NZ711234B2 - Pharmaceutical composition comprising albumin-binding arginine deiminase for cancer targeting treatment - Google Patents

Abstract

The present invention provides a pharmaceutical composition containing albumin-binding arginine deiminase fusion protein (AAD) for treating cancer or other arginine-dependent diseases. The AAD fusion protein can be purified from both soluble and insoluble fractions of crude proteins, it binds to human serum albumin (HSA) and has its high activity with longer half life for efficient depletion of arginine in cancer cells. The specific activities of wild-type ADI and AAD in the present invention are 8.4 and 9.2 U/mg (at physiological pH 7.4), respectively. The AAD used in the present invention can be used in the treatment of various cancers (e.g. pancreatic cancer, leukemia, head and neck cancer, colorectal cancer, lung cancer, breast cancer, liver cancer, nasopharyngeal cancer, esophageal cancer, prostate cancer, stomach cancer & brain cancer) and curing arginine-dependent diseases. The composition can be used alone or in combination with at least one chemotherapeutic agent to give a synergistic effect on cancer treatment and/or inhibiting metastasis. an serum albumin (HSA) and has its high activity with longer half life for efficient depletion of arginine in cancer cells. The specific activities of wild-type ADI and AAD in the present invention are 8.4 and 9.2 U/mg (at physiological pH 7.4), respectively. The AAD used in the present invention can be used in the treatment of various cancers (e.g. pancreatic cancer, leukemia, head and neck cancer, colorectal cancer, lung cancer, breast cancer, liver cancer, nasopharyngeal cancer, esophageal cancer, prostate cancer, stomach cancer & brain cancer) and curing arginine-dependent diseases. The composition can be used alone or in combination with at least one chemotherapeutic agent to give a synergistic effect on cancer treatment and/or inhibiting metastasis.

Description

CEUTICAL COMPOSITION COMPRISING ALBUMIN-BINDING ARGININE DEIMINASE FOR CANCER TARGETING TREATMENT Cross-reference to Related ation The present application claims benefit from US provisional patent ation serial number 61/773,214 filed March 6, 2013 and US non-provisional patent application serial number 14/197,236 filed March 5, 2014, and the disclosures of which are incorporated herein by reference in its entirety.

Technical Field The present invention describes albumin-binding arginine deiminase (AAD) fusion protein that has been cally modified to create a material having high activity and long in viva half-life. The present invention further describes the designs for DNA and protein engineering for creating different AAD fusion proteins. The AAD fusion proteins can be isolated and purified from soluble fraction and insoluble fraction (inclusion bodies) of the crude proteins.

The present invention further relates to albumin—binding arginine deiminase-containing pharmaceutical compositions for cancer ing treatment and curing arginine-dependent diseases in humans and other animals.

Background of the ion The incidence of pancreatic cancer, colon , liver cancer, melanoma and cervical cancer in the worldwide tion is increasing. Effective treatments for these diseases are urgently needed. In many types of cancer including leukemia, melanoma, pancreatic, colon, renal cell carcinoma, lung, prostate, , brain, cervical and liver cancers, the cancer cells are ophic for arginine since they lack of expression of argininosuccinate synthetase (ASS), making these cancers excellent targets for arginine depletion therapy.

Arginine is a semi-essential amino acid for humans and other mammals. It can be sized from citrulline via a two step process catalyzed by the urea cycle enzymes argininosuccinate synthase (ASS) and argininosuccinate lyase (ASL). Arginine can be lized to ornithine by the enzyme se, and ornithine can be converted to citrulline by omithine carbamoyltransferase (OTC) in the mitochondria. The citrulline can be utilized to synthesize arginine again. Normal cells usually do not require an exogenous supply of arginine for growth because of the abundant catalytic ty ofASS and ASL. In contrast, many types of cancers do not express ASS and therefore are auxotrophic for ne. Their growth is dependent on arginine solely obtained from blood circulation. ore, targeting circulating arginine by using arginine-degrading enzymes is a feasible strategy to inhibit ASS-negative tumor growth [Feun et al., Curr. Pharm. Des. 14:1049-1057 (2008); Kuo et al., Oncotarget. 1:246-251 (2010)] Arginine can be degraded by arginase, arginine decarboxylase, and arginine deiminase (ADI). Among them, arginine deiminase (ADI) appears to have the highest affinity for arginine (a low Km value). ADI converts arginine to citrulline and ammonia, the metabolites of the urea cycle. Unfortunately, ADI can only be found in prokaryotes e.g. Mycoplasma Sp. There are some problems associated with the ion and purification of ADI from prokaryotes. ADI isolated from monas pudz'ta fails to exhibit efficacy in vivo because of its low enzymatic activity in neutral pH. ADI produced from Escherichia coli is enzymatically inactive and subsequently requires multiple denaturation and ration process which raises the subsequent cost of tion.

As the native ADI is found in microorganisms, it is antigenic and rapidly cleared from circulation in a patient. The native form of ADI is immunogenic upon injection into human ation with a short half-life (~4 hours) and elicits neutralizing dies [Ensor et al., Cancer Res. 62:5443—5450 (2002); 1220 et al., J. Clin. Oncol. 22:1815-1822 (2004)]. These shortcomings can be remedied by pegylation. Among various forms of pegylated ADI, ADI bound with PEG ular weight 20,000) via succinimidyl succinate (ADI-PEG 20) has been found to be an efficacious formulation. However, the activity of ADI after pegylation is greatly decreased on the order of 50% [Ensor et al., Cancer Res. 62:5443-5450 (2002)]. The previous attempts to create pegylated ADI resulted in materials that are not homogenous (due to the random attachment of PEG on protein surface Lys residues) and also lt to characterize and perform quality control during the manufacturing process. Also, PEG is very expensive, greatly sing the production cost. After the enous injection of pegylated ADI in vivo, leakage or detachment of free PEG is observed and the ADI (without PEG) can elicit the immunogenicity problem. Therefore, there is a need for improved cancer-treatment compositions, particularly, improved cancer-treatment itions that have enhanced activity and in viva half-life.

