmzeemb??m£<mb?<£<mmbmm Sam:59633mmu_<mbmu_<£<mmcmm SEE/ECso??m£<E><ru?<£<mmbmm ESE/Euso??mm2>$mb?<£<mmbmm SEE/ECso??mE>§<mb?<£<mmbmm SEE/EC363:L><vmu_<mb?<mu_<mmcmm WEE:E£2{Grim£<E><ru?<£<mmbmm mmmm Sam:59633mmu_<mbmu_<£<mmcmm Sam:59633mmu_<mbmu_<£<mmcmm SEE/ECso??m£<E><ru?<£<mmbmm wmcw?ucd. a.mN¢haa-< N.NONNNa-< N.¢ONNNa-< NwONNNaé‘ N.wONNNa-< NdOhNNaé‘ N.aahNNa-< N.mahNNa-< N.mahNNa-< a.mN¢haa-< a.momNNa-< a.oamNNa-< a.aamNNa-< a.NamNNa-< a.mamNNa-< aa-< a.mN¢haa-< Na-< .Omm HOZ puma whma mhma owma awma Nwma mwma wwma mwma wwma hwma wwma mwma omma amma Nmma mmma wmma mooaosvom @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @2295a:POMS32203823335 :POMS9.296553356 @253:a:POMS32203823330 @253:a:some:asuéoacgmusm?o @253:a:some:asuéoacgmusm?o :5MB35563825386 @9533355333220553535 @2595a:POMS95596533235 @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb :5MB=U_P_P_o=u_u£<mu_<m=mb 25525::EDSEEUEQEEESV2535 8525:3255 25525::£220:szEEESEEELQ 8525:3255 25525::EDSEEUEQEEESV2535 mvam wmcwm ucmhum a.wN¢haa-< N.aonmma-< N.monmma-< N.monmma-< m.hOhNNa-< ¢.honmma-< N.oahNNa-< N.NahNNa-< Néahmmaé‘ a.wN¢haa-< aa-< a.wN¢haa-< a.wN¢haa-< a.wN¢haa-< a.wN¢haa-< a.homNNa-< a.womNNa-< a.homNNa-< .3 o. oEmF .833 -Q< miwmmhm a.wNmow-n_< a.mNmow-n_< w-n_< a.ammow-n_< a.Nmmow-n_< a.mmmow-n_< a.¢mmow-n_< aNNmowé< -n_< miwmmhm a.womow-n_< a?omowéd‘ a.womow-n_< a.momow-n_< a.oamow-n_< a.aamow-n_< a.Namow-n_< a.mamow-n_< ation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car meH «NEH meH wNwH 5N9“ wNwH meH omw? Hmw? wa? ESE/Euso??mm2>$mb?<£<mmbmm so??mE>§<mb?<£<mmbmm 633mmu_<mbmu_<£<mmcmm SEE/EC363:L><vmu_<mb?<mu_<mmcmm WEE:E£2{Grim£<E><ru?<£<mmbmm mmmm SEE/ECso??m£<E><ru?<£<mmbmm ESE/Euso??mm2>$mb?<£<mmbmm SEE/ECso??mE>§<mb?<£<mmbmm SEE/EC363:L><vmu_<mb?<mu_<mmcmm WEE:E£2{Grim£<E><ru?<£<mmbmm mmmm H.0HmNNH-< NH-< ?mmwh??é‘ H.NHmNNH-< H.mHmNNH-< H.momNNH-< H.0HmNNH-< H.HHmNNH-< H.NHmNNH-< H.mHmNNH-< mmm? wmm? hmm? wmm? mmm? 003“ H03“ NOE“ meg“ #03“ 8525:3255 25525::EDSEEUEQEEESV2535 8525:3255 25525::EDSEEUEQEEESV2535 8525:3255 @253:a:5MB=U_P_P_o=u_u£<mu_<m=mb 25525::EDSEEUEQEEESV2535 8525:3255 25525::EDSEEUEQEEESV2535 8525:3255 25525::£220:szEEESEEELQ 8525:3255 :£220:szEEESEEELQ 8525:3255 25525::£220:szEEESEEELQ 8525:3255 25525::£220:szEEESEEELQ 8525:3255 25525::£220:szEEESEEELQ 8525:3255 H?ommm?é‘ H?ommm?é‘ ?wmwh??é‘ ?é‘ H?ommm?é‘ H.womNNH-< H.womNNH-< H.womNNH-< H.womNNH-< H.womNNH-< Hé?mowéd‘ H.m?mow-o< -Q< miwmmhm H.w?mow-o< é< H.w?mow-o< H.m?mow-o< H.0Nmow-o< H.HNmow-o< H.NNmow-o< [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Table 13. IC50 values for the iRNA aents identified in Table 12.
