NZ708615B2 - Novel modulators and methods of use - Google Patents

Novel modulators and methods of use Download PDF

Info

Publication number
NZ708615B2
NZ708615B2 NZ708615A NZ70861512A NZ708615B2 NZ 708615 B2 NZ708615 B2 NZ 708615B2 NZ 708615 A NZ708615 A NZ 708615A NZ 70861512 A NZ70861512 A NZ 70861512A NZ 708615 B2 NZ708615 B2 NZ 708615B2
Authority
NZ
New Zealand
Prior art keywords
antibody
cancer
ptk7
seq
cells
Prior art date
Application number
NZ708615A
Other versions
NZ708615A (en
Inventor
Alex Bankovich
Jeffrey Bernstein
Scott J Dylla
Orit Foord
Alexandra Leida Liana Lazetic
Robert A Stull
Original Assignee
Abbvie Stemcentrx Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2011/050451 external-priority patent/WO2012031280A2/en
Application filed by Abbvie Stemcentrx Llc filed Critical Abbvie Stemcentrx Llc
Publication of NZ708615A publication Critical patent/NZ708615A/en
Publication of NZ708615B2 publication Critical patent/NZ708615B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6871—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting an enzyme
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/42—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes

Abstract

Disclosed is an antibody or fragment thereof that specifically binds to human PTK7 comprising three CDRs of a light chain variable region set forth as SEQ ID NO: 62 and three CDRs of a heavy chain variable region set forth as SEQ ID NO: 63. Further disclosed is the use of said antibody or fragment thereof for the manufacture of a medicament for detecting, diagnosing, or monitoring cancer in a subject, wherein the antibody or fragment thereof is conjugated to a detectable agent. hereof for the manufacture of a medicament for detecting, diagnosing, or monitoring cancer in a subject, wherein the antibody or fragment thereof is conjugated to a detectable agent.

Description

NOVEL MODULATORS AND METHODS OF USE CROSS REFERENCED APPLICATIONS The present application is a divisional application of New Zealand Application No. 615285, which is incorporated in its entirety herein by reference. [001a] This application claims priority to U.S. Provisional Application Ser. No. 61/444,614 filed February 18, 2011 and Patent ation Treaty (PCT); No. , filed September 2, 2011, each of which is orated herein by reference in its entirety.
SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on January 26, 2012, is named 112304PCT.txt and is 163,049 bytes in size.
FIELD OF THE INVENTION This application generally relates to novel compositions and methods of their use in preventing, treating or ameliorating hyperproliferative disorders and any expansion, recurrence, relapse or metastasis thereof. In a broad aspect, the present invention relates to the use of protein tyrosine kinase 7 (PTK7) modulators, ing anti-PTK7 dies and fusion constructs, for the treatment, diagnosis or prophylaxis of neoplastic disorders. Particularly preferred embodiments of the present invention provide for the use of such PTK7 modulators for the therapeutic treatment of malignancies comprising a ion in tumor initiating cell frequency.
BACKGROUND OF THE INVENTION [003a] Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common general knowledge in the field.
Stem and itor cell differentiation and cell proliferation are normal ongoing ses that act in concert to support tissue growth during organogenesis and cell replacement and repair of most tissues during the lifetime of all living organisms. Differentiation and proliferation decisions are often controlled by us factors and signals that are balanced to in cell fate decisions and tissue architecture. Normal tissue architecture is y ined by cells responding to microenvironmental cues that regulate cell division and tissue maturation. Accordingly, cell proliferation and entiation normally occurs only as necessary for the replacement of damaged or dying cells or for growth. Unfortunately, disruption of cell proliferation and/or differentiation can result from a myriad of s including, for example, the under- or overabundance of various signaling chemicals, the presence of altered microenvironments, c ons or some combination thereof. When normal cellular proliferation and/or differentiation is disturbed or somehow disrupted it can lead to various diseases or disorders including hyperproliferative disorders such as cancer.
Conventional treatments for cancer include herapy, radiotherapy, surgery, immunotherapy (e.g., biological se modifiers, vaccines or targeted therapeutics) or combinations thereof. Sadly, Far too many cancers are non~responsive or minimally responsive to such conventional treatments leaving few options for patients. For e, in some patients certain cancers t gene mutations that render them non-responsive despite the general effectiveness of selected therapies. Moreover, depending on the type of cancer some available treatments, such as surgery, may not be viable alternatives. Limitations inherent in current standard of care therapeutics are particularly evident when attempting to care for patients who have undergone previous treatments and have subsequently relapscd. In such cases the failed therapeutic regimens and resulting patient deterioration may contribute to tory tumors which often manifest themselves as a vely sive disease that ultimately proves to be incurable.
Although there have been great improvements in the diagnosis and treatment of cancer over the years, overall survival rates for many solid tumors have remained largely unchanged due to the failure of existing ies to prevent relapse, tumor recurrence and metastases. Thus, it remains a nge to develop more targeted and potent therapies.
One promising area of research involves the use of targeted therapeutics to go after the tumorigenic “seed” cells that appear to underlie many cancers. To that end most solid tissues are now known to contain adult, tissue-resident stem cell populations generating the differentiated cell types that comprise the majority of that tissue. Tumors arising in these tissues similarly consist of heterogeneous populations of cells that also arise from stem cells. but differ markedly in their l proliferation and organization. While it is increasingly recognized that the majority of tumor cells have a limited ability to proliferate, a minority population of cancer cells nly known as cancer stem cells or CSC) have the exclusive ability to extensively self-renew thereby enabling an inherent tumor reinitialing capacity. More specifically, the cancer stem cell hypothesis proposes that there is a ct subset of cells (i.e. CSC) within each tumor (approximately 0.!— %) that is capable of indefinite enewal and of ting tumor cells progressively limited in their replication ty as a result of differentiation to tumor progenitor cells and, subsequently, to terminally differentiated tumor cells.
In recent years it has become more evident these CSC (also known as tumor perpetuating cells or TPC) might be more resistant to traditional chemotherapeutic agents or radiation and thus persist after standard of care al therapies to later fuel the growth of refractory tumors, secondary tumors and promote metastases. In this regard cancer stem cells have been implicated in promoting the migratory and invasive potential of various sia. Moreover, growing evidence suggests that pathways that regulate genesis and/or the self-renewal of normal tissue-resident stem cells are deregulated or altered in CSC, resulting in the continuous ion of selfirenewing cancer cells and tumor formation. See generally Al~Hajj et al., 2004, PMID: 15378087; and a et 211., 2007, PMID: 17548814; each of which is incorporated herein in its entirety by reference. Thus, the effectiveness of ional, as well as more recent targeted treatment methods, has apparently been limited by the existence and/or emergence of resistant cancer cells that are capable of perpetuating the cancer even in face of these diverse ent methods. Huff et 211,, European Journal of Cancer 42: l293— 1297 (2006) and Zhou et al., Nature Reviews Drug Discovery 8: 3 (2009) each of which is incorporated herein in its entirety by reference. Such ations are confirmed by the consistent inability of traditional debulking agents to substantially increase patient survival when suffering from solid tumors, and through the development of an increasingly sephisticated understanding as to how tumors grow, recur and metastasize. Accordingly, recent strategies for treating neoplastic disorders have recognized the importance of eliminating, depleting, silencing or promoting the differentiation ol’ tumor perpetuating cells so as to diminish the possibility of tumor recurrence or metastasis leading to patient relapse.
Efforts to devel0p such strategies have incorporated recent work involving non— traditional xenograft (NTX) models, wherein primary human solid tumor ens are implanted and passaged exclusively in compromised mice. In numerous cancers such techniques confirm the existence of a subpopulation of cells with the unique ability to generate geneous tumors and fuel their growth indefinitely. As previously hypothesized, work in NTX models has confirmed that identified CSC lations of tumor cells appear more resistant to debulking ns such as chemotherapy and radiation, potentially explaining the disparity between clinical se rates and overall survival. Further, employment of NTX models in CSC research has sparked a fundamental change in drug discovery and preclinical tion of drug candidates that may lead to CSC-targeted therapies having a major impact on tumor recurrence and metastasis thereby improving patient survival rates. While progress has been made, inherent technical difficulties associated with ng y and/or xenograft tumor tissue, along with a lack of experimental platforms to characterize CSC identity and differentiation potential, pose major challenges. As such, there remains a substantial need to selectively target cancer stem cells and develop diagnostic, prophylactic or therapeutic compounds or methods that may be used in the treatment, prevention and/or management of hyperproliferativc disorders. [008a] It is an object of the present invention to overcome or ameliorate at least one of the disadvantages of the prior art, or to provide a useful alternative. [008b] Unless the t clearly requires otherwise, throughout the description and the claims, the words ise”, “comprising”, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not d to”.
Y OF THE ION The present invention, in a broad sense, is directed to methods, compounds, compositions and articles of manufacture that may be used in the treatment of PTK7 associated disorders (e.g., roliferative disorders or neoplastic disorders). The present invention provides novel protein tyrosine kinase 7 (or PTK7) modulators that effectively target tumor cells and/or cancer stem cells and may be used to treat patients suffering from a wide variety of malignancies. As will be discussed in more detail herein, there are presently several known PTK7 isoforms and the disclosed modulators preferably comprise or associate with one or more of the same. Moreover, in certain embodiments the disclosed PTK7 tors may comprise any compound that recognizes, competes, agonizes, antagonizes, interacts, binds or associates with a PTK7 polypeptide or gene (or fragment thereof) and modulates, adjusts, alters, changes or modifies the impact of the PTK7 protein on one or more logical pathways. Thus, in a broad sense the present invention is generally directed to isolated PTK7 modulators and use thereof. In red embodiments the invention is more particularly directed to ed PTK7 modulators comprising antibodies (i.e., antibodies that immunopreferentially bind, react with or associate with at least one isoform of PTK7). Moreover, as discussed ively below, such modulators may be used to provide pharmaceutical compositions useful for the prophylaxis, diagnosis or treatment of proliferative disorders. [009a] According to a first aspect, the invention provides an antibody or fragment thereof that specifically binds to human PTK7 comprising three CDRs of a light chain variable region set forth as SEQ ID NO: 62 and three CDRs of a heavy chain le region set forth as SEQ ID NO: 63. [009a] According to a second aspect, the invention provides an antibody drug conjugate comprising the antibody or fragment thereof according to the first aspect, wherein the antibody or fragment thereof is conjugated, linked, or otherwise associated with a cytotoxic agent. [009a] According to a third aspect, the invention provides a ceutical composition comprising the isolated antibody or fragment thereof according to the first aspect. [009a] ing to a fourth aspect, the invention provides a pharmaceutical composition comprising the antibody drug conjugate according to the second aspect. [009a] According to a fifth aspect, the invention provides a nucleic acid encoding a light chain variable region or a heavy chain variable region of the antibody or fragment thereof ing to the first aspect. [009a] According to a sixth aspect, the invention provides a nucleic acid encoding a light chain variable region set forth as SEQ ID NO: 48 or 62, and/or a heavy chain variable region set forth as SEQ ID NO: 49 or 63. [009a] According to a h aspect, the invention provides a vector comprising the nucleic acid according to the fifth or sixth aspects. [009a] According to an eighth aspect, the invention provides a non-human or isolated host cell sing the nucleic acid according to the fifth or sixth aspects. [009a] According to a ninth aspect, the invention provides a man or isolated host cell comprising the vector of the h aspect. [009a] According to a tenth aspect, the invention provides use of the antibody or nt thereof according to the first aspect for the manufacture of a medicament for detecting, diagnosing, or monitoring cancer in a subject, wherein the antibody or fragment thereof is conjugated to a detectable agent. [009a] According to an eleventh aspect, the invention provides use of a therapeutically effective dose of an dy conjugate comprising the antibody or fragment thereof according to the first aspect for the cture of a medicament for treating cancer in a subject, wherein the antibody or fragment f is conjugated, linked, or otherwise ated with a cytotoxic agent. [009a] According to a twelfth aspect, the invention provides use of an antibody conjugate comprising the dy or fragment thereof according to the first aspect for the manufacture of a medicament for reducing the frequency of tumor initiating cells in a subject, wherein the antibody or fragment thereof is conjugated, , or otherwise associated with a cytotoxic agent. [009a] According to a thirteenth aspect, the invention provides use of an antibody or a fragment thereof that specifically binds to PTK7 for the manufacture of a medicament for treating a neoplastic er, wherein the antibody or fragment thereof is capable of being conjugated, linked or otherwise associated with a cytotoxic agent and has an EC50 against PTK7-expressing cells from 0.5 pM to 150 pM when conjugated, linked or ise ated with the cytotoxic agent.
In selected embodiments of the invention, PTK7 modulators may comprise a PTK7 polypeptide or fragments thereof, either in an isolated form or fused or associated with other moieties (e.g., Fc-PTK7, PEG-PTK7 or PTK7 associated with a targeting moiety). In other selected embodiments PTK7 modulators may comprise PTK7 antagonists which, for the purposes of the instant application, shall be held to mean any construct or compound that recognizes, competes, interacts, binds or associates with PTK7 and neutralizes, eliminates, s, sensitizes, reprograms, inhibits or controls the growth of neoplastic cells including tumor initiating cells. In preferred embodiments the PTK7 modulators of the instant invention comprise anti-PTK7 antibodies, or fragments or derivatives f, that have unexpectedly been found to silence, neutralize, , decrease, deplete, moderate, diminish, reprogram, eliminate, or otherwise inhibit the y of tumor initiating cells to propagate, maintain, expand, erate or otherwise facilitate the survival, ence, regeneration and/or metastasis of neoplastic cells. In particularly preferred embodiments the antibodies or reactive fragments may be associated with or conjugated to one or more ancer agents (e.g., a cytotoxic agent).
In selected embodiments compatible PTK7 modulators may comprise an antibody having a light chain variable region and a heavy chain variable region wherein said light chain variable region ses an amino acid sequence having at least 60% identity to an amino acid sequence selected from the group consisting of amino acid sequences as set forth in SEQ ID NO: , SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ iD NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54.
SEQ ID NO: 56, SEQ ID NO: 58 and SEQ ID NO: 60 and n said heavy chain variable region comprises an amino acid sequence having at least 60% identity to an amino acid sequence selected from the group consisting of amino acid sequences as set forth in SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ lD NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 , SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, and SEQ ID NO: 6l. [012} Of course, in view of the instant disclosure those skilled in the art could readily identify CDRS associated with each of the entioned heavy and light chain variable regions and use those CDRs to engineer or fabricate chimeric, humanized or CDR grafted antibodies without undue experimentation. As such, in selected ments the present ion is ed to anti-PTK7 antibodies comprising one or more CDRs from a variable region sequence set forth in or . In preferred embodiments such antibodies will comprise monoclonal antibodies and, in even more preferred embodiments will se chimeric, CDR grafted or zed antibodies.
As discussed in more detail below still other embodiments will comprise such antibodies conjugated or associated with one or more cytotoxic agents. [013} Accordingly, in other embodiments the instant invention will comprise a humanized P’I‘K? modulator selected from the group consisting of hSC6.23, hSC6.24, hSC6.4l and hSC6.58.
Still other embodiments are directed to a PTK? modulator comprising a humanized antibody wherein said humanized dy comprises a light chain variable region and a heavy chain variable region wherein said light chain variable region comprises an amino acid sequence having at least 60% identity to an amino acid sequence selected from the group consisting of amino acid sequences as set forth in SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66 and SEQ ID NO: 68 and n said heavy chain variable region comprises an amino acid sequence having at least 60% identity to an amino acid sequence selected from the group consisting of amino acid sequences as set forth in SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 and SEQ ID NO: 69. {014} As previously indicated one aspect of the invention comprises the unexpected association of PTK’] polypeptides with cancer stem cells. Thus, in certain other embodiments the invention will se a PTK7 modulator that reduces the frequency of tumor initiating cells upon administration to a t. Preferably the reduction in frequency will be determined using in vitro or in viva limiting dilution analysis. in particularly preferred embodiments such analysis may be conducted using in viva limiting dilution analysis sing transplant of live human tumor cells into immunocompromised mice. Alternatively, the limiting dilution analysis may be conducted using in vitro limiting dilution analysis comprising limiting dilution deposition of live human tumor cells into in vilro colony supporting conditions. In either case, the analysis, calculation or quantification of the reduction in frequency will preferably comprise the use of n distribution statistics to provide an accurate accounting. 11 will be appreciated that, while such quantification s are preferred, other, less labor intensive methodology such as flow cytometry or immunohistochemistry may also be used to provide the desired values and, accordingly, are expressly contemplated as being within the scope of the instant invention. In such cases the reduction in ncy may be determined using flow tric analysis or irnmunohistochemical detection of tumor cell surface markers known to enrich for tumor initiating cells.
As such, in another preferred ment of the instant invention cornprises a method of treating a PTK7 associated er comprising administering a therapeutically effective amount of a PTK7 modulator to a t in need thereof whereby the frequency of tumor initiating cells is reduced. ably the PTK7 associated disorder comprises a neoplastic disorder. Again, the reduction in the tumor initiating cell frequency will preferably be determined using in vitro or in vivo limiting dilution analysis.
In this regard it will be appreciated that the present invention is based, at least in part, upon the ery that PTK7 immunogens are associated with tumor uating cells (i.e., cancer stem cells) that are involved in the etiology of various neoplasia. More specifically, the instant application unexpectedly demonstrates that the administration of various exemplary PTK7 modulators can mediate, reduce, deplete, inhibit or eliminate tumorigenic signaling by tumor initiating cells (i.e., reduce the frequency of tumor initiating cells). This reduced signaling, whether by depletion, neutralization, reduction, elimination, reprogramming or ing of the tumor initiating cells or by modifying tumor cell logy (cg, induced differentiation. niche disruption), in turn allows for the more ive treatment of PTK? associated disorders by inhibiting tumorigenesis, tumor maintenance, expansion and/or metastasis and recurrence. [017} Besides the aforementioned association with cancer stem cells, there is evidence that PTK7 isoforms may be involved in enesis, migration of endothelial cells and Specific developmental ing cascades that have been tied to oncogenesis (i.e., Wnt signaling pathways). ention in such cellular interactions, using the novel PTK7 modulators described herein, may thereby ameliorate or treat a disorder by more than one mechanism (i.e., tumor initiating cell reduction and disruption oncogenic pathway signaling) to provide additive or synergistic effects. Still other preferred embodiments may take advantage of the cellular internalization of cell surface PTK7 to r a modulator mediated anticancer agent. in this regard it will be iated that the present invention is not limited by any particular mechanism of action but rather encompasses the broad use of the disclosed modulators to treat PTK7 associated disorders (including s neoplasia).
Thus, other facets of the instant invention exploit the ability of the disclosed modulators to potentially disrupt oncogenic survival pathways while simultaneously silencing tumor initiating Cells. Such multi-active PTK? modulators (cg, PTK7 antagonists) may prove to be particularly effective when used in combination with standard of care anti-cancer agents or debulking agents. ingly red embodiments of the instant invention comprise using the disclosed modulators as anti-metastatic agents for maintenance therapy ing initial treatments. In addition, two or more PTK7 nists (cg. dies that specifically bind to two discrete epitopes on PTK?) may be used in ation in accordance with the present teachings.
Moreover, as discussed in some detail below, the PTK7 modulators of the present invention may be used in a conjugated or unconjugated state and, optionally, as a izing agent in combination with a variety chemical or ical anti-cancer agents. {019] Accordingly another preferred embodiment of the t invention comprises a method of sensitizing a tumor in a subject for treatment with an anti-cancer agent comprising the step of administering a PTK7 modulator to said t. Other embodiments comprise a method of reducing metastasis following treatment comprising administering a PTK7 modulator to a subject in need thereof. In a particularly preferred aspect of the invention the PTK7 modulator will ically result in a reduction of tumor initiating cell frequency is as determined using in vitro or in viva limiting dilution analysis.
More generally preferred embodiments of the invention comprise a method of treating a P'TK7 associated disorder in a subject in need f comprising the step of administering a PTK7 modulator to the subject. In particularly preferred embodiments the PTK7 modulator will be associated (e.g., conjugated) with an anti-cancer agent. In yet other embodiments the PTK7 modulator will internalize following association or binding with the PTK7 on or near the surface of the cell. er the beneficial aspects of the instant invention, including any disruption of signaling pathways and collateral benefits, may be achieved whether the subject tumor tissue exhibits elevated levels of PTK7 or reduced or depressed levels of P’l‘K? as compared with normal adjacent tissue. [0211 in yet r aspect the present ion will comprise a method of treating a subject suffering front neoplastic disorder sing the step of administering a therapeutically ive amount of at least one internalizing PTK? modulator. Preferred embodiments will comprise the stration of internalizing antibody modulators wherein‘ in other selected embodiments, the alizing antibody modulators are conjugated or associated with a cytotoxic agent. [0221 Other embodiments are directed to a method of treating a subject suffering from a PTK7 associated disorder comprising the step of administering a therapeutically effective amount of at least one.depleting PTK7 modulator. [023} In yet another embodiment the t invention provides methods of maintenance therapy wherein the sed effectors or modulators are administered over a period of time following an initial procedure (e.g., chemotherapeutic, radiation or surgery) designed to remove at least a portion of the tumor mass. Such therapeutic regimens may be administered over a period of weeks, a period of months or even a period of years wherein the PTK7 modulators may act prophylactically to inhibit metastasis and/or tumor recurrence. in yet other embodiments the disclosed modulators may be administrated in concert with known debulking regimens to prevent or retard metastasis, tttmor maintenance or recurrence. {024] it will further be appreciated that the PTK? modulators of the instant invention may be fabricated and selected to react with a single isoform of PTK? or a select few ms (Le. provided by splice variants) of the protein or, conversely, may comprise a pan—PTK7 modulator that reacts or associates with some or all PTK7 isoforms (five have currently been identified).
More specifically. as disclosed herein preferred modulators such as antibodies may be generated and selected so that they react with domains that are exhibited by single splice ts (e.g., at specific nctions) or with 1g domains that are conserved across multiple or all PTK’? isoforms. This is significant with rcSpcct to the instant ion in that certain isoforms may be preferably expressed on 'I‘IC and can therefore serve as therapeutic targets to provide for the selective reduction in tumorigenic cell frequency and/or depletion of cancer stem cell populations. [025} Accordingly, in a selected embodiment the ion comprises a pan~PTK7 modulator.
In other selected ments the invention comprises a PTK’I modulator that immunospecifically associates with one or more splice variants or ms. Preferably the splice variants may be selected from the group consisting of isoform :1, isoform b, isoform c and isoform d. In yet other embodiments the present invention ses a method of treating a subject in need f comprising administering a therapeutically effective amount of a pan-FTK'I tor. Still other embodiments comprise a method of treating a subject in need thereof comprising administering a therapeutically ive amount of a PTK7 modulator that immunospecifically associates with one or more isoforms. [0261 Beyond the therapeutic uses discussed above it will also be appreciated that the modulators of the instant ion may be used to diagnose PTK? related disorders and, in particular, hyperproliferative disorders. In some embodiments the modulator may be stered to the subject and detected or monitored in viva. Those of skill in the art will appreciate that such modulators may be labeled or associated with markers or reporters as disclosed below and detected using any one of a number of standard techniques (cg, MRI, CAT scan PET scan, etc). {027] Thus. in some embodiments the invention will comprise a method of diagnosing, detecting or monitoring a PTK7 associated disorder in vivo in a subject in need thereof comprising the step of administering a PTK7 modulator.
In other instances the modulators may be used in an in vitro diagnostic g using art~ recognized ures. As such, a preferred embodiment comprises a method of sing a hyperproliferative disorder in a subject in need thereof sing the steps of: a. obtaining a tissue sample from said subject; b. ting the tissue sample with at least one PTK7 modulator; and c. detecting or quantifying the PTK7 modulator associated with the sample.
Such methods may be easily discerned in conjunction with the instant application and may be readily performed using generally available commercial technology such as automatic plate readers, dedicated er systems, etc. in ed embodiments the PRC] modulator will be associated with tumor perpetuating cells present in the sample. In other preferred embodiments the detecting or quantifying step will comprise a reduction of tumor initiating cell frequency and detection thereof. Moreover, limiting on analysis may be conducted as previously d to above and will preferably employ the use of Poisson distribution statistics to provide an accurate accounting as to the reduction of ncy. {030] In a similar vein the present invention also provides kits that are useful in the diagnosis and monitoring of P’I‘K7 associated disorders such as . To this end the present invention preferably provides an article of manufacture useful for diagnosing or treating PTK7 associated disorders comprising a receptacle sing a PTK7 modulator and instructional materials for using said PTK? modulator to treat or diagnose the PTK? ated disorder. [03 1] Other preferred embodiments of the invention also exploit the properties of the disclosed modulators as an instrument useful for identifying, isolating, sectioning or enriching populations or subpopulations of tumor initiating cells through methods such as flow cytometric analysis, fluorescence activated cell sorting (FACS) or laser mediated sectioning.
As such, another preferred ment of the instant invention is directed to a method of identifying, isolating, sectioning or enriching a population of tumor initiating cells comprising the step of contacting said tumor initiating cells with a PTK? modulator. {033] The foregoing is a summary and thus contains. by ity, simplifications. generalizations, and omissions of detail; consequently, those skilled in the art will appreciate that the summary is illustrative only and is not intended to be in any way limiting. Other aspects, features, and advantages of the s, compositions and/or devices and/or other subject matter described herein will become apparent in the teachings set forth herein. The summary is pr0vided to introduce a selection ofconeepts in a simplified form that are further described below in the Detailed Description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.
BRIEF DESCRIPTION OFTHE FIGURES [O34] FIGS. lA —- lC depict, respectively, the nucleic acid sequence encoding human PTK7 (SEQ ID NO: 1), the amino acid sequence of an ary human PTK? variant (SEQ ID NO: 2) and depicts the aligned and notated sequences of four representative isol‘orms of PTK7 (SEQ 1D NOS: 3-6) wherein the underlined section in represents PTK7~l Open reading frame, the underlined section in FIG. [B s an ellular domain of PTK7 as defined herein and FIG. lC shows a protein alignment of four known exemplary isoforms of the human PTK7 protein as reported in the Gene database at NCBI in accessions: isol’orm a = 812, isol'orm b = NPu690619; isoform c = NP_690620; isoi’orm d = 62|) wherein FIG. lC further discloses the motif peptides, "GxGxFGxV," "HRDLxxxN," and "SDVWSXG" as SEQ ID NOS: l l- l 3, respectivdy. is a cal representation depicting the gene expression levels of PTK'} in untreated (-) and in ecan treated (+) mice as measured using whole transcriptome sequencing of highly enriched tumor progenitor cell (TProg), tumor perpetuating cell (TPC) and non- tumorigenic cell (NTG) populations obtained from a subset of a whole ctal tumor specimen. is a graphical representation g the ve gene expression levels of human PTK7 in highiy enriched tumor itor cell (TProg) and tumor perpetuating cell (TPC) populations obtained from mice bearing one of three different non—traditional xenograft (NTX) colorectal or pancreatic tumor cell lines, and normalized against non—tumorigenic (NTG) enriched cell populations as measured using quantitative RT—PCR.
FIGS. 4A and 4B are graphical representations showing the relative gene expression levels of human PTK? as measured using RT-PCR in whole colorectai tumor specimens from ts with Stage I-IV disease, as normalized against the mean of expression in normal colon and rectum tissue () or matched with normal adjacent tissue (). [038} FIGS. 5A and SB are graphical representations showing the relative or absolute gene expression levels, respectively, of human PTK7 genes as measured by RT-PCR in whole tumor specimens (grey dot) or matched NAT (white dots) from patients with one of eighteen ent solid tumor types. {039] FIGS. 6A and 63 provide, in a tabular form, the contiguous amino acid sequences of heavy and light chain le regions of a number of murine and humanized exemplary PTK7 modulators isolated, cloned and engineered as bed in the Examples .
FIGS. 7A — 7E provide, in graphical and r representations, physiochemical characteristics of exemplary P'l‘K7 modulators wherein depicts binding characteristics of certain modulators with respect to marine and human PTK7, provides affinity. binning and cross-reactivity data for ed tors, FIGS. 7C and 7D show comparative binding characteristics of a ed murine modulator and its humanized rpart and 3 provides g affinities for selected tors with respect to human PTK7 and its murine ortholog. {041} FIGS. 8A ~ SG depict various PTK7 constructs in accordance with the instant invention wherein FIGS. 8A — 8F e the amino acid sequences of six PTK? modulator variants in the form of 7~ECD constructs wherein the extracellular domain portion of each construct is varied and schematically illustrates the seven lg domains of the extracellular portion of PTK? along with the ELISA d binding regions of several PTK? modulators as indicated by brackets.