Summary of the ion In the present ion, albumin-binding arginine deiminase (AAD) fusion protein has increased its activity and plasma half-life in order to efficiently deplete ne in cancer cells.

Native ADI may be found in rganisms and is antigenic and rapidly cleared from circulation in a patient. The t invention constructs different AAD fusion proteins with one or two n—binding ns to maintain high activity with longer in vivo half-life (at least 5 days of arginine depletion after one injection). In the present invention, the albumin binding protein in the AAD fusion protein product does not appear to influence its specific enzyme ty but instead appears to increase the circulating half-life. The specific activities of wild- type ADI and AAD fusion protein in the present invention are 8.4 and 9.2 U/mg (at physiological pH 7.4), respectively.

In its broadest sense, the present invention provides an albumin-binding arginine deiminase fusion protein comprising a first portion comprising one or two components selected from an albumin-binding domain, an albumin-binding peptide or an albumin-binding protein(s) fused to a second portion comprising arginine deiminase to form the n-binding arginine deiminase fusion protein such that the albumin-binding arginine deiminase fusion protein retains the activity of arginine ase and is also able to bind serum albumin.

The present invention further relates to albumin-binding arginine deiminase (AAD) fusion protein —containing pharmaceutical compositions for targeted cancer treatment in humans and other animals. The first aspect of the present invention is to construct the modified AAD fusion n with high activity against cancer cells. The second aspect of the present invention is to purify AAD fusion n with high purity from both soluble and insoluble fractions of the crude proteins. The third aspect of the present invention is to lengthen the half-life of AAD fusion protein as it can bind to n very well in the circulation. The fourth aspect of the present invention is to provide a method of using the AAD-containing ceutical composition of the present invention for treating cancer by administering said composition to a subject in need thereof suffering from various tumors, cancers or diseases associated with tumors or cancers or other arginine-dependent diseases.

The AAD fusion protein of the t invention is also modified to avoid dissociation into albumin-binding protein and ADI such that it becomes more stable and has a longer ife in circulation. ADI is fused to an albumin-binding domain/peptide/protein in AAD fusion product to extend the plasma half-life and reduce the immunogenicity of the fusion product.

Albumin g domain (ABD) is a peptide that binds n in the blood. There are different variants of ABD showing different or improved human serum albumin (HSA) ies.

Different variants of ABD can be constructed and can be fiised to ADI. Unlike the naturally occurring ADI, this longer half-life property facilitates the depletion of arginine efficiently in cancerous cells, cancer stem cells and/or cancer progenitor cells.

The pharmaceutical composition containing AAD fusion protein can be used for intravenous (i.v.) injection (for rapid-acting dosage of medication) and intramuscular (i.m.) injection (for fairly rapid-acting and long-lasting dosage of medication). The application ofAAD fusion protein in the present ion can be used in the treatment of various cancers such as pancreatic cancer, leukemia, head and neck cancer, colorectal cancer, lung cancer, breast cancer, prostate cancer, cervical cancer, liver cancer, nasopharyngeal cancer, esophageal cancer and brain cancer. The present invention is directed to AAD fusion proteins, to methods of treating , to s of treating and/or inhibiting metastasis of cancerous , and to methods of curing arginine-dependent diseases.

The method of the present ion also es using a combination of different chemotherapeutic drugs and/or radiotherapy with the AAD fusion protein of the present invention to give a synergistic effect on cancer treatment.

Brief Description of the Drawings shows the design approach for construction of different AAD fusion proteins with one or two albumin-binding domain/peptide/protein(s) in three-dimensional structure. One or two albumin-binding domain/peptide/protein(s) can be fused to ADI to form the AAD fusion protein. The position of albumin—binding domain/peptide/protein is far from the ADI active site.

The albumin-binding domain/peptide/protein can be fused to the N—terminus or/and C-terminus of ADI. The structure in this figure is based on the asma arginini ADI ure (Protein Data Bank: ILXY). (A) Native ADI; (B) AAD fusion protein with two ABD or ABDI ; (C) AAD fusion protein with one ABD or ABDI at N—terminus; (D) AAD fusion protein with one ABD or ABDI at C—terminus. shows the sequence alignment for ADI in some bacterial species including Mycoplasma arginini (SEQ ID No. 23), Lactococcus lactis (SEQ ID No. 24), Bacillus cereus (SEQ ID No. 25) and us lichem'formis (SEQ ID No. 26). shows the designs and amino acid sequences for ent AAD fusion proteins originated from Mycoplasma arginini (A to E) and AAD fusion protein originated from Bacillus cereus (F). shows the creation of AAD fusion protein in two embodiments (A) and (B) by the use of intein—fusion proteins and expressed protein ligation (CBD, chitin binding domain) under the following schemes; (C) C-terminal ; (D) N—terminal fusion; (E) Intein-mediated n ligation. shows the plasmid map of the sion vector ucted for producing AAD fusion n. shows the (A) gene map, (B) nucleotide sequence (SEQ ID No. 44) and (C) amino acid sequence (SEQ ID No. 40) ofHis-ABD-PolyN—ADI. (ADI: the Mycoplasma argz'nini ADI) shows the (A) gene map, (B) nucleotide sequence (SEQ ID No. 45) and (C) amino acid sequence (SEQ ID No. 41) of His-ABD-PolyN—bcADI. (bcADI, the Bacillus cereus ADI) shows the expression and purification of AAD fusion protein: (A) AAD is ~90% soluble when expressed at 200C (lanes 2 and 3) and ~90% insoluble (inclusion body) when expressed at 37°C (lanes 4 and 5); (B) The purified AAD fusion protein in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS—PAGE) gel: lane 1, purified AAD fusion protein (52.8 kDa); lane 2, molecular weight marker. illustrates that AAD fusion protein depletes arginine ntly and inhibits the growth of various types of human cancer cell lines in in vitro tissue culture studies, including human ma (A375), human colon carcinoma (HCT116), and human pancreatic cancer (Panel). shows the albumin binding results of AAD fusion protein: (A) A non-denaturing native polyacrylamide gel (12%) showing the increase in the amount of HSA+AAD complex when the amount of AAD fusion protein (the amino acid sequence is shown in SEQ ID NO: 36; ) added increases. The mole ratios of human serum albumin (HSA): AAD in lanes 3-6 are 1:1, 1:2, 1:5, and 1:15, respectively. Lanes 1 and 2 represent HSA and AAD at 6 and 30 pmole, respectively; (B) In another experiment based on AAD fusion protein (SEQ ID NO: 40; ), an albumin: AAD ratio of 1 :8 is ent to bind all the albumin present (lane 5). is a graph showing the dose response of AAD fusion protein on plasma arginine levels in mice. A dose of 100 ug of AAD is sufficient to deplete plasma arginine for at least 5 days .

