NZ722893B2 - Antibody for skewing sex ratio and methods of use thereof - Google Patents

Abstract

purified antibody, or an antigen-binding fragment thereof, is provided that binds selectively to a protein specific to an X-chromosome of a mammalian sperm cell. The sperm cell protein comprises an amino acid sequence set forth in SEQ ID NOs: 4 and 9-16. The antibody or antigen-binding fragment thereof may be derived by immunization of a host by an antigenic peptide composition comprising one or more natural or synthetic antigenic peptide sequences set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NOs: 4 and 9-16. The antibody finds utility in identifying an X-chromosome bearing sperm cell population, and in methods for skewing a sex ratio in mammals.

Description

A purified antibody, or an antigen-binding fragment thereof, is provided that binds selectively to a protein specific to an X-chromosome of a mammalian sperm cell. The sperm cell protein comprises an amino acid sequence set forth in SEQ ID NOs: 4 and 9-16. The antibody or antigenbinding fragment f may be derived by immunization of a host by an nic peptide composition comprising one or more natural or synthetic antigenic peptide ces set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NOs: 4 and 9-16. The antibody finds utility in identifying an X-chromosome bearing sperm cell population, and in methods for skewing a sex ratio in mammals.

NZ 722893 ANTIBODY FOR SKEWING SEX RATIO AND METHODS OF USE F This utility patent appiication claims the bene?t of priority in US. Provisional Patent Application Serial Nos. 61/942,020 for Antibody for Skewing Sex Ratio and Methods of Use Thereof filed on February 19, 2014, and 62/065,797 for Antibody for Skewing Sex Ratio and Methods of Use f ?led on October 20, 2014, the entirety of the disclosures of each of which is incorporated herein by nce.

TECHNICAL FIELD The present sure relates to skewing sex ratios in mammals to select for a preferred gender of offspring. In particular, the disclosure relates to methods for selecting and/or altering a particular population of ian sperm for subsequently skewing mammalian sex ratio. The methods include providing antibodies speci?c for a sperm cell marker indicative of the presence of an X-chromosome, for use in such skewing and selecting.

OUND OF THE INVENTION The XY sex-determination system is the sex-determination system found in most mammals. In this system, the sex of a mammal is determined by a pair of sex somes (gonosomes) which code for the sex of the mammal. Females, being the homogametic sex, exhibit two X chromosomes. Maies, being the heterogametic sex, exhibit an X and a Y chromosome. In animal husbandry it is often desirable to skew sex ratios towards either male or female offspring depending on the producer’s goal. For example, in dairy cattle dry it is the female of the species that produces the income source for the farmer, i.e. milk. A dairy farmer utilizing artificial insemination to obtain replacement animals for the dairy herd may prefer to e sperm that will be biased towards production of female offspring, to ensure a reliable source of replacement heifers and so a continued income stream. Of course, similar commercial reasons exist for biasing a herd towards production of males. For example, in a beef cattle operation it is the male that provides the primary income stream (meat). Thus, improved methods of in?uencing sex ratio by in?uencing sperm sex ratio are ble.

There are a number of potential non-invasive ways to in?uence sex ratio. The potential for non-invasive sex ratio lation is far less obvious in species in which sex chromosomes mainly determine the gender of an offspring, like in all birds and mammals.

Preselecting the gender of offspring in both humans and animals has been of keen interest since the ing of recorded history. Flow cytometric analysis of sperm DNA has been shown to in a sample of semen. At very useful for evaluating the proportions of X- and Y-bearing sperm point, ?ow cytometric sorting of 'X- and Y-bearing sperm was shown to be the one only tory method that skews the sex ratio of semen (Johnson, 1992).

One of the ?rst serious i?c studies to be conducted to control prenatal sex was reported by J. L. Lush (1925). The basis for Dr. Lush’s research was the possible differential density of X- and Y- bearing sperm in the rabbit. The progeny from the inseminations made with failed to Show altered sex ratios. Since sperm separated by centrifugation then, innumerable reports have appeared describing a wide variety of methods to separate X— and Y-bearing sperm.

The majority of these methods can be grouped under the broad heading "physical tion" methods. They are based on actual or perceived differences in the , density, size, motility, or e charge of sperm. (Johnson, 1992).

Other research on the ?ow cytometry of sperm for the purpose of predetennining gender of offspring has led to a-validated method to separate X from Y some~bearing sperm for use with in vitro fertilization and embryo transfer, intratubal insemination or intracytoplasmic the viable sperm injection (Johnson, 1995). Presently, only commercially method of sexing mammalian sperm is to use a ?ow cytometer to measure sperm DNA content via fluorescence ofthe DNA-bound ?uorophore Hoechst 33342, followed by sorting sperm into ‘ three populations: 1) probably X, 2) probably Y, and 3) rmined. Millions of insemination doses of sexed sperm are produced annually by this ure. Although accuracy of sexing usually exceeds 90%, this procedure of sexing one sperm at a time has serious limitations, including cost, sort rates, and physical damage to sperm ing in lowered fertility, but not abnormalities in offspring.

Suggested areas for research e determining how sperm are damaged and where in the process of fertilization and embryonic development the infertility is manifest. Pre and post sorting procedures are done in approximately hourly batches, and these might be changed to uous procedures. Numerous genetic, physical, and immunological procedures for sexing millions of sperm in parallel have been proposed, but none appears to be le for commercialization at this time due to issues of cy, repeatability, damage to sperm, and other problems. However, increasing numbers of reports are appearing concerning ements in these procedures, and it appears inevitable that one or more of them eventually will prove to be ef?cacious. In developing such procedures, it is critical to monitor sexing accuracy regularly, ably by use of rapid and inexpensive procedures which can be implemented in the commercial laboratory setting.

Recent evidence has shown that sex ratios in mammals can be manipulated by ional, genetic, physiological, and immunological s. While there are several known methods for sexing sperm, each suffers from low accuracy, damage to sperm causing infertility, poor repeatability, lack of suitable scale—up procedures, or other problems. Moreover, fertility in cattle and possibly other species is mised on the order of 10 percentage points by an unknown mechanism that appears noncompensable by increasing the number of sperm per inseminate. (Seidel, 2012). Thus, a need in the art for improved methods for sexing mammalian sperm is identified.

SUMMARY In accordance with the foregoing need identi?ed in the art, s are provided for fying mammalian X-chromosome bearing sperm cells, and for separating such sperm cells from mixed populations of sperm cells including Y—chromosome bearing sperm cells to provide an enriched mosome bearing and/or an enriched Y—chromosome bearing sperm cell population. The methods are advantageously effective, repeatable, robust, and suitable for scaling up for adaptation to commercial enterprises.

In one aspect of the disclosure, an antibody, or an antigenic nt f, is described which binds selectively to a mammalian sperm cell protein speci?c to an X- - chromosome bearing sperm cell. The antibody or antigen-binding fragment thereof may be a monoclonal or a polyclonal antibody or an antigen-binding fragment thereof. In an embodiment, the mammalian sperm cell protein comprises the ce set forth in SEQ ID NO:4. The protein may be encoded by a gene mapping to the mammalian X—chromosome and sing the nucleotide ce of SEQ ID NO:5 or a sequence complementary o, or a nucleotide sequence having at least 85% homology to SEQ ID NO: 5 or a sequence complementary thereto.

