NZ711254B2 - Talen-based gene correction - Google Patents

Abstract

The invention is directed to transcription activator-like effector nuclease (TALEN)-mediated DNA editing of a mutated COL7A1 gene in patients with Epidermolysis bullosa (EB). Epidermolysis bullosa (EB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Recessive dystrophic epidermolysis bullosa (RDEB), the most severe and classical form of the disease, is characterized by extensive blistering and scarring of the skin and mucosal membranes. sters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Recessive dystrophic epidermolysis bullosa (RDEB), the most severe and classical form of the disease, is characterized by extensive blistering and scarring of the skin and mucosal membranes.

Description

TALEN-BASED GENE TION SPECIFICATION CROSS—REFERENCE TO D APPLICATIONS This ational application claims the benefit under 35 U.S.C. §119(e) of US. Provisional Patent ation No. 61/771,735, filed March 1, 2013, the ty of which is incorporated herein.

Seguence Listing The instant application contains a sequence listing which has been submitted in ascii format and is hereby incorporated by reference in its entirety. Said ascii copy, created on February 27, 2014, is named J110020003_st25.txt and is 74,494 byte in size.

Background of the Invention Epidermolysis bullosa (BB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Recessive dystrophic epidermolysis bullosa (RDEB), the most severe and classical form of the disease, is characterized by extensive blistering and scarring of the skin and mucosal membranes. The COL7A1 mutations associated with RDEB impair the ability of collagen 7 to connect the epidermis and ; and subsequent separation of the epidermis and dermis as a result of friction or minor injury causes the severe blistering and extensive ng of the skin associated with RDEB. People with RDEB exhibit incurable, often fatal skin blistering and are at increased risk for aggressive squamous cell carcinomal. Gene augmentation ies are promising, but run the risk of ional mutagenesis. Current gene therapy tools (e. g., viral- mediated gene—addition) rely on the provision of functional copies of a therapeutic gene that integrate at random or semi-random into the . The consequences of the random integration are perturbation of the locus where the cargo lands and potential gene inactivation or dysregulation (off target effects). These can result in life threatening side effects to the patient. It is therefore described herein engineered transcription tor like effector nucleases (TALENs) for precision genome~ editing in cells of patients with, for example, RDEB, and other genetic disorders.

All references cited herein are orated by reference in their entireties.

Summary of the Invention The present invention overcomes the off target effects by providing site specific correction of the on. The correction of the mutation may be accomplished by transformation or transfection of a cell. The cell may be selected from the group consisting of a last, nocyte, inducible pluripotent stem cell, hematopoietic stem cell, mesenchymal stem cell, embryonic stem cell, hematopoietic progeny cell, T—cell, B-cell, glial cell, neural cell, neuroglial progenitor cell, neuroglial stem cell, muscle cell, lung cell, atic cell, liver cell and a cell of the reticular endothelial system One embodiment provides a method to treat a genetic disease or disorder caused by a genetic mutation comprising ting a cell with one or more nucleic acids encoding a TALEN and a nucleic acid donor sequence, wherein TALEN protein is expressed in the cell and induces a site-specific double stranded DNA break in a target gene, wherein the donor ce is a template for DNA repair resulting in a tion of the genetic mutation and provides correct gene expression, so as to treat the genetic disease or disorder. In one embodiment, the cell is a fibroblast, keratinocyte, inducible pluripotent-, hematopoietic-, mesenchymal-, or embryonic stem cell, hematopoietic progeny cell (such as a T—cell 0r B-cell), glia and neural cell, neuroglial progenitor and stem cell, muscle cell, lung cell, pancreatic and/or liver cell and/or a cell of the reticular endothelial system. The invention further provides for the use of one or more nucleic acids to treat a genetic disease or disorder caused by a genetic mutation, where said one or more nucleic acids encode a transcription activator like or nuclease (TALEN) and a nucleic acid donor ce, wherein when TALEN protein is expressed in a cell and induces a site- specific double stranded DNA break in a target gene, and wherein the donor sequence is a template for DNA repair, results in a correction of the c mutation and provides correct gene expression, so as to treat the genetic disease or disorder.

In the one embodiment, the TALEN is a left TALEN and further sing a right TALEN that cooperates with the left TALEN to make the double strand break in the target gene. In another embodiment, the nucleic acid encoding the TALEN and/or the c acid donor sequence is part of a vector or d. In one embodiment, the TALEN includes a spacer (e.g., the spacer sequence is 12 to 30 nucleotides in length).

In one embodiment, the target gene is a gene with a genetic alteration/mutation. For example, in one embodiment, the target gene is COL7A1 (one with a mutation g, for example, aberrant expression of the protein).

In one ment, the genetic disease is epidermolysis bullosa, osteogenesis imperfecta, dyskeratosis congenital, the mucopolysaccharidoses, ar dystrophy, cystic fibrosis (CFTR), fanconi anemia, the sphingolipidoses, the lipofuscinoses, adrenoleukodystrophy, Severe combined deficiency, sickle-cell anemia or thalassemia.

One embodiment provides a method to treat a genetic disease or disorder caused by a genetic mutation comprising a) introducing into a cell (i) a first nucleic acid encoding a first transcription activator-like (TAL) effector endonuclease monomer, (ii) a second nucleic acid ng a second TAL or endonuclease monomer, and (iii) and a donor sequence, wherein each of said first and second TAL effector endonuclease monomers comprises a plurality of TAL effector repeat sequences and a Fold endonuclease domain, n each of said plurality of TAL effector repeat sequences comprises a repeat-variable diresidue, n said first TAL effector endonuclease monomer comprises the ability to bind to a first half—site sequence of a target DNA within said cell and comprises the ability to cleave said target DNA when said second TAL effector endonuclease monomer is bound to a second half-site sequence of said target DNA, wherein said target DNA comprises said first half—site ce and said second half-site sequence separated by a spacer sequence, and wherein said first and second half-sites have the same nucleotide sequence or different nucleotide sequences, wherein said donor sequence comprises homology to the target at least at the 5’ and 3’s ends of the target sequence and the preselected genetic alteration and is a template for DNA repair resulting in a correction of the genetic mutation; and (b) culturing the cell under conditions in which the first and second TAL effector endonuclease monomers are expressed, so as to correct the mutation and restores correct gene expression. Each of the first and second nucleic acids may comprise a spacer (distinct from the spacer ce).

The spacer sequence may be located between the plurality of TAL or repeat sequences and the Fold clease . The spacer ce may be 12 to 30 nucleotides. In a further embodiment, the invention provides for the use of one or more nucleic acids to treat a genetic disease or disorder caused by a genetic mutation, wherein (i) a first nucleic acid encodes a first transcription activator-like (TAL) effector endonuclease monomer, (ii) a second nucleic acid encodes a second TAL effector clease monomer, and (iii) and a donor sequence, wherein each of said first and second TAL effector clease monomers comprises a plurality of TAL effector repeat sequences and a Fold endonuclease domain, wherein each of said plurality of TAL or repeat sequences comprises a repeat—variable diresidue, wherein said first TAL or endonuclease monomer comprises the ability to bind to a first half-site ce of a target DNA within said cell and comprises the y to cleave said target DNA when said second TAL effector endonuclease monomer is bound to a second half-site sequence of said target DNA, wherein said target DNA comprises said first half-site sequence and said second ite sequence separated by a spacer sequence, and wherein said first and second half-sites have the same nucleotide sequence or different nucleotide sequences, wherein said donor sequence comprises homology to the target at least at the 5’ and 3’s ends of the target sequence and the preselected genetic alteration and is a template for DNA repair resulting in a correction of the genetic mutation; and n (b) culturing the cell under conditions in which the first and second TAL effector endonuclease monomers are expressed, so as to correct the mutation and restore t gene expression.

Another embodiment provides a nucleic acid sing a donor sequence, wherein the donor sequence is a template for site specific DNA repair resulting in a correction of a genetic mutation, wherein the donor sequence comprises homology to at least the 5’ and 3’ ends of the target sequence, wherein a portion of the donor sequence comprises a repair ce to correct the target sequence for use in conjunction with a TALEN protein. In one ment, the donor ses SEQ ID NO:22. In another embodiment, the target is COL7A1 (a gene with a mutation).

In one ment, the 5’ and 3’ ends of the donor each have at least 100 bases of sequence identity to the target, In another embodiment, the nucleic acid comprises SEQ ID NO:29 or 30.

One embodiment provides the proteins coded for or expressed by the TALEN nucleic acids.

One embodiment provides a vector or plasmid comprising a donor sequence, wherein the donor sequence is a template for site specific DNA repair resulting in a WO 34412 correction of a genetic mutation, wherein the donor sequence comprises homology to at least the 5’ and 3’ ends of the target sequence, wherein a n of the donor sequence comprises a repair sequence to correct the target sequence for use in conjunction with a TALEN protein. In one embodiment, the donor comprises SEQ ID NO:22. In one embodiment, the target is COL7A1 (with a mutation). In one embodiment, the 5’ and 3’ ends of the donor each have at least 100 bases of sequence identity to the target. One embodiment provides a vector or plasmid comprising one or more of SEQ ID NOS: 22, 31, 28, 29 or 30. Another embodiment provides an isolated host cell comprising one or more of exogenous SEQ ID N05: 22, 31, 28, 29 or 30 or the proteins expressed from such sequences. Another embodiment provides a transfected cell line comprising SEQ ID NOs: 22, 31, 28, 29 or 30 or the proteins expressed from such sequences.

