NZ713733B2 - A mutant sialidase having trans-sialidase activity for use in production of sialylated glycans - Google Patents

Abstract

The invention provides a mutant enzyme having trans-sialidase activity (EC 3.2.1.18), characterized by an enhanced trans-sialidase:sialidase ratio when compared to its parent sialidase enzyme. Further the enzyme may be used in a method for trans-sialylating mono- and oligo-saccharides, including galacto-oligosaccharides (GOS), fructo-oligosaccharides (FOS), malto-oligosaccharides (MOS), isomalto-oligosaccarides (IMO), lactulose, melibiose, maltose, glycosyl sucrose, lactosucrose and fucose. Trans-sialidated mono- and oligo- saccharides, produced with the mutant enzyme, are useful in preparing infant formula, a prebiotic nutritional supplement, and a food supplement. acto-oligosaccharides (GOS), fructo-oligosaccharides (FOS), malto-oligosaccharides (MOS), isomalto-oligosaccarides (IMO), lactulose, melibiose, maltose, glycosyl sucrose, lactosucrose and fucose. Trans-sialidated mono- and oligo- saccharides, produced with the mutant enzyme, are useful in preparing infant formula, a prebiotic nutritional supplement, and a food supplement.

Description

Title: A mutant sialidase having trans-sialidase activity for use in production of sialylated glycans FIELD OF THE INVENTION The invention relates to enzymes having sialidase activity (EC 3.2.1.18), that are derived from Trypanosomal sialidases by mutation. The enzymes obtained by on find particular use in the production of diverse ated galacto-oligosaccharides (G08) and fructo-oligosaccharides (FOS), these being important additives in infant formula, a tic nutritional supplement, and a food supplement.

BACKGROUND OF THE INVENTION Prebiotics are dietary substances that stimulate growth of selected groups of microorganisms in the colon and in addition may have other health benefits.

Galactooligosaccharides (GOS), fructooligosaccharides (FOS), ose, and isomaltooligosaccharides (IMO) are among the few well-established prebiotics. In human milk, oligosaccharides constitute the third largest component, present in s as much as 20-25 g/I around parturition, later declining to 5-15 g/L. With few exceptions, all known human milk oligosaccharides (HMOs) have a lactose core and are elongated via linkage to one or more units of galactose and N-acetylglucosamine, and can be decorated with several sialic acid and fucose residues. More than 100 different such glycan structures have been identified and approximately 10-20 0/0 of these are sialylated (Bode, 2012, Glycobio/ogy 22(9): 1147-1162). Sialylation and/or lation of many of these HMOs appear to convey important functional properties. For example, HMOs can bind human pathogens, such as, Escherichia coli K1, Haemophilus inf/uenzae, Pasteurel/a ida, Neisseria meningitidis, Campy/obacter jejuni, Vibrio cholerae, Helicobacter pylori and Streptococcus agalactiae and thereby reduce the incidence of diarrhoea and other diseases in infants. This ability of HMOs to on as e decoy receptors for human pathogens is most likely enhanced by their diversity, since mannose-containing roteins, sialylated and fucosylated glycans each target different subsets of pathogens (Kunz et al., 2000, Ann. Rev.

Nutrition -722). In addition, sialylated HMOs may modulate the immune system; for e T cell cytokine production is stimulated by ated HMOs in vitro (Eiwegger et al., 2004, Pediatric Rev. 56:536-540). In most cases, the active HMO molecules have not been identified, but in the case of necrotising enterocolitis, a frequent and often fatal disease in infants, the protective effect was recently shown to be due to a single molecule, disialyllacto-N-tetraose, using a rat model (Jantscher-Krenn et al., 2012, Gut 61:1417- 1425).

Bovine milk, which forms the basis for most infant formula, has a very low oligosaccharide content when compared with human milk, with a different sialylation and fucosylation profile. In an attempt to mimic the composition of human milk, milk formula is currently supplemented with (non-HMO) GOS and F08. However, due to their lack of sialic acid residues, the added GOS and F08 are unlikely to provide the therapeutic benefits of HMOs, described above (Bode, 2012, .

Efforts to sialylate GOS and F08 rely on glycan sialylation, which can be ed chemically as well as enzymatically using different types of enzymes [1]. For example, a trans-sialidase enzyme (TcTS) from soma cruzi, the causative agent of Chagas disease, has been used to transfer sialic acid from a donor to an acceptor glycan [2].

However, in the context of industrial production of food-grade HMOs, the T. cruzi trans- sialidase has a major ck, namely that it constitutes an important nce factor within T. cruzi [3].

A native ase (TrSA) found in the non-pathogenic Trypansoma range/i, has been used as a starting point for generating mutant enzymes that possess trans-sialidase activity [4].

Although this sialidase shares 70 % sequence identity with that of TcTS, and has the same overall tertiary structure, it is a strict hydrolase having no able trans-sialidase activity [4]. The sialidase, TrSA, and the trans-sialidase, TcTS, share a common double cement mechanism with a tyrosine as catalytic nucleophile [5] [6]. In TcTS, the acceptor binding site consists of Tyr119 and Trp312 forming stacking interactions with the acceptor sugar [7]. In TrSA, Trp313 (corresponding to Trp312 in TcTS) is found in a different conformation due to a Gln at position 284, while it has a Ser residue at position 120 corresponding to Tyr119 in TcTS [8]. In addition to these ences in the or binding site, a conserved Asp96 hydrogen bonds differently to sialic acid in the two enzymes, possibly due to two residue differences, Val96Met and la. Initial attempts based on TrSA single point mutants, failed to generate an enzyme with any trans-sialidase activity. Subsequent studies revealed the need for a combination of 5 point mutations TrSA, comprising Ser120Tyr, Tyr, and Gln284Pro at the or-binding site as well as Met96Val, and Ala98Pro at the sialic acid binding pocket to confer trans-sialidase activity (1 0/0 of TcTS) to TrSA. An additional single mutation Ile37Leu increased the levels of trans- ase activity to 10% of a T. cruzi trans-sialidase [4]. Furthermore, c data indicate that these TrSA mutants display a >25-fold lower affinity for lactose and >100-fold higher turnover (kcat) for the undesired, competing hydrolysis compared to TcTS [4] indicating a considerable need for improvement before such an enzyme would have any practical value for.trans-sialylation.

Despite the relatively close sequence homology between TrSA and TcTS, there is no evidence that the native sialidase expressed by Trypansoma i has any trans-sialidase activity. Isolation and expression of a TrSA gene from Trypansoma range/i is reported by Smith et al [31]. The isolated TrSA gene encodes an inactive protein, likely due to the substitution of a ly conserved ne, that functions by coordinating the carboxyl of sialic acid, by a cysteine residue [31]. Smith et al., also submitted a TrSA gene encoding sialidase (Q08672) to GenBank, which is predicted to be an osialidase [32]. In addition to lacking the Arg residue required for coordinating the yl of sialic acid, this sialidase (Q08672) lacks the mutations Sll9Y and Q284P that are ed to establish the or binding site, and for this reason cannot function as a trans-sialidase.

Buschiazzo et al., [33] report the isolation of a Trypansoma range/i gene that is predicted to encode a TrSA, UNIPROT: Q08672 having 70% sequence identity to TcTS, which is a common feature of other TrSAs having only hydrolytic activity. One amino acid substitution in the primary ce of a TrSA, found essential for obtaining a mutant TrSA having measurable trans-sialiase activity is Gly249-Tyr, which decreases hydrolytic activity [4]. A second mutation, Ile-37Leu, which in combination with Tyr120, significantly enhances trans- sialidase activity in this mutant [4]. r of these mutations is found in TrSA, UNIPROT: Q08672.

In human milk, lactose or HMOs of various lengths can be sialylated in d2-3 or d2-6 e which can be added to a terminal galactose or a subterminal N-acetyl-glucosamine, thereby contributing to the diversity of HMOs present. Efforts to mimic such complex oligosaccharide compositions require a trans-sialidase that can transfer sialic acid to a y of different acceptor groups. Although it is well established that TcTS can sialylate the terminal galactose of a , there is no documented ce of a trans-sialidase that can use other acceptor groups, which is essential if the diversity of HMOs is to be obtained synthetically.

Accordingly, there remains a need for an enzyme having trans-sialidase activity, that is neither a virulence factor nor derived from a pathogenic organism; and further has no significant sialidase hydrolytic activity, and that can transfer a sialic acid moiety to a range of different or groups present in a glycan molecule.