FIGS. 9A~913 illustrate expression levels of PTK7 protein in different tumor iysates and in NTX samples wherein FIGS. 9A — 9D depict tumor lysate levels for various tumors and diseasc stages as compared with normal adjacent tissue controls and provides histograms illustrating the staining of human non-traditional xenografts with selected modulators where control staining (gray) was compared to staining on non-tumorogenic (dashed) and putative cancer stem cell populations (solid). {043] FIGS. lOA-IOE graphically illustrate the capacity of a selected tor of the instant invention to internalize upon binding with PTK7 on a cell surface wherein C shows the fluorescent shift associated with an exemplary modulator (i.e. 8C6. 10.2 termed H 10 in C) and FIGS. IDA and 1013 represent controls, D demonstrate that exemplary modulators from liybridoma supernatants may be screened for internalization as compared to purified controls [’3& (SC6.2.35t 8C6. 10.2 and SC6.25.l termed H235, H l0.2 and l-l25.l respectively) and FIG. IOE illustrates the extent of internalization of s tors (each data point represents a discrete modulator) where the dashed line denotes the background cutoff and the number of PTK7 molecules that are internalized by the cell in response to the binding event is plotted on the y axis. {044] FIGS. 1 1A - l lD graphically illustrate the capability of the disclosed modulators to immunospecifically mediate the delivery of cytotoxic agents and promote cell killing wherein FIG. l IA depicts the use of three exemplary modulators (SC6.2.35, SC6.10.2 and SC6.25.3 termed , Hl0.2 and 1-1253 respectively) as targeting moieties to direct cytotoxic payloads to cells expressing PTK7 and where FIGS. ME ~ 1 1D illustrate the ability of four onal exemplary modulators to eliminate three te cell lines wherein in each FIG. the downward g curve is tive of cell killing through internalized toxin. {045] evidences the ability of three exemplary PTK7 modulators to immunospecifically mediate the delivery of cytotoxic agents and thereby reduce tumor cell viability in a variety NTX tumorcell lines.
FIGS. 13A — 13C are indicative of the capacity of the disclosed moduiators to reduce the frequency of tumor perpetuating cells and inhibit their tumorigenic potential where FIGS. 13A and lBB show that tor (i.e., 3C6.2.35 labeled SC6.H2) mediated delivery of cytotoxic agents s the viability of two discrete NTX breast tumor cell populations and FIG. [3C depicts the reduced tumorigenicity of the d cell lines upon implantation into immunocompromised mice. {0471 demonstrates the capability of exemplary humanized PTK7 modulators of the instant invention to effectively mediate the specific delivery and internalization of cytotoxic agents to PTK7 expressing cells.
DETAILED DESCRIPTION on THE INVENTION 1. Introduction While the present invention may be embodied in many different forms, disclosed herein are specific illustrative embodiments thereof that exemplify the ples of the invention. It should be emphasized that the t invention is not limited to the specific embodiments rated. Moreover, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
As previously alluded to, it has surprisingly been found that the expression of PTK7, including various isoforms, is associated with neoplastic growth and roliferative disorders and that such ligands provide useful tumor markers which may be exploited in the treatment of related diseases. More specifically, it has been discovered that PTK? modulators such as those disclosed herein may advantageously be used in the diagnosis, theragnosis, treatment or prevention of neoplastic disorders in subjects in need thereof. Accordingly, while preferred ments of the inventiOn will be discussed extensively below, particularly in the context of cancer stem cells and their interactions with the disclosed tors, those skilled in the art will appreciate that the scope of the t invention is not limited by such exemplary embodiments. Rather, the present invention and the appended claims are broadly and sly directed to PTK? modulators and their use in the sis, theragnosis, treatment or prevention of a variety of PTK? associated or mediated disorders, including neoplastic or hyperproliferative disorders, regardless of any particular mechanism of action or specifically targeted tumor component.
It will further be iated that, in st to s prior art disclosures, the present invention is largely directed to immunospecific modulators of the various isoforms of PTK7 rather than general protein tyrosine kinase modulators. That is, while the class of protein tyrosine kinase receptors have been widely ated in several types of disorders and generally ed for therapeutic intervention, P’I‘K7 specific modulators have heretofore attracted less attention. in part this may arise from the belief that interference with general PTK activity cularly with small molecules that interact with conserved kinase domains) is more effective from a therapeutic standpoint as kinase redundancy would likely compensate for any specific antagonism of particular members of the class. Moreover, P'I‘K7 reportedly comprises an inactive kinase domain (or pseudokinase domain) that may have discouraged its exploitation as a eutic target. {05[] Conversely, the present invention comprises the use of immunospecific modulators that preferentially react with one or more ms of PTK’? to provide therapeutic benefits. As briefly discussed above in certain embodiments the modulators of the present ion may be generated and selected to associate with a single PTK7 isoform while in other embodiments the selected modulators may react with more than one isoform or all recognized isol’orms of PTK7. In these latter embodiments the present invention may comprise modulators that associate or react with more than one PTK7 isoform thereby providing an cted additive or synergistic effect that may allow for quiescence of more than one PTK7 mediated pathway {052] More generally, as demonstrated in the instant application, the disclosed immunospecific PTK7 modulators can effectively be used to target and eliminate or otherwise incapacitate tumorigenic cells and treat PTK7 associated disorders (e.g., neoplasia). As used herein a PTK7 ated disorder shall be held to mean any disorder or disease (including proliferative disorders) that is marked, diagnosed or identified by a phenotypic aberration of PTK7 expression during the course or gy of the disease or disorder. In this regard the ypic aberration may, for e, comprise elevated or depressed levels of PTK7 expression, abnormal PTK7 expression on certain definable cell populations or abnormal PTK7 expression at an inapprOpriate phase or stage ofa cell cle. [053i Besides the general association discussed immediately ab0ve, the inventors have further discovered a heretofore unknown phenotypical association between selected tumor initiating cells (TIC) and PTK7. In this regard, it has been found that selected TICs express elevated levels of PTK7s when compared to normal tissue and non-tumorigenic cells (NTG), which er comprise much of a solid tumor. Thus, PTK7 isoforms comprise tumor associated markets (or antigens or immunogens) and have been found to provide effective agents for the detection and suppression OFTIC and associated neoplasia due to altered levels of the proteins on cell surfaces or in the tumor microenvironment. More. specifically, it has further been ered that P’I‘K’l tors, including immunoreactive antagonists and antibodies that associate bind or react with the ns, effectively reduce the frequency of tumor initiating cells and are therefore useful in eliminating, depleting, incapacitating, reducing, promoting the differentiation of, or otherwise precluding or limiting the ability of these tumor—initiating cells to lie t and/or continue to fuel tumor , asis or recurrence in a patient. As sed in more detail below, the TlC tumor cell subpopulation is composed of both tumor perpetuating cells (TPC) and highly proliferative tumor progenitor cells (TProg).
In view of these discoveries, those skilled in the art will appreciate that the present invention further provides PTK7 modulators and their use in reducing the frequency of tumor initiating cells. As will be discussed extensively below, P’I‘K7 modulators of the invention broadly comprise any compound that recognizes, reacts, competes, antagonizes, interacts, binds, agonizes, or ates with PTK7 or PTK7 or their genes. By these interactions, the PTK7 modulators thereby reduce or moderate the frequency of tumor initiating cells. Exemplary modulators disclosed herein comprise nucleotides, oligonucleotides, polynucleotides, peptides or polypeptides.
In certain preferred embodiments the selected modulators will comprise antibodies to PTK7 or immunorcactive nts or derivatives thereof. Such antibodies may be antagonistic or tic in nature and may Optionally be conjugated or ated with a xic agent. In other embodiments, modulators within the instant invention will comprise a PTK7 construct comprising a PTK7 isoform or a reactive fragment thereof. It will be appreciated that such constructs may comprise fusion proteins and can include reactive domains from other polypeptides such as globulins or biological response modifiers. In still other aspects, the PTK’] modulator will comprise a nucleic acid assembly that exerts the desired effects at a genomic level. Still other modulators compatible with the instant teachings will be discussed in detail below.
Whichever form of modulator is ultimately selected it will preferably be in an isolated and purified state prior to introduction into a subject. In this regard an isolated PTK7 modulator shall be construed in a broad sense and in accordance with standard pharmaceutical practice to mean any ation or composition comprising the tor in a state substantially free of unwanted contaminants (biological or otherwise). As will be discusscd in some detail below these preparations may be purified and formulated as desired using various art recognized techniques. Of , it will be appreciated that such isolated preparations may be intentionally formulated or combined with inert or active ingredients as desired to improve the commercial, manufacturing or therapeutic aspects of the finished product and provide pharmaceutical itions. iI. PTK7 logy Protein tyrosine kinase (PTK7), also known as colon carcinoma kinase 4 (CCK4), is a receptor tyrosine kinase originally cloned from normal human melanoeytes (Lee et al., Oncogene 8(12), 1993) and separately from colon carcinoma tissue (Mossie et al., Oncogene “(10), 1995).
The P'I‘K? gene is located at 6p2l.l-pl2.2. Five splice isoforms of human PTK7 have been cloned from testis cDNA (Jung, Ji et al., Biochim Biophvs Aeta 1579, 2002). The ve abundance of the isoforms with respect to one another differs between testis and hepatoma or colon carcinoma lines, but the functional significance of these ms, if any, is unknown. Bioinformatics analyses have suggested that the mouse may s a e Ptk7 isoform from alternatively spliced mRNAs (Forrest, Taylor et ai., Genome Biol 7, 2006). For the purposes of the t application it will be appreciated that the terms “PTK7” and “CCKLl” may be used interchangeably and include splice ts, isoforms, species orthologs and homologs of human PTK7 unless ise dictated by tual constraints. It will further be appreciated that the terms may also refer to any derivative or fragment of a native or variant form of PTK’)’ that contains an cpitone to which a PTK7 protein modulator (e.g., an antibody or immunoreactive fragment) can specifically bind.
Full length PTK7 protein is a type I transmembrane n, with a 674 amino acid ellular domain (ECD), followed by a short TM spanning portion and a 345 amino acid cytoplasmic domain. A complete nucleic acid sequence of an exemplary isoform of human P’I‘K7 (i.e., transcript variant 171‘K7- 1) has Genbank accession number NM_002821 and is represented in (SEQ ID NO: 1). Similarly, a full-length exemplary amino acid sequence of PTK7-l protein is shown in (SEQ ID NO: 2). Note that the PTK7 protein in SEQ ID NO: 2 differs from the translation product of the ined nucleic acid sequence of SEQ ID NO: 1 Ge. isoform a as shown in SEQ ID NO: 3) in that there is a point mutation (L —> P) at position 93 in FIG. lB.
With regard to isoforms shows the annotated alignment of amino acid sequences of four exemplary isoforms of PTK7 as reported in Genbank (Protein accessions: isoform a = 8 l2, SEQ ID NO: 3; isoform b = NP_690619, SEQ ID NO: 5; isoform C = NP~690620, SEQ ID NO: 6; isoform (1 = NPH690621, SEQ ID NO: 4). As previously alluded to the sequence set forth in isoform :1 corresponds to the translation product of the open reading frame from PTK7 t 1 set forth in FIG. IA and is the longest of the isoforms. The other splice isoforms encode extracellular domains lacking various Igcam domains ve to isoform a, as shown. All isoforms encode the same intracellular domain, Conserved submotifs in the catalytic domain of the protein scrim/tyrosine kinases are shown below the PTK7 alignments, as are annotations of the changes in the PTK7 protein thought to render its kinasc domain inactive (e.g., changes in subdomains I and VII). [058} In any event the mature full length PTK7 ECD comprises seven immunoglobulin-like domains while, as shown in FIG. lC the various Splice variants encode PTK7 isoforms that differ in their ECD structure. All isoforms contain a cytoplasmic domain with substantial homology to that found in the general class of tyrosine kinases. However, PTK’I lacks detectable ne kinase activity and, as such, belongs to a subfamily of pseudokinases in which several amino acid changes in various conserved kinase subdomains lead to impaired binding of ATP (Kroiher et al. Bloessavs 23(1), 2001). Specifically, key residues in subdomains I and VII are altered in PTK7 such that direct interactions with the non-transferable phosphates of ATP, as well as chelation of the Mg” cofactor bridging these phosphates, would be impaired (Hanks et 211., Methods Enzymol 200, 199 l ). [059} It will further be appreciated PTK7 polypeptides ible with the instant ion may be in the form of a e‘ protein or may be part of a larger protein such as a fusion protein.
It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, a pre—, pro- or prepro—protein sequence, or a sequence which aids in purification such as an affinity tag, for example, but without limitation, multiple histidinc residues, a FLAG tag, HA tag or myc tag. Additional sequences which may provide stability during inant production may also be used. Such sequences may be optionally removed as required by incorporating a cleavable sequence as an additional sequence or part thereof. Thus, a PTK? ptide as d herein may comprise constructs fused to adjunct es ing other polypeptides. Such additional ces and affinity tags are well known in the art and may be generated using standard biochemical techniques.
The biological ance of PTK7 function despite its inactive kinase domain can be inferred from the presence of conserved orthologs from Hydra through Drosophila to chicken and human, each of which by sequence analysis is predicted to lack kinase activity (Kroiher et ai., 200i ). Based upon the high conservation of a Specific TM domain motif associated with a propensity for helix-helix association and the fact that RTK typically dimerize in se to ligand engagement. it was suggested that TM domain may mediate PTK7 dimerization (Kroiher et 21]., 200i). A later study suggested that the PTK7 TM domain does not promote preferential self» association (Kobus et al., Biochemistry 44(5), 2005), but did not rule out meric interactions with the TM domains of other RTKs or members of a signaling complex. Therefore, the PTK’I psetrdokinase domain itself is not expected to directly transmit the signal, but it may interact as a scaffold for other molecules in the signaling pathway, or may recruit other ne kinase(s) (Kroiher et al., 200i). [06l] Human PTK7 is not expressed in adult colon although it is expressed in fetal colon and a variety ofcolon carcinoma derived cell lines e et al. supra, 1995), as well as in atic colorectal cancer (Saha et 211., More 294(5545) 200] ). Other normal tissues and cells reported to s PTK7 include lung, thyroid and ovary (Mossie, Jallal et al. 1995), CD4+ recent thymic emigrant T-cells (Haines et al., J Exp Med 206(2) 2009), and normal myeloid progenitors and CD34+CD38~ bone marrow cells (Prehet et al.,N 116( l 3), 2010). With respect to cancerous tissues, PTK7 expression has also been found in colon carcinoma cells (Mossie et al. 1995); in AML samples (Muller—Tidow, et al. Clin Cancer Res 10(4), 2004); in CD34- pie—TALL cells (Shangguan et al., J Proteome Res 7(5) 2008) and in c carcinoma nge et al., Genes Chromosomes Cancer 42(3), 2005). Interestingly, despite being cloned originally from normal melanocytes, PTK7 has been reported to be lost in metastatic melanoma (Easty et al., lntJ Cancer 71(6), 1997). PTK7 also may be lost in certain breast cancers containing deletions of chromosome 6p2l (Piao et al., Genes Chromosomes Cancer 30(2), 2001), although sion is le in breast cancer cell lines (Su et al., J Cancer .1 20l0). PTK7 is also expressed lung adenocarcinoma, where stronger expression levels have been correlated with a more favorable prognosis in these tumors (Endoh et al.. J Clin Oncoi 22(5), 3004). Fine mapping of the amplifications of 6p l 2-1321 region in osteosarcomas has shown that increases in gene copy number do not necessarily result in overexpression of P'I‘K7, as determined by qRT-PCR (Lu et al., Mol Cancer Res 6(6), 2008).
The ligand or ligands for PTK7 are not known, gh PTK’? has been linked to a variety of biological signaling pathways and developmental ses. The immunogiobulin-like ECD domain structure of the protein suggests that it may be a participant in or sensor of celi~cell contact and on. The Drosop/zila ortholog of PTK7, OTK, has been associated with plexin as a potential co~receptor for semaphorin signaling during axon guidance (Winberg et al., £33320 32(1), 2001). Recently an interaction between PlexinAl and PTK7 in Xenopus has been demonstrated (Wagner et al., m Bioghys Res Commun 402(2) 2010) while the chick ortholog of PTK7, KLG, has been shown to interact with PlexinAl and SemaéD in a complex important for chick cardiac morphogenesis ((Toyoftrku ct al., Genes Dev 18(4), 2004). Soluble PTK7 (sPTK7) was used to show a role for PTK7 in VEGEinduced angiogenesis, as well as in vitro tube formation, migration and invasion of human endothelial cells (Shin et al., Biochem Biophys Res Commun 371(4), 2008). Mouse PTK? has also been linked to epidermal wound healing processes, which require actin cytoskeletal reorganization and cell migration (Caddy et at, Dev Cell 19(1), 2010). {063] With respect to specific signaling cascades, PTK7 appears to be a component of various Wnt ing pathways important for development (Puppo et a1., EMBO Rep 12(1), 2010). Mice expressing a null or severely hypomorphic mutation in Ptk7 die tally, displaying phenotypes consistent with a role for PTK7 in a planar cell polarity (PCP) pathway (Lu et al., Mare: 430(6995), 2004). Similarly, chuzhoi mice containing mutant PTK7 ns with a three amino acid insertion in the ECD display PCP—defective phenotypes (Paudyal, Damrau et a1. 2010).
Murine P'I‘K7 has been shown to genetically interact with other PCP genes, including Vangl2 (Lu et at, 2004), Celsr] (Paudyal, Damrau et a1. 2010), Serb! and (Fr/113 (Caddy et al., 2010).
Membrane type-l matrix metalloproteinasc (MTl-VIMP) cleaves PTK7 to release soluble PUG (i.e., sPTK7), and disregulation of the balance of MTl~MMP activity and 7 production leads to convergent extension defects in ish, also consistent with a role for PTK7 in a PCP pathway (Golubkov et al., J Biol Chem 285(46), 2010). In s, PTK7 was found in xes with dsh and the Wnt~receptor fz7 in non-canonical Wnt ing pathways (Shnitsar et al., Develogment 135(24), 2008), s interactions between PTK? and B-catenin could be shown to be dynamically affected by canonical Wnt signaling in mouse cells (Puppo etal., 2010) onally, a conserved TCF/LEF— transcription factor binding site in the P‘TK7 promoter suggests it is a Wnt response gene and may explain PTK7 up regulation in certain colorectal cancers, since these tumors are frequently disregulatcd for War pathway ing (Katoh, lntl Moi Mg 20(3), 2007).
Within cancerous tissues, in addition to its potential for modulating the Wnt pathways described above, PTK appears to convey pro-proliferation and anti-apoptotic signals in the HCT l 16 colon carcinoma line, phenotypes which could be reversed by RNAi mediated knock-down of PTK7 (Meng et al., PLoS One 5( l l), 2010). PTK7 anti—apoptotic signals conveyed ance to anthracyclinc-mediated cell killing in AML blasts, which could be reversed using a e PTK7- Fe protein (Prebet et a1., 2010). Over-expression of PTK7 by Specific cancer cells has been exploited in a strategy to target delivery of daunorubicin to T—ALL cells in e using aptamers that bind PTK? and are subsequently alized (Xiao et 111., Chemistry 14(6), 2008). {065] In addition to the aforementioned characteristics the present disclosure demonstrates that the expression of PTK7 is elevated in various tumor ting cell populations. Along with concomitant upregulation of PTK7 in at least some of the non~tumorigenic cells in the bulk tumor. this raises the possibility that PTK7 mediated ligand receptor interactions may he triggering cell signaling cascades linked to tumor proliferation, neoangiogenesis and/or tumor metastasis. While not wishing to be bound by any particular theory, it is believed that PTK7 modulators of the present invention (particularly antagonistic or neutralizing embodiments) act, at least in part, by either reducing or eliminating tumor initiating cell frequency thereby interfering with tumor ation or survival in a different manner than traditional standard of care therapeutic regimens (e.g. irinotecan), or through immunotherapeutic ing or delivering a payload able to kill PTK7 expressing cells. For example, a reduction in cancer stem cell activity by antagonizing PTK7 may include simply promoting cell proliferation in the face of chemotherapeutic regimens that eliminate. proliferating cells, or ng differentiation of the tumor initiating cell such that their self—renewal (Le. ted proliferation and maintenance of multipotency) capacity is lost. Alternatively, in preferred ments recruitment of cytotoxic T—cells to PTK7 expressing cells, or delivery of a potent toxin conjugated to an anti-PTK7 antibody that is able to internalize, may selectively kill TPC.
III. Tumor Perpetuating Cells In contrast to teachings of the prior art. the present invention provides P'l‘K7 modulators that are particularly useful for targeting tumor initiating cells, and especially tumor perpetuating cells, thereby facilitating the treatment, management or prevention of neoplastic disorders. More Specifically, as previously indicated it has surprisingly been found that specific tumor cell ulations express PTK’? and may modify localized coordination of morphogcn signaling important to cancer stem cell self-renewal and cell al. Thus, in preferred embodiments modulators of PTK7 may be used to reduce tumor initiating cell frequency in accordance with the present ngs and thereby facilitate the ent or management of roliferative diseases.
As used herein, the term tumor initiating cell (TIC) encompasses both tumor perpetuating cells (TPC; i.e., cancer stem cells or CSC) and highly proliferative tumor progenitor cells d TProg), which together generally comprise a unique ulation (i.e. 0.140%) of a bulk tumor or mass. For the purposes of the instant disclosure the terms tumor perpetuating cells and cancer stem cells or neoplastic stem cells are equivalent and may be used interchangeably herein. Conversely, TPC differ from TProg in that they can completely tulate the composition of tumor cells ng within a tumor and have unlimited self~renewal capacity as demonstrated by serial transplantation (two or more passages h mice) of low numbers of isolated cells. As will be discussed in more detail below fluorescence-activated cell sorting (FACS) using appropriate cell surface markers is a reliable method to isolate highly enriched cell subpopttlations (e.g., > 99.5% purity) due, at least in part, to its ability to discriminate between single cells and clumps of cells (Le. doublets, etc.). Using such techniques it has been shown that when low cell numbers of highly ed TProg cells are transplanted into immunocompromised mice they can fuel tumor growth in a primary transplant. However, unlike purified TPC subpopulations the Tng generated tumors do not completely reflect the parental tumor in phenotypic cell heterogeneity and are demonstrably inefficient at reinitiaring serial tumorigenesis in subsequent transplants. In contrast, TPC subpopulations completely reconstitute the ar heterogeneity of parental tumors and can efficiently initiate tumors when serially isolated and transplanted. Thus, those skilled in the art will recognize that a definitive ence between TPC and TProg, though both may be tumor generating in primary transplants, is the unique y of TPC to perpetually fuel heterogeneous tumor growth upon serial transplantation at low cell numbers. Other common approaches to characterize TPC e morphology and examination of cell surface markers, transcriptional profile, and drug response although marker expression may change with culture conditions and with cell line passage in vilro.
Accordingly, for the purposes of the instant invention tumor perpetuating cells, like normal stem cells that support ar hierarchies in normal tissue, are preferably defined by their ability to self-renew indefinitely while maintaining the capacity for multilineage entiation.
Tumor perpetuating cells are thus e of ting both tumorigenic progeny (i.e., tumor initiating cells: TPC and TProg) and non-tumorigenic (NTG) progeny. As used herein a non- tumorigenic cell (NTG) refers to a tumor cell that arises from tumor initiating cells, but does not itself have the capacity to sclf~renew or generate the heterogeneous lineages of tumor cells that comprise a tumor. Experimentally, NTG cells are ble of reproducibly forming tumors in mice, even when transplanted in excess cell numbers. [069} As indicated, TProg are also categorized as tumor initiating cells (or TIC) due to their limited y to generate tumors in mice. TProg are progeny of TPC and are typically capable of a finite number of non—self—renewing cell divisions. Moreover, TProg cells may r be divided into early tumor progenitor cells (ET?) and late tumor itor cells (LTP), each of which may be distinguished by phenotype (e.g., cell surface markers) and different capacities to recapitulate tumor cell architecture. in spite of such technical differences, both ETP and LTP differ functionally from TPC in that they are generally less capable of serially reconstituting tumors when transplanted at low cell numbers and typically do not reflect the heterogeneity of the parental tumor. Notwithstanding the foregoing ctions, it has also been shown that s TProg populations can, on rare occasion, gain self-renewal capabilities normally attributed to stem cells and themselves become TPC (or CSC). In any event both types of tumor-initiating cells are likely represented in the typical tumor mass of a single t and are subject to treatment with the tors as disclosed herein. That is, the disclosed compositions are generally effective in reducing the frequency or altering the chemosensitivity of such PTK7 positive tumor initiating cells regardless of the particular embodiment or mix represented in a tumor. [070} in the context of the instant invention, TPC are more tumorlgenic, relatively more quiescent and often more chemoresistant than the TProg (both ETP and LTP), NTG cells and the tumor-infiltrating non—TPC d cells (cg, fibroblasts/stroma, endothelial 8: hematopoictic cells) that comprise the bulk of a tumor. Given that conventional therapies and regimens have, in large part, been designed to both debulk tumors and attack rapidly proliferating cells, TPC are likely to be more resistant to conventional ies and regimens than the faster proliferating TProg and other bulk tumor cell populations. Further, 'l‘PC often express other characteristics that make them vely chemoresistant to conventional therapies, such as increased expression of multi-drug resistance transporters, enhanced DNA repair mechanisms and anti—apoptotic proteins.
These properties, each of which contribute to drug tolerance by TPC, tute a key reason for the failure of standard oncology treatment ns to ensure long-term benefit for most patients with ed stage neoplasia; i.e. the failure to tely target and eradicate those cells that fuel continued tumor growth and recurrence (Le. TPC or CSC).
Unlike many of the aforementioned prior art treatments, the novel compositions of the present invention preferably reduce the frequency of tumor initiating cells upon administration to a t regardless of the form or specific target (e.g., genetic material, PTK? antibody or ligand fusion construct) of the selected modulator. As noted above, the reduction in tumor initiating cell frequency may occur as a result of a) elimination, depletion, sensitization, silencing or inhibition of tumor initiating cells; b) controlling the growth, expansion or recurrence of tumor initiating cells; c) interrupting the initiation, propagation, maintenance, or proliferation of tumor initiating cells; or d) by otherwise hindering the survival, regeneration and/or metastasis of the tumorigenic cells. In some embodiments, the reduction in the ncy of tumor initiating cells occurs as a result of a change in one or more physiological pathways. The change in the pathway, whether by reduction or elimination of the tumor initiating cells or by modifying their potential (cg, induced differentiation, niche disruption) or isc interfering with their y to exert affects on the tumor environment or other cells, in turn allows for the more ive treatment of P’I‘K7 ix) Ix.) associated disorders by inhibiting genesis. tumor maintenance and/or metastasis and recurrence. 1072) Among the methods that can be used to assess such a reduction in the frequency of tumor initiating cells is limiting dilution analysis either in vitro or in vivo, preferably followed by enumeration using Poisson bution tics or assessing the frequency of predefined definitive events such as the ability to generate tumors in vivo or not. While such limiting dilution analysis are the preferred methods of calculating reduction of tumor initiating cell frequency, other, less demanding s, may also be used to effectively ine the desired values, albeit slightly less accurately, and are entirely compatible with the teachings herein. Thus, as will be appreciated by those skilled in the art, it is also possible to determine ion of frequency values through well—known flow cytometric or immunohistochemica1 means. As to all the aforementioned methods see, for example, Dylla et al. 2008, PMCID: PMC2413402 & I-Ioey et al. 2009, PMlD: l966499l; each of which is incorporated herein by reference in its entirety. 1073] With respect to limiting dilutiori is, in vitro ation of tumor initiating cell frequency may be accomplished by depositing either fractionated or unfractionated human tumor cells (eg. from d and untreated tumors, respectively) into in vitro growth conditions that foster colony formation. In this manner, colony forming cells might be enumerated by simple counting and characterization of colonies, or by analysis consisting of, for example, the deposition of human tumor cells into plates in serial dilutions and scoring each well as either positive or negative for colony formation at least l0 days after plating. In vivo limiting dilution experiments or analyses, which are generally more accurate in their ability to determine tumor ting cell frequency encompass the transplantation of human tumor cells, from either untreated control or treated conditions, for example, into immunocompromised mice in serial dilutions and subsequently scoring each mouse as either positive or negative for tumor formation at least 60 days after transplant. The derivation of cell frequency values by limiting dilution analysis in vz'rm or in vivo is preferably done by ng Poisson distribution statistics to the known frequency of positive and negative events, thereby providing a frequenCy for events fulfilling the definition of a positive event; in this case, colony or tumor formation, respectively.
As to other methods compatible with the instant invention that may be used to calculate tumor initiating cell frequency, the most common comprise fiable flow cytometrie ques and immunohistochemical staining procedures. Though not as precise as the limiting on analysis techniques described immediately above, these procedures are much less labor intensive and e reasonable values in a relatively short time frame. Thus, it will be iated that a skilled artisan may use flow cytometric cell surface marker profile determination employing one or Ix.) OJ more antibodies or reagents that bind art recognized cell surface proteins known to enrich for tumor initiating cells (e.g., potentially ible markers as are set forth in Example I below) and thereby measure TIC levels from various samples. In still another compatible method one skilled in the art might ate TIC frequency in situ (e.g., in a tissue section) by histochemistry using one or more antibodies or reagents that are able to bind cell surface proteins thought to demarcate these cells.