Definitions The term "cancer stem cell" refers to the biologically distinct cell within the neoplastic clone that is capable of initiating and ning tumor growth in viva (i.e. the cancer—initiating cell).

Detailed Description of the Invention Arginine is a semi—essential amino acid for humans and other mammals. It can be synthesized from citrulline via a two step process catalyzed by urea cycle enzymes nosuccinate synthase (ASS) and argininosuccinate lyase (ASL). Arginine can be metabolized to ornithine by the enzyme arginase, and ine can be converted to citrulline by ornithine oyltransferase (OTC) in the mitochondria. The citrulline can be utilized to synthesize arginine again. Normal cells do not typically require an ous supply of arginine for grth because ofthe abundant catalytic activity ofASS and ASL. In contrast, many types of cancers do not s ASS and are therefore auxotrophic for arginine. Their growth is solely dependent on arginine from ation. Therefore, targeting circulating arginine by using arginine-degrading enzymes is a le strategy to inhibit ASS-negative tumor growth.

Arginine can be degraded by arginine deiminase (ADI). ADI converts arginine to citrulline and ammonia, the metabolites of the urea cycle. Unfortunately, ADI can only be found in prokaryotes e.g. Mycoplasma Sp. There are many problems associated with the isolation and purification of arginine deiminase from prokaryotes. ADI isolated from monas pudita failed to exhibit efficacy in vivo because of its low enzymatic activity in neutral pH. ADI produced from Escherichia coli is enzymatically ve and subsequently requires multiple denaturation and renaturation process which raised the subsequent cost of production. The plasma half-life of the native form of AD] is short (~4 hours) upon injection into human circulation [Ensor et al., Cancer Res. 62:5443-5450 ; 1220 et al., J. Clin. Oncol. 5— 1822 (2004)]. These shortcomings can be partially remedied by pegylation. Among various forms of pegylated ADI, ADI bound with PEG ular weight 20,000) via succinimidyl succinate (ADI-PEG 20) has been found to be an efficacious formulation. However, the ty of ADI after pegylation is greatly decreased (by ~50%) [Ensor et al., Cancer Res. 62:5443-5450 (2002); Wang et al., Bioconjug. Chem. 17:1447-1459 (2006)]. Also, the succinimidyl succinate PEG linker can easily be hydrolyzed and detached from the n, causing immunogenic ms after a short period of use in the body. Therefore, there is a need for improved cancer- treatment compositions, particularly, improved cancer-treatment compositions with enhanced activity.

ADI ed from P. pudita failed to exhibit efficacy in vivo because it had little enzyme activity at a neutral pH and was rapidly cleared from the circulation of experimental animals.

ADI derived from Mycoplasma arginini is described, for example, by Takaku et al, Int. J. Cancer, 51:244-249 (1992), and US. Pat. No. 5,474,928. However, a problem associated with the therapeutic use of such a heterologous protein is its antigenicity. The chemical modification of ADI from Micoplasma arginini, via a cyanuric chloride linking group, with polyethylene glycol (PEG) was described by Takaku et al., Jpn. J. Cancer Res, 84:1195—1200 (1993). However, the modified protein was toxic when metabolized due to the release of cyanide from the cyanuric de linking group. In contrast, even for the ADI-PEG20, the PEG linker can easily be yzed and detached from the protein, causing immunogenic problems after a short period of use in the body. Therefore, there is a need for compositions which degrade non-essential amino acids and which do not have the problems associated with the prior art.

In many types of cancer including melanoma, pancreatic, colon, leukemia, breast, prostate, renal cell carcinoma and liver cancers, cancer cells are auxotrophic for arginine since they lack of sion of argininosuccinate synthetase (ASS), making them excellent targets for arginine depletion therapy. In this invention, n-binding arginine ase (AAD) fusion proteins have high activity with long half—lives for efficient depletion of arginine in cancer cells.

