NZ742493B2 - A method for altering the functional state of mrna allowing its selective and specific recognition - Google Patents

Abstract

The invention relates to a method of altering the functional state of any mRNA enabling its selective and specific recognition and subsequent selective manipulation. The invention describes a universal principle for increasing the specificity and selectivity of molecular target recognition at the level of nucleic acids. The principle of the specific and selective recognition of nucleic acids is based on simultaneous complementary recognition/interference of two or more target sequences by two or more short sequence-specific oligonucleotides. Said oligonucleotides are mutually interconnected by a size-specific polymeric linking moiety, the length of which is adjusted to the mutual distance between the target sequences and the target nucleic acid, wherein targeting of said oligonucleotides results in the formation of a stable heteroduplex. Such a method of nucleic acid recognition through specific recognition of well-defined sequences of the nucleic acid that are spaced from each other by a defined distance, minimizes the probability of stable binding of the interfering construct to inadvertent nucleic acids, thereby dramatically increasing the selectivity of recognition of the targeted nucleic acid. vel of nucleic acids. The principle of the specific and selective recognition of nucleic acids is based on simultaneous complementary recognition/interference of two or more target sequences by two or more short sequence-specific oligonucleotides. Said oligonucleotides are mutually interconnected by a size-specific polymeric linking moiety, the length of which is adjusted to the mutual distance between the target sequences and the target nucleic acid, wherein targeting of said oligonucleotides results in the formation of a stable heteroduplex. Such a method of nucleic acid recognition through specific recognition of well-defined sequences of the nucleic acid that are spaced from each other by a defined distance, minimizes the probability of stable binding of the interfering construct to inadvertent nucleic acids, thereby dramatically increasing the selectivity of recognition of the targeted nucleic acid.

Description

A method for altering the functional state of mRNA allowing its selective and specific recognition Field of the Invention The ion relates to alteration of the functional state of any nucleic acid enabling its specific and ive recognition and subsequent selective manipulation. The present solution is fully universal and accessible in fields such as biotechnology, molecular biology, virology, medicine, etc. The invention has direct applicability and broad therapeutic potential most preferably in the field of oncology, but it is not restricted to this particular area.

Background of the Invention In the view of the t state of the art, unlike other, chemically similar constructs, the solution described in the present invention is designed with a diametrically different objective.

The bivalent system described in nt (Moeller, Udesen, 2011) ents a multifunctional construct for simultaneous interaction of the linked oligonucleotides with two separate target nucleic acids in order to saturate their binding sites and modulate thus their biological function. Since each oligonucleotide recognizes different target nucleic acid molecule, the construct itself principally functions in the same way as standard antisense ucleotide (with respect to the individual target nucleic acid molecules) and by no means increases the selectivity of their recognition.

Analogously, the conjugate of antisense oligonucleotides described in document (Agrawal et al., 2011) is ed to recognize two nucleic acid molecules (either identical or different), while similarly to document (Moeller, Udesen, 2011), recognizes the target nucleic acid molecules individually (i.e., via a single antisense ucleotide). Hence the document does not address the issue of their selective recognition.

Other chemically similar constructs described in documents (Kandimalla et al., 2009), (Epstein et al., 2005), (Zamore et al., 2005), (Agrawal et al., 2004) were designed for immunoregulation, to enhance their cellular uptake, miRNA recruiting and stimulatory purposes, respectively. However, none of them solves the problem of selective recognition of target nucleic acid les.

In all these cases, the described constructs represent only a kind of “superior”, multivalent form of the cting molecule, moreover that is designed to solve diametrically different issue, which is unrelated to the present solution. The fundamental differences thus lie in the fact that while the existing constructs do not solve the promiscuity of nse oligonucleotides, the present invention provides a solution to this problem.

While the current scientific dges in this field are directed to a treatment of oncological diseases it is important to note that fusion genes characteristic exclusively to tumor cells are causal in many tumor disease (leukemias, lymphomas, sarcomas, etc.) and can be certainly ered as a prospective target for anticancer y. The unique ce of fusion nucleic acid allows for specific and selective ing of tumor cells t therapeutic intervention in healthy cells. Anticancer therapies based on the interference of therapeutic agents with c acids thus can be directed against causal fusion nucleic acids and thus to achieve therapeutic effect exclusively in tumor cells. In the context of nse strategies it means targeted silencing of fusion genes via erence with the fusion mRNA, thereby preventing the synthesis of causal fusion proteins.

The issue of insufficient specificity of these antisense strategies (in the terms of binding specificity of therapeutic agents to the target sequence of mRNA, their binding affinity to the target mRNA and binding energy with the target mRNA) has been solved primarily by chemical modifications of the therapeutic agents, e. g. by chemical modification of ribose and/or phosphodiester backbone (Pirollo, Rait et al., 2003; Stahel, Zangmeister—Wittke, 2003; Jansen, Zangemeister—Wittke, 2002). Despite this, a final on has not yet been fied, since modified therapeutic agents are not sufficiently specific and ive, and they cause silencing of therapeutically off-target genes (Burnett, Rossi, 2012). This consequently ces the expression of non-targeted proteins resulting in s clinical side effects with negative impact on patient y of life.

With respect to the principle of target mRNA recognition, the application of a single therapeutic, sequence- specific oligonucleotide which binds to a c region of the target mRNA represents a commonly used rd of nse strategies. In case of fusion mRNA this specific region is most commonly the site of the direct fusion ofthe two individual fusion partners s et ai, 2007; Rangatia, Bonnet, 2006; Rapozzi et al., 2006; Scherr et al., 2005; Scherr et al., 2003; Tanaka et al., 1997). The published data however clearly indicate to the fact that despite a significant improvement in the physico-chemical properties of antisense therapeutic agents, the application of a single interfering oligonucleotide has not resolved hitherto the required progress in the issue of non-specific binding of antisense oligonucleotides to rtent mRNA molecules (Summerton et al., 2007).

