NZ725576B2 - Method of treating lung adenocarcinoma - Google Patents

Method of treating lung adenocarcinoma Download PDF

Info

Publication number
NZ725576B2
NZ725576B2 NZ725576A NZ72557615A NZ725576B2 NZ 725576 B2 NZ725576 B2 NZ 725576B2 NZ 725576 A NZ725576 A NZ 725576A NZ 72557615 A NZ72557615 A NZ 72557615A NZ 725576 B2 NZ725576 B2 NZ 725576B2
Authority
NZ
New Zealand
Prior art keywords
ros1
fusion
compound
slc34a2
protein
Prior art date
Application number
NZ725576A
Other versions
NZ725576A (en
Inventor
Dana T Aftab
Peiwen Yu
Original Assignee
Exelixis Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Exelixis Inc filed Critical Exelixis Inc
Priority claimed from PCT/US2015/027800 external-priority patent/WO2015164869A1/en
Publication of NZ725576A publication Critical patent/NZ725576A/en
Publication of NZ725576B2 publication Critical patent/NZ725576B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Abstract

This invention is directed to the treatment of cancer in a patient, particularly a patient with lung adenocarcinoma, and more particularly a patient with SLC34A2-ROS1, CD74-ROS1, or FIG-ROSl fusion-positive non-small cell lung cancer, with an inhibitor of MET, VEGFR2, and ROS1 which is a compound of Formula (I): or a pharmaceutically acceptable salt thereof. Formula (I): or a pharmaceutically acceptable salt thereof.

Description

Method of Treating Lung Adenocarcinoma Cross Reference to Related Applications This PCT application claims the benefit of U.S. Provisional Application Serial No. 61/984,599, filed April 25, 2014, the disclosure of which is hereby incorporated by reference in its entirety.
Sequence Listing This application incorporates by reference in its entirety the Sequence Listing entitled “EX14-003C-PC_2015_04_20_SEQUENCE_LISTING_ST25.txt,” created on April 27, 2015, at 12:54 pm, that is 26 KB, and filed electronically herewith.
Field of the Invention This invention is directed to the detection, diagnosis and treatment of cancer, particularly lung adenocarcinoma, using an inhibitor of receptor tyrosine kinases.
Background of the Invention Lung cancer is the leading cause of cancer-related mortality worldwide. Recent developments in ed therapies have led to a treatment gm shift in non-small-cell lung cancer (NSCLC). Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N, Sunpaweravong P, Han B, Margono B, Ichinose Y, Nishiwaki Y, Ohe Y, Yang JJ, Chewaskulyong B, Jiang H, Duffield EL, Watkins CL, Armour AA, Fukuoka M. Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med. 2009 Sep 3;361(10):947-57.Maemondo M, Inoue A, Kobayashi K, Sugawara S, Oizumi S, Isobe H, Gemma A, Harada M, Yoshizawa H, Kinoshita I, Fujita Y, Okinaga S, Hirano H, Yoshimori K, Harada T, Ogura T, Ando M, Miyazawa H, Tanaka T, Saijo Y, ra K, Morita S, Nukiwa T; North-East Japan Study Group. Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. N Engl J Med. 2010 Jun 24;362(25):2380-8. Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), nib and erlotinib, and the stic lymphoma kinase (ALK) TKI, crizotinib, have shown al ty in NSCLC patients with EGFR mutations or ALK gene rearrangements. Kwak EL, Bang YJ, e DR, Shaw AT, Solomon B, Maki RG, Ou SH, Dezube BJ, Jänne PA, Costa DB, Varella-Garcia M, Kim WH, Lynch TJ, Fidias P, Stubbs H, Engelman JA, Sequist LV, Tan W, Gandhi L, Mino-Kenudson M, Wei GC, e SM, Ratain MJ, Settleman J, Christensen JG, Haber DA, Wilner K, Salgia R, Shapiro GI, Clark JW, e AJ. Anaplastic lymphoma kinase inhibition in non-small-cell lung . N Engl J Med. 2010 Oct 28;363(18):1693-703. Shaw AT, Camidge, Engelman JA, Solomon BJ, Kwak EL, Clark JW, Salgia R, Shapiro, Bang YJ, Tan W, Tye L, Wilner KD, Stephenson P, Varella-Garcia M, Bergethon K, Iafrate AJ, Ou SH. Clinical activity of crizotinib in advanced non-small cell lung cancer ) harboring ROS1 gene rearrangement. J Clin Oncol. 2012 30 (suppl; abstr 7508). Fusion of the KIF5B (the kinesin family 5B) gene and the RET oncogene has been recently reported as a driver mutation in 1–2% of NSCLC ts and are a focus as a therapeutic target. Kohno T, Ichikawa H, Totoki Y, Yasuda K, Hiramoto M, Nammo T, Sakamoto H, Tsuta K, Furuta K, Shimada Y, Iwakawa R, Ogiwara H, Oike T, Enari M, Schetter AJ, Okayama H, Haugen A, Skaug V, Chiku S, Yamanaka I, Arai Y, Watanabe S, Sekine I, Ogawa S, Harris CC, Tsuda H, Yoshida T, Yokota J, Shibata T. KIF5B-RET fusions in lung adenocarcinoma. Nat Med. 2012 Feb 12;18(3):375-7. Takeuchi K, Soda M, Togashi Y, Suzuki R, Sakata S, Hatano S, Asaka R, Hamanaka W, ya H, Uehara H, Lim Choi Y, Satoh Y, a S, Nakagawa K, Mano H, Ishikawa Y. RET, ROS1 and ALK fusions in lung cancer. Nat Med. 2012 Feb 3):378-81. Lipson D, Capelletti M, Yelensky R, Otto G, Parker A, Jarosz M, Curran JA, Balasubramanian S, Bloom T, Brennan KW, Donahue A, Downing SR, Frampton GM, Garcia L, Juhn F, ll KC, White E, White J, Zwirko Z, Peretz T, Nechushtan H, Soussan-Gutman L, Kim J, Sasaki H, Kim HR, Park SI, Ercan D, Sheehan CE, Ross JS, Cronin MT, Jänne PA, Stephens PJ. Identification of new ALK and RET gene fusions from colorectal and lung cancer biopsies. Nat Med. 2012 Feb 12;18(3):382-4. Thus, it is ng more important to identify key driver genes in NSCLC and to develop therapies for each genomic subset of patients. [0004a] In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of ing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such nts, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. y of the ion These and other needs are met, and/or the public at least provided with a useful choice by the present invention. Described herein is a method for treating lung adenocarcinoma using an inhibitor of tyrosine kinase activity, specifically, ROS1 kinase activity. The method comprises stering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt thereof that modulates ROS1 kinase and/or a ROS1 fusion protein to a patient in need of such treatment. In one ment, the lung adenocarcinoma is non-small cell lung cancer (NSCLC). More particularly, the lung adenocarcinoma is most ntly SLC34A2-ROS1 fusion-positive NSCLC, CD74-ROS1 fusion positive NSCLC, FIG-ROS1 fusion positive NSCLC, (e.g. CD74-ROS1, FIG-ROS1, FIG-ROS1(L), FIGROS1 (S), and S1(VL)) and NSCLC harboring other known ROS1 fusions proteins.
ROS1 kinase is encoded by the ROS1 gene on chromosome 6 in humans (6q22). [0005a] More specifically, in a first aspect, the present invention provides use of a compound of Formula I: Formula I or a pharmaceutically acceptable salt thereof, wherein: R1 is halo; R2 is halo; R3 is (C1-C6)alkyl; R4 is (C1-C6)alkyl; and Q is CH or N, in the manufacture of a medicament for the treatment of lung adenocarcinoma, wherein the lung adenocarcinoma is SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1 fusion-positive nonsmall cell lung cancer.
] In a second aspect, the present invention provides use of compound 1 H H N N O O CH3 O F H3C O N nd 1 or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of ROS1 fusion-positive non-small cell lung cancer.
Described herein is a method for treating NSCLC in a patient in need of such treatment, comprising administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt thereof that simultaneously tes ROS1 and/or a ROS1 fusion protein, to the patient.
In one embodiment, the ROS1 kinase inhibitor or ROS1 fusion kinase inhibitor is a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein: R1 is halo; R2 is halo; R3 is (C1-C6)alkyl; R4 is (C1-C6)alkyl; and Q is CH or N.
In another embodiment, the compound of Formula I is a compound of Formula Ia Formula Ia or a pharmaceutically able salt f, n: R1 is halo; R2 is halo; and Q is CH or N.
In another embodiment, the compound of Formula I is compound 1: H H N N O O CH3 O F H3C O N compound 1 or a pharmaceutically acceptable salt thereof. compound 1 is known as N-(4-{[6,7- bis(methyloxy)quinolinyl]oxy}phenyl)-N'-(4-fluorophenyl)cyclopropane-1,1- dicarboxamide and by the name Cabozantinib. On November 29, 2012, the S-malate salt (i.e., L-malate salt) of (6,7-dimethoxyquinolinyl)oxy]phenyl}-N′-(4-fluorophenyl) cyclopropane-1,1-dicarboxamide (also known as cabozantinib or COMETRIQ®) was approved by the United States Food and Drug Administration for the treatment of progressive, metastatic medullary thyroid cancer (MTC). In December 2013, the European Committee for Medicinal ts for Human Use (CHMP), issued a positive opinion on the Marketing ization Application (MAA), submitted to the European Medicines Agency, or EMA, for COMETRIQ for the proposed indication of ssive, unresectable, locally advanced, or metastatic MTC. Cabozantinib is being evaluated in a broad development program, including ongoing phase 3 pivotal trials in metastatic renal cell cancer (RCC), and advanced cellular cancer (HCC).
Compound 1 is a potent inhibitor of c-MET, RET, and VEGFR2. Yakes FM, Chen J, Tan J, Yamaguchi K, Shi Y, Yu P, Qian F, Chu F, Bentzien F, Cancilla B, Orf J, You A, Laird AD, Engst S, Lee L, Lesch J, Chou YC, Joly AH. Cabozantinib (XL184), a novel MET and VEGFR2 inhibitor, simultaneously suppresses metastasis, angiogenesis, and tumor growth. Mol Cancer Ther. 2011 Dec;10(12):2298-308; Bentzien, F., Zuzow, M., Heald, N., Gibson, A., Shi, Y., Goon, L., Yu, P., Engst, S., Zhang, W., Huang, S., Zhao, L., kaia, V., Chu, F., Bautista, R., Cancilla, B., Lamb, P., Joly, A. and Yakes, M. In vitro and in vivo activity of cabozantinib (XL184), an inhibitor of RET, MET, and VEGFR2, in a model of medullary thyroid cancer. d, 2013 (23) 577. In nical studies, compound 1-mediated tion of kinase activity produced rapid and robust regression of tumor vasculature, reduced, tumor invasiveness and metastasis, and prolonged survival. Sennino B., ro-Oonuma T, Wei Y, Naylor RM, Williamson CW, Bhagwandin V, Tabruyn SP, You WK, Chapman HA, Christensen JG, Aftab DT, McDonald DM. (2012), “Suppression of tumor invasion and metastasis by concurrent inhibition of c-Met and VEGF signaling in pancreatic neuroendocrine tumors.”, Cancer Discovery, 2(3):270-87 (Epublished, 2012).
In another ment, the compound of Formula I, Ia, compound 1, or a pharmaceutically acceptable salt f, is administered as a pharmaceutical composition comprising a pharmaceutically able additive, diluent, or excipient.
In one embodiment, the compound of a I, Ia, or compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable additive, diluent, or excipient is administered to inhibit oncogenic fusion kinases involving the orphan receptor tyrosine kinase ROS1 resulting from chromosomal rearrangements that lead to constitutive tion of the ROS1 kinase activity. These ROS1 fusion kinases are targeted for tion using the compound of Formula I, Ia, or compound 1or a pharmaceutically acceptable salt thereof. These compounds can be administered as a pharmaceutical composition comprising a pharmaceutically acceptable additive, diluent, or excipient to treat lung adenocarcinoma, for example, non-small cell lung carcinoma harboring one or more oncogenic ROS1 fusion kinases.
Described herein is a method for inhibiting a ROS1 kinase and/or ROS1 fusion kinase activity in one or more non-small cell lung cancers or NSCLC cell lines, comprising administering a therapeutically effective amount of a pharmaceutical composition comprising a compound of Formula I or the malate salt of a compound of Formula I or another pharmaceutically acceptable salt of a compound of Formula I to said non-small cell lung cancers or NSCLC cell lines harboring a ROS1 kinase and/or a ROS1 fusion polypeptide.
Described herein is a method for detecting, diagnosing and treating a ROS1 fusion positive NSCLC, for example, a SLC34A2-ROS1 fusion-positive NSCLC, and other known ROS1 fusion ve NSCLC, ing ROS1 fusions CD74-ROS1, S1, FIGROS1 (L), FIG-ROS1(S), and FIG-ROS1(VL), and other ROS1 fusion proteins d by the ROS1 gene on chromosome 6 in humans (See: Bergethon K, Shaw AT, Ou SH, Katayama R, Lovly CM, McDonald NT, Massion PP, Siwak-Tapp C, Gonzalez A, Fang R, Mark EJ, Batten JM, Chen H, Wilner KD, Kwak EL, Clark JW, Carbone DP, Ji H, Engelman JA, Mino-Kenudson M, Pao W, Iafrate AJ. ROS1 rearrangements define a unique molecular class of lung cancers. J Clin Oncol. 2012 Mar 10;30(8):863-70) comprising stering a therapeutically effective amount of a pharmaceutical composition comprising a compound of Formula I or the malate salt of a compound of Formula I or another pharmaceutically acceptable salt of a compound of Formula I, to a t in need of such treatment. In a specific embodiment, the compound of Formula I is compound 1 or the malate salt of compound 1, particularly the S-malate salt of compound 1.
Described herein is a method for treating a lung adenocarcinoma which is SLC34A2- ROS1 fusion positive non-small cell lung cancer in a patient in need of such treatment, comprising administering to the patient an effective amount of nd 1: H H N N O O CH3 O F H3C O N Compound 1 or a pharmaceutically acceptable salt f.
Described herein is a method for ng a lung adenocarcinoma which is CD74- ROS1 fusion positive non-small cell lung cancer in a patient in need of such treatment, sing administering to the patient an effective amount of compound 1: H H N N O O CH3 O F H3C O N Compound 1 or a ceutically acceptable salt thereof.
Described herein is a method for treating a lung adenocarcinoma which is FIG-ROS1 fusion positive non-small cell lung cancer in a patient in need of such treatment, comprising administering to the patient an effective amount of compound 1: H H N N O O CH3 O F H3C O N Compound 1 or a pharmaceutically acceptable salt thereof.
Described herein is a method for inhibiting ROS1 fusion kinase activity in a NSCLC cell, the method comprising contacting said cell with an effective amount of a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein: R1 is halo; R2 is halo; R3 is (C1-C6)alkyl; R4 is (C1-C6)alkyl; and Q is CH or N.
In the ption in this specification reference may be made to subject matter which is not within the scope of the appended claims. That subject matter should be readily identifiable by a person d in the art and may assist in putting into practice the invention as defined in the appended claims.
Brief Description of the Figures Figure 1 s a graphical representation of ROS1 fusion proteins known to exist in Non-Small Cell Lung Carcinoma (NSCLC) tumor samples. ROS1 rearrangements in NSCLC, glioblastoma, and cholangiocarcinoma. CD74(L)/(S), r of differentiation 74, long/short isoforms; EZR, ezrin; FIG, fused in glioblastoma; LRIG3, leucine-rich repeats and globulin-like domains 3; ROS1 TK, ROS1 tyrosine kinase domain with fusion partners; SDC4, syndecan-4; SLC34A2(L)/(S), solute carrier family 34 (sodium phosphate), member 2, hort isoforms; SDC4, syndecan-4; TPM3, tropomyosin 3. Exon numbers E32, E34, E35, or E36 indicate break points of ROS1. Red box denotes the transmembrane domain retained in ROS1.
Figure 2 depicts inhibition of phosphorylation of SLC34A2-ROS1 fusion in vitro in HCC-78 NSCLC cells that were stered single escalating doses of compound 1, or 3- [(1R)(2,6-dichlorofluorophenyl)ethoxy](1-piperidinylpyrazolyl)pyridin amine (Crizotinib; XALKORI®).
Figure 3 is the amino acid sequence of an exemplary human ROS1 protein denoted herein as SEQ ID NO:1.
Figure 4 is an exemplary amino acid sequence of human ROS1 kinase domain denoted herein as SEQ ID NO: 2.
Detailed Description of the ion iations and Definitions The following abbreviations and terms have the indicated meanings throughout this ation.
Abbreviation Meaning Ac Acetyl Br Broad °C Degrees Celsius c- Cyclo CBZ CarboBenZoxy = benzyloxycarbonyl d Doublet dd Doublet of doublet dt Doublet of triplet DCM Dichloromethane DME 1,2-dimethoxyethane DMF N,N-Dimethylformamide DMSO dimethyl sulfoxide EI Electron Impact ionization G Gram(s) h or hr Hour(s) HPLC High pressure liquid tography L Liter(s) M Molar or molarity m Multiplet Mg Milligram(s) MHz Megahertz (frequency) Abbreviation Meaning Min Minute(s) mL Milliliter(s) µL Microliter(s) µM Micromole(s) or micromolar mM Millimolar Mmol Millimole(s) Mol Mole(s) MS Mass spectral analysis N Normal or normality nM Nanomolar NMR Nuclear magnetic resonance spectroscopy q Quartet RT Room temperature s Singlet t or tr Triplet TFA oroacetic acid THF Tetrahydrofuran TLC Thin layer chromatography [0024a] The term “comprising” as used in this specification and claims means “consisting at least in part of”. When interpreting statements in this specification and claims which include the term “comprising”, other features besides the features prefaced by this term in each statement can also be present. Related terms such as “comprise”, “comprises”, and “comprised” are to be interpreted in similar manner.
The symbol “-” means a single bond, “=” means a double bond.
When chemical structures are depicted or described, unless explicitly stated ise, all carbons are assumed to have hydrogen substitution to conform to a valence of four. For example, in the ure on the and side of the schematic below there are nine ens implied. The nine ens are depicted in the hand structure. Sometimes a particular atom in a structure is described in textual formula as having a hydrogen or hydrogens as substitution (expressly defined hydrogen), for example, -CH2CH2-. It is understood by one of ordinary skill in the art that the aforementioned descriptive techniques are common in the chemical arts to provide brevity and simplicity to ption of otherwise complex structures.
H H H Br Br H H If a group “R” is depicted as “floating” on a ring system, as for e in the then, unless otherwise defined, a substituent “R” may reside on any atom of the ring system, assuming replacement of a depicted, implied, or expressly defined hydrogen from one of the ring atoms, so long as a stable structure is formed.
If a group “R” is depicted as floating on a fused ring system, as for example in the formulae: R H N Z H , or , or R then, unless otherwise d, a substituent “R” may reside on any atom of the fused ring , assuming replacement of a depicted hydrogen (for example the -NH- in the formula above), implied hydrogen (for example as in the formula above, where the hydrogens are not shown but understood to be present), or expressly defined hydrogen (for example where in the formula above, “Z” equals =CH-) from one of the ring atoms, so long as a stable structure is formed. In the example depicted, the “R” group may reside on either the 5-membered or the 6-membered ring of the fused ring system. When a group “R” is depicted as ng on a ring system containing saturated carbons, as for example in the formula: (R)y where, in this example, “y” can be more than one, assuming each replaces a tly depicted, implied, or expressly defined hydrogen on the ring; then, unless otherwise defined, where the resulting structure is stable, two “R’s” may reside on the same . A simple example is when R is a methyl group; there can exist a geminal dimethyl on a carbon of the depicted ring (an “annular” carbon). In another example, two R’s on the same carbon, including that carbon, may form a ring, thus ng a yclic ring (a “spirocyclyl” group) ure with the depicted ring as for example in the formula: “Halogen” or “halo” refers to fluorine, chlorine, bromine or iodine.
As used herein, “ROS1” protein or polypeptide includes mammalian ROS1, for example, human ROS1 kinase protein (encoded by the ROS1 gene) which is a 2347 amino acid long receptor tyrosine kinase that is prone to aberrant expression g to cancer. A description of full length human ROS1 kinase (with the amino acid sequence of the human ROS1 protein) can be found at UniProt Accession No. P08922. Additionally, there are multiple known lly-occurring variants of ROS1 (see, e.g., Greenman et al., Nature 446: 153-158, 2007). The tide and amino acid sequences of murine full-length ROS1 are known (see, e.g., UniProt Accession No. Q78DX7). Using routine experimentation, the ordinarily skilled biologist would be readily able to determine corresponding sequences in non-human mammalian ROS1 homologues.
By "wild-type" ROS1 is meant the full length ROS1 kinase (i.e., for human ROS1, the 2347 amino acid long polypeptide (SEQ ID NO:1) or 2320 amino acid long ptide (mature sequence) following removal of the signal peptide ce) in healthy (or normal) tissue (e.g., non-cancerous tissue) of a normal individual (e.g., a normal individual who is not suffering from cancer). ROS1 kinase (full length or truncated) does not appear to be expressed in normal lung tissue in humans. However, using the methods bed below, the inventors have made the surprising discovery of specific inhibition of ROS1 kinase in lung cancer cells using the compounds described . Such expression in an atypical cell (in this case a cancerous cell) where no expression is seen in a typical cell (e.g., a non-cancerous lung cell) is aberrant.
Aberrantly expressed ROS1 kinase, in the form of a fusion with another protein, for example, SLC34A2, CD74 or FIG, has been reported in glioblastoma (see Charest et al., Charest et al., Genes Chromosomes Cancer 37: 58-71, 2003; Charest et al., Proc. Natl. Acad.
Sci. USA 100: 916-921, 2003) in liver cancer (see, e.g., PCT Publication No.
WO2010/093928) in bile duct cancer (see Gu et al., PLOS one 2011 Jan 6;6(1):e15640. doi: .1371/journal.pone.0015640) and in NSCLC adenocarcinoma (See Kurtis D. Davies et al.
Identifying and Targeting ROS1 Gene Fusions in all Cell Lung Cancer, Clin Cancer Res. 2012 September 1; 18(17): 4570–4579).