The size of the monomer for ADI is on the order of 45 kDa and it exists as dimer (on the order of 90 kDa) [Das et al., Structure. 12:657-667 (2004)]. A design for construction of an AAD fusion protein is shown in One or two albumin-binding domain/peptide/protein(s) with or without linker(s), SEQ ID NO: 46-49, are fused to ADI to form the AAD fusion protein. It is noteworthy that the selection of one or two particular albumin-binding domain/peptide/protein(s) can be made depending upon the type of cancer tissue to be targeted, the desired size and half- life of the resulting fiJsion n, and whether a domain or entire protein is selected. Further, the selected n-binding material may be the same or different. That is, a protein and a peptide can be fused, two proteins, two s, a domain and a protein, etc., as long as the resultant le retains the activity of the ADI and is also able to bind serum albumin with neither function of one portion of the fusion n being interfered with by the other portion of the fusion protein. The position of the n-binding domain/peptide/protein is far from the active site. The albumin-binding domain/peptide/protein can be fused to the N-terminus or/and C—terminus of ADI. There are different variants of ABD showing different or improved human serum n (HSA) affinities. Different variants of ABD can be constructed and can be fused to ADI. Some micro-organisms endowed with ADI (for example Pseudomonas sp) cannot be used, due to their potential pathogenicity and pyrogenicity. The source of ADI can be- from, but not limited to, different microorganisms, e.g. Mycoplasma (e.g. Mycoplasma arginini, lasma arthritia'is, Mycoplasma hominis), Lactococcus (e.g. Lactococcus lactis), Pseudomonas (e.g. Pseudomonas plecoglossicida, Pseudomonas putida, Pseudomonas aeruginosa), Steptococcus (e.g. Streptococcus pyogenes, Streptococcus nia, ococcus pneumoniae), Escherichia, filycobacterium (e.g. Mycobacterium tuberculosis) and Bacillus (e.g. Bacillus licheniformis, us cereus). It is preferred that ADI is cloned from Mycoplasma argz'nz'ni, Lactococcus lactis, Bacillus lichenz'formz's, Bacillus cereus, or any combination thereof. Their amino acid sequences with SEQ ID (SEQ ID NO: 23-35) and the sequence alignment for some of the amino acid sequences in are disclosed herein and also in the literature [Das et a1., Structure. 12:657-667 (2004); Wang et a1., Bioconjug. Chem. 17:1447-1459 (2006); Ni et a1., Appl. Microbiol. Biotechnol. 90:193—201 (2011)].

The design and amino acid ce for (A) native Mycoplasma argz‘m‘m' ADI protein (SEQ ID NO: 23), (B) different AAD fusion ns originated from the Mycoplasma 'ni ADI (SEQ ID NO: 36—40) and (C) AAD fusion protein originated from the Bacillus cereus ADI (SEQ ID NO: 41) are shown in Different AAD fusion proteins are successfully constructed. A linker is inserted between the n-binding protein and ADI in the AAD fusion protein in these ments.

On the other hand, a novel AAD fusion protein is also created by the use of intein-fusion proteins and expressed protein ligation (. The novel AAD fusion protein can be formed (1) by reacting the ADI having a inal cysteine e with a ve thioester at C-terminus of the ABD, or (2) by reacting the ABD having a N—terminal cysteine residue with a reactive thioester at C-terminus of the ADI so that the ADI and the ABD are linked by a covalent bond.

In , ADI with N—terminal cysteine residue reacts with reactive thioester at the C-terrninus of ABD. The thioester tag at the inus of ABD, and an OL-cysteine at the N—terrninus of ADI are required to facilitate protein ligation. These fragments are produced using a pTWINl vector (New England Biolabs) ing to the manufacturer’s . In particular, the gene coding for the ABD-Intein—CBD fusion n is synthesized and it is cloned into the vector under the control of T7 promoter for expression in E. coli (). The ABD-Intein—CBD fusion protein produced binds to chitin in a column. The amino acid sequence of ABD-Intein- CBD (SEQ ID NO: 42) is shown in . After thiol—inducible cleavage and elution from the column, the ABD with reactive thioester at its C—terrninus is obtained (). On the other hand, the gene coding for the CBD-Intein—ADI fusion protein is synthesized and cloned into the vector under the control of the T7 promoter for sion in E. 0011' (). The CBD-Intein- ADI fusion protein produced binds to chitin in a column. The amino acid sequence of the CBD- Intein—ADI (SEQ ID NO: 43) is shown in . After cleavage at pH 7 and 25°C, and elution from the column, the ADI with oc-cysteine at its N—terminus is obtained (). Finally, the AAD fusion protein is produced by the protein ligation reaction as shown in .

Importantly, AAD fusion proteins can be produced and purified in a convenient manner.

For example, an AAD fusion protein is successfully sed and purified from E. coli both in soluble fraction and insoluble fraction, and this result is shown in rmore, shows the purified AAD fusion protein analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The size of the purified AAD fusion protein is determined as 52.8 kDa.

The pharmaceutical composition of the present invention contains AAD fusion protein with high activity for depleting arginine in tumor cells for cancer ent. The specific activity of the purified AAD fusion protein is found to be similar to that of the wild-type ADI. ICso is the half maximal inhibitory concentration, that is, it represents the concentration of AAD fusion protein that is required for 50% tion of a cancer cell line. The ICso is a measure of the effectiveness of a drug. The IC50 of AAD fusion protein (amino acid sequence is shown in SEQ ID NO: 40, ) for different cancer cell lines (human melanoma, A375 & SK—mel—28; human colon carcinoma, HCT116; human pancreatic cancer, Panel; human liver cancer, Sk-hepl; human al cancer, C-33A) is shown in TABLE I. The in vitro y of AAD fusion protein on different cancer cell lines is demonstrated in It illustrates that AAD fusion protein can kill many cancer types, including human ma, human colon carcinoma and pancreatic cancer cell lines.

TABLE 1 ICso of AAD (pg/ml) C-33A (human cervical cancer) I CT116 (human colon carcinoma) For the albumin binding study, we have demonstrated successfully that the engineered AAD fusion protein can bind to human serum albumin (HSA). shows that the AAD fusion protein (amino acid sequence is shown in SEQ ID NO: 40, ) binds to HSA readily.

At a mole ratio of 1:5 or 1:15, the formation of the HSA-AAD complex forms according to the construct of using the linker molecule design. It is expected that the circulating half—life of AAD fusion protein in the blood is increased by the non—covalent HSA-AAD complex formation.

Therefore, a long-lasting version ofAAD fusion protein has been successfully created.

No commercial products show high efficacy when compared to the AAD fusion protein- ning pharmaceutical composition prepared in this invention. For uses in cancer treatment, the AAD fusion protein—containing pharmaceutical composition of the t ion serves as an anti-cancer agent to deplete the arginine in tumor tissues. AAD fusion protein is a good candidate to be used in combination with other molecular targeting or cytotoxic agents.

Examples The following examples are provided by way of describing specific embodiments of this ion without intending to limit the scope of this invention in any way.