Using any of the above-referenced methods it is then possible to quantify the reduction in frequency of TIC (or the TPC n) provided by the disclosed PTK7 modulators (including those conjugated to cytotoxic agents) in ance with the teachings herein. In some instances, the compounds of the instant invention may reduce the frequency OFTIC (by a variety of mechanisms noted above, ing elimination, induced differentiation, niche disruption, silencing, etc.) by l0%, l5%, 20%, 25 n, 30% or even by 35%. In other embodiments, the reduction in frequency of TIC may be on the order of 40%, 45%, 50%, 55%, 60% or 65%. In certain embodiments, the disclosed compounds my reduce the frequency of TIC by 70%, 75%, 80%, 85%, 90% or even 95%. Of course it will be appreciated that any reduction of the frequency of the TIC likely results in a corresponding reduction in the tumorigenicity, persistence, recurrence and aggressiveness of the neoplasia.
IV. PTK7 Modulators [076} In any event, the present invention is directed to the use of PTK? modulators, ing PTK7 antagonists, for the diagnosis, theragnosis, treatment and/or prophylaxis of various disorders ing any one of a number of PTK?‘ ated ancies. The disclosed modulators may be used alone or in conjunction with a wide variety of anti-cancer nds such as chemotherapeutic or immunotherapeutic agents (e.g., therapeutic antibodies) or biological response modifiers. In other selected embodiments, two or more discrete PTK7 modulators may be used in combination to provide enhanced anti-neoplastic effects or may be used to fabricate multispecific constructs.
In certain embodiments, the PTK? modulators of the t invention will comprise nucleotides, oligonucleotides, polynucleotides, peptides or polypeptides. Even more preferably the modulators will comprise soluble PTK7 (sPI‘K7) or a form, variant, derivative or fragment thereof including, for example, PTK7 fusion constructs (e.g., c, PTK7-targeting , etc.) or PTK7-conjugates (c.g., PTK7-PEG, PTK7-cytotoxic agent, PTK7«brm, etc). It will also be appreciated that, in other embodiments, the PTK7 modulators comprise antibodies or immunoreactive fragments or derivatives thereof. In particularly preferred embodiments the modulators of the instant invention will comprise neutralizing antibodies or derivatives or fragments thereof. In other embodiments the P’I‘K7 modulators may se alizing antibodies or fragments thereof. In still other embodiments the PTK7 modulators may comprise depleting antibodies or fragments thereof. Moreover, as with the aforementioned fusion constructs, these antibody modulators may be conjugated, linked or otherwise associated with selected xic agents, polymers, biological response modifiers (BRMs) or the like to provide ed immunotherapies with various (and ally multiple) mechanisms of action. As alluded to above such dies may be pan-PTK7 antibodies and associate with two or more PTK7 isoforms or immunospecific antibodies that selectively react with a single m. In yet other embodiments the modulators may operate on the c level and may comprise compounds as antisense constructs, siRNA, micro RNA and the like. [078} It will further be appreciated that the disclosed PTK? modulators may deplete, silence. neutralize, ate or inhibit growth, propagation or survival of tumor cells, particularly TPC, and/or associated neoplasia h a variety of mechanisms, including agonizing or antagonizing selected pathways or eliminating specific cells depending, for example, on the form of PTK7 modulator, any ated payload or dosing and method of delivery. Accordingly, while preferred embodiments disclosed herein are directed to the depletion, tion or silencing of specific tumor cell suprpulations such as tumor perpetuating cells, it must be emphasized that such embodiments are merely rative and not limiting in any sense. , as set forth in the appended claims, the present invention is broadly directed to PTK7 modulators and their use in the treatment, management or prOpliylaxis of various PTK7 ated hyperproliferative disorders irrespective of any particular mechanisrn or target tumor cell population.
In the same sense disclosed embodiments of the instant invention may comprise one or more PTK? antagonists that associate with PTK7. To that end it will be appreciated that PTK7 antagonists of the instant ion may comprise any ligand, polypeptide, peptide, fusion protein, antibody or immunologically active fragment or derivative thereof that recognizes, reacts, binds, combines, competes, associates or otherwise interacts with the PTK? n or fragment thereof and eliminates, silences, reduces, ts, hinders, restrains or controls the growth of tumor initiating cells or other neoplastic cells including bulk tumor or NTG cells. In selected embodiments the PTK7 modulators comprise PTK7 antagonists. [080} As used herein an antagonist refers to a molecule capable of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with the activities of a particular or specified protein, including the binding of receptors to ligands or the interactions of enzymes with substrates. More generally nists of the invention may comprise antibodies and antigen~bintling fragments or derivatives thereof, proteins, peptides, glycoproteins, glycopcptides, glycolipids, polysaccharides, oligosaccharides, nucleic acids, antisense ucts, siRNA, miRNA, bioorganic molecules, pcptidomimetics, pharmacological agents and their metabolites, transcriptional and translation l sequences, and the like. Antagonists may also include small molecule inhibitors, fusion proteins, receptor molecules and derivatives which bind specifically to the protein thereby tering its binding to its substrate target, antagonist variants of the n, antisense molecules ed to the protein, RNA aptamers, and ribozymes against the protein.
As used herein and applied to two or more molecules or compounds, the terms recognizes or associates shall be held to mean the reaction, binding, specific binding, combination, interaction, connection, linkage, uniting, coalescence, merger orjoining, covalently or non- covalently, of the molecules whereby one molecule exerts an effect on the other molecule.
Moreover, as demonstrated in the examples herein, some modulators of human PTK7 may, in certain cases, cross-react with PTK? from a species other than human ('e.g., murine). In other cases exemplary modulators may be specific for one or more isoforms of human PTK7 and will not exhibit cross-reactivity with PTK‘? orthologs from other species. Of course, in ction with the ngs herein such embodiments may comprise pan—PTK7 antibodies that associate with two or more isoforms from a single species or antibodies that exclusively associate with a single isoform. [0831 In any event, and as will be sed in more detail below, those skilled in the art will iate that the disclosed modulators may be used in a conjugated or unconjugated form. That is, the modulator may be associated with or conjugated to (cg. covalently or non—covalently) pharmaceutically active compounds, biological response modifiers, anti-cancer agents, xic or cytostatic agents, diagnostic moieties or biocompatible modifiers. In this respect it will be understood that such conjugates may comprise peptides, polypeptides, proteins, fusion ns, nucleic acid molecules, small molecules, mimetic agents, tic drugs, inorganic molecules, organic molecules and radioisot0pes. Moreover, as indicated herein the ed conjugate may be covalently or non-covalently linked to the PTK? modulator in various molar ratios depending, at least in part, on the method used to effect the conjugation.
V. Antibodies a. Overview As previously d to particularly preferred embodiments of the instant invention comprise PTK7 modulators in the form of antibodies that preferentially associate with one or more ms of PTK7. The term antibody is used in the broadest sense and specifically covers synthetic antibodies, monoclonal antibodies, oligoclonal or polyclonal antibodies, multiclonal antibodies, reeombinantly produced dies, intrabodies, multispecific antibodies, bispecific antibodies, monovalent antibodies, multivalent antibodies, human antibodies, humanized antibodies, chimeric antibodies, CDR-grafted antibodies, primatizcd antibodies, Fab fragments, F(ab') fragments, single-chain Fchs (scFch), single—chain Fvs (scFv), anti-idiotypic (anti-Id) antibodies and any other immunologically active antibody fragments so long as they exhibit the desired biological ty (i.e., immunos‘pecifie or preferential PTK7 association or binding). in a broader sense, the antibodies of the present invention include immunoglobulin les and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site, where these fragments may or may not be fused to another immunoglobulin domain including, but not limited to, an Fc region or nt thereof. r, as outlined in more detail herein, the terms antibody and antibodies specifically e Fe variants as described below, including full length antibodies and variant Fe-Fusions comprising Fe regions, or fragments thereof, Optionally comprising at least one amino acid residue modification and fused to an immunologically active fragment of an immunoglobulin. {085] As discussed in more detail below, the c terms antibody or immunoglolmlin comprises five distinct classes of antibody that can be distinguished mically and, depending on the amino acid sequence of the constant domain of their heavy chains, can readily be assigned to the appropriate class. For historical reasons, the major classes of intact dies are termed lgA, IgD, IgE, IgG, and IgM. In humans, the lgG and lgA classes may be r divided into recognized sses (isotypes), i.e., lgGl, IgGZ, IgG3, lgG4, lgAl, and IgA2 depending on structure and certain biochemical properties. It will be appreciated that the IgG isotypes in humans are named in order of their abundance in serum with IgGl being the most abundant. {086] While all five classes of antibodies (i.e. lgA, lgD, lgE, lgG. and lgM) and all isotypes (i.e., lgGl, IgGZ, lgG3, lgG4, lgAl, and IgAZ), as well as variations thereof, are within the scope of the present int/cation, preferred embodiments comprising the lgG class of immunoglobulin will be discussed in some detail solely for the es of illustration. it will be understood that such disclosure is, r, merely demonstrative of exemplary compositions and methods of practicing the present invention and not in any way ng of the scope of the invention or the claims ed hereto.
In this respect, human IgG immunoglobulins comprise two identical light polypeptide chains of molecular weight approximately 23,000 s, and two identical heavy chains of molecular weight 53,000-70,000 ing on the isotype. Heavy-chain constant domains that correspond to the different classes of antibodies are denoted by the corresponding lowercase Greek letter a, 5, s, y. and it, respectively. The light chains of the antibodies from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda 0.), based on the amino acid sequences of their constant domains. Those skilled in the art will iate that the subunit structures and tln'ee-dimensional urations of different classes of imtnunoglobulins are well known. [088} The four chains are joined by disulfide bonds in a Y configuration wherein the light chains bracket the heavy chains starting at the mouth of the Y and continuing through the variable region to the dual ends of the Y. Each light chain is linked to a heavy chain by one cavalent disulfide bond while two disulfide linkages in the hinge region join the heavy chains. The tive heavy and ii ght chains also have regularly spaced intrachain disulfide bridges the number of which may vary based on the isotype of IgG. [089} Each heavy chain has at one end a variable domain (V1.1) followed by a number of nt domains. Each light chain has a variable demain at one end (V1) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variabie domain is aligned with the variable domain of the heavy chain. In this regard, it will be appreciated that the variable domains of both the light (V1) and heavy (VH) chain portions determine antigen recognition and specificity. Conversely, the constant domains of the light chain (CL) and the heavy chain (Cul, CH2 or CH3) confer and te important biological properties such as secretion, transplacental mobility, circulation half-life, complement g, and the like. By convention the numbering of the constant regioa domains increases as they become more distal from the antigen binding site or amino-terminus of the antibody. Thus, the amino or N—terminus of the antibody comprises the variable region and the y or C-tcrminus ses the constant region. Thus, the CH3 and C1. s actually comprise the y-terminns of the heavy and light chain, respectively.
The term variable refers to the fact that certain portions of the variable domains differ extensively in sequence among immunoglobulins and these hot spots largely define the binding and specificity characteristics of a particular antibody. These hypervariable sites manifest themselves in three segments, known as complementarity determining regions (CDRS), in both the light-chain and the heavy-chain variable domains respectively. The more highly conserved portions of variable s flanking the CDRs are termed framework s (FRs). More specifically, in naturally ing monomeric IgG antibodies, the six CDRs present on each arm of the antibody are short, non~contiguous sequences of amino acids that are ically positioned to form the antigen binding site as the antibody assumes its three dimensional configuration in an aqueous environment.
The framework regions comprising the remainder of the heavy and light variable domains show less inter~molecular ility in amino acid sequence. Rather, the framework regions largely adopt a B-sheet conformation and the CDRs form loops which connect, and in some cases form part of, the B-sheet structure. Thus, these framework s act to form a scaffold that provides for positioning the six CDRs in correct orientation by inter-Chain, non-covalent interactions. The antigen-binding site formed by the positioned CDRS defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes the non-covalent binding of the antibody to the immnnorcactive antigen epitope. It will be iated that the position and composition of CDRs can be readily identified by one of ordinary skill in the art using the definitions provided herein. [092} As discussed in more detail below all or part of the heavy and light chain variable regions may be recombined or engineered using standard recombinant and expression techniques to provide effective antibodies. That is, the heavy or light chain variable region from a first antibody (or any portion thereof) may be mixed and matched with any selected portion of the heavy or light chain variable region from a second antibody. For example, in one ment, the entire light chain le region comprising the three light chain CDRs of a first antibody may be paired with the entire heavy chain variable region comprising the three heavy chain CDRs of a second antibody to provide an operative antibody. er, in other embodiments, individual heavy and light chain CDRs derived from s antibodies may be mixed and matched to e the desired antibody having optimized characteristics. Thus, an exemplary antibody may comprise three light chain CDRs from a first antibody, two heavy chain CDRs derived from a second antibody and a third heavy chain CDR from a third antibody.
More ically, in the context of the instant invention it will be appreciated that any of the disclosed heavy and light chain CDRS derived from the murine variable region amino acid sequences set forth in or may be rearranged in this manner to e optimized anti—PTK? (e.g. anti-hPTK7) antibodies in accordance with the instant teachings. That is, one or more of the CDRs derived from the contiguous light chain variable region amino acid ces set forth in (SEQ ID NOS: 20 — 60, even numbers) or the contiguous heavy chain variable region amino acid sequences set forth in (SEQ ID N08: 21 ~ 61 odd numbers) may be incorporated in a PTK7 modulator and, in particularly preferred embodiments, in a CDR grafted or humanized dy that immunospecil’ically associates with one or more PTK7 isoforms.
Examples of light (SEQ ID NOS: 62 — 68, even s) and heavy (SEQ lD NOS: 63 — 69, odd numbers) chain variable region amino acid sequences of such humanized modulators are also set forth in FIGS. 6A and 6B. Taken together these novel amino acid sequences depict twenty-one marine and four humanized ary modulators in accordance with the instant invention.
Moreover, corresponding nucleic acid sequences of each of the -one exemplary marine modulators and four zed tors set forth in FIGS. 6A and 6B are included in the sequence listing appended to the instant ation (SEQ ID NOS: 120— 169). [0941 In any event, the compiementarity determining regions residue numbers may be defined as those of Kabat et a1. (1991, NIH Publication 9l—3242, National Technical ation Service, Springfield, Va), specificaily, residues 24-34 (CDRI), 50-56 (CDR2) and 89—97 (CDR3) in the light chain variabie domain and 31-35 (CDRl), 50—65 (CDRZ) and 95—102 (CDR3) in the heavy chain variable domain. Note that CDRs vary considerably from antibody to antibody (and by definition wili not exhibit homology with the Kabat coasensus sequences). Maximal a1 ignmcnt of framework residues frequently es the insertion of spacer residues in the numbering system, to be used for the Fv region. In addition, the identity of certain individual residues at any given Kabat site number may vary from antibody chain to antibody chain due to interspecies or allelic divergence. See also Chothia et al., J. Mol. Biol. [96:901-917 (1987); Chothia et al., Nature 342, pp. 3 (1989), MacCallum et al., J. Mol. Biol. 262:732~745 (1996) and S. Dubel, ed., ok of Therapeutic Antibodies. 3rd ed., WILEY~VCH Veriag GmbH and Co. (2007), where the definitions include overlapping or subsets of amino acid residues when compared against each other. Each of the aforementioned references is incorporated herein by reference in its entirety and the amino acid residues which comprise g s or CDRs as defined by each of the above cited references and are set forth for comparison below.
CDR Definitions «moon: 50.65 ~ sass 47-58 -VrCDR3102102 ’Residue numbering follows the nomenclature of Kabat et 221., supra “Resadue ing follows the nomenclature of Chothta et al., supra. . . 3Residue numbering follows the nomenclature of MacCallum et al., supra {0951 As discussed herein one skilled in the art could readily define, identify derive and/0r enumerate the CDRs as defined by Kabat et al., Chothia et al. or MacCallum et al. for each respective heavy and light chain sequence set forth in or . Accordingly, each of the subject CDRs and antibodies comprising CDRs defined by all such nomenclature are expressly included within the scope of the t invention. More broadly the term variable region CDR amino acid residue includes amino acids in a CDR as identified using any sequence or structure based method as set forth above.
As used herein the term variable region framework (FR) amino acid residues refers to those amino acids in the framework region of an lg chain. The term ork region or FR region as used herein, includes the amino acid residues that are part of the variable region, but are not part of the CDRs (cg, using the Kabat. definition of CDRs). Therefore, a variable region framework is a non-contiguous sequence between about 100-120 amino acids in length but includes only those amino acids outside of the CDRs.
For the specific example of a heavy chain variable region and for the CDRS as defined by Kabat et al., framework region i corresponds to the domain of the variable region encompassing amino acids 1-30; framework region 2 corresponds to the domain of the variable region encompassing amino acids 36—49; framework region 3 corresponds to the domain of the variable region assing amino acids 66—94, and framework region 4 ponds to the domain of the variable region frOni amino acids l03 to the end of the le region. The framework regions for the light chain are similarly separated by each of the light claim variable region CDRs. Similarly, using the definition of CDRs by Chothia et al. (cg, CDR~LI 23~34, CDR~L2 50-56, CDR-L3 89- 97; CDR-Hl 26-32, CDR-HQ 50-58, CDR-H3 95-102) or McCallum et al. the framework region boundaries are separated by the respective CDR termini as described above.
With the entioned structural considerations in mind, those skilled in the art will appreciate that the dies of the present invention may comprise any One of a number of functional embodiments. In this respect, compatible antibodies may comprise any immunorcactive antibody (as the term is defined herein) that es the desired physiological response in a subject. While any of the disclosed antibodies may be used in conjunction with the present teachings, certain embodiments of the invention will comprise chimeric, humanized or human monoclonal antibodies or innnunoreactive nts thereof. Yet other embodiments may, for e, comprise neous or heterogeneous multitneric constructs, Fe variants and conjugated or glycosylationally d antibodies. Moreover, it will be understood that such configurations are not mutually exclusive and that compatible individual antibodies may comprise one or more of the functional aspects disclosed herein. For example, a ible antibody may comprise a single chain diabody with zed variable regions or a fully human full length IgG3 antibody with Fe modifications that alter the glycosylation n to modulate serum half—life.
Other exemplary embodiments are readily apparent to those skilled in the art and may easily be discernable as being within the scope of the invention. b. Antibody generation As is well known, and shown in the Examples herein. s host animals, including rabbits, mice, rats, etc. may be inoculated and used to provide antibodies in accordance with the teachings herein. Art known adjuvants that may be used to increase the logical se, depending on the ated species include, but are not d to, l's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitroplienol, and potentially useful human adjuvants such as BCG (bacille Calmette—Guerin) and corynebacterium parvum. Such adjuvants may protect the n lrorn rapid sal by sequestering it in a local deposit, or they may contain substances that stimulate the host to secrete factors that are chemotactic for ages and other components of the immune .
Preferably, if a polypeptide is being administered, the immunization schedule will involve two or more administrations of the polypeptide, spread out over several weeks. [01001 After immunization of an animal with a PTK7 immunogen (cg, soluble PTK7 or sPTK'i) which may comprise selected isoforms and/or peptides, or live cells or cell preparations expressing the desired protein, antibodies and/or antibody-producing cells can be obtained from the animal using art recognized techniques. In some ments, polyclonal anti-PTK7 antibody— containing serum is obtained by bleeding or sacrificing the animal. The serum may be used for research purposes in the form obtained from the animal or, in the alternative, the anti-PTK7 antibodies may be partially or fully purified to provide. globulin ons or homogeneous antibody preparations. c. Monoclonal antibodies While polyclonal antibodies may be used in conjunction with certain aspects of the present invention, preferred embodiments comprise the use of PTK? reactive monoclonal antibodies. As used herein, the term monoclonal dy or mAb refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible ons, e.g., naturally occurring mutations, that may be present in minor amounts. Thus, the modifier monoclonal indicates the character of the antibody as not being a mixture of discrete antibodies and may be used in conjunction with any type of antibody. In certain embodiments, such a monoclonal antibody includes an antibody comprising a polypeptide sequence that binds or associates with PTK7, wherein the PTK7-binding polypeptide sequence was ed by a process that es the selection of a single target binding polypeptide sequence from a plurality of polypeptide sequences. [0l02] In preferred embodiments, dy-producing cell lines are ed from cells isolated from the immunized animal. After immunization. the animal is sacrificed and lymph node and/or splenic B cells are immortalized by means well known in the art as shown in the appended Examples). Methods of imtnortalizing cells include, but are not limited to, transfecting them with oncogenes, infecting them with an oncogenic virus and cultivating them under conditions that select for immortalized cells, ting them to carcinogenic or mutating compounds, fusing them with an immortalized cell, e.g., a myeloma cell, and inactivating a tumor suppressor gene. If fusion with myeloma cells is used, the mycloma cells preferably do not e immunoglobulin polypeptides (a non~secretory cell line). As set forth in the Examples below immortalized cells may be screened using a PTK7 (including selected isoforms), or an immunoreactive portion thereof. In a preferred embodiment, the initial screening is performed using an enzyme-linked immunoassay (ELISA) or a radioimmunoassay.
More generally, te monoclonal dies consistent with the present invention can be prepared using a wide variety of techniques known in the art including hybridoma, recombinant techniques, phage diSplay technologies, yeast libraries, transgenic animals (e.g. a XenoMouse® or HuMAb Mouse®) or some combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques such as broadly bed above and taught in more detail in Harlow ct al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammcrling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563~68l (Elsevier, N.Y., l981) each of which is orated herein. Using the disclosed protocols, antibodies are preferably raised in mammals by multiple subcutaneous or intrapcritoneal injections of the relevant antigen and an adjuyant. As usly discussed, this immunization generally elicits an immune response that comprises production of antigeii~t‘eacti\'e antibodies (that may be frilly human if the immunized animal is transgenic) from activated splenocytes or lymphocytes. While the resulting antibodies may be harvested from the serum of the animal to provide polyclonai ations, it is lly more ble to isolate individual lymphocytes from the , lymph nodes or peripheral blood to provide nous preparations of onal antibodies. Most typically, the lymphocytes are obtained from the spleen and immortalized to provide hybridomas.
For example, as described above, the selection process can be the selection of a unique clone from a plurality of clones, such as a pool of hybridoma clones, phage clones, or recombinant DNA cloaes. It should be understood that a selected PTK? binding sequence can be further altered, b.) b.) for example, to improve affinity for the target, to humanize the target binding sequence, to e its production in cell culture, to reduce its ogenicity in vivo, to create a multispecific antibody, etc., and that an antibody comprising the altered target binding sequence is also a monoclonal antibody of this invention. In contrast to polyclonal antibody preparations, which typically include discrete antibodies directed against different determinants (epitopes), each monoclonal dy of a monoclonal antibody ation is directed against a single inant on an antigen. In addition to their specificity, monoclonal antibody preparations are advantageous in that they are lly uncontaminated by other immunoglobulins that may be cross—reactive. d. Chimeric antibodies In r embodiment, the antibody of the invention may comprise chimeric antibodies derived from covalently joined n segments from at least two different species or types of antibodies. It will be appreciated that, as used herein, the term chimeric antibodies is directed to constructs in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding ces in antibodies derived from r species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (US. Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 8i 26851~6855 (1984)). in one exemplary embodiment, a ic antibody in accordance with the teachings herein may comprise murine V” and VL amino acid sequences and constant regions derived from human sources. In other compatible embodiments a chimeric antibody of the t invention may comprise a CDR grafted or humanized dy as bed herein.
Generally, a goal of making a chimeric antibody is to create a chimera in which the number of amino acids from the intended subject species is maximized. One example is the CDR‘ grafted antibody, in which the dy comprises one or more complementarity determining regions (CDRs) from a particular species or belonging to a ular antibody class or ss, while the remainder of the antibody chain(s) is/are identical with or homologous to a corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass. For use in humans, the variable region or selected CDRs from a rodent antibody often are grafted into a human antibody, ing the lly occurring variable regions or CDRs of the human antibody. These constructs generally have the advantages of providing full strength modulator functions (cg, CDC, ADCC, etc.) while reducing unwanted immune responses to the antibody by the subject. e. Humanized antibodies Similar to the CDR grafted antibody is a humanized dy. Generally, a humanized antibody is produced from a monoclonal antibody raised initially in a non-human animal. As used herein humanized forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain a minimal sequence d from a non—human immunoglobulin. In one embodiment, a humanized antibody is a human immunoglobulin (recipient or acceptor dy) in which residues from a CDR of the recipient antibody are replaced by residues from a CDR of a non—human species (donor dy) such as mouse, rat, rabbit, or nonhuman primate having the desired specificity, affinity, and/0r capacity. {0108] Generally humanization of an dy ses an analysis of the sequence homology and canonical structures of both the donor and recipient antibodies. In selected ments, the recipient antibody may comprise consensus sequences. To create consensus human frameworks, frameworks from several human heavy chain or light chain amino acid sequences may be aligned to identify a consensus amino acid sequence. Moreover, in many instances, one or more ork residues in the variable domain of the human immunoglobulin are repiaced by corresponding non~ human es from the donor antibody. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and ork residues to identify framework residues important for antigen binding and ce comparison to identify unusual framework residues at particular ons. Such substitutions help maintain the appropriate tln'ee~dimensional configuration of the d CDR(s) and often improve infinity over similar constructs with no framework substitutions. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications may be made to further refine antibody performance using wet1~known techniques. {0109} CDR grafting and humanized dies are described, for example, in U.S.P.Ns. 6,180,370, 5,693,762, 5,693,761, 5,585,089, and 5,530,101. in general, a humanized dy will comprise substantially aii of at least one, and typically two, variable domains, in which all or ntially all of the CDRs pond to those of a non~human immtmoglobulin, and all or substantially all of the framework regions are those of a human immunoglobulin sequence. The humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fe), typically that of a human immunoglobulin. For further details, see, e.g., Jones et al., Nature 2-525 (1986); Riechmann et al., Nature 3322323629 (1988); and Presta, Curr. Op.
Struct. Biol. 2:593-596 (1992). See also, e.g., Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1: 105~1 15 (1998); Harris, Biochem. Soc. Transactions 23:10354038 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994); and U.S.P.Ns. 6,982,321 and 7,087,409. Still another method is termed humaneering and is bed, for example, in US. 2005/0008625. For the purposes of the present application the term humanized antibodies will be held to expressly include CDR grafted antibodies (i.e. human antibodies comprising one or more grafted nonhuman CDRs) with no or minimal framework substitutions.
[Ol 10] Additionally, a non-human anti-PTK7 antibody may also be modified by specific on of human T cell es or deimmunization by the methods disclosed in WO 98/52976 and WO 00/34317. Briefly, the heavy and light chain variable regions of an antibody can be analyzed for peptides that bind to MHC Class [1; these peptides ent potential T-cell epitopes (as defined in WO 76 and WO 17). For detection of ial 'l‘~cell epitopes, a computer modeling ch termed peptide threading can be applied, and in addition a database of human MHC class II binding peptides can be searched for motifs present in the V“ and V1- sequences, as described in WO 98/52976 and W0 Oil/34317. These motifs bind to any of the 18 major MHC class Ii DR pes, and thus constitute potential T cell cpitopes. Potential T-cell epitopes detected can be eliminated by substituting small numbers of amino acid residues in the variable regions, or by single amino acid tutions. As far as possible, conservative substitutions are made. Often, but not exclusively, an amino acid common to a position in human germline antibody sequences may be used. After the deimmunizing changes are identified, nucleic acids encoding V” and VL can be constructed by mutagenesis or other synthetic s (e.g., de novo synthesis, cassette replacement, and so forth). A mutagenized variable sequence can, optionally, be fused to a human constant region. [01 l i] In selected ments, at least 60%, 65%, 70%, 75%, or 80% of the zed antibody variable region residues will correspond to those of the parental framework region (FR) and CDR sequences. In other embodiments at least 85% or 90% of the humanized antibody residues will correspond to those of the al framework region (FR) and CDR sequences, In a further preferred embodiment, greater than 95% of the humanized antibody residues will correspond to those of the parental framework region (PR) and CDR sequences.