Duplex ID Hela |C50(nM) Hep3b |C50(nM) AD-57928.47 0.0026 0.0005 28.1 0.0000 0.0009 AD-60929.1 0.0010 0.0027 AD-60930.1 0.0055 0.0019 AD-60931.1 0.0028 0.0019 AD-60932.1 0.0039 0.0036 33.1 0.0349 0.1518 AD-60934.1 0.2115 0.5420 AD-60927.1 >10 AD-57928.45 <3.57225e-005 AD-60906.1 0.0048 AD-60907.1 0.0001 <3.57225e-005 AD-60908.1 0.0003 0.0072 AD-60909.1 AD-60910.1 11.1 AD-60912.1 AD-60913.1 AD-60914.1 AD-60915.1 AD-57928.45 AD-60916.1 AD-60917.1 AD-60918.1 AD-60919.1 AD-60920.1 AD-60921.1 AD-60922.1 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car Example 9. Repeat-Dose Ef?cacy of AD-57928 The repeat-dose efficacy of 28 in suppressing expression of PCSK9 protein was ed in vivo by measuring the levels of PCSK9 protein, LDL, HDL, total cholesterol (Tc), triglycerides (Tgs), alanine transaminase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) in the serum of non-human primates (NHP). The presence of injection site reation was also monitored. AD-57928 duplexes were subcutaneously administered using the dosing schedules described in Table 14 below. Group 5 animals were re-dosed with a single 25 mg/kg dose on day 92. One additional group of animals was administered a single dose of 25 mg/kg. “2xw” is two times per week; “q2w” is once every two weeks; and “qlw” is once per week.
Table 14. Dosing Schedules \\\\\\\\\\\\\\\\\\\\\\/\\\\\\ §§\\\§\\\\\\Q\\\\\ \\\\\\/ ’i “i 12 ZXW 12 dose-S 2 2 2xw, 12 doses 24 3 ’i q2w, 6 doses 6 Ari—57923 4 2 12 , q2w, 6 doses femaies 5 5.5 q‘iw, 6 doses 3 6 i qiw, 10 doses 10 "F 2 qiw, 10 doses 20 Biood : Days —9, -6, -3, i ieeds) 3-129 (efficacy bieeds) injection site observation: Yes Readouts: PCSK9 protein, LDL, HDL, To. Trigs.ALT,AST, ALP As depicted in Figure 16A, the most effective regimen for lowering LDL was a twice weekly n (2xw) which ed about a 60% reduction in LDL . The same cumulative dose administered less frequently was less efficacious than the twice a week regimen.
Figure 16B demonstrates that the 2xw regimen achieved greater than 80% PCSK9 silencing.
Figures 17A and 17B demonstrate that a single 25 mg/kg dose of 28 has the same onset of LDL and PCSK9 lowering, the same nadir of PCSK9 and LDL lowering, and equivalent rate of LDL lowering as a lower multiple-dose of 2 mg/kg 28 administered two times per week (2xw). These graphs also demonstrate that there is a trend towards faster PCSK9 lowering with the single 25 mg/kg dose and that recovery of both PCSK9 levels and LDL levels starts [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car about 20 days after nadir is reached (day 7) for the 25 mg/kg single dose. The nadir for the 25 mg/kg single dose is at Day 7.
Example 10. bility of Optimized AD-57928 iRNA Agents The additional iRNA agents prepared based on the parent ces of AD-57928 described in Figure 12A (and Table 10) were assessed for tolerability in rats. Male rats were subcutaneously administered 225 mg/kg of the indicated iRNA agents on days 1, 8, and 15, and sacrificed and necropsied on day 16 (see Table 15). The s were observed for any clinical symptoms on a daily basis and the body weights of the anmals were determined pre-study and weekly during the study. On day 16, blood from the s was assessed hematologically, for coagulation and for serum chemistry; the drug metabolism and pharmacokinetics of the agents were determined using liver samples from the animals; and the heart, lungs (insuf?ated), kidneys, liver, spleen, testes, and first and last injection sites were analyzed for any changes.
There were no changes in al signs, visual injection site observations, serum try, coagulation or microscopic pathology of the liver, spleen lung, heart, or testes. Table 16 provides a summary of the liver weights, the final body weights, the results of the hematological analyses and the pathology severity scores for the final injection sites and kidneys for each agent tested.