Several of the es below relate to methods of making an albumin-binding arginine deiminase fusion protein. Various techniques can be used including g and intein—mediated protein ligation. As used herein, the term "cloning" is broadly used and comprises constructing a fusion gene coding for the albumin-binding ne deiminase fusion protein, inserting the fusion gene into a , inserting the vector into a host organism and expressing a protein that includes an albumin-binding ne deiminase fusion protein. Numerous variants on this technique can be med and still fall within the cloning contemplated by the present invention.

Example 1 Construction of the gene coding for albumin-binding domain/peptide/protein (ABD) The gene coding for ABD is constructed by two rounds of PCR. In the first round, the PCR reaction mixture (total volume of 25 ul) contains the following materials: 1 x iProof PCR buffer (Bio-Rad) 50 uM dNTP mixture 0.5 unit of iProofDNA Polymerase (Bio-Rad) nM of each of the following oligos ABD—F1forwardprimer (SEQ ID NO: 01): ’ ’ — CATGATGCGAATTCCTTAGCTGAAGCTAAAGTCTTAGCTAACAGAGAACT- 3 ABD-R2 e primer (SEQ ID NO: 02): ’ —TAGTCACTTACTCCATATTTGTCAAGTTCTCTGTTAGCTAAGACTTTAGC- 3’ ABD—F3forwardprimer (SEQ ID NO: 03): ’ ’ - GAACTTGACAAATATGGAGTAAGTGACTATTACAAGAACCTAATCAACAA— 3 ABD-R4 reverse primer (SEQ ID NO: 04): ’ CTTCAACAGTTTTGGCATTGTTGATTAGGTTCTTGTAATAGTCAC- 3’ ABD—F5forwardprimer (SEQ ID NO: 05): ’ ’ — ACTGTTGAAGGTGTAAAAGCACTGATAGATGAAATTTTAGCTGC ABD-R6 reverse primer (SEQ ID NO: 06): ’ —AGCTACGATAAGCTTAAGGTAATGCAGCTAAAAI I I CATCTATCAGTG— 3 ’ The following PCR program is used: 98°C 30 s; 20 cycles of {98°C 10 s, 50°C 20 s, 72°C 20 s} In the second round of PCR, the PCR mixture (total volume of 50 ul) contains the following materials: 1 x iProof PCR buffer (Bio—Rad); 50 uM dNTP mixture; 1 ul ofPCR reactant as DNA template from the first round; 1 unit of iProofDNA Polymerase (Bio—Rad); 200 nM of each of the following oligos: forwardprimer (SEQ ID NO: 07): ’ ’ — GCGAATTCCTTAGCTGAAGCTAAAGTCTTAGCTAACAGAGAACT— 3 ABD-R8 reverse primer (SEQ ID NO: 08): ' —AGCTACGATAAGCTTAAGGTAATGCAGCTAAAATTTCATCTATCAGTG- 3’ The following PCR program is used: 98°C 30 s; 35 cycles of {98°C 10 s, 60°C 20 s, 72°C 20 s}; 72°C 5 min A PCR product containing the DNA sequence of ABD (169 bp) is obtained and purified by Qiagen DNA Gel Extraction Kit for cloning e.

Example 2A Construction of the fusion gene coding for the AAD fusion protein In the first PCR, the PCR mixture (total volume of 50 ul) contains the following materials : 1 x iProof PCR buffer (Bio-Rad); 50 uM dNTP e; ng ofMycoplasma argz'nz'nz' genomic DNA; 1 unit of iProof DNA Polymerase (Bio-Rad); 200 nM of each of the following oligos: ADINde-Fforwardprimer (SEQ ID NO: 09): ’ —ATCGATCGATGTCTGTATTTGACAGTAAATTTAAAGG— 3’ ADIhz's-R reverse primer (SEQ ID NO: 10): ’ ’ —AGCTAAGGAATTCGCATCATGATGGTGATGGTGGTGGCTACCCCACTTAAC — 3 The following PCR program is used: 98°C 1 min; 35 cycles of {98°C 103, 50°C 203, 72°C 403}; 72°C 5 min A PCR product of 1280 bp long is obtained and purified by Qiagen DNA Gel Extraction Kit.

After that, the second PCR is med. The PCR mixture (total volume of 50 pl) contains the following materials: 1 x iProof PCR buffer (Bio-Rad); 50 pM dNTP mixture; ng ofthe 1280 bp PCR t; ng of the 169 bp PCR product; 1 unit of iProof DNA Polymerase (Bio-Rad); 200 nM of each of the following oligos: ADINde—Ffowvardprimer (SEQ ID NO: 11): ’ —ATCGATCGATGTCTGTATTTGACAGTAAATTTAAAGG— 3’ ABD-RIO reverse primer (SEQ ID NO: 12): ’ —AGCTACGATAAGCTTAAGGTAATGCAGCTAAAATTTCATCTATCAGTG- 3’ The following PCR program is used: 98°C 1 min; 35 cycles of {98°C 10s, 50°C 203, 72°C 45s}; 72°C 5 min A PCR product of 1428 bp is obtained and purified by Qiagen DNA Gel Extraction Kit.