One embodiment provides a method to treat a genetic disease or disorder caused by a genetic mutation comprising contacting a cell with a nucleic acid encoding a TALEN, wherein the TALEN corrects the mutation and for example, restores correct gene expression, or enhances gene expression. In one embodiment, the cell is a fibroblast. In another embodiment, the TALEN is a left TALEN and further comprising a right TALEN that cooperates with the left TALEN to make a double strand cut in a DNA. In one embodiment, the nucleic acid molecule is a . In r embodiment, the nucleic acid molecule is a plasmid. In one embodiment, the TALEN includes a spacer, such as 12 to 30 tides in .

In one embodiment, the genetic disease is epidermolysis bullosa. r embodiment provides a method to treat a genetic disease or disorder caused by a genetic mutation comprising a) introducing into a cell (i) a first nucleic acid encoding a first transcription tor-like (TAL) effector endonuclease monomer, and (ii) a second nucleic acid encoding a second TAL effector clease monomer, wherein each of said first and second TAL effector endonuclease monomers ses a plurality of TAL effector repeat sequences and a FokI clease domain, wherein each of said plurality of TAL effector repeat sequences comprises a -variable di—residue, wherein said first TAL effector clease monomer comprises the ability to bind to a first half—site sequence of a target DNA within said cell and comprises the ability to cleave said target DNA when said second TAL effector endonuclease monomer is bound to a second half- site sequence of said target DNA, wherein said target DNA comprises said first half- site sequence and said second half-site sequence separated by a spacer ce, and wherein said first and second half-sites have the same nucleotide sequence or different nucleotide sequences; and (b) culturing the cell under conditions in which the first and second TAL effector endonuclease monomers are expressed, so as to correct the mutation and restores correct gene expression.

The invention provides a nucleic acid encoding a TALEN and a c acid donor sequence, wherein when the TALEN protein is expressed in a cell it induces a site-specific double stranded DNA break in a target gene, and further wherein the donor sequence is a template for DNA repair, which results in a correction of the genetic mutation and provides correct gene expression, so as to treat the genetic disease or disorder. The invention provides the nucleic acid, wherein the cell is a last, keratinocyte, inducible pluripotent-, hematopoietic—, mesenchymal—, or embryonic stem cell, hematopoietic y cell (such as a T—cell or ), glia and neural cell, neuroglial progenitor and stem cell, muscle cell, lung cell, pancreatic and/or liver cell and/or a cell of the lar elial . The invention provides the nucleic acid, wherein the TALEN is a left TALEN and further comprising a right TALEN that cooperates with the left TALEN to make the double strand break in the target gene. The right TALEN may be encoded by the nucleic acid or a second nucleic acid. The left TALEN and the right TALEN may comprise a plurality of TAL effector repeat sequences and an endonuclease domain. Each of the left and right TALENS may comprise a spacer (distinct from the spacer sequence). The spacer sequence may be located between the plurality of TAL effector repeat sequences and the endonuclease domain. The spacer sequence may be encoded by a sequence of 12 to 30 nucleotides. The invention provides the nucleic acid, wherein said c acid encoding the TALEN and/or the nucleic acid donor ce is part of a vector or plasmid. The invention es the nucleic acid, wherein the target gene is a gene with a genetic alteration/mutation. The invention es the nucleic acid, wherein the target gene is COL7A1. The 80 invention provides the nucleic acid, wherein the TALEN includes a spacer. The invention provides the nucleic acid wherein the spacer ce is 12 to 30 nucleotides in length. The invention es the nucleic acid, wherein the genetic disease is epidermolysis bullosa, osteogenesis imperfecta, dyskeratosis congenital, the mucopolysaccharidoses, ar dystrophy, cystic fibrosis (CFTR), fanconi anemia, the sphingolipidoses, the lipofuscinoses, adrenoleukodystrophy, severe combined immunodeficiency, sickle-cell anemia or thalassemia. The invention provides the nucleic acid, where in the genetic disease is epidermolysis bullosa. The invention provides at least one nucleic acid comprising (i) a first nucleic acid encoding a first transcription activator-like (TAL) effector endonuclease monomer, (ii) a second nucleic acid encoding a second TAL effector endonuclease monomer, and (iii) and a donor sequence, wherein each of said first and second TAL effector endonuclease rs comprises a plurality of TAL effector repeat sequences and a FokI clease domain, wherein each of said plurality of TAL effector repeat sequences comprises a repeat-variable diresidue, n said first TAL effector endonuclease monomer comprises the ability to bind to a first half-site sequence of a target DNA within said cell and ses the ability to cleave said target DNA when said second TAL or clease monomer is bound to a second half- site sequence of said target DNA, wherein said target DNA comprises said first half- site sequence and said second half-site sequence ted by a spacer sequence, and wherein said first and second half-sites have the same nucleotide sequence or different nucleotide sequences, wherein said donor sequence comprises homology to the target at least at the 5’ and 3’s ends of the target sequence and the ected genetic alteration and is a template for DNA repair resulting in a correction of the genetic mutation; and (b) ing the cell under conditions in which the first and second TAL effector endonuclease monomers are expressed, so as to correct the mutation and restores correct gene expression. The invention provides a protein coded for or expressed by the c acid. The invention provides a vector or d comprising the nucleic acid. The invention provides an isolated host cell comprising the nucleic acid.

The invention provides for the use of the nucleic acids, vectors, host cells, and proteins of the invention to treat a genetic e or disorder caused by a genetic mutation.

Brief Description of the Drawings Figures lA-F. TALEN targeting, nuclease architecture and modification of COL7A1 gene. (a) COL7A1 target site on chromosome 3 and TALEN array binding.

A schematic of human chromosome three and the region in exon 13 that was targeted is shown. Arrows refer to primer sets used for subsequent analyses, and the line with mottled grey box is the donor used in (f). (b) COL7A1 target site and the core constituents of the nuclease complex. The TALEN is comprised of an N— terminal deletion of 152 residues of Xanthomonas TALES, followed by the repeat domain, and a +63 C-terminal subregion fused to the catalytic domain of the FokI nuclease. (SEQ ID NO: 33; SEQ ID NO: 34) (0) Repeat Variable Diresidue (RVD) base recognition. The RVDs NN, NI, HD, and NG (that bind guanine, adenine, cytosine, and thymine, respectively) are coded to the ponding full array in lb. ((1) Sketch of TALEN-generated (lightning bolt) —stranded DNA break (DSB) and possible cellular repair isms used for break repair. (SEQ ID NO: 35; SEQ ID NO: 36). (e) Error-prone non-homologous end-joining assessment by Sanger sequencing of TALEN~treated cells. Limiting cycle PCR was performed, followed by shotgun cloning; 75 clones were ced, with 64 showing 100% alignment to the genome database and 11 exhibiting non-homologous end joining (NHEJ)-induced deletions that are represented as dashes. The TALEN left and right target sites are in bold capital letters, and the spacer sequence is in case letters.

Total bases deleted are represented at right and signified as “del” followed by numbers of bases lost. (i) Homology—directed repair (HDR). The single-stranded oligonucleotide donor (ssODN) ned 65 bp of COL?Al gene homology on the left arm and 101 bp on the right with a short, foreign sequence that serves as a unique primer site (mottled, grey box). Three primer PCR results in amplification with endogenous primer pairs (indicated with arrows labeled i. and iii.). TALEN insertion of the ODN s in a second, smaller PCR product size generated by primer pairs ii. and iii. The number at the bottom of the treated cells indicates the rate of HDR ined by densitometry. (SEQ ID NOS: 37 to (SEQ ID NO: 48).

Figure 2. TALEN modification of COL7AI gene assessed by Surveyor nuclease assay. NHEJ ment by Surveyor nuclease in RDEB fibroblasts.

Limiting cycle PCR of a ~350 bp fragment was performed followed by Surveyor mismatch assay. TALEN induced NHEJ is evidenced by the predictable banding pattern of ~200 and 300 bp (arrows). At right is the unmodified COL7A1 locus in control cells.

Figures 3A-C. TALEN COL7A1 donor design and homology-directed repair. 2014/019322 (a) COL7A1 locus with mutation indicated by asterisk. Below is the donor, in alignment to its relation with the endogenous locus that is sed of COL7A1 genomic sequences of a left arm 706 bp long and 100% gous to the c locus. In between the left and right arms, designed so that it would be knocked into the intron between exons 12 and 13, is a floxed PGK puromycin cassette (box, loxp sites indicated by flanking arrows). The right arm was 806 bp long and contained 5 base changes. Four of these were silent point mutation polymorphisms (SPMPs) (referred to as upstream and downstream) that served as s for identification of HDR—based events; the last was the normalized base that corrects the premature termination codon. The box represents three of the SPMPs that were d within bp of one another. The normal (i.e., on reversion) base is denoted by the box and the terminal tream) SPMP that removes an ApaI restriction enzyme site is represented by a black box. Lightning bolt indicates the TALEN target site and the PCR primers (black arrows), ed so one was in the donor arm and the other outside it; utilized for analyses as shown. (SEQ ID NO: 49). SPMP detection in RDEB fibroblasts. TALEN treatment and PCR amplification followed by digestion with ApaI and Sanger sequencing shows the (b) presence of the Apal— resistant SPMP that is derived from the donor and can only be t following TALEN cutting and homology—directed repair using the exogenous donor as the template, (SEQ ID NO: 50) (c) the fied base (Apal sensitive) showing that a heterozygous HDR event occurred (SEQ ID NO: 51).

