NZ745264B2 - Cancer therapy with an oncolytic virus combined with a checkpoint inhibitor - Google Patents

Abstract

The present invention concerns a pharmaceutical composition where a checkpoint inhibitor is combined with an oncolytic virus and the use of said combination for the treatment of cancer.

Description

Cancer therapy with an oncolytic virus combined with a checkpoint inhibitor The present invention concerns a pharmaceutical composition where a checkpoint inhibitor is combined with an oncolytic virus and the use of said combination for the treatment of cancer.

Cancer is the second leading cause of death worldwide. it has been estimated that half of men and one third of women will be diagnosed with some form of cancer during their lifespan. Moreover, e cancer is predominantly a disease of aging, the number of cancer deaths worldwide is predicted to increase about 45% from 2007 to 2030 (from 7.9 million to 11.5 million ) due to the increase proportion of elderly people (WHO estimates, 2008). Cancer is also the most costly disease.

The latest estimates from the al Cancer institute showed that the overall economic cost of cancer in the US. in 2007 was $226.8 n and unless more successful preventive interventions, early detection and more efficient treatments will be developed, this already huge ic burden is expected to further grow during the next two decades. Despite significant sses in the prevention, detection, diagnosis and treatment of many forms of cancer, which is testified by an increase of the percentage of 5-years cancer survivals in US. and in Europe over the last thirty years, some tumour types, such as pancreatic, liver, lung, brain remain orphan of effective ents calling for the pment of new therapeutic options. Oncolytic viruses, which t cancer-specific vulnerabilities to kill cancer cells while sparing normal cells are fast emerging as promising tools for fighting cancer (Btéitbach Bit-at M; Russia-ii assists No less than twelve different oncolytic viruses are currently oing phase l—lll clinical trials against various malignancies (?iesse?izet al 2012) used alone or in combination with other anticancer agents. Among them, the oncolytic rat parvovirus H—1PV is currently evaluated for safety and first signs of efficacy in a phase We clinical trial in patients having recurrent glioblastoma multiforme (GBM) eketatzafz) H-1PV is a small (~25 nm in er), non-enveloped icosahedral particle containing a 5.1 kb long single-stranded DNA genome ACetmore 8e. :éatteraajil 2570?).

The genomic organization of H—1PV consists of two transcriptional units under the controi of two promoters, the P4 early promoter and P38 late promoter. P4 regulates the expression of the gene encoding for the non—structural (NS) proteins (N81 and 3:1: N82) and the P38 the one encoding for the capsid (VP) prOteins (VP1, VP2, VP3) l‘ithmore & Tatterésaiié £08 The virus multiplies preferentially in fast dividing cancer cells. This once-selectivity is not based on a better uptake of the virus by cancerous cells, but rather is due to the fact that cancer cells overexpress factors such as cyclin A, E2F, or TF required for virus DNA replication. Furthermore, cancer cells are often defective in their ability to mount an efficient antiviral immune response favouring viral multiplication ( Nujeseh- et at“ 2012) The virus is known to activate multiple cell death pathways. Depending on cell type and growing conditions, H-1PV may induce apoptosis vétfltiistevgetat. 210 thhit‘na at at 1998 gangsta-at at; 1395'; Ueno et al , necrosis (Senegal. 99) or sin B=dependent cell death (EatPrazzaetal 209?) The virus was able to induce oncolysis even in cancer cells resistant to TRAIL (Tumor Necrosis Factor d Apoptosis Inducing Ligand), cisplatin and even when Bcl—2 was overexpressed (di Piazza et al., 2007). The latter results suggest that Bcl—2 is not a negativemodulator of irus cytotoxicity.

Cancer therapy? using a parvovirus and its combination with chemotherapy or an HDAC tor has been recently described ( A1; A1).

The major non-structural n N81 is the master regulator of virus DNA replication, viral‘ge-ne expression and cytotoxicity. The sole expression of N81, similarly to the entire virus, is sufficient to induce cell cycle arrest, apoptosis and cell lysis via lation of ve oxygen species and DNA damage (Hustevetatié’?’m) As results of its oncolytic activities, the virus has been shown to possess. ppressive properties demonstrated in a number of animal models which lay the basis for the launch of the clinical trial against GBM (Ewe:tease; gate} 2012.) During the last few years, in addition to therapy concepts based on tic viruses, the field of immuno—oncology has become a valuable ch in the fight against cancer. One of the most recent promising approaches to activate therapeutic antitumor immunity is the blockade of immune checkpoints. immune checkpoints refer to a plethora of inhibitory pathways hardwired into the immune system that are crucial for maintaining self—tolerance and modulating the duration and amplitude of physiological immune responses in peripheral tissues in order to minimize collateral tissue damage. It is now clear that tumors co-opt certain immune-checkpoint pathways as a major mechanism of immune resistance, particularly against T cells thatrare specific for tumor antigens. Because many of the immune checkpoints are initiated by ligand-receptor interactions, they can be readily blocked by antibodies or modulated by recombinant forms of ligands or receptors.

The huge number of genetic and epigenetic changes that are inherent to most cancer cells provide plenty of tumor—associated antigens that the host immune system can recognize, thereby requiring tumors to develop specific immune resistance mechanisms. An important immune resistance mechanism involves immune- inhibitory ys, termed immune checkpoints, which normally e immune tolerance and mitigate collateral tissue damage. A particularly important immune- checkpoint receptor is cytotoxic T-lymphocyte-associated antigen 4 (CTLA4), which downmodulates the amplitude of T cell activation. in normal logy T—ceils are activated by two signals: the T-cell receptor binding to an antigen-MHC complex and T—cell receptor CD28 binding to CD80 and CD 86 on the surface of the antigen ting cells. CTLA4 binds to CD80 or CD86 which prevents the binding of CD28 to these surface proteins and therefore negatively regulates the activation of T—cells.

Active cytotoxic T-cells are required for the immune system to attack cancer cells whereas regulatory T-cells inhibit other T—cells which may benefit the tumor. Antibody blockade of CTLA4 in cancer induced antitumor immunity in view of a shift in the ratio of regulatory T-cells to cytotoxic T—cells. Thus, increasing the amount of cytotoxic T— cells and decreasing the regulatory T—cells ses the anti—tumor response.

Clinical studies using antagonistic CTLA4 antibodies demonstrated activity in melanoma. Despite a high frequency of immune—related ty, this therapy enhanced al in two randomized Phase lll trials. TLA4 y was the first agent to demonstrate a survival t in patients with advanced melanoma and was approved by the US Food and Drug Administration (FDA) in 2010 ll, D., Nature Reviews Cancer, Vol. 12, pp. 252—264, (2012)). The approved anti-CTLA4 antibody is known under the name “ipilimumab” and marketed under the brandname “Yervoy®” by l Myers Squibb (BMS).

Some immune-checkpoint ors, such as programmed cell death protein 1 (PD1), limit T cell effector functions within tissues. By upregulating ligands for PD1, tumor cells block antitumor immune responses in the tumor microenvironment.

Clinical gs with blockers of additional immune—checkpoint proteins, such as programmed cell death n 1 (PD1), indicate broad and diverse opportunities to enhance antitumor immunity with the potential to produce durable clinical responses.

Clinical trials suggest that blockade of the PD1 pathway induces ned tumor sion in various tumor types. Responses to PD1 blockade may correlate with the expression of PD1 ligands by tumor cells.

On September ‘4, 2015 the FDA approved the humanized monoclonal antibody pembrolizumab (also known as MK—3575 or Keytruda® marketed by Merck Sharp ' Dohme; MSD) that is directed against the target PD-1 under the FDA Fast Track Development Program. it is approved for use following treatment with ipilimumab (which is directed against CTLA4), or after treatment with ipilimumab and a BRAF _ inhibitor in advanced melanoma patients who carry a BRAF mutation.

On September 30, 2015 the FDA granted accelerated approval to another anti-PD1 antibody (nivolumab; Opdivo ® ion marketed by Bristol Myers Squibb; EMS) in ation with anti-CTLA4 antibody ipilimumab for the treatment of patients with BRAF V 600 wild-type, unresectable or metastatic melanoma.