The mammalian sperm cell protein (subsequently referred to herein as GXl) may comprise the sequence set forth in NCBl Accession No. XPg0012495441 The dy or antigen-binding fragment thereof may be derived by immunization of a host by an antigenic peptide composition comprising a natural or a synthetic antigenic amino acid sequence set forth as SEQ ID NO: 4 or an antigenic sequence having at least 85% homology thereto. In embodiments, the antibody or" antigen-binding fragment thereof is derived by zation of the host by an antigenic peptide composition comprising peptides selected from the group consisting of one or more of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

In r aspect, the present sure describes methods for fying X- chromosome bearing sperm cells in a mixed population of sperm cells. In embodiments, the method ses adding an antibody or antigen~binding fragment thereof as described above to neat or diluted semen. Then, the labeled dy or antigen—binding fragment thereof is directly or indirectly detected.

In yet another aspect, the present disclosure provides methods for skewing a sex ratio in s towards a inantly male offspring population or a predominantly female offspring population. In embodiments, the methods comprise adding an antibody or antigen— binding fragment thereof as described above to a neat or diluted sample of mammalian semen, under conditions Iwhereby the antibody binds to the X—chromosome bearing sperm cells. Next, oocytes are fertilized in vivo or in vitro using the semen or sperm cells isolated therefrom, at least a portion of which include bound antibody or antigen~binding fragments thereof, to skew the of the resulting offspring population.

In alternative embodiments, the s further comprise separating unbound sperm cells from antibody or antigen~binding fragment-bound sperm cells to provide a Sperm cell population enriched for X-chromosome bearing sperm cells and a sperm cell population enriched for Y-chromosome bearing sperm cells. Any suitable method for sorting is contemplated, including without limitation ?uorescent-activated cell sorting, magnetic cell sorting, and the like.

Next, s are fertilized in vivo or in vitro using the population enriched for X-chromosome bearing sperm celis or the sperm cell population ed for Y-chromosome bearing sperm cells, to skew the sex of the resulting offspring population.

The present disclosure thus responds to a need in the art by providing effective methods for identi?cation of mosome bearing sperm cells, for separation of X- chromosome and Y-chrornosome g sperm cells, and for skewing a sex ratio of offspring resulting from fertilization with sperm cells treated as described above. Advantageously, the methods are substantially non-invasive, are ucible, and provide a viable X-chromosome skewed sperm cell population suitable for subsequent commercial arti?cial nation procedures.

BRIEF PTION OF THE DRAWINGS The accompanying g ?gures incorporated herein and forming a part of the speci?cation, illustrate several aspects of the disclosure, and together with the description serve to explain certain principles thereof. In the drawings: Figure 1A shows tative PCR analysis of GX] cDNA from a mixed- chrornosome containing sperm cell population, a pure Y-chromosome ning sperm cell population, and a pure X-chromosome containing sperm cell population; Figure 18 shows capillary gel analysis of the cDNA of Figure 1A; Figure 2A shows presence of dies according to the present disclosure to a peptide having SEQ ID NO: 1 in the rabbit serum obtained 8 weeks post-immunization compared to the pre~immune rabbit serum; Figure 2B shows presence of antibodies according to the present disclosure to a peptide having SEQ ID NO: 2 in the rabbit serum obtained 8 weeks post~immunization compared to the pre~immune rabbit serum; Figure 2C shows presence of antibodies according to the t disclosure to a peptide having SEQ ID NO: 3 in the rabbit serum obtained 8 weeks post-immunization compared to the pre-immune rabbit serum; Figure 3A shows a western blot analysis indicating speci?city of an antibody to GX~1 protein according to the present disclosure in mune rabbit serum; Figure 3B shows a n blot analysis indicating speci?city of an dy to GX-l protein according to the t disclosure in rabbit serum obtained 8 weeks post-immunization; Figure 3C is a western blot demonstrating that pre-absorbing the antibody of Figure 3B with peptides having SEQ ID NO: 1, SEQ 1D NO:2, and SEQ ID NO:3 eliminated ion of GX-l protein; Figure 4A depicts ?uorescent photomicroscopy (Scate bar = 25 microns) of sperm cells determined to be negative for association with the antibody to GX-l of Figure 3B; Figure 4B s ?uorescent photomicroscopy (Scale bar 2 25 microns) of sperm cells ined to be positive for association with the antibody to GX-l of Figure 3B; Figure 5 graphically illustrates a sex ratio of bovine sperm cells that is skewed s chhromosome bearing sperm cells following incubation with the antibody to GX-l of Figure 3B and selection of intact sperm positive for association with the antibody of Figure 4B; Figure 6 depicts an evaluation of purity of E. coli expressed GXl full length protein via SDS—12% polyacrylamide gel counterstained to visualize protein banding pattern; Figure 7 shows a computer matching analysis of peptides derived from digestion of E. xpressed GXl protein and SEQ ID NO. 4; Figure 8 graphically depicts the presence of antibodies in week 8 antiserum Compared to pre—immune serum from rabbit immunized with full length GXI protein expressed and puri?ed from E. coli cells, (GXl-E protein); [003 0] Figure 9 illustrates speci?city of anti-GXl-E protein dy for a single protein in bull sperm lysate by western blot analyses of pre-irnmune serum (Blot A) and puri?ed anti-GXia E n antibody (Blot B) on bull sperm ; Figure 10 shows evaluation of GXl ?ill length protein expressed using in vitro translation (GXi-M; the arrow indicates the location of the GXl-M protein); and Figure 11 shows a computer matching analysis of peptides d from digestion of in vitro translation expressed GXl protein (GXl-M) and SEQ ID NO. 4. nce will now be made in detail to embodiments of the disclosed subject matter, examples of which are illustrated in the accompanying drawing ?gures.

DETAILED DESCRIPTION Any citations, gene sequences, accession numbers, and reference sequences included or referred to in this application form a part of the disclosure and are incorporated herein in their entirety by reference. It will be iated that the embodiments shown and described in this patent application are an illustration of one of the modes best suited to carry out the invention.

The invention is capable of other different embodiments, and its several details are capable of modi?cation in s, obvious aspects all without departing from the invention. Accordingly, the drawings and ptions provided herein will be regarded as illustrative in nature and not as restrictive. Various embodiments of the methods and compositions of the present sure will now be described by way of the following es.

Example 1. Identification ofa Novel Biomarker for X-bearing sperm Laser capture microdissection (LCM) was used to isolate Y~bearing sperm from nonsorted bull semen in order to identify sperm bioinarkers. in brief, Percoll® prepared frozen- thawed semen from multiple Bos taurus and 305 indicus breeds was immobilized, decondensed and adhered to glass microscope slides. Sperm slides underwent in situ hybridization using the Star*FISH© paint system for the bovine Y-chromosome (Cambio Ltd; Cambridge, UK) according to the manufacturer’s instructions. Fluorescence label (Cy3) on chromosome probe enabled visual classi?cation of sex chromosome t of sperm. Using a LCM equipped cope, single sperm cells with the desired some content were lifted off the slide and "captured" onto a membrane. Total RNA isolated from each population of ed sperm cells (pure Y-chromosome containing and chromosome containing) was then compared by microarray es to identify a novel biomarker c to X-chromosome bearing sperm.

After comparing the binding of-6 sets of total RNA samples (six Y-chromosome content samples versus six mixed-chromosome content samples) to GeneChip® Bovine Genome arrays (Affymetrix; Santa Clara, CA), it was determined that expression of an uncharacterized protein LOC781191 (SEQ ID NO: 5) was only found in RNA derived from captured sperm of mixed chromosome content and not in RNA derived from captured sperm of pure Y- chromosome content. Additionally, gene mapping by the National Center for Biotechnology Information (NCBI) located DNA for GXl to the bovine X chromosome (NCBI, US. National Library of ne, 8600 Rockville Pike, Bethesda, MD 20894; Gene ID 781191).