SUMMARY OF THE INVENTION According to a first embodiment, the invention es a mutant polypeptide having at least 80% amino acid sequence identity to amino acids residues 28 — 372 of SEQ ID NO: 2, and wherein residues 197 to 203 of SEQ ID NO. 2 se one or more of substituted amino acid residues resulting in a net positive charge of at least +3 for residues 197 to 203 2014/057422 of SEQ ID NO. 2, and wherein amino acid residues 37, 96, 98, 120, 249, 284 in the sequence of the mutant polypeptide have 100% sequence identity to the corresponding amino acid residues in SEQ ID NO.2, wherein the polypeptide has trans-sialidase activity (EC 3.2.1.18). A net positive charge of at least +2, preferably +3, for residues 197 to 203 of SEQ ID NO. 2 in the polypeptide of the ion confers a reduced hydrolase activity when ed to the polypeptide having the sequence of amino acids residues 28 — 372 of SEQ ID NO: 2. The mutant polypeptide may be obtainable by mutation of SEQ ID NO: 2, and the amino acid sequence of the polypeptide may have sequence ty with SEQ ID NO: 2 with the exception that residues 197 to 203 of SEQ ID NO. 2 comprise one or more of substituted amino acid residues resulting in a net positive charge of at least +2, preferably +3, for residues 197 to 203.

According to a second embodiment, the mutant polypeptide additionally comprises a C- al linker and carbohydrate-binding domain selected from among: a) C-terminal linker peptide and carbohydrate-binding e of Trypanosoma range/i trans-sialidase comprising amino acid residues 373 to 638 of SEQ ID NO: 2; b) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma cruzi trans-sialidase (SEQ ID NO. 8); c) C-terminal linker peptide and ydrate-binding peptide of Trypanosoma congolense trans-sialidase (SEQ ID NO. 9); d) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma brucei trans-sialidase (SEQ ID NO. 10).

The mutant polypeptide may be expressed as a fusion protein comprising a homologous or logous amino-terminal signal peptide and/or a heterologous terminal or carboxy-terminal e having selective ate binding affinity for purification of the polypeptide.

According to a further embodiment, the invention provides a DNA molecule comprising a positive DNA strand having a nucleic acid sequence encoding the mutant polypeptide according to the first or second embodiment.

According to a r embodiment, the DNA molecule may have a nucleotide sequence encoding the mutant polypeptide having an amino acid sequence selected from among: a) amino acid residues 48 — 372 of SEQ ID NO. 4; b) amino acid residues 21 — 372 of SEQ ID NO. 4; c) amino acid es 48 — 638 of SEQ ID NO. 4; and d) amino acid es 21 — 638 of SEQ ID NO. 4.

According to a further embodiment, the invention provides a recombinant host cell comprising the DNA molecule encoding the mutant polypeptide, wherein said cell is prokaryotic or eukaryotic and selected from among a bacterial cell, a yeast cell and a fungal 2014/057422 cell. The DNA molecule may either be integrated into the genome of the host cell or it may be integrated into a self-replicating plasmid in the host cell.

According to a further embodiment, the invention provides a method for producing the mutant polypeptide of the invention comprising the steps of: a) providing a recombinant host cell, wherein the cell comprises a DNA molecule, the DNA molecule comprising a nucleic acid sequence encoding the mutant polypeptide of the invention, and b) incubating the host cell in a medium in which the host cell is capable of expressing the mutant polypeptide, and c) recovering the mutant polypeptide sed by the host cell in step a) from the medium.

According to a further embodiment, the invention es an enzyme composition comprising the mutant polypeptide of the invention, wherein the composition is formulated as a dry powder, a tablet, or as a liquid.

According to a further embodiment, the invention provides a method for producing sialylated mono- and/or oligo-saccharides, comprising the steps of: a) providing a sialic acid donor le and a molecule comprising an acceptor mono- and/or oligo-saccharides capable of trans-sialylation; b) contacting the molecules of (a) with the mutant polypeptide of the invention in an aqueous solution.

According to a further embodiment, the invention provides a composition comprising sialylated mono- and oligo-saccharides ed by the method of the invention, wherein the composition is selected from an infant formula, a prebiotic nutritional supplement, and a food supplement.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. A. Domain structure of a ase s (EC 3.2.1.18), as exemplified by Trypanosoma cruzi trans-sialidase (TcTS). The catalytic domain is located on the left (light gray), the carbohydrate-binding domain to the right (dark grey), the two domains are linked together by a peptide linker (black). A ligand llactose) bound in the active site is shown in black sticks. B. Cartoon of mutant trans-sialidase of the invention, showing domain ure (catalytic domain peptide; linker peptide; lectin peptide (carbohydrate- g domain)) and one example of the mutated motif (amino acids 197-203), and amino acid e positions with respect to SEQ ID NO: 2.

Figure 2. Sequence alignment of sialidase catalytic domain from Tr6 (TrSAsmut [PDB: 1WCS] with a 6th point mutation, I37L; amino acid residues 26-372 of SEQ ID NO. 2) and related trans-sialidases. Tr6 and trans-sialidases from T. cruzi (SEQ ID NO. 5), Trypanosoma congo/ense (SEQ ID NO. 6) and Trypanosoma brucei (SEQ ID NO. 7) were d using ClustalW. Amino acids within 14 A of sialic acid binding site are shown in bold.

The seven amino acid motif is indicated with filled circles, reverting mutations are ted with a triangle while other mutated sites are indicated with asterisks.

Figure 3. Homology model of Tr13 (mutant trans-sialidase of the invention). Close-up of the active site with a sialyllactose docked (dark gray). Acceptor binding site residues Tyr- 120 and Trp-313 and catalytic nucleophile Tyr-343 side chains are shown in gray. The seven introduced amino acids are shown in light gray.

Figure 4. Trans-sialidase activity of Tr6 and derived s using cGMP as sialic acid donor and methylumbelliferyl-pyrogalactoside as acceptor. Product formation is shown in arbitrary units.

Figure 5. Enzyme activity of Tr6 and selected mutants Tr13 and Tr6 D363E.

A) Hydrolase activity on the substrates pNP-Neu5Ac, 3’-sialyllactose, and cGMP.

B) Trans-sialidase activity using cGMP as sialic acid donor and MU-gal as acceptor.

Figure 6. Time course of trans-sialylation catalysed by Tr13. Accumulation of 3’- lactose over time at 25°C, pH 3, 351 mM lactose and 8mM ound sialic acid.

Figure 7. Anion exchange separation profiles for ated glycans catalyzed by Tr13.

Sialylated glycans ted from sialic acid and unused acceptor separated on Sepharose Q and detected at 210 nm.

DETAILED DESCRIPTION OF THE INVENTION A common structural feature of sialidase enzymes (EC 3.2.1.18) is their six bladed [3- propeller catalytic domain with an active site sing a catalytic arginine triad that coordinates sialic acid via the carboxylate group, an Asp residue as acid/base catalyst, and a Tyr/Glu nucleophile pair (Figure 1). The catalytic domain can additionally be functionally linked to a non-essential ydrate-binding module (CBM) that may serve to recognize sialic acid and/or assist the enzyme target its substrate on cell surfaces. Micromonospora viridifaciens secretes two forms of sialidase from the same gene, a short form, with just the catalytic domain, and a longer form with a galactose-binding , dependent on the food source [29].

I A mutant trans-sialidase derived from a Trypanosoma rangeli sialidase Li Structure of mutant trans-sialidase comprising a tic domain The present ion provides a mutant enzyme (EC 3.2.1.18) having an enhanced trans- sialidase:sialidase activity ratio relative to its ate parent enzyme, the mutant being ultimately derived from a sialidase from Trypanosoma range/i nk Acc. No: U83180.1). In a first ment, the mutant enzyme is a polypeptide comprising at least a catalytic domain having trans-sialidase activity. The amino acid sequence of the catalytic domain has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to amino acids residues 28 — 372 of SEQ ID NO. 2, and one or more amino acid residues are substituted with respect to amino acid residues 197 to 203 (amino acid motif) of SEQ ID NO. 2, to give a mutant amino acid motif that has a net ve charge of at least +2, preferably +3. Expression of the mutant enzyme yields a mature enzyme comprising a catalytic domain alone, having trans-sialidase activity e 1). The location of the catalytic domain in SEQ ID NO: 2 was confirmed using NCBI Conserved Domain Search; http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi [10].

The amino acid motif consisting of amino acid residues 197 to 203 of SEQ ID NO: 2 has the sequence IADMGGR, which has one positively charged amino acid (R) and one negatively charged amino acid (D), giving a net charge = 0. A mutant motif having a net positive charge of +2 or +3 that can be obtained by the tution of one or more amino acid residues selected from among 198-203 of SEQ ID NO: 2, wherein the selected residue is substituted with a positively charged amino acid residue, and/or the substitution of residue 199 (D) with a l or positively charged amino acid. A suitable positively charged amino acid is a K or R. A suitable neutral amino acid to tute for residue 199 (D) may be selected from among polar neutral amino acids including asparagine, glutamine, glycine, serine, threonine, cysteine, and tyrosine, or a nonpolar (hydrophobic) amino acids such as include alanine, leucine, isoleucine, valine, e, phenylalanine, tryptophan and methionine.

For example, the mutant motif may have any amino acid sequence selected from among: IAXMGGR; IXZMGGR; IAZXGGR; IAZMXGR; IAZMGXR, where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net ve charge of +2.

Alternatively, the mutant motif may have any amino acid sequence selected from among: IXDXGGR; IXDMXGR; IXDMGXR; IADXXGR; IADMXXR, where X is K or R and n Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +2.