Table 15. Dosin; Schedules Dosing Schedule AD-57928 (parent) SC on Days 1, 8, and 15 3 AD-59849 -AD-59223 [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car ation] car MigrationNone set by car [Annotation] car Unmarked set by car AD-60688 225 3 IAD-60212 225 3 Table 16. Tolerability Summary AD-57928 AD-59849 AD-59223 AD-59228 AD-60688 AD 60212 farent 11391160 H 19991424 16241147 1258+286 O‘\1 3.1% 6.8% II Day 16 No Change No Change No Change Hematology [Annotation] car None set by car [Annotation] car MigrationNone set by car [Annotation] car Unmarked set by car [Annotation] car None set by car [Annotation] car ionNone set by car [Annotation] car Unmarked set by car Day 16Final 3/3117) 3/3113: 2/3115: 3/3123: 2/3110) : lnj. Site In?ammation M M m m m m m Basophilic Granules Pathology Severity Scores: 1 2 minimal; 2 = slight; 3 2 moderate BW 2 Body Weight WBC 2 White Blood Cell LYM = Lymphocytes

Claims (46)

CLAIMS 1.:
1. A double stranded RNAi agent that inhibits the expression of Proprotein convertase subtilisin kexin 9 (PCSK9) in a cell, wherein said double stranded RNAi agent comprises a sense strand complementary to an nse strand forming a double stranded 5 region, wherein said antisense strand ses a region complementary to part of an mRNA encoding PCSK9, wherein each strand is independently 19 to 30 nucleotides in , wherein said antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence 5’ – ACAAAAGCAAAACAGGUCUAG – 3’ (SEQ ID NO: 412) and said double stranded RNAi agent is represented by formula (III): 10 sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' '-(X 'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z 'Z'Z')l-Na'- nq' 5' (III) wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q' are each ndently 0-6; 15 each Na and each Na' independently represents an oligonucleotide sequence comprising 0-25 nucleotides, 2-20 of which are modified nucleotides, each sequence comprising at least two differently modified tides, wherein the modified nucleotides are each independently ed from the group consisting of 2’-O-methyl, 2’-fluoro, and 2'- deoxythymidine (dT); 20 each Nb and each Nb' independently represents an oligonucleotide sequence comprising 0-10 nucleotides, 1-10 of which are modified nucleotides, wherein the modified nucleotides are each independently selected from the group consisting of 2’-O-methyl, 2’- fluoro, and 2'-deoxythymidine (dT); wherein the double stranded RNAi agent comprises at least one phophorothioate or 25 methylphosphonate internucleotide linkage; np, np', nq, and nq', each of which may or may not be present, independently represents an overhang nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three utive nucleotides, wherein the 30 cations on the nucleotides are ethyl or 2’-fluoro cations, and wherein XXX is complementary to X’X’X’, YYY is complementary to Y’Y’Y’, and ZZZ is complementary to Z’Z’Z’; and wherein the sense strand is conjugated to at least one ligand which is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
2. The double stranded RNAi agent of claim 1, wherein the modifications on the 5 XXX nucleotides are ent than the modifications on the X’X’X’ nucleotides, the modifications on the YYY nucleotides are different than the modifications on the Y’Y’Y’ nucleotides, and the modifications on the ZZZ nucleotides are different than the modifications on the Z’Z’Z’ nucleotides.
3. The double stranded RNAi agent of claim 1, wherein the double stranded 10 RNAi agent is ented by formula IIIa: sense: 5' np -Na -Y Y Y - Na - nq 3' antisense: 3' np'-Na'- Y'Y'Y'- Na'- nq' 5' (IIIa) wherein: np' >0 and at least one np' is linked to a neighboring nucleotide via a phosphorothioate 15 linkage; the modifications on YYY and Y'Y'Y' are 2'-O-methyl or 2'-fluoro modifications; wherein YYY is complementary to Y'Y'Y'; wherein the sense strand comprises at least one phosphorothioate linkage.
4. The double stranded RNAi agent of any one of claims 1-3, wherein the 20 modifications on the YYY nucleotides are different than the modifications on the Y’Y’Y’ tides.
5. The double ed RNAi agent of any one of claims 1-4, n the YYY motif occurs at or near the cleavage site of the sense strand.
6. The double stranded RNAi agent of claim 5, wherein the Y'Y'Y' motif occurs 25 at the 11, 12 and 13 positions of the antisense strand from the 5'-end.