The current state of the art hence still faces the ental challenge that is the specificity and selectivity of the eutic effect exclusively towards the primary target. A real progress in anticancer strategies thus does not lie in the development of new therapeutic agents per se, but in the development of systems that allow ive therapeutic action.

The limitation in terms of insufficient specificity and selectivity of ncer strategies is solved by the present invention that represents a universal on for any therapeutic strategy that is based on interference with nucleic acids. The principle of specific and selective recognition of a target nucleic acid together with the principle of selective action is described and explained via targeted interference with causal fusion genes, directly implementing the present invention into anticancer antisense strategies.

In all of the referred patents and publications the term "specificity" strictly refers to the complementary base pairing of the oligonucleotide and target sequenceof nucleic acid, i.e. specificity = complementarity; whereas in the present invention the term "specificity" refers to complementary recognition and binding to only one defined target nucleic acid, 1'. e. specificity = ive recognition of the target nucleic acid.

The present invention is hence clearly distinct from the existing antisense systems ed for controlled intervention of nucleic acids. In other words, the present invention represents a principally innovative solution.

Brief Summary of the Invention The insufficient specificity stemming from sequence homology to the target c acid, e. g. target mRNA, is effectively addressed by altering of functional state of the target mRNA enabling its selective and specific recognition and subsequent selective intervention, manipulation, detection, quantification, labeling, pre- targeting and g, wherein the mRNA is being targeted by a construct sing at least two sequence- ic oligonucleotides that are ly interconnected through a size-specific polymeric moiety the length of which defines their mutual distance, wherein each of the sequence-specific oligonucleotides targets a pre-defined target sequence of the mRNA resulting in a stable heteroduplex and through this alteration this mRNA is ively and specifically recognized. The ic and selective recognition of c acid subsequently can be used for selective therapeutic intervention when the transfer of genetic information coded by the nucleic acid is interrupted, or for diagnostic and research purposes.

By this alternation, defined sequences of nucleic acids are specifically recognized, wherein these sequences have to be at a precisely defined distance from each other. In the case of simultaneous recognition of defined sequences at defined distance from each other, the interfering system designed for the particular l distribution of target ces forms a thermodynamically preferred and tically stable bond with the target c acid. This principle of recognition minimizes the probability of non-specific interaction and stable binding to inadvertent nucleic acids and hence ed interference with nucleic acids outside the primary target is dramatically decreased.

The described principle of nucleic acid recognition dramatically increases the specificity and selectivity of interference with one single, particular ed defined nucleic acid. The described principle is fully universal and it is not restricted only to a mutual interconnection of two sequence-specific oligonucleotides, i.e. it enables purposeful interconnection of any number of oligonucleotides (n ≥ 2) through a corresponding number of terfering polymeric linking moieties (n ≥ 1), all with respect to the final application ion.

In a preferred embodiment of the invention, when the target mRNA is a fusion mRNA, each of the specified sequences is located on the respective fusion partner and the interfering system is targeted exclusively towards the fusion nucleic acid that directly ensures selective therapeutic action solely in tumor cells.

Moreover, since the antisense systems are able to have an effect in all cells comprising the target mRNA, the present invention brings the prospect of curative therapy, since its implementation allows selective therapeutic targeting of tumor stem cells. By the other words the described innovation brings the hope for full and permanent curing of the oncological disorder.

In the context of anticancer antisense gies directed to intervention of fusion genes, this principle enables stable interference with the targeted fusion mRNA solely only in the case, when both of the complementary sequences of the individual fusion partners, which furthermore are at a precisely d distance from each other, are recognized. By this means the specificity and selectivity of erence is significantly increased, whilst the probability of non-specific stable interaction with partially gous sequences is excluded. In the absence of aneous recognition of both of the complementary sequences, i.e. in the case of unwanted interaction with inadvertent mRNA, partial interaction of such system with the non-targeted mRNA is energetically unstable and results in spontaneous disconnection (Dias, Stein, 2002).

The application of the present invention in medicine is demonstrated via antisense systems ed for anticancer therapy with the y aim of selective intervention of causal fusion genes. In the context of oncological diseases characterized by the ce of fusion genes it means selective targeting ively of impaired cells that maximizes therapeutic intervention in the primary target by a fully revolutionary manner. In the field of oncology the present invention represents a revolutionary tool for intervening exclusively tumor cells (i.e. without intervention in healthy cells).

Detailed Description of the Invention The present solution that is the method of altering the functional state of any mRNA enabling its selective and specific ition and subsequent selective intervention, lation, detection, quantification, labeling, pre-targeting and sorting of this mRNA, is proposed to increase the specificity and selectivity of targeting of a particular nucleic acid, and altogether with the specified ation field (e.g. controlled inhibition of causal fusion genes; detection of presence and quantification of nucleic acids; nucleic acid labeling; pre- targeting and sorting of nucleic acids) forms integral and inseparable parts of the invention, by which the subject of invention is clearly defined. The subject matter of the invention thus involves c and selective targeting of any particular nucleic acid through simultaneous recognition of its two (or more) specified sequences, which moreover have to be at a pre-defined particular distance from each other.

From the view of the tiveness, the present invention provides a revolutionary tool increasing the selectivity and specificity of target nucleic acid recognition allowing its selective intervention, manipulation, detection, quantification, labeling, pre-targeting and sorting.

Selective recognition of a particular nucleic acid (preferably mRNA) in the described way can be subsequently utilized for ive eutic intervention of its natural biological function, when alteration of its functional state prevents the er of encoded genetic information. In this way the mechanism of the transfer of genetic information from nucleic acid to protein is interrupted, which in the case of fusion mRNA enables direct suppression of the expression of causal fusion oncoproteins.