Furthermore, the mutant motif may have any amino acid sequence selected from among: IXZXGGR; IAZXXGR; IAZMXXR; IAXMGXR; IAXMXGR; IAXXGGR; and IAZXXXZ where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +3.

Furthermore, the mutant motif may have any amino acid sequence selected from among: VTNKKKQ, R, IANKKKQ, and IANRRRQ. Thus according to one example, the mutant enzyme is a polypeptide comprising a catalytic domain corresponding to amino acids residues 28 — 372 of SEQ ID NO: 4, wherein the motif consisting of amino acid residues 197 to 203 has a positive charge of +3.

The mutant enzyme of the t invention differs from the sialidase of Trypanosoma range/i (GenBank Acc. No: U83180.1) by an additional 6 point mutations located within the catalytic domain. These 6 point mutations in T. range/i sialidase were previously sed by Paris et al., 2005 [4]. Thus the immediate parent enzyme, from which the t mutant enzyme was derived, has the protein sequence of TrSA5mut (Protein Data Bank file: 1WCS) that further includes I37L as the 6th point mutation (corresponding to SEQ ID NO: I.ii Structure of mutant trans-sialidase comprising a catalytic domain and a carbohydrate- binding peptide (lectin-domain) connected by a linker peptide In a second embodiment, the mutant enzyme is a polypeptide comprising a catalytic domain according to the first embodiment (corresponding to amino acids residues 28 — 372 of SEQ ID NO: 2, wherein one or more amino acid residues within a motif consisting of amino acid from residue 197 to 203 of SEQ ID NO. 2 is mutated, wherein the mutant motif has a net ve charge of at least +2, preferably +3, as well as a C-terminal carbohydrate-binding domain where the two domains are linked by a linker peptide. The carbohydrate-binding domain and linker peptide ising a non-catalytic region) has an amino acid sequence having at least 25°/o, 30°/o, 35°/o, 40°/o, 45°/o, 50°/o, 55°/o, 60°/o, 65°/o, 70°/o, 75°/o, 80°/o, 85%, 90%, 95%, or 98% sequence identity to amino acid residues 373 — 638 of SEQ ID NO: 2. The C-terminal ydrate-binding domain folds separately from the tic domain, in a B-sandwich fold, leaving the two domains to ct h a hydrophobic interface.

Examples of the second embodiment include the mutant enzyme wherein the C-terminal domain is derived from a Trypanosomal trans-sialidase or sialidase enzyme. For example, the C-terminal domain may be selected from among: C-terminal amino acid residues 373 to 638 of SEQ ID NO: 2 derived from Tr6 mutant T. range/i sialidase; C-terminal linker peptide and carbohydrate-binding e having SEQ ID NO. 8, derived from amino acid residues 373 to 642 of T. cruzi trans-sia|idase ot ID Q26966]; C-terminal linker peptide and carbohydrate-binding peptide having SEQ ID NO. 9, derived from amino acid residues 452 to 702 of T. congo/ense trans-sia|idase [Uniprot IDGOWJG3]; C-terminal linker e and carbohydrate-binding peptide having SEQ ID NO. 10, derived from amino acid residues 373 to 642 of T. brucei trans-sia|idase (Uniprot ID [Q57XJ2].

Optionally, the mutant enzyme according to the first or second ment is a polypeptide comprising an N-terminal peptide region fused to the catalytic domain corresponding to amino acids residues 1 — 372 of SEQ ID NO: 2. According to one example of the second embodiment, the mutant enzyme is a polypeptide comprising amino acids residues 28 — 638 of SEQ ID NO: 4 or amino acids residues 1 — 638 of SEQ ID NO: 4.

I.iii The mutant amino acid motif in the mutant trans-sialidase confers an enhanced trans- sialidase:sialidase activity ratio and sia/y/ated t yield The T. i sia|idase mutant enzymes, previously described by Paris et a|., 2005 [4], had the major deficiency that they retained the ytic catalytic properties of the parent T. range/i sia|idase from which they were derived. The mutant enzyme of the present invention according to the first or second embodiment, se a mutant motif (as defined in Li and I.ii) having a net positive charge of at least +2. Mutations creating this mutant motif greatly reduce the ase activity of the parent sia|idase enzyme (see Example 3.3; figure 5A).

The catalytic effect of the mutant motif was surprising since the motif is relatively far removed from the acceptor binding site (~14 A), and is therefore unlikely to affect acceptor binding directly. The net positively charged motif, which is located at the border of the binding cleft, may change the electrostatic field in the cleft, creating an increased hydrogen bond donor capacity that could potentially disrupt or even reverse the water k in the active site. Hydrolysis requires a water network aligned with oxygen lone pairs towards the sia|ic acid. Thus, introduction of a strong positive charge (e.g. at least +2) and hydrogen- donor cy at the edge of the binding cleft may turn the oxygen lone pairs towards the field of the s and correspondingly impair the philicity of the water network in the cleft. Such a disruption of the water network could provide the theoretical explanation for the ite quenching of hydrolysis, not achieved by other sia|idase mutants.

The mutant trans-sia|idase has a high trans-sialylation product yield when assayed under optimal conditions due to its very low hydrolase activity (see Example 4).

I.iv The mutant trans-sialidase has broad acceptor-substrate specificity The mutant trans-sialidase of the invention has unexpectedly broad acceptor-substrate specificity, in contrast to native TcTS, which is only known to act on acceptor substrates comprising a terminal ose [24]. The mutant trans-sialidase is both able to trans- sialylate terminal galactose as well as al glucose and even monomers of glucose and fucose. Importantly, the mutant enzyme was also able to trans-sialylate GOS and IMO and lactulose preparations in reasonable yields (Example 5; Table 2). The sialylated GOS and IMO products obtained using the mutant trans-sialidase are complex, indicating that oligosaccharides of different chain length in the GOS and IMO mixtures are sialylated. In view of its broad acceptor-substrate specificity, the mutant trans-sialidase is particularly suitable for enzymatic sialylation of a broad range of s in the manufacture of functional food ingredients and prebiotics. GOS and IMO and lactulose are well-documented prebiotic compounds used as a nutritional supplement.

Additionally, the mutant trans-sialidase is able to use casein glycomacropeptide (cGMP), which is a side-stream from dairy ry, as sialic acid donor le 5, figure 5). In summary, the mutant enzyme of the invention, is characterized by both a high trans- ase:sia|idase ty ratio and a remarkably broad acceptor-substrate specificity, while having the additional advantages of neither being derived from a thogenic host, nor being a virulence factor.

II A method for production of the mutant trans-sialidase of the invention, including sion vectors and host cells IIi Expression constructs for production of a mutant trans-sia/idase The invention further provides DNA molecules comprising a positive DNA strand having a nucleic acid sequence encoding the mutant trans-sialidase according to the first and second embodiment. For the purposes of expression in a selected host cell, the mutant trans- sialidase may be expressed as an N-terminal translational fusion protein, having an N- terminal homologous or heterologous terminal peptide comprising a signal e sequence and optionally followed by a protease cleavage site. A suitable N-terminal fusion protein may include d-factor signal sequence and Kex2 and/or Ste3 protease recognition sequences.

For the purposes of purification of the expressed protein, the mutant trans-sialidase may be expressed as a translational fusion n comprising a heterologous peptide having selective substrate binding affinity suitable for purification of the polypeptide, as for example c-myc and 6xHis-tag, as present in SEQ ID NO: 12. The logous e may be located either N-terminal or y-terminal to the mutant trans-sialidase in the fusion protein, either in addition to/or independently of an N-terminal signal peptide. 2014/057422 According to an embodiment, the invention provides a DNA molecule ng the mutant trans-sialidase selected from among: a nucleotide sequence encoding a catalytic domain comprising amino acids residues 28 — 372 of SEQ ID NO: 4; a nucleotide sequence encoding an N-terminal peptide region fused to the catalytic domain comprising amino acids es 1 - 372 of SEQ ID NO: 4; a nucleotide sequence ng the tic domain linked to a carbohydrate-binding domain sing amino acid residues 28 - 638 of SEQ ID NO: 4; and a tide ce ng an N-terminal peptide region fused to the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 1 - 638 of SEQ ID NO: 4.

For example, the DNA molecule encoding the mutant trans-sialidase may be selected from among: nucleotide sequence 84 - 1116 of SEQ ID NO: 3 encoding the catalytic domain comprising amino acids residues 28 - 372 of SEQ ID NO: 4; nucleotide sequence 1 - 1116 of SEQ ID NO: 3 ng an inal peptide region fused to the catalytic domain comprising amino acids es 1 — 372 of SEQ ID NO: 4; nucleotide sequence 84 - 1914 of SEQ ID NO: 3 ng the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 28 — 638 of SEQ ID NO: 4; nucleotide sequence 1 - 1914 of SEQ ID NO: 3 encoding an N-terminal e region fused to the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 1 - 638 of SEQ ID NO: 4.