7. The double stranded RNAi agent of any one of claims 1-6, n the Y nucleotides contain a 2’-O-methyl cation and the Y’ nucleotides contain a 2’-fluoro modification.
8. The double stranded RNAi agent of any one of claims 1-7, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified.
9. The double stranded RNAi agent of any one of claims 1-8, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified, 5 and wherein the modifications on the nucleotides are independently selected from the group consisting of 2’-O-methyl, 2’-fluoro, and 2’-deoxythymidine (dT).
10. The double stranded RNAi agent of any one of claims 1-9, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5’-terminus of the sense strand; the 5’-terminus of the antisense strand; or at both the 5’- terminus of the sense 10 strand and 5’-terminus of the antisense strand.
11. The double stranded RNAi agent of any one of claims 1-10, wherein the nse strand comprises two phosphorothioate internucleotide es between the 3’-end three terminal nucleotides and two phosphorothioate internucleotide linkages between the 5’ end three terminal nucleotides; and 15 wherein the sense strand ses two phosphorothioate internucleotide linkages between the 5’ end three terminal nucleotides.
12. The double stranded RNAi agent of any one of claims 1-11, wherein each strand is 19 to 23 nucleotides in length.
13. The double stranded RNAi agent of any one of claims 1-11, n each 20 strand is 19 to 25 nucleotides in length.
14. The double stranded RNAi agent of any one of claims 1-11, n each strand is 21 to 25 nucleotides in length.
15. The double ed RNAi agent of any one of claims 1-11, wherein the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides. 25
16. The double stranded RNAi agent of any one of claims 1-11, wherein the double-stranded region is 19-30 nucleotide pairs in length.
17. The double stranded RNAi agent of any one of claims 1-11, n the double-stranded region is 19-25 tide pairs in length.
18. The double stranded RNAi agent of any one of claims 1-11, herein the doublestranded region is 19-23 nucleotide pairs in length.
19. The double stranded RNAi agent of any one of claims 1-11, wherein the double-stranded region is 23-27 nucleotide pairs in length. 5
20. The double stranded RNAi agent of any one of claims 1-11, wherein the double-stranded region is 21-23 nucleotide pairs in length.
21. The double stranded RNAi agent of any one of claims 1-11, wherein the double-stranded region is 19-21 nucleotide pairs in length.
22. The double stranded RNAi agent of any one of claims 1-11, wherein the region 10 complementary to part of an mRNA ng PCSK9 comprises the nucleotide sequence of 5’- ACAAAAGCAAAACAGGUCUAGAA - 3’(SEQ ID NO:1666).
23. The double stranded RNAi agent of any one of claims 1-11, wherein the antisense strand comprises the nucleotide sequence 5’- ACAAAAGCAAAACAGGUCUAG - 3’ (SEQ ID NO: 412) and the sense strand comprises the nucleotide sequence 5’- 15 AGACCUGUUUUGCUUUUGU -3’ (SEQ ID NO: 191).
24. The double ed RNAi agent of any one of claims 1-11, wherein the sense strand comprises the nucleotide ce of 5’- CUAGACCUGUTUUGCUUUUGU – 3’ (SEQ ID NO:1665) and the antisense strand comprises the nucleotide sequence of 5’- ACAAAAGCAAAACAGGUCUAGAA - 3’(SEQ ID NO:1666). 20
25. The double stranded RNAi agent of claim 24, wherein the antisense strand consists of the nucleotide sequence 5’- ACAAAAGCAAAACAGGUCUAGAA - 3’(SEQ ID 6) and the sense strand consists of the nucleotide sequence 5’- CUAGACCUGUTUUGCUUUUGU -3’ (SEQ ID NO: 1665).
26. The double ed RNAi agent of claim 24, wherein the antisense strand 25 differs by no more than 4 bases from the tide sequence of 5’- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa - 3’ (SEQ ID NO:1663), and the sense strand differs by no more than 4 bases from the nucleotide ce of 5’- csusagacCfuGfudTuugcuuuugu - 3’ (SEQ ID NO:1657), wherein a, c, g, and u are 2'-O-methyl (2'-OMe) modified A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2'-fluoro modified A, C, G, and U, respectively; s is a phosphorothioate linkage; and dT is 2'-deoxythymidine.