Figure 4A—B. Cre inase excision of PGK—puromycin. (a) Sketch of donor with floxed PGK puromycin. Introduction of a Cre-recombinase plasmid into puromycin resistant fibroblasts resulted in removal of the puromycin transgene. (b) Genomic loxp/COL7A1 junction. PCR was used to demonstrate the presence 'of a loxP footprint (triangle/sequence below) in the intron between exons 12 and 13 in the RDEB TALEN/donor treated cells. (SEQ ID NO: 52).

Figure 5A-D. Early crossover event sequence analysis. (a) key for marker sequences introduced into the donor. Arrow=upstream SPMPs, 1ine=the 1837 base 3O causative for RDEB, arrow=downstream SPMPs. (SEQ ID NO: 53). Upstream crossover event. Sanger sequencing showing the incorporation of the upstream SPMPs (b) the maintenance of the mutation at base 1837 (SEQ ID NO: 54; (SEQ ID NO: 55) (c) and the absence of the downstream SPMP (SEQ ID NO: 56; (SEQ ID NO: 57) ((1) indicating that HDR occurred from the donor but failed to correct the mutation. Legend has been fixed to include D (SEQ ID NO: 58; (SEQ ID NO: 59).

Figure 6A-D. Sketch of putative early cross over event. (a) TALEN arrays are shown binding to the target sequence and the donor is shown below. (b) binding to target site and TALEN dimerization mediate a double stranded DNA break (lightning) and stimulation of HDR using the donor as the repair template. (0) Theoretical cross-over events. Alignment of the endogenous DNA and the donor results in a cross over event (Cross Over #1) where c al is exchanged in a manner where the upstream SPMPs (box) are incorporated while the second crossover (arrow/Cross Over #2) event happens upstream of the corrective base and downstream SPMP. ((1) Resolved genomic sequence ning partial donor sequences (lines and box) with maintenance of the mutated base (box).

Figure 7A-C. Schematic of HDR and normal mRNA tion. (a) Mutated endogenous COL7A1 locus with TALEN target site indicated by lightning.

Mutated base is shown and underneath is the donor that results in the (b) repair of the locus with ent presence of donor-derived sequences from exon 12 through the intron between exons 15 and 16. (c) mRNA analysis. The indicated primers amplified a product that contains the corrective base (box and the Apal SPMP black box) in the same amplicon.

Figure 8A. Sequence analysis of TALEN cutting of donor. (SEQ ID NO: 60). (a) cDNA from TALEN treated RDEB fibroblasts was analyzed by direct Sanger sequencing. The TALEN site is ed in a red box (note that it is a l TALEN sequence as the remainder of the site is within the adjacent intron. Arrow shows an exon/exon boundary). The RDEB mutation is underlined and showed a reversion to the wild type status (mutant=T, normal=C). The downstream Apal SPMP is present and shown. Sequence ent is of the cDNA sequence expected to be encoded by the donor on top and the recovered sequence on the bottom. The dashes/gaps show the deletions likely due to post~HDR TALEN cutting that d subsequent NHEJ (non-homologous end joining). (SEQ ID NO:61; SEQ ID NO: 62).

Figures 9A-F. TALEN-mediated gene g of COL7A1 with HDR and resultant ized gene and n expression. (a) TALEN-corrected cells with conversion of the mutation to wild—type status, (SEQ ID NO: 64) and (b) restoration of collagen type VII production assessed by immunofluorescence. (c) Homozygous RDEB premature termination codon cDNA sequencing, (SEQ ID NO: 65) and (d) absence of type VII collagen protein production. (e) Sanger sequencing of wild—type COL7A1 locus, (SEQ ID NO: 66) and (f) type VII collagen expression. Cells were d simultaneously and confocal microscopy exposure times and instrument setting were identical. Nuclei are stained with DAPI and show as blue.

Figure 10A-B. Sanger sequencing of mRNA from TALEN corrected fibroblasts. (a)Fibrob1ast clone 1-19 (SEQ ID NO: 67; SEQ ID NO: 68) and (b) 1- 21 showed the presence of the corrected base (line) and the downstream SPMP (arrow). (SEQ ID NO:69; SEQ ID NO: 70).

Figures llA-D. TALEN ation mapping . (a) Schematic of TALEN-induced DNA break that accepts the GFP cargo, permanently marking the genomic locus. (b) TALEN and IDLV co-expression in 293 cells resulted in stable GFP cells (flow cytometry analysis performed 6 weeks post TALEN and IDLV delivery). (c) Schema for linear amplification-mediated PCR. Blue arrow denotes the LAM PCR primer, and the dashed lines represent the products of linear amplification that were subsequently cloned and mapped to determine the TALEN- induced IDLV genomic fusion fragment. (d) (nr)LAM PCR/PCR identified integrants. LAM PCR sequence ry and genome database search revealed five sites into which the IDLV integrated. Sequences mapped to the spacer region of the COL7A1 target site and four off—target sites at somes 7, 16, 1, and 5 (none of the latter sequences were derived from a coding exon). (SEQ ID NOS: 71-75).

Figure lZA-B. Integrase ent lentivirus. (a) sketch of GFP viral cassette that was produced with a defective ase. (b) 293 IDLV GFP expression time course in the absence of TALENS over tial analyses over 9 days showing rapid loss of GFP.

Figures 13 and 14 depict constructs.

Detailed Description of the Invention The invention is directed to transcription tor-like effector nuclease (TALEN)-mediated DNA editing of disease—causing mutations in the context of the human genome and human cells to treat ts with compromised genetic disorders. This is an advance over previous gene therapy trials/tools that rely on the provision of functional copies of a therapeutic gene that integrate at random or semi- random into the genome. The consequences of the previous gene therapy methods are perturbation of the locus where the cargo lands and potential gene inactivation or dysregulation. These can result in life threatening side effects. The approach described herein maximizes safety and efficacy by employing a tailor made TALEN for, for example, the human genes that corrects the mutation spot alone while preserving the remainder of the genome in pristine condition — in other words, there is no disruption of the ing genome, thus eliminating the off targets effects associated with the existing logy (e.g., viral-mediated gene-addition). This is a novel ch and is the first personalized gene therapy with mediated transgene-free correction of disease causing mutation in cells, for example, human cells. Thus, the technology can be used in cells, such as human cells, such that a loss-of-function mutation can be seamlessly corrected with ation of normal cellular on. In other embodiments, gene expression can be enhanced.

Definitions In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same g as ly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials r or equivalent to those described herein can be used in the practice or testing of the present invention. Specific and preferred values listed below for radicals, substituents, and ranges are for illustration only; they do not exclude other defined values or other values within defined ranges for the radicals and substituents.

As used herein, the articles “a” and “an” refer to one or to more than one, i.e., to at least one, of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

The term “about,” as used herein, means approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 20%.

The term “isolated” refers to a (s), cell or cells which are not associated with one or more factors, cells or one or more cellular components that are ated with the factor(s), cell or cells in vivo.

“Cells” e cells from, or the ct” is, a vertebrate, such as a mammal, including a human. Mammals include, but are not limited to, humans, farm animals, sport animals and companion animals. Included in the term “animal” is dog, eat, fish, gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey (e. g., ape, gorilla, chimpanzee, or orangutan), rat, sheep, goat, cow and bird.

A “control” subject is a subject having the same characteristics as a test subject, such as a r type of disease, etc. The control subject may, for example, be examined at precisely or nearly the same time the test subject is being treated or examined. The control subject may also, for example, be examined at a time distant from the time at which the test subject is ed, and the results of the ation of the control subject may be recorded so that the recorded results may be compared with results obtained by examination of a test subject.

A “test” subject is a subject being treated.

A “disease” is a state of health of a subject wherein the subject cannot maintain tasis, and wherein if the disease is not rated then the subject‘s health continues to orate. In contrast, a “disorder” in a subject is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. However, the definitions of “disease” and “disorder” as described above are not meant to supersede the definitions or common usage related to specific addictive diseases or disorders.

A disease, condition, or disorder is “alleviated” if, for example, the severity of a symptom of the disease or disorder, the ncy with which such a symptom is experienced by a patient, or both, are reduced.

As used , an “effective amount” means, for example, an amount sufficient to produce a selected , such as alleviating symptoms of a disease or disorder.

The term “measuring the level of expression” or mining the level of expression” as used herein refers to, for example, any measure or assay which can be used to correlate the results of the assay with the level of expression of a gene or protein of interest. Such assays include measuring the level of mRNA, n levels, etc. and can be performed by assays such as northern and western blot analyses, binding assays, blots, etc. The level of expression can include WO 34412 rates of expression and can be measured in terms of the actual amount of an mRNA or protein present.

As used herein, the term “pharmaceutically able carrier” includes, for example, any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal ment or listed in the US Pharmacopeia for use in animals, including humans.

The term “pharmaceutically—acceptable salt” refers to, for example, salts which retain the biological effectiveness and properties of the compounds of the present invention and which are not biologically or otherwise undesirable. In many cases, the compounds of the t invention are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.

By the term “specifically binds,” as used herein, is meant, for example, a molecule which recognizes and binds a specific molecule, but does not ntially ize or bind other molecules in a .

The term “‘symptom,’’ as used herein, refers to, for example, any morbid phenomenon or ure from the normal in structure, function, or sensation, experienced by the t and indicative of disease.

As used herein, the term ing” may include prophylaxis of the specific disease, disorder, or ion, or alleviation of the symptoms ated with a specific disease, disorder or condition and/or preventing or eliminating the symptoms. A “prophylactic” treatment is, for example, a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the e. “Treating” is used interchangeably with “treatment” herein.

A “therapeutic” treatment is, for example, a ent administered to a subject who exhibits symptoms of pathology for the purpose of diminishing or eliminating those symptoms.