Analogously, selective recognition of a particular nucleic acid (preferably mRNA) in the bed way resulting in alteration of its functional state can be subsequently used for various diagnostic or ch purposes: - for a direct detection, visualization, localization and quantification of the recognized nucleic acid (preferably mRNA) via purposeful incorporation of detectable moieties, e. g. FITC, RITC, isotope P32 into the primary structure of the sequence-specific oligonucleotides. The use of labeled sequence-specific oligonucleotides enables quantification of the recognized mRNA in the analyzed sample in situ, in vitro, in vivo and ex-vivo, - for purification and sorting of the recognized mRNA from other nucleic acids present in the sed sample, - for functional analysis of the particular genes via purposeful incorporation of photo-labile functional groups into the primary structure of the sequence-specific oligonucleotides enabling reversible alteration of the functional state of the recognized mRNA.

Terms and definitions nse system. Unlike the currently used antisense systems for controlled suppression of target mRNAs (Guo et al., 2013; Burnett, Rossi, 2012; Vaishnaw et al., 2010; Missalidis, 2008; Wang et al., 2003; Clark, 2000), the present invention ates their most significant limitation which is the insufficient specificity and ivity of y target recognition (i.e. promiscuity of antisense oligonucleotides). The promiscuity of standard antisense s that is closely linked with the length of the antisense oligonucleotide is effectively solved by simultaneous erence of two (or more) nse oligonucleotides, complementarily recognizing the target sequences localized at a precisely defined distance from each other. In the field of anticancer therapies and ally for controlled suppression of causal fusion genes, the t invention, via its design and mechanism of target mRNA recognition, represents apilot rto not applied) antisense system.

Construct. The described construct comprises two (or more) sequence-specific Oligonucleotides which are mutually interconnected through a size-specific polymeric linking moiety.

Sequence-specific oligonucleotide. Oligonucleotides represents ces which is complementary to the target nucleic acid (preferably mRNA) or to nucleic acid derivatives. Target nucleic acids are preferably of human .

Oligonucleotides may be formed by any nucleotides, optionally by chemical derivatives/analogues such as DNA, RNA, 2'-O-(2-methoxyethyl)—RNA, 2'-O-methyl-RNA, 2'-O-fluoro-RNA, LNA, PNA, morpholino, INA, FANA, ANA, UNA, HNA, etc., and within the present invention they may be mutually ed either as blocks of Oligonucleotides with a specific chemical modification or as individual Oligonucleotides comprising differently modified nucleotides. Both the nucleobases and the sugar-phosphate backbone may be chemically modified. : i 5 _ t - o l . ' ' - - °='i'° o- -oFl) 0= 0‘?‘° 0:2—6 . ase 0 0 ass 3“" Base 3—6 03° Base 0 0 ass 0 Base i ; <2 F <2? <3 1 I ; a l l—sN l : ‘~ : : 0 .

TNA FANA ANA “NA CeNA GNA l PNA I . ; . E . 9 o O _ 9 _ _ _ E O=Fl’-O 0=l?-0 (Hf—o oar-0 O=|f‘0 : O=$-N\ 0 O O 0 i 0 Base R : Slaw Base Base ass ass O ase 0 0 0 0 O : . k j NH: l N R . o : ovo Nl-j/O i : LNA Bridged Bridged i we : z : . - . 9 9 't‘” 9 ° ° — — =Ff—0Me e o=i|=-Me o:|f—s O=lf- H3 0312— e NH_ . o o o o o o o ‘l Ease ‘l Ease ] Ease B356 B 0 0 356 0 O O 1 358 O E o o E859 1 OH on OH : OH OH ------------------------ Examples of RNAderivatives A: modifications of the sugar moiety; B: modifications of the phosphate bond; C: modifications of the sugar- ate backbone.

In the present invention the first oligonucleotide, second oligonucleotide, optionally other ucleotide comprise a contiguous sequence of at least 3 nucleotides that is capable of base pairing to the complementary sequence of target nucleic acid (preferably mRNA), wherein - tides may be A, I, U, T, C, G or derivatives thereof — Oligonucleotides may se any mutual combination of nucleotides or derivatives thereof.

Other preferred sequences of Oligonucleotides are at least 4 nucleotides, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, no more than 30, no more than 29, no more than 28, no more than 27, no more than 26, no more than 25, no more than 24, no more than 23, no more than 22, no more than 21, no more than , no more than 19, no more than 18, no more than 17, no more than 16, no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3 nucleotides long.

The preferred length of the oligonucleotides (individually) is between 10 and 25 nucleotides.

Each of the oligonucleotides within one construct recognizes different complementary sequences of any but single defined target nucleic acid (preferably mRNA).

The length of ucleotides within one present construct may vary with respect to the particular application. A stronger interaction with the target nucleic acid may be achieved by a prolongation of the ucleotide length. On the other hand, prolongation of the oligonucleotides may impair their bioavailability and cellular internalization. However, since the present invention comprises two (or more) oligonucleotides in ation (cooperative simultaneous binding to the target nucleic acid), it is le to use shorter oligonucleotides, preferably ting of less than 17 nucleotides.

Size-specific ric linking moiety. The sequence-specific oligonucleotides are mutually interconnected via a size-specific ric linking moiety through covalent bond, maintaining the 5' to 3' orientation of all the consecutively onnected oligonucleotides. The polymeric linking moiety is attached to the 5' end of first oligonucleotide and the 3' end of second oligonucleotide , wherein the ucleotides are linked by said polymeric g moiety.

The polymeric linking moiety may consist of any sequence and number of nucleotides (or nucleotide derivatives/analogues), preferably between 3 and 50 nucleotides (in any of their combination). As well as the polymeric linking moiety may consist of abasic units, in which case the linking moiety is just a sugarphosphate or ally modified backbone.

The polymeric linking moiety may be covalently attached to the nucleobase or to the sugar-phosphate backbone of the oligonucleotides.

The polymeric linking moiety may e.g. be a polypeptide, polysaccharide, saturated or unsaturated hydrocarbon (C2-C40), preferably a water soluble natural or synthetic polymer though.