27. The double stranded RNAi agent of claim 24, wherein the antisense strand 5 differs by no more than 3 bases from the nucleotide sequence of 5’- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa - 3’ (SEQ ID NO:1663), and the sense strand differs by no more than 3 bases from the nucleotide sequence of 5’- csusagacCfuGfudTuugcuuuugu - 3’ (SEQ ID NO:1657).
28. The double stranded RNAi agent of claim 24, wherein the antisense strand 10 differs by no more than 2 bases from the nucleotide sequence of 5’- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa - 3’ (SEQ ID NO:1663), and the sense strand differs by no more than 2 bases from the nucleotide sequence of 5’- csusagacCfuGfudTuugcuuuugu - 3’ (SEQ ID NO:1657).
29. The double stranded RNAi agent of claim 24, wherein the sense strand 15 comprises the nucleotide sequence of 5’- csusagacCfuGfudTuugcuuuugu – 3’ (SEQ ID NO:1657) and the antisense strand comprises the nucleotide sequence of 5’- AfAfAfgCfaAfaAfcAfgGfuCfuagsasa - 3’ (SEQ ID NO:1663), n a, c, g, and u are 2'-O-methyl (2'-OMe) modified A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2'- fluoro modified A, C, G, and U, respectively; dT is 2'-deoxythymidine; and s is a 20 phosphorothioate linkage.
30. The double stranded RNAi agent of claim 1, wherein each strand is independently 19 to 30 nucleotides in length, wherein the antisense strand comprises at least 19 contiguous tides of the nucleotide ce 5’ – ACAAAAGCAAAACAGGUCUAG - 3’ (SEQ ID NO: 412), 25 wherein the double stranded RNAi agent ses at least one modified nucleotide selected from the group ting of 2’-O-methyl, 2’-fluoro, and 2'-deoxythymidine (dT); n the antisense strand comprises two phosphorothioate internucleotide linkages between the 3’-end three terminal nucleotides and two orothioate internucleotide linkages between the 5’ end three terminal nucleotides; 30 wherein the sense strand comprises two phosphorothioate ucleotide es between the 5’ end three terminal nucleotides; and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
31. The double stranded RNAi agent of any one of claims 1-11, wherein the double stranded RNAi agent comprises: 5 (a) an antisense strand ting of the nucleotide sequence 5’- aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa -3’ (SEQ ID NO: 1151) and a sense strand consisting of the nucleotide ce 5’- CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf -3’ (SEQ ID NO: 600); (b) an antisense strand consisting of the nucleotide sequence 5’- 10 aCfaAfAfAfgCfaAfaacAfgGfuCfuAfgsAfsa -3’ (SEQ ID NO: 1246) and a sense strand consisting of the nucleotide sequence 5’- CfuAfgAfcCfuGfUfUfuUfgCfuuuUfgUf -3’ (SEQ ID NO: 695); (c) an antisense strand consisting of the nucleotide sequence 5’- aCfaaaAfgCfaAfaacAfgGfuCfuAfgsAfsa -3’ (SEQ ID NO: 1253) and a sense strand 15 consisting of the tide sequence 5’- CfuAfgAfcCfuGfUfUfuUfgCfuUfUfUfgUf -3’ (SEQ ID NO: 702); (d) an antisense strand consisting of the nucleotide sequence 5’- aCfaAfAfAfgCfaAfaacAfgGfuCfusAfsg -3’ (SEQ ID NO: 1263) and a sense strand consisting of the nucleotide sequence 5’- AfgAfcCfuGfUfUfuUfgCfuuuUfgUf -3’ (SEQ ID NO: 712); 20 (e) an antisense strand consisting of the tide sequence 5’- aCfaaaAfgCfaAfaacAfgGfuCfusAfsg -3’ (SEQ ID NO: 1269) and a sense strand consisting of the nucleotide ce 5’- AfgAfcCfuGfUfUfuUfgCfuUfUfUfgUf -3’ (SEQ ID NO: 718); (f) an antisense strand consisting of the nucleotide sequence 5’- asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa -3’ (SEQ ID NO: 1369) and a sense strand 25 ting of the nucleotide ce 5’- CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf -3’ (SEQ ID NO: 818); (g) an antisense strand consisting of the nucleotide sequence 5’- asCfsaAfaagCfaAfaacAfgGfucuAfgsasa -3’ (SEQ ID NO:1660) and a sense strand consisting of the nucleotide sequence 5’- CfsusAfgAfcCfuGfUfUfuUfgcuuuugu -3’ SEQ ID NO:1654); 30 or (h) an antisense strand consisting of the nucleotide sequence 5’- asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa -3’ (SEQ ID NO: 1400) and a sense strand consisting of the nucleotide sequence 5’- CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfs -3’ (SEQ ID NO: 849); 5 wherein a, g, c, and u are 2’-O-methyl (2’-OMe) modified A, G, C, and U nucleotides, respectively; Af, Gf, Cf, and Uf are 2’fluoro A, G, C, and U modified nucleotides, respectively; dT is a 2'-deoxythymidine nucleotide and s is a phosphorothioate e.