A “therapeutically effective amount” of a compound is, for example, that amount of compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered. 2014/019322 As used herein, “amino acids” are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding o, as indicated in the ing table: Full Name Three-Letter Code One-Letter Code Aspartic Acid Asp D Glutamic Acid Glu E Lysine Lys K Arginine Arg R Histidine His H Tyrosine Tyr Y Cysteine Cys C Asparagine Asn N Glutamine Gln Q Serine Ser S Threonine Thr T Glycine Gly G Alanine Ala A Valine Val V Leucine Leu L Isoleucine lie I Methionine Met M Proline Pro P Phenylalanine Phe F Tryptophan Trp W The expression “amino acid” as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids. “Standard amino acid” means any of the twenty standard o acids ly found in naturally occurring peptides. “Nonstandard amino acid residue” means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, “synthetic amino acid” also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as ), and substitutions. Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide’s circulating half-life without adversely ing their activity. Additionally, a disulfide e may be present or absent in the peptides of the invention. 40 The term “amino acid” is used interchangeably with “amino acid residue,” and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.

Amino acids may be classified into seven groups on the basis of the side chain R: (1) aliphatic side chains; (2) side chains containing a yl (OH) group; (3) side chains ning sulfur atoms; (4) side chains containing an acidic or amide group; (5) side chains containing a basic group; (6) side chains containing an aromatic ring; and (7) proline, an imino acid in which the side chain is fused to the amino group.

As used herein, the term “conservative amino acid substitution” is defined herein as exchanges within one of the following five groups: 1. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly; 11. Polar, negatively charged es and their amides: Asp, Asn, Glu, Gln; 111. Polar, positively charged es: His, Arg, Lys; IV. Large, tic, ar residues: Met Leu, Ile, Val, Cys V. Large, aromatic residues: Phe, Tyr, Trp As used herein, the term “nucleic acid” encompasses RNA as well as single, double'and triple stranded DNA and cDNA. Furthermore, the terms, “nucleic acid,” “DNA,” “RNA” and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, the so called “peptide nucleic acids,” which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the t invention. By “nucleic acid” is also meant any nucleic acid, r composed of deoxyribonucleosides or ribonucleosides, and whether composed of odiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, her, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramida’te, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone es, and combinations of such linkages. The term nucleic acid also ically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single—stranded polynucleotide sequence is the 5'-end; the left- hand direction of a double-stranded polynucleotide sequence is referred to as the 5'- direction. The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the “coding strand”; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as “upstream ces”; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as “downstream sequences.” Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate ns of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include s.

“Homologous” as used , refers to the subunit sequence similarity n two polymeric molecules, e.g., between two c acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules.

When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is ed by adenine, then they are homologous at that position. The homology between two ces is a direct function of the number of matching or homologous positions, e.g., if half (e. g., five positions in a polymer ten subunits in length) of the ons in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are d or homologous, the two sequences share 90% homology. By way of example, the DNA sequences 3'ATTGCC5' and 3'TATGGC share 50% homology.

As used herein, “homology” is used synonymously with “identity.” The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm. For example, a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 4-2268), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877). This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et a1. (1990, J. Mol. Biol. 215:403-410), and can be accessed, for example at the National Center for Biotechnology ation (NCBI) world wide web site.

BLAST nucleotide searches can be performed with the NBLAST m (designated “blastn” at the NCBI web site), using, for example, the ing parameters: gap penalty = 5; gap extension penalty = 2; ch penalty = 3; match reward = 1; expectation value 10.0; and word size = 11 to obtain nucleotide sequences homologous to a nucleic acid described herein. BLAST protein searches can be performed with the XBLAST program (designated “blastn” at the NCBI web site) or the NCBI “blastp” program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences gous to a protein molecule described herein. To obtain gapped alignments for ison purposes, Gapped BLAST can be utilized as described in Altschul et a1. (1997, Nucleic Acids Res. 25:3389-3402). atively, PSI-Blast or PHI-Blast can be used to perform an iterated search which s distant relationships between molecules (Id.) and relationships between molecules which share a common pattern.

When utilizing BLAST, Gapped BLAST, PSI-Blast, and ast programs, the default parameters of the respective programs (e. g., XBLAST and NBLAST) can be used.

The percent identity between two sequences can be determined using techniques r to those described above, with or without allowing gaps. In calculating percent identity, typically exact matches are d.

The terms "comprises," ”comprising," and the like can have the meaning ascribed to them in US Patent Law and can mean "includes," "including" and the like. As used herein, "including" or "includes" or the like means including, without limitation.

TALENS Transcription Activator—Like or Nucleases (TALENs) are artificial restriction enzymes generated by fusing the TAL effector DNA binding domain to a DNA cleavage domain. These reagents enable efficient, programmable, and specific DNA cleavage and represent powerful tools for genome editing in situ. Transcription activator-like effectors (TALES) can be y engineered to bind practically any DNA sequence. The term TALEN, as used herein, is broad and includes a monomeric TALEN that can cleave double stranded DNA without assistance from another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are engineered to work er to cleave DNA at the same site.

TALENS that work together may be referred to as a left—TALEN and a right-TALEN, which references the handedness of DNA. See USSN 12/965,590; USSN 13/426,991 (US 8,450,471); USSN 13/427,040 (US 8,440,431); USSN ,137 (US 8, 440,432); and USSN 13/738,381, all of which are incorporated by reference herein in their entirety.

TAL effectors are proteins secreted by Xanthomonas ia. The DNA g domain contains a highly conserved 33-34 amino acid sequence with the exception of the 12th and 13th amino acids. These two locations are highly variable (Repeat Variable Diresidue (RVD)) and show a strong ation with ic nucleotide recognition. This simple relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA binding domains by selecting a combination of repeat segments containing the appropriate RVDs.

The non-specific DNA cleavage domain from the end of the FokI endonuclease can be used to construct hybrid nucleases that are active in a yeast assay, These reagents are also active in plant cells and in animal cells. Initial TALEN studies used the wild-type FokI ge domain, but some subsequent TALEN studies also used FokI cleavage domain variants with mutations designed to improve cleavage specificity and cleavage activity. The FokI domain ons as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid 25_ residues between the TALEN DNA binding domain and the FokI cleavage domain and the number of bases between the two individual TALEN binding sites are ters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA binding domain and the Fold cleavage domain may be modified by introduction of a spacer (distinct from the spacer sequence) n the plurality of TAL effector repeat ces and the Fokl endonuclease domain. The spacer sequence may be 12 to 30 tides.

The relationship between amino acid sequence and DNA recognition of the TALEN binding domain allows for designable proteins. In this case artificial gene synthesis is problematic because of improper annealing of the repetitive sequence found in the TALE binding domain. One solution to this is to use a publicly available software program rks) to calculate oligonucleotides suitable for assembly in a two step PCR; oligonucleotide assembly followed by whole gene amplification. A number of modular assembly schemes for ting engineered TALE constructs have also been ed. Both methods offer a systematic approach to engineering DNA binding domains that is conceptually similar to the modular assembly method for generating zinc finger DNA recognition domains.

Once the TALEN genes have been assembled they are inserted into plasmids; the plasmids are then used to transfect the target cell where the gene products are expressed and enter the nucleus to access the genome. TALENs can be used to edit s by inducing double-strand breaks (DSB), which cells d to with repair mechanisms. In this manner, they can be used to correct mutations in the genome which, for example, cause disease.

Vectors and Nucleic Acids A variety of c acids may be introduced into cells to obtain sion of a gene. As used , the term nucleic acid includes DNA, RNA, and nucleic acid analogs, and nucleic acids that are double—stranded or single—stranded (i.e., a sense or an nse single strand). Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for e, stability, hybridization, or solubility of the nucleic acid. Modifications at the base moiety include deoxyuridine for deoxythymidine, and 5-methy1-2'-deoxycytidine and 5- bromo-2'-doxycytidine for deoxycytidine. cations of the sugar moiety include modification of the 2' hydroxyl of the ribose sugar to form 2'~O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone can be modified to produce lino nucleic acids, in which each base moiety is linked to a six membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained. See, Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7(3):187; and Hyrup et al. (1996). an. Med. Chem. 4:5. In addition, the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a oroamidite, or an alkyl phosphotriester backbone.

Nucleic acid sequences can be operably linked to a regulatory region such as a promoter. Regulatory regions can be from any species. As used herein, operably linked refers to positioning of a regulatory region relative to a nucleic acid sequence in such a way as to permit or tate transcription of the target nucleic acid. Any type of promoter can be operably linked to a nucleic acid ce. Examples of promoters e, without tion, tissue-specific promoters, constitutive promoters, and ers responsive or unresponsive to a particular stimulus (e.g., inducible promoters).

Additional regulatory regions that may be useful in nucleic acid constructs, include, but are not limited to, polyadenylation sequences, ation control sequences (e.g., an internal ribosome entry segment, IRES), ers, inducible elements, or introns. Such regulatory regions may not be necessary, although they may increase expression by affecting transcription, stability of the mRNA, translational efficiency, or the like. Such tory regions can be included in a nucleic acid construct as desired to obtain optimal expression of the nucleic acids in the cell(s). Sufficient expression, however, can sometimes be obtained without such onal elements.

A nucleic acid construct may be used that encodes signal peptides or selectable markers. Signal peptides can be used such that an d polypeptide is directed to a particular cellular location (e.g., the cell e). Non-limiting examples of selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase (TK), and xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in e. Other selectable markers include fluorescent polypeptides, such as green fluorescent protein or yellow fluorescent n.