In a preferred ment, the polymeric linking moiety comprise a non-nucleotide polymer such as poly(meth)acrylate or ed eth)acrylate (preferably poly(ethyleneoxy) and 2(N,N- dimethylamino)ethyl (meth)acrylate), poly(vinylalcohol), poly(vinylpyrrolidone), poly(ethylene glycol), crylamide), poly(oxazoline), poly(ethyleneimine), poly(alkyleneoxide), lactone-based polymer, poly(acrylic acid), poly(lactide acid), poly(glycolic acid), poly(propylene), tyrene), poly(olefin), poly(amide), poly(cyanoacrylate), poly(imide), poly(ethylene terephtalate), poly(tetramethylene glycol), poly(urethane), as well as a mutual combination thereof or ation of other natural or synthetic rs (Kadajji, Betageri, 2011).

The length of the polymeric g moiety may be adjusted according to the specific application of the construct. The length of the polymeric linking moiety is preferably adjusted to the mutual distance between the target sequences of the target nucleic acid, preferably an mRNA. In case that the complementary sequences are up to 20 nucleotides far from each other, the final length of the size-specific polymeric linking moiety may be between 10-100 angstrom based on the distance between nucleotides in a linear, fully extended nucleic acid. The length of the polymeric linking moiety is not restricted and may be freely adjusted according to the final application. It is generally preferred that the polymeric linking moiety is no more than 1000 angstrom in length, no more as 900, 800, 700, 600, 500, 400, 300, 200 or 100 angstrom in length. It is also preferred that the polymeric linking moiety is at least 5 angstrom in length, such as 10, 15, 20, 25, 30, 35, 40 or 45 angstrom in .

Preferred ranges of the size-specific ric linking moiety are between 5 and 1000 angstrom, between 10 and 800 angstrom, between 20 and 500 angstrom, between 20 and 200 angstrom, between 10 and 1000 angstrom and n 20 and 80 angstrom.

Synthesis Sequence-specific oligonucleotides. The chemical sis of ce-specific oligonucleotides is carried out on a solid support using the phosphoroamidite method, i.e. via consecutive oligomerization of individual monomers derived from protected 2'-deoxynucleosides (dA, dC, dG, dT), ribonucleosides (A, C, G, U) or other ally modified sides, while both their particular selection and sequence order depend on the final application. The synthetic cycle involves step-wise conjugation of dual nucleosides to the growing oligomer in the order corresponding to the sequence complementary to the target nucleic acid (preferably mRNA). When completed, the sequence-specific oligonucleotide is released from the solid support to the solution, prepared for conjugation with the size-specific linking moiety.

Synthesis of RNA, DNA oligonucleotides.

Synthesis cycle. The sis of size-specific oligonucleotides proceeds step-wise in the 3' to 5' direction when one nucleotide is added to the growing oligomer per synthesis cycle until the desired sequence is obtained (Greco, Tor, 2007).

Step 1: De-tritylation (removal of protecting group) The dimethoxytrityl (DMT) protecting group is removed by a solution of an acid, e.g. 2% trichloroacetic acid or 3% dichloroacetic acid, in an inert solvent (dichloromethane or toluene).

Step 2 and 3: Activation and Coupling (conjugation of nucleosides) 0,02-0,2M solution of nucleoside phosphoramidite in acetonitrile is activated by 0,2–0,7M solution of an acidic azole catalyst i.e. 1H-tetrazole, 2-ethylthiotetrazole, 2-benzylthiotetrazole, 4,5-dicyanoimidazole, or other similar compounds (Wei, 2013). The activated phosphoramidite in 1,5 – 2,0-fold excess over the support-bound oligonucleotides is then reacted with the starting solid t (first coupling) or a supportbound oligonucleotide precursor (following couplings). The 5'-hydroxy group reacts with the activated phosphoramidite moiety of the ng nucleoside phosphoramidite to form a phosphite er linkage.

Upon the completion of the coupling reactions, any unbound reagents and by-products are removed by washing.

Step 4: Oxidation The newly formed tri-coordinated phosphite triester linkages are subsequently ed with iodine and water in the presence of weak bases (pyridine, lutidine, or collidine) into a tetra-coordinated ate triester.

Oxidation may be carried out under anhydrous conditions using tert-butyl hydroperoxide (Alul et al., 1991), or eventually using (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (Manoharan et al., 2000).

Step 5: Capping.

The solid support-bound material is treated with a mixture of acetic ide and ylimidazole.

After termination of the coupling and oxidation on, a small proportion of the solid support-bound 5'- OH groups (0,1 to 1%) remains unreacted and needs to be ently blocked, e.g. by acetylation, in order to prevent the formation of ucleotides with an internal base deletion commonly referred to as (n-1) shortmers.

Step 6: Cleavage Cleavage of the oligonucleotide from the solid support and de-protection is carried out using concentrated ammonium hydroxide.

Synthesis of RNA, DNA oligonucleotides with phosphorothioate backbone Modified oligonucleotides, wherein one of the oxygen atoms in the phosphodiester backbone is replaced with a sulfur atom, are sized ously to common RNA and DNA ucleotides (for details see the Synthesis cycle section). The difference lies in the replacement of the oxidation step with sulphurization.

Synthesis of LNA oligonucleotides Modified oligonucleotides, in which the ribose is modified by a covalent bridge between the 2'-O and 4'-C atoms, are synthesized according to Obika et al. (1997) and Koshkin et al. (1998).

Synthesis of PNA oligonucleotides Modified oligonucleotides, in which the sugar-phosphate backbone is formed by repeating N-(2-aminoethyl)- glycine units mutually linked via a peptide-like bond, are synthesized according to n et al. (1991).

Synthesis of Morpholino oligonucleotides Modified oligonucleotides, in which the nucleobase is linked to a morpholine ring and interconnected via a orodiamidate linkage, are synthesized according to Summerton and Weller (1991, 1993b, 1997).

Synthesis of GNA oligonucleotides Modified oligonucleotides, in which the sugar-phosphate backbone is constituted by repeating glycol moieties interconnected via a phosphodiester linkage, are sized according to Ueda et al. (1971) and Cook et al. (1995, 1999).