To validate microarray ?ndings (i.e., whether the expression of the GXl biomarker was speci?c to X—chromosome bearing sperm) additional sperm cells were captured from freshly prepared islides probed with the Star*FISH© paint system for either the bovine Y-chromosome or the X-chromosome (Cambio) and total RNA was isolated from the three populations of captured sperm cells: (1) Mixed~chromosome containing, (2) pure Y-chromosome containing and (3) pure mosome containing. Total RNA was converted to CDNA and then ted to quantitative polymerase chain reaction (qPCR) using primers speci?c to GXl (Table l).

After normalization with exogenous control, quantitative polymerase chain reaction results (Figure 1A) indicate that detected expression of (DU was equal between mixed chromosome containing and pure X some ning samples, whereas detected expression of GXl was equal between pure Y chromosome containing sample and no cDNA template control (NTC). Thus, based on qPCR analyses expression of GXI was found only in cDNA derived from sperm population with X-chromosomes (i.e., pure X-chromosome containing or mixed-chromosome containing) and not in cDNA derived from pure Y- chromosome bearing sperm (see Figure 1A). Note where sample crosses threshold (dotted line; Figure 1A) determines threshold cycle for sample and for comparisons the lower cycle number equals greater expression level. Capillary gel es was utilized to con?rm PCR results (Figure 1B), with ampli?ed DNA for GXl only detected in the mixed chromosome containing and pure X chromosome containing samples.

Table 1. Sequence of primers used for tative polymerase chain reactions.

Gene Primer Anneal ID Locatio Temp.

Primer Sets n (bp) 781 191 4—27 5’- GAGGGTGTGTCTCCCTGG 56°C 200 (SEQ ID NO: 6) 110- 32 TCCTAACTACTCTGGAGCCTTGG (SEQ 132 ID NO: 7) Example 2. Production ofAnti‘GX] Peptide Antibody Next, poiyclonal antiserum was generated in s against multiple e antigens for GXl protein by nthesis Inc (Lewisville, TX). Speci?cally, the amino acid sequence for GXl protein was derived from the DNA sequence for GXI (SEQ ID NO:4) and analyzed for antigenic sites. Three immunograde peptides d from 3 different antigenic sites within GXI n (Table 2) were synthesized utilizing-FMOC chemistry under continuous ?ow conditions using PEG~polystyrene resins. At the completion of synthesis, peptides were cleaved from the resin, de~protected, and then precipitated using cold diethyl ether. The precipitate was then washed three times with cold diethyl ether and dissolved prior to lyophilization.

Purity and mass of peptides were evaluated by analytical—scale reverse-phase high performance liquid chromatography (HPLC) chromatogram and matrix—assisted laser desorption ionization I), respectively. For analytical and preparative HPLC, analyses and puri?cations were performed using a Beckman System Gold Liquid Chromatography system, equipped with a binary pump delivery system, autosampler, column thermostat, and mono- (UV), or wavelength detector (DAD). Chromatography methods used were using standard conditions using 5 pm, 150 X 4.6 mm or 2.1 mm columns (Phenomenx or Agilent), at 20°C, with detection at 7» K 210, 220 or 280 nm, Mobile phase A was 0.1 % TFA in ultrapure water, while mobile phase B was neat acetonitrile. The tion was ed at a ?ow rate of 1.0 or 0.2 mL/min using a linear gradient program.

MALDI-TOF mass spectrometry was med using a Voyager-DE STR ctrometry workstation with delayed extraction and linear capability, equipped with a 337- nm nitrogen laser and a 2-m ?ight tube. Mass spectra were obtained in the positive ion mode using an accelerating voltage of 25 kV. Approximately one microliter of the peptide or protein sample was mixed with 1 ul of matrix (10mg of sinapinic acid and 0.1% 4-hydroxy—dv cyanocinnarnic acid in lml of distilled water) and 0.3 ul of this mixture was applied to the sample plate.

Once quality was d, each synthesized peptide was individually conjugated to keyhole limpet hemocyanin (KLH) carrier protein and combined into a cocktail mixture. The peptide cocktail was emulsi?ed in Freund’s Complete Adjuvant and injected into a New Zealand white rabbit every two weeks for a total of ?ve co-immunizations to induce GXl antiserum production. Serum was collected prior to primary zation (pm-immune; week 0), fourth booster injection (week 8), two weeks after the fourth booster injection (week 10) and upon termination of project (week 14). Seras collected at weeks 0 and 8 were analyzed by enzyme» linked immunosorbent assay ) titer assay for each antigen peptide to ensure speci?city of antiserum.

For the ELISA titer assay, brie?y, microtiter plate wells were ?rst coated at room temperature with peptide solution in coating buffer (PBS) and were then blocked with 1% BSA in PBS for 1h at 37°C. Samples, antibodies in serum or d, were loaded in duplicates and incubated for 2 h at room temperature. Secondary HEP—conjugated IgGs (120,000) in blocking buffer was added (1 h, room temperature) and the reaction was visualized by the addition of the chromogenic substrate (ABTS) for 30 min. The absorbence at 405 nm was ed using an ELISA plate reader. Plates were washed four times with washing buffer (PBS, pH 7.4, ning 0.1% (v/v) Tween 20) after each step. As a reference for quanti?cation, a standard curve was established by a serial dilution of control antibody. s from ELISA indicated that pre-immune serum lack dies reactive to the three peptide ns (i.e., values for'absorbance at 405 nm less than 0.1) for all dilutions tested.

Week 8 serum contained antibodies reactive to the three peptide antigens as indicated by binding of antibody(s) to wells coated with peptide antigens (i.e., values for absorbance at 405 nm greater than 0.1) for all dilutions tested (see Figure 2A, B, C).

Peptide conjugated resin columns were used to purify and trate dies speci?c for peptide antigens from GXl antiserum by immunoaf?nity chromatography, thus generating anti-GXI peptide antibody. Upon arrival in the laboratory, Speci?city of the dies for a single protein was determined by western blot analyses comparing reactivity of pre-immune serum, anti-GXI peptide antibody and preabsorbed anti-GXI e antibody on. bull sperm lysate.

In brief, sperm lysates were separated on SIDS-12% polyacrylamide gel and transferred to PVDF membrane. The results are presented in Figure 3. In the ?gure, M = protein standard, and S = sperm lysate. As shown, immunoblctting sperm lysates with preimmune serum did not detect any protein bands (Figure 3A) s probing with anti-GXI peptide antibody detected a single protein band (Figure 38, see arrow) in the bull sperm lysate. Preabsorbing anti- GXl peptide dy with peptide ns prior to probing the western blot eliminated detection of the protein band in sperm lysate (Figure 3C).

Table 2. Sequence of synthetic peptides used to immunize s to produce GXl antiserum.

Peptide No. Amino acid sequence (N~terminus to C~terminus) Epitope position 1 2-20 ' CTKRTGKPQSSRVVRKHLPP (SEQ 1D NO: 1) 2 2847 CKTSSQLRPPKNVKVARASAR (SEQ ID NO: 2) 3 83~l 02 CKVNEELNQNGPEEVPESVE (SEQ ID NO: 3) Example 3. Incubation ofAnti~GX1 Peptide Antibody with Bull Semen For the following studies, commercially available extended and cooled semen was used. In brief, ejaculate was collected from bulls (multiple Bos mums and Bo: indicus breeds were tested, speci?cally Angus, Cross, and Red s), mixed with BIOXcell er (IMV Technologies, Maple Grove MN) and equilibrated at 4-5°C for 3 h prior to shipping overnight on ice packs. Upon l at the laboratory, semen was washed with HEPES~PVA buffer (prewarmed to 25-30°C; 114 mM NaCl, 3.2 mM KCl, 0.3 mM NaH2P04, 10 mM Lactic Acid, 2 mM CaClg, 0.5 mM MgC12, 10 mM HEPES. 2 mM NaHC03, 0.2 mM Na Pyruvate, 0.1% PVA).