32. The double stranded RNAi agent of any one of claims 1-31, wherein the ligand HO OH O H H HO O N N O AcHN HO OH O H H HO O N N O AcHN O O O HO OH HO O N N O AcHN H H 10 O .
33. The double stranded RNAi agent of any one of claims 1-32, wherein the ligand is attached to the 3' end of the sense strand.
34. The double ed RNAi agent of claim 33, n the RNAi agent is conjugated to the ligand as shown in the following schematic wherein X is O or S.
35. A pharmaceutical composition sing the double ed RNAi agent of any one of claims 1-34, and at least one pharmaceutically acceptable ent.
36. An isolated cell containing the double stranded RNAi agent of any one of 5 claims 1-34.
37. Use of the double stranded RNAi agent of any one of claims 1-34 in the manufacture of a medicament for ting PCSK9 expression in a cell, wherein the medicament is ated such that: (a) after the cell is contacted with the double stranded RNAi agent; and 10 (b) after maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a PCSK9 gene, the expression of the PCSK9 gene in the cell is inhibited.
38. Use of the double stranded RNAi agent of any one of claims 1-34 in the cture of a medicament for treating a subject having a lipidemia mediated by PCSK9 15 expression.
39. The use of claim 38, wherein the medicament is formulated for a human.
40. The use of claim 39, wherein the medicament is formulated for a human that has hypercholesterolemia.
41. The use of claim 38, wherein the medicament is formulated to administer the 20 double stranded RNAi agent at a dose of: about 0.01 mg/kg to about 10 mg/kg; or about 0.5 mg/kg to about 50 mg/kg.
42. The use of claim 38, wherein the medicament is formulated to administer the double stranded RNAi agent in two or more doses.
43. The use of claim 42, wherein the medicament is formulated to administer the 25 double stranded RNAi agent in a dosing regimen that comprises a loading phase followed by a maintenance phase.
44. The use of claim 43, wherein the medicament is formulated such that the maintenance phase comprises administering the medicament to the subject once every three months.
45. The use of claim 43, wherein the medicament is ated such that the 5 maintenance phase comprises administering the medicament to the subject once every six months.
46. The use of claim 38, n the medicament is formulated for subcutaneous or intravenous administration.
NZ749002A 2012-12-05 2013-12-05 PCSK9 iRNA compositions and methods of use thereof NZ749002B2 (en)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US201261733518P 2012-12-05 2012-12-05
US61/733,518 2012-12-05
US201361793530P 2013-03-15 2013-03-15
US61/793,530 2013-03-15
US201361886916P 2013-10-04 2013-10-04
US61/886,916 2013-10-04
US201361892188P 2013-10-17 2013-10-17
US61/892,188 2013-10-17
NZ709013A NZ709013A (en) 2012-12-05 2013-12-05 Pcsk9 irna compositions and methods of use thereof

Publications (2)

Publication Number Publication Date
NZ749002A NZ749002A (en) 2020-10-30
NZ749002B2 true NZ749002B2 (en) 2021-02-02

Family

ID=

Similar Documents

Publication Publication Date Title
JP7239335B2 (en) PCSK9 iRNA compositions and methods of use thereof
CN107250362B (en) Apolipoprotein C3(APOC3) iRNA compositions and methods of use thereof
JP5894913B2 (en) DSRNA formulated with lipids targeting the PCSK9 gene
CN107287202B (en) Angiopoietin-like 3(ANGPTL3) iRNA compositions and methods of use thereof
US9051567B2 (en) Methods for increasing efficacy of lipid formulated siRNA
JP2017012176A (en) Compositions and methods for inhibition of pcsk9 genes
NZ749002B2 (en) PCSK9 iRNA compositions and methods of use thereof
EA037110B1 (en) PCSK9 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
NZ714530A (en) Serpina1 irna compositions and methods of use thereof
NZ714530B2 (en) SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
NZ714577B2 (en) Tmprss6 irna compositions and methods of use thereof
NZ714577A (en) Tmprss6 irna compositions and methods of use thereof