Synthesis of TNA oligonucleotides Modified oligonucleotides, in which the sugar-phosphate backbone is constituted by threose instead of ribose, are synthesized according to Chaput and Szostak (2003).

Size-specific polymeric linking moiety. Chemical sis of the size-specific linking moiety is performed using the common methods of organic and polymer chemistry, which allow to control the final molecular weight and hence the final length of the polymer chain, e.g. atom transfer radical polymerization (Matyjaszewski, Xia, 2001). The pecific polymeric g moiety may be a bifunctional moiety (i.e. functionally modified at both of its ends) to enable subsequent attachment to both of the sequence-specific oligonucleotides into a final, 5' to 3' oriented construct.

The bifunctional size-specific polymeric linking moiety is preferably formed by non-nucleotide polymers such as polyethylene glycol (PEG), however, the resulting uct is not restricted to this particular type of polymeric moiety (for a detailed description of possible structural variants see the ed description of the Invention n). PEGylation of nucleotides and the s of ation of PEGylated nucleotides have been bed previously by Jäschke et al. (1994) and Fischer et al. (2008). atively, if the size-specified polymeric linking moiety is not directly synthetized, it is le to use a cially available polymer moieties such as 17-O-DMT-hexaethyleneoxideO-phosphoramidite, 8- DMT-O-triethyleneoxideO-phosphoramidite, 6-DMT-hexane diolO-DMT-phosphoramidite, or 1,3- propanediol, phosphoramidite and others.

Construct. The synthesis of the final construct is carried out by consecutive conjugation of the size-specific polymeric linking moiety with the first ce-specific oligonucleotide and subsequent attaching the resulting precursor to the second sequence-specific oligonucleotide, e.g. via "click" chemistry (Presolski et al., 2011; Besanceney-webler et al., 2011; Bowman, Hoyle, 2010).

Brief Description of the Drawings Figure 1 depicts the general principle of highly specific interaction of the interfering system with the target sequence of the c acid via two sequence-specific oligonucleotides being mutually interconnected through a size-specific linking moiety. The proposed principle is universal and adjustable so that it enables purposeful onnection of any number of sequence-specific oligonucleotides (n ≥ 2) via a corresponding number of non-interfering size-specific linking moieties (n ≥ 1).

Figure 2 depicts the highly specific interaction of the interfering system with the target sequences of fusion mRNA via two sequence-specific oligonucleotides mutually interconnected through a size-specific g moiety. Each of the sequence-specific oligonucleotides binds to the corresponding sequence of the fusion partners.

The solution bed in this invention can be considered as universally applicable for selective and ic recognition of any target nucleic acid, ably fusion mRNA. In the t of antisense systems, when the target nucleic acid is a fusion mRNA (its presence unequivocally characterizes and distinguishes tumor cells from healthy ones), the present invention enables selective recognition and targeting solely of the tumor cells. The innovation in the form of ed selectivity and specificity of recognition solely of the target nucleic acid, preferably a fusion mRNA, allows controlled intervention of target fusion genes. e 1. Selective and specific recognition of the BCR-ABL fusion mRNA in chronic myelogenous leukemia or Ph+ acute blastic leukemia, or other neoplasia where BCR-ABL fusion mRNA is present, using the present invention.

The proposed construct selectively and specifically recognizes the BCR-ABL mRNA in a way when the first sequence-specific oligonucleotide targets the sequence of BCR and the second oligonucleotide targets the sequence of ABL, whilst both of the oligonucleotides are mutually interconnected through a size-specific polymeric linking moiety. It is also possible to apply more than two sequence-specific oligonucleotides, when each of them targets either the BCR or ABL, wherein each of the fusion partners is targeted by at least one oligonucleotide. The sequence-specific oligonucleotides are ly interconnected through a corresponding number of polymeric linking moieties. A stable, thermodynamically and energetically preferable complementary interaction n the construct and the targeted BCR-ABL mRNA is formed only in the case, when each of the target sequences is fully recognized and moreover spaced from each other by a certain distance defined by the pecific polymeric linking moiety. By this means the probability of stable binding of the construct to partially homologous mRNAs is minimized that prevents a stable ention with inadvertent mRNA molecules. With respect to the fact, that fusion BCR-ABL mRNA is exclusively present in tumor cells, the described principle of BCR-ABL mRNA recognition s in preferential and stable intervention solely in tumor cells, thereby to a selective recognition and targeting of tumor cells.

The ces of individual sequence-specific oligonucleotides within the construct are complementary to the target sequences of individual fusion partners BCR, ABL. The target sequences of BCR, ABL may be optional referring to the primary sequence of the fusion BCR-ABL mRNA, however in a preferred embodiment the distance of the target sequences from the fusion breakpoint site is no more than 100 nucleotides, irrespective of the particular fusion BCR-ABL mRNA variant. ‘ acgttcc cctc tgactatgag cgtgcagagt ggagggagaa catccgggag cagcagaaga agtgtttcag aagcttctcc tccg tggagctgca gatgctgacc aactcgtgtg tgaaactcca gactgtccac agcattccgc tgaccatcaa agaa gcccttcagc taqg_g§gtgacttt gagcctcagg gtctgagtga aqccgctcgt tggaactcca aqgaaaacct tctcgctgga cccagtgaaa atgaccccaa ccttttcgt tatg tqgc cagtggagat aacactctaa gcataactaa aggtgaaaag Partial primary ce of fusion BCR-ABL mRNA (GenBank: AJ311467.1); BCR — black, ABL — grey; target sequences are underlined. linking moiety (8 nt gap) 3' GTTATTCCTTC ———————————-———f GTCGCCGGTCATCGTAG 5’ Example of the construct designed for selective and specific recognition of BCR-ABL mRNA. The complementary oligonucleotide to BCR (17 nt) and ABL] (l7nt) are shown in black and grey, respectively.

Analogously to Example 1, Examples 2-7 in an abridged form as well as the list of other fusion mRNAs are given below.