Nucleic acid constructs can be introduced into cells of any type using a variety of techniques. Non-limiting examples of techniques include the use of transposon systems, recombinant viruses that can infect cells, or liposomes or other non-viral s such as electroporation, microinjection, or calcium phosphate precipitation, that are capable of delivering c acids to cells.

Nucleic acids can be incorporated into vectors. A vector is a broad term that es any specific DNA t that is designed to move from a carrier into a target DNA. A vector may be referred to as an expression vector, or a vector system, which is a set of components needed to bring about DNA insertion into a genome or other targeted DNA sequence such as an episome, plasmid, or even phage DNA segment. Vectors most often n one or more expression cassettes that se one or more expression control sequences, wherein an expression l sequence is a DNA sequence that controls and regulates the transcription and/or translation of another DNA sequence or mRNA, respectively.

Many different types of vectors are known. For example, plasmids and viral vectors, e.g., retroviral vectors, are known. Mammalian expression plasmids typically have an origin of replication, a suitable promoter and optional enhancer, and also any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non- transcribed sequences. Examples of vectors include: plasmids (which may also be a carrier of another type of vector), irus, adeno—associated virus (AAV), lentivirus (e.g., modified HIV-l, SIV or FIV), retrovirus (e.g., ASV, ALV or MoMLV), and osons (e.g., Sleeping Beauty, P-elements, Tol-2, Frog Prince, piggyBaC).

Therapeutic Uses TALEN-based gene correction has many clinical and preclinical (e.g., research) applications. For example, TALEN-based gene correction can used to correct genes in which mutations lead to disease. For example, any disease characterized by small base tions including insertions and deletions such as, but not restricted to, epidermolysis bullosa, osteogenesis ecta, dyskeratosis congenital, the mucopolysaccharidoses, muscular dystrophy, cystic fibrosis (CFTR), fanconi anemia, the sphingolipidoses, the lipofuscinoses,, adrenoleukodystrophy, severe combined immunodeficiency, sickle-cell anemia, semia, and the like.

In one embodiment, the disease is molysis Bullosa. Recessive dystrophic epidermolysis bullosa (RDEB) is characterized by a onal deficit of the type VII collagen protein due to gene defects in the type VII collagen (COL7A1) gene. This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three cal alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying . Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa.

COL7A1 is located on the short arm of human chromosome 3, in the chromosomal region denoted 3p21.31 (Ensembl No: ENSG00000114270). The gene is approximately 31,000 base pairs in size and its coding sequence is nted into 118 exons, see SEQ ID NO: 32.

COL7A1 is transcribed into an mRNA of 9,287 base pairs (Accession Nos. for human mRNA and protein are NM_000094 and NP_000085, respectively). In the skin, the type VII collagen protein is synthesized by keratinocytes and dermal fibroblasts. The symbol for the orthologous gene in the mouse is Col7a1 (Accession No for Mouse mRNA and protein are NM_00738 and NP_031764, respectively).

People with RDEB exhibit incurable, often fatal skin blistering and are at increased risk for aggressive squamous cell carcinomal. Gene tation therapies are ing, but run the risk of insertional mutagenesis. It is therefore described herein engineered transcription activator like or nucleases (TALENs) for precision genome-editing in cells of patients with RDEB. It is described herein the ability of TALENs to induce site—specific double-stranded DNA breaks (DSB) leading to gy~directed repair (HDR) from an exogenous donor te. This s resulted in COL7A1 gene mutation correction and restoration of normal gene and protein expression. This study provides proof-of-concept for personalized genomic medicine and is the first TALEN-mediated in situ correction of an endogenous human gene in fibroblasts.

Cells to be modified by TALEN-based gene correction can be obtained from the patient or from a donor. The cells can be of any type, such as fibroblast cells, keratinocytes, inducible pluripotent-, hematopoietic—, mesenchymal—, and embryonic stem cells, hematopoietic progeny cells, such as T—cells, s, glia and neurons, lial progenitor and stem cells, muscle cells, lung cells, pancreatic and liver cells and/or cells of the reticular endothelial system). Once modified by TALEN- based gene correction, the cells can be expanded and/or administered to a patient to treat the disease.

Matrices can be used to deliver cells of the present invention to specific anatomic sites, where ular growth factors may or may not be incorporated into the , or encoded on plasmids incorporated into the matrix for uptake by the cells, can be used to direct the growth of the initial cell population. d DNA encoding cytokines, growth factors, or hormones can be d within a r gene~activated matrix carrier. The radable polymer is then implanted near the site where ent is desired.

For the purposes described herein, either autologous, allogeneic or xeongenic cells of the present invention can be administered to a patient by direct injection to a preselected site, systemically, on or around the surface of an acceptable matrix, or in combination with a pharmaceutically acceptable carrier.

Additionally, nucleic acid constructs or proteins can be injected locally or systemically into a subject, with, for example, a pharmaceutically acceptable carrier.

/Expansion of Cells Cells to be d by TALEN-based gene correction can be ed from the patient or from a donor. The cells can be of any type, such as fibroblast cells.

Once modified by TALEN—based gene correction, the cells can be expanded and/or administered to a patient to treat the disease.

The cells can be cultured in culture medium that is established in the art and commercially available from the American Type Culture Collection (ATCC), Invitrogen and other companies. Such media include, but are not d to, Dulbecco’s d Eagle’s Medium (DMEM), DMEM F12 medium, Eagle’s Minimum Essential Medium, F-12K medium, Iscove’s Modified Dulbecco’s Medium, Knockout D-MEM, or RPMI-l640 medium. It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as needed for the cells used. It will also be apparent that many media are ble as low—glucose formulations, with or without sodium pyruvate.

Also contemplated is mentation of cell culture medium with mammalian sera. Sera often contain cellular factors and components that are needed for viability and expansion. Examples of sera include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), human serum, chicken serum, porcine serum, sheep serum, rabbit serum, rat serum (RS), serum replacements ding, but not limited to, KnockOut Serum Replacement (KSR, Invitrogen)), and bovine embryonic fluid. It is understood that sera can be heat-inactivated at 55—65°C if deemed needed to inactivate components of the complement cascade. Modulation of serum concentrations, or withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. In one embodiment, the cells are cultured in the presence of PBS /or serum specific for the-species cell type. For example, cells can be isolated and/or expanded with total serum (e.g., FBS) or serum replacement concentrations of about 0.5% to about 5% or greater including about 5% to about 15% or greater, such as about 20%, about 25% or about %. Concentrations of serum can be determined empirically.

Additional supplements can also be used to supply the cells with trace elements for optimal growth and expansion. Such supplements include insulin, transferrin, sodium selenium, and combinations thereof. These components can be included in a salt solution such as, but not limited to, Hanks’ Balanced Salt SolutionTM (HBSS), Earle’s Salt SolutionTM, idant supplements, MCDB-ZOlTM supplements, phosphate buffered saline (PBS), N—2—hydroxyethylpiperazine-N’— ethanesulfonic acid (HEPES), namide, ascorbic acid and/or ascorbic acid phosphate, as well as additional amino acids. Many cell culture media already contain amino acids; however some require supplementation prior to culturing cells.

Such amino acids include, but are not limited to, ine, L—arginine, L—aspartic acid, L—asparagine, L-cysteine, L-cystine, L-glutamic acid, L—glutamine, L-glycine, L-histidine, L-inositol, L—isoleucine, L—leucine, L-lysine, L-methionine, L— phenylalanine, L—proline, L-serine, L-threonine, L—tryptophan, L-tyrosine, and L— valine.

Antibiotics are also typically used in cell culture to te bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not d to, ericin (FungizoneTM), llin, icin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, xic acid, neomycin, nystatin, paromomycin, polymyxin, cin, rifampicin, spectinomycin, tetracycline, tylosin, and . es can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, 8- iol, hydrocortisone, insulin, prolactin, progesterone, somatostatin/human growth hormone (HGH), thyrotropin, thyroxine, and L—thyronine. B - mercaptoethanol can also be supplemented in cell culture media.

Lipids and lipid rs can also be used to supplement cell e media, depending on the type of cell and the fate of the differentiated cell. Such lipids and carriers can include, but are not limited to extrin (a , B , y ), cholesterol, ic acid conjugated to albumin, linoleic acid and oleic acid conjugated to n, unconjugated linoleic acid, linoleic-oleic-arachidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others.

Albumin can similarly be used in fatty-acid free formulation.

Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components and synthetic or ymers.

Cells often require additional factors that encourage their attachment to a solid support (e.g., attachment factors) such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, “superfibronectin” and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L—lysine, MatrigelTM, thrombospondin, and/or vitronectin.

Cells can be cultured at different densities, e.g., cells can be seeded or maintained in the e dish at different densities. For example, at densities, ing, but not limited to, densities of less than about 2000 cells/well of a 12-well plate (for example, 12—well flat-bottom growth area: 3.8cm2 well volume: 6.0 ml or well ID x depth (mm) 22.1x17.5; well ty (ml) 6.5, growth area (cm2) 3.8), including less than about 1500 cells/well of a 12—well plate, less than about 1,000 cells/well of a 12—well plate, less than about 500 cells/well of a 12-well plate, or less than about 200 cells/well of a l plate. The cells can also be seeded or maintained at higher densities, for example, great than about 2,000 cells/well of a 12-well plate, greater than about 2,500 cells/well of a 12-well plate, greater than about 3,000 cells/well of a 12-well plate, greater than about 3,500 cells/well of a 12— well plate, greater than about 4,000 cells/well of a l plate, greater than about 4,500 cells/well of a 12—well plate, greater than about 5,000 cells/well of a 12-well plate, greater than about 5,500 cells/well of a 12-well plate, greater than about 6,000 cells/well of a 12—well plate, greater than about 6,500 cells/well of a 12—well plate, ' greater than about 7,000 cells/well of a 12-well plate, r than about 7,500 cells/well of a 12-well plate or greater than about 8,000 cells/well of a 12—well plate.