Sperm pellets were resuspended in HEPES~PVA ning 1:1000 dilution of Live/Dead® Fixable Far Red (Life Technologies, Grand Island, NY) dead cell stain and then incubated for 10 min at 35°C. Sperm were washed once with HEPES-PVA to remove excess stain and then resuspended to a ?nal concentration of 10 x106 cells/mL PVA.

One milliliter of sperm suspension was transferred to round bottom Protein LoBind tubes and then centrifuged at 4°C at x400g for 5 min, supernatant removed and sperm pellets gently vortexed (these conditions were used for all subsequent centrifugations). hout remaining steps, sperm and buffers were kept at 4°C. After centrifugation, sperm pellets were suspended in 1 mL blocking buffer [3% normal goat serum (NGS; Southern Biotech, Birmingham, AL) and 2 mM EDTA in co’s Phosphate Buffered Saline (DPBS; Gibc0® Life Technologies)]. Sperm were incubated for 30 min with gentle agitation then subjected to centrifugation. Resulting sperm pellets were suspended in 1 mL blocking buffer containing anti— GXl peptide dy (0 to 20 ug/rnL) and incubated for 1.5 h with gentle ion. Then wash buffer (1 mL; 0.5% NGS, 2 mM EDTA, DPBS) was added to each tube prior to centrifugation.

Sperm were subjected to a second wash before suspension in 0.5 mL wash buffer containing 1.5 ug abbit IgG-cyanine dye conjugate (Cy2; Jackson ImmunoResearch Laboratories, West Grove, PA).

Sperm were incubated for 20 min with gentle agitation prior to washing twice with wash buffer and ?xing with 1% paraformaldehyde (15 min; freshly prepared from 16% paraformaldehyde; Electron Microscopy Sciences, Hat?eld, PA). Fixed cells were centrifuged, washed, centrifuged and ?nally ded with 0.1% PVA in DPBS. Percent of membrane intact sperm positive for GXl protein surface staining (cells positive for Cy2 and negative for Live/Dead® Far Red) was determined using a BD Accuri C6 ?ow cytometer (BD Biosciences, San Jose, CA). Samples were stored at 4°C and protected from light until further analyses could be performed.

Example 4. Isolation ofBull Sperm Positivefor Anti-6X] e Antibody Association A FACSAria II Special Order System er 6 color 4B—2R; BD Biosciences) with 50 mW of 488 nm laser and 100 mW of 640 nm laser was ed to separate bovine sperm. The system was con?gured with 1.0 neutral day ?lter plus a 70 pm nozzle tip at a sheath pressure of 70 psi using BioSure® preservative-free sheath ?uid (BioSure; Grass , CA). Detectors ed forward scatter area, height, width (FSC-A; -H; -W), side scatter area, height width (SCC-A; -H; ~W) for singlet mination, 488 nm laser (FITC-A) with a 530/30 nm ?lter set and a 505 mm long pass mirror to detect cells labeled with Cy2 (cells positive for GXl protein) as described above and 640 nm laser (APC-A) with a 670/30 nm ?lter and a 750 nm tong pass mirror to discriminate absence or presence of Live/Dead® Far Red staining. All samples were processed at 4°C and collected into 12 x 75 mm BSA coated tubes in sheath ?uid. A portion of each sample was analyzed on BD FACSDiva 6.1.3 prior to and post-sorting to determine percent ofmembrane intact sperm ve for GXl protein.

Sorting for absence or presence of anti-(3X1 peptide antibody association, i.e. sorting a mixed sperm cell population to purify for absence or presence of anti—6X1 peptide antibody ation, was con?rmed using cent microscopy (see Figures 4A, 48; scale bar "7 25 microns). Cells were exposed to anti-GXl antibody and to anti-rabbit IgG—cyanine dye conjugate (Cy2; green color) as described above to detect ceils positive for association with anti-0X1 peptide antibody, and counterstained with DAPI (blue color). As shown, membrane-intact cells sorted to e a population of sperm cells negative for association with anti-(3X1 peptide antibody did not label with Cy: (Figure 4A), whereas membrane~intact cells sorted to e a population of sperm cells positive for association with anti-GXI peptide antibody labeled with Cy2 (Figure 4A).

Exampie 5. Sex Ratio ofBull Sperm Positivefor XI Peptide Antibody Association Each sorted sample (see Example 4 above) was spun onto a clean uncoated cytospin glass slide (Thermo ific Inc, Waltham, MA) using a cytocentrifuge (settings 1000 rpm for min) with a disposable single cyto?lnnel (Therrno Fisher Scienti?c). Immediately after removal from the cytofunnel clip, each slide was subjected to a decondensation procedure modi?ed from Rens et al. . Speci?cally, solution A (10 mM Tris, 154 mM NaCl) was placed onto the sperm spot, then equal volume of solution B (freshly ed 50 mM DTT in solution A) was added to the droplet. After 2.5 min at room temperature, an equal volume of modi?ed solution C (1% SDS, 100 mM Disodium tetraborate) was added to the droplet. Slides were incubated for 103 prior to placement into prechilied 100% EtOH (-20°C). Slides _ were then incubated for 15 min at -20°C and then dried at room temperature. Subsequent rehydration, perrneabilization and ation were performed as follows: 5 min in DPBS twice, 15 min in 200 mM HCl freshly prepared in H20, 5 min in 2 X SSC, 2 min in 70% EtOH, 2 min in 90% EtOH, 2 min in 100% EtOH and then dried at room temperature. A probe mixture for bovine Y chromosome was prepared concurrent with slide processing; 5 pM peptide nucleic acid probe {Cy3—OO-AGCCCTGTGCCCTG; SEQ ID NO: 8; sequence derived from Perret et al. (1990)] in 50% deionized formamide, 10% dextan sulfate, 2 X SSC was incubated for 10 min at 75°C and held at 37°C until use.

Dried slides were placed onto a prewarmed Omnislide thermal cycler (37°C) and prepared probe was then deposited onto the sperm spot with a glass coversiip; edges were sealed with rubber . Slides were subjected to 2 min at 75°C prior to incubating at 37°C for a minimum of 18h. Following hybridization tion, rubber cement was carefully d without disturbing the coverslip placement; then slides were placed into DPBS with 0.1% Tween and agitated for 2 min to gently remove lips. Excess probe was washed from slides by incubating in DPBS-0.1% Tween 20 at 45°C for 15 min then in 2 X SSC—0.05% Tween 20 for 5 min. Glass coverslips were mounted over the sperm spot on each slide using g Gold® mounting media with DAPI (Life Technologies). For quality control, the assay included slides prepared from nonsorted sperm as well as X— or ed sperm (Select Sires Inc, Plain City, OH). Two observers uninformed of treatments evaluated sperm for presence or absence of Y chromosome (presence or absence of Cy3 punctate spot within the sperm head) to determine percent of Y- and X-bearing sperm in each sample.

Selecting for membrane intact sperm that were positive for anti-GXl peptide dy association resulted in skewing towards X-bearing sperm with n concentrations of the anti-GXl peptide antibody. As the concentration of anti-GK] peptide antibody incubated with the bull sperm was increased, the proportion of X-chromosome bearing sperm being increased within the population selected to be positive for association with anti-(3X1 peptide antibody. in other words, increasing the concentration of anti-GXI peptide antibody incubated with the bull sperm resulted in the proportion of X-bearing sperm being increased within the tion selected to be positive for association with anti-GXI peptide dy (Figure 5).