Multiple additional immune-checkpoint receptors and ligands, some of which are selectively upregulated in various types of tumor cells, are prime targets for blockade, particularly in combination with ches that enhance the activation of antitumor immune responses, such as vaccines.

Anti—PD-L1 antibodies and methods of making the same are known'in the art. Such dies to, PD-L1 may be polyclonal or monoclonal, and/or recombinant, and/or humanized. Examples of dies to PD-L1 are disclosed in US Patent No. 8, 217,149, US ation No. 13/511,538, US Application No. 13/478,511.

Exemplary agents that target immune-checkpoint pathways are shown in the following Table 1 ied from Pardoll, D., Nature Reviews Cancer, Vol. 12, pp. 252—264, (2012): i Bi'o'iog'i’éél' Ant—ibgdy' or lg gFunc?on fusion protein Surfac'enprotei H 7 inhibitory receptor lpilimumab , -. (brandname: CTLA4 marketed ;_ Yervoy® g by BMS) 5*? Tremelimumab (also known as ticilimumab or CP- fép‘rogrsrhrrroa‘ce lhhoibitryreceptor?g MDX-1106 (also I” known as BMS- death 1 (PD-)1 _ ; 936558 or " or mab, :f brandname: Opdivo® marketed 1' by EMS) :, MK 3475 (also ' known :3 pembrolizumab or lambrolizumab, brandname: ."_ Keytruda ® 3 J marketed by MSD) '3 CT—O1’l AMP-224 ?’PDLi Ligand for PDT: MDX-1105' ' ?'LAes ' ’ ’ Inhibitory resists 3|MP321 1 H3 “ Inhibitory ligand?" EMGA271 Although for some tumor types (e.g. melanoma, lung) the treatment with checkpoint inhibitors shows ing results, it has been recognized that patients with some other tumors (e.g. colon, pancreas) do not benefit from such a treatment.

Therefore, it is the object of the present invention to provide means for an improved cancer y and to make a larger range of tumors susceptible to checkpoint inhibitor treatment.

According to the invention this is achieved by the subject matters d in the claims.

In the study resulting to the present invention it was asked whether a checkpoint tor, e.g. an Dt antibody‘like pembrolizumab, izes with an oncolytic virus, eg. a parvovirus like H-1PV or afrelated rodent parvovirus, in killing cancer cells. It Was shown that the administration of pembrolizumab iates the oncolytic activity of the virus in a synergistic manner in several patients.

The present invention provides a pharmaceutical composition containing (a) an oncolytic virus in combination with,(b) a checkpoint inhibitor. The present invention also provides the use of said pharmaceutical combination for treating cancer.

Preferably, in said pharmaceutical ition the oncolytic virus and the checkpoint tor are present in an effective dose and ed with a pharmaceutically acceptable carrier.

As used herein the term “agent” is understood to mean a subStance that produces a d effect in a tissue, system, animal, mammal, human, or other subject.

Accordingly, the term “anti-neoplastic agent” is understood to mean a substance producing an anti—neoplastic effect in a tissue, system, animal, mammal, human, or other subject. it is also to be understood that an “agent" may be a single nd or a combination or composition of two _or more nds.

By the term “treating” and derivates thereof as used herein, is meant therapeutic therapy. in reference to a particular condition, treating means: (1) to ameliorate the condition or one or more of the biological manifestations of the conditions, (2) to interfere with (a) one or more points in the biological cascade that leads to or is responsible for the condition or (b) one or more of the biological manifestations of the ion (3) to alleviate one or more of the symptoms, effects or side effects associated With the condition, or (4) to slow the progression of the condition or one or more of the ical manifestations of the condition.

As used , “prevention” is understood to refer to the prophylactic administration of a drug to substantially diminish the likelihood or severity of a condition or biological -30 manifestation thereof, or to delay the onset of such condition or biological manifestation thereof. The skilled artisan will appreciate that “preventions” is not an absolute term. Prophylactic therapy is appropriate, for example, when a subject is considered at high risk for ping cancer, such as when a subject has a strong family history of cancer or when a subject has been exposed to a carcinogen.

As used herein, the term “effective amount” means that amount of a drug or pharmaceutical agent that will elicit the biological or l response of a tissue, system,'animal or human that is being sought, for instance, by a researcher or clinician. Furthermore, the term “therapeutically effective amount” means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, g, tion, or amelioration of a disease, disorder or side effect. The term also includes within its scope amounts effective to enhance normal physiological function. An “effective dose” useful for treating and/or preventing these diseases or disorders may be determined using methods known to one skilled in the art.

The administration of a therapeutically effective amount of the ations of the invention are advantageous over the individual component compounds in that the combinations provide, one or more of the following improved ties when ed to the individual administration of a eutically effective amount of a component compound: i) a greater anticancer effect than the most active single agent, ii) synergistic or highly synergistic anticancer activity, iii) a dosing protocol that provides enhanced anticancer activity with d side effect profile, iv) a ion in the toxic , profile, v) an increase in the therapeutics window, or vi) an increase in the bioavailability of one or both of the component compounds.

"Pharmaceutically acceptable" is meant to encompass any carrier, which does not interfere with the effectiveness of the biological activity of the active ingredients and that is not toxic to the patient to whom it is administered. es of suitable pharmaceutical carriers are well known in the art and e phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, e solutions etc.. Such carriers can be ated by conventional methods and can be administered to the subject at an effective dose. Additional pharmaceutically compatible carriers can include gels, bioadsorbable matrix materials, implantation elements containing the therapeutic agent, or any other suitable vehicle, delivery or dispensing means or material(s).

As Used herein the term r" refers to an abnormal growth of cells or tissue and is understood to include malignant neoplastic growths. The term “neoplastic” means of or related to a neoplasm. In some embodiments the cancer is a solid tumor, i.e. brain cancer (particularly glioma‘s: ependymomas, astrocytomas [e.g. glioblastoma multiforme], endrogliomas, brainstem , oligoastrocytomas); colon cancer (in particular non—MSI CRC), bladder cancer, liver cancer, breast cancer (particularly double or triple negative breast cancer), kidney cancer, head/neck squamous cell carcinoma, lung cancer cularly lung squamous cell carcinoma, non—small-cell lung cancer (NSCLS), small—cell lung cancer (SCLC)), malignant melanoma, ovarian stomach cancer. The cancer, pancreatic cancer, prostate cancer, renal cell cancer or term “cancer” also encompasses metastasis' of the mentioned tumors in various organs. In a preferred embodiment these tumours are resistant to parvovirus toxicity.

In a further preferred embodiment these tumour to be treated are recurrent tumours.

A particular advantage of the pharmaceutical composition of the present invention is that even cancer initiating stern cells can be successfully treated. This has a positive effect as regards the avoidance of the recurrence of the tumours and asis formation.

In other embodiments the cancer is a heme malignancy, i.e. acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), c lymphocytic leukemia (CLL), chronic d leukemia (CML), diffuse large B-cell lymphoma ), EBV- positive DLBCL, primary inal large B-cell lymphoma, (histiocyte)-rich large B-cell lymphoma, follicular lymphoma, Hodgkin‘s ma (HL), mantle cell lymphoma (MCL), multiple myeloma (MM), myeloid cell leukemia-1 protein (MCI-1), myelodysplastic syndrome (MDS), non—Hodgkin‘s lymphoma (NHL), or small lymphocytic lymphoma (SLL).

“Checkpoint inhibitor” means any agent that cause a blockade of immune system inhibitory checkpoints. Blockade of inhibitory immune checkpoints activates immune system on. Suitable targets and agents are mentioned in Table 1 to which reference is made. in a preferred embodiment the ligand—receptor interaction as a target for cancer treatment is the interaction between the transmembrane programmed cell death 1 protein (PDCDi, PD—1, also known as 00279) and its , PD—1 ligand (PD-L1, . in normal physiology PD-L1 on the cell surface binds to PD—1 on an immune cell surface, which inhibits immune cell activity.