Examples The following example is provided in order to demonstrate and further illustrate certain embodiments and aspects of the present invention and is not to be construed as limiting the scope thereof.

Example 1 Materials and Methods.

Research subject and cell line derivation.

After obtaining informed parental consent we obtained a punch biopsy from the skin of a male RDEB patient with a homozygous c.1837 C>T premature ation codon mutation. Approval for research on human subjects was ed from the University of Minnesota Institutional Review Board. A primary fibroblast cell line was derived and maintained in low oxygen concentration conditions.

TALEN and donor construction.

The TALEN candidate described in Fig. 1A was generated via the Golden Gate Assembly method and inserted into a homodimeric form of a CAGGs er driven FokI endonuclease as described [1, 2]. The left donor arm was amplified with the LAF and LAR primers shown in Table 1. The right arm was synthesized in two fragments (inner and outer) using an overlapping oligonucleotide assembly strategy as described [3, 4]. All primer sets are shown in Table l; the left and right arms were cloned into a floxed PGK puromycin cassette.

Table 1. (SEQ ID NOS: 1-21) TALEN correction for RDEB COS outer fragment 1 >12 TCACGGGTAGCCMCGCTATGTCCTGATAGCGGTCCGCTTAGGAGAGAAGCGGAGGAATC CO? C7671 ccacatccctgtctcfl COB C7APAF CWGGGACCMTGAGGGTA C09 C7672 tetagtggggagaggcaatg Ct t} RTi TCGACTTGEATGACGTTCAG (11 1 RT2 GTTCGAGCCACGA‘IGACTG C12 Surveyor F ttroagccalatcccagcic Dot or R :gctccagctaalcegaaat DDZ Oligo Duplex TOD G‘T'CCGTACGGATCCMGCTTCGTCGACCTAGCC 003 Oligo Oupiex Bottom CA‘FGCCTAGGTTCGMGCAGCTGGATCGGGG'A‘C 004 Linker F GGATCCAAGCTTCGTCGACCTAGCC 005 ssODN donor (PAGE purified) tclgcglccc igtccalcac tgccatcgtc ccacatccct gtctctttct gacccctgcccatct 905 awmvcwgrofgi ? 9i gamma!» Mash; c«meals»:armada saw-mam «terms » magma: : a DO? on target sun/ever primers DOS “(23.3 FWD TCTCAGGCAAGAAAATFGGA 009 ) REV TGTGCATTTATYCTGTGTCTTGT? D 1 0 5q33.1 FWD GAGTTCCCTTGGGCCTAUC O1 1 $133.1 REV GGCTGCAGTGAGCTATGATG D12 7q213 FWD ACTCCAAGTCACAGGGGATG EOS 7:1213 REV GAGCTCTGACTGCTGTTTGC E02 16913.3 FWD TTGCTCACAGAAGGACCACA 503 169133 REV ACGTGGGTGTGACGGTTATT Gene transfer.

All TALEN treatments consisted of delivery of 2.5 ug of each TALEN and ug amount of donor via the Neon Transfection System (Life es) with the following instrument settings: 1500 V, 20ms pulse width, and a single pulse. For 48 hours post gene transfer the cells were incubated at 31 C[5].

Cell Culture.

Cells were maintained in growth media comprised of DMEM supplemented with 20 % FBS, 100 U/mL nonessential amino acids, and 0.1 mg/ml each of penicillin and streptomycin, respectively (Invitrogen) and cultured at 2% 02, 5% C02~ and 37 C.

Surveyor nuclease.

Genomic DNA was isolated 48 hours post TALEN gene transfer and amplified for 30 cycles with Surveyor F and Surveyor R primers and subjected to Surveyor nuclease ent as described [6]. Products were resolved on a 10% TBE PAGE gel (Invitrogen). For off target amplicons the PCR reaction proceeded for 35 cycles and all primers are listed in Table 1.

Homology directed repair analysis.

For quantification of HDR, TALENS and 5 pl of a 40 uM single stranded ucleotide donor were transfected into cells and screened by PCR at 48 hours using three primers: Surveyor F, Surveyor R, and linker forward primers.

Densitometry was performed as described [6]. For gene correction, 10 ug of the donor plasmid was introduced along with the 2.5 ug each of TALEN DNA and selection was performed as described subsequently.

Selection.

Cells were selected in bulk in 0.2 ug/mL puromycin, segregated into sub- pools, screened for HDR, and then plated at low density 50 total cells) in a 10 cm2 dish. A cloning disk with silicone grease (all from Corning) was placed over single cells in the ce of base media supplemented with 10 ng/mL epidermal growth factor and 0.5 ng/mL fibroblast growth factor. Cells were ed to sequentially larger vessels. An adenoviral cre recombinase was added at an MOI of to remove the PGK cin cassette (Vector BioLabs).

Cell correction molecular ing.

C7GTl and C7GT2 primer pairs were employed to amplify a on from the donor into the endogenous locus (upstream SPMP screening). The ApaI SPMP region was assessed on genomic DNA treated with Apal pre- and post- PCR 2014/019322 amplification with C7APAF and C7GT2. Messenger RNA from clonal isolates was converted to cDNA and screened with RTl and RT2 and then digested with Apal.

ApaI-resistant amplicons were cloned and Sanger sequenced.

Cell ion Analysis.

Gene corrected fibroblasts were expanded in T150 flasks and nized to obtain single cell suspensions. Cells were then resuspended in 100ul PBS + 0.5% BSA + propidium iodide (eBiosciences), followed by addition of an equal volume of PKHZ6 reference microbeads (SIGMA). Five thousand bead events were collected and absolute viable cell number was calculated as per manufacturer protocol (SIGMA). iPSC Generation and ma assay.

Gene corrected fibroblasts (or un-corrected cells as a control) were rammed to iPSCs as bed [7, 8] and then placed in the flank of a SCID mouse until a visible mass formed. The mass was excised for embedding and staining.

Immunofluorescence.

Gene corrected cells were plated on a chamber slide and were fixed 24 hours later with 4% paraformaldehyde, permeabilized with 0.2% Triton X, blocked with 1% BSA and stained with a onal ype VII collagen antibody (121500; generously provided by Drs David Woodley and Mei Chen). Secondary antibody staining was performed with donkey abbit IgG Cy3 (1:500; Jackson Immunoresearch). Isotype control staining was done using whole molecule rabbit IgG (Jackson Immunoresearch). Nuclei were stained with 4’, 6—diamidino phenylindole (Vector tories). Images were taken using a PMT voltage of 745 on an Olympus BX61 FV500 confocal microscope (Olympus Optical Co LTD) and analyzed using the Fluoview software version 4.3. Light microscopy was performed on a Leica microscope.

IDLV and LAM-PCR/anAM PCR.

Integrase—defective lentiviral (IDLV) particles were produced in 293T cells via lipid based co-transfection (Lipofectamine 2000, Invitrogen) of the CMV—GFP transfer vector, the R8.2 packaging plasmid harboring the D64V( integrase mutation [9, 10], and the pMD2.VSV—G envelope-encoding plasmid. Gene tagging was performed by nucleofection of HEK 293 cells with the TALENs followed 24 hours later by a transduction of GFP IDLV at an MOI of 7. 100mg of c DNA was ed in duplicate by LAM-PCR [11] using enzymes MseI and Tsp509I and anAM—PCR [12] to ensure genome—wide recovery of IDLV integration sites. (nr)LAM-PCR amplicons were sequenced by the Roche/454 pyrosequencing platform and integration site data were analyzed using the HISAP pipeline [13, 14],[15]. Genomic on harboring >1 IS in close ce were scanned for potential TALEN off-target binding sites using the pattern matcher scan-for—matches Results/Discussion Lack of type VII collagen protein at the dermal-epidermal junction (DEJ) results in loss of the structural integrity of the skin. Restoration of deposition of the type VII collagen at the DEJ by allogeneic systemic hematopoietic cell or localized fibroblast lantation can alleviate symptoms [16-18]. However, suboptimal efficacy of allogeneic cell transplantation due to risks of toxicity, infection, and graft failure provides s to develop new autologous cell-based ies. Therefore, a genome-editing strategy for COL7A1 tion based on TALEN technology is described herein. Fibroblasts are an ideal cell type due to their ease of derivation and low susceptibility to growth arrest in culture as well as their ability to deposit type VII collagen at the DEJ [18, 19]. TALENs are engineered nucleases that can induce a double-stranded DNA break at a user-defined genomic locus, thus stimulating HDR, and are superior to other ses in their targeting capacity and ease of generation [20, 21].

The TAL Effector-Nucleotide Targeter software [22, 23]identified 68 potential TALEN sites for the human COL7A1 locus and t recent experimental data on a large series of human genes [21] ize the high targeting capacity for TALENs, a consideration for RDEB and other diseases that exhibit geneity in the location and number of mutated sequences. The Golden Gate g methodology was used to generate a patient-specific nuclease proximal to a premature termination codon in exon 14 of the COL7A1 gene (Fig. 1A). A TALEN is composed of an engineered TALE repeat array fused to the FokI nuclease domain (Fig. 1B); the binding specificities of TALE repeats in the array are dictated by the identities of two hypervariable residues within each repeat (Fig. 1C). TALEN- treated RDEB fibroblasts were analyzed for evidence of repair by the two major DNA repair pathways: error—prone non-homologous ining (NHEJ) and HDR.