As used , the term "ROS1 fusion" refers to a portion of the ROS1 polypeptide comprising the kinase domain of the ROS1 protein (or polynucleotide encoding the same) fused to all or a portion of r polypeptide (or polynucleotide encoding the same), where the name of that second polypeptide or polynucleotide is named in the fusion. (The term "fusion" simply means all or a portion of a polypeptide or polynucleotide from first gene fused to all or a portion of a polypeptide or a polynucleotide from a second gene). For example, an SLC34A2-ROS1 fusion is a fusion between a portion of the SLC34A2 polypeptide (or polynucleotide encoding the same) and a portion of the ROS1 polypeptide (or polynucleotide encoding the same) comprising the kinase domain ROS1. An ROS1 fusion often results from a chromosomal ocation or inversion. There are numerous known ROS1 fusions, all of which are ROS1 fusions of the present disclosure and e, without limitation, the SLC34A2-ROS1 fusion ns whose members include SLC34A2- ROS1(VS), SLC34A2-ROS1(S), SLC34A2-ROS1(L) (see U.S. Patent ation No. 20100143918), CD74-ROS1 (see U.S. Patent Publication No. 20100221737) and the FIGROS1 fusion proteins whose members include FIG-ROS1(S), FIG-ROS1(L), and FIGROS1 (XL) (see PCT Publication No. WO2010/093928), the disclosures of which are each incorporated herein in their entireties. The designation of (L), (S), (VS), (VL) (XS) or (XL) following a ROS1 polypeptide or ROS1 fusion, generally refers to long, short, very short, very long, extra short, and extra-long ROS1polypeptide or polynucleotide tively.
All of the known ROS1 fusion proteins comprise the full kinase domain of full length ROS1. Thus, as used herein, by a "polypeptide with ROS1 kinase activity" (or "polypeptide having ROS1 kinase activity") is meant a protein (or polypeptide) that includes the full kinase domain of full length ROS1 protein and, thus, retains ROS1 kinase activity. miting examples of ns with ROS1 kinase activity include, without limitation, full length ROS1 protein, the SLC34A2-ROS1 fusion proteins, whose members e 2-ROS1(VS), SLC34A2-ROS1(S), SLC34A2-ROS1(L) (see U.S. Patent Publication No. 43918), CD74-ROS1 (see U.S. Patent Publication No. 21737) and the FIG-ROS1 fusion proteins whose members include FIG-ROS1(S), FIG-ROS1(L), and FIG-ROS1(XL) (see PCT Publication No. WO2010/093928), and any truncated or mutated form of ROS1 kinase that retains the kinase domain of full-length ROS1 kinase n. An exemplary kinase domain of ROS1 is set forth in SEQ ID NO: 2, a "polypeptide with ROS1 kinase activity" is one whose amino acid sequence comprises SEQ ID NO: 2, or a kinase active portion thereof.
As used herein, "polypeptide" (or "amino acid sequence" or "protein") refers to a polymer formed from the linking, in a defined order, of preferably, a-amino acids, D-, L- amino acids, and combinations thereof. The link between one amino acid residue and the next is referred to as an amide bond or a peptide bond. Non-limiting examples of polypeptides include refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or ns thereof, and to naturally occurring or synthetic molecules. Polypeptides also include derivatized les such as glycoproteins and lipoproteins as well as lower molecular weight polypeptides. "Amino acid sequence" and like terms, such as "polypeptide" or in", are not meant to limit the ted amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
It will be recognized in the art that some amino acid ces of a polypeptide of the t disclosure can be varied without significant effect of the structure or function of the mutant protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity (e.g. the kinase domain of ROS1). In general, it is possible to replace residues that form the tertiary structure, provided that residues performing a r function are used. In other instances, the type of residue may be tely unimportant if the tion occurs at a itical region of the protein.
Thus, a polypeptide with ROS1 activity of the present disclosure further includes variants of the full length ROS1 protein or the various ROS1 fusion polypeptides described herein that shows substantial ROS1 kinase activity. Some non-limiting vative substitutions include the exchange, one for another, among the aliphatic amino acids Ala, Val, Leu and Ile; exchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; exchange of the amide residues Asn and Gln; exchange of the basic residues Lys and Arg; and exchange of the aromatic residues Phe and Tyr. Further examples of conservative amino acid substitutions known to those skilled in the art are: Aromatic: phenylalanine phan tyrosine (e.g., a tryptophan residue is replaced with a phenylalanine); Hydrophobic: leucine cine valine; Polar: glutamine asparagines; Basic: arginine lysine histidine; Acidic: aspartic acid glutamic acid; Small: alanine serine threonine methionine glycine. As indicated in detail above, further guidance concerning which amino acid changes are likely to be phenotypically silent (i.e., are not likely to have a significant deleterious effect on a function) can be found in Bowie et al., Science 247, supra.
“SLC34A2” may refer to the sodium-dependent phosphate transport protein 2B encoded by the human SLC34A2 gene protein, or the SLC34A2 gene. The human SLC34A2 protein (isoform A, which has an NCBI ion number NP_001171469) is a 689 amino acid protein. SLC34A2 is further described herein.
CD74 is also referred to as the HLA class II histocompatibility antigen gamma chain also known as HLA-DR antigens-associated invariant chain or CD74 (Cluster of Differentiation 74), is a protein that in humans is encoded by the CD74 gene. An illustrative human CD74 protein has an NCBI accession number of NP_001020329 and an mRNA accession number of NM_001025158. CD74 has 160 amino acids and is encoded by the CD74 gene located on chromosome 5 . CD74 has 9 exons. CD74 is further described herein.
FIG (Fused in Glioblastoma) is also referred to as “Golgi-associated PDZ and coiled- coil motif containing” or “GOPC” protein, is encoded by a gene located on chromosome 6 at 6q21. This protein in human has 462 amino acids. FIG has 3 isoforms produced by alternative ng. An exemplary human FIG protein referred to in the present disclosure has a UniProtKB identifier of Q9HD26-1.
“SLC34A2-ROS1 fusion protein or gene” refers to somatic gene fusions of the partners 2 and ROS1. In some embodiments, the SLC34A2-ROS1 fusion protein including N-terminal domain of a fusion partner, such as 2 and the C-terminal kinase domain of ROS1 n. The N-terminal domain of a fusion partner may be positioned at N- terminus of the fusion protein, and the inal kinase domain of ROS1 protein may be positioned at the C-terminus of the fusion protein. The fusion partner may be a N-terminal domain of SLC34A2 protein, which is positioned at N-terminus of the fusion protein. In this case, the fusion protein may be represented as SLC34A2-ROS1 protein which includes N- terminal domain of SLC34A2 protein at inus and C-terminal kinase domain of ROS1 protein at C-terminus. Another embodiment provides a fusion gene encoding the fusion n, where a gene encoding the N-terminal domain of the fusion partner positions at 5' end and a gene encoding the C-terminal kinase domain of the ROS1 protein positions at 3' end. In some ments, portions of the SLC34A2 protein is fused in frame to ns of the ROS1 protein comprising a functional kinase domain as a result of an aberrant chromosomal ocation yielding a ROS1 chromosomal ngement with SLC34A2. In some embodiments, SLC34A2-ROS1 fusion protein can include the fusion SLC34A2 exon 4- ROS1 exon 32. In some embodiments, SLC34A2-ROS1 fusion protein can include the fusion SLC34A2 exon 4-ROS1 exon 34 SLC34A2-ROS1 fusion protein or gene having a functional ROS1 kinase domain as used in the t disclosure may contain other breakpoints involving the two translocation partners SLC34A2 and ROS1. Exemplary SLC34A2-ROS1 fusion proteins can be found in COSMIC-Catalogue of somatic mutations in cancer database v.68 at cancer.sanger.ac.uk/cancergenome/projects/cosmic/ the contents of which are incorporated herein by reference in its entirety.
ROS1 fusion protein or gene” refers to c gene fusions of the partners CD74 and ROS1. Exemplary CD74-ROS1 fusion proteins can be found in COSMICCatalogue of somatic mutations in cancer se v.68 at cancer.sanger.ac.uk/cancergenome/projects/cosmic/ the contents of which are incorporated herein by reference in its entirety.
“FIG-ROS1 fusion protein or gene” refers to somatic gene fusions of the partners FIG and ROS1. In some embodiments, an intra-chromosomal homozygous deletion of 240 kilobases on human some 6, at position 6q21 is responsible for the formation of the FIG-ROS1 locus. In some embodiments, the FIG-ROS1 transcript is encoded by 7 FIG exons and 9 ROS1-derived exons. In some embodiments, the FIG-ROS1 gene encodes for an inframe fusion protein with a constitutively active and onal ROS1 kinase domain.
Exemplary FIG-ROS1 fusion proteins can be found in -Catalogue of somatic mutations in cancer database v.68 at cancer.sanger.ac.uk/cancergenome/projects/cosmic/ the contents of which are incorporated herein by nce in its entirety.
“Patient” for the purposes of the present sure includes humans and other animals, particularly mammals, and other organisms. Thus the methods are applicable to both human therapy and veterinary applications. In r embodiment the patient is a mammal, and in another embodiment the patient is human.
“Pharmaceutically acceptable salt” of a compound means a salt that is pharmaceutically acceptable and that possesses the desired pharmacological ty of the parent compound. It is understood that the pharmaceutically acceptable salts are non-toxic.
Additional information on suitable pharmaceutically acceptable salts can be found in Remington’s Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, which is incorporated herein by reference or S. M. Berge, et al., “Pharmaceutical Salts,” J. Pharm. Sci., 1977;66:1-19 both of which are incorporated herein by reference.
Examples of pharmaceutically acceptable acid addition salts include those formed with inorganic acids such as hloric acid, romic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; as well as organic acids such as acetic acid, trifluoroacetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, malic acid, citric acid, benzoic acid, cinnamic acid, 3-(4-hydroxybenzoyl)benzoic acid, ic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, glucoheptonic acid, 4,4’-methylenebis-(3-hydroxyenecarboxylic acid), 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfuric acid, ic acid, glutamic acid, hydroxynaphthoic acid, lic acid, stearic acid, muconic acid, p-toluenesulfonic acid, and salicylic acid and the like.
“Prodrug” refers to compounds that are transformed (typically rapidly) in vivo to yield the parent compound of the above formulae, for example, by hydrolysis in blood. Common es include, but are not limited to, ester and amide forms of a compound having an active form bearing a ylic acid moiety. Examples of pharmaceutically acceptable esters of the compounds of this invention include, but are not limited to, alkyl esters (for example with between about one and about six carbons) the alkyl group is a straight or branched chain. Acceptable esters also e cycloalkyl esters and arylalkyl esters such as, but not limited to benzyl. es of pharmaceutically acceptable amides of the compounds of this invention include, but are not limited to, primary amides, and secondary and tertiary alkyl amides (for example with between about one and about six carbons). Amides and esters of the compounds of the present invention may be ed according to conventional methods.
A thorough discussion of prodrugs is provided in T. Higuchi and V. Stella, “Pro-drugs as Novel ry s,” Vol. 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incorporated herein by reference for all purposes.
“ROS1” or the “ROS1 protein” is a transmembrane receptor tyrosine kinase, and is further bed .
“Therapeutically effective ” is an amount of a compound of the invention, that when administered to a patient, ameliorates a m of the disease. A therapeutically effective amount is intended to include an amount of a compound alone or in combination with other active ingredients effective to modulate c-Met, and/or VEGFR2, or ive to treat or prevent cancer. The amount of a compound of the invention which constitutes a “therapeutically ive amount” will vary depending on the compound, the disease state and its severity, the age of the patient to be treated, and the like. The therapeutically effective amount can be determined by one of ordinary skill in the art having regard to their knowledge and to this disclosure.
“Treating” or “treatment” of a disease, disorder, or syndrome, as used herein, includes (i) preventing the disease, disorder, or syndrome from occurring in a human, i.e. causing the clinical symptoms of the disease, disorder, or syndrome not to develop in an animal that may be exposed to or predisposed to the disease, disorder, or syndrome but does not yet experience or display symptoms of the disease, disorder, or syndrome; (ii) reversing or ting the disease, disorder, or syndrome, i.e., arresting its development; and (iii) relieving the disease, disorder, or syndrome, i.e., causing regression of the e, disorder, or syndrome. As is known in the art, adjustments for systemic versus localized delivery, age, body weight, l health, sex, diet, time of administration, drug interaction and the severity of the condition may be ary, and will be ascertainable with routine experience.
“Yield” for each of the reactions bed herein is expressed as a percentage of the theoretical yield.
Embodiments In one embodiment the compound of Formula I is the compound of Formula Ia: Formula Ia or a pharmaceutically acceptable salt thereof, wherein: R1 is halo; R2 is halo; and Q is CH or N.
In another embodiment, the compound of Formula I is compound 1: H H N N O O CH3 O F H3C O N Compound 1 or a pharmaceutically acceptable salt thereof. As indicated previously, compound 1 is referred to herein as N-(4-{[6,7-bis(methyloxy)quinolinyl]oxy}phenyl)-N'-(4- fluorophenyl)cyclopropane-1,1-dicarboxamide. , which is incorporated herein by reference in its entirety, discloses compound 1 and describes how it is made (WO 2005/030140, Example 12, 37, 38, and 48) and also discloses the therapeutic activity of this compound to t, regulate and/or modulate the signal transduction of kinases, (WO 2005/030140, Assays, Table 4, entry 289). Example 48 is on paragraph [0353] in WO 2005/030140.
In other embodiments, the compound of Formula I, Ia, or compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition, wherein the pharmaceutical ition additionally comprises a ceutically acceptable carrier, excipient, or diluent. In a specific embodiment, the compound of Formula I is compound 1.
The nd of Formula I, Formula Ia and compound I, as described herein, es both the recited compounds as well as individual isomers and es of isomers.
In each instance, the compound of Formula I includes the pharmaceutically acceptable salts, hydrates, and/or solvates of the recited compounds and any individual s or mixture of isomers thereof.
In other embodiments, the compound of Formula I, Ia, or compound 1 can be the (L)- malate salt. The malate salt of the compound of Formula I and of compound 1 is disclosed in and USSN 095, both of which are incorporated herein by nce in their entireties.
In other embodiments, the compound of Formula I is the (D)-malate salt, which is also ed to as the R-malate salt.
In other ments, the compound of Formula Ia is the malate salt.
In other embodiments, the compound of Formula Ia is the (L)-malate salt, which is also referred to as the S-malate salt.
In other embodiments, compound 1 is the (D)-malate salt, which is also referred to as the S-malate salt.
In other embodiments, compound 1 is the malate salt.
In other ments, compound 1 is the (L)-malate salt, which is also referred to as the S-malate salt.
In another embodiment, the malate salt is in the crystalline N-1 form or the N-2 form of the (L) malate salt and/or the (D) malate salt of compound 1 as disclosed in United States patent Application Ser. No. 61/325095. Also see , incorporated by nce in its ty, for the properties of lline enantiomers, including the N-1 and/or the N-2 crystalline forms of the malate salt of nd 1. Methods of making and characterizing such forms are fully described in PCT/US10/021194, which is incorporated herein by reference in its entirety.
Described herein is a method for reversing or inhibiting NSCLC, comprising administering to a patient in need of such treatment a therapeutically ive amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, in any of the embodiments disclosed herein. In a specific ment, the compound of Formula I is compound 1, or a pharmaceutically acceptable salt thereof. bed herein is a method for reversing or inhibiting SLC34A2-ROS1fusion- positive NSCLC, comprising administering to a patient in need of such treatment a therapeutically ive amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, in any of the embodiments disclosed herein. In a specific embodiment, the compound of Formula I is compound 1 or a pharmaceutically able salt thereof.
Described herein is a method for reversing or inhibiting CD74-ROS1fusion-positive NSCLC, comprising stering to a patient in need of such treatment a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, in any of the embodiments disclosed herein. In a specific embodiment, the compound of Formula I is compound 1 or a pharmaceutically able salt thereof.
Described herein is a method for reversing or inhibiting S1fusion-positive NSCLC, comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, in any of the embodiments disclosed . In a specific embodiment, the compound of Formula I is compound 1 or a pharmaceutically acceptable salt thereof.
In another embodiment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, is stered before, concurrently, or subsequent to one or more other treatments. In another embodiment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered subsequent to one or more treatments. “Treatment” means any of the treatment options are available to the skilled n, including surgery, chemotherapeutic agents, hormone therapies, antibodies, immunotherapies, radioactive iodine therapy, and radiation. In particular, “treatment’ means another chemotherapeutic agent or antibody.
Thus, in another embodiment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine ent.
In another embodiment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered post-docetaxel treatment.
In another embodiment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, is stered post HER-2 antibody treatment. In another ment, the HER-2 antibody is trastuzumab.
In another ment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine and/or docetaxel treatment.
In another embodiment, the compound of Formula I, Ia, or compound 1, or a pharmaceutically acceptable salt thereof, is administered orally once daily as a tablet or capsule. In these and other embodiments, the compound of a I, or a pharmaceutically acceptable salt thereof, is compound 1, or a ceutically acceptable salt thereof.
In another embodiment, compound 1 is administered orally as its free base or the malate salt as a capsule or tablet.
In another ment, compound 1 is stered orally once daily as its free base or as the malate salt as a capsule or tablet containing up to 100 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 100 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a e or tablet containing 95 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 90 mg of compound 1.
In another embodiment, nd 1 is stered orally once daily as its free base or as the malate salt as a capsule or tablet containing 85 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 80 mg of compound 1.
In another ment, nd 1 is stered orally once daily as its free base or as the malate salt as a capsule or tablet containing 75 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a e or tablet containing 70 mg of compound 1.
In another embodiment, compound 1 is stered orally once daily as its free base or as the malate salt as a e or tablet containing 65 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 60 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 55 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 50 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 45 mg of compound 1.
In another ment, compound 1 is stered orally once daily as its free base or as the malate salt as a capsule or tablet containing 40 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 35 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 30 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 25 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 20 mg of compound 1.
In another embodiment, compound 1 is stered orally once daily as its free base or as the malate salt as a e or tablet containing 15 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet ning 10 mg of compound 1.
In another embodiment, compound 1 is administered orally once daily as its free base or as the malate salt as a capsule or tablet containing 5 mg of compound 1.
In another embodiment, compound 1 is administered as its free base or malate salt orally once daily as a tablet as provided in the following table.
Ingredient (% w/w) Compound 1 31.68 Microcrystalline Cellulose 38.85 Lactose anhydrous 19.42 Hydroxypropyl Cellulose 3.00 Croscarmellose Sodium 3.00 Total Intra-granular 95.95 Silicon dioxide, Colloidal 0.30 Croscarmellose Sodium 3.00 Magnesium Stearate 0.75 Total 100.00 In another embodiment, compound 1 is administered orally as its free base or malate salt once daily as a tablet as provided in the following table.
Ingredient (% w/w) Compound 1 25.0-33.3 Microcrystalline Cellulose q.s Hydroxypropyl Cellulose 3 Poloxamer 0-3 rmellose Sodium 6.0 Colloidal n Dioxide 0.5 Magnesium te 0.5-1.0 Total 100 In another embodiment, compound 1 is administered orally as its free base or malate salt once daily as a tablet as provided in the following table.
Ingredient Theoretical Quantity (mg/unit dose) Compound 1 100.0 Microcrystalline Cellulose PH- 155.4 Lactose Anhydrous 60M 77.7 Hydroxypropyl Cellulose, EXF 12.0 Croscarmellose Sodium 24 dal Silicon Dioxide 1.2 Magnesium Stearate (Non- 3.0 Bovine) Opadry Yellow 16.0 Total 416 Any of the tablet formulations provided above can be adjusted ing to the dose of compound 1, or a pharmaceutically acceptable salt thereof desired. Thus, the amount of each of the formulation ingredients can be proportionally adjusted to provide a table formulation containing various amounts of compound 1 as provided in the previous aphs. In another embodiment, the formulations can n 20, 40, 60, or 80 mg of compound 1, or a pharmaceutically acceptable salt thereof. bed herein is a method for ting or reversing the progress of abnormal cell growth in a mammal, comprising administering a compound of Formula I, or a pharmaceutically acceptable salt thereof, wherein the abnormal cell growth is cancer mediated by a ROS1 fusion protein, for example, SLC34A2-ROS1 fusion protein, CD74- ROS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, S1(S) fusion protein, and FIG-ROS1(VL) fusion n, and other ROS1 fusion proteins comprising a functional C-terminal ROS1 kinase domain as encoded by the ROS1 gene on chromosome 6 in humans (6q22). In one embodiment, the cancer is lung adenocarcinoma. In another, the lung adenocarcinoma is non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is SLC34A2-ROS1 fusion-positive all cell lung cancer. In another embodiment, the lung adenocarcinoma is CD74-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is FIG-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is a ROS1 fusion-positive non-small cell lung . In r ment, a nd of Formula I, or a pharmaceutically acceptable salt thereof is administered as a pharmaceutical composition comprising a compound of Formula I, or a ceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier. In another ment, the compound of Formula I is administered subsequent to another form of treatment. In another embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine treatment. In another embodiment, a compound of Formula I or a pharmaceutically acceptable salt thereof, is administered postcarboplatin and/or abine treatment. In another embodiment, a nd of Formula I is administered post-crizotinib treatment. In another embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered post-crizotinib and/or gemcitabine treatment. In another embodiment, a nd of Formula I or a pharmaceutically acceptable salt f, is administered post-docetaxel treatment. In another embodiment, a compound of Formula I is administered post-carboplatin treatment. In another embodiment, a compound of Formula I or a pharmaceutically acceptable salt thereof, is stered post-cisplatin and/or gemcitabine and/or docetaxel ent. In another embodiment, a compound of a I or a pharmaceutically acceptable salt thereof, is administered post-carboplatin and/or gemcitabine and/or docetaxel treatment. In another ment, a compound of Formula I or a ceutically acceptable salt thereof, is administered post-crizotinib and/or gemcitabine and/or docetaxel treatment.