Example 6. Association ofAnti—GX] Peptide Antibody with Bull, Stallion, Man, Ram, Boar and Buck Sperm The y of anti~GX1 peptide antibody to bind to sperm of various species was evaluated on semen freshly collected from bull and on as well as extended/frozen semen from man, ram, boar and buck (Cervidae). First, semen collected from these species was washed twice with DPBS to remove extender and/or seminal ?uid. Semen pellets were resuspended in DPBS and d onto uncoated glass microscope slides. Slides were allowed to dry for 10 min at room temperature before ?xation in -20°C Methanol (100% ACS grade; Thermo Fisher i?c Inc.) Slides were incubated for 10 min at 420°C then allowed to dry completely in a fume hood for a minimum of 10 min.

The area around the sperm spot location was encircled using hydrophobic ink (GnomePen; FroggaBio Inc, Toronto, ON Canada). Sperm cells were ated in DPBS containing 1:500 dilution of Live/Dead® Fixable Violet (Life Technologies) cell stain and then incubated for 30 min at room ature in a humidified chamber with protection from light (conditions used for all subsequent incubations unless otherwise noted). Rehydration liquid was wicked off the slides and replaced with 10% NGS in DPBS to block nonspeci?c binding sites.

Slides were incubated for i h at room temperature.

After wicking the blocking solution from the slides, 3% NGS-DPBS containing 0.5 or ug/mL anti-GXI peptide antibody (aka primary antibody) was placed on slides after absorption t or with the 3 peptide antigens (ratio 1 antibody to 10 of each e n; see Table 2). Slides containing a mix of primary antibody and peptide antigens function as absorption control [nomenclature based on Burry, R. W. (2011)]. For onal controls, two slides were covered with 3% NGS-DPBS; i.e., no y antibody. All slides were incubated overnight at After wicking liquid from the slides, the sperm spots were washed three times with DPBS at room temperature, ting for 5 min per wash. Then 3% NOS-DPBS containing 1:1000 dilution of anti-rabbit IgG-Cy3 conjugate (secondary dy; Jackson ImmunoResearch Laboratories) was placed onto each sperm spot. The slides were then incubated for 15 min at room temperature. Of the control slides, the one incubated with secondary antibody serves as secondary control to discern ci?c binding of the Cy3 conjugate. The remaining control slide was incubated with 3% NGS-DPBS omitting the ary antibody; this is the labeling control to determine endogenous ?uorescence.

After wicking liquid from slides, the sperm spots were washed three times with DPBS at room temperature, incubating for 5 min per wash. Glass coverslips were d over the sperm spot on each slide using Prolong Gold® mounting media with DAPI (Life Technologies).

Slides were evaluated using an Arcturus® LCM system equipped with Nikon e Ti-E inverted research cope, 40 & 60x ives, and epi-?uorescence (Life Technologies).

Fixed stained sperm were evaluated for the presence of GXl protein by visualizing the attachment of anti~rabbit IgG—Cy3 ate to sperm presumably through c binding of the anti-6X1 peptide antibody. A fluorescent ?lter with excitation for 510-560 nm and emission for >590 nm was utilized to evaluate the speci?c staining with anti-GXl peptide antibody. The counterstains were used to localize where the binding occurred on sperm; Live/Dead® Fixable Violet and DAPI were visualized using a ?uorescent ?lter with excitation for 325-375 nm and emission for >420 um.

Of the sperm the Xl antibody associated with, it was localized to the upper head region in the bovine. In human sperm, anti—GXI antibody was associated with the tail. Of the horse, sheep and deer sperm in which anti-6X1 was associated, localization was noted in the tail with several sperm also having some localization in the lower head region. In boar sperm, association of anti—GXI was observed in the lower head region of some sperm. Control slides were evaluated with same exposure gs that were used to examine the anti-GXl peptide antibody labeled samples. For all species (bovine, human, equine, ovine, cervidae and porcine) tested, association with anti-GXl peptide antibody was absent on sperm on all control : absorption, secondary and labeling. The anti-GXI antibody did not bind to every sperm cell, further supporting speci?city to X—chromosome bearing sperm cells.

Example 7. Synthesis and Purification ofGXI Protein using E. coli.

A clone of GXl mRNA was generated by PCR cation of cDNA derived from bovine testes RNA. An amplicon sized approximately 439 bp was ligated into the TA cloning vector (pGEM-T Easy, Promega, Madison, WI). Once identity was corriirmed by cing, plasmid containing the GXl cDNA was subjected to PCR to generate a cDNA fragment which ts of nucleotide sequence for the protein coding region for (DH ?anked by restriction into E. coli protein expression vector. Speci?cally, enzyme cleavage sites for subsequent ligation the forward primer was designed to add an Nde I cleavage site immediately prior to start codon of the GXl coding region whereas the reverse primer was designed to replace the stop codon domain the GXI coding region with sequences for a glycine amino acid, an intein-chitin binding to digestion with tag and a Spe I ge site (Table 3). The products of the PCR were subjected appropriate restriction enzymes prior to on into digested pTXBl vector [New England Plasmids s Inc (NEB), Ipswich, MA] and ormation into E. coli JM109 cells (NEB). of GXl cDNA insertion by were isolated from transformants and then screened for presence ction ion. Positive clones were sequenced to insure that GXl cDNA was in the proper orientation to the intein tag for C—terrninus labeling then ormed into E. coli T7 Express cells (contains T7 RNA poiymerase gene; NEB).

Table 3. Sequence of primers used to generate GXl cDNA insert for expression using E.

Primer Sequence* Forward 5’- GGT GGT CAT ATG ACT AAG CGG ACT GGG —3’ (SEQ lD NO: 25) Reverse 5’- GGT GGT AAC TAG TGC ATC TCC CGT GAT GCA ACC CTG GCT GCC CAC CGG TCC CGC TGG - 3’ (SEQ ID NO: 26) iction enzyme cleavage sequence underlined To express intein tagged GXl protein, LB media was inoculated with a T7 Express with addition of cell transformant, cells cultured to density of 0.4 to 0.6 013509 and then induced isopropyl~beta-D-thiogalactoside (IPTG). After 2—4 h of incubation, cells from IPTG-induced fusion protein was culture were collected, lysed, and loaded onto a chitin resin column. The GXl immobilized Onto the chitin resin through binding of the intein-chitin binding domain tag. column was washed to remove nonspeci?c binding of non-(3X1 fusion proteins. The GXI protein was ed from the column through ion of the intein cleavage by the addition of dithiothreitol-containing buffer.

Following elution, the E. coli expressed GXI protein (hereafter abbreviated as GXl- E) was dialyzed with PBS, concentrated using an Amicon® ultra centrifugal device (10K MWCO; EMD Millipore, Billerica, MA) and purity con?rmed by SDS-PAGE (see Figure 6; M = protein standard; P = dialyzed and trated protein). Only a single band of protein was visible on the Stained gel. The GXl-E protein was sent to a commercial company for ation of protein identity. Upon arrival at the company, the GXl-E protein was digested with n and the resulting peptides were analyzed by LC/MS/MS (MS Bioworks LLC, Ann Arbor, MI). Computer analysis matched the peptide sequences to the GXl protein sequence with 86% coverage (see Figure 7; 98/114 amino acids matched, light grey areas indicate on of peptide matching and dark grey areas indicate identi?cation of modi?ed amino acid).

Example 8. Production ofAnti-GX] Protein Antibody?'om E. coli Expressed GXJ Protein Polyclonal antiserum was generated in rabbits against GXi-E protein prepared as described in Example 7. Brie?y, the GXl-E n was emulsi?ed in Freund’s Complete Adjuvant and injected into a New Zealand white rabbit every two weeks for a total of seven co~ immunizations to induce GXl-E antiserum production. Serum was collected prior to primary immunization (pie-immune; week 0), prior to fourth booster ion (week 8), two weeks after the fourth booster injection (week 10), prior to seventh booster injection (week 14), one week after the seventh booster ion (week 15) and upon termination ofproject (week 17).