WO 67626 Upregulation of PD—L1 on the cancer cell surface may allow them to evade the patient's immune system by inhibiting T cells that might otherwise attack the tumor cell. Antibodies that bind to either PD~1 or PD-L1 and therefore block the interaction allow the T-cells to attack the-tumor. Thus, in a preferred embodiment, PD-t antagonists are used as checkpoint tor.

“PD-1 nist” means any chemical compound or biological molecule that blocks binding of PD—L1 expressed on a cancer cell to PD-1 expressed on an immune cell (T cell, B cell or NKT cell) and ably also blocks binding of PD—L2 expressed on a cancer cell to the -cell expressed PD-1. Alternative names or synonyms for PD—1 and its ligands include: PDCD1, PD1, CD279 and SLEBZ for PD-1; PDCD1L1, PDL1, B7H1, 87—4, CD274 and B7-H for PD-L1; and PDCD1L2, PDL2, B7-DC, Btdc and 00273 for PD-L2. In any of the treatment method, medicaments and uses of the present invention in which a human individual is being treated, the PD-1 antagonist blocks binding of human PD—L1 to human PD-1, and ably blocks g of both human PD—L1 and PD-L2'to human PD—1. Human PD—1 amino acid sequences can be found in NCBI Locus N.: NP_054862 and NP_079515, respectively.

PD—1 antagonists useful in the any of the ent method, medicaments and uses of the present invention include monoclonal antibody (mAb), or antigen binding fragment thereof, which specifically binds to PD~1 or PD-L1, and preferably specifically binds to human PD-1 or human PD—Li. The mAb may be a human antibody, a humanized antibody or a chimeric antibody, and may e a human constant region. in some ments the human constant region is selected from the group consisting of lgG1, lgGZ, lgGB and lgG4 constant regions, and in preferred embodiments, the human constant region is an lgG1 or lgG4 constant region, in some embodiments, the antigen binding fragment is selected from the group consisting of Fab, Fab—SH, F(ab‘)2, scFv and Fv fragments.

Examples of mAbs that bind to human PD—1, and useful in the treatment , medicaments and uses of the present invention, are described in US 7,521,051, US 8,008,449, and US 8,354,509. Specific anti—human PD—l mAbs useful as the PD—1 antagonist in the treatment method, medicaments and uses of the present invention include: MK—3475 (pembrolizumab), a humanized lgG4 mAb with the structure described in WHO Drug Information, Vol. 27, No. 2, pages 161—162 ; nivolumab (EMS-936558), a human lgG4 mAb with the structure described in WHO Vol. 27, No.1, 68-69 (2013); the humanized antibodies Drug information, pages h409A11, h409A16 and h409A17, which are described in W02008/156712 it will be realized by those d in the art that any type of virus, which is potentially cytotoxic to tumor cells, may be employed in the combination of the present Replication competent toxic viruses used in the invention may affect kill invention. tumor by lysis, i.e. be oncolytic, or may kill tumor cells via a ent mechanism. of the practice of the invention include Particular examples viruses for use in irus, retrovirus, vesicular stomatitis virus, Newcastle Disease virus, polyoma virus, vaccinia virus, herpes simplex virus and parvovirus. Preferably the oncolytic virus is a parvovirus, more preferabiy parvovirus H—1 or a related rodent parvovirus Rat minute selected from Lulll, Mouse minute virus (MMV), Mouse parvovirus (MPV), virus (RMV), Rat parvovirus (RPV), or Rat virus (RV).

The term “oncolytic virus” and particularly "parvovirus" or “parvovirus H-1” as used herein comprises wild—type or modified ation—competent tives thereof, well as related s or vectors based on such viruses or derivatives. Suitable oncolytic viruses, derivatives, etc. as well as cells which can be u'sed for actively producing said viruses and which are useful for therapy, are readily determinable within the skill of the art based on the disclosure herein, without undue empirical effort.

Administration of the compounds may be effected by different ways, e.g. by intravenous, intraperitoneal, aneous, intramuscular, topical, intratumoral or intradermal administration. The route of administration, of course, depends on the kind of therapy and the kind of compounds contained 'in the pharmaceutical is readily ition. The dosage regimen of the virus and oint inhibitor determinable within the skill of the art, by the attending physician based an patient size, data, observations and other clinical factors, including for example the pati‘ent's body surface area, age, sex, the particular virus, the particular inhibitor etc. to be administered, the time and route of administration, the tumor type and which the characteristics, general health of the patient, and other drug ies to is made to patient is being subjected. As s the checkpoint inhibitors reference reference the e insert and patient information sheet which are incorporated by herewith. ing a dosage regimen (also referred to herein as an administration for a combination therapy of the invention depends on several factors, regimen) including the serum or tissue turnover rate of the entity, the level of symptoms, the immunogenicity of the entity, and the accessibility of the target cells, tissue or organ in the individual being treated. Preferably, a dosage regimen maximizes the amount of each therapeutic agent delivered to the patient tent with an acceptable level of side effects. Accordingly, the dose amount and dosing frequency of each therapeutic agent in the combination depends in part on the particular therapeutic agent, the severity of the cancer being treated, and patient characteristics. Guidance is selecting appropriate doses of antibodies, cytokines, and small molecules are available. See, e.g., Wawrzynczak (1996) Antibody Therapy, Bios Scientific Pub. Ltd.

Oxfordshire, UK; Kresina (ed.) (1991) Monoclonal Antibodies, nes and Arthritis, Marcel Dekker, New York, NY; Bach (ed.)(1193) Monoclonal Antibodies and Peptide Therapy in mune Diseases, Marcek Dekker, New York, NY; Beart et al, (2003) New Engl. J. Med. 1—608; Milgrom et al. (1999) New Eng/J. Med 66— 1973; Slamon et al. (2001) New Engl. J. Med. 344:788-792; Beniaminovitz et al. (2000) New Engl. J. Med. 342:613—619; Ghosh et al. (2003) New Engl. J. Med. 348:24-32; Lipsky et al. (2000) New Engl. J. Med. 343;1594—1602; Physicians‘Desk Reference 2003 (Physicians‘Desk Reference, 57th ed); Medical Economics Company; lSBN; 1563634457; ‘57th edition (November 2002). Determination ofthe appropriate dosage regimen may be made by the clinician, e.g., using parameters or factors known or suspected in the art to affect treatment or ted to affect treatment, and will depend, for example, the t‘s clinical history (e.g., previous therapy), the type and stage of the cancer to be treated and biomarkers of response to one or more of the therapeutic agents in the combination therapy.

Since the virus in the ation with the checkpoint inhibitor according to the invention comprises infectious virus particles with the ability to penetrate h the blood system, treatment can be performed or at least initiated by intravenous injection of the virus. However, a red route of administration is intratumoral administration.

Since long—term intravenous treatment is susceptible to ng inefficient as a result of the formation of neutralizing antibodies to the virus, different modes of stration can be adopted after an initial regimen intravenous viral administration, or such ent stration techniques, e.g., intratumoral virus W0 2017/167626 administration, can be alternatively used thmughout the entire course of viral treatment. technique, (virus, vector and/or cell As another speci?c administration the virus agent) can be administered to the patient from a source implanted in the t. For e, a catheter, e.g., of silicone be or other biocompatible material, can connected to, a small subcutaneous reservoir (Rickham oir) led in the patient during tumor removal or by a separate procedure, to permit the parvovirus composition to be injected locally at various times without further surgical intervention. The virus or derived vectors can also be injected into the tumor by stereotactic surgical techniques or by tion ing techniques. stration of the virus can also be med by continuous infusion of viral particles or fluids containing viral particles through implanted catheters at low flow rates using, suitable pump systems, e.g., peristaltic infusion pumps or convection enhanced delivery (CED) pumps. is from an.

A yet another method of administration of the viral combination part implanted article constructed and arranged to dispense the parvovirus to the desired cancer tissue. For example, wafers can be employed that have been impregnated with the virus, particularly parvovirus H-t, whereinthe wafer is ed to the edges of the resection cavity at the conclusion of surgical tumor removal. Multiple wafers can be employed in such therapeutic intervention. Cells that actively produce the virus, or virus-based s, can be injected into the tumor or into the tumoral cavity after tumor removal. * it can also allow the clinical use of the virus and/or checkpoint inhibitor at lower therapeutic doses preserving or even enhancing anticancer efficacy while increasing safety and reducing and/or ng side effects. in view of the strong synergistic effect between the virus and checkpoint inhibitor it is possible to foresee the reduction of the therapeutic doses, e.g. half or a third of the previously used single component doses are preserving the desired therapeutic effect. In View of the reduced doses (severe) side effects may be reduced or even avoided.