Then it is digested with restriction enzymes NdeI and HindIII, and ligated to plasmid pREST A rogen) that is predigested with the same enzymes. The ligation product is then transformed into E. coli BL21 (DE3) cells. The ce of the constructed fusion gene is confirmed by DNA sequencing. e ZB Cloning of His-ABD-PolyN—ADI The construction of His-ABD-PolyN—ADI (SEQ ID NO: 40, in ) is done by two steps of overlapping PCR, the PCR fragment obtained from the last step is inserted into the vector pET3a between the NdeI and BamHI sites. The gene map, nucleotide sequence and amino acid sequence of I-Iis-ABD-PolyN—ADI are shown in Primers involved in construction of His-ABD—PolyN—ADI: hisABDNde-Fforwardprimer (SEQ ID NO: 13): ’ ’ — GGAGATATACATATGCATCATCACCATCACCATGATGAAGCCGTGGATG RI reverse primer (SEQ ID NO: 14): ’ ~TTGTTATTATTGTTGTTACTACCCGAAGGTAATGCAGCTAAAATTTCATC — 3 ABDn~R2 reverse primer (SEQ ID NO: 15): ’ —AGAACCGCCGCTACCATTGTTATTATTGTTGTTACTACCCGA— 3’ ADln-Fforwardprimer (SEQ ID NO: 16): ’ — 3 —AATAATAACAATGGTAGCGGCGGTTCTGTATTTGACAGTAAATTTAAAGG ADIBam—R reverse primer (SEQ ID NO: 17): ’ —TAGATCAATGGATCCTTACCACTTAACATCTTTACGTGATAAAG — 3’ In the first round of PCR, 50 ul of reaction volume containing the known concentration of components are prepared in two PCR tubes. In each of the tubes, dNTP, iProof buffer (BIO- RAD), iProofDNA polymerase (BIO-RAD), primers and DNA template are mixed and added up to 50 pl by ddHZO. The DNA template used in the reaction is a pET3a vector containing the gene of ADI from Mycoplasma arginini with a removal of an internal NdeI site on without altering the protein sequence of the ADI gene.

The two on tubes contain the primer mixtures of (A) 10 pmol hisABDNde-F (SEQ ID NO: 13), 0.5 pmol RI (SEQ ID NO: 14) and 10 pmol ABDn-RZ (SEQ ID NO: 15); and (B) 10 pmol ADIn-F (SEQ ID NO: 16) and 10 pmol ADIBam—R (SEQ ID NO: 17), respectively.

The PCR program is set according to the recommended steps in the manual with an annealing and extension temperature (time) at 50 °C (20 s) and 72 °C (40 s), respectively. The two products generated by PCR with the size of 237 bp and 1278 bp. The products are extracted and applied as template for the next round ofPCR.

In the second overlapping step, the reaction mixture is ed in a similar way to the first round except the template used was the mixture of 1 pmol of the 237 bp PCR t and 1 pmol of the 1278 bp PCR product from the first round PCR. Primers used are changed to 10 pmol hisABDNde-F (SEQ ID NO: 13) and 10 pmol ADIBam-R (SEQ ID NO: 17).

The annealing and extension ature (time) are 50 °C (20 s) and 72 °C (60 s), respectively. A PCR product with the size of 1484 bp is generated from the reaction. The PCR product is purified and digested with NdeI and BamHI and then ligated into the pre-digested pET3a d. The ligated product is then transformed into E. coli BL21 (DEB) for the production ofrecombinant protein.

Example 2C Cloning of I-Iis-ABD-PolyN-bcADI The uction of His-ABD-PolyN—bcADI (SEQ ID NO: 41, in ) is done by two steps of overlapping PCR, the PCR nt obtained from the last step is inserted into the vector pET3a between the NdeI and BamHI sites. The gene map, nucleotide sequence and amino acid sequence of I-Iis-ABD-PolyN—bcADI are shown in Primers involved in construction of His-ABD-PolyN—bcADI: hz'sABDNde—FZforwardprimer (SEQ ID NO: 18): ’ ’ — GGAGATATACATATGCATCATCACCATCACCATGATGAAGCCGTGGATG bcABDnn-RI reverse primer (SEQ ID NO: 19): ’ ’ —TTGTTATTATTGTTGTTACTACCCGAAGGTAATGCAGCTAAAATTTCATC bcABDn-RZ e primer (SEQ ID NO: 20): ’ —TTTACCGCCGCTACCATTGTTATTATTGTTGTTACTACCCGA— 3’ bcADln-Fforwardprimer (SEQ ID NO: 21): ’ —AATAATAACAATGGTAGCGGCGGTAAACATCCGATACATGTTACTTCAGA— 3’ bcADIBam-R reverse primer (SEQ ID NO: 22): ’ —TAGATCAATGGATCCCTAAATATCTTTACGAACAATTGGCATAC ’ In the first round of PCR, 50 H1 of reaction volume containing the known concentration of components are ed in two PCR tubes. In each of the tubes, dNTP, iProof buffer (BIO- PAD), iProofDNA polymerase (BIO-RAD), primers and DNA template are mixed and added up to 50 111 by dngO. The DNA template used in the on is a pET3a vector containing the gene of ADI from Bacillz'us cereus with a removal of an internal NdeI site mutation without altering the protein sequence of the ADI gene.

The two reaction tubes n the primer mixtures of (A) 10 pmol hisABDNde—FZ (SEQ ID NO: 18), 0.5 pmol m—Rl (SEQ ID NO: 19) and 10 pmol bcABDn—RZ (SEQ ID NO: ); and (B) 10 pmol bcADIn-F (SEQ ID NO: 21) and 10 pmol bcADIBam—R (SEQ ID NO: 22), respectively. The PCR program is set according to the recommended steps in the manual with an annealing and extension temperature (time) at 50 °C (20 s) and 72 °C (40 s), respectively. The two products are generated by PCR with the size of 237 bp and 1250 bp. The products are extracted and applied as template for the next round of PCR.

In the second overlapping step, the reaction mixture is ed in a similar way to the first round except the template used is the mixture of 1 pmol of the 237 bp PCR product and 1 pmol of the 1250 bp PCR product from the first round PCR. Primers used are changed to 10 pmol hisABDNde—FZ (SEQ ID NO: 18) and 10 pmol bcADIBam—R (SEQ ID NO: 22).

The annealing and extension temperature (time) are 50 °C (20 s) and 72 °C (60 s), respectively. A PCR product with the size of 1512 bp is generated from the on. The PCR product is purified and digested with NdeI and BamHI and then ligated into the pre-digested pET3a plasmid. The ligated product is then transformed into E. coli BL21 (DE3) for the production mbinant protein.