Sera collected at weeks 0 and 8 were analyzed by ELISA titer assay to ensure speci?city of rum for GXl—E protein. Results from ELISA indicated that pre-immune serum lack antibodies reactive to the GXl-E protein whereas the serum collected at week 8 contained high concentrations of dies (i.e., high titers) for the GXl-E protein. As shown in Figure 8, mune serum lacked antibodies reactive to the GXl-E protein (values for absorbance at 405 nm less than 0.1) for all dilutions tested s week 8 serum contained antibodies reactive to the GXl-E protein (values for absorbance at 405 nm greater than 0.1) for all ons tested.

Protein conjugated resin columns were used to purify and concentrate antibodies from week 10 antiserum (immunoaffinity chromatography), thus generating puri?ed anti-GXl-E n antibody. Upon arrival in the Iaboratory, speci?city for a single protein was determined by western blot analyses comparing vity of pre-immune serum (Figure 9, Blot A) and puri?ed anti-GXl-E protein-(Figure 9, Blot B) on bull sperm iysate. Immunoblotting sperm s with pre-immune serum did not detect any protein bands whereas probing with anti-GXI- E protein antibody detected a single protein band in bull sperm iysate and the control GXl-E protein (Figure 9; lane 1 2 n standard; lane 2 : bull sperm lysate; lane 3 : blank; lane 4 2 d GXl-E n).

Example 9. Synthesisand Purification of GXI Protein using a ian In Vitro Protein Expression System.

The clone of GXl mRNA (Example 7) was subjected to PCR to generate a cDNA fragment which consists of nucleotide sequence for the protein coding region for GXI ?anked by restriction enzyme ge sites for subsequent ligation into protein expression vector.

Specifically, the forward primer was designed to add an Nde I cleavage site immediately prior to start codon of the GXl coding region whereas the reverse primer was designed place an Xho I immediately following the stop codon of the GXl coding region (Table 4).

Table 4. Sequence of primers used to generate GXl cDNA insert for in Vitro translation Primer Se uence* Forward 5’» GGT GGT CAT ATG ACT AAG CGG ACT GGG -3’ (SEQ ID NO: 25) Reverse 5’- GTG GTG GTG CTC GAG CTG GCT GCC CAC CGG ch - 3’ (SEQ ID NO: 27) ‘ *Restriction enzyme cleavage sequence underlined The products of the PCR were ted to digestion with appropriate restriction enzymes prior to on into digested pT7CFE1-NHIS~GST—CHA vector (Thermo Fisher Scientific) and transformation into E. coli JM109 cells (NEB). Plasmids were isolated from transformants and then screened for presence of GXl cDNA insertion by restriction digestion.

Positive clones were sequenced to insure that GXl cDNA was in the proper orientation to the hexahistidine (His) — glutathione S-transferase (GST) tag for inus labeling. Puri?ed plasmid DNA from positive clones was used with the 1-step human ield in Vitro translation kit o Fisher Scienti?c) following manufacturer instructions to synthesize His-' GST tagged GXI protein. In Vitro translation reactions diluted in xTractor® buffer (Clontech Laboratories Inc, Mountain View, CA) were loaded onto a His TALON gravity column (Clontech). The passage of the diluted reactions across the column allows for immobilization of the His-GST GXl fusion protein to the cobalt resin through binding of the stidine tag.

The column was washed to remove nonspeci?c binding of non-GXI proteins. The GXl protein was released from the column through the addition of discrete volumes of imidazole—containing buffer. [007i] Purity of the His-GST GXI fusion protein in each elution volume was evaluated (see Figure 10) by SDS—PAGE (on SDS-12% polyacrylamide gel), ing a protein standard (lane 1) to in Vitro translation reaction (lane 2) prior to binding to cobalt resin column and the elution of immobilized protein with discrete volumes of imidazole-containing buffer (lanes 3 to ). Elutions deemed to contain only the in Vitro expressed GXl protein (hereafter abbreviated as GXl-M) were combined for is with PBS and then concentrated using Amicon® ultra centrifugal device (10K MWCO; EMD Millipore) prior to shipment to commercial company for con?rmation of protein identity. Upon arrival at the y, the GXl-M protein was digested with trypsin and the ing peptides were ed by LC/MS/MS (MS Bioworks LLC).

Computer analysis matched the peptide sequences to the GXI protein sequence with 87% coverage (Figure 11; 99/114 amino acids; light grey areas indicate location of peptide matching and dark grey areas indicate identification of modi?ed amino acid).

Example 10. Identification ofvariants ofSEQ ID NO: 4.

Variants were identi?ed sing amino acid sequences determined to deviate by one or more amino acid es from the sequence set forth in SEQ ID NO: 4 with minimal ce on the antigenic properties of the resulting variant protein. Each variant protein contained one or more of the peptide regions set forth herein as SEQ ID NO: 1, 2, and 3.

Variants were identified by the P software (NCB1) as having at least 79%, 85%, 90% or 95% identity with the amino acid sequence set forth in SEQ ID NO: 4. The variants of the X— chromosome-bearing mammalian sperm cell protein se the amino acid sequences set forth in SEQ ID NO: 9 — l6, and the ns for the variants of the X—chromosome-bearing mammalian sperm cell protein may be encoded by the nucleotide sequences set forth in SEQ ID NO: 17 — 24.

Computer analyses as summarized above determined that the evaluated variant protein sequences exhibited high sequence homology with the GXl and would be speci?cally bound by the X1 e antibody (Example 2) as well as an antibody against the full length protein (Examples 8 and 11; see in?a). The computer analysis showed the following homologies to the GXl protein sequence (SEQ ID NO: 4) for certain variants: SEQ ID NO: 9 (Gene ID: 781267) = 98%; SEQ ID NO: 10 (Gene ID: 100336610) = 92%, SEQ ID NO: 11 (Gene ID: 781072) 2 91%, SEQ ID NO: 12 (Gene ID: 100299333) = 90%, SEQ ID NO: 13 (Gene ID: 102327690) = 81%, SEQ ID NO: 14 (Gene ID: 102328632) = 79%, SEQ ID NO: 15 (Gene ID: 100337198) = 85%, and SEQ ID NO: 16 (Gene ID: 100337198 isoform) = 82%.

Example 1 1. Production ofAnti~GX1 Protein Antibodyfrom In Vitro sed GX] Protein.

Polyclonal antiserum will be generated in rabbits against GXl—M protein by Bio— Synthesis Inc. Speci?cally, the GXl-M protein will be emulsi?ed in Freund’s Complete Adjuvant and then injected into a New Zealand white rabbit eyery two weeks for a total of ?ve coaimmunizations to induce GXl-M antiserum production. Serum will be collected prior to primary immunization (pro—immune; week 0), fourth booster injection (week 8), two weeks after the fourth booster injection (week 10) and upon termination of project (week 14). Sera ted at weeks 0 and 8 will be analyzed by ELISA titer assay to ensure speci?city of antiserum.

Protein conjugated resin columns will be used to purify and concentrate dies from GXl-M antiserum (immunoaffinity chromatography), thus generating d anti-GXl-M protein antibody. Upon arrival in the laboratory, speci?city for a single protein will be determined by n blot analyses comparing reactivity of pro-immune serum, anti-GXl-M protein dy and preabsorbed anti-GleM protein antibody on bull sperm lysate.