In case of parvovirus the infection effects kill tumor cells but does not harm normal cells and such infection can, for example, be d out by, intratumoral use of a suitable irus, e.g., parvovirus H—1, or a related virus or vectors based on such viruses, to effect tumor—specific therapy without adverse neurological or other side effects.

A combination therapy of the invention may be used prior to or following surgery to remove a tumor and may be used prior to, during or after radiation therapy.

A combination therapy of the invention is typically used to treat a tumor that is large enough to be found by palpation or by imaging techniques well known in the art, such as MRI, ultrasound, or CAT scan. in some preferred embodiments, a combination therapy of the invention is used to treat an advanced stage tumor having dimensions of at least about 200 mm3, 300mm3, 400mm3, , 750mm3, or up to 1000mm3.

The pharmaceutical ation may also comprise one or more additional therapeutic agents. The additional therapeutic agent may be, e.g., a chemotherapeutic agent, a biotherapeutic agent (including but not limited to antibodies to VEGF, EGFR, Her2/neu, VEGF receptors, other growth factor receptors, CD20, CD40, CD4OL, CTLA—4, OX-4O 4-188, and ICOS), an immunogenic agent (for example, attenuated cancerous cells, tumor antigens, antigen presenting cells such as dendritic cells pulsed with tumor derived antigen or nucleic acids, immune ating nes (for example, lL-2, lFNdZ, GM-CSF), and cells transfected with genes encoding immune stimulating cytokines (such as but not d to GM—CSF).

Examples of chemotherapeutic agents include alkylating agents such as cyclosphosphamide, an, a camptothecin, chlorozotocin, stine, lomustine, nimustine, ranimustine, antibiotics,‘ bleomycins, caminomycin, dactinomycin, daunorubicin, idarubicin, 5—flourouracil (5~FU), methotrexate, cytarabine, platinum analog such as cisplatin and carboplatin; vinblastine, platinum; etoposide ); ifosfamide, mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin, xeloda; ibandronate; topoisomerase inhibitors; difluoromethylornithine (DMFO); ids, fen, raloxifene, ifene, 4~ hydroxytamoxifen, trioxifene, keoxifene or aromatase inhibitors.

The present invention also relates to the use of (a) a parvovirus H4 and (b) checkpoint inhibitor for the preparation of (a) pharmaceutical composition(s) or ation for the ent of cancer.

The mode of administration of (a) and (b) may be simultaneously or tially, wherein, preferably, (a) and (b) are sequentially (or separately) administered. This means that (a) and (b) may be provided in a single unit dosage form for being taken er or as separate entities (e.g. in separate ners) to be administered simultaneously or with a certain time difference. This time difference may be between 1 hour and 1 week, preferably between 12 hours and 3 days. in addition, it is le to administer the virus via another administration way than the checkpoint tor. In this regard it may be advantageous to ster either the virus or oint inhibitor intratumoraly and the other systemically or orally. in a ular preferred embodiment the virus is administered intratumoraly and the checkpoint inhibitor intravenously. Preferably, the virus and the checkpoint inhibitor are administered as separate compounds. Concomitant treatment with the two agents is also possible.

Each therapeutic agent in a combination therapy of the invention may be administered either alone or in a medicament (also referred to herein as pharmaceutical composition) which comprises the therapeutic agent and one or more pharmaceutically acceptable carriers, excipients and diluents, according to standard pharmaceutical practice. Each therapeutic agent in a combination therapy of'the ion may be administered simultaneously (i.e., in the same medicament), concurrently (i.e., in separate medicaments administered one right after the other in is ularly useful any order) or sequentially in any order. Sequential administration when the therapeutic agents in the combination therapy are in different dosage forms (one agent is a tablet or e and another agent is a sterile liquid) and/or are administered on different dosing schedules, eg a chemotherapeutic that is administered at least daily and a biotherapeutic that is administered less ntly, such as once weekly, once every two weeks, or once every three weeks. in some embodiments, at least one of the therapeutic agents in the combination therapy is administered using the same dosage regimen (dose, frequency and duration of treatment) that is typically employed when the agent is used as '30 monotherapy for treating the same cancer. In other embodiments, the patient receives a lower total amount of at least one of the therapeutic agents in the combination therapy than when the agent is used as erapy, e.g., smaller doses, less frequent doses, and/or shorter treatment duration. The checkpoint inhibitor and oncolytic virus described herein may be provided as a kit which ses a first container and a second container and a package insert. The first container contains at least one dose of a medicament comprising a oint inhibitor, ably an D—i antagonist, the second container contains at least the package insert, or one dose of a medicament comprising an tic virus, and label, which comprises instructions for treating a patient for cancer using the ments. The first and second containers may be comprised of the same or different shape (e.g., vials, syringes and booies) and/or material (e.g. Plastic or glass). The kit may further comprise other materials that may be useful in stering the medicaments, such as diluents, s, lV bags and lines, needles and syringes. In some preferred embodiments of the kit, the anti—PD—1 antagonist are intended an anti-PD-1 antibody and the instructions state that the medicaments for use in treating a patient having a cancer that tests positive for PD-L1 expression by an lHC assay. in the present invention it has been shown for the first time that the combinatorial use of a inhibitor, an oncolytic virus, particularly parvovirus H-i PV, and oint particularly pembroiizumab,‘ may be a valid approach against cancer, in particular brain tumor, colon carcinoma and pancreatic carcinomas. As outlined more ed in the examples it was surprisingly possible to reduce metastasis size in a tumor type (CRC) which is normally not responsive to checkpoint inhibitor treatment. Even more surprisingly, an a considerable tumor size reduction was obtained in inoperable primary glioblastoma multiforme. hide Without the intent of being bound to a theory, as previously mentioned tumors themselves from attacks by the immune system by using immune checkpoint at the pathways, e.g. h binding of PD—L1 at the tumor side to the “PD-1 receptor T-cell side. This results in immune tolerance of the body to the tumor. Immune checkpoint inhibitors are antibodies which block the immune checkpoint ys (e.g. 6—L1 or anti-PD‘l antibodies). As a result the immune tolerance breaks cells may recognize the tumor and attack it. However, this down and the immune does not work for all tumor types since tumors often have a microenvironment which makes it impossible that the activated immune cells invade into the tumor. This invasion into the tumor is now made possible by using the oncolytic virus, in particular a parvovirus, more particularly parvovirus H—1, which attacks the tumor and W0 2017/167626 changes its microenvironment. In other words, the tic virus is able to make the tumor “naked” through oncolysis and the immune cells which have been “armed” by using the checkpoint inhibitor are able to start the invasion into the tumor. The oncolytic virus may be seen as a door opener for a successful immune response.

With this concept it should be possible to treat any tumor type, also those where checkpoint inhibitor treatment failed in the past since the oncolytic virus treatment transfoms an non—immunogenic tumor in an immunogenic one. in view of the l principle this works with any oncolytic virus as long as it changes the tumor microenvironment and with any checkpoint inhibitor. This could lead to long—term effects in prevention of disease relapse, potentially adding to initial oncolysis. This combination of effects renders the tumor more succeptible to the immune system, in particular after previous therapy with the virus. t's ekamples show that this combination therapy leads to either remission or stable disease.

When examining cancer progression it has been found out that an evolving crosstalk between different cells, involving especially cancer cells and immune cells, is utilized.