Described herein is a method for inhibiting or ing the progress of abnormal cell growth in a mammal, comprising stering a compound of a Ia, or a pharmaceutically acceptable salt thereof, wherein the abnormal cell growth is cancer mediated by a ROS1 fusion protein, for example, SLC34A2-ROS1 fusion n, CD74- ROS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion protein, and FIG-ROS1(VL) fusion protein, and other ROS1 fusion proteins comprising a functional C-terminal ROS1 kinase domain as encoded by the ROS1 gene on chromosome 6 in humans (6q22). In one embodiment, the cancer is lung adenocarcinoma. In r, the lung adenocarcinoma is non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is SLC34A2-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is CD74-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is FIG-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is a ROS1 fusion-positive all cell lung . In another embodiment, a compound of Formula Ia, or a pharmaceutically acceptable salt thereof is administered as a pharmaceutical composition comprising a compound of Formula Ia, or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier. In another embodiment, the compound of Formula Ia is administered subsequent to another form of treatment. In another embodiment, a compound of Formula Ia, or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine treatment. In another embodiment, a compound of Formula Ia, or a pharmaceutically acceptable salt thereof, is administered postdocetaxel treatment. In another embodiment, a compound of Formula Ia, or a pharmaceutically acceptable salt thereof, is stered post-cisplatin and/or gemcitabine and/or docetaxel treatment. In another ment, a nd of a Ia or a pharmaceutically acceptable salt thereof, is administered post-carboplatin and/or gemcitabine treatment. In another embodiment, a compound of Formula Ia, or a pharmaceutically able salt thereof, is administered post-crizotinib ent. In another embodiment, a compound of Formula Ia, or a pharmaceutically acceptable salt thereof, is administered postcrizotinib and/or gemcitabine treatment. In another embodiment, a nd of Formula Ia or a pharmaceutically able salt thereof, is administered post-docetaxel treatment. In another embodiment, a compound of Formula Ia is administered post-carboplatin treatment.
In another embodiment, a compound of Formula Ia or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine and/or docetaxel treatment. In another embodiment, a nd of Formula Ia or a pharmaceutically acceptable salt thereof, is administered arboplatin and/or abine and/or xel treatment. In r embodiment, a compound of Formula Ia or a pharmaceutically acceptable salt thereof, is administered post-crizotinib and/or gemcitabine and/or docetaxel treatment.
Described herein is a method for inhibiting or reversing the progress of abnormal cell growth in a , comprising administering compound 1 or a pharmaceutically acceptable salt thereof, wherein the abnormal cell growth is cancer mediated by a ROS1 fusion protein, for example, SLC34A2-ROS1 fusion protein, CD74- ROS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion n, and FIG-ROS1(VL) fusion protein, and other ROS1 fusion proteins sing a functional C-terminal ROS1 kinase domain as encoded by the ROS1 gene on chromosome 6 in humans (6q22). In one ment, the cancer is lung adenocarcinoma. In r, the lung adenocarcinoma is all cell lung cancer. In another embodiment, the lung adenocarcinoma is SLC34A2-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung arcinoma is CD74-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is FIG-ROS1 fusion-positive non-small cell lung cancer. In another embodiment, the lung adenocarcinoma is a ROS1 fusion-positive non-small cell lung cancer. In another embodiment, compound 1 or a pharmaceutically acceptable salt thereof is administered as a pharmaceutical ition comprising nd 1 or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier. In another embodiment, compound 1 is administered subsequent to another form of ent. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine treatment. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-docetaxel treatment. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine and/or docetaxel ent. In another embodiment, compound 1 or a pharmaceutically acceptable salt thereof, is administered post-carboplatin and/or gemcitabine ent. In another embodiment, compound 1 or a pharmaceutically acceptable salt thereof is administered post-crizotinib treatment. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-crizotinib and/or gemcitabine treatment. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-docetaxel treatment. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-carboplatin treatment. In another embodiment, compound 1, or a ceutically acceptable salt thereof, is administered post-cisplatin and/or gemcitabine and/or docetaxel treatment. In another embodiment, compound 1, or a ceutically acceptable salt thereof, is administered arboplatin and/or gemcitabine and/or docetaxel ent. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-crizotinib and/or gemcitabine and/or docetaxel treatment. In another embodiment, compound 1, or a pharmaceutically acceptable salt thereof, is administered post-crizotinib and/or carboplatin ent.
] Described herein is a method for preventing, treating, inhibiting or reversing the progress of abnormal cell growth in a mammal, comprising stering nd 1, or a pharmaceutically acceptable salt thereof, wherein the abnormal cell growth is a cancer ed by a ROS1 fusion protein, for e, SLC34A2-ROS1 fusion protein, CD74- ROS1 fusion n, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion protein, FIG-ROS1(VL) fusion protein, or other ROS1 fusion proteins, wherein the cancer has been previously treated with a eutic regimen of crizotinib, and/or carboplatin and is resistant to crizotinib, and/or carboplatin. In some embodiments, the cancer that is resistant to crizotinib, and/or carboplatin, harbors one or more ROS1 fusion proteins selected from: SLC34A2-ROS1 fusion protein, CD74-ROS1 fusion protein, FIGROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion protein, and FIGROS1 (VL) fusion protein, and/or contains a mutation in the ROS1 kinase domain of the SLC34A2-ROS1 fusion protein, CD74-ROS1 fusion protein, FIG-ROS1 fusion protein, 1 (L) fusion protein, FIG-ROS1(S) fusion protein, or S1(VL) fusion protein. In one embodiment, the crizotinib and/or carboplatin resistant cancer is a cancer having a mutation in the ROS1 kinase domain of a CD74-ROS1 fusion protein. In a related embodiment, the cancer is a crizotinib refractory CD74-ROS1 fusion positive lung adenocarcinoma, for e, a crizotinib tory CD74-ROS1 fusion positive NSCLC, harboring a mutation in the ROS1 kinase domain. In another embodiment, the crizotinib and/or carboplatin resistant cancer is a cancer, for example, a inib resistant lung adenocarcinoma, for example, a crizotinib resistant NSCLC, ing a mutation selected from E1990G, G2032R, L2026M, L1951R, M2128V, K2003I, and combinations f in the ROS1 kinase domain of a CD74-ROS1fusion protein.
Described herein is a method for preventing, treating, inhibiting or reversing the progress of abnormal cell growth in a mammal, for e, a cancer, the method comprising administering a compound of Formula I, or a pharmaceutically acceptable salt thereof, wherein the abnormal cell growth is a cancer mediated by a ROS1 fusion protein, for example, SLC34A2-ROS1 fusion protein, CD74-ROS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion protein, S1(VL) fusion n, or other ROS1 fusion proteins, wherein the cancer has been previously treated with a therapeutic regimen of crizotinib, and/or carboplatin and is resistant to crizotinib, and/or carboplatin. In some embodiments, the cancer that is ant to crizotinib, and/or carboplatin, harbors one or more ROS1 fusion proteins selected from: SLC34A2-ROS1 fusion protein, CD74-ROS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion n, FIG-ROS1(S) fusion protein, and FIG-ROS1(VL) fusion protein, and/or contains a mutation in the ROS1 kinase domain of the SLC34A2-ROS1 fusion protein, OS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion protein, or FIG-ROS1(VL) fusion protein. In one embodiment, the crizotinib ant cancer is a cancer having a mutation in the ROS1 kinase domain of a CD74-ROS1 fusion protein. In a related embodiment, the cancer is a crizotinib refractory CD74-ROS1 fusion positive lung adenocarcinoma, for example, a crizotinib refractory CD74-ROS1 fusion positive NSCLC, harboring a on in the ROS1 kinase domain. In another embodiment, the crizotinib resistant cancer is a cancer, for example, a crizotinib resistant lung adenocarcinoma, for example, a crizotinib resistant NSCLC, harboring a on selected from E1990G, G2032R, L2026M, , M2128V, K2003I, and combinations thereof in the ROS1 kinase domain of a CD74-ROS1fusion protein. In various embodiments described above, a method for preventing, treating, inhibiting or reversing the progress of al cell growth in a mammal, comprises administering a compound of Formula I, or a compound of Formula Ia, or compound 1, or a pharmaceutically acceptable salt thereof, in an ary therapeutically effective dose ranging from about 0.01mg/kg to about 100 mg/kg, or from about 0.1 mg/kg to about 75 mg/kg, or from about 0.1 mg/kg to about 50 mg/kg, or from about 0.1 mg/kg to about 40 mg/kg, or from about 0.1 mg/kg to about 30 mg/kg, or from about 0.1 mg/kg to about 20 mg/kg, or from about 0.1 mg/kg to about 15 mg/kg, or from about 0.1 mg/kg to about 10 mg/kg or from about 0.1 mg/kg to about 5 mg/kg, or from about 0.1 mg/kg to about 1 mg/kg to a patient in need thereof, n the abnormal cell growth is a cancer mediated by a ROS1 fusion protein, for example, SLC34A2-ROS1 fusion n, CD74-ROS1 fusion protein, FIG-ROS1 fusion protein, S1(L) fusion protein, FIGROS1 (S) fusion protein, FIG-ROS1(VL) fusion protein, or other ROS1 fusion protein; or a cancer ing one or more mutations in a ROS1 fusion protein, for example, a mutation in a ROS1 kinase domain in a SLC34A2-ROS1 fusion protein, CD74-ROS1 fusion protein, FIG-ROS1 fusion protein, FIG-ROS1(L) fusion protein, FIG-ROS1(S) fusion protein, FIGROS1 (VL) fusion protein, or other ROS1 fusion proteins, including in some embodiments, a cancer that has been previously treated with a eutic regimen of crizotinib, and/or carboplatin and is ant to crizotinib, and/or carboplatin, for example, a crizotinib resistant cancer, for example, a crizotinib resistant lung arcinoma, for example, a crizotinib resistant NSCLC.
Administration Administration of the compound of Formula I, Formula Ia, or compound 1, or a pharmaceutically acceptable salt f, in pure form or in an appropriate pharmaceutical composition, can be carried out via any of the accepted modes of administration or agents for g similar utilities. Thus, administration can be, for example, , nasally, parenterally venous, intramuscular, or subcutaneous), topically, transdermally, intravaginally, intravesically, intracistemally, or rectally, in the form of solid, semi-solid, lyophilized powder, or liquid dosage forms, such as for e, s, suppositories, pills, soft elastic and hard gelatin dosages (which can be in capsules or tablets), powders, solutions, suspensions, or aerosols, or the like, specifically in unit dosage forms suitable for simple administration of precise dosages.
] The compositions will include a conventional pharmaceutical carrier or excipient and a compound of Formula I as the/an active agent, and, in addition, may include carriers and adjuvants, etc.
Adjuvants include preserving, wetting, suspending, sweetening, flavoring, perfuming, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, butanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and n.
If desired, a pharmaceutical composition of the compound of Formula I may also n minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering , antioxidants, and the like, such as, for example, citric acid, sorbitan monolaurate, triethanolamine oleate, butylalted ytoluene, etc.
The choice of composition depends on various factors such as the mode of drug administration (e.g., for oral administration, itions in the form of tablets, pills or capsules) and the bioavailability of the drug substance. Recently, pharmaceutical compositions have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area i.e., decreasing particle size. For example, U.S. Pat. No. 4,107,288 describes a pharmaceutical composition having particles in the size range from 10 to 1,000 nm in which the active material is supported on a crosslinked matrix of macromolecules. U.S. Pat. No. 5,145,684 describes the production of a pharmaceutical composition in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical ition that exhibits ably high bioavailability.
Compositions suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions.
Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols leneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, ble oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper ty can be maintained, for example, by the use of a coating such as in, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
One specific route of administration is oral, using a convenient daily dosage regimen that can be ed according to the degree of severity of the disease-state to be treated.
Solid dosage forms for oral stration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active nd is admixed with at least one inert ary ent (or carrier) such as sodium citrate or dicalcium phosphate or (a) s or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, cellulose derivatives, starch, alignates, gelatin, polyvinylpyrrolidone, sucrose, and gum acacia, (c) humectants, as for e, glycerol, (d) disintegrating agents, as for example, agar-agar, m carbonate, potato or tapioca starch, alginic acid, croscarmellose sodium, complex silicates, and sodium carbonate, (e) solution retarders, as for example paraffin, (f) tion accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, magnesium stearate and the like (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures f. In the case of capsules, s, and pills, the dosage forms may also comprise buffering agents.
Solid dosage forms as described above can be prepared with coatings and shells, such as enteric coatings and others well known in the art. They may contain pacifying agents, and can also be of such composition that they release the active compound or nds in a certain part of the intestinal tract in a delayed manner. Examples of embedded compositions that can be used are polymeric substances and waxes. The active compounds can also be in microencapsulated form, if appropriate, with one or more of the above-mentioned excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable ons, solutions, suspensions, syrups, and elixirs. Such dosage forms are prepared, for example, by dissolving, sing, etc., the compound of Formula I, or a pharmaceutically acceptable salt thereof, and optional pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, ol, l and the like; solubilizing agents and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl ate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide; oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil and sesame oil, ol, ydrofurfuryl alcohol, polyethyleneglycols and fatty acid esters of sorbitan; or mixtures of these substances, and the like, to thereby form a solution or suspension.
Suspensions, in addition to the active compounds, may n suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.
Compositions for rectal administration are, for e, suppositories that can be prepared by mixing the compound of Formula I, or a pharmaceutically acceptable salt thereof, with, for example, suitable non-irritating excipients or carriers such as cocoa butter, hyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and therefore, melt while in a suitable body cavity and release the active ent therein.
Dosage forms for topical administration of the compound of Formula I, or a pharmaceutically acceptable salt thereof, e nts, powders, sprays, and inhalants.
The active component is admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic compositions, eye ointments, powders, and solutions are also contemplated as being within the scope of this disclosure.
Compressed gases may be used to disperse the compound of Formula I, or a pharmaceutically acceptable salt thereof, in aerosol form. Inert gases suitable for this e are nitrogen, carbon e, etc.
] Generally, depending on the intended mode of administration, the pharmaceutically acceptable compositions will contain about 1% to about 99% by weight of a compound(s) of Formula I, or a pharmaceutically acceptable salt thereof, and 99% to 1% by weight of a suitable pharmaceutical excipient. In one example, the composition will be between about 5% and about 75% by weight of a compound(s) of Formula I, Formula Ia, or compound 1, or a pharmaceutically acceptable salt thereof, with the rest being suitable pharmaceutical excipients.
Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington's Pharmaceutical Sciences, 18th Ed., (Mack Publishing Company, Easton, Pa., 1990). The composition to be administered will, in any event, contain a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, for treatment of a disease-state in ance with the teachings of this disclosure.
The compounds of this disclosure, or their pharmaceutically acceptable salts or solvates, are administered in a therapeutically ive amount which will vary depending upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of the compound, the age, body weight, general , sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the ular disease-states, and the host undergoing therapy. The nd of Formula I, Formula Ia, or compound 1, or a pharmaceutically acceptable salt thereof, can be stered to a patient at dosage levels in the range of about 0.1 to about 1,000 mg per day.
For a normal human adult having a body weight of about 70 kilograms, a dosage in the range of about 0.01 to about 100 mg per kilogram of body weight per day is an e. The ic dosage used, however, can vary. For e, the dosage can depend on a number of s including the requirements of the patient, the severity of the condition being treated, and the pharmacological activity of the compound being used. The determination of optimum dosages for a ular patient is well known to one of ordinary skill in the art.
In other embodiments, the compound of Formula I, Formula Ia, or compound 1, or a pharmaceutically acceptable salt thereof, can be administered to the patient rently with other cancer treatments. Such treatments include other cancer chemotherapeutics, hormone replacement therapy, radiation therapy, or immunotherapy, among others. The choice of other therapy will depend on a number of factors including the metabolic stability and length of action of the compound, the age, body weight, general health, sex, diet, mode and time of stration, rate of excretion, drug combination, the severity of the particular disease-states, and the host undergoing therapy.
Described herein is a method for detecting, diagnosing and treating ROS1 fusions related disease such as SLC34A2-ROS1 fusion-positive NSCLC, CD74-ROS1 fusion-positive NSCLC, and FIG-ROS1 fusion-positive NSCLC, in addition to other ROS1 fusion positive NSCLC. We describe in more detail here methods for the detection and diagnosing of such disorders. Treating these ers can be better accomplished with the administering of a therapeutically effective amount of a pharmaceutical composition comprising a compound of Formula I or the malate salt of a nd of Formula I or another pharmaceutically acceptable salt of a compound of Formula I, ing in a specific embodiment, the compound of Formula I is compound 1 or the malate salt of compound 1 to a patient who has been identified or sed as having a ROS1 fusion related disease such as SLC34A2-ROS1 fusion-positive NSCLC, CD74-ROS1 fusion-positive NSCLC, and 1 fusion-positive NSCLC.
In another aspect, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is stered to a patient for preventing or treating a lung cancer.In some of these ments, the method ses stering to the patient in need thereof, a composition comprising at least one inhibitor against an ROS1 fusion n, at least one tor against the ROS1 fusion gene encoding the fusion protein, at least one inhibitor against a ROS1 coding gene, or a combination thereof, as an active ient.
ROS1 and Fusion Partners SLC34A2, CD74 and FIG The ROS1 protein, SLC34A2 protein, CD74 protein and FIG n, the SLC34A2-ROS1 fusion, or the CD74-ROS1 fusion; or the FIG-ROS1 fusion or sometimes simply called the “ROS1 fusion protein and nucleic acids,” including methods of detection, diagnosing, kits for detecting and diagnosing, methods of screening, methods of treating and preventing and various therapy for lung cancer patients, methods to measure the effectiveness of treatments and other pharmaceutical ingredients can be used in combination with the various treatments are described below.
The ROS1 n is an orphan transmembrane receptor tyrosine kinase. Human ROS1 kinase protein (encoded by the ROS1 gene) is a 2347 amino acid long receptor tyrosine kinase that is prone to aberrant expression leading to cancer. A description of full length human ROS1 kinase (with the amino acid sequence of the human ROS1 protein) can be found at UniProt Accession No. P08922 (E.C.- 2.7.10.1). As shown in Table 1, the signal peptide, extracellular, transmembrane, and kinase domains of ROS1 are found at the following amino acid residues in SEQ ID NO: 1 Table 1. Amino acid es and domains of ROS1 protein in SEQ ID NO: 1 Signal peptide 1-27 Extracellular domain 28-1859 Transmembrane domain 1860-1882 Kinase domain 1945-2222 Protein Domain Amino Acid residues in SEQ ID NO:1 Signal Peptide 1-27 Extracellular domain 28-1859 Transmembrane domain 1860-1882 Kinase domain 1945-2222 The human ROS1 protein may be encoded by a human ROS1 gene d on human chromosome 6. The C-terminal domain of ROS1 protein may include an amino acid sequence encoded by a polynucleotide from 31st or 32nd or 34th exon to the last exon (for example, 32nd or 34th exon) or a fragment thereof of ROS1 gene. The C-terminal domain of ROS1 protein may include consecutively at least about 100 amino acids from the start position of 31st or 32nd exon. For e, the C-terminal domain of ROS1 protein may include consecutively about 100 to about 700 amino acids, consecutively about 200 to about 600 amino acids, or consecutively about 250 to about 500 amino acids, or consecutively about 270 to about 425 amino acids, or consecutively about 270 to about 450 amino acids, or consecutively about 475 to about 625 amino acids from the start position of the 32nd exon (long form) or the 34th exon (short form) toward C-terminus of the ROS1 n. The inferred breakpoint for the ROS1 protein is 1750, or 1852-1853 aa for SLC34A2-ROS1 fusion ns and CD74-ROS1 fusion proteins and 1880-1881 aa for FIG-ROS1 fusion proteins.
In one exemplary embodiment, the human SLC34A2 gene encoding the human SLC34A2 protein (mRNA NM_001177998) is localized to human some 4 (4p15.2) and contains 13 exons and an amino acid length of about 690 amino acids. The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different ms have been found for this gene. The SLC34A2 protein may be derived from a mammal, such as a human. The N-terminal domain of a SLC34A2-ROS1fusion protein may include an amino acid sequence encoded by a polynucleotide from the first exon to the 12th exon, or from the first exon to the fourth exon, or from the first exon to the second exon of SLC34A2 gene. These last observed exons in the structure of SLC34A2 gene have inferred breakpoints of 429 and 2076. The N-terminal domain of a SLC34A2-ROS1 fusion protein may include consecutively at least about 30-250 amino acids from 1st on (that is, at least amino acid sequence from 1st to 250th positions, or fragments thereof) of the SLC34A2 protein. The N-terminal domain of SLC34A2-ROS1 fusion protein may include consecutively about 30 to 250 amino acids, consecutively about 30 to 225 amino acids, consecutively about 40 to 200 amino acids, or consecutively about 40 to 175 amino acids from the 1st amino acid position of the SLC34A2 protein.
In one exemplary embodiment, the SLC34A2-ROS1 fusion is a chromosomal ocation between human chromosomes 6 and 4 that fuses the 3’ region of ROS1 to the 5’ region of SLC34A2. The fusion protein is ed and validated using s s known to one skilled in the art and or as described herein. In some embodiments, a compound of a I, or a pharmaceutically acceptable salt thereof, is then administered to a patient in need thereof for preventing or treating a lung cancer. In some embodiments, a composition is administered to a patient in need f sing at least one inhibitor against the SLC34A2-ROS1 fusion protein, at least one inhibitor t the SLC34A2-ROS1 fusion gene ng the fusion protein, at least one inhibitor against a ROS1 coding gene, or a combination thereof, as an active ingredient.
In the 2-ROS1 fusion protein, the fusion, or fusion region may occur between various exons of the SLC34A2 gene and the ROS1 gene. Many fusions are known to one skilled in the art. Examples of such fusions include the 2nd, and/or 4th exon of SLC34A2 gene and 32nd (Long, L), and/or 34th exon (Short, S) of ROS1 gene, which is called as a fusion point or breakpoint. Other ROS1 and SLC34A2 fusion or breakpoints are known, and can be found in the COSMIC-Catalogue of somatic mutations in cancer database v.68 at cancer.sanger.ac.uk/cancergenome/projects/cosmic/ . The term "a fusion region" may refer to a polynucleotide fragment (about 10-30 nucleotides) or polypeptide (about 5-30 amino acids) fragment around the fusion point.