Example 12. Skewing Sex Ratio in Offspring after Separating Sperm. dy or antigen-binding fragment according to Examples 2, 8 and/or 11 is labeled with a able substance, without intending any limitation including ?uorescent, radioactive, enzymatic, or protein . Antibody or antigen-«binding fragment may be conjugated to solid supports, such as, but not limited to, tubes, beads, and/or plates. Then the labeled and/or conjugated antibody or antigen-binding nt is added to neat or diluted sample of mammalian semen and/or sperm under conditions whereby the antibody binds to the X—chromosome bearing sperm cells. Next, sperm cells bound to the antibody are separated from unbound sperm cells. Any suitable method for ting is contemplated, including without limitation ?uorescent-activated cell sorting, ic cell sorting, adherence to antibody—coated tubes, adherence to antibody-coated plates, adherence to antibody-coated beads, adherence to other solid matrices, and the like. Separated sperm cells then may be used immediately to inseminate females or fertilize s in vitro, or are processed and frozen using conventional methods known in the art to allow for use to inseminate and/or fertilize in vitro upon a later date. ' Example 13. Skewing Sex Ratio in ing without Separating Sperm.

An antibody or antigen—binding fragment thereof derived as described in Examples 2, 8 and/or 11 is added to neat or diluted sample of mammalian semen and/or sperm under conditions y the dy/antigen-binding fragment binds to the X—chromosome bearing sperm cells and provides a physical barrier preventing the antibody-bound sperm cells from fertilizing an oocyte. Next, semen containing a mixture of sperm cells, some und antibody or antigen-binding fragment f and some Without such bound antibody/antigen- - binding fragment, are used immediately to inseminate females or to fertilize oocytes in vitro, or are processed and frozen using conventional methods known in the art to allow for use to inseminate and/or ize upon a later date. In this method the unbound sperm, a population enriched for Y-chromosome bearing sperm, are able to fertilize the oocyte and bias the resulting population of offspring towards males, whereas the bound sperm, a population enriched for‘X- some bearing sperm, are ted.

Example 14‘ Skewing Sex Ratio in Offspring without Separating Sperm.

An antibody or antigen—binding fragment thereof derived as described in Examples 2, 8 and/or 11 is conjugated by methods well-known in the art to an inhibitory substance, without intending any limitation ing a chemical agent, a pharmaceutical agent, and/or a cytotoxin.

The conjugated antibody/antigen—binding fragment is added to a neat or diluted sample of mammalian semen and/or Sperm under conditions whereby the antibody/antigen—binding nt binds to the X-chromosome bearing sperm cells. By the bound inhibitory nce, the antibody/antigen—binding fragment-bound sperm cells are prevented from fertilizing an oocyte.

Next, semen containing a mixture of sperm cells, some with bound conjugated antibody/antigen- binding nt thereof and some without such bound antibody/antigen—binding fragment, are ' used immediately to nate females or fertilize oocytes in vitro, or are processed and frozen using conventional methods known in the art to allow for use to inseminate and/or ize upon a later date. In this method the unbound sperm, a population enriched for Y—chromosome bearing sperm, are able to fertilize the oocyte and bias the resulting population of offspring towards males, Whereas the bound sperm, a population enriched for thhromosome bearing sperm, are inhibited.

The present disclosure thus responds to a need in the art by providing effective methods for ?cation of X-chromosome bearing sperm cells, for separation of X- chromosome and Y-chromosorne bearing sperm cells, and/or for skewing a ratio of mixed lX-/Y— chromosome bearing sperm cells in favor of X-chromosome hearing or Y-chromosome g sperm cells. Advantageonsly, the methods are substantially non-invasive, are reproducible, and provide a viable X-chromosome skewed sperm cell population suitable for subsequent commercial artificial insemination procedures.

In turn, the described methods readily admit of scaling up to commercial scale, such as for sorting large quantities of semen to provide sperm cells tailored for a male or female— skewed sex ratio for arti?cial insemination purposes, or for providing a sample of semen or sperm cells including a mixed population of mosome bearing and Y—chromosome bearing sperm cells that, by binding of antibody or n-binding fragment thereof according to the present disclosure, include X-chromosome g sperm cells that are prevented from fertilizing oocytes.

While the terms used herein are believed to be well—understood by one of ordinary skill in the art, de?nitions are set forth to facilitate explanation of certain of the presently- disclosed t matter. ing long-standing patent law convention, the terms "a," "an," and "the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "a cell" includes a plurality of such cells, and so forth.

Unless otherwise indicated, all numbers expressing quantities of ingredients, prOperties such as reaction ions, and so forth used in the speci?cation and claims are to be understood as being modi?ed in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical ters set forth in this speci?cation and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter.

As used herein, the term "abou ," when referring to a value or to an amount of a composition, dose, sequence identity (e.g., when comparing two or more nucleotide or amino acid sequences), mass, weight, temperature, time, , concentration, percentage, etc, is meant to encompass variations of in some embodiments $2094), in some embodiments 21:10%, in some ments 325%, in some embodiments i1 %, in some embodiments i0.5%, and in some embodiments i0.1% from the ed amount, as such variations are riate to perform the disclosed methods or employ the disclosed compositions.

The "comprising", which is with "includingH I! term synonymous containing" or "characterized by" is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. "Comprising" is a term of art used in claim language which means that the named elements are essential, but other elements can be added and still form a construct within the scope of the claim.

As used herein, the phrase "consisting of' es any element, step, or ingredient not speci?ed in the claim. When the phrase "consists of appears in a clause of the body of a claim, rather than immediately following the le, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.

As used herein, the phrase "consisting ially of limits the scope of a claim to the speci?ed materials or steps, plus those that do not materially affect the basic and novel teristic(s) of the claimed subject matter. With respect to the terms "comprising", "consisting of", and "consisting essentially of", where one of these three terms is used herein, the presently disclosed and claimed t matter can e the use of either of the other two terms .

As used herein, the term "andfor" when used in the context of a listing of entities, refers to the entities being present singly or in combination. Thus, for example, the phrase "A, S, C, and/or 0" includes A, S, C, and O individually, but also includes any and all combinations and subcombinations of A, S, C, and O.

The term "antibody" (Ab) as used herein includes monoclonal antibodies, polyclonal antibodies, muitispeciiic antibodies and antibody fragments, as long as they exhibit the desired biologicai activity. The term "polyclonai antibody" as used herein refers to an antibody obtained from a population of heterogeneous dies, 128., they are secreted by different B cell lineages within the body. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies that make up the population are identical except for le naturally occurring mutations.

Monoclonal antibodies are highiy speci?c, being directed against a single nic site.

The term "antibody" (Ab) as used herein also includes antibody fragments. An "antibody fragment" is a n of an intact antibody, preferably the n g or variable region of the intact antibody. Examples of antibody fragments include but are not limited to: Fab, Fab', 2, and Fv fragments; diabodies; linear dies (see US. Pat. No. 5,641,870, Example 2; Zapata et aI., Protein Eng. 8(10): 1057-1062 [1995]); singleuchain antibody molecules; and multispecific antibodies formed from antibody fragments.

The term "sex ratio" as used herein refers to the ratio of males to s in a mammalian population. It may also include the prediction of sex ratio in a particular populaticin.

The term "semen" as used herein refers to the ?uid and sperm cells contained n in mammals. Semen as used herein includes neat and diluted semen.

The foregoing description of preferred embodiments has been presented for purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed. Obvious modi?cations or variations are possible in light of the above ngs. The embodiments were chosen and described to provide the best illustration of the ples of the disclosed subject matter and its practical ation to thereby enable one of ordinary skill in the art to utilize the invention in s embodiments and with various modi?cations as are suited to the particular use contemplated. All such modi?cations and variations are within the scope of the invention as determined by the claims when interpreted in accordance with the breadth to which they are fairly, legally and equitably entitled.

References.