Exampte 2. Selective and specific recognition of the AMLI-ETO fusion mRNA in acute myeloid leukemia M2 or other neoplasia where AMLI-ETO fusion mRNA is present, using the present ion. ‘ atcaaaa tcacagtgga tgggccccga gaacctcgaa athtactga gaaqcactcc acaatgccag actcacctgt gaag acgcaatcta ggctgactcc tccaacaatg ccacctcccc caactactca aggagctcca agaaccagtt catttacacc gacaacgtta actaai:ggca cgagccattc tcctacagcc ttgaatggcg ccccctcacc acccaatggc Partial primary sequence of fusion AMLI-ETO mRNA (GenBank: S78158.1); AMLI— black, ETO — grey; target sequences are underlined. linking moiety (17 nt gap) 3’ TAGTGTCACCTACCCG ---------------- GCATGACTCTTCGTGAGG 5' Example of the uct designed for ive and specific recognition ofAMLI-ETO mRNA. The complementary oligonucleotide to AMLI (16 nt) and ETO (18nt) are shown in black and grey, tively.

:Example 3. Selective and specific recognition of the CBFB—MYHII fusion mRNA in acute myeloid leukemia M4 or other sia where CBFB-MYHI 1 fusion mRNA is present, using the present ion. ‘ tttgaag atagagacag gtctcatcgg gaggaaatgg agejtoaag3__§ggg§gg_ggtc acagg‘gatgc ttaacgaggc Cgagggqaag gccattaagc: tggccaagga crgtggcgtcc ctcag‘ttccc agctccagga cacccaggag tt Partial primary sequence of fusion CBFB-MYH] 1 mRNA (GenBank: AF249897.1); CBFB — black, MYHII — grey; target sequences are underlined. linking moiety (12 nt gap) 3' TATCTCTGTCCAGAGTAGCC TTACTTCAACTCTCG 5' Example of the construct designed for selective and specific recognition of CBFB-MYHI 1 mRNA. The complementary ucleotide to CBFB (20 nt) and MYHII (15nt) are shown in black and grey, respectively.

Example 4. Selective and specific recognition of the MKLI fusion mRNA in acute myeloid leukemia or other neoplasia where RBM15-MKL1 fusion mRNA is present, using the present invention. ‘ tccctgt ggggggcaac aaagacaagg ccgg ggtccttcat gccttcccac cttgtgagtt ctcccagcag ttcctggatt cccctgccaa ggcactggcc aaatctgaag gagattacct ggtcatgatc cgtg ctttgaaaao tccaqqg ca gagc agagaaggag cttggagcgg gccaggacag aggactatct caaacggaag attcgttccc gqccggagag atcggagctg gtcaggatgc acattttgga agagaccth gctgagccar Partial primary sequence of fusion RBM15-MKL1 mRNA (GenBank: AF364035.1); RBM15 — black, MKLI — grey; target ces are underlined. linking moiety (8 nt gap) linking moiety (12 nt gap) 3' CGGTTTAGACTTCT --------- ACCAGTACTAGTAACAG TCAGGTCGGCGTAAAG 5' Example of the construct designed for selective and specific recognition of REM]5-MKL1 mRNA. The complementary oligonucleotide to RBMIJ' (14 nt, 17 nt) and MKLI (17 nt) are shown in black and grey, tively.

Example 5. Selective and specific recognition of the P fusion mRNA in acute myeloid leukemia or other neoplasia where MOZ—CBP fusion mRNA is present, using the present invention. ‘ aaatgaa cttttcccta gagaatactt ccgtcgtttg tcttcgcagg tcag gtgtcagtcc tcttctaaga ggaagtctaa agatgaagaa gaag agtcagatga Egctgatgat gggaataact qqgaacacaa qt.“ lit tog acagc Co'ttg-..§git—“ with gagggcagcc agcc actggagtga ac t agccagcaaa cagagcatgg tcaacagttt gcccaccttc cctacagata tcaaqaatac ttcagtcacc aacgtgccaa Partial primary sequence of fusion P mRNA (GenBank: A125 1844. l); MOZ — black, CBP — grey; target sequences are underhned. linking moiety (15 nt gap) linking moiety (13 nt gap) 3' TACTTCTCAGTCTACTAC ------ TGACCCTTGTGTTCAGGTA ------- ATCAGTTCGACCTCC 5' Example of the construct designed for selective and specific recognition ofMOZ-CBP mRNA.' The complementary oligonucleotide to MOZ (18 nt, 19 nt) and CBP (15 nt) are shown in black and grey, respectively.

Example 6. Selective and specific recognition of the TAFZN-TEC fusion mRNA in myxoid chondrosarcoma or other neoplasia where TEC fusion mRNA is present, using the present invention. ‘ ttatgat catg attcctatag tcaaaaccag cagtcctatc attcacaaag ggaaaactac agccaccaca cacaagatat gccctqcotc caagcccaat atagcccttc ccgtcggggt topaqtta£g_gggcgcagac atacagctcg gaatacacca cggagatcat gaaccccgac taeaccaagc tgaccatgga ccttggcagc atca cggctacagc Partial primary ce of fusion TAF2N-TEC mRNA (GenBank: AJ245932.1); TAFZN — black, TEC — grey; target sequences are underhned. g moiety (9 nt gap) linking moiety (13 nt gap) 3' GTGTGTGTTC ------ CGCAGGTTCGGGTTATA ——————— GTCCAAGGTCAATACG 5' Example of the construct designed for selective and specific recognition of TAFZN—TEC mRNA. The complementary oligonucleotides to TAF2N (16 nt) and TEC (17 nt, 16 nt) are shown in black and grey, respectively.