Example 3 Expression and purification of the AAD fusion protein For preparing the seed culture, the strain E. coli BL21(DE3) ng the plasmid encoding the AAD fusion protein ( is cultured in 5 ml of 2xTY medium, 30°C, 250 rpm, overnight. The overnight seed e (2.5 ml) is added to 250 ml of 2xTY, 37°C, 250 rpm, 2.5 h (until OD600 «3 0.6-0.7). When the ODgoo reached, IPTG is added to the culture (0.2 mM final concentration). The growth is continued for 22 more hours at 20°C and then the cells are collected by centrifugation. The cell pellet is resuspended in 25 ml of 10 mM sodium phosphate buffer, pH 7.4. The cells are lysed by sonication. The soluble portion is ted after centrifugation. The fusion protein ining a His tag) is then purified by nickel affinity chromatography. TABLE 2 shows that cultivation temperature is an important factor in affecting the solubility of AAD fusion protein (amino acid sequence is shown in SEQ ID NO: 40, ) obtained from the expression host.

For isolating the soluble fraction of AAD fusion protein, the cell pellet is resuspended in ml of 10 mM sodium phosphate buffer, pH 7.4. The cells are lysed by sonication. The soluble portion is collected after centrifugation. The AAD fusion protein ins a His tag) is then purified by nickel affinity chromatography.

For isolating the insoluble fraction of AAD fusion n, the cell pellet is ended in 25 ml of 20 mM Cl, pH 7.4, 1% Triton X-100. The cells are lysed by sonication. The insoluble portion (inclusion bodies) is collected by centrifugation. The protein is unfolded by resuspending in 10 ml of 20 mM Tris-HCl, pH 7.4, 6 M Guanidine HCl, and vortexed until it becomes soluble. The protein is refolded by adding the unfolded protein solution drop by drop into a fast stirring solution of 100 ml of 20 mM Sodium phosphate buffer, pH 7.4. The insoluble als are removed by centrifugation. Salting out of the protein is performed by adding solid ammonium sulphate powder into the supernatant to achieve 70% saturation. The insoluble n is collected by centrifugation and it is resuspended in 10 ml of 20 mM sodium phosphate buffer. The AAD fusion protein (contains a His tag) is then purified by nickel affinity chromatography.

TABLE 2 Cultivation temperature CC) Yieid {mg}! 258m} culture eoiubitity » 90""g ineiasim batty 1055 } on A375 Get-Is Example 4 Enzyme activity assay and Enzyme kinetics for AAD fusion protein To determine the enzyme activity for ype ADI and AAD fusion protein in the present invention, the diacetyl monoxime (DAM) - thiosemicarbazide (TSC) assay for citrulline detection is used. The reaction is shown below.

L—Arglnlne arginine deiminasetADllorAADfusmn n > L—Cltrulllne + Ammonla This assay is run by adding sample to a color reagent, which is made by mixing acidic ferric chlon'de solution with DAM-TSC solution. Briefly, enzyme is incubated with 20 mM arginine, 10 mM sodium phosphate pH 7.4 for 5 min at 37°C. The reaction e is heated at 100°C for 5 min to develop the color and read at 540 nm (light path = 1 cm). A standard curve is ucted using various concentrations of citrulline. One unit of the ADI native enzyme is the amount of enzyme activity that converts l umol of arginine to l umol of citrulline per minute at 37°C under the assay conditions. The specific activities of wild—type ADI and AAD fusion protein in the present invention are 8.4 and 9.2 U/mg (at pH 7.4, physiological pH) respectively.

The specific activities for wild-type ADI and AAD fusion protein at different pH range (from pH .5 to 9.5) are also determined, and the optimum pH is at 6.5. Therefore, the results te that AAD fusion protein depletes arginine efficiently, as the fusion with albumin—binding protein does not affect enzyme activity ofADI.

The Michaelis constant K1]] is the substrate concentration at which the reaction rate is at half-maximum, and is an inverse e of the substrate's affinity for the enzyme. A small Km indicates high affinity for the substrate, and it means that the rate will approach the maximum reaction rate more quickly. For determination of the enzyme cs or Km value, the activity of wild-type ADI and AAD fusion protein are measured under different concentration of substrate arginine (2000 uM, 1000 HM, 500 [.LM, 250 "M, 125 HM, 62.5 uM) at pH 7.4. The measured Kn1 values of the AAD fusion protein shown in (SEQ ID NO: 40, ADI protein is originated from Mycoplasma argininz') and AAD fusion protein shown in (SEQ ID NO: 41, ADI protein is ated from Bacillus cereus) are 0.0041 mM and 0.132 mM tively. The results suggest that the fusion to ABD did not affect the binding affinity of the different AAD fusion proteins to arginine.

Cell proliferation assay and in vitro efficacy of AAD fusion protein on cancer cell lines e medium DMEM is used to grow the human melanoma A375 & SK—mel-28, human pancreatic cancer Panel and human cervical cancer C-33A cell lines. The EMEM medium is used to culture the SK—hep 1 liver cancer and C-33A cervical cancer cell line. Cancer cells (2-5 X 103) in 100 pl culture medium are seeded to the wells of l plates and incubated for 24 h. The culture medium is ed with medium containing different concentrations of AAD fusion protein. The plates are incubated for an additional 3 days at 37°C in an atmosphere of 95% air/5% C02. MTT assay is performed to estimate the number of viable cells in the culture according to manufacturer’s ctions. The amount of enzyme needed to achieve 50% inhibition of cell growth is defined as IC5o.

As shown in TABLE 1 and the s indicate that AAD fusion n es arginine efficiently and inhibits the growth of various types of human cancer cell lines in in vitro tissue culture studies. For example, human melanoma, human colon oma, human pancreatic cancer, human liver cancer and human cervical cancer, all have low values of IC50 (see TABLE 1), as these cancer types are all inhibited by AAD fusion protein readily. As predicted, AAD fusion protein would inhibit all cancer types that are arginine—dependent (for example, the ASS—negative cancers).