Burry, R. W. , Journal of Histochemistry and Cytochemistry 59: 642.

L. A. Johnson (1992), J. Anim. Sci. 70:8-18.

L. A. Johnson (1995), Reprod Fertil Dev. 93-903.

J. L. Lush (1925), J. Agric. Res. 30:893.

Perret et al. (1990), Genomics 6: 482-90.

Rens et al. (2001), Reproduction 121: 541—6. 0.13. Seidel (2012), J Reprod Dev. 58(5);505—9}

Claims (24)

WHAT IS CLAIMED:

1. A purified antibody, or an antigen-binding fragment thereof, that binds selectively to a mammalian X-chromosome-bearing sperm cell protein comprising a sequence selected from the group ting of SEQ ID NOs:4 and 9-16, or a sequence having at least 85% sequence identity thereto.

2. The dy or antigen-binding fragment of claim 1, wherein the mammalian sperm cell protein is encoded by a gene comprising a nucleotide ce selected from the group consisting of SEQ ID NOs:5 and 17-24, or a sequence complementary thereto, or a nucleotide sequence having at least 85% sequence ty to a nucleotide sequence selected from the group ting of SEQ ID NOs:5 and 17-24, or a sequence complementary thereto.

3. The antibody or antigen-binding fragment of claim 1, wherein the antibody is a monoclonal or a polyclonal dy, or an antigen-binding fragment thereof.

4. The antibody or antigen-binding fragment of claim 3, wherein the antibody or antigen- binding fragment f is derived by immunization of a non-human host by an nic peptide composition comprising a natural or a synthetic nic amino acid sequence selected from the group of sequences consisting of SEQ ID NOs:4 and 9-16, or an antigenic sequence having at least 85% sequence identity thereto.

5. The antibody or antigen-binding fragment of claim 3, wherein the dy or antigen- binding fragment thereof is derived by immunization of the non-human host by an antigenic peptide composition sing peptides selected from the group consisting of one or more of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

6. The antibody or antigen-binding fragment of claim 1, wherein the mammal is selected from the group consisting of humans, bovines, s, ovines, Cervidae, camelids, and porcines.

7. The antibody or antigen-binding fragment of claim 6, wherein the mammal is one of Bos Taurus and Bos indicus, or a cross-breeding thereof.

8. A method for identifying a population of X-chromo some-bearing mammalian sperm cells, comprising: contacting a neat or a diluted sample of mammalian sperm with an antibody, or an antigen-binding fragment thereof, that binds selectively to a natural or synthetic ian X- chromosome-bearing sperm cell protein comprising a sequence ed from the group of sequences consisting of SEQ ID NOs:4 and 9-16, or a sequence having at least 85% sequence identity thereto; and directly or indirectly detecting the bound antibody or antigen-binding fragment thereof.

9. The method of claim 8, wherein the mammalian X-chromosome-bearing sperm cell protein is a natural or synthetic peptide encoded by a gene comprising a nucleotide ce selected from the group consisting of SEQ ID NOs:5 and 17-24, or a sequence complementary thereto, or a nucleotide sequence having at least 85% ce identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:5 and 17-24, or a sequence mentary thereto.

10. The method of claim 8, including contacting the sample with an antibody that is a monoclonal or a polyclonal antibody, or an antigen-binding fragment thereof.

11. The method of claim 10, including contacting the sample with an antibody or antigen- binding fragment thereof that is derived by immunization of a non-human host by an antigenic peptide ition comprising a natural or a synthetic antigenic amino acid sequence ed from the group of sequences consisting of SEQ ID NOs:4 and 9-16, or an antigenic sequence having at least 85% ce identity thereto.

12. The method of claim 10, including contacting the sample with an dy or antigen- binding fragment thereof that is derived by immunization of the non-human host by an nic peptide composition comprising natural or synthetic peptides selected from the group consisting of one or more of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

13. The method of claim 8, including obtaining the sample from a mammal selected from the group consisting of humans, bovines, equines, , ae, camelids, and porcines.

14. The method of claim 13, wherein the mammal is one of Bos Taurus and Bos s, or a cross-breeding thereof.

15. A method for skewing a sex ratio, comprising: obtaining a sample of mammalian semen having a population of sperm cells including X- chromosome-bearing sperm cells and Y-chromosome-bearing sperm cells; and ting a neat or a diluted portion of the sample of semen and/or the population of sperm cells with an antibody or an antigen-binding fragment thereof that binds ively to a natural or synthetic ian X-chromosome-bearing sperm cell protein comprising a sequence selected from the group of sequences consisting of SEQ ID NOs:4 and 9-16, or a sequence having at least 85% sequence identity thereto, to provide a mixed population of sperm cells including a portion of sperm cells having the antibody or antigen-binding fragment bound thereto; wherein the sample of mammalian semen is not obtained from humans.

16. The method of claim 15, wherein the mammalian X-chromosome-bearing sperm cell n is a natural or synthetic peptide encoded by a gene comprising a nucleotide sequence ed from the group of sequences consisting of SEQ ID NOs:5 and 17-24, or a sequence complementary thereto, or a nucleotide sequence having at least 85% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:5 and 17-24, or a sequence complementary thereto.

17. The method of claim 15, including contacting the sample or the population of sperm cells isolated therefrom with an antibody that is a monoclonal or a polyclonal dy, or an antigen- binding fragment thereof.

18. The method of claim 17, ing contacting the sample with an antibody or antigen- g fragment thereof that is derived by immunization of a non-human host by an antigenic peptide composition comprising a natural or a synthetic antigenic amino acid sequence selected from the group of sequences consisting of SEQ ID NOs:4 and 9-16, or an antigenic sequence having at least 85% sequence ty thereto.

19. The method of claim 17, including contacting the sample with an antibody or antigen- g fragment thereof that is derived by immunization of the non-human host by an antigenic peptide composition comprising l or synthetic peptides selected from the group consisting of one or more of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

20. The method of claim 15, further including fertilizing an oocyte with at least a portion of the mixed population of sperm cells.

21. The method of claim 20, further including separating sperm cells having the antibody or antigen-binding fragment thereof bound thereto from other sperm cells of the mixed population of sperm cells prior to the step of fertilizing, to provide an X-chromosomeenriched population of sperm cells and a Y-chromosome-enriched tion of sperm cells.

22. The method of claim 21, wherein the separating is performed by one or more of fluorescent-activated cell sorting, magnetic cell g, adherence to antibody-coated tubes, adherence to dy-coated plates, adherence to antibody-coated beads, and combinations thereof.

23. The method of claim 15, including obtaining the sample of semen from a mammal selected from the group consisting of bovines, equines, ovines, Cervidae, camelids, and porcines.

24. The method of claim 23, wherein the mammal is one of Bos Taurus and Bos indicus, or a breeding thereof. A1 13111111111111: $137171. 11111111 31 {31111311131 {11111111131111 111111111 m 11111111 111 1" mW113? “11.11 1111113 P1111 Plate. 1 111111 13111111 31111de MC 111 11 1: 1: a 5 WWWWmW«WV; g i 2‘11} $313111 TBMPEMQ;w Saws-m W“ 11 11 - :11 1.. .. . 11-111 11 11111 111 SUBSTITUTE SHEET (RULE 26) FIG: 2A FIG EB A. Peptig?a E E. ng?i?e 2'. 111.132.11.11. m 1.2 “r {m m ?st—immune 3mm: L2 wwwwwwkb I 3:: ”{MLE W23; 8 32mm X: ., E5 m3... a §§¢ . ma?aam5 «mammw?ew?? {1.1. 6 _ w.4. H a3 .4 k§§x¥ 5. am6a..4 i . K&\\§%§¢§§§§N§Q§ $5§§M§§§a?§ ..\