The DNA molecules encoding the mutant trans-sialidase to be expressed are cloned into a suitable self-replicating or genome-integrating vector (plasmid) or are PCR amplified for the purpose of introducing the DNA molecules into a suitable expression host cell. Where the DNA molecule is cloned into vector, the DNA molecule will be cloned behind a DNA promoter, whereby the nucleotide sequence of the promoter is operably linked to the nucleic acid sequence encoding the mutant trans-sialidase. Suitable promoter elements for expression in yeast or other fungi include the Gal 4 promoter, the ADC ol dehydrogenase) promoter, alcohol oxidase promoter (AOX), PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, while ers for prokaryotic expression vectors include the p-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci.

U.S.A. 75:3727-3731).

IIii Expression hosts comprising mutant trans-sia/idase expression constructs Suitable expression hosts include bacterial (e.g. Escherichia coli; Bacillus subti/is; Bacillus licheniformis); yeast (e.g. Saccharomyces cerevisiae; Pichia pastoris, Hansenu/a polymorpha) or fungal (Aspergil/us niger, A. oryzae, Trichoderma viridae) hosts. DNA molecules, encoding the mutant trans-sialidase to be expressed, may be introduced into a host cell by transformation employing standard protocols known in the art, for example by electroporation. Preferably the mutant trans-sialidase is fused with a signal peptide, facilitating secretion of the expressed protein and its subsequence cation from the host cultivation medium.

The invention es a method for producing the mutant trans-sialidase comprising the steps of providing a recombinant host cell, wherein the cell ses a DNA molecule encoding the mutant trans-sialidase according to the first or second embodiment, and ting the host cell in a medium in which the cell is capable of expressing the mutant trans-sialidase, for example a growth medium, and then recovering the mutant trans- sialidase expressed by the host cell from the host cell cultivation and/or incubation medium.

IIiii Methods for detecting and measuring the specific activity of the mutant trans-sialidase The invention provides a method for assaying the mutant trans-sialidase of the invention, that may for example be obtained by recombinant expression. Example 2.1 describes a fluorescence-based assay employing cGMP-bound sia|ic acid (for example 1 mM) as donor ate and umbe||ifery|-B-D-galactopyranoside (MU-Gal) as the acceptor (for example 0.5 mM), where the reaction is performed in a 50 mM phosphate-citrate (pH 6) at °C.

The trans-sialylation:sialidase activity ratio of an enzyme of the invention can be determined by measuring and determining the ratio of the initial reaction rate of the enzyme for the trans-sialidase on with respect to the sialidase on as described in Example 2.1 and 2.2.

III Methods for producing a product comprising sialylated mono- or o|igo- saccharides The invention further provides a method for producing a product comprising ated mono- or saccharides n), comprising the steps of: providing a sia|ic acid donor molecule and a molecule comprising an acceptor (e.g. glycan) capable of trans-sialylation; providing a mutant trans-sialidase according to the first or second embodiment; contacting the mutant trans-sialidase with both of the donor and acceptor molecules in an aqueous solution.

A le sia|ic acid donor molecule includes cGMP-bound sia|ic acid. One source of cGMP is a side-stream (e.g. cheese-processing waste stream) from the dairy industry. Other sources include fetuin, co|ominic acid and free sia|ic acid. Whey containing sia|ic acids, is a byproduct obtained when cheese or rennet casein is produced from milks such as cow milk, goat milk, and sheep milk. For example acid whey, is generated by separating the solids when skim milk is coagulated to form cottage cheese. A cheese sing waste stream is the portion of cheese manufacturing not ed for cheese after formation of curd. The cheese processing waste stream typically refers to the fluid drained from curd, which is frequently discarded. A cheese processing waste stream can be whole whey, ralized whey permeate, the regeneration stream from demineralized whey permeate, whey permeate, whey powder.

A suitable acceptor glycan capable of trans-sialylation includes galacto-oligosaccharides (GOS), fructo-oligosaccharides (FOS), malto-oligosaccharides (MOS), isomaltooligosaccarides (IMO), lactulose, melibiose, maltose, glycosyl sucrose, e, lactosucrose, Lacto-N-tetraose (LNT), Lacto-N-neotetraose , N-fucopentaose I (LNFP I), and Lacto-N-fucopentaose V (LNFP V) and fucose.

Optimal substrate concentrations for use in producing sialylated products using the expressed trans-sialidase of the invention may be determined for each selected acceptor substrate. The sialyloligosaccharides produced according to the methods of the invention may be recovered using methods known in the art, including, but not limited to, ultrafiltration, diafiltration, electrodialysis, ion-exchange chromatography and phase partition chemistry.

IV Methods for ing a t sing sialylated galacto-oligosaccharides The invention further es a two-step method for producing sialylated GOS comprising the steps of: providing a source of lactose, contacting the lactose with a [3- galactosyltransferase capable of transferring a galactose residue from lactose to an acceptor molecule capable of extension by transgalactosylation ( e.g. lactose or a GOS); followed by the step of combining the product of galactosylation with a sialic acid donor molecule (as described herein) to provide a e; and then contacting the mixture with a mutant sialidase according to the first or second embodiment to produce a sialylated GOS product. An additional step of enrichment and purification of the products of transgalactosylation (i.e. GOSs) may be included prior to performing the step of trans- sialylation with the mutant trans-sialidase. The suitable B-galactosyltransferase is a type of glycosyltransferase (EC.2.4.1) which catalyzes the transfer of galactose, such s being well-known in the art [30].

V Sialylated mono- or oligo-saccharides and compositions thereof The invention further provides a sialylated mono- and/or oligosaccharide product or a ition comprising the product, obtained by treating a mono- and/or oligosaccharide substrate with the sialidase of the invention. Compositions comprising the sialylated mono- and/or accharide products may include infant formula, a tic nutritional supplement or a food supplement. 2014/057422 In the present context, infant formula means a foodstuff comprising the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the t invention, which is suitable for nutritional use by infants during the first 4-6 months or even 4 to 12 months of life and satisfying by itself the nutritional requirements of s.

In the present context, a prebiotic food ment uses the ated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present ion, to enhance the beneficial effects and efficiency of probiotics, such as Lactobacillus and Bifidobacterium species, for example by promoting the development of an early bifidogenic intestinal microbiota in infants, in ng the risk of development of allergy and/or asthma in infants, in preventing and treating pathogenic infections in such as diarrhoea in infants.

In the present context, the food supplement is a digestive health functional food used with the ion to enhance and preserve digestive health, and avoid digestive disorders, by ing the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, as physiologically functional ingredients or components in the form of a liquid, tablets, capsules, or powder.

EXAMPLES Example 1 Cloning and expression of T. rangeli sialidase gene mutants in yeast 1.1 Construction of vector comprising parent sialidase gene a-Tr6) A gene encoding a polypeptide comprising a T. rangeli sialidase (PDB 1WCS; SEQ ID NO. 1) with the following mutations, M96V, A98P, S120Y, GZ49Y, Q284P and I37L [12] was codon- optimized and synthesized by DNA 2.0 (Menlo Park, California, United States of America).

The synthetic gene was inserted into PICZqC vector (Invitrogen) between the XbaI and XhoI restriction sites ting a gene (SEQ ID NO: 11) encoding a translational fusion comprising the mutant trans-sialidase (SEQ ID NO: 13) having a N-terminal q-factor signal sequence followed by Kex2 and Ste3 protease recognition sites (SEQ ID NO: 12), and a C- terminal c-myc and 6xHis tag (SEQ ID NO: 14). The encoded mature polypeptide has 662 amino acids, following removal of the signal peptide and protease recognitions sites, and a theoretical molecular mass of 73kDa. The plasmid vector was propagated in ichia coli NM522 grown at 37 °C with shaking in low salt LB (10 g/L tryptone, 5 g/L yeast extract and g/L NaCl) supplemented with 25 ug/mL zeocin. 1.2 Mutation of parent gene (Tr6) The vector, pPICZd-Tr6, was used as template for introduction of additional mutations by PCR using overlapping primers (Table 1) employing standard PCR mutation protocols. PCR products were inserted in C between the XhoI and XbaI sites. Constructs were sequenced to confirm the mutations and to assure that no unwanted ons had been introduced by PCR. The mutants of Tr6 are denoted by the amino acid change compared to the parent (e.g. Tr6 Q123R), except for a multi-mutant denoted Tr13 where amino acids 197-203 were changed from IADMGGR to VTNKKKQ.

Ta b | e 1 ms:—guenceSEQIDNO.