Example 6 In vivo half-life determination of AAD fusion protein Balb/c mice (5-7 weeks) are used in this study and they are allowed to acclimatize for a week before the experiment. Mice (n=3) are separated into four groups and injected with 0, 100, 500 or 1000 pg of AAD fusion protein (SEQ ID NO: 40, ) in 100 pl PBS intraperitoneally, respectively. Blood of each mouse is collected at 0 h and Day 1-7. Sera are ed after centrifugation. The sera are then deproteinised and analyzed by amino acid analyzer for arginine.

As shown in , AAD fusion n (SEQ ID NO: 40, ), even at the lowest dosage of 100 ug, depletes plasma arginine efficiently at Day 1, 3 and 5, suggesting that AAD can deplete arginine in viva efficiently for at least 5 days. The ne level returns to normal gradually at Day 6 and Day 7 in all treatment groups.

Example 7 In vivo efficacy of AAD fusion protein on cancer cell xenografts Nude balb/c mice (5-7 weeks) are used in this study and they are allowed to acclimatize for a week before the experiment. Mice are inoculated subcutaneously with 2x106 cancer cells in 100 pl of fresh culture medium. Ten days later, the mice are randomly separated into control and treatment group. l group receives 100 ill PBS and treatment group receives 100 pl AAD fusion protein intraperitoneally weekly. Tumor size is measured by caliper and tumor volume is calculated using formula: h x width2)/2. Blood draw are obtained at Day 5 after each treatment for plasma measurement of arginine.

Claims (23)

WHAT IS CLAIMED IS:

1. An albumin-binding arginine deiminase fusion protein comprising a first portion comprising one or two components selected from an albumin-binding domain, an albumin-binding peptide or an n-binding protein(s) fused to a second portion comprising arginine deiminase to form the albumin-binding arginine deiminase fusion protein, and one or more linker molecules; the first portion being positioned far from active site of the second portion by said linker le such that the albumin-binding arginine deiminase fusion protein retains the activity of arginine deiminase and binds serum albumin with r function of one portion of the fusion n being interfered with by the other portion of the fusion protein, wherein the albumin-binding ne deiminase fusion protein comprises a sequence selected from SEQ ID NO: 36, 37, 38, 39, 40, or 41.

2. The albumin-binding arginine deiminase fusion protein of claim 1 wherein the two components of the first portion are the same.

3. The albumin-binding arginine deiminase fusion protein of claim 1 wherein the two components of the first n are different.

4. The albumin-binding arginine deiminase fusion n of claim 1 wherein the albumin-binding domain, peptide or protein is SEQ ID NO: 46, 47, 48, or 49.

5. The albumin-binding arginine deiminase fusion protein of claim 1 n the linker molecule comprises a sequence selected from SEQ ID NO: 50, 51, 52, 53, or serineglycine-serine (SGS) amino acid sequence.

6. The albumin-binding arginine deiminase fusion protein of claim 1 further comprising at least one of Poly-N or a His tag.

7. The n-binding arginine deiminase fusion protein of claim 1 n the arginine deiminase is produced from Mycoplasma arginini.

8. The albumin-binding arginine ase fusion protein of claim 1 wherein the arginine deiminase is produced from Bacillus cereus.

9. The albumin-binding arginine deiminase fusion n of claim 1 wherein the fusion protein is formed by ng the arginine ase having a N-terminal cysteine residue with a reactive thioester at C-terminus of the albumin-binding domain so that the arginine deiminase and the albumin-binding domain are linked by a covalent bond.

10. The albumin-binding arginine deiminase fusion protein of claim 1 wherein the fusion protein is formed by reacting the albumin-binding domain having a N-terminal cysteine residue with a reactive thioester at C-terminus of the arginine ase so that the arginine deiminase and the n-binding domain are linked by a covalent bond.

11. The albumin-binding arginine deiminase fusion protein of claim 1 wherein the fusion protein is formed by using SEQ ID NO: 42 and 43 and by reacting the arginine deiminase having a inal cysteine residue with a reactive thioester at C-terminus of the albumin-binding domain so that the ne deiminase and the albumin-binding domain are linked by a covalent bond.

12. Use of the albumin-binding arginine ase fusion protein according to any one of claims 1 to 11 in the ation of a medicament for treating arginine-dependent diseases, namely cancer, in a patient, wherein a clinically effective amount of the medicament is to be administered to the patient, and wherein the medicament is for reducing the availability of circulating arginine.

13. The use according to claim 12 wherein the cancer is pancreatic cancer, leukemia, head and neck cancer, colorectal cancer, lung cancer, breast cancer, liver cancer, nasopharyngeal cancer, esophageal cancer, prostate cancer, stomach cancer, cervical cancer or brain .

14. A method of making the albumin-binding arginine deiminase fusion protein of claim 1 comprising ucting a fusion gene coding for the albumin-binding arginine deiminase fusion protein, inserting the fusion gene into a vector, ing the vector into a host organism and expressing a protein including the albumin-binding arginine deiminase fusion protein of claim 1.

15. The method of making the n-binding arginine deiminase fusion protein according to claim 14 further comprising purifying the fusion n.

16. The method of making the albumin-binding arginine deiminase fusion protein according to claim 15 wherein the purifying is performed by chromatography.

17. The method of making the albumin-binding arginine deiminase fusion protein according to claim 15 wherein the purifying is performed from soluble fractions of crude proteins.

18. The method of making the albumin-binding arginine deiminase fusion protein according to claim 15 wherein the ing is performed from insoluble fractions of crude proteins.

19. A method of making the albumin-binding ase fusion n of claim 1 by intein mediated protein ligation between the albumin-binding domain, albumin-binding peptide or albumin-binding protein(s) and the second portion comprising arginine deiminase.

20. A pharmaceutical composition sing the albumin-binding arginine deiminase fusion protein of claim 1 in a pharmaceutically-acceptable carrier.

21. The pharmaceutical composition of claim 20 wherein the composition has a pH in a range of 5.5 to 9.5.

22. The pharmaceutical composition of claim 20 wherein the ition has a pH of 7.4.

23. The pharmaceutical composition of claim 20 wherein the composition has a pH of 6.5.