The CD74-ROS1 fusion is a ROS1-involved a chromosomal translocation between human chromosomes 5 and 6 that fuses the 3’ region of ROS1 to the 5’ region of CD74. The fusion protein is detected and validated using various methods known to one skilled in the art and or as described herein. The N-terminal domain of a CD74-ROS1 fusion protein may include an amino acid sequence encoded by a polynucleotide from the first exon to the 12th exon, or from the first exon to the fourth exon, or from the first exon to the second exon of CD74 gene. The N-terminal domain of a CD74-ROS1 fusion n may include consecutively at least about 30-250 amino acids from 1st position (that is, at least amino acid sequence from 1st to 250th positions, or fragments thereof) of the CD74 protein. The N- terminal domain of OS1 fusion protein may include consecutively about 30 to 250 amino acids, consecutively about 30 to 225 amino acids, consecutively about 40 to 200 amino acids, or consecutively about 40 to 210 amino acids or fragments thereof from the 1st amino acid position of the CD74 protein.
In the fusion protein, the fusion, or fusion region may occur between s exons of the CD74 gene and the ROS1 gene. Many fusions are known to one skilled in the art. es of such CD74-ROS1fusions include the 6th exon of CD74 gene fused to the 32nd, or 34th exon of ROS1 gene, which is called as a fusion point or breakpoint. Other ROS1 and CD74 fusion or breakpoints are known, and can be found in the COSMICCatalogue of somatic mutations in cancer database v.68 at cancer.sanger.ac.uk/cancergenome/projects/cosmic/. The term "a fusion region" may refer to a polynucleotide fragment (about 10-30 nucleotides) or polypeptide (about 5-30 amino acids) nt around the fusion point.
] The fusion protein FIG-ROS1 results from an intra-chromosomal deletion on human chromosome 6 fusing the 5’ region of FIG (aka GOPC) to the 3’ region of ROS1.
FIG-ROS1 fusions have been identified in s from cholangiocarcinoma and ovarian cancer patients at a ncy of 8.7% and 0.5%, respectively. The FIG-ROS1 fusion protein can be detected and ted using various methods known to one skilled in the art and or as described herein. The N-terminal domain of a FIG-ROS1 fusion protein may include utively at least about 150-500 amino acids from 1st position (that is, at least amino acid sequence from 1st to 500th positions, or fragments thereof) of the FIG protein.
The N-terminal domain of FIG-ROS1 fusion n may include consecutively about 150 to about 500 amino acids, consecutively about 200 to 450 amino acids, consecutively about 220 to 425 amino acids, or consecutively about 220 to about 420 amino acids or fragments thereof from the 1st amino acid position of the FIG protein.
In the FIG-ROS1 fusion protein, the fusion, or fusion region may occur between various exons of the FIG gene and the ROS1 gene. Several S1 s are known to one skilled in the art. Examples of such fusions e the 4th or 8th exon of FIG gene fused to the 35th, or 36th exon of ROS1 gene, which is called as a fusion point or breakpoint.
Other ROS1 and FIG fusions or breakpoints are known, and can be found in the COSMICCatalogue of somatic mutations in cancer database v.68 at cancer.sanger.ac.uk/cancergenome/projects/cosmic/. The term "a fusion region" may refer to a polynucleotide fragment (about 10-30 nucleotides) or polypeptide (about 5-30 amino acids) fragment around the fusion point.
Other ROS1 fusion partners can include TPM3, SDC4, EZR, and LRIG3, in addition to the SLC34A2, CD74, and FIG fusions described in detail herein. (See Fig. 1 herein, and for example, Takeuchi K, Soda M, Togashi Y, Suzuki R, Sakata S, Hatano S, et al. RET, ROS1 and ALK fusions in lung cancer. Nat Med. 2012, and Kurtis D. Davies, Anh T.
Le, Mariana F. Theodoro, Margaret C. , Dara L. Aisner, Eamon M. Berge, Luigi M.
Terracciano, Matteo Incarbone, Massimo Roncalli, Federico Cappuzzo, D. Ross Camidge, Marileila a-Garcia, and Robert C. Doebelet, Identifying and Targeting ROS1 Gene Fusions in Non-Small Cell Lung Cancer, (2012), Clin Cancer Res. 2012 September 1; 18(17): 579, the contents of these disclosures relating to the ROS1 fusion proteins is incorporated herein in their entireties.
In one embodiment, the ROS1fusion protein of the present disclosure comprises the C-terminal domain of human ROS1 protein (for example, human ROS1 as provided in SEQ ID NO. 1) providing a functional kinase domain, which consists essentially of consecutive about 50 to 300 amino acids starting from an amino acid ponding to the start position of 32nd exon of the ROS1 protein and then toward C-terminus of the ROS1 As used herein, the exon number is numbered ing to the exon number allocated by the National Center for Biotechnology ation (NCBI) hosted by the National Institutes of Health, Bethesda, Maryland USA. In some exemplary embodiments, the fusion protein SLC34A2-ROS1 may have any of the amino acid sequence identified as such by the NCBI. The nucleotide ces of DNA molecules and the amino acid sequences of ns encoded by the DNA molecules may be determined by an automated DNA sequencer or an automated peptide sequencer. The otide or amino acid) sequences ined by such automated sequencing means may include partial error compared with actual sequences. Generally the sequences determined by automated cing may have ce identity of at least about 90%, at least 20 about 95%, at least about 99%, or at least about 99.9% compared with actual sequences. Therefore, the fusion protein, the fusion gene or the fusion region may have an amino acid sequence or a nucleotide sequence having sequence identity of at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% compared with the sequences of identified as such by the NCBI.
For the purpose of simplicity, the following disclosure refers to the ROS1 fusion protein SLC34A2-ROS1, but may also apply to other ROS1 fusion proteins described herein.
The exemplified SLC34A2-ROS1 fusion protein, in some embodiments may consist of 80- 200 N-terminal amino acid es of 2 and at least 300 C-terminal residues of ROS1, preferably ranging from 300-500 C-terminal amino acid residues. The fusion gene has a protein tyrosine kinase domain together with helical s. Without wishing to be bound by any theory, it is believed that the tertiary conformation of the SLC34A2-ROS1 fusion protein induces homo-dimerization which will activate the oncogenic protein tyrosine kinase domain by auto-phosphorylation. Taken together, the SLC34A2-ROS1 fusion gene may be highly expressed and then dimerized after translation owing to SLC34A2. Then, the dimerized ROS1 protein tyrosine kinase domain may be stimulated abnormally, thus facilitating the stimulation of an oncogenic pathway, for example, as seen in a ROS1 fusion related NSCLC lung cancer.
Once a fusion is detected it will be known as a fusion gene of SLC34A2-ROS1 encoding the fusion protein of SLC34A2-ROS1. A method of providing information for sing a lung cancer, comprising the step of detecting, in a test sample obtained from a t, a fusion as described herein. sis would compare a fusion gene ng the fusion protein; and an overexpression of ROS1 compared to a standard sample from an individual t a cancer, wherein when at least one element is selected and detected in the test sample, allowing the subject to be identified as any or all of the following: a cancer patient, a lung cancer patient, NSCLC lung cancer patient, a ROS1 fusion related NSCLC patient, and/or a SLC34A2-ROS1 fusion related NSCLC patient.
The deletion, inversion or translocation of some 6 may be detected by using a polynucleotide (a probe) capable of hybridizing with (complementarily binding to) the deletion, inversion or translocation region in human chromosome 6 and/or a primer pair capable of ing the deletion, inversion or translocation of human chromosome 6, for example, capable of ing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the inversion region in human chromosome 6. The fusion n, the fusion gene, and the fusion region are described herein. In an exemplary embodiment, the fusion protein may also be detected by detecting the ce of the fusion protein or the fusion gene or mRNA ponding to the fusion gene, for example, with the use of ROS1 specific or ROS1 fusion specific antibodies known in the art and described herein.
The presence of the fusion protein may be detected be a general assay that measures the interaction between the fusion protein and a material (e.g., an antibody or an aptamer) specifically binding to the fusion protein. The general assay may be immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), florescence immunoassay (FIA), luminescence immunoassay (LIA), western blotting, FACS, and the like.
In on, the ce of the fusion gene or the mRNA may be detected by a general assay such as PCR, FISH (fluorescent in situ hybridization), and the like, using a polynucleotide capable of hybridizing with (complementarily binding to) the fusion gene or the mRNA. FISH is described in more detail below. The fusion gene may be detected and/or validated by using the integration techniques of whole-transcriptome (RNA) and/or wholegenome DNA sequencing through massively parallel sequencing technologies. The polynucleotide capable of hybridizing with the fusion gene or the mRNA may be a siRNA, an oligonucleotide, DNA probe, or DNA primer, which can detect the fusion gene or the mRNA by a direct ization with the fused or truncated gene or transcript in the test sample.
In further embodiments, fluorescence u hybridization (FISH) is ed in the methods described herein (as described in Verma et al. Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York, N.Y. (1988)). A FISH assay can be performed using one or more probe sets, ments are provided such as: (1) A first probe set, which is a first probe set targeting a somal site which contains the ROS1 gene (first somal site); it consists of a probe 1A labeled with a first scent substance and a probe 1B labeled with a second fluorescent substance; probe 1A is complementary to the first region, which is the 5' region in the aforementioned first chromosomal site, probe 1B is complementary to the second region, which is present at a distance from the aforementioned first region and is the 3' region in the aforementioned first chromosomal site, and the breakpoint in the ROS1 gene when the SLC34A2-ROS1 fusion gene is produced by a translocation between the SLC34A2 and ROS1 genes is located in the 3' tail of the aforementioned first region, between the aforementioned first and second regions, or in the 5' tail of the aforementioned second region; (2) A second probe set, which is a second probe set targeting a chromosomal site which contains the 2 gene (second chromosomal site); it consists of a probe 2A labeled with a first fluorescent substance and a probe 2B labeled with a second fluorescent substance; probe 2A is complementary to the first region, which is the 5' region in the aforementioned second chromosomal site, probe 2B is complementary to the second region, which is t at a distance from the aforementioned first region and is the 3' region in the aforementioned second chromosomal site, and the breakpoint in the SLC34A2 gene when the SLC34A2-ROS1 fusion gene is produced by a translocation between the SLC34A2 and ROS1 genes is located in the 3' tail of the aforementioned first region, between the aforementioned first and second regions, or in the 5' tail of the aforementioned second region; (3) a third probe set consisting of the aforementioned probe 2A and the aforementioned probe 1B; and (4) a fourth probe set consisting of a probe 4A which is complementary to the chromosomal site containing the ROS1 gene (the third chromosomal site), and a probe 4B which is mentary to the chromosomal site containing the SLC34A2 gene (the fourth chromosomal site).
The length of the aforementioned first chromosomal site can be 0.5–2.0 Mb. The length of the aforementioned second somal site can be 0.5–2.0 Mb. The length of the aforementioned third chromosomal site can be 0.5–2.0 Mb. The length of the aforementioned fourth chromosomal site can be 0.5–2.0 Mb.
] In some embodiments, the FISH assay may be correlated with other physical chromosome mapping techniques and genetic map data. The FISH technique is well known (see, e.g., U.S. Pat. Nos. 696; 5,447,841; 5,776,688; and 5,663,319). Examples of c map data can be found in the 1994 Genome Issue of Science (265: 1981f).
Correlation n the location of the gene encoding ROS1 protein and/or, in the case of ROS1 fusion polypeptides, the gene encoding the fusion partner of a ROS1 fusion protein (e.g., the FIG gene, the SLC34A2 gene, or the CD74 gene) on a physical chromosomal map and a specific disease, or predisposition to a specific disease, may help t the region of DNA associated with that genetic disease. The nucleotide sequences of the t disclosure may be used to detect differences in gene sequences between normal, r, or affected individuals.
In situ hybridization of somal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps. Often the placement of a gene on the some of another mammalian species, such as mouse, may reveal associated s even if the number or arm of a particular human chromosome is not known. New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for e genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localized by genetic linkage to a particular genomic region, for e, AT to 11q22-23 (Gatti et al., Nature 336: 577-580 (1988)), any sequences mapping to that area may represent ated or regulatory genes for further investigation. The nucleotide sequences encoding the ROS1 fusions of the present disclosure, or portions thereof, may also be used to detect differences in the somal location due to translocation, inversion, etc., among normal, carrier, or affected individuals.
It shall be tood that all of the s (e.g., PCR and FISH) that detect polynucleotides encoding a polypeptide with ROS1 kinase activity (e.g., full-length ROS1 or an ROS1 fusion polynucleotides such as SLC34A2-ROS1, or CD74-ROS1, or FIGROS1 (S)), may be combined with other methods that detect polypeptides with ROS1 kinase activity or polynucleotides encoding a polypeptide with ROS1 kinase activity. For example, detection of a FIG-ROS1 fusion polynucleotide in the genetic material of a biological sample (e.g., FIG-ROS1 in a circulating tumor cell) may be followed by Western blotting analysis or immuno-histochemistry (IHC) analysis of the ns of the sample to determine if the FIGROS1 polynucleotide was actually expressed as a S1 fusion polypeptide in the biological sample. Such Western blotting or IHC analyses may be performed using an antibody that specifically binds to the polypeptide encoded by the detected S1 polynucleotide, or the es may be performed using antibodies that specifically bind either to full length FIG (e.g., bind to the N-terminus of the protein) or to full length ROS1 (e.g., bind an epitope in the kinase domain of ROS1). Such assays are known in the art (see, e.g., U.S. Pat. No. 7,468,252).
In another example, the CISH technology of Dako allows chromatogenic in situ hybridization with immuno-histochemistry on the same tissue n. See Elliot et al., Br J Biomed Sci 2008; 65(4): 167- 171, 2008 for a comparison of CISH and FISH.
] Described herein is a method for diagnosing a patient as having a lung cancer or a suspected lung cancer driven by an ROS1 kinase. The method includes contacting a biological sample of said lung cancer or a suspected lung cancer (where the biological sample comprising at least one nucleic acid le) with a probe that hybridizes under stringent conditions to a nucleic acid molecule ng a polypeptide with ROS1 kinase ty such as a full length ROS1 polynucleotide or a ROS1 fusion polynucleotide (e.g., a FIG-ROS1 fusion polynucleotide, an SLC34A2-ROS1 fusion polynucleotide, or a CD74-ROS1 fusion polynucleotide), and wherein hybridization of said probe to at least one nucleic acid molecule in said biological sample identifies said patient as having a lung cancer or a suspected lung cancer driven by a ROS1 kinase. bed herein is a method for sing a patient as having a lung cancer or suspected of having lung cancer driven by a ROS1 kinase. The method includes contacting a biological sample of said lung cancer or suspected lung cancer (where said ical sample comprises at least one polypeptide) with a reagent that specifically binds to a polypeptide with ROS1 kinase ty (e.g., a S1 fusion polypeptide, an SLC34A2-ROS1 or a CD74-ROS1 fusion polypeptide), wherein specific binding of said t to at least one fusion polypeptide in said ical sample identifies said patient as having a lung cancer or a suspected lung cancer driven by a ROS1 kinase.
In various embodiments, the identification of a lung cancer or suspected lung cancer as being driven by a ROS1 kinase will identify that patient having that lung cancer or suspected lung cancer as being likely to respond to a ROS1-inhibiting therapeutic.
] A kit for detecting translocations between SLC34A2 and ROS1 genes can include one or more probe sets. (1) A first probe set includes a probe 1A labeled with a first fluorescent substance and a probe 1B labeled with a second fluorescent substance; Probe 1A is complementary to the first region, which is the 5' region in the aforementioned first chromosomal site, probe 1B is mentary to the second region, which is present at a distance from the aforementioned first region and is the 3' region in the aforementioned first chromosomal site, and the breakpoint in the ROS1 gene when the SLC34A2-ROS1 fusion gene is produced by a translocation between the SLC32A2 and ROS1 genes is located in the 3' tail of the aforementioned first region, between the aforementioned first and second regions, or in the 5' tale of the entioned second region; (2) A second probe set, which is a second probe set targeting a chromosomal site which contains the SLC32A2 gene (second chromosomal site); it consists of a probe 2A labeled with a first fluorescent substance and a probe 2B labeled with a second scent substance; probe 2A is complementary to the first region, which is the 5' region in the aforementioned second chromosomal site, probe 2B is complementary to the second region, which is present at a distance from the aforementioned first region and is the 3' region in the aforementioned second chromosomal site, and the oint in the SLC32A2 gene when the SLC34A2-ROS1 fusion gene is produced by a translocation between the SLC32A2 and ROS1 genes is located in the 3' tail of the aforementioned first region, n the aforementioned first and second regions, or in the 5' tale of the aforementioned second region; (3) A third probe set consisting of the aforementioned probe 2A and the aforementioned probe 1B; and a fourth probe set consisting of a probe 4A which is complementary to the chromosomal site ning the ROS1 gene (the third chromosomal site) and a probe 4B which is complementary to the chromosomal site containing the SLC32A2 gene (the fourth somal site).
A kit useful for identifying patients susceptible to SLC34A2-ROS1 translocation includes one or more elements selected from a group comprising an explanation of the use of the probes, a DNA contrast stain, a buffer for hybridization use, an encapsulant, and a control slide. The kit makes it le to implement conveniently and efficiently the detection method described herein. The kit can e as required elements (essential ingredients) the aforementioned first probe set, second probe set, third probe set or fourth probe set. Two or more types of probe sets can also be included in the kit. For example, the kit can incorporate first probe set and third probe set. Since the details for each probe set have been described above, they will not be repeated here.
Detection of the ce or absence of a SLC34A2-ROS1 fusion polynucleotide can be performed directly using genome DNA that encodes the aforementioned fusion polypeptide or a transcript from that genome DNA, but it may also be performed indirectly using a translation product from that transcript (the entioned fusion polypeptide).
Because the genome DNA that encodes the fusion polypeptide is formed by ion between the 117.61-117.75Mb region of chromosome 6, (6q22) the phenomenon of the present disclosure may be detected in the “detection of the presence or absence of a SLC34A2-ROS1 fusion polynucleotide.” In this detection of inversion, for example, a split n a e region upstream from the kinase domain coding region of the ROS1 gene and a 3'-side region ream from that coding region of the ROS1 gene may be detected, or a split between the coding region of part or all of the l domains and 5'-side region upstream from that coding region of the SLC32A2 gene and a 3'-side region downstream from the coding region of the helical s of the SLC34A2 gene may be detected.
Techniques known and available to the d practitioner may be used in the “detection of the presence or absence of a SLC34A2-ROS1 fusion polynucleotide” in the present disclosure. If “genome DNA that encodes the aforementioned fusion polypeptide” is the object, for example, in situ hybridization (ISH) using fluorescence or the like, genome PCR, direct sequencing, southern blotting, or genome microarray analysis may be used. If a “transcript from the aforementioned genome DNA” is the object, for example, RT-PCR, direct sequencing, northern ng, dot blotting, or cDNA microarray analysis may be used.
The kit described herein can also include other elements. Examples of these other elements are the specification for use of the probes, a DNA counterstain such as DAPI, a hybridization buffer, a wash buffer, solvents, mounting media, control slides, reaction vessels, and other equipment. Specifications for stic purposes can also be included.
Furthermore, specifications, etc. can also be included that show how the detection (positive identification) of SLC34A2-ROS1translocation in some samples from cancer ts should be set up in these patients using an ROS1 kinase inhibitor. Moreover, a plan for determining the treatment course and an explanation of this plan can also be included.
Comparatively long probes (approximately 200 kb (probe 1A) to approximately 1,370 kb (probe 4B) are plated. Therefore, complementation between the probes and the target sequences does not need to be highly restrictive, to the extent that specific hybridization intended in the present disclosure is achieved. An example of similarity n target sequences is at least 90%, preferably at least 95%, and more preferably at least 98%.
In the case where a first probe set and second probe set are used, the two fluorescence signals are separated and detected individually in chromosomal samples in which the translocation between the SLC34A2 gene and the ROS1 gene occurred; in chromosomal samples in which the translocation did not occur, lly the two fluorescence signals are observed to be next to each other, or a signal (yellow) that is a combination of the two scence signals is observed. Thus, the presence or absence of a translocation between the 2 gene and the ROS1 gene is reflected in the pattern of the fluorescence . Consequently, a translocation n the SLC34A2 gene and the ROS1 gene can be determined from the pattern of the fluorescence signal.
The judgment reached above is preferably and typically made based on a comparison of a result with a control (test sample). Here, the control is a chromosomal sample derived from a patient with non-small cell lung cancer or a chromosomal sample derived from a patient exhibiting precancerous lesions. In addition, chromosomal samples from a t t cerous lesions, chromosomal samples from patients who do not have cancer, or chromosomal samples taken from normal, healthy subjects can also be used as the l. Chromosomal samples derived from strains of cells can also be used as a When the fusion gene is a fusion gene SLC34A2-ROS1encoding the fusion protein of SLC34A2-ROS1, the fusion gene SLC34A2-ROS1 (or any other ROS1 fusion gene, e.g. CD74-ROS1, & FIG-ROS1) may be detected by using a polynucleotide (a probe) capable of hybridizing with (complementarily binding to) the fusion region and/or a primer pair capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the fusion region. In addition, in one exemplary ment, the fusion protein SLC34A2-ROS1may be detected using an antibody or aptamer specifically binding to the fusion region of the fusion protein SLC34A2-ROS1.
In addition, the detection can be performed by a fusion assay which is a combination of chromogenic in situ hybridization (CISH) method and silver in situ hybridization (SISH) method. The "fusion point" in the present ication refers to a point where a portion derived from the respective genes of SLC34A2 is fused with a portion derived from the ROS1 gene.
The term “capable of hybridizing with the fusion region (or the inversion region)” may refer to having a complementary sequence or a sequence having sequence identity of at least 90% with that of the fusion region (or the inversion region). Another embodiment provides a composition for diagnosing a cancer, including one or more selected from the group consisting of a polynucleotide capable of hybridizing with the fusion region, a primer pair e of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides ing the fusion . Also a polynucleotide capable of izing with the inversion region in human chromosome 6, a primer pair capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the inversion region of human chromosome 6, and an antibody or aptamer binding to the fusion region.