Tr_fwd GCTCTCGAGAAGAGAGAGGCTGAAG 1 5 Tr_rev CGCTCTAGAAATGCTGCTGTACCAGC 1 6 Q123S_F CTATTGGACCTCTCACAGAGATGGATCTGACTGG 1 7 R CATCTCTGTGAGAGGTCCAATAGTTCCTTGTCTTG 1 8 R125G_F GACCCAGCACGGAGATGGATCTGACTGGGAACC 19 R125G_R CAGATCCATCTCCGTGCTGGGTCCAATAGTTCC 20 G127A_F GCACAGAGATGCTTCTGACTGGGAACCATTGTTG 2 1 G127A_R CCCAGTCAGAAGCATCTCTGTGCTGGGTCCAATAG 22 E175Q_F ACTTACTAAGCAGTTCGTAGGTGGAGTAGGCG 23 E175Q_R CTCCACCTACGAACTGCTTAGTAAGTATGCCGTCGAACTC 24 V177L_F TAAGGAATTCTTGGGTGGAGTAGGCGCCG 25 V177L_R CCTACTCCACCCAAGAATTCCTTAGTAAGTATGCCGTCG 26 V180A_F CGTAGGTGGAGCTGGCGCCGCCATCGTG 27 R CGCCAGCTCCACCTACGAATTCCTTAGTAAG 28 G202K_F TGCTGACATGAAGGGAAGAGTATTTACAAAAATTATGTATTCC 29 G202K_R ATACTCTTCCCTTCATGTCAGCAATTTGCACAG 3 0 N250R_F AGTCGATTACAGAAGACGTCTGGTGTACGAATCC 3 1 N250R_R CCAGACGTCTTCTGTAATCGACTCGGTTATTAATGATTAGC 3 2 F GAGATTAATACTAATGAGGTTTATTCTCTTGTTTTTGTCCG 3 3 D363E_R CAAGAGAATAAACCTCATTAGTATTAATCTCATGTAGGGAATA 3 4 13MUT_F CCCTGTGCAAGTAACTAATAAGAAGAAGCAAGTATTTACAAA 3 5 AATTATGTATTCCGAGG 13MUT_R TTGTAAATACTTGCTTCTTCTTATTAGTTACTTGCACAGGGTA 3 6 TACCAAATTAC P98A_F GGTTGTCGATGCTACGGTCATAGTAAAGGGAAATAAGTTG 3 7 P98A_R CTATGACCGTAGCATCGACAACCCTTGAAACTG 3 8 Y249G_F CCGAGTCGATGGAAATAGACGTCTGGTGTACGAATC 3 9 Y249G_R TATTTCCATCGACTCGGTTATTAATGATTAGC 40 Restriction sites are underlined and mutated nucleotides are given in bold. 1.3 Expression and purification of Tr6 and mutants thereof sed in yeast Transformation and selection of zeocin resistant P. pastoris X-33 strains sing the Tr6 and mutants thereof was carried out essential as described in [14].

For low-scale protein synthesis, P. pastoris X-33 harboring pPICZd with mutated genes were grown in 180 mL BMMY (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6), 13.4 g/L yeast nitrogen base, 0.4 mg/L biotin and 0.5 °/o methanol) shaking at 30 °C for three days. Protein synthesis was induced every 24 hours by addition of methanol to a final concentration of 0.5 %. Cells were removed by centrifugation for 5 min at 3000 g and supernatant was subsequently sterile filtered using a 0.2 pm Minisart filter rius AG). The atant was concentrated about 100-fold using Vivaspin20 concentrators with a 30 kDa cutoff (Sartorius AG). 6xHis-tagged protein was purified from concentrated samples using Ni-sepharose (GE Healthcare) columns in accordance with manufacturer’s instructions, desalted with PD-10 columns (GE Healthcare) into a buffer containing 20 mM sodium phosphate (pH 7.4), 100 mM NaCl and 10 °/o glycerol and finally concentrated to about 200 uL using Vivaspin0.5 concentrator with 50 kDa cutoff (Sartorius AG).

For large-scale production, P. pastoris X-33 harboring pPICZd with mutated genes were grown in a 5 L Sartorius Biostat Aplus fermentor as bed previously [13]. The 6xHis- tagged protein was ed by Cu2+ affinity column chromatography using a CIM® IDA-8f m| Tube Monolithic Column (BIA Separations GmbH, h, Austria) as described previously [14]. Protein concentrations were determined using the BCA protein assay (Thermo scientific) with bovine serum n as standard. e 2 Methods for measuring the trans-sialidase and sialidase enzymatic activity 2.1 Trans-sialidase activity assay Trans-sialidase activity was d as described previously [17] but with the following modifications. Reactions were performed in 50 mM phosphate-citrate (pH 6) at 30 °C using 2.9 pg/mL enzyme. The assay employed 1 mM cGMP-bound sialic acid as donor substrate and MU-Gal as the acceptor. MU-Gal at 0.5 mM was the highest final concentration to be tested due to its low solubility in aqueous solution. A solution of 87 mM MU-Gal in DMSO was diluted to 2 mM in 50 mM ate-citrate buffer (pH 6) immediately before preparing the reactions. When assaying crude enzyme preparations from P. pastoris, a background signal was observed, and attributed to cleavage of MU-Gal by nous B-galactosidase.

This background signal could be removed by washing the column eight times with 440 uL of mM HCI after sample application without desorption of the sia|y|ated product and this was therefore done routinely. 2.2 Sialidase activity assays ase activity was measured in a reaction containing 50 mM phosphate-citrate buffer (pH 7), 0.75 mM pNP-NeuAc and 3 ug/mL ase . Reactions were initiated by addition WO 67112 of substrate and followed spectrophotometrically at 410 nm at 30 °C. pH 7 was chosen to enable detection of released pNP in a continuous assay. Reaction rates were ized as 0/0 of the activity of the Tr6 parent enzyme. For measurement of hydrolysis of natural substrates, the assay was med with either 1 mM 3’-sialyllactose, 1 mM 6’-sialyllactose or 1 mM cGMP-bound sialic acid in 50 mM phosphate-citrate buffer (pH 5) using 1 ug/mL enzyme. ons were started by addition of enzyme and stopped by adding H2804 to 45 mM final concentration. Quantification of free sialic acid was performed using a 2- thiobarbituric acid assay [15] with the modification that butanol extraction was substituted with mixing with dimethyl sulfoxide (DMSO) [16].

Example 3 A positively-charged motif on the border of the binding cleft of sialidase quenches its hydrolytic activity 3.1 Selection of candidate residues in Tr6 ase for on screening The catalytic domains of the ases were identified using NCBI Conserved Domain Search [10]. Pymol v1.3 (Schrodinger) was used to identify amino acids within 14 A of the sialic acid binding site. The T. range/i sialidase mutant Tr6 (see below) and trans-sialidases from T. cruzi (TcTS) (Uniprot ID Q26966), Trypanosoma congo/ense (Uniprot ID GOWJG3) and Trypanosoma brucei (Uniprot ID Q57XJ2) were aligned using ClustalW [11] (figure 2).

Ranking of chemical difference between substituted amino acids in Tr6 vs. TcTS was done based on being first- or second sphere relative to the substrate and based on the polar/nonpolar and small/large distinction; such property-based selection turned out to correlate well with standard substitution matrices (BLOSUM62), i.e. the most unlikely substitutions were considered noteworthy. A 3D-model of one mutant, Tr13, was made using HHpred [12] with automatic template selection (1ms9_A) (Figure 3). The Tyr120 side chain conformation was manually changed to resemble that of the solved structure (PDB 1WCS). A comparison of the amino acid sequence of T. cruzi trans-sialidase (TcTS) and T. range/i ase (TrSA), in particular those residues lying within 14 A of the sialic acid g site, reveal a large number of candidate amino acid residues whose substitution might account for the ’s trans-sialidase activity. The ate amino acids were evaluated in terms of their impact on degree of surface exposure, en bonding, extent of change in chemical structure/properties, and their distance from the acceptor binding site. On this basis, the single es or a combination of residues depicted in the primary sequence of the catalytic domain shown in figure 2 were selected for mutagenesis. 3.2 Measurement of net trans-sialylated product yield by Tr6 ase mutants To assess the performance of the mutant enzymes, they were produced by recombinant expression in P. is, transformed with the respective mutant gene, by growth in shake flask cultures. The trans-sialidase activity of the sed mutant enzymes was measured with a fluorescence-based assay using cGMP as sialic acid donor and methylumbelliferyl-B- ctopyranoside (MU-Gal) as or (Figure 4). As the detected product is a measure of both the trans-sialidase activity ct formation) and ase activity (product degradation) the assay provides an effective screen for s having a higher trans- sialidase to hydro|ase activity ratio. 3.3 Selected Tr6 ase mutants catalyze a net increase in trans-sialydated product yield All the Tr6 sialidase mutants were shown to be active enzymes (Figure 4). Reversion of two of the mutations (P98A and Y249G) originally introduced in the Tr6 parent sialidase, led to a reduction in trans-sialidase activity over the Tr6 parent. This confirms that these two residues in Tr6 (P98 and Y249) contribute to trans-sialidase activity of this enzyme. Of all mutants tested, only two mutants, namely Tr13 (comprising a VTNKKKQ motif) and Tr6 D363E enhanced trans-sialidase activity relative to Tr6, while all other mutants displayed a decreased trans-sialidase activity. When the Tr6 parent sialidase was mutated by a single amino acid substitution to create a +1 net charge for residues 197-303 (IADMKGR) this led to a significant loss of activity, compared to the Tr6 parent. The net +3 charge of the corresponding motif in the Tr13 mutant thus appears to provide a significant and unexpected improvement in trans-sialidase activity relative to Tr6. The parent enzyme Tr6 and the two s Tr13 and Tr6 D363E were produced in a 5 L fermentor and purified in amounts sufficient to characterize their catalytic properties. Hydrolase activity was ed using the cial substrate para-nitrophenyl neuraminic acid (pNP-Neu5Ac) as well as the l ates 3’-sialyllactose, 6’-sialyllactose and cGMP. The a-2,6-linked sialic acid constitutes about 50 0/0 of total sialic acid content in cGMP [21]. Since none of the enzymes exhibited detectable activity on 6’-sialyllactose (data not shown), it was unlikely that a-2,6-linked sialic acid in cGMP can be used as a donor.