Example 7. Selective and specific recognition of the UT fusion mRNA in mediastinal carcinoma or other neoplasia where BRD4-NUT fusion mRNA is present, using the present invention. ‘ gagcgct atgtcacctc ctgtttgcgg aagaaaagga aacctcaagc tgagaaagtt gatgtgattg ccggctcctc gaag ggcttctcgt cctcagagtc ctcc agtgagtcca gctcctctga cagcgaagac tccgaaacag Cuggitl—lefllgiifl gatatgagca cctag tgccgccctg tctccatccc ttcc Ctttctccca ccaai:ttctq avcccaccaga ccacccaccc agggagccac ctccacagcc catca'tgcct Partial primary sequence of fusion BRsz-NUTmRNA (GenBank: AY166680.1); BRD4 — black, NUT — grey; target sequences are underlined. linking moiety (7 nt gap) linking moiety (7 nt gap) linking moiety (8 nt gap) 3 ' TCTCGAGGTCACTCAGGT —-—~ ACTGTCGCTTCTGAGGCT ---— AGACG'i.‘AAC(—?GCCC'I’GGC ——-- GTACTTTGGATCACGGCG 5 ' e of the uct designed for selective and specific recognition -NUT mRNA. The complementary oligonucleotides to BRD4 (18 nt, 18 nt) and NUT(18 nt, 18 nt) are shown in black and grey, respectively.

In analogy, it is possible to selectively and specifically recognize the following fusion mRNAs: fusion PML-RARA mRNA fusion BCM-ILZ mRNA fusion TEL-AMLI mRNA fusion CEV14-PDGFRB mRNA fusion TCR-RBTN2 mRNA fusion RBMIS-MKL mRNA fusion TMPRSSZ-ETS mRNA fusion TRK3 mRNA fusion NPM-ALK mRNA fusion TFE3-PRCC mRNA fusion PLZF-RARA mRNA fusion TFE3-ASPSCR1 mRNA fusion MLL-AF9 mRNA fusion PAX8—PPARG mRNA fusion DEK-CANmRNA fusion TETI-TP53 mRNA fusion FUS-ERG mRNA fusion TFEB-ALPHA mRNA fusion AMLI-MTG mRNA fusion TFE3-PSF mRNA fusion AMLl-EAP mRNA fusion CHOP-EWS mRNA fusion NUP98-PMX1 mRNA fusion PAX3-FKHR mRNA fusion MLL-AFPI mRNA fusion JAZFI-JJAZI mRNA fusion EA2-HLF mRNA fusion FUS-CREB312 mRNA fusion MOZ-P300 mRNA fusion TPM3-ALKmRNA fusion TEL-PDGFRB mRNA fusion CLTC-ALK mRNA fusion MLL-AFXI mRNA fusion V11 mRNA fusion EZA-PBXI mRNA fusion EWS-FLII mRNA fusion MLL-AF6 mRNA fusion AMZI-EVI-J mRNA fusion NUP98—HOXA9 mRNA fusion ETV6-MN1 mRNA fusion MLL-AF4 mRNA fusion MLL-ENL mRNA fusion NUP98-RAP1GDS1 mRNA fusion CALM-AF]0 mRNA fusion FUS—CHOP mRNA fusion PAX7-FKHR mRNA fusion SYT-SSXmRNA fusion EWS-CHNmRNA fusion TCF12-TEC mRNA fusion EWS-WTI mRNA fusion FE3 mRNA fusion -PDGFB mRNA fusion TPM4-ALK mRNA Other applications ofthe present invention are demonstrated via Examples 8-11.

Example 8. Selective and ic eutic intervention to the natural biological function of any mRNA, when after application of the present invention and alteration of the functional state of the recognized mRNA the er of genetic information coded by this mRNA is prevented. y, the mechanism of translation of the genetic information from mRNA to protein is interrupted which in case of a fusion mRNA, such as in es 1-7, results in direct suppression of the expression of causal fusion oncoproteins. e 9. Selective and specific detection of any mRNAs and subsequent quantification thereof, when ce-specific oligonucleotides contain an incorporated detectable label, such as FITC, RITC, P32 isotope, which after application of the present invention and alteration of the functional state of the recognized mRNA emits a detectable signal corresponding to the stable duplex.

Example 10. Purification and g of selectively and specifically recognized mRNA from other nucleic acids present in the ed sample, when the application of the present invention results in the alteration of the functional state of the recognized mRNA, i.e. a stable heteroduplex with different electrophoretic ty is formed. Consequently, it is possible to separate the ized mRNAs from other nucleic acids by applying of an external electric field. Analogously, via purposeful modification of sequence-specific oligonucleotides with primary antibodies, it is possible to sort the recognized mRNA after application of the present invention on the basis of its interaction with secondary antibodies.

Example 11. Functional analysis of individual genes, when a y structure of sequence-specific oligonucleotides contain incorporated photo-labile functional groups enabling reversible change of the functional state of recognized mRNA. After application of the t invention and alteration of the functional state of the recognized mRNA it is possible to reverse this effect by application of radiation of a required wavelength. In this way it is possible to ively and ically study effects of suppression of gene expression under in situ and in vivo ions.

Definitions of specific embodiments of the invention as claimed herein follow.

According to a first aspect of the invention, there is provided a method for altering of the functional state of any nucleic acid enabling its selective and specific recognition, and subsequently selective intervention, manipulation, detection, quantification, labeling, pre-targeting and sorting thereof, wherein, the nucleic acid is targeted by applying a construct formed by at least two sequence-specific -stranded oligonucleotides being mutually interconnected through a linking , the length of which is adjusted to the mutual distance between the target ces of the target nucleic acid, and which defines their mutual distance, n each of the sequence-specific single-stranded oligonucleotides is targeted to a predefined target ce of the nucleic acid resulting in the formation of a stable heteroduplex and on the basis of such alternation the nucleic acid is selectively and specifically recognized, provided said method is not performed within a human and provided that the linking moiety is not DNA.