Another embodiment provides a use of the fusion protein and/or the fusion gene for diagnosing a cancer. The patient may be any mammal, for example, a primate such as a human or monkey, a rodent such as a mouse or a rat, in particular a human. The test sample, suitable for use in any assays mentioned, may be a cell (e.g., a lung cell); a tissue (e.g., a lung tissue); body fluid (e.g., blood); circulating tumor DNA, ating tumor cells. The samples may be ted in any manner known to one skilled in the art, including collection from the surgical biopsy of tumor, a core biopsy of tumor, a fine needle aspirate of tumor, pleural on, and other known methods of separating cells and tissues from ts. For example, a FISH assay ibed ) could be performed on ating tumor cells.
The patient may be receiving treatments or have plans to be treated with a kinase inhibitor. The test sample may e a cell derived from a human cancer cell or an t thereof.
Another embodiment provides a fusion gene encoding the fusion protein, where a gene encoding the N-terminal domain of the fusion partner positions at 5' end and a gene encoding the C-terminal domain of the ROS1 protein positions at 3' end. In one ary embodiment, when the fusion protein is the SLC34A2-ROS1protein, the fusion gene may be represented as SLC34A2-ROS1gene, where a gene encoding the N-terminal domain of SLC34A2 ons at 5' end and a gene encoding the C-terminal domain of the ROS1 protein positions at 3' end.
Another ment provides an expression vector including the fusion gene and optionally ription elements (e.g., a promoter and the like) operably linked to the fusion gene. Another embodiment provides a transformant cell transformed with the expression vector.
Biological specimens obtained in the course of treatment or diagnosis (biopsy samples, etc.) are often formalin fixed, but in this case, the use of in situ hybridization is advantageous because the DNA genome which is the ion object is stable under formalin fixing and because detection sensitivity is high.
In in situ hybridization, the genomic DNA that encodes a SLC34A2-ROS1fusion ptide in the biological specimen can be detected by hybridizing the polynucleotide of (a) or (b) stated below having a chain length of at least 15 nucleotide bases: (a) a polynucleotide that is at least one probe selected from the group made up of probes that hybridize to a polynucleotide that encodes the 2 protein and probes that hybridize to a polynucleotide that encodes the ROS1 protein (b) a polynucleotide that is a probe that hybridizes to a fusion site of a polynucleotide that encodes the SLC34A2 protein and a polynucleotide that encodes the ROS1 protein.
] In in situ ization, the genome DNA that encodes a CD74-ROS1fusion polypeptide in the biological specimen can be detected by hybridizing the polynucleotide of (a) or (b) stated below having a chain length of at least 15 bases: (a) a polynucleotide that is at least one probe selected from the group made up of probes that hybridize to a polynucleotide that encodes the CD74 protein and probes that hybridize to a polynucleotide that encodes the ROS1 protein (b) a polynucleotide that is a probe that hybridizes to a fusion site of a polynucleotide that encodes the CD74 n and a polynucleotide that encodes the ROS1 In in situ hybridization, the genome DNA that encodes a FIG-ROS1fusion polypeptide in the biological en can be detected by hybridizing the polynucleotide of (a) or (b) stated below having a chain length of at least 15 bases: (a) a polynucleotide that is at least one probe selected from the group made up of probes that ize to a polynucleotide that s the FIG protein and probes that ize to a polynucleotide that encodes the ROS1 protein (b) a polynucleotide that is a probe that hybridizes to a fusion site of a polynucleotide that encodes the FIG protein and a polynucleotide that encodes the ROS1 protein.
However, the DNA sequence of a gene may mutate in the natural world (that is, non-artificially). Accordingly, such natural variants may also be contemplated (similarly hereinafter).
The polynucleotide stated in (a) of the present sure may be any, provided that it can detect the presence of genome DNA that encodes the aforementioned ROS1 fusion n in the biological specimen by hybridizing to a polynucleotide that s the ROS1 binding partner, i.e. SLC34A2, CD74 or FIG protein or a polynucleotide that encodes the ROS1 protein, which are the target base sequences of that polynucleotide. It is ably a polynucleotide stated in (a1) through (a4) below. (a1) A combination of a polynucleotide that hybridizes to the coding region of part or all of the helical domain of exons 1-2 and 5'-side region upstream from that coding region of the SLC34A2 gene (also ed to as "5' SLC34A2 probe 1" hereinafter) and a polynucleotide that hybridizes to the coding region of the kinase domain and 3'-side region downstream from that coding region of the ROS1 gene (also referred to as "3' ROS1 probe 1" hereinafter.) (a2) A combination of a polynucleotide that hybridizes to the 5'-side region upstream from the coding region of the kinase domain of the ROS1 gene (also referred to as "5' ROS1 probe 1" hereinafter) and a polynucleotide that hybridizes to coding region of the kinase domain and 3'-side region downstream from that coding region of the ROS1 gene (also referred to as "3' ROS1 probe 1" hereinafter.) ] (a3) A combination of a polynucleotide that hybridizes to the coding region of the ectin type-III 9 and 5'-side region upstream from that region of the ROS1 gene (also referred to as "5' ROS1 probe 2" hereinafter) and a polynucleotide that hybridizes to the coding region of the transmembrane domain and 3'-side region downstream from that coding region of the ROS1 gene (also referred to as "3' ROS1 probe 2" hereinafter.) (a4) A combination of a polynucleotide that hybridizes to the coding region of part or all of the l domain and 5'-side region upstream from that coding region of the SLC34A2 gene (also referred to as "5' SLC34A2 probe 1" hereinafter) and a polynucleotide that hybridizes to the coding region of the coiled coil domain and 3'-side region downstream from that coding region of the SLC34A2 gene (also referred to as "3' SLC34A2 probe 1" hereinafter.) The region (target base sequence) to which the polynucleotide of (a1) used in in situ hybridization izes is preferably a region within 000 bases from the fusion site of the SLC34A2 gene and ROS1 gene, for reasons of specificity to the target base sequence and detection sensitivity, and the region to which the polynucleotides of (a2) through (a4) used in in situ hybridization hybridize is preferably a region within 1,000,000 bases from the oint in the SLC34A2 gene or ROS1 gene, for the same reasons.
The polynucleotide stated in (a) or (b) above used in in situ hybridization is preferably a collection made up of a plurality of types of polypeptide that can cover all of the entioned target base sequences, for reasons of specificity to the target base sequence and detection sensitivity. In this case, the length of the polynucleotides that constitute the collection is at least 15 bases, and preferably 100 to 1000 bases.
The polynucleotide stated in (a) or (b) above used in in situ hybridization is preferably labeled by fluorescent dye or the like for detection. Examples of such a fluorescent dye include DEAC, FITC, R6G, TexRed and Cy5, but are not d to these. Other than a fluorescent dye, the aforementioned polynucleotide may also be labeled with a dye (chromogen) such as DAB, or silver and the like based on enzymatic metal deposition.
In in situ ization, if 5' SLC34A2 probe 1 and 3' ROS1 probe 1 are used, or if ' ROS1 probe 1 and 3' ROS1 probe 1 are used, or if 5' ROS1 probe 2 and 3' ROS1 probe 2 are used, or if 5' SLC34A2 probe 1 and 3' SLC34A2 probe 1 are used, it is preferred that these probes are labeled with mutually different dyes. When in situ hybridization is performed using a combination of probes labeled with ent dyes in this manner, when the signal produced by the label of 5' SLC34A2 probe 1 (for example, scence) and the signal produced by the label of 3' ROS1 probe 1 overlap, it can be determined that genome DNA that encodes a SLC34A2-ROS1 fusion polypeptide has been detected. On the other hand, when the signal produced by the label of 5' ROS1 probe 1 and the signal produced by the label of 3' ROS1 probe 1 are split, or the signal produced by the label of 5' ROS1 probe 2 and the signal produced by the label of 3' ROS1 probe 2 are split, or the signal ed by the label of 5' SLC34A2 probe 1 and the signal produced by the label of 3' 2 probe 1 are split, it can be determined that genome DNA that encodes a SLC34A2-ROS1 fusion polypeptide has been detected.
Polynucleotide labeling may be performed by a known que. For example, a substrate base labeled with fluorescent dye or the like by nick ation or random priming may be integrated in a polynucleotide, thereby labeling that polynucleotide. In in situ hybridization, the conditions used when hybridizing the polynucleotide stated in (a) or (b) above and the aforementioned biological specimen may be varied depending on various factors such as the length of the relevant polynucleotide, but an example of high-stringency ization conditions is 0.2xSSC, 65°C, and an example of low-stringency hybridization conditions is 2.0xSSC, 50°C. Note that hybridization conditions of the same stringency as the aforementioned ions can be ed by a person skilled in the art appropriately selecting the various conditions such as salt concentration (dilution ratio of SSC) and temperature, as well as concentration of surfactant (NP-40, etc.), concentration of formamide, and pH. For example, for general hybridization conditions for screening, polynucleotide compositions are provided that are capable of hybridizing under moderate to high stringency conditions to a polynucleotide sequence provided herein, or a fragment thereof, or a complementary sequence thereof. Hybridization techniques are well known in the art of molecular biology. For purposes of ration, suitable moderately stringent conditions for testing the hybridization of a polynucleotide of the present disclosure with other polynucleotides include prewashing in a solution of 5.times.SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridizing at 50°C-60°C, 5X SSC, overnight; followed by washing twice at 65°C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 0.1% SDS. One skilled in the art will understand that the stringency of ization can be readily manipulated, such as by altering the salt content of the hybridization solution and/or the temperature at which the hybridization is performed. For e, in another ment, suitable highly ent hybridization conditions include those described above, with the exception that the temperature of hybridization is increased, e.g., to 60-65°C or 65-70°C.
Examples of methods for detecting genome DNA that encodes a SLC34A2- ROS1fusion polypeptide using the polynucleotide stated in (a) or (b) above other than the aforementioned in situ hybridization are rn blotting, rn blotting and dot ng.
In these methods, the aforementioned fusion gene is detected by hybridizing under moderate to high ency ions the polynucleotide stated in (a) or (b) above to a membrane on which a nucleic acid extract obtained from the aforementioned biological specimen has been transcribed. When using the polynucleotide of (a), it can be determined that genome DNA that encodes a SLC34A2-ROS1fusion polypeptide has been detected when a polypeptide that hybridizes to a cleotide that encodes the SLC34A2 protein and a polypeptide that hybridizes to a cleotide that encodes the ROS1 protein recognize the same band developed on the membrane.
Genome microarray analysis and DNA microarray analysis are additional methods for ing genome DNA that encodes a SLC34A2-ROS1fusion polypeptide using the polynucleotide of (b) above. In these methods, an array of polynucleotides of (b) is fixed on a substrate, and the relevant genome DNA is detected by putting the biological specimen in contact with the polynucleotides on the array. In PCR or cing, the polynucleotide of (c) stated below may be used to specifically amplify part or all of a SLC34A2-ROS1fusion polynucleotide, using DNA (genome DNA, cDNA) or RNA prepared from the biological specimen as a template. (c) A polynucleotide that is a pair of primers designed to sandwich a fusion site of a polynucleotide that encodes the SLC34A2 n and a polynucleotide that encodes the ROS1 protein. The "polynucleotide that is a pair of primers" is a primer set of which one primer hybridizes to a polynucleotide that encodes the SLC34A2 protein and the other primer hybridizes to a polynucleotide that encodes the ROS1 protein in a base sequence such as the entioned fusion polynucleotide that serves as a target. The length of these polynucleotides is normally 15 to 100 bases, and preferably 17 to 30 bases.
] From the viewpoints of precision and sensitivity of detection by PCR, the polynucleotide stated in (c) of the present disclosure is preferably a complementary sequence to the base sequence of the aforementioned fusion polynucleotide within 5000 bases from the fusion site of the polynucleotide that encodes the SLC34A2 protein and the polynucleotide that encodes the ROS1 protein.
The ucleotide that is a pair of primers” can be appropriately designed by known techniques based on the base sequence of the SLC34A2-ROS1fusion polynucleotide that serves as a target. Advantageous examples of the "polynucleotide that is a pair of s" are primer sets made up of one primer selected from the group made up of SLC34A2-ROS1-F1, SLC34A2-int15-F1, SLC34A2-int15-F2, SLC34A2-ex16-F1, SLC34A2-ex23-F1, SLC34A2-ex24-F1, SLC34A2-F-orf2438 and SLC34A2-int15-F3.5, and one primer selected from the group made up of SLC34A2-ROS1-R1, ROS1-int11-R3, ROS1- int7-R1, nt11-R0.5, nt11-R1, nt7-R2 and ROS1-R-orf2364. More preferably, it is SLC34A2-ROS1-F1 and SLC34A2-ROS1-R1, SLC34A2-int15-F1 and SLC34A2-ROS1-R1, 2-int15-F2 and ROS1-int11-R3, SLC34A2-ex16-F1 and SLC34A2-ROS1-R1, SLC34A2-ex23-F1 and 2-ROS1-R1, or SLC34A2-ex24-F1 primer and ROS1-int7-R1 primer.
Described herein are methods of: identifying, assessing or detecting a 2-ROS1 fusion; methods of identifying, assessing, ting, and/or treating a t having a cancer, e.g., a cancer having a SLC34A2-ROS1, a CD74-ROS1, or a FIGROS1 fusion; isolated SLC34A2-ROS1, CD74-ROS1, or a FIG-ROS1 nucleic acid molecules, c acid constructs, host cells containing the nucleic acid les; purified SLC34A2-ROS1, CD74-ROS1, or S1 ptides and g agents; detection reagents (e.g., probes, primers, antibodies, kits, capable, e.g., of specific detection of SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1 nucleic acids or proteins); screening assays for identifying les that interact with, e.g., inhibit, 5'SLC34A2-3'ROS1, 5’CD74-3’ROS1, or a 5‘FIG-3’ROS1fusions, e.g., novel kinase inhibitors; as well as assays and kits for evaluating, identifying, assessing and/or treating a subject having a cancer, e.g., a cancer having one or more of a SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1 fusion. The compositions and methods identified herein can be used, for example, to identify new SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1 inhibitors; to evaluate, identify or select subject, e.g., a patient, having a cancer; and to treat or prevent a cancer.
SLC34A2-ROS1, CD74-ROS1, and FIG-ROS1 Nucleic Acid Molecules.
Described herein is a nucleic acid molecule (e.g., an isolated or purified) nucleic acid molecule that es a fragment of a SLC34A2, or a CD74, or a FIG gene and a fragment of a ROS1 proto-oncogene. In one embodiment, the nucleic acid molecule includes a fusion, e.g., an in-frame fusion, of at least one exon of SLC34A2, CD74, or FIG and an exon of ROS1 (e.g., one or more exons encoding a ROS1 ne kinase domain or a fragment thereof).
In an illustrative embodiment, the 5'SLC34A2-3'ROS1 nucleic acid molecule comprises ient SLC34A2 and sufficient ROS1 ce such that the encoded 'SLC34A2-3'ROS1 fusion has constitutive kinase activity, e.g., has elevated activity, e.g., kinase ty, as compared with wild type ROS1, e.g., in a cell of a cancer referred to herein. In an embodiment the encoded 5'SLC34A2-3'ROS1 fusion comprises at least 1, 2, 3, 4, 5, 6, 7, 9, 10, or 11 exons from SLC34A2 and at least 1, 2, 3, 4, 5, 6, 7, 9,10, 11, 12, or 13 ROS1 exons. In one embodiment, the encoded 4A2-3'ROS1 fusion polypeptide includes a helical domain, or a functional fragment thereof, and a ROS1 tyrosine kinase domain or a functional nt thereof.
In an illustrative embodiment, the 5'CD74-3'ROS1 nucleic acid molecule comprises sufficient CD74 and sufficient ROS1 sequence such that the encoded 5'CD74- 3'ROS1 fusion has constitutive kinase activity, e.g., has elevated activity, e.g., kinase activity, as compared with wild type ROS1, e.g., in a cell of a cancer referred to . In an embodiment, the encoded 5'CD74-3'ROS1 fusion comprises at least 1, 2, 3, 4, 5, 6, exons from CD74 and at least 1, 2, 3, 4, 5, 6, 7, 9,10, 11, 12, or 13 ROS1 exons. In one embodiment, the encoded 5'CD74-3'ROS1 fusion polypeptide includes a helical; anchor for type II membrane protein domain, or a functional fragment thereof, and a ROS1 tyrosine kinase domain or a functional fragment thereof.
In an illustrative embodiment, the 5'FIG-3'ROS1 c acid molecule comprises sufficient FIG and sufficient ROS1 sequence such that the encoded 5'FIG-3'ROS1 fusion has constitutive kinase activity, e.g., has elevated activity, e.g., kinase activity, as compared with wild type ROS1, e.g., in a cell of a cancer referred to herein. In an embodiment the encoded 5'FIG-3'ROS1 fusion comprises at least 1, 2, 3, 4, 5, 6, 7, or 8 exons from FIG and at least 1, 2, 3, 4, 5, 6, 7, 9,10, 11, 12, or 13 ROS1 exons. In one embodiment, the encoded 3'ROS1 fusion polypeptide includes a coiled coil domain, or a functional fragment thereof, and a ROS1 tyrosine kinase domain or a functional nt thereof.
In one embodiment, the SLC34A2-ROS1 fusion nucleic acid molecule includes a nucleotide ce that has an in-frame fusion of exon 2 and/or 4 of SLC34A2 with exon 32, and/or 34, and/or 35 of ROS1. In another embodiment, the c acid molecule includes a nucleotide sequence that includes a breakpoint. For example, the SLC34A2-ROS1 fusion can include an in-frame fusion of at least exon 4 of SLC34A2 or a nt thereof (e.g., exons 1-4 of 2 or a fragment thereof) with at least exon 32 and/or 34 of ROS1 or a fragment thereof (e.g., exons 30-43 of ROS1 or a fragment thereof).
In certain ments, the 2-ROS1 fusion is in a 5'-SLC34A2 to 3'-ROS1 configuration. In one ment, the nucleic acid molecule includes the nucleotide sequence of exons 1-4 of the SLC34A2 gene, or a fragment thereof. In another embodiment, the nucleic acid molecule includes the nucleotide sequence of exons 30-43 e.g. 32, and/or 34, and/or 35 of the ROS1 gene, or a fragment thereof, or a sequence substantially identical there In one embodiment, the CD74-ROS1 fusion c acid molecule includes a nucleotide sequence that has an in-frame fusion of exons 1-6 of CD74 with exon 32, and/or 34 of ROS1. In another embodiment, the nucleic acid molecule includes a tide sequence that includes a breakpoint. For example, the CD74-ROS1 fusion can include an inframe fusion of at least exon 6 of CD74 or a fragment thereof (e.g., exons 1-6 of CD74 or a fragment f) with at least exon 32 and/or 34, and/or 35 of ROS1, or a fragment thereof (e.g., exons 30-43 of ROS1 or a fragment thereof). In certain embodiments, the CD74-ROS1 fusion is in a 5'-CD74 to 3'-ROS1 configuration. In one embodiment, the nucleic acid molecule includes the nucleotide ce of exons 1-6 of the CD74 gene, or a fragment thereof. In r embodiment, the nucleic acid molecule includes the nucleotide sequence of exons 30-43 e.g. 32, and/or 34 and/or 35 of the ROS1 gene, or a nt f, or a sequence substantially identical there to.
In one embodiment, the FIG-ROS1 fusion nucleic acid molecule includes a nucleotide sequence that has an in-frame fusion of exons 1-8, e.g. 1-4, or 1-8 of FIG with exon 32, and/or 34, and/or 35 of ROS1. In another embodiment, the nucleic acid molecule includes a nucleotide sequence that includes a breakpoint. For example, the S1 fusion can include an in-frame fusion of at least exon 4 and/or exon 8 of FIG or a fragment thereof (e.g., exons 1-4, or 1-8, of FIG or a fragment thereof) with at least exon 32 and/or 34, and/or 35 of ROS1 or a fragment thereof (for example, exons 30-43 of ROS1 or a fragment thereof). In certain embodiments, the FIG-ROS1 fusion is in a 5'-CD74 to 3'-ROS1 configuration. In one embodiment, the nucleic acid molecule includes the nucleotide sequence of exons 1-6 of the CD74 gene, or a fragment thereof. In another embodiment, the c acid molecule includes the nucleotide sequence of exons 30-43 e.g. 32, and/or 34, and/or 35 of the ROS1 gene, or a fragment thereof, or a sequence substantially identical there In other embodiments, the SLC34A2-ROS1 fusion nucleic acid molecule includes a nucleotide sequence encoding a 2-ROS1 fusion ptide that includes a fragment of a SLC34A2 gene and a fragment of a ROS1 proto-oncogene. In one embodiment, the nucleotide sequence encodes a SLC34A2-ROS1 fusion polypeptide that includes a helical domain or a functional fragment thereof, and a ROS1 tyrosine kinase domain or a functional fragment thereof.
In another embodiment, the CD74-ROS1 fusion nucleic acid molecule includes a OS1 fusion that includes a fusion junction between the ROS1 transcript and the CD74 transcript. In another embodiment, the c acid molecule includes a fusion, e.g., an me fusion, of at least exon 32, or 34, or 35 of ROS1 or a fragment f (e.g., exons 30-43 of ROS1 or a fragment thereof), and at least exon 1 or a nt thereof (e.g., exons 1-6 of CD74 or a fragment thereof). In certain embodiments, the CD74- ROS1 fusion is in a 5'- CD74 to 3'- ROS1 configuration. In one ment, the nucleic acid molecule includes the nucleotides corresponding to exons 30-43 of a ROS1 gene, e.g. exons 32, 34, or 35 or a fragment thereof, or a sequence substantially identical there to.
In another ment, the S1 fusion nucleic acid molecule includes a FIG-ROS1 fusion that includes a fusion junction between the ROS1 transcript and the FIG transcript. In r embodiment, the nucleic acid molecule includes a fusion, e.g., an inframe fusion, of at least exon 32, or 34, or 35 of ROS1 or a fragment thereof (e.g., exons 30- 43 of ROS1 or a fragment thereof), and at least exon 4 or 8 a fragment thereof (e.g., exons 1- 8 of FIG or a nt f). In certain ments, the FIG-ROS1 fusion is in a 5'- FIG to 3'- ROS1 configuration. In one ment, the nucleic acid molecule includes the nucleotides corresponding to exons 30-43 of a ROS1 gene, e.g. exons 32, 34, or 35 or a fragment thereof, or a sequence substantially identical there to.