Tr13 showed greatly reduced hydro|ase activity for all 3 substrates, while D363E only showed reduced hydro|ase activity on pNP-Neu5Ac (Figure 5A).

In the trans-sialidase activity time course assay, the initially ed product formation represents the trans-sialidase reaction rate, while maximum product formation is a measure of both trans-sialidase ty (product formation) and hydro|ase activity ct degradation). While, Tr6 and Tr13 appeared to have similar trans-sialidase activity, Tr13 gave twice the trans-sialylated product yield, under these reaction conditions (Figure SB), confirming the reduced hydrolytic activity of this Tr13 mutant trans-sialidase. By contrast, the Tr6 D363E had a similarly low product formation profile as Tr6, consistent with their similar hydrolytic activity using cGMP as donor (Figure 5A).

The Tr13 mutant, comprising a VTNKKKQ motif, introduces three lysine residues, where K200 and K201 are partly shielded from the active site (Figure 3) while K202 points towards the center of the active site. uction of the single mutation 6202K, which is part of the VTNKKKQ motif, does not confer the same properties since this mutant exhibited reduced trans-sialidase activity compared to the parent. The ed maximal yield obtained with the Tr13 mutant suggests that the VTNKKKQ motif does not affect acceptor binding affinity but rather uniquely reduces the hydrolytic ty (water kcat and/or KM).

The mechanism by which the VTNKKKQ motif exerts its effect is hypothesized to involve impairing water nucleophilicity for attack on sialic acid (by partial disruption of the water network) and by reducing water’s retention time in the active site in competition with the acceptor. The effect may be acceptor-dependent, as the total extend of hydrolysis not only depends on the impaired water network but also the KM of the or during trans- sialylation, which s acceptor vs. water ion time and thus, the competition between ysis and sialylation.

Thus the Tr13 mutant trans-sialidase ents a major advance in engineering a hydrolysis-impaired sialidase enzyme. The insertion of the VTNKKKQ motif is sufficient to confer low hydrolase activity, ching the very low levels of hydrolase activity characteristic of TcTS to a sialidase enzyme. TcTS is distinguished by both an exceptionally low hydrolase ty and the higher affinity for e in TcTS compared to Tr6. Within protein engineering at large, viable mutants with improved properties that e so substantially from a wild type (by 13 site changes including a 7 amino acid loop structure with a +3 charge difference) are unusual (if not unprecedented).

Example 4 Optimal reaction ions and specific activity of Tr13 mutant trans- sialidase catalyzed trans-sialylation 4.1 Optimized ons conditions for Tr13 mutant trans-sialidase Optimal reaction conditions (pH, temperature, and concentration of donor and acceptor) were determined employing a quadratic central composite design. MODDE Version 7.0.0.1 (Umetrics AB, Umea, Sweden) was used as a tool to design the experimental frame and to fit and analyze the data by multiple linear regression analysis. The pH regimes 3, 4 and 5, the incubation temperatures 20, 40 and 60 °C and the concentrations of the acceptor lactose of 117, 234 and 351 mM were tested. Reactions used a fixed concentration of cGMP- bound sialic acid of 8 mM in 15 mM phosphate-citrate buffer with specified pH values using ug/mL Tr13. Lactose and cGMP were solubilized in buffer and pre-incubated at specific temperatures, before the reactions were initiated by addition of enzyme. The biocatalysis process was allowed to proceed for 20 min before the reaction was stopped by heating for min at 90 oC. Concentration of sialyllactose was ined by HPAEC, as described in 4.2.

The best reaction ions were identified at 351 mM lactose (highest tested), pH 3 (lowest ) and at 20 0C (lowest tested) using 8mM cGMP (data not shown). 4.2 Quantification of sialyllactose Sialyllactose was quantified by High-performance anion exchange chromatography (HPAEC- PAD) using a Dionex BioLC system consisting of GS50 gradient pumps, ED50 electrochemical detector, AS50 chromatography compartment coupled to an AS50 autosampler (Dionex Corp., Sunnyvale, CA). Samples (10 uL) were injected on a CarboPacTM PA1 (4 mm X 250 mm) analytical column (Dionex Corp., Sunnyvale, CA) at a flow rate of 1 mL/min. The elution program was based on the method described in [18] except for the modifications in the eluent system given below. The eluent system comprised of deionised water (A), 0.5 M NaOH (B), 1 M NaOAc (C). For the first 3 min an isocratic elution of 80: 20 (% A:B) was applied, which was followed by a linear gradient from 80:20 (% A:B) to 20 (% A:B:C) from 3 to 27 min. Strongly ed anions were removed from the column by isocratic elution at 40:20:40 (% A:B:C) from 27 to 31 min. Subsequently the column was re-equilibrated for 7 min with 80:20 (%A:B). 4.3 Specific activity of Tr13 mutant sia/idase catalyzed trans-sialylation A time study was performed at these conditions and the specific trans-sialidase activity of the enzyme was determined (Figure 6). The reaction was followed by sampling in a 100 min period and concentration of sialyllactose was determined by LC/MS as bed in Example . The samples at t=0min were made using nactivated enzyme. Three replicates were made and each data series fitted to a second order polynomial function. The slope to t=0min for each series was used to calculate the ic activity and the standard deviation.

The specific trans-sialidase ty measured as number of sialyl-moieties transferred of Tr13 was 4.4 +/-0.7 nmol*min'1 per ug of enzyme on cGMP. It was apparent that a higher t yield could be obtained by extending the on time from 20 up to 100 s with no detectable product degradation, since no free sialic acid was detected by LC/MS. A maximum yield (not determined) of at least about 2.5 mM 3’-sialyllactose is predicted by extrapolation. In cGMP, sialic acid is bound as a-2,3- sialic acid and a-2,6-bound sialic acid in a ratio of about 1:1 [21] and hence only 4 of the 8 mM cGMP-bound sialic acid was theoretically accessible giving a yield of about 63 °/o.

Example 5 Tr13 catalyzed production and purification of sialylated glycans WO 67112 The ability of Tr13 to trans-sialylate different glycan acceptor molecules (GOS, IMO, lactulose, melibiose, e, and fucose ) was tested as s. The reactions were carried out in stirred glass bottles in reaction volumes of 50 mL for melibiose and maltose, 88 mL for fucose, 100 mL for lactulose, and 250 mL for G08 and IMO. The on was performed in 15 mM phosphate-citrate buffer (pH 3) with 351 mM sialic acid acceptor (GOS, IMO, lactulose, melibiose, maltose and ) and 8 mM cGMP-bound sialic acid at 25 0C using pg/mL enzyme. Prior to the reaction, the substrates were pre-incubated in the buffer.

The reaction was carried out for 20 s and then stopped by enzyme inactivation by heating at 90°C for 10 minutes. 5.1 Separation of trans-sialylation products The reaction mixture was then applied to a HiScale 50/20 (GE Healthcare) anion exchange tography column packed with 402 mL of Sepharose Q FF. The separation was done at ambient temperature with an AKTA purifier 100 work station ed with a P-900 pump, UV-900 monitor, and Frac-950 fraction collector, all lled by UNICORN software (GE Healthcare). The elution was performed at a flow rate of 70 mL/min and monitored at 210 nm. Before injection, the column was equilibrated with 5 column volumes (CV) of water. After injection the column was washed with 3 CV of water which elutes neutral, unreacted acceptor molecules. Negatively charged nds, i.e. ated products and afterwards free sialic acid, and then eluted with 3.5 CV of 40 mM ammonium formate. The column is then flushed clean with 2 CV of 400 mM ammonium formate, and then regenerated with 3 CV of water. Fractions of interest were collected automatically. The products were lyophilized and ammonium formate was removed by repeated solubilization and lyophilization. Product ures were determined by LC/MS, as described below.

According to LC/MS analysis, the anion exchange step completely separated the sialylated compounds from both sialic acid, and from the acceptor used in the reaction (see Figure 7). .2 Identification of trans-sialylation products by capillary Liquid Chromatography/Mass spectrometry (LC/MS) LC/MS analyses were performed on an Agilent 1100 lent 6340 ion trap MS system was used. Oligosaccharides were separated using a Hypercarb porous graphitic carbon (PGC) column (0.32 x 150 mm, 5pm, Thermo scientific) at 30°C. Samples (0.5 uL) were loaded onto the column in 10 mM ammonium onate. Gradient elution was achieved using a binary solvent system consisting of (A) 10 mM ammonium bicarbonate, adjusted to pH 8.5 with ammonium hydroxide, and (B) 100% acetonitrile at a flow rate of 5 uL/min.