{Oi l2] Humanized antibodies may be fabricated using common molecular biology and biomolecular engineering techniques as described herein. These s include isolating, manipulating, and expressing nucleic acid sequences that encode all or part of immunoglobulin Fv variable regions from at least one of a heavy or light chain. Sources of such nucleic acid are well known to those skilled in the art and, for example, may be obtained from a hybridoma, eukaryotic cell or phage producing an antibody or inununoreactive fragment against a predetermined target, as described above, from ne immunoglobulin genes, or from synthetic constructs. The recombinant DNA encoding the humanized antibody can then be cloned into an appropriate expression vector. [01 i3} Human ne sequences, for example, are disclosed in Tomlinson. I. A. et a]. (1992) J. Mol. Biol. 227:776«798; Cook, G. P. et al. (1995) Immunol. Today l6: 237-242; Chothia. D. et al. (1992) J. Mol. Bio. 9-817; and Tomlinson et al. (l995) EMBOJ 14:4628-4638. The V BASE directory provides a comprehensive directory of human immunoglobulin le region sequences (See Retter et ai., (2005) Nuc Acid Res 33: 4). These sequences can be used as a source of human sequence, e.g., for framework regions and CDRs. As set forth herein consensus human framework regions can also be used, e.g., as bed in U.S.P.N. 6,300,064. t'. Human antibodies {OI 14] In addition to the aforementioned antibodies, those skilled in the art will appreciate that the antibodies of the present invention may comprise fully human antibodies. For the purposes of the instant application the term human antibody comprises an antibody which possesses an amino acid sequence that corresponds to that of an antibody produced by a human and/or has been made using any of the techniques for making human antibodies as disclosed herein. This definition of a human antibody ically excludes a humanized antibody comprising non-human antigen- g residues. 15‘] Human antibodies can be produced using various techniques known in the art. As alluded to above, phage display techniques may be used to provide active binding regions in accordance with the t ngs. Thus, certain embodiments of the invention provide methods for producing anti-PTK? antibodies or antigen‘binding portions f comprising the steps of synthesizing a library of (preferably human) antibodies on phage, screening the library with a selected PTK7 or an antibody—binding portion thereof, isolating phage that binds PTK7, and obtaining the immunoreactive fragments from the phage. By way of example, one method for ing the y of antibodies for use in phage display techniques comprises the steps of immunizing a non-human animal comprising human or non~human immunoglobulin loci with the selected PTK7 or an nic portion thereof to create an immune response, extracting antibody- producing cells from the immunized animal; isolating RNA encoding heavy and light chains of antibodies of the invention from the extracted cells, reverse transcribing the RNA to produce cDNA, amplifying the CDNA using primers, and inserting the cDNA into a phage display vector such that antibodies are expressed on the phage. More particularly, DNA encoding the V” and VL domains are recombined er with an seFv linker by PCR and cloned into a phagemid vector (cg, p CANTAB 6 01' pComb 3 H38). The vector may then be electroporated in E. eoli and then the E. coli is infected with helper phage. Phage used in these s are typically filamentous phage including fd and M13 and the VH and V1, domains are usualiy recombinantly fused to either the phage gene III or gene. V111. [01 I6] Recombinant human anti—PTK7 antibodies of the invention may be isolated by ing a recombinant combinatorial antibody library prepared as above. in a preferred embodiment, the library is a scFv phage display library, generated using human VL and V" cDNAs prepared from mRNA isolated from B cells. Methods for preparing and screening such libraries are well known in the art and kits for generating phage display libraries are commercially available (e.g., the Pharmaeia Recombinant Phage Antibody System, catalog no. 2701; and the Stratagene SuriZAPm phage display kit, catalog no. 240612). There also are other methods and reagents that can be used in generating and screening antibody display libraries (see, e.g., U.S.P.N. ,223,409; PCT Publication Nos. W0 92/18619, W0 91/1727 1, W0 92/2079], WO 92/15679, WO 93/01288, W0 92/01047, WO 92/09690; Fuchs et al., Bio/Technology 9: 1370-1372 ( 1991); Hay et al., Hum. Antibod. Hybridomas 3:81-85 ; Huse et al., Science 246:1275~1281 (1989); McCafferty et al., Nature 2-554 ; Griffiths et a1., EMBO J. 12:725—734 (1993); Hawkins et ai., J. M01. Biol. 226:889-896 (1992); Clackson et 31., Nature 352:624~628 (1991); Gram et al., Proc. Natl. Acad. Sci. USA 6-3580 (1992); Gan'ad at al.. Bio/Technology 921373-1377 (1991 ); Hoogenboom et ah, Nuc. Acid Res. 1941334137 ; and Barbas (:1 211., Proc. Natl. Acad. Sci. USA 88:7978~7982 (1991). {01 17] The antibodies produced by naive libraries (either natural or synthetic) can be of te affinity (Ka of about 106 to 107 M“), but affinity maturation can also be mimicked in vitro by constructing and reselecting from secondary libraries as bed in the art. For example, mutation can be introduced at random in vitro by using erronprone polymerase (reported in Leung et a1., Technique, 1: 1 1-15 (1989)) in the method of s et 211., J. Mol. Biol. 226: 889-896 (1992) or in the method of Gram et al., Proc. Natl. Acad. Sci. USA, 89: 3576-3580 (1992).
Additionally, affinity maturation can be performed by ly mutating one or more CDRs, e.g. using PCR with primers carrying random sequence spanning the CDR of interest, in ed individual Fv clones and screening for higher ty clones. W0 9607754 described a method for inducing mutagenesis in a compiementarity determining region of an giobulin light chain to create a library of light chain genes. Another effective approach is to recombine the V“ or V;, s seiected by phage display with repertoires of naturally occurring V domain variants obtained from tmimmunized donors and screen for higher affinity in several rounds of chain reshuffling as bed in Marks et a1., Biotechnol., 10: 779-783 ( 1992). This technique allows the production of dies and antibody fragments with a dissociation constant Kd (keg/km) of about ‘9 M or less. {01 18] It will further be appreciated that similar procedures may be employed using libraries comprising eukaryotic cells (cg, yeast) that express binding pairs on their surface. As with phage display technology, the cukaryotic libraries are screened against the antigen of st (i.e., PTK7) and cells expressing candidate-binding pairs are isolated and cloned. Steps may be taken to optimize library content and for affinity maturation of the reactive binding pairs. See, for example, U.S.P.N. 7,700,302 and U.S.S.N. 12/404,059. In one embodiment, the human antibody is selected from a phage y, where that phage library ses human antibodies (Vaughan et al. Nature Biotechnology 14:309-3 I4 (1996): Sheets et al. Proc. Natl. Acad. Sci. 95:6157-6162 ); Hoogenboom and Winter, 1. Mol. Biol, 227:381 (1991); Marks et al.. J. Mol. Biol, 2222581 (1991)).
In other embodiments human binding pairs may be isolated from combinatorial antibody libraries generated in otic cells such as yeast. See e.g., U.S.P.N. 7,700,302. Such techniques advantageously allow for the screening of large s of candidate modulators and provide for relatively easy manipulation of candidate sequences (e.g., by affinity maturation or recombinant shuffling). {01 19] Human antibodies can also be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous globulin genes have been partially or completely inactivated. Upon nge, human antibody production is observed, which closely resembles that seen in humans in all respects, ing gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S.P.Ns. 5,545,807; 5,545,806; 825; 5,625,126; 425; 5,661,016, and U.S.P.N 6,075,18l and 6,150,584 regarding XenoMouse® logy along with the following scientific publications: Marks et al., chnology 10: 779-783 (1992); Lonberg et al., Nature 368: 856—859 (1994); Morrison, Nature 368:812—13 (1994); ld et al., Nature Biotechnology l4: 845-51 (1996); ger, Nature hnology 14: 826 (1996); Lonberg and Huszat, Intern. Rex. Immunol. 13:65—93 (1995).
Alternatively, the human antibody may be prepared via immortalization of human B—lymphocytes ing an antibody directed against a target antigen (such B lymphocytes may be recovered from an individual suffering from a neoplastic disorder or may have been immunized in vitro).
See, e.g., Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (l985); Boemer et al., .1. lmmunol, 147 (0:86—95 (1991); and U.S.P.N. 5,750,373.
VI. Antibody Characteristics 0120 No matter how obtained or which of the aforementioned forms the antibodY modulator takes (cg, humanized, human, etc.) the preferred embodiments of the disclosed modulators may exhibit various teristics. In this regard anti~PTK7 antibody-producing cells (e.g., hybridomas or yeast colonies) may be selected, cloned and further screened for ble characteristics including, forexample, robust growth, high antibody production and, as discussed in more detail below, desirable antibody characteristics. Hybridomas can be expanded in viva in syngeneic animals, in animals that lack an immune system, e.g., nude mice, or in cell culture in vitro. s of selecting, cloning and expanding hybridomas and/or colonies, each of which produces a discrete antibody species, are well known to those of ordinary skill in the art. a. lizing antibodies [012” In particularly red embodiments the modulators of the instant invention will se neutralizing antibodies or derivative or fragment thereof. The term neutralizing antibody or neutralizing antagonist refers to an antibody or antagonist that binds to or interacts with a PTK7 molecule and prevents g or association of the ligand to any binding partner thereby interrupting the biological response (e.g., phOSphorylation or VEGF—induced angiogenesis) that otherwise would result from the interaction of the molecules. In ing the binding and specificity of an antibody or immunologically functioaal fragment or derivative thereof, an antibody or fragment will substantially t binding of the ligand to its binding partner or substrate when an excess of antibody reduces the quantity of binding partner bound to the target molecule by at least about 20%, 3 9’0, 40%, 50%, 60%, 70%, 809’, 85%, 90%. 9 %, 97%, 99% or more as measured, for example, by phosphorylation or selected substrates (Shirt et al, Biochem and Biopltys Res Com, Vol. 37 I :4) or in an in vim; competitive g assay. In the case of antibodies to PTK7 for e. a neutralizing antibody or nist will preferably diminish the phosphorylation ability of PTK7 with regard to a specific substrate by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or more. It will be appreciated that this diminished activity may be measured directly using art ized techniques or may be measured by the impact such reduction will have on secondary activities such as angiogcnesis. b. Internalizina antibodies [0l22] While evidence indicates that PTK7 or selected isoforms thereof may be present in a soluble form, at least some PTK7 likely remains associated with the cell surface thereby ng for internalization of the disclosed modulators. Accordingly, the anti-I"I‘K7 antibodies of the instant invention may be internalized, at least to some , by cells that express PTK7. For example, an anti-PTK7 antibody that binds to 171‘K7 on the surface of a tumor—initiating cell may be internalized by the turner-initiating cell. In particularly preferred embodiments such anti-PTK7 antibodies may be associated with or conjugated to anti~cancer agents such as xic moieties that kill the cell upon internalization. {0l231 As used herein, an anti-PTK7 antibody that internalizes is one that is taken tip by the cell upon binding to PTK7 associated with a ian cell. The internalizing antibody es antibody fragments, human or humanized antibody and antibody conjugates. Internalization may occur in win-0 or in viva. For therapeutic applications, internalization may occur in viva. The number of antibody molecules internalized may be sufficient or adequate to kill a PTK7-expressing cell, especially a PTK‘i-expressing tumor initiating cell. Depending on the potency of the antibody or antibody conjugate, in same instances, the uptake of a single dy molecule into the cell is sufficient to kill the target cell to which the antibody binds. For example, certain toxins are highly potent in killing such that internalization of one molecule of the toxin conjugated to the antibody is sufficient to kill the tumor cell. Whether an anti—PTK7 antibody internalizes upon binding PTK7 on a ian cell can be determined by various assays including those described in the Examples below (cg, Examples 12 and 13). Methods of ing whether an antibody internalizes into a cell are also bed in U.S.P.N. 7,619,068 which is incorporated herein by reference in its entirety. c. Depicting antibodies i0l24] In other preferred embodiments the modulators of the instant ion will se depleting antibodies or derivatives or fragments thereof. The term depleting antibody refers to an antibody or fragment that binds to or associates with a PTK'] on or near the cell surface and s, promotes or causes the death, incapacitation or elimination of the cell (e.g., by complement—dependent cytotoxicity or antibody—dependent cellular cytotoxicity). In some embodiments discussed more fully below the selected depleting antibodies will be associated or conjugated to a cytotoxic agent. Preferably a depleting antibody will be able to remove, incapacitate, ate or kill at least 20%, 30%, 40%. 50%, 60%, 70%, 80%, 85%, 9 %, 95%, 97% or 99% of tumor perpetuating cells in a defined cell population. in some embodiments the cell population may comprise enriched, sectioned, purified or isolated tumor perpetuating cells. In other embodiments the cell population may comprise whole tumor samples or heterogeneous tumor extracts that comprise tumor perpetuating cells. Those skilled in the art will appreciate that standard biochemical techniques as bed in the Examples below (e.g., Examples 13 and 14) may be used to monitor and quantify the depletion of tumorigenic cells or tumor perpetuating cells in accordance with the teachings herein. (1. Epitope binding it will further be appreciated the disclosed anti-PTK’I antibodies will ate with, or bind to, discrete es or determinants presented by the ed target(s). As used herein the term epitOpe refers to that n of the target antigen capable of being recognized and specifically bound by a particular antibody. When the antigen is a polypeptide such as PTK7. epit0pes can be formed both from contiguous amino acids and noncontiguous amino acidsjuxtaposed by tertiary folding of a n. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. More specifically. the skilled artisan will appreciate the term epit0pe includes any protein determinant capable of specific binding to an imnnmoglobulin or T-cell receptor or ise interacting with a molecule. Epitopic determinants generally consist of chemically active surface ngs of molecules such as amino acids or carbohydrate or sugar side chains and generally have specific three dimensional structural teristics, as well as Specific charge characteristics. onally an e may be linear or conformational. In a linear epitope, all of the points of interaction between the protein and the interacting le (such as an antibody) occur linearly along the primary amino acid sequence of the protein. In a conformational epitope, the points of interaction occur across amino acid residues on the protein that are linearly separated from one another. [0l26] Once a desired e on an antigen is determined, it is possible to generate antibodies to that e, e.g., by immunizing with a peptide sing the epitope using techniques described in the present invention. Alternatively, during the ery process, the tion and terization of antibodies may elucidate information about desirable epitopes. From this information, it is then possible to competitively screen antibodies for binding to the same epitope.
An approach to achieve this is to conduct competition studies to find antibodies that itively bind with one another, i.e. the antibodies compete for binding to the antigen. A high throughput process for binning antibodies based upon their cross-competition is described in WO 03/48731. [0127} As used herein, the term binning refers to a method to group antibodies based on their antigen binding characteristics. The assignment ofbins is somewhat arbitrary, depending on how different the observed binding patterns of the antibodies tested. Thus, while the technique is a useful tool for categorizing antibodies of the instant invention, the bins do not always ly correlate with epitopes and such initial determinations of epitope binding should be further confirmed by other art recognized methodology as described .
With this caveat one can ine r a selected primary antibody (or fragment thereof) binds to the same epitope or cross competes for binding with a second antibody by using s known in the art and set forth in the Examples herein. in one embodiment, one allows the primary antibody of the invention to bind to PTK7 under saturating conditions and then measures the ability of the secondary antibody to bind to PTK7. If the test antibody is able to bind to PTK7 at the same time as the primary anti-PTK7 dy, then the secondary antibody binds to a different epitope than the y antibody. However, if the secondary dy is not able to bind to P’I‘K7 at the same time, then the secondary antibody binds to the same epitope, an overlapping epitope, or an epitope that is in close proximity to the epitope bound by the primary antibody. As known in the art and detailed in the Examples below, the desired data can be obtained using solid phase direct or indirect mmunoassay (RIA), solid phase direct or indirect enzyme immunoassay (BIA), sandwich competition assay, a BiacoreTM system (i.e., surface plasmon resonance — GE Healthcare), a ForteBio® Analyzer (i.e., bio-layer interferometry - ForteBio, Inc.) or flow cytometric methodology. The term surface plasmon resonance, as used herein, refers to an optical phenomenon that allows for the analysis of real-time specific interactions by detection of alterations in protein concentrations within a biosensor matrix. In a particularly preferred embodiment, the analysis is performer! using a Biacore or ForteBio instrument as demonstrated in the Examples below.
The term compete when used in the context of dies means competition between antibodies as determined by an assay in which the antibody or immunologically functional fragment under test prevents or ts Specific binding of a reference antibody to a common antigen. Typically, such an assay involves the use of purified antigen bound to a solid surface or cells bearing either of these, an unlabeled test globulin and a labeled reference immunoglobulin. Competitive inhibition is measured by determining the amount of label bound to the solid surface or cells in the presence of the test immunoglobulin. Usually the test immunoglobulin is t in excess. Antibodies fied by competition assay (competing antibodies) include dies binding to the same epitOpe as the reference antibody and antibodies binding to an adjacent e sufficiently proximal to the epitope bound by the reference antibody for steric hindrance to occur. Additional details regarding methods for determining competitive g are provided in the Examples . Usually, when a competing antibody is present in excess, it will inhibit specific binding of a reference antibody to a common antigen by at least 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75%. In some instance, binding is inhibited by at least 80%, 85%, 90%, 95%, or 9 % or more.
[Ol30] Besides epitopc specificity the disoloscd antibodies may be characterized using a number of different al characteristics including, for example, binding affinities, melting ature (Tm), and isoelectric . e. Binding affinity {0131] In this t. the present invention further encompasses the use of antibodies that have a high binding affinity fora selected PTK7 or, in the case of pan—antibodies, more than one type of PTK7. An antibody of the invention is said to specifically bind its target antigen when the dissociation constant K, (km/k0“) is 5 lO‘SM. The antibody specifically binds antigen with high affinity when the K. is 5 5x lO'QM, and with very high affinity when the K(. is 5 5x IO'IOM. In one embodiment of the invention, the antibody has a K, of S 1043M and an off—rate of about l’see.
In one embodiment of the invention, the off-rate is < lxlO'S/sec. In other embodiments of the invention, the antibodies will bind to P'l‘K? with a K; of between about lO‘SM and 10‘mM, and in yet another embodiment it will bind with a Ki 5 2x lO’wM. Still other selected ments of the present invention comprise dies that have a disassoeiation constant or Kd (km/k0“) of less than IO‘ZM, less than SXlO‘zM, less than lO'3M, less than leO'3M, less than 10‘4M, less than leO' 4M, less than lO‘SM, less than 5x lO'SM, less than lO'f’M, less than leO‘éM, less than lO'7M, less than 5xl0'7M, less than lO'gM, less than SXIO'SM, less than lO'9M, less than leO‘gM, less than 10' ’OM, less than SXIO‘ROM, less than l0"”l\/I, less than 5x 10'”M, less than IO'IQM, less than 5xlO“2M, less than 10"3M, less than leO"3M, less than lO'MM, less than SXIO'HM, less than lO'ISM or less than 5x10"5M. [0132} In specific embodiments, an antibody of the invention that ospeeifically binds to PTK'I has an association rate constant or k,,,, rate (PTK7 (Ab) + antigen (Ag)"},n<—Ab-Ag) of at least lOSM‘Is", at least 2x s‘], at least 5xl05M"s’l, at least 106M"s'1, at least 5x106M‘ls“, at least 107M"s", at least 5x lO7M"s", or at least 108M"s“.
In r ment, an antibody of the invention that immunospecifically binds to PTK7 has a clisassociation rate constant or kw rate (PTK7 (Ah) + antigen (Ag)k(,n-(-Ab-Ag) of less than 10"5‘ ', less than Sam’s", less than lO'gs", less than leO‘zs' ', less than l0'3s“, less than 5x10'3s’l, less than l0'4s'l, less than leoqs' I, less than lO'ss". less than 5", less than lO‘Gs' I, less than leO'os'l less than l0'7s~ ', less than 5xl0'7s", less than l0'8s'i, less than SXIO'SS", less than 100$", less than leO‘qs" or less than lO‘ms‘ 1.
In other selected embodiments of the present invention anti»PTK7 antibodies will have an affinity constant or Kn (km/ken) of at least , at least leOzM'], at least l03M“, at least 5x l03M". at least 104M", at least 5x10‘M", at least 105M", at least 5x105M“, at least ‘, at leasthlObM'l, at least 107M“, at least 5xlO7M‘1, at least 108M", at least leOSM", at least lOQM‘l, at least 5xlo9M", at least lO'OM“, at least 5xlo'0lvl", at least lo' ‘M", at least 5xlo“lvr', at least lOIQM‘l, at least 5XIOIZM'1, at least I, at least 5x lOUM‘E, at least lOMlVfl, at least SXIOMM", at least [0'5M'I or at least 5x1015M". f. lsoeleetric points In addition to the aforementioned binding properties, anti—PTK’] antibodies and fragments thereof, like all polypeptides, have an etrie Point (pl), which is generally defined as the pH at which a polypeptide carries no net charge. It is known in the art that protein solubility is typically lowest when the pH of the solution is equal to the isoelectric point (pl) of the n.
Therefore it is possible to optimize solubility by altering the number and location of ble residues in the antibody to adjust the pl. For example the pl of a polypeptide can be manipulated by making the appropriate amino acid substitutions (e.g., by substituting a charged amino acid such as a lysine, for an uncharged residue such as alanine). Without wishing to be bound by any particular theory, amino acid tutions of an antibody that result in changes of the pl of said antibody may improve solubility and/or the stability of the antibody. One skilled in the art would understand which amino acid substitutions would be most appropriate for a particular antibody to achieve a desired pl. [0136} The pl of a protein may be determined by a variety of methods ing but not d to, isoelectric focusing and various computeralgorithms (see for example Bjellqvist et al., I993, Electrophoresis 14: 1023). In one embodiment, the pl of the TK? antibodies of the invention is between is higher than about 6.5, about 7.0, about 75, about 8.0, about 8.5, or about 9.0. In another embodiment, the pl of the anti-PTK7 antibodies of the invention is between is higher than 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0. In yet r embodiment, tutions ing in alterations in the pl of antibodies of the invention will not significantly sh their binding ty for PTK7. As discusscd in more detail below, it is specifically contemplated that the tutionts) of the Fe region that result in altered binding to FcyR may also result in a change in the pi. In a preferred embodiment, substitutionts) of the Fc region are specifically chosen to effect both the desired alteration in FcyR binding and any desired change in pl. As used herein, the pi value is defined as the. pl of the predominant charge form. g. Thermal stability [Oi37] It will further be appreciated that the Tm of the Fab domain of an antibody can he a good indicator of the thermal stability of an antibody and may further provide an indication of the shelf life. Tm is merely the temperature of 50% unfolding for a given domain or sequence. A lower Tm tes more aggregation/less stability, whereas a higher 'l‘m indicates less aggregation/more stability. Thus, antibodies or fragments or derivatives having higher Tm are preferable. Moreover, using art—recognized ques it is possible to alter the composition of the anti-PTK7 antibodies or domains thereof to increase or optimize molecular stability. See, for example, U.S.PIN. 7,960,142. Thus, in one embodiment, the Fab domain of a selected antibody has a Tm value higher than at least 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 105°C, 1 10°C, 1 15°C or 120°C. In another embodiment, the Fab domain of an antibody has a Tm value higher than at least about 50°C, about 55°C, about 60°C, about 65°C, about 70°C, about 75°C. about 80°C, about 85°C, about 90°C, about 95°C, about l00°C, about 105°C, about i l0°C, about l 15°C or about 120°C. Thermal melting temperatures (Tm) of a protein domain (e.g., a Fab domain) can be measured using any standard method known in the art, for example, by differential scanning calorimetry (see, c.g.. r et al.. 2000, ys. 3. 04; Vermeer ct al., 2000, s. J. 79: 2150-2154 both incorporated herein by reference).
VII. PTK7 Modulator Fragments and Derivatives [Ol38] Whether the agents of the present invention se intact fusion constructs, antibodies, fragments or derivatives, the selected modulators will react, bind, combine, complex, connect, attach, join, interact or otherwise associate with PTK7 and thereby provide the desired anti-neoplastic s. Those of skill in the art will appreciate that modulators sing anti- P’I‘K'I antibodies interact or associate. with PTK? through one or more binding sites expressed on the antibody. More specifically, as used herein the term binding site comprises a region of a polypeptide that is responsible for selectively binding to a target molecule of interest (cg, enzyme, antigen, ligand, receptor, substrate or inhibitor). Binding domains se at least one binding site (eg. an intact IgG antibody will have two binding domains and two g sites). Exemplary binding domains include an antibody variable domain, a receptor-binding domain of a ligand, a ligand-binding domain of a receptor or an enzymatic domain. For the purpose of the instant invention the typical active region of PTK'I (e.g., as part of an Fe-PTK? fusion construct) may comprise a binding site for a substrate or promote phosphorylation. a. Fragments [0139} Regardless of which form of the tor (cg. chimeric, humanized, etc.) is selected to practice the invention, it will be appreciated that immunoreactive nts of the same may be used in accordance with the teachings herein. In the broadest sense, the term antibody fragment comprises at least a portion of an intact antibody (eg. a naturally occurring immunoglobulin).
More particularly the term fragment refers to a part or portion of an dy or antibody chain (or PTK7 molecule in the case of Fe fusiOns) comprising fewer amino acid residues than an intact or complete antibody or antibody chain. The term antigen»binding fragment refers to a polypeptide fragment of an immunoglobulin or antibody that binds antigen or competes with intact antibody (i.e., with the intact antibody from which they were derived) for antigen binding (i.e., ic binding). As used herein, the term nt of an antibody molecule includes antigen—binding fragments of antibodies, for example, an dy light chain (V1,), an antibody heavy chain (VH), a single chain antibody (scFv), a 2 fragment, a Fab fragment, an Fd fragment, an Fv Fragment, single domain antibody fragments, diabodies, linear antibodies, single-chain antibody molecules and multispecific antibodies formed from antibody fragments. Simiiarly. an active fragment of PfK7 ses a n of the PTK7 molecule that retains its ability to interact with PTK?‘ substrates or receptors and modify them in a manner similar to that of an intact PTK7 (e.g., phosphorylation ~ though maybe with somewhat less efficiency). [0l40] Those skilled in the art will appreciate fragments can be obtained via al or enzymatic treatment of an intact or complete modulator (e.g., antibody or antibody chain) or by inant means. In this regard, while various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, explicitly includes antibodies or fragments or derivatives thereof either produced by the cation of whole antibodies or synthesized de novo using recombinant DNA methodoiogies. {0141] More specifically, papain digestion of antibodies es two identical antigen-binding fragments, called Fab fragments, each with a single antigen-binding site, and a residual Fc fragment, whose name reflects its ability to llize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen. The Fab fragment also contains the constant domain of the Iight chain and the first constant domain (CH1) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy-chain CHI domain including one or more cysteines from the antibody hinge region. Fab-SH is the designation herein for Fab' in which the ne residuc(s) of the constant domains hear at least one free thiol group. 3 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of dy fragments are also known. See, e.g.. Fundamental lnununology, W. E. Patti, ed, Raven Press, NY. ( WOO), for a more detailed description of other antibody fragments.
It will further be iated that an Fv fragment is an antibody fragment that contains a complete antigen recognition and binding site. This region is made up of a dimer of one heavy and one light chain variable domain in tight association, which can be covalent in nature, for e in scFv. It is in this configuration that the three CDRs of each variable domain ct to define an antigen binding site on the surface of the VH-VL dimer. Collectively, the six CDRs or a subset thereof confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, gh usually at a lower ty than the entire binding site. [0143} In other embodiments an antibody fragment, for example, is one that comprises the Fc region, retains at least one of the biological functions normally associated with the Fc region when present in an intact antibody, such as FcRn binding, antibody half life modulation, ADCC function and complement binding. In one embodiment, an antibody fragment is a monovalent antibody that has an in vivo half life substantially r to an intact antibody. For example. such an antibody fragment may comprise on n binding arm linked to an Fe sequence e of conferring in vivo stability to the fragment. b. Derivatives {0144] In another embodiment, it will further be iated that the modulators of the invention may be monovalent or alent (e.g., bivalent, trivalent, etc). As used herein the term valency refers to the number of potential target (i.e., PTK7) g sites associated with an dy. Each target binding site specifically binds one target molecule or specific position or locus on a target molecule. When an antibody of the instant invention comprises more than one target g site (multivalent), each target binding site may specifically bind the same or different molecules (cg, may bind to different ligands or different antigens, or different epitopes or positions on the same antigen). For the purposes of the instant invention, the subject antibodies will preferably have at least one binding site specific for human PTK7. In one embodiment the antibodies of the instant invention will be monovalent in that each binding site of the molecule will specifically bind to a single PTK7 position ope. In other embodiments, the antibodies will be multivalent in that they comprise more titan one binding site and the different binding sites specifically associate with more than a single position or epitope. In such cases the multiple epitopes may be present on the selected PTK7 polypeptide or spice variant or a single epiIOpe may be present on PTK7 while a second, different epitope may be present on another le or surface. See, for e, U.S.P.N. 2009/Ol30105.
As alluded to above, multivalent antibodies may immunospecifically bind to different cs of the desired target molecule or may immunospccifieally bind to both the target molecule as well as a logous epitope, such as a heterologous polypeptide or solid support material.
While preferred embodiments of the anti~PTK7 dies only bind two antigens (i.e. bispecific antibodies), antibodies with additional specificities such as trispecific antibodies are also encompassed by the instant invention. Examples of bispecific antibodies include, without limitation, those with one arm directed against PTK7 and the other arm directed against any other antigen (e.g., a modulator cell marker). Methods for making bispecific antibodies are known in the art. Traditional production of full—length bispecific antibodies is based on the coexpression of two immunoglobulin heavy light chain pairs, where the two chains have different icities (Millstein et al., 1983, Nature, 305537-539). Other more sophisticated compatible multiSpecific ucts and methods of their fabrication are set forth in U.S.P.N. 2009/0155255. [0146} In yet other embodiments, antibody variable domains with the desired binding specificities (antibody—antigen combining sites) are fused to immunoglobulin nt domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant , comprising at least part of the hinge, C112, and/or CH3 regions. In one example, the first heavy- chain constant region (Cnl) containing the site necessary for light chain binding is present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain s and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co» transfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when, the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance. {0147] In one embodiment of this approach. the bispecific dies are ed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm (e.g., PTK7), and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding icity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This ch is disclosed in WO 94/04690. For further details of ting bispecific antibodies see, for example, Suresh et al., 1986, s in Enzymology, 121:210.