Cancer cells can alter the immune microenvironment and the function of immune cells leading to immunosuppression and immune ni??rigi?man et al.,: 2012; vrch etal. 2012 Halama et al., 2011(a), 2011(b)). For example, in the case of liver ases of a ctal cancer (CRC) it has been shown that the invasive margin of colorectal cancer liver metastases is an immunological microenvironment of its own dimensions. This environment s migration of T cytes into the invasive margin following a distinct chemokine gradient. infiltrating T lymphocytes exert tumor stimulating effects via their own production of CCLS. The microenvironment in liver metastases of colorectal cancer shows no Th1, Th2 or Th1? milieu but instead is optimized for promoting inflammation involving chemokines and growth factors like VEGF, HGF and MIF. (Halama et al., 2016). In this e a) an immunosuppressive landscape, b) a potential tumor-protective ism of colorectal cancer metastases and c) the tumor-promoting properties of specific immune cell s in tumors and metastases has been highlighted. in this 3O publication it has also been shown that tumor cells are PD—Lt negative at the invasive margin. This may be an explanation why the treatment with checkpoint - inhibitors was not so successful in several tumor entities so far. As previously mentioned, the microenvironment must be changed by the oncolytic virus before immune cells can successfully enter the tumor and attack it. In this regard reference is made to Example 2 and Figures 1-9 showing that after the treatment with parvovirus H~1 and PD1 antibody a significant se in T cell density was observed in the tumor and that most T cells are PD 1 positive.

The invention will now be described by way of illustration only by reference to the following non—limiting Examples, Methods and Figures.

FIGURES Fig. 1: lmmunofluoresence of Biopsy 1 of liver metastasis (CD3) shows vital tumor areas, clear in?ltrate of CD3 positive cells. in?ltrates are heterogenous Fig. 2: lmmunofluorescence of Biopsy 1 of liver metastasis (CD8) shows clear rate of or T cells, again, heterogenous. interestingly, there is close vicinity of CD8+ T cells with tumor lium which is rare to be observed Fig. 3: lmmunofluorescertce of Biopsy 1 of liver metastasis (PD—1) shows that predominantly the stromal compartment is T cell rich. Most of them are PD1 positive Fig. 4: immuno?uorescence of Biopsy 2 of liver metastasis (CD3) shows that after first on of H—1 PV + PD—1 antibody a significant increase in T cell y was observed (about + 30-50%). Again heterogenous pattern Fig. 5: lmmunofluorescence of Biopsy 2 of liver metastasis (CD8) shows a significant increase in CD8+ T cell y. Very heterogenous. Close contact of CD8+ T cells with tumor cells Fig. 6: lmmunofluorescence of Biopsy 2 of liver metastasis (PD—1) shows that most T cells are PD—1 positive Fig 7: lmmunofluorescence of Biopsy 3 of liver metastasis (CD3) shows that after second infusion with H—1 PV + PD—1 antibody there is still increase in T cell density. Again very hetergenous.

Fig. 8: lmmunofluorescence of Biopsy 3 of liver metastasis (CD8) shows dense T cell infiltrates, similar to biopsy 2 W0 2017/167626 shows that Fig. 9: lmmunofluorescence of Biopsy 3 of liver metastasis (PD-1) still most T cells are PD-1 positive Fig. 10-15: Cytokine profiles Data from Multiplex-Cytokine fication Reference for protein quantification Equal protein amounts for each biopsy Ratios are shown (dotted columns have too low proteins amounts to robust) Fig. 10: lncreased/Upregulated Proteins: CTACK—CCL27, lL-16, SDF-1 alpha, lP—10, MIP—1b Fig. 11: Decreased/Downregulated Proteins: G-CSF, lL—5, lL—7, lL-13, IL—12p40, FGP basic, MIF, , lL—1 alpha Fig. 16: MRl of progressing ent glioblastoma multeforme prior to treatment and during treatment (55 and 101 days after administration of H-1 PV + pembrolizumab) Upper row: Prior to treatment with H—1 PV + Pembrolizumab Middle row: 55 days after administration of H—1 PV + Pembrolizumab Lower row: 101 days after administration of H1 PV + Pembrolizumab EXAMPLES Example 1: l Methods (a) Fluorescence in situ hybridization (FISH) FISH assayz'The method procedure was performed essentially as described by Silahtaroglu et al (Molecular and Cellular Probes. 2003; 17:165—169) and Nehmé et al (J Neurosci Methods. 2011; 196:281-288). The FISH assay was first ished in human NBK cells cultured in vitro and extended to paraffin—embedded tumor tissue deriving from human glioma afts in lmmunodefficient rats. The asSay protocol and RNA sequences in was then applied for the detection of H—1PV DNA patient- derived paraf?n—embedded or cryopreserved tumor material.

Positive and negative controls: In each FISH assay, paraffin—embedded tumor in rats were tissue deriving from H—1PV— or mock—treated human glioma xenografts used as positive or negative controls, respectively. No probe (reagent substitution negative control; target—specific hybridization probe omitted) and mismatch (target- Specific hybridization probe with 3-5 nucleotides d) controls were also included.

Hybridization probes: The target-specific hybridization probes were custom- designed by Exiqon (Vectbae lemmas?) to recognize H-1PV non-structural (NS) and structural (VP) protein ceding sequences and ented locked nucleic acid (LNA) oligonucleotides with increased target specificity and otency binding (for a reference, see wwwexrencem The probes were synthetized by reverse complementation either-to H—1PV negative (sense) or ve (antisense) strand DNA and were double digoxin —labeled at their 3’ and 5’ ends. Both NS- and VP-specific probes were applied as a mix of equal amounts, in order to increase the hybridization signal.

NS1-antisense: . 5DlGN/TCAGCACACAACAGATGGCAT/SDlGN VP-antisense: 5DlGN/TACTATCCAGAGCAACCATCAT/3DlGN NS1-sense: 5DIGN/AATTCGCTAGGTTCAATGCGCT/BDIGN VP-sense: TGACCTACCAACATCAGATACA/SDIGN Signal ization: Signal visualization was achieved by sequential tion with anti-DIGN antibody conjugated with adish peroxidase (Roche, Sigma- W0 2017/167626 Aldrich, Munich, y), and the Tyramide Signal Amplification (TSA)/cyanine by using (Cy) 3 reagent (Perkin Elmer, Germany). image acquisition was performed a Zeiss Cell Observer microscope and the ZEN re. the Fiji lmageJ Signal quantitation:. For the quantitative analysis of positive signals re was used, and an automated analysis using purpose-developed custom Germany) and macros (Dr. D. Krunic, German Cancer Research Center, Heidelberg, constant processing settings was conducted. Results were presented as average of positive signals field um) intensity per microscope obserVation (dFOV=1.000 cell. The value of the and/or as average intensity of positive s per labeled ched probe) background fluorescence -positive signals generated by the defined the cut-off between positive and negative s. Signal intensity was expressed in arbitrary units . (b) Cell culture & Proliferation assays from healthy donors and after a short period of, rest were T cells were drawn anti- stimulated in CD3/CD28 coated 96 well plates (anti-CD3 from end, USA, RPMI 1640 (PAA, CD8 from BD, Germany) overnight. T cell culture media contained 1% Glutamine USA), 10% human serum (heat—inactivated for 30 minutes at 56 °C), Non—essential amino acids (PAA, USA), 1% llin/streptomycine (PAA, USA), 1% lines were cultured (PAA, USA) and 1% HEPES (PAA, USA). Commercial tumor cell according to the ers instructions. Quantification of cells was performed in TC1O (BioRad, triplicates with double measurements with the automated cell counter y), especially directly after seeding (Le. 0.5 * 105 cells /ml for proliferation in plates) and after incubation/treatment. Primary cell 25 assays, cells equally seeded lines were authenticated using Multiplex Cell Authentication by Multiplexion (Heidelberg, Germany) as described recently (Gasmgast alt. 23) The SNP profiles matched known profiles were unique, consistent with a human epithelial tumor cell line. All cell lines were tested for Mycoplasma contamination by PCR.

Preparation of ascites (from colorectal cancer patients) and extraction of hages and lymphocytes was performed as follows. Adapted from previous reports ascites was collected into sterile plastic bags. The outlet nozzle of each bag wasprepared by desinfection with 70% alcohol and the first on of ascites is WO 67626 ded while the remaining s is distributed in 50 ml Falcon tubes.