The gradient was initially at 98:2 (% A:B) for 5 min, followed by a linear se to 42:58 (% A:B) at 33 min. This concentration of B was held for 3 min. Subsequently the eluent was returned to 98:2 (% A:B) at 40 min and the system was allowed to equilibrate for 10 min prior to the next injection. All solvents used were of the t HPLC grade. A PEEKTM Tubing (30 cm x 65 um ID, IDEX Health & Science) was used as transfer line to the electrospray ion source of the MS system. The mass spectrometry was performed in negative ion mode, and was scanned in the range m/z 150-2200 (2 microscans, maximum accumulation time of 150 ms, an ion current count of 200,000) followed by data-dependent M82 scans of the four most abundant ions in each MSl scan.

All glycan substrates were shown to the trans-sialylated by Tr13 (Figure 7). The composition of G08 and IMO sialylation products generated by Tr13 was complex (Table 2).

Four and five different sialylated compounds, respectively, were ed. In the case of GOS, the product of the lowest molecular weight was sialyllactose (m/z of 632), whereas incubation of IMO with cGMP led also to production of sialylated glucose (m/z of 470), since the starting material was abundant in that monomer.

Table 2. Products of sialylation of various glycans analysed by LC/MS.

Acceptor m/z Product t yield conc.

GOS SA-(1-Gal- 1 ,-4 [3-Glc -044% SA---,---,-01Ga114BGa114BGlc --ND SA---,---,---,--01Gal14BGall4BGall4BGlc SA-(x-Gal- 1 ,4-B-Gal- 1 ,4-B-Gal- 1 ,4-B-Ga1— 1,4-B-Glc Fucose 454 SA-(x-Fuc w1.17% 14 ose 632 Gal-l,6Glc 0.52% 0 98 Lactulose 632 SA-a-Gal-1,4-B-Fru 0.97% 1 84 Maltose 632 SA-(x-Glc-l,4Glc w0.55% 1 IMO 470 SA-oc-Glc 0.60% ND 794 SA-(x-Glc-(x-Glc-(x-Glc -- SAGlc---01Glc- 01-GlcGlc -- 1118 SAWdGlcaGlcaGlcaGlcaGlc -- Yields are given as product concentration and as % (w/w) of product produced from acceptor used.

ND; the molar concentration of sia|y|ated GOS and IMO could not be calculated since the distribution of different chain lengths was not ined.

Of the compounds produced, sialyllactulose was produced in the highest molar yield.

Galactose and the 1,4-[3 bond between galactose and fructose in lactulose may be a structure that is particularly accessible to the active site cleft of Tr13. Although the acceptors, ose (1,6-0i-bound galactose) and maltose t -bound glucose) are of similar size, their sia|y|ation yield was more than 40 0/0 lower. e 6 Prebiotic effect of various sia|y|ated glycans 6.1 Methods for measuring bacterial growth on sialylated glycans Bacterial growth assays on sia|y|ated glycans were performed with the following strains: Bifidobacterium longum longum (Danisco Global Culture Collection DGCC 232), Bifidobacterium longum infantis (DGCC 233), Bifidobacterium longum infantis (DGCC 1497), Bifidobacterium longum infantis (DGCC 2238), Lactobaci/lus acidophilus (NCFM, ATCC 700396), Bifidobacterium longum (Bl-05, DGCC 9917), Bifidobacterium lactis , DGCC2013), and idium perfringens (ATCC 13124). The tested sia|y|ated substrates were dissolved in water at 10% (w/v) and sterilized by sterile filtration (0.2 pm Minisart, Sartorius AG, Gottingen, y). Galactan from potato (Megazyme International LTD, Bray, Co. Wicklow, Ireland), used as prebiotic standard control, was sterilised by UV- radiation for 30 seconds, clue to its high viscosity. The bacterial strains were precultured in MRS-medium (de Man, Rogosa and Sharpe medium without e) with no additional sugars added, for 24 h at 37 0C under anaerobic conditions, before being diluted with fresh MRS-medium to 1 % (v/v). Growth on test substrates was performed by adding 20 uL of 10 0/0 test substrates solutions and 180 uL 1 0/0 cell suspension in multi-well plates and growth was followed by ement of optical density at 600 nm (OD600) using Biolink® software (Labsystems) in a een® C system (Labsystems, Helsinki, Finland) as described previously [19]. The growth in MRS-medium without addition of ydrates was used as control. The ments were performed in three replicates for each strain and carbohydrate substrate and growth was determined as the area under the growth curve.

Data are given as mean values 1 standard error.

To assess the impact of sia|y|ation it would have been nt to compare bacterial growth on ated and unsialylated acceptor molecules. Since the distribution of sia|y|ated molecules of different chain length in case of GOS and IMO was not quantified, galactan from potato was used as a l, clue to its confirmed prebiotic properties [26]. 6.2 The effect of Tr13 trans-sialyated glycans on bacterial growth All the B. longum subsp. infantis strains tested contain a sialidase (a prerequisite for utilising the sialylated compounds) as well as C. perfringens that contains the necessary enzymes for metabolising sia|ic acid [27]. Although variations in growth were seen on the different substrates, even within species, it was evident that most bacteria to some extent were able to grow on the sialylated compounds.

As shown in Table 3, ated melibiose and maltose did not appear to promote growth of the group of probiotic s. Growth of B. infantis 233, B. infantis 1497, and B. longum 232, was ed to various degrees by different sialylated compounds, while sialylated fucose promoted growth of all three. r, none of the sialylated compounds promoted growth of B. is 2238, B. lactis, L. acidophi/us, and B. longum 9917, while L. acidophi/us grew well on the prebiotic control substrate galactan. C. perfringens grew icantly better than all the probiotic strains on the tested ated compounds. Mixed cultures are more likely to reveal a selective growth effect of ated on probiotic bacteria.

Table 3. Bacterial growth on sialylated glycans.

Bacterial strain Area under the growth curve [OD600 X min]* B. infantis 233 :1 —: 20 B. infantis 2238 294 __ 68 274 : —: 20 158 : B. is 1497 0 2 B. longum 232 _:20 122 : B. lactis 176: —: 18 102: L. acidophilus _: 2 193 : B. longum 9917 30 14 101: C. perfringens 32 : 17 844 : *Area under the growth curve of probiotic strains and pathogenic Clostridium perfringens grown on sialylated glycans; galactan was used as a control; growth responses for the substrates are shown for a substrate concentration of 10 g/L for all bacterial strains. Data are given as average values of 3 replicates and shown 1 s.d. The growth of B. longum infantis 1497, B. lactis and C. perfringens was not tested on sialylmelibiose, nor was growth of B. longum infantis 1497 on sialylmaltose (ND).

Recently, three fucosylated HMOs were shown to stimulate bifidobacteria, while E. coli and C. perfringens were unable to utilise the HMOs [28], and the organic acid fermentation products ted their growth. rmore, a primary functionality of sialylated HMOs is rather attributed to their role as decoy molecules and in modulation of the immune system.

References 1. Chen X, Varki A (2010) Advances in the biology and chemistry of sialic acids. ACS Chem Biol 5: 163-176. 2. Singh S, Scigelova M, Hallberg ML, Howarth OW, Schenkman S, et al. (2000) sis of sialyloligosaccharides using the trans-sialidase from Trypanosoma cruzi: novel ed and di-sialylated products from digalactoside acceptors. Chem Commun 1013—1014. 3. Pereira ME, Zhang K, Gong Y, Herrera EM, Ming M (1996) Invasive ype of Trypanosoma cruzi restricted to a population expressing trans-sialidase. Infect Immun 64: 3884-3892. 4. Paris G, Ratier L, Amaya MF, Nguyen T, Alzari PM, et al. (2005) A Sialidase Mutant Displaying trans-Sialidase Activity. J Mol Biol 345: 923—934.

. Amaya MF, Watts AG, Damager I, Wehenkel A, Nguyen T, et al. (2004) Structural insights into the catalytic mechanism of Trypanosoma cruzi trans-sialidase. Structure 12: 775-784. 6. r I, Buchini S, Amaya MF, Buschiazzo A, Alzari P, et al. (2008) Kinetic and mechanistic analysis of Trypanosoma cruzi trans-sialidase s a classical ping-pong mechanism with acid/base catalysis. Biochemistry 47: 3507-3512. 7. Buschiazzo A, Amaya MF, Cremona ML, Frasch AC, Alzari PM (2002) The crystal structure and mode of action of trans-sialidase, a key enzyme in Trypanosoma cruzi pathogenesis.

Mol Cell 10: 757-768. 8. Buschiazzo A, Tavares GA, ella O, Spinelli S, Cremona ML, et al. (2000) Structural basis of sialyltransferase activity in osomal sialidases. EMBO J 19: 16-24. 9. Paris G, Cremona ML, Amaya MF, Buschiazzo A, Giambiagi S, et al. (2001) Probing molecular function of trypanosomal sialidases: single point mutations can change ate specificity and increase hydrolytic activity. Glycobiology 11: 305-311.