According to r approach described in WO96/2701 l, a pair of antibody molecules can be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 domain of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are ed with larger side chains (e.g. tyrosine or tryptOphan). Compensatory cavities of identical or r size to the large side chain(s) are d on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (eg. alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers. {0l48l Bispecific antibodies also e cross«linked or heteroconjugate antibodies. For e, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin.
Such antibodies have, for e, been proposed to target immune system cells to unwanted cells (U.S.P.N. 4,676,980), and for ent of HIV infection (WO 91/00360, WO 92/200373, and EP 03089). Heteroconjugat’e dies may be made using any convenient cross~linking methods.
Suitable cross-linking agents are well known in the art, and are disclosed in U.S.P.N. 4,676,980, along with a number of cross~linl<ing techniques.
VIII. PTK7 Modulators - nt Region Modifications a. Fc region and Fc receptors [0!49] In addition to the various modifications, substitutions, additions or deletions to the variable or binding region of the disclosed modulators (erg, Fc-PTK7 or anti-PTK7 antibodies) set forth above, those skilled in the art will appreciate that selected embodiments of the present invention may also se substitutions or modifications of the constant region (i.e. the Fe region). More particularly, it is contemplated that the FIR? modulators of the ion may n inter alia one or more additional amino acid residue substitutions, mutations and/or modifications which result in a compound with preferred characteristics including, but not limited to: altered pharmacokinetics, increased serum half life, increase binding affinity, reduced immunogenicity, increased production, d Fe ligand binding, enhanced or reduced ADCC or CDC activity, altered glycosylation and/or disulfide bonds and modified binding specificity. In this regard it will be appreciated that these Fe variants may advantageously be used to e the effective anti-neoplastic properties of the disclosed modulators.
The term Fc region herein is used to define a C—terminal region of an immunoglobulin heavy chain, including native sequence Fe regions and variant Fc regions. gh the boundaries of the Fe region of an immunoglobulin heavy chain might vary, the human IgG heavy chain Fc region is usually defined to stretch from an amino acid residue at position Cy5226, or from Pro230, to the carboxyl—terminus thereof, The C-terminal lysine (residue 447 according to the EU numbering system) of the Fc region may he removed, for example, during tion or cation of the antibody, or by recombinantly engineering the nucleic acid encoding a heavy chain of the antibody. ingly, a composition of intact antibodies may comprise antibody populations with all K447 residues removed, antibody populations with no K447 es removed, and antibody populations having a mixture of antibodies with and without the K447 residue. A functional Fc region possesses an effector function of a native sequence Fc region. Exemplary or functions include Cl q g; CDC; Fe receptor binding; ADCC; phagocytosis; down tion of cell surface ors (cg. B cell receptor; BCR), etc. Such effector functions generally require the Fc region to be combined with a binding domain (e.g., an antibody variable domain) and can be assessed using various assays as disclosed, for example, in definitions herein. [015 l] Fe receptor or FcR describes a receptor that binds to the Fc region of an antibody. in some embodiments, an FcR is a native human FcR. In some embodiments, an FcR is one that binds an lgG antibody (a gamma receptor) and es receptors of the Fer/RI, Fc.RH, and II subclasses, including allelic variants and atively spliced forms of those receptors. Fcyll receptors include FcleIA (an activating receptor) and FcyRIIB (an inhibiting receptor), which have similar amino acid sequences that differ ily in the cytoplasmic domains thereof.
Activating receptor Fey RIIA contains an imtnunoreceptor tyrosinebased activation motif (lTAM) in its cytoplasmic domain. Inhibiting receptor FyRIIB contains an reccptor tyrosine—based inhibition motif (ITIM) in its cytoplasmic domain. (see, e.g., Dacron. Annu. Rev. Immunol. [5203-234 (1997)). FcRs are reviewed, for example, in Ravetch and Kinet, Annu. Rev. Immunol 9145732 (1991 ); Cape] et al.. Immunomethods 4 (1994); and dc Haas et al., J. Lab. Clin.
Med. 126:330-41 ( l995). Other FeRs, including those to be identified in the future, are encompassed by the term FcR herein. The term Fe receptor or FcR also includes the neonatal receptor, FcRn, which, in n instances, is sible for the transfer of maternal IgGs to the fetus (Guyer et al., J. lmmunol. l 172587 (1976) and Kim et al., J. Immunol. 242249 (1994)) and regulation of tasis of innnunoglobulins. Methods of measuring binding to FcRn are known (see, e.g., Ghetic and Ward, i. Today 18( l2):592-S98 (1997); Ghetie et al., Nature Biotechnology, 15(7):637-640 G997); Hinton et al., J. Biol. Chem. :62l3-6216 (2004); W0 2004/92219 (Hinton et a1.) b. Fe functions [0152} As used herein complement dependent cytotoxicity and CDC refer to the lysing of a target cell in the presence of complement. The complement activation pathway is initiated by the binding of the first component of the complement system (CI q) to a le, an antibody for example. complexed with a cognate antigen. To assess complement. activation, a CDC assay, eg. as described in o-Santoro et al., 1996, J. Immtmol. Methods, 2022163, may be performed.
Further, dy-dependent cell—mediated cytotoxicity or ADCC refers to a form of xicity in which secreted lg bound onto Fc receptors (FcRs) t on certain cytotoxic cells (e.g., Natural Killer (NK) cells, neutrophils, and macrOphages) enables these cytotoxic effector cells to bind specifically to an antigen-bearing target cell and subsequently kill the target cell with cytotoxins. Specific high~affinity igG antibodies directed to the target arm cytotoxic cells and are absolutely required for such killing. Lysis of the target cell is extracellular, requires direct cell-to- cell contact, and does not involve complement. [0i54] PTK7 modulator variants with altered FcR binding affinity or ADCC activity is one which has either enhanced or diminished FcR binding activity and/or ADCC activity compared to a parent or unmodified antibody or to a modulator comprising a native sequence Fc region. The modulator variant which displays increased binding to an FcR binds at least one PcR with better affinity than the parent or unmodified antibody or to a modulator comprising a native sequence Fc region. A variant which displays decreased binding to an FcR, binds at least one FcR with worse affinity than the parent or unmodified antibody or to a modulator comprising a native ce Fc region. Such variants which display decreased binding to an FCR may possess little or no appreciable binding to an FCR, e.g., 020% binding to the FcR compared to a native sequence IgG Fe region, eg. as determined techniques well known in the art.
{Ol55] As to FcRn, the antibodies of the instant invention also comprise or encompass Fe variants with modifications to the constant region that provide ives (e.g., serum ives) in a mammal, preferably a human, of greater than 5 days, greater than 10 days, r than l5 days, preferably greater than 20 days, r than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, r than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months. The sed half-lives of the antibodies (or Fe containing molecules) of the present invention in a mammal, preferably a human, results in a higher serum titer of said antibodies or antibody fragments in the mammal, and thus, reduces the frequency of the administration of said antibodies or antibody fragments and/or reduces the concentration of said antibodies or antibody nts to be stered. Antibodies having increased in viva half-lives can be generated by techniques known to those of skill in the art. For e, antibodies with increased in viva half‘lives can be ted by ing (e. g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fe domain and the FcRn or (see, e.g., international Publication Nos. WO 97/3463 1; W0 04/029207; U.S.P.N. 6,737,056 and U.S.P.N. 2003/0l903l 1. Binding to human FcRn in tire and serum half life of human FcRn high affinity g polypeptides can be assayed e.g., in transgenic mice or transfeeted human cell lines expressing human FcRn, or in primates to which the polypeptides with a variant Fc region are administered. W0 2000/42072 describes antibody variants with improved or diminished binding to FCRns. See also, cg, Shields et al. J.
Biol. Chem. 9(2):659l-6604 (2001).
[Ol56] In still other embodiments, glycosylation patterns or compositions of the antibodies of the invention are modified. More particularly, preferred embodiments of the present invention may comprise one or more engineered glycoforms, i.e., an altered ylation pattern or altered carbohydrate composition that is covalently attached to a molecule sing an Fc .
Engineered glycoforms may be useful for a variety of purposes, including but not limited to enhancing or reducing effector function, increasing the ty of the antibody for a target antigen or facilitating production of the antibody. In cases where reduced effector function is d‘ it will be appreciated that the molecule may be engineered to express in an agiycosylated form. Such carbohydrate modifications can be accomplished by, for example, aitering one or more sites of glycosylation within the antibody sequence. That is, one or more amino acid substitutions can be made that result in elimination of one or more variable region framework glycosylation sites to y eliminate ylation at that site (see e.g. U.S.P.Ns. 5,714,350 and 6,350,861.
Conversely, enhanced effector functions or ed binding may be imparted to the Fe containing molecule by engineering in one or more additional glycosylation sites.
[Ol57l Additionally or alternatively, an Fe variant can be made that has an d glycosylation composition, such as a hypofucosylated antibody having reduced amounts of fucosyi residues or an antibody having increased bisecting GlcNAc structures. These and similar altered glycosylation patterns have been demonstrated to increase the ADCC ability of antibodies. Engineered glycoforms may be generated by any method known to one skilled in the art, for example by using engineered or variant expression strains, by ression with one or more enzymes (for example ylglucosaminyltransferase Ill (GnTll 1)), by expressing a molecule comprising an Fc region in various organisms or cell lines from various organisms or by ing carbohydrate(s) after the molecule comprising Fc region has been expressed. See, for e, Shields, R. L. et al. (2002) J.
Biol. Chem. 277:26733—26740; Umana et al. (1999) Nat. Biotech. l7: l76—l, as well as, European Patent No: EP l,l76,195; PCT ations W0 03/035835; W0 423, Umana et al, 1999, Nat. Biotechnol 17: I76- l 80; Davies et al., 20017 Biotechnoi Bioeng 742288-294; Shields et al, 2002, J Biol Chem 277:26733—26740; Shinkawa et al., 2003, J Biol Chem 278:3466-3473) U.S.P.N. 6,602,684; U.S.S.Ns. 10/277370; 10/ 1 13,929; PCT W0 00/61739A l; PCT W0 0 l/292246Ai: PCT W0 02/3 l 1 140m; PCT W0 02/30954Al; l’otillcgcntTM technology (Bion'a, Inc.); GlycoMAbTM glycosylation engineering logy (GLYCART biotechnology AG); W0 0006l739; EA01229125; N. 2003/01 15614; Okazaki et al., 2004, JMB, 336: 1239-49, IX. Modulator Expression a. Overview [0l58] DNA encoding the desired PTK7 modulators may be readily isolated and sequenced using conventional procedures (e.g., by using oligonttcleotide probes that are capable of binding specifically to genes encoding dy heavy and light chains). Isolated and subcloned hybridonta cells (or phage or yeast derived colonies) may serve as a preferred source of such DNA if the modulator is an antibody. If desired, the nucleic acid can further be manipulated as described herein to create agents including Fusion proteins, or chimeric, humanized or fully human antibodies.
More particularly, the isolated DNA (which may be modified) can be used to clone constant and variable region sequences for the manufacture antibodies as described in U.S.P.N. 7,709,61 l. [0l59l This exemplary method s extraction of RNA from the ed cells, conversion to cDNA, and amplification by PCR using antibody Specific primers. Suitable primers are well known in the art and, as exemplified herein, are readily available from numerous commercial sources. It will be appreciated that, to express a recombinant human or non-human antibody isolated by screening of a combinatorial library, the DNA encoding the antibody is cloned into a recombinant expression vector and introduced into host cells including mammalian cells, insect cells, plant cells, yeast, and bacteria. in yet other embodiments, the modulators are introduced into and expressed by simian COS cells, N80 cells, Chinese r Ovary (CHO) cells or myeloma cells that do not otherwise produce the desired construct. As will be discussed in more detail below, transformed cells expressing the desired modulator may be grown up in relatively large quantities to provide clinical and cial supplies of the fusion construct or immunoglobulin.
[Ol60] Whether the c acid encoding the d portion of the PTK7 modulator is obtained or derived from phage display logy, yeast libraries, liybridoma based technology, tically or from commercial sources, it is to be understood that the present invention explicitly asses nucleic acid molecules and ces encoding PTK7 modulators including fusion proteins and anti-PTK7 antibodies or antigen-binding fragments or derivatives thereof. The invention further encompasses nucleic acids or nucleic acid molecules (cg, polynucleotides) that ize under high stringency, or alternatively, under intermediate or lower stringency ization conditions (e.g., as defined below), to polynucleotides complementary to nucleic acids having a polynucleotide sequence that encodes a modulator of the invention or a nt or t thereof. The term nucleic acid molecule or isolated nucleic acid molecule. as used herein, is intended to include at least DNA les and RNA molecules. A nucleic acid molecule may be single—stranded or double—stranded, but preferably is double-stranded DNA. Moreover, the t invention comprises any vehicle or construct, incorporating such modulator encoding polynucleotide ing, without limitation, s, plasmids, host cells, cosmids Or viral constructs.
[Ol 61] The term isolated nucleic acid means a that the nucleic acid was (i) amplified in vitro, for example by polymerase chain reaction (PCR), (ii) recombinantly produced by cloning, (iii) purified, for example by cleavage and gel-electrophoretic fractionation, or (iv) synthesized, for example by chemical synthesis. An isolated nucleic acid is a nucleic acid that is available for manipulation by recombinant DNA techniques.
More specifically. nucleic acids that encode a modulator, ing one or both chains of an antibody of the invention, or a fragment, derivative, mutein, or t thereof, polynucleotides ient for use as hybridization probes, PCR primers or sequencing primers for identifying, analyzing, mutating or amplifying a polynucleotide encoding a polypeptide. anti-sense nucleic acids for inhibiting expression of a polynucleotide, and complementary sequences of the foregoing are also provided, The nucleic acids can be any . They can be, for example, 5, 10, l5, 20, 25, 30, 35, 40, 45,50, 75, l00, 125, [50, I75, 200, 250, 300, 350, 400, 450, 500, 750, l,000, l,500, 3,000, 5,000 or more nucleotides in length, and/or can comprise one or more onal sequences, for example, regulatory ces, and/or be part of a larger nucleic acid, for example, a vector. These nucleic acids can be single-stranded or double—stranded and can comprise RNA and/or DNA nucleotides, and cial variants thereof (e.g., peptide nucleic . c acids encoding modulators of the invention, including antibodies or immunoreactive fragments or derivatives thereof, have preferably been isolated as described above. [0163} As indicated, the invention further es nucleic acids that hybridize to other nucleic acids under particular hybridization conditions Methods for hybridizing nucleic acids are well known in the art. See, e.g., Current Protocols in Molecular Biology, John Wiley & Sons, N .Y. (1989), 63.1-63.6. For the purposes of the instant application, a moderately stringent hybridization condition uses a prewashing solution containing 5x sodium chloride/sodium citrate (SSC), 0.5% SDS, 1.0 mM EDTA (le 8.0), hybridization buffer of about 50% formamide, 6xSSC, and a hybridization temperature of 55°C (or other similar hybridization solutions, such as one containing about 50% formamide, with a hybridization temperature of 42°C), and washing conditions of 60°C, in 0.5xSSC. 0. l % SDS. A ent ization condition liybridizes in GXSSC at 45°C, followed by one or more washes in 0.leSC, 0.3“? SDS at 68°C. Furthermore, one of skill in the art can manipulate the hybridization and/or washing conditions to increase or decrease the stringency of hybridization such that c acids comprising nucleotide sequences that are at least 65, 70, 75, 80, 85, 90, 95, 98 or 99% identical to each other typically remain hybridized to each other. More generally, for the purposes of the instant disclosure the term substantially identical with regard to a nucleic acid sequence may be construed as a sequence of nucleotides exhibiting at least about 85%, or 90%, or 95%, or 97% sequence identity to the reference nucleic acid sequence. {0164] The basic parameters affecting the choice of hybridization conditions and guidance for devising suitable conditions are set forth by, for e, Sambrook, Fritsch, and Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. N.Y., chapters 9 and l l; and Current Protocols in Molecular Biology, 1995, Ausubel et al., eds, John Wiley & Sons, Inc, sections 2. l0 and 6.3-6.4), and can be readily ined by those having ordinary skill in the art based on, for e, the length and/or base ition of the nucleic acid.
IOl65] it will further be appreciated that nucleic acids may, according to the invention, be present alone or in ation with other nucleic acids, which may be homologous or heterologous. In red embodiments, a nucleic acid is functionally linked to sion control sequences that may be homologous or logous with respect to said nucleic acid. In this context the term homologous means that a c acid is also functionally linked to the expression control sequence naturally and the term heterologons means that a nucleic acid is not functionally linked to the expression l sequence naturally. c. Expression l0l66] A nucleic acid, such as a nucleic acid expressing RNA and/or protein or peptide, and an expression l sequence are onally linked to one another, if they are covalently linked to one r in such a way that expression or transcription of said nucleic acid is under the control or under the influence of said expression control sequence. If the nucleic acid is to be translated into a functional protein, then, with an expression control sequence functionally linked to a coding sequence, induction of said expression control ce results in transcription of said nucleic acid, without g a frame shift in the coding sequence or said coding sequence not being capable of being translated into the desired protein or peptide. [0 l 67} The term expression control sequence comprises according to the invention promoters, ribosome binding sites, enhancers and other control elements that regulate transcription of a gene or translation of mRNA. In particular embodiments of the invention, the expression control sequences can he regulatecli The exact structure of expression l sequences may vary as a function of the species or cell type, but generally comprises S’—untranscribed and 5'- and 3‘—untranslated sequences which are involved in initiation of transcription and translation, respectively, such as TATA box, capping sequence, CAAT sequence, and the like. More specifically, 5'~untranscribed expression control sequences comprise a promoter region that includes a promoter sequence for transcriptional control of the- functionally linked nucleic acid. Expression control sequences may also comprise enhancer sequences or upstream activator sequences.
[Ol 68] According to the invention the term promoter or promoter region relates to a nucleic acid sequence which is d upstream (5') to the nucleic acid sequence being expressed and ls expression of the sequence by providing a recognition and binding site for RNA- rase. The promoter region may include further recognition and binding sites for further factors that are involved in the regulation of transcription of a gene. A promoter may control the transcription of a prokaryotic or eukaryotic gene. Furthermore, a promoter may be inducible and may initiate transcription in response to an inducing agent or may be constitutive il’ transcription is not controlled by an inducing agent. A gene that is under the control of an ble promoter is not expressed or only expressed to a small extent if an inducing agent is absent. In the presence of the inducing agent the gene is switched on or the level of ription is increased. This is mediated, in l, by binding of a specific transcription factor.
[Ol69] Promoters which are preferred according to the ion include promoters for SP6, T3 and T7 polymerase, human U6 RNA promoter, CMV promoter, and artificial hybrid promoters thereof (eg. CMV) where a part or parts are fused to a part or parts of promoters of genes of other cellular proteins such as e.g. human GAPDH (glyceraldehyde—B-phosphate dehydrogenase), and including or not including (an) additional intron(s). [0i70] According to the invention, the term expression is used in its most general meaning and ses the production of RNA or of RNA and protein/peptide. It also comprises partial expression of c acids. rmore, expression may be carried out transiently or stably. 10l7l] In a preferred embodiment, a c acid molecule is according to the invention present in a vector, where appropriate with a er. which controls expression of the nucleic acid. The term vector is used here in its most l meaning and comprises any intermediary vehicle for a nucleic acid which enables said nucleic acid, for e, to be introduced into prokaryotic and/or eukaryotic cells and, where appropriate, to be integrated into a genome. s of this kind are preferably replicated and/or sed in the cells. Vectors may comprise plasmids, phagemids, bacteriophages or viral genomes. The term plasmid as used herein generally relates to a construct of extracln'omosomal genetic al, usually a circular DNA duplex, which can replicate independently of chromosomal DNA. [0172} In practicing the present invention it will be iated that many conventional techniques in molecular biology, microbiology, and recombinant DNA technology are Optionally used. Such couventional techniques relate to vectors, host cells and recombinant methods as defined . These techniques are well known and are explained in, for example, Berger and Kimmel, Guide to Molecular g Techniques, Methods in Enzymology volume 152. Academic Press, Inc, San Diego, Calif.; Sambrook et al., Molecular Cloning-A Laboratory Manual (3rd Ed), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 and Current Protocols in Molecular Biology, F. M. Austibel et al., eds, supra Other useful references, e.g. for cell isolation and culture (e.g., for subsequent nucleic acid or protein ion) include Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition, Wiley-Liss, New York and the references cited therein; Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. New York, N.Y.; Gamborg and Phillips (Eds) ([995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer—Verlag (Berlin Heidelberg New York) and Atlas and Parks (Eds) The ok of Microbiological Media (1993) CRC Press, Boca Raton, Fla. Methods of making nucleic acids (e.g., by in vitro amplification, purification from cells, or chemical synthesis), methods for manipulating nucleic acids (cg, site-directed mutagcnesis, by restriction enzyme digestion, ligation, etc.), and various vectors, cell lines and the like useful in manipulating and making nucleic acids are described in the above references. In addition, essentially any polynucleotide ding, e.g., labeled or biotinylated polynucleotides) can be custom or standard ordered from any of a variety of commercial sources. [0173} Thas, in one aspect, the t invention provides recombinant host cells ng recombinant expression of antibodies of the invention or portions thereof. Antibodies produced by expression in such recombinant host cells are referred to herein as inant antibodies. The present invention also provides progeny cells of such host cells, and dies produced by the same.
{Ol74} The term recombinant host cell (or simply host cell), as used herein, means a cell into which a recombinant expression vector has been uced. it should be understood that recombinant host cell and host cell mean not only the particular subject cell but also the progeny of such a cell. Because certain modifications may occur in ding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term host cell as used herein. Such cells may comprise a vector according to the invention as described above. [0175} In another aspect, the present invention provides a method for making an antibody or portion thereof as described . According to one embodiment, said method comprises culturing a cell transfected or transformed with a vector as described above, and retrieving the antibody or portion f. {0176} As indicated above, expression of an antibody of the invention (or fragment or variants thereof) preferably comprises expression vector(s) containing a polynucleotide that s the desired anti-PTK7 antibody. Methods that are well known to those skilled in the art can be used to construct expression vectors sing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for e, in vizro recombinant DNA techniques, synthetic ques, and in viva genetic recombination. Embodiments of the invention, thus, e replicable vectors sing a nucleotide sequence encoding an anti- PTK7 antibody of the ion (e.g., a whole antibody, a heavy or light chain of an antibody, :1 heavy or light chain variable domain of an antibody, or a portion thereof. or a heavy or light chain CDR, a single chain Fv, or fragments or variants thereof), operably linked to a promoter. in preferred embodiments such vectors may include a nucleotide sequence encoding the heavy chain of an antibody molecule (or fragment thereof), a nucleotide sequence encoding the light chain of an antibody (or fragment thereof) or both the heavy and light chain. {0l77] Once the nucleotides of the present invention have been isolated and modified according to the ngs herein, they may be used to produce selected modulators including anti-PTK7 antibodies or fragments thereof.
X. Modulator Production and Purification Using art recognized molecular biology techniques and current protein ex pression methodology, ntial quantities of the desired modulators may be produced. More specifically, nucleic acid molecules encoding modulators, such as dies ed and engineered as bed above, may be integrated into well known and commercially available protein production systems comprising various types of host cells to provide preclinical, clinical or commercial quantities of the desired pharmaceutical product. it will be iated that in preferred embodiments the nucleic acid molecules encoding the tors are engineered into vectors or expression vectors that provide for efficient integration into the ed host cell and subsequent high expression levels of the desired PTK? tor.
Preferably nucleic acid molecules encoding PTK7 modulators and vectors comprising these nucleic acid molecules can be used for transfection of a suitable mammalian, plant, bacterial or yeast host cell though it will be appreciated that proltaryotic systems may be used for modulator production. ection can be by any known method for ucing polynoclcotides into a host cell. s for the introduction of logous polynuclcotidcs into ian cells are well known in the art and include dextran—mediatcd transfcction, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into . In addition, nucleic acid molecules may be introduced into mammalian cells by viral s. Methods of transforming mammalian cells are well known in the art. See, e.g., U.S.P.Ns 4,399,216, 4,912,040, 4,740,461, and 4,959,455. Further, methods of transforming plant cells are well known in the art, including, e.g., agrobacteriurn-mediated transformation, biolistic transformation, direct injection, electroporation and viral ormation. Methods of transforming bacterial and yeast cells are also well known in the art.
[OESOJ Moreover, the host cell may be nsfected with two expression vectors of the invention, for example, the first vector encoding a heavy chain d ptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain cal selectable markers that enable substantially equal expression of heavy and light chain polypeptides.
Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides In such situations, the light chain is preferably placed before the heavy chain to avoid an excess of toxic free heavy chain. The coding sequences for the heavy and light chains may se CDNA or c DNA. a. Host-expression systems [0l8 l] Varieties of host-expression vector systems, many commercially available, are compatible with the teachings herein and may be used to express the modulators of the invention.
Such host-expression systems represent vehicles by which the coding sequences of interest may be expressed and subsequently ed, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express a molecule of the invention in situ. Such systems include, but are not limited to, microorganisms such as bacteria (e.g., E. coli, B. subtilis, streptomyecs) transformed with recombinant bacteriOphage DNA, plasmid DNA or cosmid DNA expression vectors containing modulator coding sequences; yeast (e.g..
Saccharomyces, Pichia) transfected with recombinant yeast expression vectors containing modulator coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baeulovirus) ning modulator coding sequences; plant cell systems (e.g., Nicotlana, ArabidOpsis, duckweed, corn, wheat, potato, etc.) ed with recombinant virus expression s (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transfected with recombinant plasmid expression vectors (cg, Ti plasmid) coutaining tor coding ces; or mammalian cell systems leg, COS, Cl-lO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (cg, othionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). [0182} In bacterial systems, a number of expression vectors may be advantageously selected ing upon the use intended for the molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of a modulator, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., EMBO l. 2: l79l (1983)), in which the coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & , Nucleic Acids Res. 132310143109 (1985); Van Heelte & Schuster, J. Biol. Chem. 2455036509 (1989)); and the-like, pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST .
In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) may be used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The coding sequences may be cloned individually into non-essential regions (for example, the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example. the polyhedrin promoter).
In mammalian host cells, a number of viral-based expression s may be used to introduce the desired nucleotide ce. In cases where an adenovirus is used as an sion vector, the coding sequence of interest may be ligated to an irus ription/translalien control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non- essential region of the viral genome (cg, region E1 or EB) will result in a recombinant virus that is viable and capable of sing the molecule in infected hosts (cg, see Logan & Shenk, Proc.
Natl. Acad. Sci. USA 8 59 ). Specific initiation signals may also be required for efficient translation of inserted coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the tion codon must be in phase with the reading frame of the desired coding sequence to ensure ation of the entire insert. These exogenous translational control signals and initiation codons can he of a variety of s, both natural and synthetic. The ency of expression may be enhanced by the ion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittner et al., Methods in Enzymol. 153:51-544 (1987)). Thus, compatible mammalian cell lines available as hosts for expression are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC). These include, inter alia, Chinese hamster ovary (CHO) cells, N80 cells, SP2 cells, HER-293T cells, 293 Freestyle cells (Life Technologies), NIH— 3T3 cells, HeLa cells, baby hamster kidney (BHK) cells, African green monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep 62), A549 cells, and a number of other cell lines.
For long—term, high~yield production of recombinant proteins stable expression is preferred. Accordingly, cell lines that stably express the ed modulator may be engineered using standard art recognized techniques. Rather than using expression vectors that contain viral origins of ation, host cells can be transformed with DNA controlled by appropriate sion control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc), and a able marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The able marker in the inant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to er cell lines which s the molecule. Such engineered cell lines may be particularly useful in screening and evaluation of compositions that interact directly or indirectly with the molecule. [01861 A number of selection systems are well known in the art and may be used including, but not d to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 1 1:223 0977)), hypoxanthineguanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci.
USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:8 17 (1980)) genes can be employed in tk-, hgprtw or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhl’r, which s resistance to methotrexale (Wigler et al., Natl. Acad. Sci. USA 77:35? U980); O'Hare et al., Proc. Natl. Acad.
Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 782072 (1981)); neo, which s resistance to the aminoglycoside (3-418 (Clinical Pharmacy 122488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann.
Rev. Pharmacol. l. 32:573—596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 ; TIB TECH 11(5): 155-2 15 (May, 1993)); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30:147 (1984)). Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired inant clone, and such methods are described, for example, in Ausubel et al. (eds), Current Protocols in lar Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY ; and in Chapters l2 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (l994); Colberre—Garapin et a1., 3. M01. Biol. l5021 (1981), It will be appreciated that one particularly preferred method of establishing a stable, high yield cell line ses the glutamine synthetase gene expression system (the GS system) which provides an efficient approach for enhancing expression under certain conditions. The GS system is discussed in whole or part in connection with EP patents 0 216 846, O 256 055, 0 323 997 and O 338 841 each of which is orated herein by reference. i0i87] In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired.