Centrifugation with 1500 rpm for 10 min. Supernatants were mixed with RPMI medium (1:2) and used as conditioned medium (CM). For macrophage populations (a), pellets were then resuspended in RPMI medium and are run through a Ficoll gradient (30 min at 2000 rpm at room temperature). The interphase was then collected in RPMI, washed and centrifuged (1800 rpm for 10 min) and the resulting pellets are then seeded into cell flasks with RPMI. For macrophage populations the supernatants were then harvested after an adherence step of 1,5h (37°C), the remaining adherent cells were washed with PBS (three times) and then supplemented with CM. For lymphocytes (b), pellets were then resuspended in RPMI medium centrifuged again and pellets were then seeded into cell flasks with RPMl.

After adherence, the supernatant was used to extract lymphocytes. After experiments with either the macrophages or lymphocytes the supernatant was measured for cytokines and the cells were harvested and analyzed with stainings (double staining CD163 and CD68 for hages, CEA for tumor cells and CD3 for lymphocytes) and controlled for purity of cell content (>95%). Extraction of tumor cells was performed after dissociationof tumor tissue and on steps. (c);9vltokine & Chemggfpe Qua—Hilfigetign A two-laser array reader simultaneously quantifies all cytokines and chemokines of interest. Standard curves and concentrations were calculated with Bio—Plex Manager 4.1.1 on the basis of the 5—parameter ic plot regression formula. Briefly, small pieces of ted frozen tissue were transferred in 150 pl cold lysis buffer, ed, frozen at —— 80°C (10 min) and thawed on ice. After incubation in a cold onic bath (1 0 min), samples were frozen again at -80°C, thawed on ice and centrifuged (13.000 rpm, 20 min, 4°C). The protein concentration of the supernatant was determined and the concentration of lysates was adjusted to 1000 pg/ml (300 pg/ml for biopsies) using human serum diluent (BioRad) and cytokine/chemokine concentrations in tissue lysates were quantified by multiplex protein arrays, according to manufacturer’s instructions (BioRad Laboratories, Hercules, CA, USA).

The detection ivity of the analytes ranged from 1 pg / ml to 100 ng / ml. Values that were identified as "Out of range" by the rm were olated based on the single standard curves that were generated for each analyte. As standard curves showed minimal standard deviations the highest cOncentrated standard concentration was used for the extrapolation. To form classes of cytokines (in used descending order e.g. TH1, TH2, TH17 etc.) the AMIGO database was car] in evaluating specific terms (e.g. 3030: _. :ibttcgsfzmi'aeggstieicntcl of activated T regulation of macrophage activation, G020042104: positive regulation cell proliferation or GO:0006935: chemotaxis) or literature search. Positive controls from samples with TH1, TH2 or TH1? dominated cytokines were used for is.

General reproducibility (precision) of the multiplex protein quantification approach on with serial ns showed an excellent reproducibility (Spearman’s Rank correlation r=0.975 and p=0.0001, median difference 70 pg/ml). Accuracy was evaluated measurements of solutions with known concentrations of the cytokine, e.g. CCL5 .000 pg/ml which showed a standard deviation of 628.92 pg/ml, corresponding 2.5% from the expected value and CCL5 at 100 pg/ml which showed a standard deviation of 2.7 pg/ml, corresponding to 2.7% from the expected value. Calibration the investigated analytes is performed as by the manufacturer ended (BioRad, Germany) and we refer to the manufacturer’s homepage for additional reference material on accuracy and precision great .cs‘mtwebragttwebt2dftlsrllitetMretaulli5... Sarita » t).

Comparison between different serial section invasive margin protein quanti?cations also revealed an excellent reproducibility (spearman’s rank correlation rho=0.922, p=0.0001). Finally the comparison of the ratios of laser-assisted microdissected material to macrodissected al revealed that the invasive margin indeed is a precisely separated region with reproducible and ct cytokine es. Also, the differences to the surrounding adjacent liver or the liver asis are so pronounced that the macrodissected specimen tely les the patterns found in the microdissected en.

Generation of cytokine and chemokine data from biopsy material was performed as outlined above. Due to the limitations in the amount of material available, the protein concentrations used for the assays was set to 300 mg. Histologically the adjacent liver of the patients remained unchanged under ent as compared to before treatment, with respect to morphology and immune cell presence. ore, as control for the precision of the cytokine measurement (and to assess effects of dilution etc.) the cytokine levels of the adjacent liver before and under treatment were used and showed excellent concordance (spearman’s rank correlation rho=0.991 and 01, median difference 5 pg/ml). This also makes effects of wound healing (that should not be present anymore after day 8 post-biopsy) unlikely to interfere with the effects of CCR5 inhibition. The percentage of apoptotic tumor cells was determined by counting apoptotic nuclei (based on r logy) and intact tumor cells in sections stained with hemalaun and/or H&E as described previously Duals at: at_ 2003) (d) lmmunohistochemistry & lmmunofluorescence FFPE s were deparaffinized and rehydrated (BOND Dewax Solution, Leica, Germany). After heat-induced epitope retrieval (HlER) at 100 °C (BOND Epitope Retrieval Solution 1 or 2, Leica, Germany), endogenous peroxidase activity was blocked by incubation with 3% peroxide block for 20 min (BOND Polymer Refine Detection System, Leica, Germany). The sections were blocked with 10% normal goat serum (Vector, A list of the used antibodies and dilutions can be found below. These were applied as primary antibodies at room temperature for 30 min.

The slides were incubated with a secondary dy (rabbit-anti—mouse lgG, Bond Polymer Refine Detection System, Leica, Germany) for 8 min at room temperature.

Further amplification of the signal was achieved through incubation with a third antibody, conjugated with horse radish peroxidase and coupled to dextrane molecules in large numbers, for 8 min at room temperature (Poly—HRP-mouse~anti— rabbit lgG, Bond Polymer Refine Detection System, Leica, Germany). The antigen ion was performed by a color reaction with 3,3-di—amino-benzidine (DAB chromogen, Bond r Refine Detection System, Leica, Germany). The sections were counterstained with hematoxylin (Bond Polymer Refine Detection System, Leica, Germany) and mounted with Aquatex (Merck, Germany). Matched isotype controls were used a negative control and adjacent normal tissue or known ve cells were used as positive control.