Described herein are nucleic acid constructs that include the SLC34A2-ROS1, CD74-ROS1, and FIG-ROS1fusion nucleic acid molecules bed herein. In certain embodiments, the nucleic acid molecules are operatively linked to a native or a heterologous regulatory sequence. Also included are vectors and host cells that include the SLC34A2- ROS1 nucleic acid molecules described herein, e.g., vectors and host cells suitable for producing the nucleic acid les and ptides described herein.
] Described herein are nucleic acid molecules that s or inhibits the expression of a nucleic acid molecule that s a SLC34A2-ROS1 fusion described herein. Examples of such c acid molecules include, for example, antisense molecules, ribozymes, RNAi, triple helix molecules that hybridize to a nucleic acid encoding SLC34A2- ROS1, CD74-ROS1, and FIG-ROS1 or a transcription regulatory region of SLC34A2-ROS1, CD74-ROS1, and FIG-ROS1and blocks or reduces mRNA expression of SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1.
Described herein is a nucleic acid molecule, e.g., nucleic acid fragment, suitable as probe, primer, bait or y member that includes, flanks, hybridizes to, which are useful for identifying, or are otherwise based on, the ROS1 fusions described herein. In certain embodiments, the probe, primer or bait le is an oligonucleotide that allows capture, detection or isolation of a ROS1 fusion nucleic acid molecule described herein. The oligonucleotide can comprise a nucleotide sequence substantially complementary to a nt of the ROS1 fusion nucleic acid molecules described herein. The sequence identity between the nucleic acid fragment, e.g., the oligonucleotide, and the target ROS1fusion sequence need not be exact, so long as the sequences are sufficiently complementary to allow the capture, detection or isolation of the target sequence. In one embodiment, the nucleic acid fragment is a probe or primer that includes an oligonucleotide between about 5 and 25, e.g., between 10 and 20, or 10 and 15 tides in length. In other embodiments, the nucleic acid fragment is a bait that includes an oligonucleotide between about 100 to 300 tides, 130 to 230 tides, 150 to 200 nucleotides, 200 to 350, 350 to 950, 300 to 600, 500- 1000, 750- 2000, nucleotides 00 nucleotides, in length and do not necessarily include the ROS1 fusion nucleic acids.
In one embodiment, the nucleic acid fragment can be used to identify or capture, e.g., by hybridization, a SLC34A2-ROS1 fusion, or a CD74-ROS1 fusion, or a S1 fusion. In an illustrative example, the c acid fragment can be a probe, a primer, for use in identifying or capturing, e.g., by hybridization under moderate to high stringency conditions, a SLC34A2-ROS1 fusion or a CD74-ROS1 fusion, or a FIG-ROS1 fusion described herein. In one embodiment, the nucleic acid fragment can be useful for identifying or capturing a SLC34A2-ROS1, or a CD74-ROS1, or a FIG-ROS1 breakpoint. In one exemplary embodiment, the nucleic acid fragment hybridizes to a nucleotide sequence within a chromosomal ngement that creates an in-frame fusion of exon 4 or 13 of SLC34A2 with exon 32, 34, or 35 of ROS1 (e.g., a sequence within a translocation on chromosome 6).
The probes or primers described herein can be used, for example, for FISH detection or PCR amplification, or for RT-PCT confirmation of ROS1 rearrangements and identification of binding partners. In one ary embodiment where detection is based on PCR, amplification of the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion junctions can be performed using a primer or a primer pair, e.g., for amplifying a sequence flanking the 2-ROS1, or OS1, or FIG-ROS1 fusion junctions described herein, e.g., the mutations or the junction of a somal rearrangement described herein. In one embodiment, a pair of isolated oligonucleotide primers can amplify a region ning or adjacent to a on in the SLC34A2-ROS1 fusion. For example, forward primers can be designed to hybridize to a nucleotide sequence within SLC34A2, CD74, or FIG c or mRNA ce. In various embodiments, primers to ROS1, SLC34A2, and FIG (various species including human) are commercially available from Qiagen (Cat. Nos. QF0018545, QF00449078, and QF00278992 Qiagen, Gaithersburg, MD, USA). In other embodiments, confirmation of the presence of ROS1 fusion polynucleotides can be performed on patient’s tumor samples using a panel of PCR primers including SLC34A2 exon 4 and CD74 exon 6 forward primers paired each with a ROS1 exon 32 and exon 34 reverse primer. RNA from the tumor sample can be extracted from FFPE tissue using the Agencourt Formapure method (Agencourt Biosciences, Beverly, MA, USA) and reverse transcribed using the Superscript III cDNA sis kit commercially available from Invitrogen, ad, CA, USA. The following s can be used to determine SLC34A2-ROS1 or CD74-ROS1 breakpoints: SLC34A2 exon 4 forward, TCGGATTTCTCTACTTTTTCGTG (SEQ ID NO:3); CD74 exon 6 forward, CTCCTGTTTGAAATGAGCAGG (SEQ ID NO:4); ROS1 exon 32 reverse, GGAATGCCTGGTTTATTTGG (SEQ ID NO:5); and ROS1 exon 34 reverse, TGAAACTTGTTTCTGGTATCCAA (SEQ ID NO:6) . PCR amplifications can be performed in any PCR l cycler, for example, a Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany), using um Taq polymerase (Invitrogen) under standard conditions with 40 ng of cDNA. cDNA was sequenced using the BigDye 3.0 kit (Life Technologies, Carlsbad, CA).
The nucleic acid fragment can be detectably labeled with, e.g., a radiolabel, a fluorescent label, a inescent label, a chemiluminescent label, an enzyme label, a g pair label, or can include an affinity tag; a tag, or identifier (e.g., an adaptor, barcode or other sequence identifier).
In another exemplary embodiment, a method of determining the presence of a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion comprising: directly acquiring knowledge that a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion nucleic acid molecule or polypeptide is present in a sample from a subject. The sample can be a sample comprised of fluid, cells, tissue, e.g., a tumor tissue, it can include a nucleic acid sample, a n sample, a tumor biopsy or a circulating tumor cell or nucleic acid, it can be chosen from a lung , including a NSCLC, a SCLC, a SCC, or a combination thereof and an adenocarcinoma or a ma.
The method of detecting the SLC34A2-ROS1, or CD74-ROS1, or S1 fusion in a nucleic acid molecule, and by the use of any of the following methods: nucleic acid hybridization assay, amplification-based assays, PCR-RFLP assay, real-time PCR, sequencing, screening is, FISH, spectral karyotyping or MFISH, comparative genomic hybridization), in situ hybridization, SSP, HPLC or mass-spectrometric genotyping.
The method detecting a SLC34A2-ROS1, or OS1, or FIG-ROS1 fusion polypeptide or protein is described including the method of contacting a protein sample with a reagent which specifically binds to a 2-ROS1, or OS1, or FIG-ROS1 fusion polypeptide; and detecting the formation of a complex of the SLC34A2- ROS1, or OS1, or FIG-ROS1 fusion polypeptide and the reagent. Methods of polypeptide ion include using a reagent labeled with a detectable group to facilitate detection of the bound and d reagent, wherein the reagent is an antibody molecule, wherein the level or activity the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion is evaluated, wherein the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion is detected prior to initiating, , or after, a treatment in a subject, wherein the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion is detected at the time of diagnosis with a cancer, wherein the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion is detected at a predetermined interval, e.g., a first point in time and at least at a subsequent point in time.
] Responses to treatment are also included, ically where, responsive to a determination of the presence of the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion, one or more of the following are used: (1) stratifying a patient population; (2) identifying or selecting the subject as likely or unlikely to respond to a treatment; (3) selecting a treatment option; and/or (4) prognosticating the time course of the disease in the subject.
An isolated or purified nucleic acid molecule that encodes a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion or a breakpoint comprising fragment thereof can be used for confirmatory purpose and direct specific ent of NSCLC and lung adenocarcinoma ROS1 fusion ve cancer using the compounds of the present invention. Other constructs can be used to direct ic treatment of ROS1 fusion positive cancers, for example, ROS1- rearranged NSCLC, including: an isolated or purified nucleic SLC34A2-ROS1, or CD74- ROS1, or S1 fusion nucleic acid molecule operatively linked to a native or a logous regulatory ce. An isolated or purified vector sing a nucleic acid molecule that encodes a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion or a oint comprising fragment thereof. A host cell comprising a vector. A nucleic acid molecule that specifically reduces or inhibits the expression of a nucleic acid molecule that encodes a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion, which can be selected from an antisense molecule, ribozyme, siRNA, or triple helix molecule. An isolated or purified SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide or breakpoint containing nt thereof. The isolated or purified SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide having a ROS1 kinase activity, and/or a dimerizing or multimerizing activity. An isolated or purified antibody molecule that specifically binds a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide. The antibody le, wherein said antibody molecule is a monospecific antibody molecule to the SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide.
Examples of the method for detecting the translation product of the SLC34A2- ROS1, or CD74-ROS1, or FIG-ROS1 fusion polynucleotide in the present disclosure are immunostaining, western blotting, ELISA, flow cytometry, precipitation and antibody array analysis. In these methods, an antibody that binds to a SLC34A2-ROS1, or OS1, or FIG-ROS1 fusion polypeptide is used. Examples of such an antibody are an antibody specific to a polypeptide containing a fusion site of the SLC34A2, or CD74, or FIG protein and ROS1 protein (also referred to as "fusion pecific antibody" hereinafter), an antibody that binds to a polypeptide made up of a region on the C terminal side from the aforementioned fusion site of the ROS1 protein (also ed to as "ROS1-C terminal antibody" hereinafter), and an antibody that binds to a polypeptide made up of a region on the N terminal side from the aforementioned fusion site of the SLC34A2, or CD74, or FIG protein (also referred to as " SLC34A2, or CD74, or FIG -N terminal antibody" hereinafter).
Here, "fusion site-specific antibody" means an antibody that specifically binds to a polypeptide ning the aforementioned fusion site but does not bind to either wild-type (normal-type) SLC34A2, or CD74, or FIG protein or wild-type (normal-type) ROS1 protein.
A SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide can be detected by the aforementioned fusion site-specific antibody or a combination of the aforementioned ROS1-C terminal antibody and SLC34A2, or CD74, or FIG -N terminal antibody. However, since almost no expression of the ROS1 n, for example, is detected in normal lung cells, the presence of a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide in lung adenocarcinoma tissue can be detected even if the ROS1-C terminal dy alone is used in immunostaining.
In various ments, immunohistochemical staining (IHC) and western blotting applications for the identification of ROS1 fusion polypeptides of the present disclosure can be med using o-ROS1, ROS1antibodies that are commercially available from Cell ing Technology (Danvers, MA, USA). In one embodiment, identification of ROS1 fusion ve cancer cells, for example NSCLC ROS1 rearranged lung cancer cells can be made with rabbit anti-ROS1monoclonal antibody D4D6, Cat. No. 3287 (Cell Signaling Technology, Danvers, MA, USA).
In some embodiments, the "antibody that binds to a SLC34A2-ROS1, or CD74- ROS1, or FIG-ROS1 fusion polypeptide" can be prepared by a person skilled in the art selecting an appropriate known method. An example of such known methods is a method in which an immune animal is inoculated with the aforementioned polypeptide made up of a C al portion of the ROS1 protein, a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polypeptide, the aforementioned polypeptide made up of an N terminal portion of the SLC34A2, or CD74, or FIG protein, etc. thereby ting the immune system of the animal, and then the blood serum of the animal is recovered (polyclonal antibody), and methods for producing monoclonal dies such as the oma method, recombinant DNA method and phage display method. If an antibody to which a labeled substance is bound is used, the target protein can be directly detected by detecting the label. The labeled substance is not particularly limited provided that it can bind to the antibody and can be ed. Examples include peroxidase, β-D-galactosidase, microperoxidase, horseradish peroxidase (HRP), fluorescein isothiocyanate (FITC), rhodamine isothiocyanate (RITC), alkali phosphatase, , and radioactive substances. Furthermore, in on to s that directly detect a target protein using an antibody to which a labeled substance is bound, methods that ctly detect the target protein using protein G, protein A or a secondary antibody to which a labeled substance is bound may also be used.
If the presence of a SLC34A2-ROS1, or OS1, or FIG-ROS1 fusion polynucleotide or polypeptide is detected in a specimen isolated from a subject by the aforementioned methods, it is judged that efficacy of cancer treatment by a ROS1 tyrosine kinase inhibitor such as a compound of Formula I, Ia or compound 1, or a pharmaceutically acceptable salt thereof, will be high in that patient, whereas if the presence of a SLC34A2- ROS1, or CD74-ROS1, or FIG-ROS1 fusion polynucleotide is not detected, it is judged that efficacy of cancer treatment by a ROS1 tyrosine kinase inhibitor will be low in that patient.
As bed above, any of the polynucleotides stated in (a) through (c) below having a chain length of at least 15 bases may be advantageously used in detecting the presence or absence of a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polynucleotide; (a) a cleotide that is at least one probe selected from the group made up of probes that ize to a polynucleotide that encodes the SLC34A2, or CD74, or FIG protein and probes that hybridize to a polynucleotide that encodes the ROS1 n.; (b) a polynucleotide that is a probe that hybridizes to a fusion site of a polynucleotide that encodes the SLC34A2, or CD74, or FIG protein and a polynucleotide that encodes the ROS1 protein; (c) a polynucleotide that is a pair of primers designed to sandwich a fusion site of a polynucleotide that encodes the SLC34A2, or CD74, or FIG protein and a polynucleotide that encodes the ROS1 protein.
These cleotides have a base sequence complementary to the specific base sequence of the target gene. Here, "complementary" may mean not completely complementary, provided that it hybridizes, for example, under mopderate to high stringency conditions. For example, these polypeptides have 80% or , preferably 90% or higher, more preferably 95% or higher, and most preferably 100% homology with the ied base sequence.
In the polynucleotides of (a) through (c), in part or all of DNA or RNA, nucleotides may be substituted with artificial nucleic acids such as PNA (polyamide nucleic acid, peptide nucleic acid), LNA (trademark, locked nucleic acid, bridged nucleic acid), ENA mark, 2'-O, 4'-C-ethylene-bridged nucleic acids), GNA (glycerol nucleic acid) and TNA (threose c acid).
Further, as described above, an antibody that binds to a SLC34A2-ROS1, or CD74-ROS1, or S1 fusion polypeptide is advantageously used in detecting the translation product of a SLC34A2-ROS1, or CD74-ROS1, or FIG-ROS1 fusion polynucleotide. Accordingly, described herein is a drug for determining the effectiveness of cancer treatment by a ROS1 tyrosine kinase inhibitor, comprising this antibody.
The detection method of a fusion gene described herein includes a step of detecting the presence of polynucleotides of the present specification in a sample obtained from a test subject. As the sample obtained from a test t, substances collected from a test subject (samples isolated from a living body), specifically, any types of body fluid (preferably blood) collected, alveolar and bronchial washings, samples having undergone biopsy, and phlegm samples are used. Preferably, a biopsy sample or a phlegm sample from an ed area in the lung of a test subject is used. From the sample, genome DNA can be ted and used. In addition, transcripts thereof (products produced as a result of ription and translation of a ; for example, mRNA, cDNA and proteins) can be used. Particularly, it is preferable to e and use mRNA or cDNA.
Genome DNA can be extracted by known methods, and the extraction can be easily med using a commercially available DNA extraction kit.
The step of detection can be performed according to known gene analysis methods (for example, known methods that are commonly used as gene detection methods such as PCR, LCR (Ligase chain reaction), SDA (Strand displacement amplification), NASBA (Nucleic acid sequence-based amplification), ICAN (Isothermal and chimeric primer-initiated ication of c acids), LAMP (Loop-mediated isothermal ication) method, TMA (Gen-Probe' s TMA system) method, in situ hybridization method, and microar-rays). For example, a hybridization technology in which a c acid hybridized with a polynucleotide to be detected is used as a probe, a gene ication technology in which DNA hybridized with a polynucleotide to be detected is used as a primer, or the like is used.
Specifically, the detection is performed using nucleic acids derived from a sample obtained from a test subject, for example, mRNA and the like. The amount of mRNA is measured by a method of gene amplification reaction by using primers that are designed so as to be able to specifically amplify the ce of a polynucleotide to be detected. The primers used in the ion method bed herein, or the primers included in the detection kit are not ularly limited as long as the primers can specifically amplify the sequence of a cleotide to be detected, and designed based on the base sequence of a cleotide to be detected. Primers used in the PCR amplification monitor method can be designed using primer design software (for example, Primer Express manufactured by PE tems) and the like. In addition, since the larger the size of a PCR product is, the more the amplification efficiency worsens, it is appropriate for a sense primer and an antisense primer to be designed such that the size of amplification products obtained when mRNA or cDNA is amplified becomes 1 kb or less.
More specifically, a sense primer (5'-primer) is designed from a portion encoding SLC34A2, and an antisense primer (3'-primer) is designed from a portion ng ROS1. It is able to use the primer included in the detection kit described herein, and it is more preferable to use the primer that is most suitably included in the detection kit. In the PCR amplification monitor method, it is also possible to design multiplex PCR for detecting all fusion polynucleotides in a single reaction liquid, by mixing the above sense primers corresponding to respective genes. By the method suitable for each amplification technology, it is possible to confirm r or not a target gene (whole gene or a specific portion thereof) has been amplified. For example, in the PCR method, PCR products are analyzed by agarose gel ophoresis and subjected to ethidium bromide staining and the like, whereby it is possible to confirm whether or not amplified nts having a target size have been obtained. When the amplified fragments having a target size have been obtained, this indicates that a polynucleotide to be detected is present in the sample obtained from a test subject. The presence of a polynucleotide to be detected can be detected in this manner.
The detection method of a fusion gene described herein preferably includes a step of detecting the presence of a specific polynucleotide in a sample obtained from a test subject by a gene amplification reaction and a step of detecting whether or not amplified fragments having a target size have been obtained.
The detection using a hybridization technology is med using, for example, northern hybridization, dot blotting method, DNA microarray method, and RNA protection method. As probes used for hybridization, it is possible to use a probe which comprises sequences consisting of 16 bases respectively upstream and downstream of the fusion point as a center of a nucleic acid molecule consisting of at least 32 consecutive bases hybridizing with a polynucleotide to be ed or with a complementary strand thereof under a moderate to high stringency conditions (preferably under a high ency condition), or comprises complementary strands thereof.
It is also possible to use a gene amplification technology such as RT-PCR. In the RT-PCR method, the PCR amplification monitor (real time PCR) method is med during the process of gene amplification, whereby the presence of a polynucleotide to be detected can be more quantitatively analyzed. PCR amplification monitor methods can be used. Real time PCR is a known method, and can be simply performed using cially available instruments and kits for this method.
The detection method of a fusion protein of some of the embodiments described herein includes a step of detecting the presence of a specific polypeptide in a sample obtained from a test subject, that is, a polypeptide encoded by a polynucleotide to be detected (hereinafter, called a polypeptide to be detected). Such a detection step can be performed by immunoassay method or enzyme activity assay method that is conducted by preparing a solubilized liquid derived from a sample ed from a test t (for e, a cancer tissue or cells obtained from a test t) and ing a polypeptide to be detected contained in the liquid with an anti-SLC34A2, or an anti-CD74, or an anti- FIG antibody and an anti-ROS1 antibody. Preferably, it is possible to use techniques using a monoclonal antibody or a polyclonal dy specific to a polypeptide to be detected, such as enzymatic immunoassay method, double antibodies sandwich ELISA , scence immunoassay method, radioimmunoassay method, and western blotting method.
When the polynucleotide to be detected or polypeptide to be detected in the detection method described herein is detected from a sample obtained from a test subject, the test t is a subject (patient) who has cancer with the polynucleotide positive and is to be provided with ent using ROS1 inhibitors.
The detection kit described herein comprises at least sense and antisense primers that are designed so as to be able to specifically amplify a polynucleotide to be detected in the detection method described herein. The sense and antisense primer set is a set of polynucleotides functioning as primers for ying a polynucleotide to be detected.
In one embodiment, the primer set described herein for the detection of a fusion gene comprises (1) a primer set which comprises a sense primer designed from a portion encoding SLC34A2, or CD74, or FIG and an antisense primer designed from a portion encoding ROS1 and is for detecting a fusion gene of SLC34A2, or CD74, or FIG and ROS1 gene, wherein the anti-sense primer consists of a nucleic acid molecule (preferably a c acid le consisting of at least 16 bases) hybridizing with a “polynucleotide to be detected” under moderate to high stringencyconditions (preferably under high stringency conditions), and the sense primer consists of a nucleic acid molecule rably a nucleic acid molecule consisting of at least 16 bases) izing with a complementary strand of the “polynucleotide to be detected” under a stringent condition (preferably under high stringency conditions).
The following primer sets (2) and (3) are included in the primer set as more specific variants of primer set (1). (2) A primer set of a sense primer that consists of an oligonucleotide consisting of at least any 16 consecutive bases. ] (3) A primer set of a sense primer that consists of an oligonucleotide consisting of at least any 16 consecutive bases.
In these primer sets (1) to (3), an interval between the ons where the sense primer and the anti-sense primer are selected is preferably 1 kb or less, or the size of an amplification product amplified by the sense primer and the antisense primer is ably 1 kb or less.
In addition, the primer has a strand length consisting of 15 to 40 bases in general, preferably consisting of 16 to 24 bases, more preferably consisting of 18 to 24 bases, and particularly preferably consisting of 20 to 24 bases.
The primer set can be used for amplifying and ing a polynucleotide to be detected. er, though not particularly limited, the respective primers included in the primer set of the present disclosure can be prepared by, for example, al synthesis.
Exemplary ROS1, SLC34A2, or CD74 primers operable to detect ROS1 fusion polynucleotides are provided in Table 2.
Table 2. Exemplary primer set for fying various ROS1 fusion proteins in accordance with the present disclosure.