Such modifications , glycosylation) and processing (e.g., cleavage) of protein products may be important for the function and/or purification of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and ation of proteins and gene products. As known in the art appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the expressed polypeptide. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary ript, glycosylation, and phosphorylation of the gene product are particularly effective for use in the instant invention. ingly, particularly preferred mammalian host cells include, but are not limited to, CHO, VERY, BHK, HcLa, COS, NSO, MDCK, 293, 3T3, W138, as well as breast cancer cell lines such as, for example, BT483, H5578T, I-ITBZ, BT20 and T47D, and normal mammary gland cell line such as, for exampie, CRL703O and HsS78Bst. Depending on the modulator and the selected production , those of skill in the art may easily select and optimize appropriate host cells for ent expression of the tor. b. Chemical synthesis s the aforementioned host cell systems, it will be appreciated that the modulators of the invention may be chemically synthesized using techniques knowu in the art (e.g., see Creighton, E983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiiler, M., et al., 1984, Nature 310: lOS—l l I). For example, a peptide ponding to a polypeptide fragment of the invention can be sized by use of a peptide synthesizer, Furthermore, if d, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or on into a polypeptide sequence. Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-a1ninobutyric acid, Abu, Ziamino butyric acid, g-Abu, e—Ahx, 6iamino hexanoic acid, Ail), Z-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitruiiine, cysteic acid, t—butylglycine, t-butylaianine, phenylglycine, cyclohexyialanine, b-alanine, fluoro—amino acids, designer amino acids such as 1)- methyl amino acids, Ca-mcthyi amino acids, Nit—methyl amino acids, and amino acid analogs in general. rmore, the amino acid can be D orotary) or L (levorotary). c. Transgenic systems [0l89] The PTK7 tors of the invention also can be produced transgenically through the generation of a mammal or plant that is enic for the immunoglobulin heavy and light chain sequences (or fragments or derivatives or variants thereof) of interest and production of the desired compounds in a recoverable form. In connection with the transgenic production in mammals, anti- PTK7 antibodies, for example, can be produced in, and recovered from, the milk of goats, cows, or other s. See. e.g., Ns. 690, 5,756,687, 5,750,!72, and 5,741,957. In some embodiments, non-human transgenic animals that comprise human immunoglobulin loci are immunized with PTK7 or an immunogenic portion thereof, as described above. Methods for making antibodies in plants are described, e.g., in U.S.P.Ns. 6,046,037 and 5,959,177.
In accordance with the teachings herein non-human transgenic s or plants may be produced by introducing one or more nucleic acid molecules encoding a PTK? tor of the invention into the animal or plant by standard transgenic ques. Sec Hogan and U.S. Pat. No. 6,417,429. The transgenic cells used for making the transgenic animal can be embryonic stem cells or somatic cells or a fertilized egg. The transgenic non-human organisms can be chimeric, meric heterozygotes, and nonchimeric homozygotes. See, e.g., Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual 2nd ed, Cold Spring Harbor Press (E999); Jackson et al., Mouse. Genetics and Transgenics: A Practical ch, Oxford University Press (2000); and Pinkert, Transgenic Animal Technology: A Laboratory Handbook, Academic Press (1999). In some embodiments, the transgenic man s have a ed disruption and replacement by a targeting construct that s, for example, a heavy chain and/or a light chain of interest. In one embodiment, the transgenic animals comprisc and express nucleic acid molecules encoding heavy and light chains that specifically bind to PTK7. While anti-PTK? antibodies may be made in any transgenic animal, in particularly preferred embodiments the non—human animals are mice, rats, sheep, pigs, goats, cattle or horses. in further embodiments the non-human enic animal expresses the d ceutical product in blood, milk, urine, saliva, tears, mucus and other bodily fluids from which it is readily obtainable using art recognized purification techniques.
It is likely that modulators, including antibodies, expressed by different cell lines or in transgenic animals will have different glycosylation patterns from each other. However, all modulators encoded by the nucleic acid molecules provided herein, or comprising the amino acid sequences provided herein are part of the instant invention, regardless of the glycosylation state of the molecule, and more generally, regardless of the ce or absence of post—translational modifieationts). In addition the invention encompasses modulators that are differentially modified during or after translation, e.g., by glycosylation, aeetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical cations may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBHi, acetylation, formylation, ion, ion, metabolic synthesis in the presence of tunicamycin, etc. Various post—translational modifications are also encompassed by the invention include, for example, e.g., ed or O- linked carbohydrate , processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked ydrate chains, and addition or deletion of an N~terminal methionine residue as a result of prokaryotic host cell expression. Moreover, as set forth in the text and Examples below the polypeptides may also be modified with a able label, such as an enzymatic, fluorescent, radioisot0pic or affinity label to allow for detection and isolation of the modulator. (1. cation Once a modulator of the invention has been produced by inant expression or any one of the other techniques disclosed herein, it may be purified by any method known in the art for purification of immunoglobulins, or more lly by any other standard technique for the purification of proteins. In this respect the modulator may be isoiated. As used herein, an isolated PTK7 modulator is one that has been fied and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the polypeptide and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. Isolated tors include a modulator in silu within recombinant cells e at least one component of the pol ypeptide's natural environment will not be present. [0193} When using recombinant techniques, the PTK? modulator (cg. an anti«PTK7 antibody or derivative or fragment f) can be produced.intracellularly, in the peripiasmic space, or directly ed into the medium. If the desired molecule is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, may be removed, for example, by centrifugation or ultrafiltration. For example, Carter, et al., Bio/Technology [0:163 (1992) be a procedure for isolating antibodies that are secreted to the periplasmic Space of E. coli. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 minutes. Cell debris can be removed by centrifugation. Where the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon iitration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of itious contaminants.
The modulator (cg, fc-PTK7 or anti—PTK7 dy) composition prepared from the cells can be purified using, for example. hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fe domain that is present in the selected construct. Protein A can be used to purify antibodies that are based on human IgG 1, lgG2 or IgG4 heavy chains (Lindmarlt, et al.,J lmmunol Meth 62:1 (1983)). Protein G is recommended for all mouse isotypes and for human IgG3 (Guss, et al., EMBO J 5:1567 (l986)). The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)bcnzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the antibody comprises :1 CH3 domain, the Bakerbond ABX'“ resin (J. T. Baker; Phillipsburg, NJ.) is useful for purification. Other techniques for protein purification such as fractionation on an ion—exchange column, ethanol precipitation, reverse phase HPLC, cinematography on silica, chromatography on heparin, sepharose chromatography on an anion or cation ge resin (such as a polyaspartic acid column), chromatofocusing, SDS-PAGE and ammonium sulfate precipitation are also available depending on the antibody to be recovered. In particularly preferred embodiments the modulators of the instant ion will be purified, at least in part, using Protein A or n G affinity chromatography.
XI. ated PTK’? Modulators {0195] Once the modulators of the invention have been purified according to the teachings herein they may be linked with, fused to, conjugated to (cg, covalently or non-covalently) or otherwise assodated with pharmaceutically active or diagnostic moieties or biocompatible modifiers. As used herein the term ate will be used broadly and held to mean any le associated with the disclosed modulators less of the method of association. In this respect it will be understood that such conjugates may comprise peptides, polypeptides, proteins, polymers, c acid molecules, small molecules, mimetic agents, synthetic drugs, inorganic molecules, c molecules and radioisotopes. Moreover, as indicated above the ed conjugate may be covalently or valently linked to the tor and exhibit various molar ratios ing, at least in part, on the method used to effect the conjugation.
[Oi 96} In red embodiments it will be apparent that the modulators of the invention may be conjugated or associated with proteins, polypeptides or peptides that impart selected characteristics (cg, biotoxins, biomarkers, purification tags, etc.). More generally, in selected embodiments the present invention encompasses the use of modulators or fragments thereof recombinantly fused or chemically ated ding both covalent and non-covalent conjugations) to a heterologous n or polypeptide wherein the polypeptide comprises at least , at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least. 80, at least 90 or at least 100 amino acids. The construct does not necessarily need to be directly linked, but may occur through linker sequences. For example, antibodies may be used to target lieterologous polypeptides to ular cell types expressing PTK7, either in vitro or in vivo. by fusing or conjugating the modulators of the present invention to antibodies specific for particular cell surface receptors.
Moreover, modulators fused or conjugated to heterologous polypeptides may also be used in in vitro immunoassays and may be ible with purification methodology known in the art. See e.g., International publication No. WO 93121232; an Patent No. EP 5; ttra et al., 1994, Immunol. Letti 39:91—99; US. Pat. No. 5,474,981; Gillies et al., l992, PNAS 892M28- l432; and Fell ct al., l99l, J. Immunol. 146:2446-2452. :1. Biocompatible modifiers In a red embodiment, the modulators of the invention may be conjugated or otherwise associated with biocompatible ers that may be used to adjust, alter, improve or moderate modulator characteristics as d. For example, antibodies or fusion constructs with increased in viva half-lives can be generated by attaching relatively high molecular weight polymer molecules such as commercially available polyethylene glycol (PEG) or similar biocompatible polymers. Those skilled in the art will appreciate that PEG may be obtained in many different molecular weight and lar configurations that can be selected to impart specific properties to the antibody (eg the half~life may be tailored). PEG can be ed to modulators or antibody fragments or derivatives with or without a multifunctional linker either through site—specific conjugation of the PEG to the N— or C-terminus of said antibodies or antibody fragments or via epsilon-amino groups present on lysine residues. Linear or ed polymer derivatization that results in minimal loss of biological activity may be used. The degree of conjugation can be closely monitored by SDS~PAGE and mass spectrometry to ensure Optimal conjugation of PEG molecules to antibody molecules. Unreacted PEG can be separated from antibody-PEG conjugates by, e.g., size exclusion or change cinematography. In a similar , the disclosed modulators can be conjugated to albumin in order to make the antibody or antibody fragment more stable in vivo or have a longer half life in vivo. The techniques are well known in the art, see e.g., international Publication Nos. W0 93/ | S 199, W0 93/ i 5200, and W0 01/77 l 37; and European Patent No. 0 4i 3, 622. Other biocompatible conjugates are evident to those of ordinary skill and may readily be fied in accordance with the teachings herein. b. Diagnostic or detection agents [01981 in other preferred embodiments, tors of the present ion, or fragments or derivatives thereof, are conjugated to a diagnostic or detectable agent, marker or reporter which may be a biological molecule (e.g., a peptide or nucleotide), a small molecule, phore, or radioisotope. Labeled modulators can be useful for monitoring the development or progression of a hyperproliferative disorder or as part of a clinical testing procedure to determine the efficacy of a particular therapy including the disclosed modulators (i.e. theragnostics) or to determine a future course of treatment. Such markers or reporters may also be useful in ing the selected modulator, separating or isolating TIC or in preclinical procedures or toxicology s.
Such diagnosis and ion can be lished by coupling the modulator to detectable substances including, but not limited to, various enzymes comprising for example horseradish peroxidase, alkaline phosphatase, beta~galactosidase, or acetylcholinesterase; prosthetic groups, such as but not limited to streptavidinlbiotin and avidin/biotin; fluorescent materials, such as but not limited to, umbelliferone, fluorescent, fluorescent isothiocynate, rhodamine, dicltlorotriazinylamine scein, dansyl chloride or phycoerythrin; luminescent materials, such as but not limited to, luminol; bioluminescent als, such as but not limited to, rase, luciferin, and aequorin; radioactive als, such as but not d to iodine (”[1, ml, '23], ’31,), carbon (NC), sulfur (35$), m (3H), indium (”5111, min, 112In, 1Him), and technetium (”Tc), um (:O'Ti), gallium (“Ga 67Ga), palladium ('03Pd), molybdenum (99Mo), xenon (mXe), "fluorine (18F), 1538“]! 277M, mGd, HQPm! mom, 175:ng ‘GGHO, 90y, ”Sc, lSGRe: lBSRc, 1-4an lOSRh, ”Ru. 680e, 57Co. “Zn. 8551: ”P, mGd. mqu,SICI‘,543411.7536, “33m and “7Tin: positron emitting metals using various positron emission aphies, noradioactive paramagnetic metal ions, and molecules that are radiolabeled or conjugated to specific radioisotopes. In such embodiments appropriate detection methodology is well known in the art and readily available from numerous commercial sources.
As indicated above, in other embodiments the modulators or fragments thereof can be fused to marker sequences, such as a peptide or fluoroPhore to facilitate purification or diagnostic procedures such as immunohistochemistry or FACs. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide (SEQ ID NO: 7), such as the tag provided in a pQE vector (Qiagen Inc), among others, many of which are commercially available. As bed in Gentz et al., E989, Proc. Natl. Acad. Sci. USA 86:821~824, for instance, hexa-histidine provides for convenient purification of the fusion protein. Other e tags useful for purification include. but are not limited to, the hemaggiutinin "HA" tag, which corresponds to an epitOpe derived from the influenza hemagglutinin protein (Wilson et at, 1984. Cell ) and the "flag" tag (U.S.P.N. 4,703,004). c. Therapeutic Moieties As usly alluded to the tors or fragments or tives thereof may also be conjugated, linked or fused to or otherwise associated with a therapeutic moiety such as anti-cancer agents, a cytotoxin or cytotoxic agent, e.g., a cytostatic or cytocidal agent, a eutic agent or a radioactive metal ion, e.g., alpha or betawemitters. As used herein a cytotoxin or xic agent includes any agent or therapeutic moiety that is detrimental to cells and may inhibit cell growth or survival. Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, cmetine, mitomycin, eleposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin, maytansinoids such as DM—l and DM—4 (lmmunogen, Inc), dione, mitoxantrone. mithramycin, actinomycin D, l-dehydrotestoster0ne, orticoids, procaine, tetracaine, iidocaine, prepranolol, putomycin, epirubicin, and cyclophosphamide and analogs or homologs thereof. Additional cytotoxins comprise auristatins, inciuding monomethyl auristatin E (MMAE) and monomethyl atin F (MMAF) (Seattle Genetics, Inc), amanitins such as alpha- amanitin, beta-amanitin, gamma-amanitin or n-amanitin (Heidelberg Pharma AG), DNA minor groove binding agents such as duocarmycin derivatives (Syntarga, B.V.) and modified pyrrolobenzodiaZepine dimers (PBDs, Spirogen, Ltd). Furthermore, in one embodiment the PTK7 modulators of the instant invention may be ated with anti-CD3 binding molecules to recruit cytotoxic T-cells and have them target the tumor initiating cells (BiTE technology; see e.g., nn, S. et. at. Annual Meeting of AACR Abstract No. 5625 (2010) which is incorporated herein by reference). {0202] Additional compatible therapeutic moieties comprise cytotoxic agents including. but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5— flttorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BCNU) and lomustine (CCNU), cyclothosphamide. busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (ll) (DDP) ciSplatin), cyclines (e.g., ubicin (formerly ycin) and doxorubicin), antibiotics (e.g., dactinomycin (formeriy mycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine). A more extensive list of eutic moieties can be found in PCT ation W0 03/075957 and U.S.P.N. 200910155255 each of which is incorporated herein by reference. [0203} The selected modulators can also be conjugated to therapeutic moieties such as radioactive materials or yclie chelators useful for conjugating radiometal ions (see above for examples of radioactive materials). In certain embodiments, the macrocyclic chelator is l,4,7,IO— tetraazacyclododeeane—N,N',N",N"—tetraacctic acid (DOTA) which can be attached to the antibody via a linker molecule. Such linker molecules are commonly known in the art and described in Denardo et al., 1998, Clin Cancer Res. 4:2483; Peterson et al., I999, Bioconjug. Chem. 101553; and Zimmerman et al., l999. Nucl. Med. Biol. 26:943. [0204} Exemplary radioisotopes that may be compatible with this aSpect of the invention include, but are not limited to, iodine (ml, [251, 1231, ”ILL carbon (MC), copper (fizCu, “Cu, 67Ctl), sulfur (35$), tritium (3H), indium (“5111, min, ”gin, inim), bismuth (glzBi, 213Bi), technetium (99Tc), thallium (zo'Ti), gallium (686a, 67Ga), palladium (103Pd), molybdenum (”Mo), xenOn (mXe), fluorine ('XF), ”33m, ”7141, “on, “9pm, ”out, with, “Giro, ”or, ”Sc, 130Re, ”Site, ”3 Pr, msRh, ”Ru, “Ge, 57Co, “Zn, 85Sr, 33?, '53Gd, mYb, 5‘Cr, 54Mn, 7536, ”3Sn, MT in, mAc. 7“Br, and 2] lAt.
Other radionuclides are also available as diagnostic and therapeutic agents, especially those in the energy range of 60 to 4,000 keV. Depending on the condition to be d and the desired eutic profile, those skilled in the art may readily select. the appropriate radioisotope for use with the disclosed tors.
PTK7 modulators of the present invention may also be conjugated to a therapeutic moiety or drug that modifies a given ical response (e.g., biological response modifiers or BRMs). That is, therapeutic agents or moieties compatible with the t invention are not to be ued as limited to classical chemical therapeutic agents. For example, in ularly preferred embodiments the drug moiety may be a n or ptide or fragment thereof possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, Onconase (or another cytotoxic RNase). pseudomonas exotoxin, a toxin. or diphtheria toxin: a protein such as tumor necrosis factor, terferon, B-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent. e.g., TNF- or, TNF—B, AIM I(see, International Publication No. WO 99), AIM Ii (see, International Publication No. W0 97/349l I), Fas Ligand ashi et al., 1994, J. Immunol., 6: l 567), and VEGI (see, International Publication No. WO 99123105), :1 thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or atin; or, a biological reSponse modifier such as, for e, a lymphokine (cg, interleukin~ l (“IL-l"), interleukin-2 ("IL—2“), interleukin-6 ("IL—6"), granulocytc macrophage colony stimulating factor SF"), and granulocyte colony stimulating factor (”G-CSF")), or a growth factor (e.g., growth hormone ("GH")). As set forth above, methods for fusing or conjugating modulators to polypeptide moieties are known in the art. In addition to the previously disclosed subject references see, c.g., U.S.P.Ns. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851, and ,1 12,946; EP 307,434; 13? 367, I 66; PCT Publications WO 88 and WO 91/06570; Ashkenazi et al., l99l, PNAS USA 88:!0535: Zheng et al., 1995, J Immunol 1154:5590; and Vil et al., 1992, PNAS USA 89:] l337 each of which is incorporated herein by reference. The association of a modulator with a moiety does not necessarily need to be direct, but may occur h linker sequences. Such linker molecules are commonly known in the art and described in Denardo et al., 1998, Clin Cancer Res 422483; Peterson et al., l999. jug Chem l0z553; Zimmerman et al., 1999, Nucl Med Biol 26:943; t, 2002, Adv Drug Deliv Rev 53:171 each of which is incorporated herein.
More generally, techniques for conjugating therapeutic moieties or cytotoxic agents to modulators are well known. Moieties can be conjugated to modulators by any art-recognized method, including, but not limited to aldehyde/Schilf e, sulphydryl linkage, acidalabilc linkage, cis-aconityl linkage, hydrazone linkage, enzymatically degradable linkage (see generally t, 2002, Adv Drug Deliv Rev 53: l7l). Also see, e.g., Anion et al., "Monoclonal Antibodies For Itnmunotargeting Of Drugs In Cancer Therapy“, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds), pp. 243-56 (Alan R. Liss, Inc. l985); l-Iellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed), Robinson et al. (eds), pp. 62363 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of xic Agents in Cancer y: A Review“, in Monoclonal Antibodies '84: Biological And al Applications, Pinchera et al. (eds), pp. 475—506 (1985); "Analysis, Results, And Future Prospective Ol’The Therapeutic Use Of Radiolabeled Antibody in Cancer y", in Monoclonal Antibodies For Cancer ion And Therapy, Baldwin et al. (eds), pp. 303-16 (Academic Press 1985), and Thorpe et al., l982, Immunol. Rev. 62:] 19. In preferred embodiments a PTK7 modulator that is conjugated to a therapeutic moiety or cytotoxic agent may be alized by a cell upon binding to a P'l‘K7 molecule associated with the cell e thereby delivering the therapeutic payload.
XII. Diagnostics and Screening a. stics As indicated, the present invention prevides in vitro or in viva methods for detecting, diagnosing or monitoring hyperproliferative disorders and methods of screening cells from a patient to identify tumorigenic cells including TPCs. Such methods include identifying an individual having cancer for treatment or monitoring progression of a cancer comprising contacting the t or a sample obtained from a patient with a selected PTK7 modulator as described herein and detecting presence or absence, or level of association of the modulator to bound or free PTK? in the sample. When the modulator comprises an antibody or immunologically active fragment thereof the association with particular PTK? in the sample likely denotes that the sample may contain tumor uating cells (cg. a cancer stem cells) indicating that the dual having cancer may be effectively treated with a PTK7 modulator as described herein. The s may further se a step of comparing the level of binding to a control- sely, when the selected modulator is Fc-PTK7 the binding properties of the ed PTK7 may be exploited and monitored (directly or indirectly, in vivo or in vitro) when in contact with the sample to provide the desired information. Other diagnostic or theragnostic methods compatible with the teachings herein are well known in the art and can be practiced using commercial materials such as dedicated ing systems. in a particularly preferred embodiment the modulators of the instant invention may be used to detect and quantify PTK7 levels in a patient sample (cg, plasma or blood) which may, in turn, be used to detect, diagnose or monitor PTK? associated ers including hyperproliferative disorders. In related embodiments the modulators of the instant invention may be used to detect, monitor and/or quantify circulating tumor cells either in vivo or in vitro (see, for example, WO 20l2/0l28801 which is incorporated herein by reference). in still other preferred embodiments the circulating tumor cells may comprise cancer stem cells. {0209] Exemplary compatible assay methods include radioimmunoassays, enzyme immunoassays, competitivebinding , fluorescent immunoassay, immunoblot assays, Western Blot analysis, flow cytometry assays, and ELISA assays. More generally detection of PTK? in a ical sample or the measurement of PTK7 enzymatic activity (or inhibition thereof) may be accomplished using any art—known assay. Compatible in viva theragnostics or diagnostics may comprise art ized imaging or ring techniques such as ic resonance imaging (MRI), erized tomography leg. CAT scan), positron tomooraphy (cg, PET scan) radiography, ultrasound, etc.- Those skilled in the art will readily be able to recognize and- implement appropriate detection, ring or imaging techniques (often comprising commercially available sources) based on the etiology, pathological manifestation or clinical progression of the disorder. [02l0] In another embodiment, the invention provides a method of analyzing cancer progression and/or pathogenesis in. vivo. In another embodiment, analysis of cancer progression and/or pathogenesis in viva comprises determining the extent of tumor ssion. In another embodiment, analysis comprises the identification of the tumor. In another embodiment, analysis of tumor progression is performed on the y tumor. In another embodiment, analysis is performed over time depending on the type of cancer as known to one skilled in the art. In another embodiment. further analysis of secondary tumors originating from metastasizing cells of the primary tumor is ed iii-viva. In r embodiment, the size and shape of secondary tumors are ed. In some embodiments, further ex vivo analysis is med. {021 I] In another ment, the invention provides a method of analyzing cancer progression and/or pathogenesis in vivo including determining cell metastasis or detecting and quantifying the level of ating tumor cells. In yet another embodiment, analysis of cell asis comprises determination of progressive growth of cells at a site that is discontinuous from the primary tumor. In another embodiment, the site of cell asis analysis ses the route of neoplastic . 1n some embodiment, cells can disperse via blood vasculature, lymphatics, within body cavities or combinations thereof. In another embodiment, cell metastasis analysis is performed in view of cell migration, dissemination, extravasation, proliferation or combinations thereof.
In n examples, the tumorigenic cells in a subject or a sample from a subject may be assessed or terized using the disclosed modulators prior to therapy or regimen to establish a baseline. In other examples the sample is derived from a subject that was treated. In some examples the sample is taken from the subject at least about 1, 2,4, 6, 7, 8, 10, 12, l4, IS, 16, l8, , 30, 60, 90 days, 6 , 9 months, 12 months, or >12 months after the subject begins or terminates treatment. In certain es, the tumorigenic cells are assessed or characterized after a certain number of doses (e.g., after 2, 5, IO, 20, 30 or more doses of a therapy). In other examples, the gcnic cells are characterized or assessed after 1 week, 2 weeks, 1 month, 2 months, 1 year, 2 years, 3 years, 4 years or more after receiving one or more therapies.
In another aspect, and as discussed in more detail below, the present invention provides kits for detecting, monitoring or diagnosing a hyperproliferative disorder, identifying individual having such a disorder for possible treatment or monitoring progression (or regression) of the disorder in a patient, wherein the kit comprises a modulator as described herein, and reagents for detecting the impact of the modulator on a sample. in. Screeninty The PTK7 modulators and cells, cultures, populations and compositions comprising the same, including progeny thereof, can also be used to screen for or identify compounds or agents (e.g., drugs) that affect a function or activity of tumor ting cells or progeny thereof by interacting with PTK7 (e.g., the polypeptide or genetic components thereoi). The invention therefore further provides systems and methods for evaluation or identification of a compound or agent that can affect a function or activity tumor initiating cells or progeny f by associating with PTK7 or its substrates. Such compounds and agents can be drug candidates that are screened for the treatment of a hyperproliferative disorder, for example. In one ment, a system or method comprises tumor initiating cells exhibiting PTK7 and a compound or agent (e.g., drug), wherein the cells and compound or agent (e.g., drug) are in contact with each other. [02 l 5] The invention further provides methods of screening and identifying PTK7 modulators or agents and compounds for altering an activity or function of tumor initiating cells or progeny cells. In one embodiment, a method includes contacting tumor initiating cells or progeny thereof with a test agent 01' compound; and determining if the test agent or compound modulates an activity or function of the PTK’] associated tumor initiating cells. {0216] A test agent or compound modulating a PTK7 related ty or function of such tumor ting cells or progeny thereof within the population identifies the test agent or compound as an active agent. Exemplary ty or function that can be modulated include changes in cell morphology, sion of a marker, differentiation or ferentiation, maturation, proliferation, viability, apoptosis or cell death neuronal progenitor cells or progeny thereof. {0217] Contacting, when used in reference to cells or a cell culture or method step or treatment, means a direct or indirect interaction between the ition (cg, a PTK7 associated cell or cell culture) and another referenced entity. A particular example of a direct interaction is physical ction. A particular example of an indirect interaction is where a composition acts upon an intermediary molecule which in turn acts upon the referenced entity (cg, cell or cell culture). {0218] In this aspect of the invention tes indicates influencing an activity or function of tumor initiating cells or progeny cells in a manner compatible with detecting the effects on cell ty or function that has been determined to be nt to a particular aspect (e.g., metastasis or proliferation) of the tumor initiating cells or progeny cells of the ion. ary activities and functions e, but are not limited to, measuring morphology, developmental markers, differentiation. proliferation. viability. cell respiration, mitochondrial activity, membrane ity, or expression of markers associated with certain conditions. Accordingly, a compound or agent (e.g., a drug candidate) can be evaluated for its effect on tumor initiating cells or progeny cells, by contacting such cells or progeny cells with the compound or agent and measuring any modulation of an activity or function of tumor initiating cells or progeny cells as disclosed herein or would be known to the skilled artisan. s of screening and identifying agents and nds include those suitable for high throughput screening, which include arrays of cells (e.g., microarrays) positioned or placed, optionally at pre—determined locations or addresses. hroughput robotic or manual handling methods can probe chemical interactions and determine levels of expression of many genes in a short period of time. Techniques have been deveIOped that utilize molecular signals (e.g., fluorophores) and automated analyses that process information at a very rapid rate (see, e.g., Pinhasov et al., Comb. Chem. High Throughput Screen. 7:133 (2004)). For example, microarray technology has been extensively utilized to probe the interactions of thousands of genes at once, while providing information for specific genes (see. e.g., Mocellin and Rossi, Adv. Exp. Med. Biol. 593:19 (2007)).
Such screening methods (e.g., high—thrmtghput) can identify active agents and nds rapidly and efficiently. For example, cells can be oned or placed (pie-seeded) on a culture dish, tube, flask, roller bottle or plate (cg, a single multi-well plate or dish such as an 8, 16, 32, 64, 96, 384 and 1536 multi-well plate or dish), optionally at defined locations, for identification of potentially therapeutic molecules. Libraries that can be screened include, for example, small molecule ies, phage display libraries, fully human dy yeast y ies (Adimab, LLC), siRNA libraries, and adenoviral transfection vectors.
XIII. Pharmaceutical Preparations and Therapeutic Uses a. Formulations and routes of administration ] Depending on the form of the modulator along with any optional conjugate, the mode of intended delivery, the disease being treated or monitored and numerous other variables, compositions of the instant invention may be ated as desired using art recognized ques.