Immunofluorescence double ng was performed on cryosections using a red fluorescence Alexa Fluor 594 dye-labeled donkey—anti—mouse igG (Life Technologies, y) and a green fluorescence Alexa 488 ‘dye— d goat—anti- rabbit lgG (Life Technologies, Germany) sequentially for the chemokine double ngs (or in case of green ?uorescence Alexa 488 dye—labeled goat-anti—mouse of CD68, lgG the second primary antibody was omitted for control). For the analysis donkey PD—L1, CD4, CD8 and CCL5 a red fluorescence Alexa Fluor 594 dye-labeled anti—rabbit dye- lgG (lnvitrogen, Germany) and a green fluorescence Alexa 488 labeled goat— anti—mouse used lgG (Life Technologies, Germany) were anti-mouse simultaneously. For the analysis of CD3 and CCL5 Alexa Fluor555 goat anti-rabbit IgG were lgG (H+L) molecular probes A21422 and Alexa Fluor 488 goat in methanol prior used. Cryo sections were fixed either with 4% PFA or 33% acetone After incubation of the first to staining according to dy recommendations. for 1 primary antibody overnight at 4 °C, Alexa Fluor 594 (1 :100 dilution) was applied hour. The second primary antibody was applied for 3 hours at room temperature detected with Alexa Fluor 488 (1:100 dilution) for 1 hour during sequential double incubated overnight staining. For aneous staining both primary antibodies were 1 hour. Sections were following both Alexa Fluor antibodies (1:100 dilution each) for mounted using Vectashield with DAPl (Vector, USA) for counterstain. Confocal images were obtained on a Nikon CZ Plus confocal microscope system. recognizing human CD3epsilon (1:100 dilution and Mouse monoclonal antibodies HIER1 for FFPE, 4% PFA on and HlER2 for cryo sections, clone PS1, CD8 (1 :50 Novocastra, UK and rabbit monoclonal anti—CD3, clone Sp7 from Abcam), dilution and HlER2 for FFPE, 1:100 dilution and 4% PFA fixation and for cryo sections, clone 4811, stra, UK), CCR5 (1:50 dilution and HlER1 for FFPE, 1:100 dilution, 4% PFA fixation and HIER1 for cryo sections, clone MM0065—6H20, clone VL1, abcam, UK), CCL5 (1:50 dilution and 4% PFA fixation for cryo sections, methanol BioLegend, USA), PD1 (1:50 dilution and HIER1 for FFPE, 33% acetone in fixation for cryo sections, clone NAT, abcam, UK), CD68 (1:200 dilution and HlER1 for FFPE, 1:700 dilution and 33% acetone in methanol on for cryo sections, acetone in clone KP1, abcam, UK), CD163 (1:500 dilution and HIER2 for FFPE, 33% ol fixation for cryo sections, clone EDHu—1, AbD Serotec, UK), CD44 (1:9000 dilution and HlER1 for FFPE, 1:5000 dilution, 4% PFA on and HIER2 for cryo ns, clone 156-3011, abcam, UK), CD74 (1:50 on and HIER 1 for FFPE, 1:75 dilution, 4% PFA fixation and HlER2 for cryo sections, clone LN2, abcam, UK), K167 (1:200 dilution, PFA fixation, clone MlB—1, DAKO, USA). CCR1 (1:501dilution and HlER1 for FFPE, 4% PFA fixation and HIER1 for cryo sections, clone MM0061- 7B17, abcam, USA), CXCL9 (1:100 dilution and 33% acetone in methanol fixation for cryo sections, clone MM0220-7F11, abcam, UK), CD11b (1:50 dilution and 33% acetone in methanol fixation for cryo sections, clone 2Q902, abcam, UK) and CXCL10 (1:50 dilution and 33% acetone in methanol fixation for cryo sections, clone 6D4, abcam, UK), interferon-alpha2 (1:50 on, clone EBI-1, eBioscience) and interferon— gamma (1:00 dilution, clone 827, BioLegend). Rabbit antibodies recognizing human PD—L1 (1:50 dilution and HIER2 for FFPE, 1:150 dilution and 4% PFA fixation for cryo sections, polyclonal, abcam, UK), CCR3 (1:800 dilution, Hl‘ER1 and 4% PFA fixation for cryo sections, clone Y31, abcam, UK), CD4 (1:150 dilution and 4% PFA fixation for cryo ns, clone SP35, Zytomed Systems, Germany), CD11b (1:500 dilution and 4% PFA on, clone EP1345Y, abcam, UK), CD8 (1 :150 dilution and 4% PFA fixation for cryo sections, clone SP16, Zytomed s, Germany) and CEACAM5 (1:100 on, clone 327, Sino ical). Classical H&E and TUNEL staining was performed according to manufacturer’s description (in situ cell death detection kit, Roche, Germany) and serial ns were used to quantify dead tumor cells by comparing TUNEL vs. morphological analysis. As the side—by- side. comparison of tissue sections med the excellent diagnostic value of morphological analysis as published previously (Quart vet 314.233) morphological analysis was the preferred method for evaluation. (e) Whole Slide (Immune) Cell Quantification The number of stained immune cells was d using a computerized image analysis system consisting of a NDP Nanozoomer (Hamamatsu Photonics, Japan) attached to a personal computer. Complete microscopic images of full tissue sections were automatically obtained (virtual microscopy) and the average cell density across the measured region was used for analysis. Cell counts were generated with 8 Specifically developed software program (VlS software suite, Visiopharm, Denmark) across a given region of st (on average 10 mmz, with up to 40 mmz) as reported previously (;i:i’alileittt2a,__e;ga;lt 200%) . evaluations were visually checked for tency. (f) Flow Cytometry 2017/056886 For each experiment, tissue from the invasive margin of colorectal cancer liver metastases (up to 10g) was dissociated by g and multiple g steps using in a 24- a 40pm cell strainer and RPMI medium. The extracted cells were then placed well plate with RPMI medium (supplemented by 10% FCS) overnight and then optionally d with Monensin (BD Biosciences, Germany) for three hours. Cells CCL5 using were then ted, centrifuged and analyzed for CD3, CD8, CD4 and flow cytometry rd protocols.

Surface staining was performed as follows: for each 100 pl FACS buffer 2,5 pl C03- V450(560365, BD, Germany), 1,25 pl CD4-PerCP—Cy5.5 (560650, BD, Germany) and 2,5 pl CD8—APC—H7 (641400, BD Biosciences, Germany) were used, followed by 20 min incubation on ice (protected from light) and centrifguation.

Intracellular staining was then med by taking up cells into 1% PFA and incubation for 15 min followed by three washing steps with 0.1 % Saponin buffer (and centrifugation). Staining of CCL5 was performed as follows: for each 100 pl 0.1 % J Saponin buffer 5 pl anti-human—RANTES (CCL5)—eFluor660 (AF647, eBioscience, UK) or isotype control mouse lgG2bk—eFluor660 with 1,25 pl , eBioScience, UK) were used, followed by 15 min incubation at room temperature (protected from light) and two washing steps with 0.1% Saponin buffer. Labeled cells were then subjected to FACS using a BD Biosciences FACS Canto ll cytometer (Harvard Stem Cell Institute), gated against negative controls.

To establish the positive control prior to measuring the tumor tissue and to identify lymphocyte populations, healthy donor lymphocytes were treated as outlined above.

Example 2: Combined modality treatment with parvovirus H-1 and checkpoint inhibitor in a patient having a metastasizing CRC (colorectal cancer) A t suffering from ctal cancer (poorly differentiated adenocarcinoma of colon transversum; mutation status: KRAS WT, NRAS WT, MSS; ?rst surgery 2013) with progressing liver ases (progression in size and number) was treated with a cumulative dose of 1.2 x 109 PFU parvovirus H—1 applied in three consecutive daily infusions (4 x 108 pfu; day 1-3), ed by treatment with the immune checkpoint inhibitor pembrolizumab (Keytruda®) according to the manufacturer’s posology (2 BW, day 1). This treatment with the same dosage regimen was repeated after weeks.

Biopsies performed on the liver metastasis were taken prior to treatment and at various time points during the treatment with the following sing findings: in comparison to the first biopsy which-was prior to the H-1PV + pembrolizumab treatment, lymphocytic infiltration was observed which increased in later biopsies (second and third biopsies). Furthermore, imaging analysis (ultrasound, CT, MRl) revealed a mass ion of the liver metastases.

Reference is made to Fig. 1-9 which show that during the treatment a significant increase in T cell density, with a dominant CD8+ T cell population, was observed.

The Tvcell infiltrates are heterogenous with striking vicinity of T cells with tumor cells.

Most T cells are PD1 positive.

Cytokine and chemokine quantification has been performed using the method as described in e 1 above: The profiles are shown in Fig. 10 to 15. Increases of lP1O and CCL5 seem to be prevailing. There was no increase in lL-2 and only mild increases in interferon gamma.

A FISH analysis was performed as described in Example 1 (a) above. it shows that active virus (H—1 PV) can be ined in the biopsy 2. This is a clear indication that the virus ed into the tumor/metastases.

Example 3: Combined modality treatment with parvovirus H-1 and checkpoint inhibitor in a primary inoperable GBM (glioblastoma multiforme) patient A patient suffering from inoperable glioblastoma multiforme was treated with a cumulative dose of 1.2 x 109 PFU parvovirus H~1 applied in three consecutive daily ons, followed by treatment with pembrolizumab uda®) according to the manufacturer’s posology (2 BW, 3 days after H1- PV administration). lVlRl was taken prior to the y and during the treatment with the ,H—1 PV + checkpoint inhibitor pembrolizumab. It revealed a size reduction of the tumor exceeding 30% after 55 days of treatment and a nearly complete remission at day 2017/056886 101. The patient is doing well and does not require any additional medication. The MRls are shown in Fig. 16.