Surveyor nuclease assay and Sanger sequencing that showed 11 mutated alleles out of 75 total analyzed were consistent with NHEJ (Figs. 2A and 2E). TALEN cleavage also resulted in the e of an oligonucleotide duplex at the DNA break site (Figs. 2B-F)[24]. These data established that the nuclease is active at the target site. It was next ascertained whether RDEB cells could undergo HDR following co-delivery of TALENs and an oligonucleotide donor (ODN) containing a unique primer sequence flanked by short donor arms (Fig. 1F). RDEB fibroblasts transfected with TALEN plasmids and the ODN were then analyzed with a three-primer PCR approach that simultaneously s the modified and unmodified alleles. This assay showed that TALENs in RDEB cells can stimulate HDR to incorporate an exogenous sequence from the ODN donor (Fig. 1G) and the 14.6% rate of NHEJ and 2.1% rate of HDR show the efficacy of TALEN use for high-level modification of human fibroblasts.

To determine whether a COL7A1 mutation causing RDEB could be corrected and a population of genetically corrected cells subsequently ed, an exogenous donor plasmid was ted that would allow for selective ion and expansion of gene-corrected cells. This donor consisted of homology arms that spanned ~l kb of the COL7A1 locus between exons 12 and 16 (Fig. 3A). Within the donor was a floxed-PGK-puromycin cassette oriented so that it would be inserted into the intron between exons l2 and 13. The flanking loxP sites allow for removal of the selectable marker with Cre recombinase, leaving a small loxP “footprint” in the intron (Fig. 4). Within the right donor arm, five single base pair alterations were engineered: the normal base at the site of the mutation that restores a normal genotype and four silent point mutation polymorphisms (SPMPs) that allowed for delineation of HDR—modified alleles versus fied ones (Fig. 3A). Three of these SPMPs are am of the target base and the one downstream removes an ApaI restriction site (alterations ter ed to as upstream or downstream SPMPs).

Of the nine clones analyzed, four were obtained that showed evidence of HDR. In one clone, the presence of the upstream SPMPs was evident; r, the RDEB-pathogenic COL7A1 mutation persisted and the downstream SPMP was not found (Fig. 5). These data suggest that an HDR crossover event occurred within the donor arm upstream of the region that restores a normal genotype (Fig. 6). For the remaining three clones, however, the downstream donor-inserted SPMP was detectable, indicating that one allele underwent HDR and the other did not, resulting in a heterozygous COL7A1 locus (Figs. 3B and 3C).

HDR should revert the mutant base and restore normal gene expression.

Accordingly, this was ed with an RT-PCR strategy for the detection of the normal base and the downstream SPMPS in the same transcript ing splicing out of the intervening intron (Fig. 7). Interestingly, direct sequencing of the cDNA in one clone showed a deletion of sequences at the TALEN target site (Fig. 8). These data indicate that the TALEN was active after HDR and induced an additional NHEJ—mediated mutation. Previous studies with zinc finger endonucleases (ZFNs) show that silent mutations in the donor sequence can reduce the frequency of this undesired event”; however, this was not possible in this experiment e the TALEN site was at an intron/exon boundary and it was opted to leave the donor TALEN sequence unperturbed so as not to t splicing. This negatively impacted the recovery of one clone; however, two clones ted the desired HDR~based, donor—derived, normal transcripts (Fig. 9A). It was next ascertained whether TALEN ent restored type VII collagen protein sion ed to untreated RDEB mutant or wild-type cells g abnormal or normal transcripts, respectively (Figs. 9C and 9E). Immunofluorescence-based detection of type VII collagen revealed a rescue of type VII collagen production in TALEN—treated cells and a complete absence in untreated control RDEB fibroblasts (Figs. 9B and 9D).

These results confirm the ability of TALENs to e a genetic modification at a disease-specific target site with restoration of normal mRNA and protein production.

The risk of off-target effects is a eration in the clinical use of genome— editing reagents. Options for mapping off-target sites of gene-editing nucleases include: (i) performing in vitro Systematic ion of Ligands by Exponential Enrichment (SELEX) with monomeric DNA-binding proteins of each nuclease in a pair and then using this data to predict potential off target 25], (ii) performing an in vitro cleavage site selection using dimeric nucleases and then interrogating sites from this selection that occur in the genome of cells of interest for nuclease- induced mutations, (iii) utilizing the propensity of an integration-defective lentivirus (IDLV) to integrate into nuclease—induced DSBS and then identifying points of insertion by R[9]. Although methods (ii) and (iii) appear to be better at identifying nuclease off-target sites than method (i), the former methods fail to identify off-target sites predicted by the other, suggesting that no method is comprehensive in its detection of off—target events. Method (iii) was utilized with an IDLV with green fluorescent protein (GFP) gene that can be trapped into a nuclease— generated DSB (Fig. 11A)[9, 26]. Human embryonic kidney (293) cells were used due to their accelerated erative capacity, which should promote rapid dilution of non-integrated IDLV and minimize random integration. In on, it was hypothesized that, due to the open chromatin structure of 293 cells, any off—target effects will manifestto a greater degree than in primary cells and will allow for a more sensitive mapping of off—target events. Introduction of the GFP IDLV alone resulted in a rapid loss of GFP expression in 293 cells (Fig. 12). The roduction of IDLV and TALENS resulted in a stable population of GFP cells (Fig. 11B), which were used for mapping the ation sites with nonrestrictive linear amplification- mediated PCR ((nr)LAM—PCR) (Fig. 11C). Five sites were recovered that showed a junction n the IDLV and adjacent genomic sequence (Fig. 11D). These events are not unexpected, as even nucleases used in clinical trials show off-target s and the non-coding regions recovered t that this TALEN possesses a safety profile that is not predicted to negatively impact gene expreSSion.

At the resolution of the LAM—PCR methodology, the TALEN described herein shows a high rate of on—target activity. In addition, these studies, like others, show that a potential target for ered nucleases is the donor construct itself and they highlight the benefits of the inclusion of a marker sequence that can aid in selection of the desired HDR event [27].

In summary, skin cells from an RDEB patient were obtained and the donor and TALEN reagents (sequences are included below) were designed and rapidly constructed to specifically target this unique mutation. The ation of the gene editing tools resulted in correction of the RDEB mutation in diploid human fibroblasts—cells that are suitable for therapeutic use after direct expansion or ramming into pluripotency ed by expansion [7, 8] - and e the first-ever demonstration of TALEN—mediated correction of a disease gene in the human genome. These studies provide the proof that TALENS can be used in the development of clinically relevant individualized therapies. flamplfi An example of a Donor Plasmid Sequence is set forth in SEQ ID NO: 22. An example of the Left Arm of the Donor Sequence is set forth in SEQ ID NO:3l. An example of the Loxp site of Donor is set forth in SEQ ID NO:23. An example of the PGK Promoter of Donor is set forth in SEQ ID NO:24. An example of the Puromycin Gene of the Donor sequence is set forth in SEQ ID NO:25. An example of the Bovine Growth Hormone polyadenylation signal of Donor is set forth in SEQ ID NO:26. An e of the Loxp Site Of Donor is set forth in SEQ ID NO:27. An example of the Right Arm of Donor is set forth in SEQ ID NO:28. An example of TALEN Left (pTAL 286) is set forth in SEQ ID NO:29. An example of TALEN Right (pTAL 28’?) is set forth in SEQ ID NO:30.

Bibliography 1. n, D. F., et al. ent TALEN-mediated gene knockout in livestock.

Proceedings of the National Academy ofSciences of the United States ofAmerica 1093 17382-17387. 2. Cermak, T., et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic acids research 391 e82. 3. Osborn, M. J., Defeo, A. P., Blazar, B. R., and Tolar, J. Synthetic Zinc Finger Nuclease Design and Rapid Assembly. Human gene therapy. 4. Gibson, D. G., Young, L., Chuang, R. Y., Venter, J. C., Hutchison, C. A., 3rd, and Smith, H. O. (2009). Enzymatic assembly of DNA les up to several hundred kilobases. Nature methods 62 343-345.

. Doyon, Y., Choi, V. M., Xia, D. F., V0, T. D., Gregory, P. D., and Holmes, M. C. ent cold shock enhances zinc-finger nuclease-mediated gene disruption. Nature methods 71 459-460. 6. n, D. Y., Waite, A. J., Katibah, G. E., Miller, J. C., Holmes, M. C., and Rebar, E. J. A rapid and general assay for monitoring endogenous gene modification.

Methods in molecular biology (Clifton, NJ 6491 247-256. 7. Tolar, J ., et al. Keratinocytes from Induced Pluripotent Stem Cells in onal Epideimolysis Bullosa. The Journal ofinvestigative dezmatology. 8. Tolar J. et al. Induced pluripotent stem cells from individuals with recessive dystrophic epidermolysis bullosa. The Journal of Investigative dezmatology 131' 848- 856. 9. l R. et al. An unbiased genome-wide analysis of zinc-finger nuclease specificity. Natuzebiotechnology 29' 816823 . Vargas, J., Jr. Gusella, G. L. Najfeld V., n, M. E. and Cara, A. (2004).