That is, in various embodiments of the instant invention compositions comprising PTK7 modulators are ated with a wide variety of pharmaceutically acceptable carriers (see, e.g., o, Remington: The Science and Practice ofPharmacy with Facts and Comparisons: cts Plus, 20th ed. (2003); Ansel at al., Pharmaceutical Dosage Forms and Drug wy Systems, 7m ed, Lippencott Williams and Wilkins (2004); Kibbe et at, Handbook of Plzrzi-izzacezm'ml Erripimzrs, 3m ed, Pharmaceutical Press (2000)). Various pharmaceutically acceptable carriers, which include vehicles, adjuvants, and diluents, are readily available from numerous cial sources. Moreover, an assortment of pharmaceutically acceptable auxiliary substances, such as pH adjusting and ing agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are also ble. Certain miting exemplary carriers include saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
More particularly it will be appreciated that, in some ments, the therapeutic compositions of the invention may be administered neat or with a minimum of additional compouents. Conversely the PTK? modulators of the present invention may optionally be formulated to contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries that are well known in the art and are relatively inert substances that facilitate administration of the modulator or which aid processing of the active compounds into preparations that are pharmaceutically optimized for delivery to the site of action. For example, an excipient can give form or consistency or act as a diluent to improve the pharmacokinetics of the modulator. le excipients include but are not limited to stabilizing agents, wetting and emulsifying agents, salts for varying osmolarity, ulating agents, buffers, and skin ation enhancers.
Disclosed tors for systemic administration may be formulated For entcral, parenteral or t0pical administration. indeed, all three types of formulation may be used simultaneously to e systemic administration of the active ingredient. ents as well as formulations For parenteral and nonparenleral drug delivery are set forth in Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing (2000). Suitable ations for parenteral administration include aqueous solutions of the active compounds in soluble form, for example, water—soluble salts. In addition, suspensions of the active compounds as apprOpriate for oily injection suspensions may be administered. Suitable lipOphilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension and include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
Optionally, the suspension may also contain stabilizers. Liposomes can also be used to ulate the agent for delivery into the cell. [0224'] Suitable formulations forenteral stration include hard or soft gelatin capsules. pills, tablets, including coated tablets, elixirs. sions, syrups or inhalations and controlled release forms thereof. {0225] In general the nds and compositions of the invention, sing PTK7 modulators may be administered in viva, to a subject in need thereof, by various routes, ing, but not limited to, oral, intravenous, intranrterial, subcutancmis, parenteral, intranasal. intramuscular, intracardiac, intraventricular, intratracheal, buccal, rectal, intraperitoneal, intradermal, topical, ermal, and intrathecal, or otherwise by implantation or inhalation. The subject compositions may be formulated into preparations in solid, scmi~solid, liquid, or gaseous forms; including, but not limited to, tablets, capsules, powders, granules, ointments, solutions, suppositories, enemas, injections, inhalants, and aerosols. The riate formulation and route of stration may be selected according to the intended application and eutic regimen. b. Dosages Similarly, the particular dosage regimen, i.e., dose, timing and repetition, will depend on the particular individual and that individual's l history. Empirical considerations such as pharmacokinetics (e.g., half-life, clearance rate, etc.) will contribute to the determination of the dosage. Frequency of administration may be determined and adjusted over the course of therapy, and is based on ng the number of hyperprolil’erative or neoplastic cells, including tumor initiating cells, maintaining the reduction of such beeplastie cells, reducing the proliferation of neoplastic cells, or delaying the development of metastasis. Alternatively, sustained continuous release formulations of a subject therapeutic composition may be appropriate. As alluded to above various formulations and devices for achieving sustained release are known in the art.
From a therapeutic standpoint the pharmaceutical compositions are administered in an amount effective for ent or laxis of the specific indication. The therapeutically effective amount is typically dependent on the weight of the t being treated, his or her physical or health condition, the extensiveness of the condition to be treated, or the age of the subject being treated. In general, the PTK7 modulators of the invention may be administered in an amount in the range of about 10 rig/kg body weight to about 100 rug/kg body weight per dose. In certain embodiments, the PTK7 modulators of the invention may be administered in an amount in the range of about 50 rig/kg body weight to about 5 mg/kg body weight per dose. In certain other embodiments, the PTK7 tors of the invention may be stered in an amount in the range of about 100 ttg/kg body weight to about to mg/kg body weight per dose. Optionally, the PTK7 modulators of the invention may be stered in an amount in the range of about 100 rig/kg body weight to about 20 mg/kg body weight per dose. Further optionally, the PTK7 modulators of the invention may be administered in an amount in the range of about 0.5 mg/kg body weight to about 20 mg/kg body weight per dose. In certain embodiments the compounds of present invention are provided a dose of at least about 100 rig/kg body , at least about 250 ttg/kg body weight, at least about 750 ttg/kg body weight, at least about 3 tug/kg body weight, at least about 5 mg/kg body weight, at least about 10 tug/kg body weight is stered. [022%] Other dosing regimens may be predicated on Body e Area (BSA) calculations as disclosed in U.S.P.N. 7,744,877 which is incorporated herein by reference in its entirety. As is well known in the art the BSA is ated using the patient’s height and weight and provides a measure of a subject’s size as represented by the surface area of his or her body. In selected embodiments of the invention using the BSA the modulators may be stered in dosages from mg/m2 to 800 mg/mz. in other preferred embodiments the modulators will be stered in dosages from 50 mg/m?‘ to 500 mg/m2 and even more preferably at dosages of 100 mg/mz, lSO trig/mg, 200 rug/m2, 250 m g/mg, 300 tug/ma, 350 rug/mg, 400 mg/mzor 450 trig/ma. Of course it will be appreciated that, regardless of how the dosages are calculated, multiple dosages may be administered over a ed time period to provide an absolute dosage that is substantially higher than the individual administrations.
In any event. the PTK7 modulators are preferably administered as needed to subjects in need thereof. Determination of the frequency of stration may be made by persons skilled in the art, such as an ing physician based on considerations of the condition being treated, age of the subject being d, severity of the condition being treated, general state of health of the t being treated and the like. lly, an effective dose of the PTK7 modulator is administered to a subject one or more times. More particularly, an effective dose of the tor is administered to the subject once a month, more than once a month, or less than once a month. In certain embodiments, the effective dose of the PTK7 modulator may be stered multiple times, including for periods of at least a month, at least six months, or at least a year. In yet other embodiments, several days (2, 3, 4, 5, 6 or 7), several weeks (1, 2, 3, 4, 5, 6, 7 or 8) or several months ( l 7 or 8) may lapse between administration of the disclosed modulators. , 2, 3, 4, 5, 6, [0230} Dosages and ns may also be determined empirically for the disclosed therapeutic compositions in individuals who have been given one or more administration(s). For example, individuals may be given incremental dosages of a therapeutic ition produced as described herein. To assess efficacy of the selected composition, a marker of the specific disease, disorder or condition can be followed as described previously. In embodiments where the individual has cancer, these include direct measurements of tumor size via palpation or visual observation, indirect measurement of tumor size by x-ray or other imaging ques; an improvement as assessed by direct tumor biopsy and microsc0pic examination of the tumor sample; the measurement of an ct tumor marker (e.g., PSA for prostate cancer) or an n identified according to the methods described herein, a decrease in pain or paralysis; improved , vision, breathing or other disability associated with the tumor; increased appetite; or an increase in quality of life as measured by accepted tests or prolongation of survival. It will be apparent to one of skill in the art that the dosage will vary depending on the individual. the type of neoplastic condition, the stage of neoplastic condition, whether the neoplastic condition has begun to metastasize to other location in the individual, and the past and concurrent treatments being used. c. Combination therapies Combination therapies contemplated by the invention may be ularly useful in decreasing or ting unwanted neoplastic cell proliferation (cg. endothelial cells), decreasing the occurrence of cancer, decreasing or preventing the recurrence of cancer, or decreasing or preventing the spread or asis of cancer. in such cases the compounds of the instant invention may function as sensitizing or chemosensitizing agent by removing the TPC propping up and perpetuating the tumor mass (e.g. NTG cells) and allow for more effective use of current standard of care debulking or anti-cancer agents. That is, a combination therapy comprising a PTK7 modulator and one or more anti-cancer agents may be used to diminish established cancer cg, decrease the number of cancer cells present and/or decrease tumor burden, or rate at least one manifestation or side effect of cancer. As such, ation therapy refers to the stration of a PTK? modulator and one or more anti—cancer agent that includes, but is not d to, cytotoxic agents, cytostatic agents, chemotherapeutic agents, targeted anti-cancer agents, biological response modifiers, immunotherapeutic agents, cancer vaccines, anti-angiogenic agents, cytokines, hormone therapies, ion therapy and anti-metastatic agents. ing to the methods of the present invention, there is no requirement for the combined results to be additive of the effects observed when each treatment (e.g., anti-PTK7 antibody and anti-cancer agent) is conducted separately. Although at least additive effects are generally desirable, any increased umor effect above one of the single therapies is beneficial.
Furthermore, the invention does not e the combined ent to exhibit synergistic s. r, those skilled in the art will appreciate that with certain selected combinations that comprise red embodiments, synergism may be ed. [0233} To practice combination therapy according to the invention, a PTK7 modulator (e.g., anti-PTK7 antibody) in ation with one or more anti-cancer agent may be administered to a subject in need thereof in a manner effective to result in anti-cancer activity within the subject. The PTK? modulator and anti-cancer agent are provided in amounts effective and for periods of time effective to result in their combined presence and their combined actions in the tumor environment as d. To achieve this goal, the PTK7 modulator and anticancer agent may be administered to the subject simultaneously, either in a single composition, or as two or more distinct compositions using the same or different administration routes.
Alternatively, the modulator may precede, or follow, the anti-cancer agent treatment by, cg, intervals ranging from minutes to weeks. In certain embodiments wherein the anti-cancer agent and the aniibody are applied separately to the subject, the time period between the time of each delivery is such that the anti—cancer agent and modulator are able to exert a combined effect on the tumor. In a particular embodiment, it is plated that both the ancer agent and the PTK7 modulator are administered within about 5 minutes to about two weeks of each other.
In yet other embodiments, several days (2, 3, 4, 5, 6 or 7), several weeks (1, 2, 3, 4, 5, 6, 7 or 8) or several months (l, 2, 3, 4, 5, 6, 7 or 8) may lapse between administration of the modulator and the anti-cancer agent. The PTK? modulator and one or more ancer agent (combination theraPY) may be administered once, twice or at least the period of time until the condition is treated, palliated or cured. Preferably, the combination therapy is administered multiple times. The combination therapy may be administered from three times daily to once every six months. The administering may be on a schedule such as three times daily, twice daily, once daily. once every two days, once every three days, once weekly, once every two weeks, once every month, once every two months, once every three months, once every six months or may be stered continuously via a minipump. As previously indicated the combination therapy may be administered via an oral, mucosal. buccal, intranasal, inhalable, intravenous, subcutaneous. intranmscular, parenteral, ttmor or topical route. The combination y may be administered at a site distant from the site of the tumor. The combination therapy generally will be administered for as long as the tumor is present provided that the combination therapy causes the tumor or cancer to stop growing or to decrease in weight or volume.
In one embodiment a PTK7 modulator is administered in combination with one or more anti-cancer agents for a short ent cycle to a subject in need thereof. The duration of treatment with the antibody may vary ing to the particular anti-cancer agent used. The invention also contemplates tinuous administration or daily doses divided into several l administrations. An appropriate treatment time fora particular anti-cancer agent will be appreciated by the skilled n, and the invention contemplates the continued ment of l treatment schedules for each anti~cancer agent.
The present invention contemplates at least one cycle, preferably more than one cycle during which the combination therapy is administered. An riate period of time for one cycle will be appreciated by the skilled artisan, as will the total number of cycles, and the interval between cycles. The invention contemplates the continued assessment of Optimal treatment schedules for each modulator and anticancer agent. Moreover, the invention also provides for more than one administration of either the anti-PTK? antibody or the anti-cancer agent. The modulator and anti-cancer agent may be administered interchangeably, on alternate days or weeks; or a sequence of antibody treatment may be given. followed by one or more treatments of anti- cancer agent therapy. In any event, as will be understood by those of ordinary skill in the art, the appropriate doses of chemotherapeutic agents will be generally around those already employed in clinical therapies wherein the chemotherapeutics are administered alone or in combination with other chemotherapeutics. {0238] In another preferred embodiment the PTK7 modulators of the instant ion may be used in maintenance y to reduce or ate the chance of tumor recurrence following the initial presentation of the disease. Preferably the disorder will have been d and the initial tumor mass eliminated, reduced or otherwise ameliorated so the patient is asymptomatic or in remission. At such time the subject may be administered pharmaceutically effective s of the disclosed modulators one or more times even though there is little or no indication of disease using standard diagnostic procedures. In some embodiments the effectors will be stered on a regular schedule over a period of time. For example the PTK7 modulators could be adminisrered weekly, every two weeks, monthly, every six weeks, every two mOnths, every three months every six months or annually. Given the teachings herein, one skilled in the art could readily determine favorable dosages and dosing regimens to reduce the potential of disease recurrence Moreover such ents could be continued for a period of weeks, months, years or even indefinitely depending on the patient response and clinical and diagnostic parameters. [0239} In yet another preferred embodiment the modulators of the present invention may be used to prophylactically to prevent or reduce the ility of tumor metastasis following a debulking procedure. As used in the t disclosure :1 debulking procedure is defined broadly and shall mean any procedure, technique or method that eliminates, reduces, treats or ameliorates a tumor or tumor eration. Exemplary debulking procedures include, but are not limited to, surgery, radiation treatments (i.e., beam radiation), chemotherapy or ablation. At appropriate times readily determined by one skilled in the art in view of the t sure the PTK7 modulators may be administered as suggested by clinical and diagnostic or theragnostic procedures to reduce tumor metastasis. The modulators may be administered one or more times at pharmaceutically effective dosages as determined using standard techniques. Preferably the dosing regimen will be accompanied by appropriate stic or monitoring ques that allow it to be ed as necessary. d. Anti—cancer agents As used herein the term anti—cancer agent means any agent that can be used to treat a cell proliferative disorder such as cancer, including cytotoxic agents, cytostatic agents, anti» angiogenic agents, debulking agents, chemotherapeutic agents, radiotherapy and herapeutic agents, targeted anti-cancer agents. biological se modifiers. antibodies, and immunotherapeutic agents. It will be appreciated that, in selected embodiments as discussed above, ancer agents may comprise conjugates and may be associated with modulators prior to stration.
[O24l1 The term cytotoxic agent means a substance that decreases or inhibits the function of cells and/or causes destruction of cells, i.e., the substance is toxic to the cells. Typically, the substance is a naturally occurring molecule derived from a living organism. es of cytotoxic agents include, but are not limited to, small molecule toxins orenzymatically active toxins of bacteria (e.g., ria toxin, Pseudomonas endotoxin and exotoxin, Staphylococcal enterotoxin A), fungal (e,g.,a—sarcin, restrictocin), plants (e.g., abrin, ricin, modeccin, viscumin, pokeweed anti- viral protein, saporin, gelonin, momoridin, santhin, barley toxin, Aleurites fordii proteins, dianthin proteins, Phytoiacca mericana ns (PAPI, PAPIi, and , Momordica charantia inhibitor, , crotin, saponaria officinalis inhibitor, gelonin, mitegeliin, restrictocin, ycin, neomycin, and the tricotheccnes) or animals, e.g., cytotoxic RNases, such as extraceliuiar pancreatic RNases; DNase i, inciuding fragments and/or ts thereof.
A chemotherapeutic agent means a chemical compound that non-specifically decreases or inhibits the growth, proliferation, and/or survival of cancer cells (e.g., cytotoxic or atic agents). Such chemical agents are often directed to intracellular processes necessary for cell growth or division, and are thus particularly ive against cancerous cells, which generaliy grow and divide rapidly. For exampie, stine depoiymerizes microtubules, and thus inhibits cells from entering s. In general, chemotherapeutic agents can e any chemical agent that inhibits, or is designed to inhibit, a cancerous cell or a cell iikely to become cancerous or generate tumorigenic progeny (e.g., TIC). Such agents are often administered, and are often most effective, in combination, e.g., in the formulation CHOP. {0243] es of anti-cancer agents that may be used in ation with (or conjugated to) the moduiators of the present invention include, but are not limited to, aikyiating agents, alkyl suifonates, aziridines, nimines and methylamclamines, acetogenins, a camptothecin, bryostatin, callystatin, CC- 1065, cryptophycins, doiaslatin, duocarmycin, eieutherobin, pancratistatin, a sarcodictyin, spengistatin, nitrogen mustards, antibiotics, enediyne antibiotics, dynemicin, bisphosphonates, an esperamicin, chromoprotein enediyne antiobiotic chromophorcs, aclacinomysins, actinomycin, mycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, bicin, 6-diazo—5- norleucine, Pairiamycin® doxorubicin, epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamyein. rodorubicin, streptonigrin, sti‘eptozoein, tubercidin. uhenimc‘t, zinosttttin, zorubicin: anti-metaboiites, foiic acid analogues, purine analogs, androgcns, anti-adrenals, folic acid replenisher such as frolinic acid, aceglatone, aidOphosphamide glycoside, evulinic acid, eniluracil, amsacrine, bestrabucil, bisantrene, edatraxate, defofamine, demecolcine, diaziquone, eifomithine, elliptinium e, an epothilone, etogiucid, gallium nitrate, hydroxyurea, Ientinan, ionidainine, maytansinoids, mitoguazone, mitoxantrone, mopidanmol, rine, pentostatin, phenamet, pirarubicin, losoxantrone, podophyilinic acid, 2- ethylhydrazide, procarbazine, PSK® polysaccharide complex (JHS Natural Products, Eugene, OR), razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,222"—trichlorotriethyiamine; trichothecencs (eSpeciaiiy T—2 toxin, verracurin A, roridin A and ine); urethan; vindesine; dacarbazine; mannomustine; mitobronitoi; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclOphosphamide; thiotepa; taxoids, chloranbucil; ® abine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs, vinblastine; platinum; etoposide (VP-16); mide; mitoxantrone; vincristine; NAVELBINEa vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronale; irinotecan (Camptosar, CPT—l I). topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids; capecitabine; combretastatin; leucovorin (LV); oxaliplatin; tors of PKG-alpha, Raf, H—Ras. EGFR and VEGF—A that reduce cell proliferation and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and ive estrogen receptor modulators (SERMs), aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, and anti-androgens; as well as troxacitabine (a l.3- dioxolane nucleoside cytosine analog); nse oligonucleotides,; ribozymes such as a VEGF expression inhibitor and a HERZ expression inhibitor; vaccines, PROLEUKIN® rIL~2; LURTOTECAN® topoisomerase 1 inhibitor; ABARELIX® rmRH; Vinorelbine and Esperamicins and pharmaceutically able salts, acids or derivatives of any of the above. Other embodiments comprise the use of immunotherapeutic agents, such as antibodies, approved for cancer therapy including, but not limited to, rituximab, trasttizumab, gerntuznmab ozogamcin, alemtuzumab, ibritumomab an, tositttmomab, bevacizumab, mab, patitumttmab, ofatuniumab, ipilimumab and brentuximab vedolin. Those d in the art will be able to readily identify additional anti-cancer agents that are compatible with the teachings herein. e. herapy [0244} The present invention also provides for the combination of PTK? modulators with radiotherapy (i.e., any mechanism for inducing DNA damage locally within tumor cells such as gamma-irradiation, . [TV-irradiation, microwaves, onic emissions and the like). ation therapy using the directed delivery. of radioisotopes to tumor cells is also contemplated, and may be used in tion with a targeted anti—cancer agent or other targeting means. Typically, radiation therapy is administered in pulses over a period of time from about I to about 2 weeks. The radiation therapy may be administered to subjects having head and neck cancer for about 6 to 7 weeks. Optionally, the radiation therapy may be administered as a single dose or as multiple, sequential doses. f. Neoplastic conditions {0245] Whether administered alone or in combination with an anti—cancer agent or radiotherapy, the P’I‘K7 tors of the instant invention are particularly useful for generally treating neoplastic conditions in patients or ts which may include benign or malignant tumors (e.g., renal, liver, kidney, bladder. breast, gastric, ovarian, colorectal, prostate, pancreatic, lung, thyroid, hepatic carcinomas; sarcomas; glioblastomas; and various head and neck tumors); leukemias and lymphoid malignancies; other disorders such as neuronal, glial, astrocytal, alamic and other glandular, macrophagal, epithelial, stromal and blastocoelic ers; and inflammatory, angiogenic, immunologic disorders and disorders caused by pathogens. Particularly preferred targets for treatment with therapeutic compositions and methods of the present invention are neoplastic ions comprising solid tumors. in other preferred embodiments the modulators of the present invention may be used for the sis, prevention or treatment of hematologic malignancies. Preferably the subject or patient to be treated will be human although, as used herein, the terms are expressly held to comprise any mammalian species.
More specifically, neoplastic conditions subject to ent in ance with the t ion may be ed from the group including, but not limited to, adrenal gland tumors, AIDS-associated s, alveolar soft part sarcoma, ytic tumors, bladder cancer (squamous cell carcinoma and transitional cell carcinoma), bone cancer (adamantinoma, aneurismal bone cysts, osteochondroma, osteosarcoma), brain and Spinal cord s, metastatic brain tumors, breast cancer, carotid body tumors, cervical cancer, ehondrosarcoma, chordoma, chromophobe renal cell carcinoma, clear cell carcinoma, colon cancer, colorectal cancer, ous benign fibrous histiocytomas, lastic small round cell tumors, cpendymomas, Ewing's tumors, extraskeletal myxoid chondrosarcoma, fibrogenesis imperfecla ossium, fibrous dysplasia of the bone, gallbladder and bile duct cancers, gestational trophoblastic disease, germ cell tumors, head and neck s, islet cell tumors, 's a, kidney cancer (nephroblastoma, papillary renal cell carcinoma), leultemias, lipoma/bcnign lipomatous tumors, liposarcoma/malignant lipomatous tumors, liver cancer (hepatoblastoma, hepatocellular carcinoma), lymphomas, lung cancers (small cell carcinoma, adenocarcinoma, squamous cell carcinoma, large cell carcinoma etc), medulloblastoma, melanoma, meningiomas, multiple endocrine neoplasia, multiple mycloma, myelodysplastic syndrome, neuroblastoma, neuroendocrine tumors, ovarian , pancreatic cancers, papillary thyroid carcinomas, parathyroid tumors, ric cancers, peripheral nerve sheath tumors, hromocytoma, pituitary tumors, prostate cancer, posterious unveal melanoma, rare hematologic disorders, renal metastatic cancer, id tumor, rhabdomysarcoma, sarcomas, skin cancer, soft-tissue sarcomas, squamous cell cancer, stomach cancer, synovial sarcoma, testicular cancer, thymic carcinoma, thymoma, thyroid metastatic cancer, and uterine cancers (carcinoma of the cervix, endometrial carcinoma, and leiomyoma). In certain preferred embodiments, the cancerous cells are selected from the group of solid tumors including but not d to breast cancer, non~small cell lung cancer (NSCLC), small cell lung cancer, pancreatic cancer, colon , prostate cancer, sarcomas, renal metastatic cancer, thyroid atic cancer, and clear cell carcinoma. [0247} With regard to hematologic malignancies it will be r be appreciated that the compounds and methods of the present invention may be particularly effective in treating a variety of B-cell mas, including low grade/NHL follicular cell lymphoma (FCC), mantle cell lymphoma (MCL), e large cell lymphoma (DLCL), small lymphocytic (SL) NHL, intermediate grade/follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade lymphoblastic NHL, high grade small non-cleaved cell NHL, bulky disease NHL, strom's Macroglobulinemia, lymphoplasmacytoid lymphoma (LPL), mantle cell lymphoma (MCL), follicular lymphoma (FL), diffuse large cell lymphoma (DLCL), Burkitt's lymphoma (BL), AIDS—related lymphomas, monocytic B cell lymphoma, angioimmunoblastic lymphoadenOpathy, small lymphocytic, follicular, diffuse large cell, diffuse small cleaved cell, large cell blastic lympltoblastoma, small, non-cleaved, t's and non-Burkitt's, follicular, predominantly large cell; ular, predominantly small d cell; and follicular, mixed small cleaved and large cell lymphomas. See, Gaidono et al., "Lymphomas", IN CANCER: PRlNCIPLES & PRACTICE OF ONCOLOGY, Vol. 2: 2131-2145 (DeVita et al., eds., Ssup.th ed. 1997). It should be clear to those of skill in the art that these lymphomas will often have different names due to changing systems of classification, and that patients having lymphomas classified under different names may also benefit from the combined therapeutic regimens of the present invention. [0248} In yet other preferred embodiments the P'I‘K7 tors may be used to effectively treat certain myeloid and hematologic malignancies including lenkemias such as chronic lymphocytic leukemia (CLL or B-CLL) or acute myeloid leukemia AML. Such leukemias are inantly a disease of the elderly that starts to increase in incidence after fifty years of age and reaches a peak by late sixties. Clo/l- generally involves the eration of neoplastic peripheral blood lymphocytes. Clinical finding of CLL involves cytosis, lymphadenopatliy, Splenomegaly, anemia and ocytopenia. AML is also called acute myelogenous ia, acute lastic leukemia, acute granulocytic leukemia, and acute nonlymphocytic leukemia.
The underlying pathophysiology in AML consists of a maturational arrest of bone marrow cells in the earliest stages of develOpment. In the case of either disorder treatment regimens can readily be derived by those skilled in the art in view of the t disclosure using clinically accepted procedures. [0249} The present invention also provides for a preventative or prOphylactic treatment of subjects who present with benign or precancerous tumors. It is not believed that any particular type of tumor or neoplastic disorder should be excluded from treatment using the present invention.
However. the type of tumor cells may be relevant to the use of the invention in combination with secondary therapeutic agents, particularly chemotherapeutic agents and targeted anti-cancer agents. {0250} Still other preferred embodiments of the instant invention comprise the use of PTK? tors to treat subjects ing from solid tumors. in such subjects many of these solid tumors comprise tissue exhibiting various genetic mutations that may render them particularly susceptible to treatment with the disclosed effectors. For example, KRAS, APC and CTNNB land CDHl mutations are relatively common in patients with colorectal . Moreover, patients suffering from tumors with these ons are usually the most refractory to current therapies; especially those patients with KRAS mutations. KRAS activating mutations, which typically result in single amino acid substitutions, are also implicated in other difficult to treat malignancies, including lung adenocarcinoma, mucinous adenoma, and ductal carcinoma of the pancreas. [025M Currently, the most reliable prediction of r colorectal cancer patients will respond to EGFRv or VEGF—inhibiting drugs, for example, is to test for n KRAS “activating" mutations. KRAS is mutated in 35—45% of colorectal cancers, and patients whose tumors express d KRAS do not respond well to these drugs. For e, KRAS mutations are predictive of a lack of response to panitumumab and cetuximab therapy in colorectal cancer e et al.
Cancer Res 66:3992—5; tis et al. NEJM 359: 1757-1765). Approximately 85% of patients with colorectal cancer have mutations in the APC gene (Markowitz & Bertagnolli. NEJM 36122449-60), and more than 800 AFC mutations have been characterized in patients with familial adenomatous polyposis and colorectal cancer. A majority of these mutations result in a truncated AFC protein with reduced functional ability to mediate the destruction of beta-catenin. Mutations in the beta-catenin gene. CTNNB i, can also result in increased stabilization of the protein, resulting in r import and subsequent activation of l oncogenic transcriptional programs, which is also the ism of oncogenesis resulting from failure of mutated AFC to appropriately mediate beta-catcnin destruction, which is required to keep normal cell eration and differentiation programs in check- {0252] Loss of CDH l (E-cadherin) expression is yet another common occurrence in colorectal cancer, often observed in more advanced stages of the disease. E-cadherin is the central member of adherinjtmctions that connect and organize cells in epithelial layers. Normally E-cadherin physically sequesters beta-catenin (CTNNB l) at the plasma membrane; loss of erin sion in colorectal cancer results in localization of beta-catenin to the s and transcriptional activation of the beta ~catenin/ WNT pathway. Aberrant beta-catenin/ WNT signaling is central to oncogenesis and nuclear beta—catenin has been implicated in cancer stemness (Schmalhofer et al., 2009 PMID l9l 53669). E-cadherin is required for the expression and function of EphA2 a knowa binding partner for PTK7 ligands in lia cells (Dodge Zantek et al., 1999 PMID 1051 1313; Orsulic S and Kemler R, 2000 PMID 10769210). Using tors that bind to PTK7 s and agonize with or antagonize receptor binding may modify, interrupt or reverse the pro—oncogenic processes. Alternatively, PTK7 modulators may preferentially bind to tumor cciis with aberrant PTK7 interactions based on the binding preferences of the PTK7 tors. Hence patients with cancers carrying the above mentioned genetic traits may benefits from ent with aforementioned PTK’? moduiators.
XIV. Articies of Manufacture Pharmaceutical packs and kits comprising one or more containers, comprising one or more doses of a PTK7 modulator are also provided. in certain embodiments, a unit dosage is provided wherein the unit dosage contains a predetermined amount of a composition comprising, for example, an anti~PTK7 antibody, with or t one or more additional agents. For other embodiments, such a unit dosage is supplied in single—use prefiiled syringe for injection. In still other embodiments, the ition contained in the unit dosage may comprise saline, sucrose, or the like; a buffer, such as phosphate, or the like; and/or be formulated within a stable and effective pH range. Alternatively, in certain embodiments, the composition may be provided as a lyOphilized powder that may be reconstituted upon addition of an apprOpriate liquid, for e, steriie water.