. Marchler-Bauer A, Lu S, on JB, Chitsaz F, Derbyshire MK, et al. (2011) CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res 39: D225—D229. 11. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) ClustalW and ClustalX version 2. ormatics 23: 2947-2948. 12. S6ding J, Biegert A, Lupas AN (2005) The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res 33: W244-W248. 13. Michalak M, Thomassen LV, Roytio H, Ouwehand AC, Meyer AS, et al. (2012) Expression and characterization of an endo-1,4-[3-galactanase from Emericella nidulans in Pichia is for enzymatic design of potentially prebiotic oligosaccharides from potato galactans.

Enzyme Microbl Technol 50: 121-129. 14. Silva IR, Larsen DM, Meyer AS, Mikkelsen JD (2011) Identification, expression, and characterization of a novel bacterial RGI Lyase enzyme for the production of bio-functional fibers. Enzyme Microb Technol 49: 160-166. 15. Denny PC, Denny PA, Allerton SE (1983) Determination of sialic acid using 2- thiobarbituric acid in the absence of hazardous sodium arsenite. Clin Chim Acta 131: 333- 336. 16. Skoza L, Mohos S (1976) Stable thiobarbituric acid chromophore with yl sulphoxide. Application to sialic acid assay in analytical de-O-acetylation. Biochem J 159: 457-462. 17. er S, Tiralongo E, Paris G, Yoshino T, Schauer R (2003) A nonradioactive 96-well plate assay for screening of trans-sialidase activity. Anal Biochem 322: 139—147. 18. Kunz C, Rudloff S, Hintelmann A, tz G, Egge H (1996) High-pH exchange chromatography with pulsed amperometric detection and molar response factors of human milk oligosaccharides. J Chromatogr B 685: 211-221. 19. Makelainen H, Saarinen M, Stowell J, Rautonen N, Ouwehand AC (2010) Xylo- oligosaccharides and lactitol promote the growth of Bifidobacterium lactis and acillus species in pure cultures. Benefic Microb 1: 139-48.

. Henikoff S, Henikoff JG (1992) Amino acid substitution matrices from protein blocks.

Proc Natl Acad Sci U S A 89:10915-10919. 21. Saito T, Itoh T (1992) Variations and distributions of O-glycosidically linked sugar chains in bovine K-casein. J Diary Sci 75: 1768-1774. 22. Scudder P, Doom JP, Chuenkova M, Manger ID, a MEA (1993) Enzymatic Characterization of lactoside 02,3-trans-Sialidase from Trypanosoma cruzi. J Biol Chem 268: 891. 23. Ribeirao M, a-Chioccola VL, Eichinger D, Rodrigues MM, Schenkman S (1997) Temperature differences for trans-glycosylation and hydrolysis on reveal an acceptor binding site in the tic ism of Trypanosoma cruzi trans-sialidase. iology 7: 1237-1246. 24. Schenkman S, Jiang MS, Hart GW, Nussenzweig V (1991) A novel cell surface trans- sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65: 1117-1125. . t D, Sauerbrei B, Thiem J (2000) Chemoenzymatic Synthesis of Sialyl Oligosaccharides with Sialidases Employing Transglycosylation Methodology. J Org Chem 65: 8518-8526. 26. Onumpai C, Kolida S, Bonnin E, Rastall RA (2011) Microbial ation and selectivity of pectin fractions with various structures. Appl Environ iol 77: 5747-5754. 27. Walters DM, Stirewalt VL, Melville SB (1999) Cloning, Sequence, and Transcriptional Regulation of the Operon Encoding a Putative N-AcetylmannosaminePhosphate Epimerase (nanE) and Sialic Acid Lyase (nanA) in Clostridium perfringens. J iol 181: 4526—4532. 28. Yu ZT, Chen C, Kling DE, Liu B, McCoy JM, et al. (2013) The Principal Fucosylated Oligosaccharides of Human Milk Exhibit Prebiotic Properties on Cultured Infant Microbiota.

Glycobiology 23: 169-177. 29. Gaskell A, Crennell S, Taylor G. (1995) The three s of a bacterial sialidase: a beta-propeller, an immunoglobulin module and a galactose-binding jelly-roll. Structure 3:1197-1205.

. Lamsal BP (2012) Production, health aspects and potential food uses of dairy prebiotic galactooligosaccharides. J Sci Food Agric 92: 2020-2028. 31. Smith LE, Uemura, H, Eichinger D. (1996) Isolation and expression of an open reading frame encoding sialidase from Trypansoma rangeli Molecular and mical Parasitology 79: 21-33. 32. Smith LE, Q27064 UniprotKB submitted JAN-1996 to EMBL/GenBank/DDBJ database. 33. Buschiazzo A, a, ML, Campetella O, Frasch ACC and Sanchez DO. (1993) Sequence of a Trypansoma rangeli gene closely related to Trypansoma cruzi trans-sialidase.

Claims (13)

Claims

1. A mutant polypeptide having at least 80% amino acid sequence identity to amino acid residues 28 – 372 of SEQ ID NO: 2, and wherein: a. amino acid residues 197 to 203 of SEQ ID NO. 2 are substituted with amino 5 acid residues VTNKKKQ , and b. amino acid residues 37, 96, 98, 120, 249, 284 in the sequence of the mutant polypeptide have sequence ty to the corresponding residues in SEQ ID NO.2, and n the mutant polypeptide has trans-sialidase activity.

2. The mutant polypeptide of claim 1, wherein the polypeptide further comprises a C- terminal linker and carbohydrate-binding domain selected from among: a. C-terminal linker peptide and carbohydrate-binding peptide of osoma rangeli trans-sialidase sing amino acid residues 373 to 638 of SEQ ID 15 NO: 2; b. inal linker peptide and carbohydrate-binding peptide of Trypanosoma cruzi sialidase comprising SEQ ID NO. 8; c. C-terminal linker peptide and carbohydrate-binding peptide of osoma congolense trans-sialidase sing SEQ ID NO. 9; 20 d. C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma brucei trans-sialidase comprising SEQ ID NO. 10.

3. The mutant polypeptide of claims 1 or 2, having an amino acid sequence selected from amino acids residues 28 – 372; 1 – 372, 28 – 638, and 1 – 638 of SEQ ID NO: 25 4.

4. The mutant polypeptide of any one of claims 1 to 3, wherein the polypeptide is expressed as a fusion protein comprising a homologous or heterologous aminoterminal signal peptide and/or a heterologous peptide having selective substrate 30 binding ty for purification of the polypeptide.

5. A DNA molecule comprising a positive DNA strand having a c acid sequence encoding the mutant polypeptide of any one of claims 1 to 4. 35

6. A DNA molecule according to claim 5, wherein the nucleotide sequence is selected from among: a. a nucleotide sequence encoding amino acid residues 28 – 372 of SEQ ID NO. b. a nucleotide sequence encoding amino acid residues 1 – 372 of SEQ ID NO. 4; c. a nucleotide sequence encoding amino acid residues 28 – 638 of SEQ ID NO.4 ; and d. a nucleotide ce encoding amino acid residues 1 – 638 of SEQ ID NO. 4. 5

7. A recombinant host cell comprising the DNA molecule of claims 5 or 6, wherein said cell is prokaryotic or a man eukaryotic cell, and is preferably selected from among a bacterial cell, a yeast cell and a fungal cell.

8. A method for producing the mutant ptide according to any one of claims 1 to 10 4, comprising: a. providing a recombinant host cell, wherein the cell comprises a DNA molecule, the DNA molecule comprising a nucleic acid sequence encoding the mutant polypeptide according to any one of claims 1 to 4, b. incubating the host cell in a medium suitable for expression of the mutant 15 polypeptide, and c. recovering the mutant polypeptide expressed by the host cell in step b) from the medium.

9. An enzyme composition comprising the mutant polypeptide according to any one of 20 claims 1 to 4, wherein the composition is formulated as a dry powder, a tablet, or as

10. A method for producing sialylated mono- and/or saccharides, comprising the steps of: 25 a. providing a sialic acid donor molecule and a molecule comprising an acceptor mono- and/or oligo-saccharide capable of being trans-sialylated; and b. contacting the molecules of (a) with the mutant polypeptide according to any one of claims 1 to 4 in an s medium. 30

11. The method of claim 10, wherein the donor molecule is provided in the form of a dairy side stream, a whey or a casein glycomacropeptide.

12. The method of claims 10 or 11, wherein the acceptor glycan is ed from among one or more of galacto-oligosaccharide, fructo-oligosaccharide, malto- 35 oligosaccharide, isomalto-oligosaccharide, e, lactosucrose, lactulose, lacto-N- tetraose, lacto-N-neotetraose, lacto-N-fucopentaose I, lacto-N-fucopentaose V, melibiose, e, glycosyl sucrose and fucose.

13. The method of claim 12, wherein the acceptor glycan is one or more galactooligosaccharide , the method further comprising a ing step of contacting lactose with a -trans-galactosidase to produce the one or more galactooligosaccharide.