List of References: Breitbach CJ, Burke J, Jonker D, Stephenson J, Haas AR, Chow LQ, Nieva J, Hwang TH, Moon A, Patt R et al (2011) intravenous delivery of a multi-mechanistic cancer- targeted tic poxvirus in humans. Nature 477: 99-102 Castro, F., Dirks, W.G., Fahnrich, 8., Hotz-Wagenblatt, A., Pawlita, M., and Schmitt, M. . High-throughput SNP-based authentication of human cell lines. lnt J Cancer 132, 308- 314.

Cotmore SF, Tattersall P (2007) Parvoviral host range and cell entry mechanisms.~ Adv Virus Res 70: 183-232 Di Piazza M, Mader C, Geletneky K, o y Calle M, Weber E, ofer J, .

Deleu L, Rommelaere J (2007) Cytosolic Activation of Cathepsins Mediates Parvovirus H-1—lnduced Killing of Cisplatin and TRAIL—Resistant Glioma Cells.

Journal of Virology 81: 4186—4198 Duan et al. 2003; J. Pathol. 199, 221—228 Geletneky K, Huesing J, Rommelaere J,,Schlehofer JR, Leuchs B, Dahm M, Krebs 0, von Knebel Doeberitz M, Huber B, Haida J (2012) Phase l/lla study of intratumoral/intracerebral or intravenous/intracerebral administration of Parvovirus H- ’l (ParvOryx) in patients with progressive primary or recurrent glioblastoma multiforme: ParvOrny1 protocol. BMC cancer 12: 99 Fridman, W.H., Pages, F., Sautes—Fridman, C., and Galon, J. (2012). The immune contexture in human tumours: impact on al outcome. Nat Rev Cancer 12, 298- 306.

Gabrilovich, D.l., d—Rosenberg, S., and Bronte, V. (2012). Coordinated regulation of myeloid cells by tumours. Nat Rev lmmunol 12, 253-268.

Halama, N., Braun, M., Kahlert, C., Spille, A., Quack, C., Rahbari, N., Koch, M., Weitz, J., Kloor, M., Zoernig, l., et al. (2011a). Natural Killer Cells are Scarce in Colorectal Carcinoma Tissue Despite High Levels of ines and nes.

Clinical cancer research : an of?cial journal of the American Association for Cancer ch 17, 678689.

W0 2017/167626 Halama, N., , 8., Kloor, M., Zoernig, l., Benner, A., Spille, A., Pommerencke, T., von, K.n.e.b.e.l.D.M., Folprecht, G., Luber, B., et al. (2011b). Localization and y of Immune Cells in the invasive Margin of Human Colorectal Cancer Liver Metastases Are Prognostic for Response to Chemotherapy. Cancer Res 71, 5670- 5677.

Halama, N., Michel, 8., Kloor, M., Zoernig, l., Pommerencke, T., von Knebel Doeberitz, M., Schirmacher, P., Weitz, J., Grabe, N., and Jager, D. (2009a). The localization and density of immune cells in primary tumors of human metastatic colorectal cancer shows an association with response to chemotherapy. Cancer immunity 9, 1.

Halama, N., Spille, A., Lerchl, T., Brand, K., Herpel, E., Welte, 8., Keim, 8., nn, B., Klupp, F., Kahlert, C., etal. (2013). Hepatic metastases of colorectal of immune cancer are rather homogeneous but differ from primary s in terms cell ration.Oncoimmunology 2, e24116.

Halama, N., Zoernig, l., Spille, A., Michel, 8., Kloor, M., Grauling—Halama, 8., Westphal, K., Schirmacher, P., Jaeger, D., and Grabe, N. (2010). Quantification of prognostic immune cell markers in colorectal cancer using whole slide imaging tumor maps. Anal Quant Cytol Histol 32, 333—340.

Halama, N., g, l., Spille, A., Westphal, K., Schirmacher, P., Jaeger, D., and Grabe, N. (2009b). tion of immune Cell Densities in Immune Cell Conglomerates: An Approach for High-Throughput Quantification. PL08 One 4, e7847.

Halama et al. (2016),“Tumoral immune cell exploitation in colorectal cancer liver metastases can be targeted effectively by anti-CCR5 therapy in cancer ts”; Cancer Cell, in press Hristov G, Kramer M, Li J, El—Andaloussi N, Mora R, Daeffler L, Zentgraf H, Rommelaere J, Marchini A (2010) Through Its Nonstructural Protein N81, Parvovirus H—1 Induces Apoptosis via lation of Reactive Oxygen Species. J Virol 84: 5909-5922 WO 67626 Nuesch JP, Lacroix J, Marchini A, Rommelaere J (2012) Molecular pathways: rodent parvoviruses-—mechanisms of oncolysis and prospects for clinical cancer treatment.

Clin Cancer Res 18: 3516—3523 Ohshima T, lwamaM, Ueno Y, ma F, Nakajima T, Fukamizu A, Yagami K (1998) induction of apoptosis in vitro and in vivo by H-1 parvovirus infection. The Journal of general virology 79 ( Pt 12): 3067—3071 Ran Z, Rayet B, Rommelaere J, Faisst S (1999) Parvovirus Hinduced cell death»: influence of intracellular NAD consumption on the regulation of is and apoptosis. Virus Res 65: 161-174 Rayet B, Lopez—Guerrero JA, Rommelaere J, Dinsart C (1998) Induction of programmed cell death by parvovirus H—1 in U937 cells: tion with the tumor necrosis factor alpha signalling pathway. J Virol 72: 8893-8903 Russell SJ, Peng KW, Bell JC (2012) Oncolytic virotherapy. Nat Biotechnol 30: 658— Ueno Y, Harada T, lseki H, Ohshlma T, Sugiyama F, Yagami K (2001) Propagation of rat parvovlrus in thymic lymphoma cell line )d and subsequent appearance of a resistant cell clone after lytic infection. J Virol 75: 3965—3970

Claims (12)

Claims 1.

1. A pharmaceutical ation containing (a) parvovirus H-1 and (b) an anti-PD1 antibody or an anti-PD-L1 antibody.

2. The ceutical combination of claim 1, n the anti-PD1- 5 antibody is pembrolizumab or nivolumab.

3. The pharmaceutical combination of claim 1 or 2, further comprising one or more additional therapeutic agents ed from chemotherapeutic agents, biotherapeutic agents, an immunogenic agents, immune stimulating cytokines and cells transfected with genes encoding 10 immune stimulating cytokines.

4. The use of (a) parvovirus H-1 and (b) an anti-PD1 antibody or an anti- PD-L1 antibody for the preparation of a pharmaceutical combination for the treatment of cancer.

5. The use according to claim 4, wherein the pharmaceutical combination 15 is adapted for sequential administration of (a) parvovirus H-1 and (b) the anti-PD1 dy or the anti-PD-L1 antibody.

6. The use according to claim 4 or 5, wherein the pharmaceutical combination is adapted for treatment of solid tumours, haematological cancer and/or cancer initiating stern cells. 20

7. The use according to any of claims 4 to 6, wherein the cancer is brain cancer, colon cancer, bladder cancer, liver cancer, breast cancer, kidney cancer, head/neck us cell carcinoma, lung cancer, malignant melanoma, ovarian cancer, atic cancer, prostate cancer, renal cell cancer or h cancer.

8. The use according to 25 claim 7, wherein the brain cancer is glioblastoma multiforme.

9. The use according to any one of claims 4 to 8, wherein the pharmaceutical combination is adapted for intratumoral or intravenous administration of (a) parvovirus H-1 and/or (b) the anti-PD1 dy or the D-L1 antibody.

10. A kit which comprises a first container, a second container and a package insert, wherein the first container comprises at least one dose of a pharmaceutical composition containing parvovirus H-1, the second ner comprises at least one dose of a pharmaceutical composition 5 comprising an anti-PD1 antibody or an anti-PD-L1 dy, and the package insert comprises ctions for applying the two pharmaceutical composition(s) as a combination to treat an individual having cancer.

11. The kit of claim 10, wherein the cancer is brain cancer, colon cancer, 10 bladder cancer, liver cancer, breast cancer, kidney cancer, head/neck squamous cell carcinoma, lung cancer, malignant melanoma, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer or h cancer.

12. The kit of claim 11, wherein the brain cancer is glioblastoma multiforme. WO 67626 Biopsy 1 (C03)