Primer name Primer Sequence (5’-3’) ROS1 InvPCR F1 GTCTGGCATAGAAGATTAAAG (SEQ ID NO: 7) ROS1 InvPCR F2 AAACGAAGACAAAGAGTTGG (SEQ ID NO: 8) ROS1 InvPCR R1 GTCAGTGGGATTGTAACAAC (SEQ ID NO: 9) ROS1 InvPCR R2 AAACTTGTTTCTGGTATCC (SEQ ID NO: 10) ROS1 Break Rev1 AGCCAACTCTTT (SEQ ID NO: 11) TCTATTTCCCAAACAACGCTATTAATCAGACCC (SEQ ROS1 E43R1 ID NO: 12) ROS1 E34R TTGTTTCTGGTATCCAA (SEQ ID NO: 13) CD74 E5F CCTGAGACACCTTAAGAACACCA (SEQ ID NO: 14) SLC34A2 E4F TCGGATTTCTCTACTTTTTCGTG (SEQ ID NO: 15) A method of screening an anticancer drug includes: contacting a sample compound to a cell expressing the fusion protein; and ing the fusion protein expression level in the cell, n the fusion protein expression level in the cell d with the sample compound is decreased compared with that before the treatment with the sample compound or that in a eated cell, the sample compound is determined as a candidate compound for the anticancer drug.
The method of screening an anticancer drug may further include the step of measuring the fusion protein expression level in the cell before the treatment of the sample compound. In this case the sample compound may be determined as a candidate compound for the anticancer drug when the fusion protein expression level after treatment of the sample compound is decreased compared with that before the treatment with the sample compound in the same cell. Alternatively, the method of screening an anticancer drug may include providing cells expressing the fusion protein, and contacting a sample compound to a part of the provided cells. In this case the sample compound may be determined as a ate compound for the anticancer drug when the fusion protein expression level in the cell contacted with the sample compound is decreased compared with that in the cells which are not contacted with the sample compound.
The cell used in the screening method may be a cell d from a cancer cell where the fusion gene or the fusion protein is expressed and/or activated, an extract of the cell, or a culture of the cell. The cancer cell may be a solid cancer cell, in particular a lung cancer, for e a non-small cell lung cancer such as a lung adenocarcinoma, as described above.
Still another embodiment provides a method of screening an anticancer drug against lung cancer including: treating a cell expressing the fusion protein with a sample compound; measuring the fusion protein expression level in the cell, n the fusion protein expression level in the cell d with the sample compound is decreased compared with that before the treatment with the sample compound or that in a non-treated cell, the sample compound is determined as a candidate nd for the ncer drug against lung cancer.
The ROS1 fusion proteins (i.e. SLC34A2-ROS1, CD74-ROS1, and FIGROS1 ) can be used as a marker for diagnosing a lung cancer or for treating or preventing or treating a lung . The treatment or prevention of lung cancer comprises the step of administering a therapeutically effective amount of at least one inhibitor against the fusion protein, at least one inhibitor t the fusion gene encoding the fusion protein, at least one inhibitor against a ROS1 coding gene, or .a combination thereof, to a patient in need thereof.
The inhibitor can be such as Formula I, Ia or compound 1, or a pharmaceutically acceptable salt thereof.
] Another embodiment provides a method of preventing and/or treating a cancer, comprising administering a pharmaceutically (therapeutically) effective amount of at least one inhibitor against the fusion protein, at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a ROS1 coding gene, or a combination thereof, to a patient in need thereof, any of which may be the compounds of Formula 1 and the other specific compounds disclosed herein. The method may further comprise the step of identifying the patient who needs the prevention and/or treatment of a cancer, prior to the step of administering such treatment. Another ment provides a composition for preventing and/or treating a cancer, sing administering at least one inhibitor against the fusion protein, including a 1, either alone or with at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a ROS1 coding gene, or a combination thereof. Another embodiment provides a use of an inhibitor against the fusion protein, an inhibitor against the fusion gene encoding the fusion protein, an inhibitor against a ROS1 coding gene, or a combination thereof, for ting and/or treating a cancer. The inhibitor can be such as Formula I, Ia or nd 1, or a ceutically acceptable salt thereof.
In the present sure, the cancer may be a lung , in particular a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC) such as a lung adenocarcinoma, a squamous cell lung carcinoma, or a large cell lung carcinoma.
The composition wherein the inhibitor against the ROS1 fusion n is at least one ed from the group consisting of an aptamer specifically binding to the fusion protein, an antibody specifically binding to the fusion protein and the inhibitor against the fusion gene or the ROS1 coding gene is at least one selected from the group consisting of siRNA, shRNA, miRNA, and an r, which are capable of specifically binding to the fusion gene or the ROS1 coding gene.
Any ROS1 kinase inhibitor that inhibits the sion of ROS1 and/or ROS1 kinase activity (e.g., transcription, translation, or stability) may be used alone or in combination with the compound of Formula I, Ia, or compound 1, or a pharmaceutically able salt thereof.
The inhibiting agent may be ROS1-specific, or it may be non-specific (e.g., nonspecific kinase inhibitors, multi-target inhibitors). Several ROS1 kinase inhibitors have been developed, and their al applications are being investigated. Downstream of the ROS1 kinase activity, there are kinases such as phosphatidylinositol 3 kinases (PI3K) and extracellular signal kinases 1/2 (ERK) (Wixted JH et al. J Biol Chem 2011), and STAT3 (Hwang JH et al. Mol Endocrinol 2003; 17: 1155-1166). A drug that inhibits such downstream signal transmission routes can also be used as an alternative to an ROS1 kinase inhibitor or as an adjuvant, alone or in combination with the compounds of Formula 1.
In one mode, subjects judged to have a SLC34A2-ROS1, or CD74-FIG translocation or a FIG-ROS1 deletion, are also judged as having an ROS1 mutation at a site beyond the ocation site. An example of an ROS1 mutation is an activating mutation, which enables constitutive kinase activity. The ROS1 activating mutation is an arbitrary on that causes an increase in activation in comparison with the wild type mutation. For example, an ROS1 activating mutation may bring about permanent ROS1 activation. There may even be a secondary ROS1 ting mutation t that is associated with or is due to the use of an ROS1 inhibitor. Mutations that give rise to an increase in ROS1 signal activity occur because of, for example, a kinase domain point mutation, deletion, insertion, duplication, or inversion, or combination of two or more of those, which give rise to an increase in the ROS1 signal. For subjects who are judged to have both a ROS1 fusion translocation or deletion as provided herein, and an ROS1 mutation, the on can also be made to treat them with an ROS1 kinase tor. In addition, treatment/therapy may be carried out on them based on that decision.
As described above, the effectiveness of cancer treatment by a ROS1 tyrosine kinase inhibitor is considered to be high in a patient in whom a SLC34A2-ROS1, or a CD74- ROS1, or a FIG-ROS1 fusion polynucleotide is detected by the method described herein. For this reason, cancer treatment can be efficiently performed by administering a ROS1 ne kinase inhibitor ively to those cancer patients who possess the 2-ROS1, or a CD74-ROS1, or a FIG-ROS1 fusion gene and the ROS1 gene. Accordingly, described herein is a method for treating cancer, comprising a step of administering a ROS1 tyrosine kinase inhibitor which is Formula I, Ia or compound 1, or a pharmaceutically acceptable salt thereof, to a patient in whom the effectiveness of cancer treatment by that ROS1 tyrosine kinase inhibitor was determined to be high by the aforementioned diagnostic method described herein.
] In the present disclosure, a men" is not only a biological specimen (for example, cells, tissue, organ, fluid (blood, lymph fluid, etc.), digestive fluid, sputum, alveolar/bronchial lavage fluid, urine, stools), but also includes c acid extracts e DNA extract, mRNA extract, or cDNA preparation or cRNA preparation prepared from mRNA extract) or protein extracts obtained from these ical specimens. This specimen may also be one that has undergone formalin fixing treatment, l fixing treatment, freezing treatment or paraffin embedding treatment.
Furthermore, the genome DNA, mRNA, cDNA or protein may be prepared by a person skilled in the art after selected a suitable known technique considering the type, state and so forth of the specimen.
In addition to the aforementioned substances (polynucleotides, antibodies) as active ingredients, the drug of the present invention may contain other pharmaceutically acceptable ingredients. Examples of such ingredients include buffering , emulsifiers, suspending agents, stabilizers, preservatives, physiological saline and so forth. As buffering agents, ates, citrates, acetates and so forth may be used. As emulsifiers, gum arabic, sodium alginate, tragacanth and so forth may be used. As suspending agents, glycerol monostearate, aluminum monostearate, methylcellulose, carboxymethylcellulose, hydroxymethylcellulose, sodium lauryl sulfate and so forth may be used. As stabilizers, propylene , diethyl e, ascorbic acid and so forth may be used. As vatives, sodium azide, benzalkonium chloride, paraoxybenzoic acid, chlorobutanol and so forth may be used.
Furthermore, in addition to the preparation that contains polynucleotides and dies, preparations such as a substrate, a ve control (for example, SLC34A2- ROS1, CD74-ROS1, or FIG-ROS1 fusion polynucleotides, SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1 fusion polypeptides, or cells that possess them, etc.) and a negative control necessary for detection of the label appended to the polynucleotides and antibodies, a counterstaining reagent (DAPI, etc.) used in in situ hybridization or the like, a molecule required in detecting the antibody (for e, a secondary antibody, protein G, protein A), and buffer solution used in dilution or washing of the dy may be combined as a kit for use in the method described herein. This kit may include instructions for use of the kit.
Described herein is the aforementioned kit for use in the method described .
The methods of detection described herein are particularly useful when a fusion protein is detected which consists essentially of N-terminal domain of a fusion partner and C- terminal domain of ROS1 n encoding a kinase domain. The fusion protein may be SLC34A2-ROS1 fusion protein consisting essentially of N-terminal domain of SLC34A2 protein or fragment thereof and C-terminal domain of ROS1 protein encoding a kinase domain. The fusion protein may be CD74-ROS1 fusion protein consisting essentially of N- terminal domain of CD74 protein or a fragment thereof and C-terminal domain of ROS1 protein encoding a kinase domain. The fusion protein may be FIG-ROS1 fusion protein consisting ially of N-terminal domain of FIG protein or a fragment thereof and C- terminal domain of ROS1 protein encoding a kinase domain. The method can be used for diagnosing a lung cancer, ularly non small cell lung cancer and includes: detecting at least one of a ROS1-involved chromosomal ngement including inversion, translocation, or deletion in chromosome 6; a fusion protein wherein protein is fused with other protein; a fusion gene encoding the fusion protein; and the pression of ROS1 compared to a standard sample from an individual without a cancer. When one of the chromosomal rearrangements described above selected from the above group is detected in the test , the individual for ent of a ROS1 inhibitor, such as a a I, Ia or compound 1, or a ceutically acceptable salt thereof. ation of Compound 1 Preparation of N-(4-{[6,7-bis(methyloxy)quinolinyl]oxy}phenyl)-N'-(4- fluorophenyl)cyclopropane-1,1-dicarboxamide and the (L)-malate salt thereof.
The synthetic route used for the preparation of N-(4-[6,7-bis(methyloxy)quinolin yl]oxy}phenyl)-N'-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide and the (L)-malate salt thereof is depicted in Scheme 1: Scheme 1 OH Cl O O POCl3/CH3CN O O N O N O N 2,6-Lutidine H H N N Pd/C HCO2H, HCO2K O O K2CO3,H2O, THF O O F EtO H O (L)-Malic acid F Acetone O N O O THF O N Cl N Oxalyl de H H THF N N 1) SO2Cl2, Et3N DMF O O THF F O O O O O F HO OH O .C4H6O5 F HO N H2N O N Compound (I) Preparation of ro–6,7–dimethoxy–quinoline A reactor was charged sequentially with 6,7-dimethoxy-quinolineol (10.0 kg) and acetonitrile (64.0 L). The resulting mixture was heated to approximately 65 °C and orus oxychloride (POCl3, 50.0 kg) was added. After the addition of POCl3, the temperature of the reaction mixture was raised to approximately 80 °C. The reaction was deemed complete (approximately 9.0 hours) when less than 2 percent of the starting material remained (in process high-performance liquid chromotography [HPLC] analysis). The reaction mixture was cooled to approximately 10 °C and then quenched into a d on of dichloromethane (DCM, 238.0 kg), 30% NH4OH (135.0 kg), and ice (440.0 kg). The resulting mixture was warmed to approximately 14 °C, and phases were separated. The organic phase was washed with water (40.0 kg) and concentrated by vacuum distillation to remove the solvent (approximately 190.0 kg). Methyl-t-butyl ether (MTBE, 50.0 kg) was added to the batch, and the mixture was cooled to approximately 10 °C, during which time the product llized out. The solids were recovered by centrifugation, washed with n heptane (20.0 kg), and dried at approximately 40 °C to afford the title compound (8.0 kg).
Preparation of 6,7–Dimethyl–4–(4-nitro–phenoxy)–quinoline A reactor was sequentially charged with 4-chloro-6,7-dimethoxy-quinoline (8.0 kg), 4 nitrophenol (7.0 kg), 4 dimethylaminopyridine (0.9 kg), and 2,6 ne (40.0 kg). The reactor contents were heated to approximately 147 °C. When the reaction was complete (less than 5 percent starting material remaining as determined by in process HPLC analysis, approximately 20 hours), the reactor contents were allowed to cool to approximately 25 °C.
Methanol (26.0 kg) was added, followed by potassium carbonate (3.0 kg) dissolved in water (50.0 kg). The reactor contents were stirred for approximately 2 hours. The resulting solid precipitate was filtered, washed with water (67.0 kg), and dried at 25 °C for approximately 12 hours to afford the title compound (4.0 kg).
Preparation of 4–(6,7 –Dimethoxy–quinoline–4–yloxy)–phenylamine A solution containing potassium formate (5.0 kg), formic acid (3.0 kg), and water (16.0 kg) was added to a mixture of methoxy(4-nitro-phenoxy)-quinoline (4.0 kg), percent palladium on carbon (50 percent water wet, 0.4 kg) in ydrofuran (THF, 40.0 kg) that had been heated to imately 60 °C. The addition was carried out such that the ature of the on mixture remained approximately 60 °C. When the reaction was deemed complete as determined using in-process HPLC analysis (less than 2 t starting material remaining, lly 1 5 hours), the reactor contents were filtered. The filtrate was concentrated by vacuum distillation at approximately 35 °C to half of its original volume, which resulted in the itation of the product. The t was recovered by filtration, washed with water (12.0 kg), and dried under vacuum at approximately 50 °C to afford the title compound (3.0 kg; 97 percent area under curve (AUC)).
Preparation of 1-(4-Fluoro-phenylcarbamoyl)-cyclopropanecarboxylic acid Triethylamine (8.0 kg) was added to a cooled (approximately 4 °C) solution of commercially available cyclopropane-1,1-dicarboxylic acid (2 1, 10.0 kg) in THF (63.0 kg) at a rate such that the batch temperature did not exceed 10 °C. The solution was stirred for approximately 30 minutes, and then thionyl chloride (9.0 kg) was added, g the batch temperature below 10 °C. When the on was te, a solution of 4–fluoroaniline (9.0 kg) in THF (25.0 kg) was added at a rate such that the batch temperature did not exceed 10 °C. The mixture was stirred for approximately 4 hours and then diluted with isopropyl acetate (87.0 kg). This solution was washed sequentially with aqueous sodium hydroxide (2.0 kg dissolved in 50.0 L of water), water (40.0 L), and aqueous sodium chloride (10.0 kg dissolved in 40.0 L of water). The organic solution was concentrated by vacuum distillation followed by the addition of e, which resulted in the precipitation of solid. The solid was recovered by centrifugation and then dried at approximately 35 °C under vacuum to afford the title compound. (10.0 kg).
Preparation of 1-(4-Fluoro-phenylcarbamoyl)-cyclopropanecarbonyl chloride ] Oxalyl chloride (1.0 kg) was added to a solution of 1-(4-fluoro-phenylcarbamoyl)- cyclopropanecarboxylic acid (2.0 kg) in a mixture of THF (11 kg) and N, N- dimethylformamide (DMF; 0.02 kg) at a rate such that the batch temperature did not exceed °C. This on was used in the next step without further processing.
Preparation of N-(4-{[6,7-bis(methyloxy)quinolinyl]oxy}phenyl)-N'-(4- fluorophenyl)cyclopropane-1,1-dicarboxamide The solution from the previous step containing 1-(4-fluoro-phenylcarbamoyl)- cyclopropanecarbonyl chloride was added to a mixture of 4-(6,7-dimethoxy-quinoline yloxy)-phenylamine (3.0 kg) and potassium carbonate (4.0 kg) in THF (27.0 kg) and water (13.0 kg) at a rate such that the batch temperature did not exceed 30 °C. When the reaction was complete (in typically 10 minutes), water (74.0 kg) was added. The mixture was stirred at 15-30 °C for approximately 10 hours, which resulted in the precipitation of the t.
The product was recovered by filtration, washed with a pre-made solution of THF (11.0 kg) and water (24.0 kg), and dried at approximately 65 °C under vacuum for imately 12 hours to afford the title compound (free base, 5.0 kg). 1H NMR (400 MHz, d6-DMSO): δ 10.2 (s, 1H), 10.05 (s, 1H), 8.4 (s, 1H), 7.8 (m, 2H), 7.65 (m, 2H), 7.5 (s, 1H), 7.35 (s, 1H), 7.25 (m, 2H), 7.15(m, 2H), 6.4 (s, 1H), 4.0 (d, 6H), 1.5 (s, 4H). LC/MS: M+H= 502.
Preparation of N-(4-{[6,7-bis(methyloxy)quinolinyl]oxy}phenyl)-N'-(4- fluorophenyl)cyclopropane-1,1-dicarboxamide, (L) malate salt A solution of L-malic acid (2.0 kg) in water (2.0 kg) was added to a solution of Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolineyloxy)-phenyl]-amide (4- fluoro-phenyl)-amide free base (1 5, 5.0 kg) in ethanol, maintaining a batch temperature of approximately 25 °C. Carbon (0.5 kg) and thiol silica (0.1 kg) were then added, and the resulting mixture was heated to imately 78 °C, at which point water (6.0 kg) was added. The reaction mixture was then ed, followed by the addition of isopropanol (38.0 kg), and was allowed to cool to approximately 25 °C. The product was red by filtration and washed with isopropanol (20.0 kg), and dried at approximately 65 °C to afford the title compound (5.0 kg).
Alternative ation of N-(4-{[6,7-Bis(methyloxy)quinolinyl]oxy}phenyl)-N’-(4- fluorophenyl)cyclopropane-1,1-dicarboxamide and the (L)-malate salt thereof.
An alternative synthetic route that can be used for the preparation of N-(4-{[6,7- bis(methyloxy)quinolinyl]oxy}phenyl)-N’-(4-fluorophenyl)cyclopropane-1,1- dicarboxamide and the (L)-malate salt thereof is depicted in Scheme 2, as described in , the entire contents of which is incorporated by reference.
Scheme 2 Preparation of 4–Chloro–6,7–dimethoxy–quinoline ] A reactor was charged sequentially with 6,7-dimethoxy-quinolineol (47.0 kg) and acetonitrile (318.8 kg). The resulting mixture was heated to approximately 60 °C and phosphorus oxychloride (POCl3, 130.6 kg) was added. After the on of POCl3, the temperature of the on mixture was raised to approximately 77 °C. The reaction was deemed complete (approximately 13 hours) when less than 3% of the starting material remained (in-process high-performance liquid chromatography [HPLC] analysis). The reaction mixture was cooled to approximately 2-7 °C and then quenched into a d solution of dichloromethane (DCM, 482.8 kg), 26 t NH4OH (251.3 kg), and water (900 L). The resulting mixture was warmed to approximately 20-25 °C, and phases were separated. The organic phase was filtered h a bed of AW hyflo super-cel NF (Celite; .4 kg) and the filter bed was washed with DCM (118.9 kg). The combined organic phase was washed with brine (282.9 kg) and mixed with water (120 L). The phases were separated and the organic phase was concentrated by vacuum distillation with the removal of solvent (approximately 95 L residual volume). DCM (686.5 kg) was charged to the reactor containing organic phase and concentrated by vacuum distillation with the removal of solvent (approximately 90 L residual volume). Methyl t-butyl ether (MTBE, 226.0 kg) was then charged and the temperature of the mixture was adjusted to -20 to -25 °C and held for 2.5 hours ing in solid precipitate which was then filtered and washed with n-heptane (92.0 kg), and dried on a filter at approximately 25 °C under en to afford the title nd. (35.6 kg).
Preparation of 4–(6, 7 –Dimethoxy–quinoline–4–yloxy)–phenylamine 4-Aminophenol (24.4 kg) dissolved in methylacetamide (DMA, 184.3 kg) was charged to a reactor containing 4-chloro-6,7-dimethoxyquinoline (35.3 kg), sodium tbutoxide (21.4 kg) and DMA (167.2 kg) at 20-25 °C. This e was then heated to 100- 105 °C for approximately 13 hours. After the reaction was deemed complete as determined using cess HPLC analysis (less than 2 percent starting material remaining), the r contents were cooled at 15-20 °C and water (pre-cooled, 2-7 °C, 587 L) charged at a rate to maintain 15-30 °C temperature . The resulting solid precipitate was filtered, washed with a mixture of water (47 L) and DMA (89.1 kg) and finally with water (214 L). The filter cake was then dried at approximately 25 °C on filter to yield crude 4-(6, 7-dimethoxy-quinoline yloxy)-phenylamine (59.4 kg wet, 41.6 kg dry calculated based on LOD). Crude 4-(6, 7- dimethoxy-quinolineyloxy)-phenylamine was refluxed (approximately 75 °C) in a mixture of ydrofuran (THF, 211.4 kg) and DMA (108.8 kg) for approximately 1hour and then cooled to 0–5 °C and aged for approximately 1 hour after which time the solid was filtered, washed with THF (147.6 kg) and dried on a filter under vacuum at approximately 25 °C to yield 4-(6,7-dimethoxy-quinolineyloxy)-phenylamine (34.0 kg).