Novel integrasedefective lentiviral episomal vectors for gene transfer. Human gene therapy 153 361-372. 40 11. Schmidt, M., et al. (2007). High-resolution insertion~site analysis by linear amplification-mediated PCR (LAM-PCR). NatMethods 41 1051-1057. 12. Paruzynski, A., et a1. (2010). -wide hroughput ome analyses by anAM-PCR and next-generation sequencing. NatProtoc 51 1379- 1395. 13. Dsouza, M., , N., and Overbeek, R. . Searching for patterns in 45 genomic data. fronds Genet 133 497-498. 14. Arens, A., et al. Bioinformatic clonality analysis of next-generation sequencing- derived viral vector ation sites. Human gene therapy methods 233 111-118.

. Arens, A., et al. (2012). Bioinformatic clonality analysis of next-generation sequencing-derived viral vector integration sites. Hum Gene Ther Methods 231 111-118. 16. Wagner, J. E., et al. Bone marrow transplantation for recessive dystrophic epidermolysis bullosa. The New Englandjourual ofmedicine 3633 9. 17. Tolar, J., et al. (2009). Amelioration of molysis bullosa by transfer of wild- type bone marrow cells. Blood 1133 174. 18. Wong, T., et al. (2008). ial of fibroblast cell therapy for recessive dystrophic epidermolysis bullosa. The Journal ofinvestigative dermatology 1283 217 9- 2189. 19. Goto, M., et al. (2006). Fibroblasts show more potential as target cells than keratinocytes in COL7A1 gene therapy of dystrophic epidermolysis bullosa. The Journal ofin vestigative dermatology 1263 766-772.

. Cermak, T., et a1. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic acids research. 21. Reyon, D., Tsai, S. Q., Khayter, C., Foden, J. A., Sander, J. D., and Joung, J. K.

FLASH assembly of TALENs for high-throughput genome editing. Nature biotechnology 302 460-465. 22. Sander, J. D., Zaback, P., Joung, J. K., Voytas, D. F., and Dobbs, D. (2007). Zinc Finger er (ZiFiT)1 an engineered zinc finger/target site design tool. Nucleic acids research 355 W599'605. 23. Doyle, E. L., et a1. TAL Effector-Nucleotide Targeter (TALE-NT) 2.03 tools for TAL effector design and target prediction. Nucleic acids research 401 W117 - 122. 24. Orlando, S. J et al.

., ZinC'finger nuclease-driven targeted integration into mammalian genomes using donors with limited somal homology. Nucleic acids research 383 e152.

. Pattanayak, V., Ramirez, C. L., Joung, J. K., and Liu, D. R. Revealing off-target ge specificities of zinc-finger nucleases by in vitro selection. Nature methods 8: 765770. 26. Paruzynski, A., et a1. Genome-wide hroughput integrome es by anAM-PCR and next-generation cing. Nature protocols 51 1379-1395. 27. Zou, J., et al. (2009). Gene targeting of a disease-related gene in human induced pluripotent stem and embryonic stem cells. Cell stem cell 53 97-110.

All publications, patents and patent ations are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of ration, it will be apparent to those skilled in the art that the invention is susceptible to additional ments and that certain of the details described herein may be varied erably without departing from the basic principles of the invention.

Claims (26)

1. A composition sing a c acid encoding a first Transcription activator-like effector nuclease ("TALEN") protein, wherein the first TALEN protein is capable or inducing a site-specific double stranded DNA break in a COL7A1 gene in a cell, the COL7A1 gene having a genetic mutation capable of causing epidermolysis bullosa, and a nucleic acid donor sequence, wherein the donor sequence is a template for correction of the genetic mutation in the COL7A1 gene.

2. Use of a nucleic acid encoding a first TALEN protein and a nucleic acid donor sequence of claim 1 in the manufacture of a medicament for the treatment epidermolysis bullosa.

3. The composition of claim 1, or use of claim 2, wherein the cell is selected from the group ting of a fibroblast, keratinocyte, ble otent stem cell, hematopoietic stem cell, mesenchymal stem cell, embryonic stem cell, hematopoietic progeny cell, T-cell, B-cell, glial cell, neural cell, neuroglial progenitor cell, neuroglial stem cell, muscle cell, lung cell, pancreatic cell, liver cell and a cell of the reticular endothelial system.

4. The composition of claim 1 or 3, or use of claim 2 or 3, n the first TALEN protein is a left TALEN and the nucleic acid further encodes a second TALEN which is a right TALEN that ates with the left TALEN to make the site-specific double stranded DNA break in the target gene.

5. The composition of any one of claims 1, 3 or 4, or use of any one of claims 2 to 4, wherein the nucleic acid encoding the TALEN protein or the nucleic acid donor sequence is part of a vector or plasmid.

6. The composition of any one of claims 1 or 3 to 5, or use of any one of claims 3 to 6, wherein a first TALEN or a second TALEN comprise a plurality of TAL effector repeat sequences and an endonuclease domain and a spacer between the plurality of TAL or repeat sequences and the endonuclease domain includes a spacer.

7. The composition of claim 6, or use of claim 6, wherein the spacer is 12 to 30 nucleotides in length.

8. A composition of any one of claims 1 or 3 to 7, or use of any one of claims 3 to 7, comprising at least one nucleic acid comprising: (i) a first nucleic acid encoding a first transcription activator-like (TAL) effector endonuclease monomer, (ii) a second c acid encoding a second TAL or endonuclease monomer, (iii) and a donor sequence, n each of the first and second TAL effector endonuclease monomers comprises a plurality of TAL effector repeat ces and a FokI endonuclease domain, wherein each of the plurality of TAL effector repeat sequences comprises a repeat-variable diresidue, wherein the first TAL effector endonuclease monomer is capable of binding to a first half-site sequence of a target DNA within the cell, the target DNA having a c mutation, and the first TAL effector clease monomer is capable of cleaving the target DNA when the second TAL effector endonuclease monomer is bound to a second half-site sequence of the target DNA, wherein the target DNA comprises the first half-site sequence and the second half-site sequence separated by a spacer sequence, and wherein the first and second half-sites have the same nucleotide sequence or different nucleotide sequences, wherein the donor sequence comprises a region homologous to the target DNA at least at the 5’ and 3’ ends of the target DNA and is a template for DNA repair ing in a correction of the genetic mutation in the target DNA, further wherein the donor sequence is a template for correction of the c mutation in the COL7A1 gene.

9. A protein coded for or expressed by the c acid encoding the first TALEN protein of any one of claims 4 to 6.

10. A protein coded for or expressed by the first c acid or the second nucleic acid of claim 8.

11. A vector comprising the nucleic acid encoding the first TALEN protein of any one of claims 4 to 6.

12. A vector comprising the first nucleic acid or the second c acid of claim 8.

13. A nucleic acid coding for a TALEN protein, wherein the nucleic acid comprises a sequence selected from the group ting of SEQ ID NO: 29 and SEQ ID NO: 30.

14. A protein coded or expressed by the nucleic acid of claim 13.

15. The use according to any one of claims 2 to 7, n the medicament comprises: at least one nucleic acid comprising (i) a first nucleic acid encoding a first transcription activator-like (TAL) effector endonuclease monomer, (ii) a second nucleic acid encoding a second TAL effector endonuclease monomer, and (iii) a donor sequence, wherein each of the first and second TAL or endonuclease monomers ses a plurality of TAL effector repeat sequences and a FokI endonuclease domain, wherein each of the plurality of TAL effector repeat sequences comprises a repeat-variable diresidue, wherein the first TAL effector endonuclease monomer is capable of binding to a first half-site sequence of a target DNA within the cell, the target DNA having a genetic mutation, and the first TAL effector endonuclease r is capable of cleaving the target DNA when the second TAL effector endonuclease monomer is bound to a second half-site sequence of the target DNA, wherein the target DNA comprises the first half-site sequence and the second half-site sequence ted by a spacer ce, and n the first and second half-sites have the same nucleotide sequence or different nucleotide sequences, wherein the donor sequence comprises a region homologous to the target DNA at least at the 5' and 3' ends of the target DNA and is a template for DNA repair resulting in a tion of the genetic mutation in the target DNA, wherein the target DNA is a COL7A1 gene.

16. The use of claim 15, wherein the donor sequence comprises SEQ ID NO: 22.

17. The use of claims 15 or claim 16, wherein the 5' and 3' ends of the donor each have at least 100 bases of sequence identity to the target.

18. The composition of any one of claims 1 or 3 to 7, or the use of any one of claims 15 to 17, n the donor sequence is a template for site specific DNA repair resulting in a correction of a genetic mutation, wherein the donor sequence comprises homology to at least the 5' and 3' ends of a target sequence, wherein a portion of the donor ce comprises a repair ce to correct the target sequence for use in conjunction with a TALEN protein.

19. The composition of claim 18, wherein the donor comprises SEQ ID NO: 22.

20. The composition of claim 18 or claim 19, wherein the 5' and 3' ends of the donor each have at least 100 bases of sequence identity to the target.

21. The composition of any one of claims 1, 3 to 7 or 18 to 20, or the use of any one of claims 2 to 8 or 15 to 18, wherein the donor sequence is part of a vector or plasmid.

22. The composition or use of claim 21, wherein the donor sequence comprises SEQ ID NO: 22.

23. The composition or use of claim 21 or claim 22, wherein the 5′ and 3′ ends of the donor sequence each have at least 100 bases of sequence ty to the target.

24. A vector or plasmid comprising one or more of SEQ ID NOs: 29 or 30.

25. An isolated host cell sing a vector or plasmid comprising one or more of exogenous SEQ ID NOs: 29 or 30 or the proteins expressed from such sequences.

26. A transfected cell line comprising a vector or plasmid comprising SEQ ID NOs: 29 or