According to a second aspect of the invention, there is provided a construct for altering the functional state of any nucleic acid enabling its selective and specific recognition, and subsequently selective intervention, lation, detection, quantification, labeling, pre-targeting and sorting thereof, wherein, the uct is targeting said nucleic acid to form a stable heteroduplex, and wherein the construct comprises at least two sequence-specific -stranded oligonucleotides being mutually interconnected through a linking moiety, each of the sequence-specific single-stranded oligonucleotides is targeted to a pre-defined target sequence of the nucleic acid resulting in the formation of a stable heteroduplex, each of the oligonucleotides within the one construct recognize different complementary sequences of the target nucleic acid, the length of the linking moiety is adjusted to the mutual distance between the target sequences of the target nucleic acid and is between 5 and 1000 angstrom, provided the linking moiety is not DNA.

According to a third aspect of the invention, there is provided a ition comprising a uct according to the second aspect when used in in vitro diagnostics.

According to a fourth aspect of the invention, there is provided use of a construct according to the second aspect in the manufacture of a medicament for diagnosing or treating cancer.

Claims (18)

1. A method for altering of the functional state of any nucleic acid enabling its selective and ic recognition, and subsequently selective intervention, manipulation, detection, quantification, labeling, pre-targeting and sorting thereof, wherein, the nucleic acid is targeted by ng a construct formed by at least two ce-specific single-stranded oligonucleotides being mutually interconnected through a linking moiety, the length of which is adjusted to the mutual ce between the target sequences of the target c acid, and which defines their mutual distance, wherein each of the sequence-specific single-stranded oligonucleotides is targeted to a pre-defined target sequence of the nucleic acid resulting in the formation of a stable heteroduplex and on the basis of such alternation the nucleic acid is selectively and specifically recognized, provided said method is not performed within a human and provided that the linking moiety is not DNA.

2. The method according to claim 1, wherein the nucleic acid is any mRNA.

3. The method according to claim 2, wherein any mRNA is a fusion mRNA.

4. The method according to claim 3, wherein each of the fusion partners of the target fusion mRNA is targeted by at least one sequence-specific oligonucleotide.

5. The method according to claim 3, wherein the target sequences are localized not more than 100 nucleotides from the fusion breakpoint site.

6. The method ing to claim 2, wherein the sequences of individual sequence-specific oligonucleotides of the construct are targeted according to the mentarity to individual predefined regions of mRNA.

7. The method according to claim 2, wherein the mRNA is targeted with a construct comprising at least 3 oligonucleotides, each of the oligonucleotides targets a fined target sequence of the individual regions of mRNA, wherein the oligonucleotides are being mutually interconnected through a corresponding number of size-specific linking moieties.

8. The method according to claim 2, n the length of the linking moiety ranges between 5 and 1000 angstrom.

9. The method according to claim 2, wherein the linking moiety is attached to the 5' end of the first oligonucleotide and to the 3' end of the second oligonucleotide.

10. The method according to claim 2, wherein the linking moiety is a polymeric linking moiety.

11. The method according to claim 1, wherein the g moiety comprises a) any sequence and number of nucleotides or tide derivatives/analogues selected from 2'-O-(2- methoxyethyl)-RNA, 2'-O-methyl-RNA, 2'O-fluoro-RNA, LNA, PNA, lino, INA, FANA, ANA, UNA or HNA units, or a combination thereof, wherein the linking moiety may also t of a sugar-phosphate backbone or any chemically modified abasic backbone; b) a polypeptide of any sequence; c) a polysaccharide; d) a saturated or unsaturated hydrocarbon (C 2-C 40); e) a cleotide polymer selected from poly(meth)acrylate or modified poly(meth)acrylate, poly(vinylalcohol), poly(vinylpyrrolidone), poly(ethylene glycol), poly(acrylamide), poly(oxazoline), poly(ethyleneimine), poly(alkyleneoxide), e-based polymer, poly(acrylic acid), actide acid), poly(glycolic acid), poly(propylene), poly(styrene), poly(olefin), poly(amide), poly(cyanoacrylate), poly(imide), poly(ethylene terephtalate), poly(tetramethylene glycol), poly(urethane), or ymers f.

12. The method according to claim 11, n the nucleotides or nucleotide tives/analogues selected from 2'-O-(2-methoxyethyl)-RNA, 2'-O-methyl-RNA, 2'O-fluoro-RNA, LNA, PNA, lino, INA, FANA, ANA, UNA or HNA units, or a combination thereof, comprise between 1 and 50 nucleotides in any combination.

13. The method according to claim 11, wherein the ed poly(meth)acrylate comprises poly(ethyleneoxy) and 2(N,N-dimethylamino)ethyl (meth)acrylate).

14. The method according to claim 1, wherein the length of sequence-specific oligonucleotides is at least 3 nucleotides, wherein they se any nucleotides or chemical derivatives/analogues thereof selected from DNA, 2'-O-(2-methoxyethyl)-RNA, 2'-O-methyl-RNA, 2'O-fluoro-RNA, LNA, PNA, morpholino, INA, FANA, ANA, UNA or HNA units, or a combination f, and may be ly combined either as blocks of oligonucleotides with a specific chemical modification or as individual oligonucleotides consisting of differently modified nucleotides.

15. The method according to claim 1, wherein the length of sequence-specific oligonucleotides ranges between 10 and 25 nucleotides.

16. A construct for altering the functional state of any nucleic acid enabling its selective and specific recognition, and subsequently ive intervention, manipulation, ion, quantification, labeling, pre-targeting and sorting thereof, wherein, the construct is targeting said nucleic acid to form a stable heteroduplex, and wherein the construct comprises at least two sequence-specific single-stranded oligonucleotides being mutually interconnected through a linking moiety, each of the sequencespecific single-stranded oligonucleotides is ed to a pre-defined target sequence of the nucleic acid resulting in the formation of a stable heteroduplex, each of the oligonucleotides within the one uct recognize different complementary sequences of the target nucleic acid, the length of the linking moiety is adjusted to the mutual distance between the target sequences of the target nucleic acid and is between 5 and 1000 angstrom, provided the linking moiety is not DNA.

17. A composition comprising the construct of claim 16, when used in in vitro diagnostics.

18. Use of a construct of claim 16 in the manufacture of a medicament for diagnosing or treating cancer.