Alternative Preparation of 4–(6, thoxy-quinolineyloxy)-phenylamine 4-chloro-6,7-dimethoxyquinoline (34.8 kg) and 4-aminophenol (30.8 kg) and sodium tert pentoxide (1.8 equivalents) 88.7 kg, 35 weight percent in THF) were charged to a reactor, followed by N,N-dimethylacetamide (DMA, 293.3 kg). This mixture was then heated to 105–115 °C for approximately 9 hours. After the reaction was deemed complete as determined using in-process HPLC analysis (less than 2 percent starting al remaining), the reactor contents were cooled at 15-25 °C and water (315 kg) was added over a two hour period while maintaining the temperature n 20-30 °C. The reaction mixture was then agitated for an additional hour at 20-25 °C. The crude product was collected by filtration and washed with a mixture of 88kg water and 82.1 kg DMA, followed by 175 kg water. The t was dried on a filter drier for 53 hours. The LOD showed less than 1 percent w/w.
In an alternative procedure, 1.6 equivalents of sodium tert-pentoxide were used and the reaction temperature was increased from 0 °C. In addition , the cool down temperature was increased to 35-40 °C and the starting temperature of the water addition was adjusted to 35-40 °C, with an allowed exotherm to 45 °C.
Preparation of 1–(4–Fluoro–phenylcarbamoyl)–cyclopropanecarboxylic acid Triethylamine (19.5 kg) was added to a cooled ximately 5 °C) solution of cyclopropane–1,1–dicarboxylic acid (24.7 kg) in THF (89.6 kg) at a rate such that the batch temperature did not exceed 5 °C. The solution was stirred for approximately 1.3 hours, and then thionyl chloride (23.1 kg) was added, keeping the batch temperature below 10 °C. When the addition was complete, the solution was stirred for imately 4 hours keeping temperature below 10 °C. A on of 4–fluoroaniline (18.0 kg) in THF (33.1 kg) was then added at a rate such that the batch temperature did not exceed 10 °C. The mixture was stirred for approximately 10 hours after which the reaction was deemed complete. The reaction mixture was then diluted with isopropyl acetate (218.1 kg). This on was washed sequentially with aqueous sodium hydroxide (10.4 kg, 50 percent dissolved in 119 L of water) further diluted with water (415 L), then with water (100 L) and finally with aqueous sodium chloride (20.0 kg dissolved in 100 L of water). The organic solution was concentrated by vacuum distillation (100 L residual volume) below 40 °C followed by the addition of nheptane (171.4 kg), which resulted in the precipitation of solid. The solid was recovered by filtration and washed with n-heptane (102.4 kg), resulting in wet, crude 1-(4-fluorophenylcarbamoyl )-cyclopropanecarboxylic acid (29.0 kg). The crude, 1-(4-fluorophenylcarbamoyl )-cyclopropanecarboxylic acid was dissolved in ol (139.7 kg) at approximately 25 ºC followed by the addition of water (320 L) resulting in slurry which was recovered by filtration, washed sequentially with water (20 L) and n-heptane (103.1 kg) and then dried on the filter at approximately 25 °C under nitrogen to afford the title compound (25.4 kg).
Preparation of luoro-phenylcarbamoyl)-cyclopropanecarbonyl chloride Oxalyl chloride (12.6 kg) was added to a on of luoro-phenylcarbamoyl)- ropanecarboxylic acid (22.8 kg) in a mixture of THF (96.1 kg) and N, N- dimethylformamide (DMF; 0.23 kg) at a rate such that the batch temperature did not exceed °C. This solution was used in the next step without further processing.
Alternative Preparation of 1-(4-Fluoro-phenylcarbamoyl)-cyclopropanecarbonyl chloride A r was charged with luoro-phenylcarbamoyl)- cyclopropanecarboxylic acid (35 kg), 344 g DMF, and 175kg THF. The reaction mixture was adjusted to 12-17 °C and then to the reaction mixture was charged 19.9 kg of oxalyl de over a period of 1 hour. The reaction e was left stirring at 12-17 °C for 3 to 8 hours. This solution was used in the next step without further processing.
Preparation of cyclopropane-1,1-dicarboxylic acid 7-dimethoxy-quinoline yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide The solution from the previous step containing 1-(4-fluoro-phenylcarbamoyl)- cyclopropanecarbonyl chloride was added to a mixture of compound 4-(6,7-dimethoxyquinolineyloxy )-phenylamine (23.5 kg) and potassium carbonate (31.9 kg) in THF (245.7 kg) and water (116 L) at a rate such that the batch temperature did not exceed 30 °C. When the reaction was complete (in approximately 20 minutes), water (653 L) was added. The mixture was stirred at 20-25 °C for approximately 10 hours, which resulted in the precipitation of the product. The product was recovered by filtration, washed with a pre-made solution of THF (68.6 kg) and water (256 L), and dried first on a filter under nitrogen at imately 25 °C and then at approximately 45 °C under vacuum to afford the title compound (41.0 kg, 38.1 kg, calculated based on LOD). ative Preparation of cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxyquinolineyloxy )-phenyl]-amide (4-fluoro-phenyl)-amide A reactor was d with 4-(6,7-dimethoxy-quinolineyloxy)-phenylamine (35.7 kg, 1 equivalent), followed by 412.9 kg THF. To the reaction mixture was charged a solution of 48.3 K2CO3 in 169 kg water. The acid de solution of described in the ative Preparation of 1-(4-Fluoro-phenylcarbamoyl)-cyclopropanecarbonyl chloride above was transferred to the reactor containing 4-(6,7-dimethoxy-quinolineyloxy)- phenylamine while maintaining the temperature between 20-30 °C over a minimum of two hours. The reaction mixture was stirred at 20-25 °C for a minimum of three hours. The reaction temperature was then adjusted to 30-25 °C and the mixture was agitated. The agitation was stopped and the phases of the mixture were allowed to separate. The lower aqueous phase was removed and discarded. To the remaining upper organic phase was added 804 kg water. The reaction was left stirring at 15-25 °C for a minimum of 16 hours.
The product precipitated. The t was filtered and washed with a mixture of 179 kg water and 157.9 kg THF in two portions. The crude product was dried under a vacuum for at least two hours. The dried product was then taken up in 285.1 kg THF. The resulting suspension was transferred to reaction vessel and agitated until the suspension became a clear (dissolved) solution, which required heating to 30-35 °C for approximately 30 minutes. 456 kg water was then added to the solution, as well as 20 kg SDAG-1 ethanol (ethanol denatured with methanol over two hours. The mixture was ed at 15-25 °C fir at least 16 hours. The product was filtered and washed with a mixture of 143 kg water and 126.7 THF in two portions. The product was dried at a maximum temperature set point of 40 In an alternative procedure, the on temperature during acid chloride formation was adjusted to 10-15 °C. The recrystallization temperature was d from 15- °C to 45-50 °C for 1 hour and then cooled to 15-25 °C over 2 hours.
Preparation of cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinoline -phenyl]-amide (4-fluoro-phenyl)-amide, malate salt Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolineyloxy)– phenyl]–amide (4-fluoro-phenyl)-amide (1-5; 13.3 kg), L-malic acid (4.96 kg), methyl ethyl ketone (MEK; 188.6 kg) and water (37.3 kg) were charged to a reactor and the mixture was heated to reflux (approximately 74 °C) for approximately 2 hours. The r temperature was d to 50 to 55 °C and the reactor contents were filtered. These sequential steps described above were repeated two more times starting with similar amounts of starting material (13.3 kg), L-Malic acid (4.96 kg), MEK (198.6 kg) and water (37.2 kg). The combined filtrate was azeotropically dried at atmospheric pressure using MEK (1133.2 kg) (approximate residual volume 711 L; KF < 0.5 % w/w) at approximately 74 °C. The temperature of the reactor contents was reduced to 20 to 25 °C and held for approximately 4 hours resulting in solid precipitate which was filtered, washed with MEK (448 kg) and dried under vacuum at 50 °C to afford the title compound (45.5 kg).
Alternative Preparation of cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxyquinolineyloxy )-phenyl]-amide (4-fluoro-phenyl)-amide, (L) malate salt Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolineyloxy)- phenyl]-amide (4-fluoro-phenyl)-amide (47.9 kg), L-malic acid (17.2), 658.2 kg methyl ethyl ketone, and 129.1 kg water (37.3 kg) were charged to a reactor and the mixture was heated 50-55 °C for approximately 1-3 hours, and then at 55-60 °C for an on al 4-5 hours. The e was clarified by filtration through a 1 μm cartridge. The reactor temperature was adjusted to 20-25 oC and vacuum led with a vacuum at 150-200 mm Hg with a maximum jacket ature of 55 °C to the volume range of 558-731 L.
The vacuum lation was med two more times with the charge of 380 kg and 380.2 kg methyl ethyl ketone, respectively. After the third lation, the volume of the batch was adjusted to 18 v/w of cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxyquinolineyloxy )-phenyl]-amide (4-fluoro-phenyl)-amide by charging 159.9 kg methyl ethyl ketone to give a total volume of 880L. An addition al vacuum distillation was carried out by adjusting 245.7 methyl ethyl ketone. The reaction e was left with moderate agitation at 20-25 °C for at least 24 hours. The product was filtered and washed with 415.1 kg methyl ethyl ketone in three portions. The product was dried under a vacuum with the jacket temperature set point at 45 °C.
In an alternative procedure, the order of addition was changed so that a solution of 17.7 kg L-malic acid dissolved in 129.9 kg water was added to cyclopropane-1,1- dicarboxylic acid [4-(6,7-dimethoxy-quinolineyloxy)-phenyl]-amide (4-fluoro-phenyl)- amide (48.7 kg) in methyl ethyl ketone (673.3 kg).
Biological Example Growth of HCC-78 and NCI-H2228 cells Both HCC-78 and NCI-H2228 cells were received from DSMZ and ATCC tively as a frozen ical sample thawed into a T-75 flask (Nunc) and grown until 80 to 90% confluent for adherent cells or until cells were at a density of 1 - 2 x 106 cells/mL for suspension cells.
NCI-H2228, a human lung NSCLC adenocarcinoma cell line (ATCC, CRL 5935) harboring the activating EML4-ALK fusions, were seeded at a density of 3.5 x 104 cells/well and 2.5 x 104 well for 48 hours or 72 hours respectively, in 0.1 ml in RPMI 1640 (ATCC 30-2001), 10 % FBS, 1 % penicillin-streptomycin onto black 96-well plates (Costar, 3904).
HCC-78, a human lung NSCLC adenocarcinoma cell line (DSMZ, ACC 563) harboring the activating SLC34A2-ROS1 fusions and or-Met, were seeded at a density of 2.5 x 104 cells/well and 2 x 104 cells/well for 48 hours or 72 hours respectively, in 0.1 ml in RPMI 1640 (ATCC 30-2001), 10 % FBS (heat-inactivated, Cellgro), 1 % penicillinstreptomycin onto black 96-well plates (Costar, 3904).
Cells were grown at 37°C in a humidified, 5% CO2 atmosphere for 16 hours.
DMSO or serial dilutions of nd 1 in fresh serum free medium or serum containing medium were added to the cells and incubated for 48 hours or 72 hours at 37°C in a humidified, 5% CO2 atmosphere prior to the addition of 5’-bromo-2’-deoxy ne (BrdU) labelling solution (Roche) for 2 to 4 hours. Suspension cells were transferred to filter plates (Corning, 3504) before performing the assay. Cells were assayed for eration by monitoring BrdU incorporation. Reagents from the Cell Proliferation ELISA, BrdU (chemiluminescence) kit (Roche ences, 11 669 915 001) were used ing to the manufacturer’s instructions. After BrdU labelling, cells were fixed with FixDenat solution. rdU peroxidase (POD) conjugate was added and plates were washed with 1x PBS.
Substrate solution was added, and luminescence measurements were taken on a Victor Wallac V plate reader (Perkin Elmer). The tage inhibition of proliferation was ated by ing cell eration with compound 1 treatment to DMSO treated samples. tage inhibition values at 5 to 8 compound 1 concentrations were used to ate IC50 values.
Biological Example Inhibition of ROS1 phosphorylation HCC-78 cells, a human lung NSCLC adenocarcinoma cell line (DSMZ, ACC 563) harboring the activating SLC34A2-ROS1 fusion and phosphor-Met, were seeded at 3 x105 well onto 6-well plates (Nunclon, 152795), RPMI 1640 (ATCC, 30-2001) containing 10% FBS (heat-inactivated, Cellgro) and 1% penicillin-streptomycin (Cellgro).
DMSO or serial dilutions of compound 1 in fresh medium with 10% FBS in a final concentration of 0.3% DMSO (vehicle) were added to the cells and incubated for 3 hour.
After treatment, cells were collected and washed with cold PBS and immediately lysed with 0.15 mL of cold lysis buffer (50 mM Tris HCl, pH 8.0, 150 mM NaCl, 1% NP 40, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM EDTA, 50 mM NaF, 1 mM sodium pyrophosphate, 1 mM Na3VO4, 2 mM PMSF, 10 μg/mL aprotinin, 5 μg/mL leupeptin and 5 µg/mL pepstatin A).
Lysates were collected, and protein concentrations were measured by the BCA method (Pierce). Lysates were collected and protein concentrations were measured by the BCA method (Pierce). Lysates were mixed with NuPage LDS sample buffer (Invitrogen NP0007) and Reducing Agent (Invitrogen 4), then heated at 70°C for 10 min. 20 µg protein was loaded onto NuPage 10% Bis Tris gels (Invitrogen, NP0302). Proteins were transferred to nitrocellulose membranes (Invitrogen, LC2001), blocked for 1 hr. in Odyssey Blocking Buffer (Li-Cor,927 40000), and incubated at 4°C overnight with the anti-ROS1 mouse monoclonal antibody (1:1000) (Cell Signaling Technology, 3266) and Anti-phospho ROS1 (Y2274) rabbit antibody (1:1000) (Cell Signaling Technology, 3077) diluted in Odyssey Blocking Buffer containing 0.1% Tween 20. Membranes were washed four times for 10 min each with TBS T buffer (50 mM Tris HCl, pH7.2; 150 mM NaCl; 0.1% Tween 20) and blotted with Goat anti Mouse IRDye680 (Li-Cor, 926 32220) and Goat anti Rabbit IRDye800 (Li-Cor, 926 32211) secondary antibodies in y Blocking buffer containing 0.1% Tween 20 and 0.01% SDS for 60 min at room temperature. Membranes were washed four times for 10 min each with TBS-T buffer and rinsed with PBS twice. The membranes were scanned using the Odyssey Scanner (Li-Cor) and the signal intensity of each band was quantified using ImageQuant (Molecular s). IC50 values were calculated based on the signal with compound treatment compared to the vehicle (DMSO) control.
Inhibition of SLC34A2-ROS1mediated kinase activity in HCC-78 NSCLC cells administered with single escalating doses of compound 1, or 3-[(1R)(2,6-dichloro fluorophenyl)ethoxy](1-piperidinylpyrazolyl)pyridinamine (Crizotinib; XALKORI®) is shown in Fig. 1. Fig. 1 clearly illustrates the potent inhibitory activity of nd 1 against ROS1 fusion kinase, and is more potent than the comparator control, 3- [(1R)(2,6-dichlorofluorophenyl)ethoxy](1-piperidinylpyrazolyl)pyridin amine (Crizotinib) at the concentrations tested in vitro.
Biological Example ROS1-Dependent Proliferation of HCC-78 NSCLC Cells IC50 values were ated for compound 1 and comparator l, 3-[(1R) (2,6-dichlorofluorophenyl)ethoxy](1-piperidinylpyrazolyl)pyridinamine (Crizotinib) after incubation of active agents with HCC-78 NSCLC cells for 48 or 72 hours at various concentrations. tation of proliferation of HCC-78 NSCLC cells was performed using BrdU ELISA (chemiluminescence, Roche Biosciences, Cat. No. 11 669 915 001) in ance with manufacturer’s recommendations. Determination of IC50 values (A-E) ntration at 50% inhibition) were determined as provided above, and computationally determined using GraphPad Prism software.
Table 3. ROS1-Dependent Proliferation of HCC-78 NSCLC Cells in the presence of compound 1 of the t invention and 3-[(1R)(2,6-dichlorofluorophenyl)ethoxy]- -(1-piperidinylpyrazolyl)pyridinamine (Crizotinib).
NCI-H2228 HCC-78 Tissue Type Lung ogy NSCLC Adenocarcinoma Genotype Information EML4-ALK fusion SLS34A2-ROS1 fusion TP53 Q331* CDKN2A M1 *157 del, ?fs: RB1 E204fs*10 Compound Name 48 hr Prolif. 72 hr Prolif. 48 hr Prolif. 72 hr Prolif.
IC50 (nM) IC50 (nM) IC50 (nM) IC50 (nM) Compound 1 D E A A 3-[(1R)(2,6-dichloro C C B A fluorophenyl)ethoxy](1- piperidinylpyrazol yl)pyridinamine (Crizotinib) IC50 data ed: E- 5,000 – 10,000 nM; D- 1,000-5,000 nM; C- 500-1000 nM; B- 100-500 nM; A- 10-100 nM.
Other Embodiments The foregoing disclosure has been described in some detail by way of illustration and example, for purposes of clarity and tanding. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations and modifications can be made while remaining within the spirit and scope of the invention. It will be obvious to one of skill in the art that changes and modifications can be practiced within the scope of the appended .
Therefore, it is to be understood that the above description is intended to be illustrative and not restrictive.
The scope of the invention , therefore, be determined not with reference to the above description, but should instead be determined with reference to the following ed , along with the full scope of equivalents to which such claims are entitled.

Claims (23)

Claims
1. Use of a compound of Formula I: Formula I or a ceutically acceptable salt thereof, wherein: R1 is halo; R2 is halo; R3 is (C1-C6)alkyl; R4 is (C1-C6)alkyl; and Q is CH or N, in the manufacture of a medicament for the treatment of lung adenocarcinoma, wherein the lung adenocarcinoma is SLC34A2-ROS1, CD74-ROS1, or FIG-ROS1 fusionpositive all cell lung .
2. The use of claim 1, wherein the compound of Formula I is a compound of Formula Ia Formula Ia, or a pharmaceutically acceptable salt thereof, wherein: R1 is halo; R2 is halo; and Q is CH or N.
3. The use of claim 1 or 2, wherein the compound of Formula I is nd 1: H H N N O O CH3 O F H3C O N compound 1 or a pharmaceutically acceptable salt thereof.
4. The use of any one of claims 1-3, n the pharmaceutically acceptable salt of the compound of Formula I, Formula Ia and compound 1 is the (L)- or (D)-malate salt.
5. The use of claim 3, wherein the pharmaceutically acceptable salt of the nd 1 is the (L)-malate salt.
6. The use of claim 3, wherein the pharmaceutically acceptable salt of the compound 1 is the (L) malate salt and/or the (D) malate salt, which is in the lline N-1 form or N-2 form.
7. The use of any one of claims 1-6 wherein the medicament comprises a pharmaceutically acceptable carrier, excipient, or diluent.
8. The use of any one of claims 1-7, wherein the medicament is formulated for administration subsequent to another form of treatment.
9. The use of any one of claims 1-7, wherein the medicament is formulated for administration post-cisplatin and/or gemcitabine treatment.
10. The use of any one of claims 1-7, wherein the medicament is formulated for administration post-carboplatin treatment.
11. The use of any one of claims 1-7, wherein the medicament is formulated for administration arboplatin and/or gemcitabine treatment.
12. The use of any one of claims 1-7, wherein the medicament is formulated for administration post-cisplatin and/or carboplatin treatment.
13. The use of any one of claims 1-7, wherein the medicament is formulated for administration post-docetaxel treatment.
14. The use of any one of claims 1-7, wherein the medicament is formulated for administration post-crizotinib treatment.
15. The use of any one of claims 1-7, wherein the medicament is formulated for stration post-crizotinib and/or abine treatment.
16. The use of any one of claims 1-7, wherein the medicament is formulated for administration rizotinib and/or gemcitabine and/or docetaxel treatment.
17. The use of any one of claims 1-7, wherein the medicament is formulated for administration post-cisplatin and/or gemcitabine and/or docetaxel treatment.
18. Use of compound 1 H H N N O O CH3 O F H3C O N compound 1 or a ceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of ROS1 fusion-positive nonsmall cell lung .
19. The use of claim 18, wherein the medicament comprises at least one pharmaceutically acceptable carrier.
20. The use of claim 18 or 19, wherein the pharmaceutically acceptable salt of compound 1 is the (L)- or (D)-malate salt.
21. The use of any one of claims 18-20, wherein the ceutically acceptable salt of compound 1 is the (L)-malate salt.
22. The use of claim 20, wherein the pharmaceutically acceptable salt of compound 1 is the (L) malate salt and/or the (D) malate salt, which is in the crystalline N-1 form or N-2 form.
23. Use of any one of claims 1-22 substantially as herein described with reference to any e thereof and with or without reference to the accompanying drawings. W0
NZ725576A 2014-04-25 2015-04-27 Method of treating lung adenocarcinoma NZ725576B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201461984599P 2014-04-25 2014-04-25
US61/984,599 2014-04-25
PCT/US2015/027800 WO2015164869A1 (en) 2014-04-25 2015-04-27 Method of treating lung adenocarcinoma

Publications (2)

Publication Number Publication Date
NZ725576A NZ725576A (en) 2021-03-26
NZ725576B2 true NZ725576B2 (en) 2021-06-29

Family

ID=

Similar Documents

Publication Publication Date Title
AU2015249232B2 (en) Method of treating lung adenocarcinoma
EP2892532B1 (en) Inhibitors of met, vegfr and ret for use in the treatment of lung adenocarcinoma
US20150057335A1 (en) Novel fusion genes identified in lung cancer
EP3030577B1 (en) Novel nrg1 fusion genes in cancer
US20160058777A1 (en) Identification and treatment of cancer subsets
NZ725576B2 (en) Method of treating lung adenocarcinoma
JP5119546B2 (en) Diagnosis of malignant transformation of gastrointestinal stromal tumor originating in the stomach
WO2022192232A1 (en) Ep300 degrader and uses thereof in neuroblastoma