In certain preferred embodiments, the composition comprises one or more substances that inhibit protein aggregation, including, but not limited to. sucrose and arginine. Any label on, or associated with, the containerts) indicates that the enclosed composition is used for diagnosing or treating the disease condition of choice.
The present invention also es kits for producing singic~dose or multi~dose administration units of a PTK7 modulator and, optionally, one or more anti—cancer agents. The kit comprises a container and a labei or package insert on or ated with the container. Suitable containers include, for e, s, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition that is effective for treating the condition and may have a steriie access port (for exampie the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
Such kits wiii generally contain in a le container :1 ceuticaily acceptable formulation of the PTK'] modulator and, optionally, one or more anti~cancer agents in the same or different containers. The kits may also contain other pharmaceutically acceptable ations, either for diagnosis or combined therapy. For e, in addition to the PTK? modulator of the invention such kits may contain any one or more of a range of anti~cancer agents such as chemotherapeutic or radiotherapeutic drugs; anti-angiogenic agents; anti-metastatic ; targeted anti-cancer agents; cytotoxic agents; and/or other ancer agents. Such kits may also provide appropriate reagents to conjugate the PTK? modulator with an anti—cancer agent or diagnostic agent (e.g., see U.S.P.N. 7,422,739 which is incorporated herein by reference in its ty). {0255] More specifically the kits may have a single container that contains the PTK7 modulator, with or without additional components, or they may have distinct containers for each desired agent. Where combined therapeutics are provided for ation. a single solution may be pie-mixed, either in a molar equivalent combination, or with one component in excess of the other.
Alternatively, the PTK7 modulator and any optional anti«cancer agent of the kit may be maintained separately within distinct containers prior to administration to a patient. The kits may also comprise a second/third container means for containing a e, pharmaceutically acceptable buffer or other diluent such as bacteriostatic water for injection (BWFI), phosphate-buffered saline (PBS), Ringer‘s solution and dextrose on.
When the ents of the kit are provided in one or more liquid solutions, the liquid solution is preferably an s solution, with a sterile aqueous on being particularly preferred. However, the components of the kit may be provided as dried powderts). When reagents or components are ed as a dry powder, the powder can be reconstituted by the addition of a le solvent. It is envisioned that the t may also be provided in another container. [02571 As indicated briefly ab0ve the kits may also contain a means by which to administer the antibody and any optional components to an animal or patient, e.g., one or more needles or syringes, or even an eye dropper, pipette, or other such like apparatus, from which the formulation may be injected or introduced into the animal or applied to a diseased area of the body. The kits of the present invention will also lly include a means for containing the vials, or such like, and other component in close confinement for commercial sale. such as. cg, injection or blow-molded plastic containers into which the d vials-and other apparatus are placed and retained. Any label or package insert indicates that the PTK7 tor composition is used for treating cancer, for example colorectal cancer.
In other preferred embodiments the modulators of the instant invention may be used in conjunction with, or se, diagnostic or therapeutic devices useful in the diagnosis or treatment of proliferative disorders. For example, in on preferred embodiment the compounds and compositions of the instant invention may be combined with certain diagnostic devices or instruments that may be used to detect, monitor, quantify or profile cells or marker compounds involved in the etiology or station of proliferative disorders. In particularly preferred embodiments the devices may be used to detect, monitor and/or quantify circulating tumor cells either in viva or in w'tro (see, for example, WO 12880] which is orated herein by reference). in still other preferred embodiments, and as discussed above, the ating tumor cells may comprise cancer stem cells.
XV. Research Reagents Other preferred embodiments of the invention also exploit the preperties of the disclosed modulators as an instrument useful for identifying, isolating, sectioning or enriching populations or subpopulations of tumor initiating cells through methods such as flow cytometry, fluorescent ted cell sorting (FACS), magnetic activated cell sorting (MACS) or laser mediated sectioning. Those skilled in the art will appreciate that the modulators may be used in several compatible techniques for the characterization and manipulation of TIC including cancer stem cells (e.g., see U.S.S.Ns. 12/686,359, 12/669,136 and 12/757,649 each of which is incorporated herein by reference in its entirety).
XVI. Miscellaneous Unless ise defined herein, scientific and technical terms used in connection with the present invention shall have the gs that are ly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall e pluralities and plural terms shall include the singular. More Specifically, as used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates ise. Thus, for example, reference to "a protein" includes a plurality of proteins; reference to "a cell" includes mixtures of cells, and the like. In addition, ranges provided in the ication and appended claims include both end points and all points between the end points. Therefore, a range oi2.0 to 3.0 includes 3.0, 3.0. and all points between 2.0 and 3.0. [026l] Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, logy, iology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art.
The methods and techniques of the present invention are generally performed according to tional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook J. & Russell D. Molecular Cloning: A Laboratory , 3rd ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (2000); Ausubel et al., Short Protocols in Molecular Biology: A dium of Methods from t Protocols in Molecular Biology, Wiley, John & Sons, inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring , NY. (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. . Enzymatic reactions and purification techniques are performed according to manufacturer's Specifications, as commonly accomplished in the art or as described herein. The nomenclature used in contraction with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and ceutical chemistry described herein are those well known and ly used in the art. {0262] All references or documents disclosed or cited within this specification are, without limitation, incorporated herein by reference in their entirety. Moreover, any section headings used herein are lor organizational es only and are not to be construed as limiting the subject matter described. terns [0263} The present invention, thus generally described above, will be understood more readily by nce to the following examples, which are provided by way of illustration and are not intended to be limiting of the instant invention. The examples are not intended to represent that the experiments below are all or the only experiments performed. Unless ted otherwise, parts are parts by weight, molecular weight is weight average molecular weight, ature is in degrees rade, and pressure is at or near atmospheric.
Example 1 Enrichment of Tumor ting Cell tions [026-1] To characterize the cellular heterogeneity of solid tumors as they exist in cancer patients, elucidate the identity of tumor perpetuating cells (TPC; Le. cancer stem cells: CSC) using particular phenotypie markers and identify clinically nt therapeutic targets, a large non- traditional xenograft (NTX) tumor bank was developed and maintained using art recognized techniques. The NTX tumor bank, comprising a large number of discrete tumor cell lines, was propagated in immunocompromised mice through multiple passages of heterogeneous tumor cells originally obtained from numerous cancer patients afflicted by a variety of solid tumor malignancies. The continued availability of a large number of discrete early passage NTX tumor cell lines having well defined lineages greatly facilitate the fication and isolation of TPC as they allow for the reproducible and repeated characterization of cells purified from the cell lines.
More particularly, isolated or purified TPC are most accurately defined retrOSpectively according to their ability to generate phenotypically and logically heterogeneous tumors in mice that recapitulate the patient tumor sample from which the cells originated. Thus, the ability to use small populations of isolated cells to te fully geneous tumors in mice is strongly indicative of the fact that the isolated cells comprise TPC. in such work the use of minimally passaged NTX cell lines greatly simplifies in viva experimentation and provides readily verifiable results. Moreover, early passage NTX tumors also respond to therapeutic agents such as irinotecan (i.e. Camptosarel), which prevides clinically relevant insights into underlying mechanisms driving tumor growth, resistance to current therapies and tumor recurrence. {0265] As the NTX tumor cell lines were ished the constituent tumor cell phenotypes were analyzed using flow cytometry to identify discrete markers that might be used to characterize, isolate, purify or enrich tumor ting cells (TIC) and separate or e TPC and TProg cells within such populations. In this regard the inventors employed a proprietary proteomic based platform (Le. F‘henol’rint’M Array) that provided for the rapid characterization of cells based on protein expression and the concomitant identification of potentially useful s. The PhenoPrint Array is a proprietary proteomic rm comprising ds of discrete binding molecules, many obtained from commercial sources, arrayed in 96 well plates wherein each well contains a distinct antibody in the phycoerythrin scent channel and multiple additional antibodies in different fluorochromes d in every well across the plate. This allows for the determination of expression levels of the antigen of interest in a subpopulalion of selected tumor cells h rapid inclusion of relevant cells or elimination of non—relevant cells via non- phycoerythrin channels. When the Phenol’rint Array was used in combination with tissue dissociation, transplantation and stem cell techniques well known in the art (Al-Hajj et al., 2004, a et al., 2007 and Dylla et al., 2008, all supra, each of which is incorporated herein by reference in its entirety), it was possible to effectively fy nt markers and subsequently isolate and transplant specific human tumor cell ulations with great efficiency.
Accordingly, upon establishing various NTX tumor cell lines as is commonly done for human tumors in severely immune compromised mice, the tumors were resected from mice upon reaching 800 - 2,000 mm3 and the cells were dissociated into single cell suspensions using artrecognized enzymatic digestion techniques (See for example U.S.P.N. 2007/0292414 which is incorporated herein). Data obtained from these suSpensions using the PhenoPrint Array provided both absolute (per cell) and relative (vs. other cells in the population) surface protein expression on a ccll-by-cell basis, g to more complex characterization and stratification of cell pOpulations.
More specifically, use of the PhenoPrint Array allowed for the rapid identification of proteins or markers that prospectively distinguished TIC or TPC from NTG bulk tumor cells and tumor stroma and, when isolated from NTX tumor models, provided for the relatively rapid characterization of tumor cell subpopulations expressing differing levels of specific cell surface proteins. In particular, proteins with heterogeneous expression across the tumor cell population allow for the isolation and transplantation ofdistinct, and highly purified, tumor cell subpopulations expressing either high and low levels of a particular protein or marker into immune—compromised mice, thereby facilitating the assessment of whether 'l‘PC were ed in one subpopulation or another. [0267} The term enriching is used synonymously with isolating cells and means that the yield (fraction) of cells of one type is increased over the fraction of other types of cells as compared to the starting or initial cell population. ably, enriching refers to increasing the tage by about l0%, by about 20%, by about 30%, by about 40%, by about 50% or greater than 50% of one type of cell in a population of cells as compared to the starting population of cells. [0268} As used herein a marker, in the context of a cell or tissue, means any characteristic in the form ofa chemical or biological entity that is identifiably associated with, or specifically found in or on a particular cell, cell tion or tissue including those identified in or on a tissue or cell tion affected by a e or disorder. As manifested, markers may be morphological, functional or mical in nature. In preferred embodiments the marker is a cell surface n that is differentially or preferentially expressed by specific cell types (e.g., TPC) or by cells under certain ions (cg, during specific points of the cell life cycle or cells in a particular niche).
Preferably, such markers are proteins, and more preferably, s an epitope for dies, aptamers or other binding molecules as known in the art. However, a marker may consist of any molecule found on the surface or within a cell including, but not limited to, proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids and steroids. Examples of morphological marker characteristics or traits include, but are not limited to, shape, size, and nuclear to asmic ratio. Examples of functional marker characteristics or traits include- but are not limited to, the ability to adhere to particular substrates, ability to incorporate or exclude particular dyes, for example but not limited to exclusions of lipophilic dyes, ability to migrate under particular conditions and the ability to differentiate along particular lineages. Markers can also be a n expressed from a er gene, for example a reporter gene sed by the cell as a result of introduction of the nueleic acid sequence encoding the reporter gene into the cell and its transcription resulting in the production of the reporter protein that can be used as a marker. Such er genes that can be used as markers are, for example but not limited to fluorescent proteins enzymes, chromomeric proteins, resistance genes and the like.
In a related sense the term marker phenotype in the context of a tissue, cell or cell population (e.g., a stable TPC phenotype) means any marker or combination of markers that may be used to characterize, identify, separate, isolate or enrich a particular cell or cell population (e.g., by FACS). In specific embodiments, the marker phenotype is a cell surface phenotype that may be ined by ing or identifying the expression of a combination of cell surface markers.
Those skilled in the art will recognize that us markers (or their e) have been assoeiated with various populations of cancer stem cells and used to isolate or characterize tumor cell subpopulations. In this respect exemplary cancer stem cell markers comprise OCT4, Nanog, STATS, EPCAM, CD24, CD34, NB84, TrkA, GD2, CD133, CD20, CD56, CD29, B7113, CD46, transferrin receptor, JAMS, carboxypeptidase M, ADAM9, oncostatin M, LgrS, Lgr6, CD324, CD325, nestin, Soxl, Bmid, eed, easyhl, easth, mf2, yyl, srnarcA3, AS, smarcD3, smarcEl, mllt3, FZD 1, 132132, FZD3, FZD4, FZDG, FZD7, FZDS, PZD9, FZDIO, WNT2, WNT2B, WNT3, WNTSA, WNTIOB, WNT16, AXIN 1 , BCL9, MYC, (TCF4) , ILlRAP, TEM8, 4, MUC16, GPRCSB, SLC6A14, SLC4A1 l, PPAP2C, CAVI, CAV2.
PTPN3, 1,EPHA2, , CX3CL1, ADORAZA, MPZLl, FL] 10052, C4.4A, EDG3, RARRESI, TMEPAI, PTS, CEACAM6, NID2, STEAP, ABCAS, CRlMl, ILlRl, OPN3, DAF, MUCl, MCP, CPD, NMA, ADAM9, GJAI, SLC19A2, ABCAl, PCDI-l7, ADCY9, SLC39A1, NPCl, ENPPl, N33, GPNMB, LY6E, CELSRl, LRPS, C200rf52, TMEPAI, FLVCR, PCDHAIO, GPR54, TGFBR3, SEMA4B, PCDHBZ, ABCGZ, CD166, AFP, EMF-4, B-catenin, CD2, CD3, CD9, CD14, CD31, CD38, CD44, CD45, CD74, CD90, CXCR4, n, EGFR, CD105, CD64, CD16, CD 16a, CD16b, GL1}, GLIZ, CD491), and CD49f. See, for example, Schulenburg et al., 2010, PMID: 29, N. 7,632,678 and U.S.P.Ns. 292414, 2008/0175870, 2010/0275280, 2010/0162416 and 201 1/0020221 each of which is incorporated herein by reference. It will be appreciated that a number of these markers were included in the PhenoPrint Array described above. {0271] Similarly. non-limiting es nfcell surface phenotypes associated with cancer stem cells of certain tumor types include CD44'“CD24‘°‘”, ALDI—l”, CD133+, CD123+, CD34+CD382 CD44*CD24", CD46MCD324+CD66C‘, CD133+CD34*CD10“CD19“, CD138‘CD34”CD19+, CD133+RC2+, CD44+agfi1hiCD133+, CD44+CD24+ESA+, CD271+, ABCBS’r as well as other cancer stem cell surface phenotypes that are known in the art. See, for example, Schulenburg et a1., 2010, supra, Visvader et a1., 2008, PMID: 18784658 and U.S.P.N. 2008/0138313, each of which is incorporated herein in its entirety by reference. Those skilled in the art will appreciate that marker phenotypes such as those exemplified immediately above may be used in conjunction with standard flow cytometric analysis and cell sorting techniques to characterize, isolate, purify or enrich TIC and/or TPC cells or cell populations for further analysis. Of interest with regard to the instant invention CD46, CD324 and, Optionally, CD660 are either highly or heterogeneously expressed on the surface of many human colorectal (“CR"), breast (“BR”), non-small cell lung (NSCLC), small ceil lung (SCLC), pancreatic (“PA”), prostate (“PR”), kidney (“KDY”), melanotna (“Mel”), ovarian (“0V”), and head and neck cancer (“EN") tumor cells, regardless of whether the tumor specimens being analyzed were primary patient tumor specimens or patient—derived NTX .
Cells with negative expression (i.e. 9! as - ) are herein d as those cells expressing less than, or equal to, the 95‘” percentile of expression observed with an isotype control antibody in the channel of fluorescence in the presence of the complete antibody staining cocktail ng for other proteins of interest in additional channels of fluorescence emission. Those d in the art will appreciate that this procedure for defining negative events is referred to as escence minus one”, or "FMO", staining. Cells with expression greater than the 95m percentile of expression observed with an isotype control dy using the FMO staining procedure described above are herein defined as ive” (i.e."+”). As defined herein there are various populations of cells broadly defined as “positive.” First, cells with low expression (i.e. “10”) are generally defined as those cells with observed expression above the 95‘“ percentile determined using FMO staining with an isotype control antibody and within one standard ion of the 95‘h percentile of expression observed with an isotype control antibody using the FMO staining procedure described above.
Cells with “high" expression (i.e. “hi”) may be defined as those cells with observed expression above the 951“ percentile determined using FMO staining with an isotype control antibody and greater than one standard deviation above the 95”I tile of sion observed with an isotype control antibody using the FMO staining procedure described above. in other ments the 99lh percentile may preferably be used as a demarcation point between negative and positive FMO staining and in ularly preferred embodiments the percentile may be greater than 99%.
Using techniques such as those described above to quickly identify and rank colorectal tumor antigens based on expression intensity and heterogeneity across l NTX tumors from colorectal cancer patients, candidate TPC antigens were further assessed byicomparison of tumor versus normal adjacent tissue and then selected based, at least in part, on the up- or down- regulation of the ular antigen in malignant cells. Moreover, systematic ”analysis of a variety of cell surface markers for their ability to enrich for the ability to transplant fully heterogeneous tumors into mice (i.e. tumorigenic ability), and subscquent combination of these markers substantially improved the resolution of the method and improved the ability to tailor fluorescence activated cell sorting (FACS) techniques to identify and characterize distinct, highly ed tumor cell subpopulations that exclusively ned all tumor generating y upon transplantation (i.e. tumor initiating cells). {0274] To reiterate, the term tumor initiating cell (TIC) or tttmorigenic (TG) cell encompasses both Tumor Perpetuating Cells (TPC; i.e. cancer stem cells) and highly proliferative Tumor Progenitor cells ), which together generally comprise a unique subpopulation (i.e. 0. l 25%) of a bulk tumor or mass; the characteristics of which are d above. The majority of tumor cells terized in this fashion are devoid of this tumor forming y, and can thus be characterized as non-tumorigenic (NTG), singly, it was observed that most distinct markers identified using the proprietary PhenoPrint Array did not demonstrate an ability to enrich tumor initiating cell populations in colorectal tumors using standard FACS protocols. but that distinct marker combinations could be used to identify two subpopulations of tumor initiating cells: TPC and TProg. Those skilled in the art will recognize that the defining difference between TPC and TProg, though both are tumor initiating in primary transplants, is the ability of TPC to perpetually fuel tumor growth upon serial transplantation at low cell s. Furthermore, the marker/proteins used in combination to enrich for both TPC and 'I‘Prog were n to be associated with cells containing such activity in any tissue or neoplasm prior to ery by current inventors though others have defined cell e markers or enzymatic ty that can similarly be used to enrich for tumorigenic cells (Dylla et al 2008, supra). As set forth below, specific tumor cell subpopulations isolated using cell surface marker combinations alluded to above were then analyzed using whole transcriptome next generation sequencing to identify and characterize differentially expressed genes.
Example 2 Isolation and Analysis of RNA Samples From Enriched Tumor ting Cell Populations [0275} The established colorectai NTX tumor line SCRX-CR4 was passaged as described in Example 1 and Used to initiate tumors in immune compromised mice. Once the mean tumor burden reached ~ 300 mm3 the mice were randomized and treated with i5 mg/kg irinotecan, 25 mg/kg gemcitabine, or vehicle control (PBS) twice weekly fora period of at least twenty days prior to euthanization. Tumors were then removed and TPC, TProg and NTG cells, respectively, were isolated from freshly resected colorectal NTX tumors and, similarly, TG and NTG cells were ed from pancreatic NTX tumors, lly using the technique set out in Example 1. More particularly, cell populations were isolated by FACS and immediately pelleted and lysed in Qiagen RLTplus RNA lysis buffer (Qiagen, Inc.) The iysates were then stored at ~80°C until used. Upon thawing, total RNA was extracted using the Qiagen RNeasy isolation kit (Qiagen, Inc.) following vendor’s instructions and quantified on the Nanodmp (Thermo ific) and a Bioanalyzer 2100 (Agilent Technologies) again using the vendor’s protocols and recommended instrument settings.
The resulting total RNA preparation was suitable for c sequencing and analysis. [0276} Total RNA samples ed from the respective cell populations isolated as described above from vehicle or chemotherapeutic agent-treated mice were prepared for whole transcriptome sequencing using an Applied Biosystems SOLiD 3.0 (Sequencing by Oligo Ligation/Detection) next generation sequencing platform (Life Technologies), starting with 5 ng of total RNA per sample. The data generated by the SOLiD platform mapped to 34,609 genes from the human genome and was able to detect PTK7, in several samples.
Generally the SOLiD3 next generation cing platform enables parallel sequencing of clonally-amplified RNA/DNA nts linked to beads. Sequencing by ligation with dye- labeled oligonucleotides is then used to generate 50 base reads of each fragment that exists in the sample with a total of greater than 50 n reads generating a much more accurate representation of the mRNA transcript level expression of proteins in the genome. The SOLiD3 platform is able to capture not only expression, but SNPs, known and unknown alternative splicing events, and potentially new exon eries based solely on the read coverage (reads mapped uniquely to genomic locations). Thus, use of this next generation platform allowed the determination of differences in transcript level sion as well as differences or preferences for specific splice ts of those expressed mRNA transcripts. Moreover, analysis with the SOLiD3 rm using a modified whole transcriptome protocol from Applied Biosystems only required approximately 5 ng of starting material pie-amplification. This is significant as extraction of total RNA from sorted cell tions where the TPC subset of cells is, for example, vastly smaller in number than the NTG or bulk tumors and thus results in very small quantities of usable starting material. {0278} ate runs of sequencing data from the SOLiD3 platform were normalized and transformed and fold ratios calculated as is standard industry practice. As seen in FlG. 2. P'l‘K7 gene expression levels (expressed as reads per million mapped to exons; RPM_exon) were measured in respective SCRx-CR4 tumor cell subpopulations. An analysis of the data showed that PTK7 was tip—regulated at the transcript level n 2 - 4 fold over the NTG population, and 50 —— 200% over the TProg population, in vehicle or irinotecan treated mice, respectively. [0279} The ations detailed above show that PTK? expression is generally ed in TPC populations and suggests that PTK7 may play an important role in turnori genesis and tumor maintenance, thus coustituting an interesting target for immunotherapeutic approaches.
Example 3 Real-Time PCR is of PTK7 in Enriched Tumor Initiating Cell Populations {0280] To validate the ential PTK7 expression observed by whole transcriptome sequencing in TPC populations versus TProg and N'I‘G cells in colorectal cancer, and TG versus NTG cells in pancreatic cancer, TaqMan® quantitative real-time PCR was used to measure gene expression levels in respective cell populations isolated from various NTX lines as set forth above.
It will be appreciated that such real-time PCR analysis allows for a more direct and rapid measurement of gene expression levels for discrete targets using primers and probe sets specific to a particular gene of interest. '1‘aqMan®real-time tative PCR was performed on an Applied Biosystems 7900HT Machine (Life Technologies), which was used to measure P'l‘K? and PTK7 gene expression in multiple patientiderived NTX line cell populations and ponding controls.
Moreover, the analysis was conducted as specified in the instructions supplied with the TaqMan System and using commercially available PTK7 and PTK7 /probe sets (Life Technologies).
As seen in quantitative real-time PCR interrogation of gene expression was conducted using NTG and TPC populations isolated from 2 distinct colorectal NTX tumor lines (SCRX-CR4 & CR5) and a pancreatic tumor line (SCRX-PAB). TProg cell populations were also ted and analyzed for SCRx-CR4. The data set forth in shows that PTK7 gene expression is elevated more than 2-fold in colorectal TPC, when compared versus NTG cells from the same tumors. P'FK"? was also elevated more than 2-fold in TPC in mice undergoing treatment with irinotccan, and in the TIC cell population of pancreatic tumors (eg. SCRx-PA3). The observation of ed PTK’) expression in NTX TPC preparations as compared with NTG cell controls from both colorectal and pancreatic t—derived NTX tumors using the widely accepted ology of real-time quantitative PCR confirms the more sensitive SOLiD3 whole transcriptome sequencing data of the previous Example. Such findings further support the observed association between PTK? expression levels and cells underlying tumorigenesis, ance to therapy and ence.
Example 4 Expression of P'I‘K7s in tionatetl Colorectal Tumor Specimens In light of the fact that PTK7 gene expression was found to be ed in TPC populations from colorectal tumors when compared with TProg and NTG cells from the same tumors, experiments were ted to determine whether elevated PTK7 expression was also detectable in unfractionated colorectal tumor samples versus normal adjacent tissue (NAT).
Measurements were also made to determine how the expression of PTK7 in tumors compares with levels in normal tissue ens (NL). {0283] More specifically custom TumorScan qPCR (Origene Technologies) 384-well arrays ning l to colorectal patient tumor specimens at different stages, normal adjacent tissue, and 48 normal tissues were designed and fabricated using art known techniques. Using the procedures detailed in Example 3 and the same PTK7 ic primer/probe sets, ® real-time tative PCR was performed in the wells of the custom plates. [0284} FIGS. 4A and 4B show the results of the expression data in a graphical format normalized t the mean expression in normal colon and rectum tissue. More particularly, summarizes data generated using 168 tissue specimens, obtained from i 10 colorectal cancer patients at various stages of the disease (LN), (35 tissue ens of which are normal adjacent (NAT) tissue from colorectal cancer patients) and 48 normal tissues from other locations (NL Tissue). In the plot, data From each tissue specimenfpatient is represented by a dot, with the geometric mean value of each population demarcated on the X-axis represented as a line.
Similarly, contains data from 24 matched colorectal patient specimens ed from tumor (T) or normal adjacent tissue (N) at various stages of the disease . Here the plotted data is presented on a sample by sample basis with linkage between the respective tumor and normal adjacent tissue from individual patients. Expression of PTK? is clearly higher in the majority of matched tumor versus normal nt tissue, with the differential expression in Stages 3 and 4 reaching statistical significance (n 2 4, P _<, 0.037). {0285] Both FIGS. 4A and 4B indicate that, in all four stages presented, the expressed level of the PTK7 gene is elevated in a ty of ctal tumors and in matched tumor specimens versus normal adjacent tissue. Moreover, the mean PTK? gene expression in any Stage of coiorcctal cancer appears elevated versus most normal tissues that were evaluated ().
.These results demonstrate that PTK’7 expression is increased in colorectal cancer and, when coupled with the above observations that PTK7 expression is greatest in colorectal TPC and atic TIC, suggests that therapeutic targeting of cancer stem cells expressing PTK7 may provide a therapeutic benefit to cancer patients.
Example 5 Differential Expression of PTK7 in Exemplary Tumor Samples [0286} To r assess PTK7 gene expression in additional colorectal cancer patient tumor samples and tumor specimens from patients sed with l of 18 different solid tumor types, Taqman® qRT-PCR was performed using TissueScan qPCR (Origene Technologies) 384—well arrays, which were custom fabricated as described in Example 4 but including solid tumor samples from eighteen different tumor types rather thanjust colorectal samples. The results of the measurements are presented in FIGS. 5A and SB and show that gene expression of PTK7 is significantly ed in a number of solid tumor types. {0287} In this regard, FIGS. 5A and SB show the relative and absolute gene expression levels. tively. of human ‘ in whole tumor specimens (grey dots) or matched normal adjacent tissue (NAT; white dots) from patients with one ofeighteen different solid tumor types. In , data is normalized against mean gene expression in NAT for each tumor type analyzed. In FIG. SB, the absolute expression of PTK7 was assessed in various tissues/tumors, with the data being plotted as the number of cycles (Ct) needed to reach exponential amplification by quantitative real-time PCR. Specimens not amplified were assigned a Ct value of 45, which represents the last cycle of amplification in the experimental protocol. Each dot ents an dual tissue specimen, with the mean value represented as a black line. [0288! Using the custom assembled OriGene TissueScan Array, it was observed that the ty of ts diagnosed with colorectal cancer and most ts diagnosed with adrenal, endomctrial, esophageal, liver, thyroid and bladder cancer had significantly more I’l‘K7 gene expression in their tumors versus NAT, suggesting that PTK7 might play a role in genesis and/0r tumor progression in these tumors. There were also subsets of lung and prostate cancer patients with elevated PTK7 expression versus NAT. What was also clear from these studies is that PTK'} gene expression was generally moderate in most NAT samples; with the highest expression being observed in the breast, cervix, ovary, pancreas, testis and bladder. Again, these data suggest that elevated PTK? expression is indicative, and potentially dispositive, as to tumorigenesis or tumor perpetuation in patients presenting with selected roliferative disorders.
Example 6 Construction and Expression of PTK7 Immunogens {0289] In order to generate and characterize certain PTK7 modulators in accordance with the instant invention two forms of PTK7 immunogen were constructed and expressed. Initially a commercial expression vector, pCMV6~XL4~PTK7, was sed from Origene, Inc. The sequence of the full length ORF (underlined portion of FIG. IA) was confirmed, then subcloned by PCR into the EcoRI and NotI sites of the pCDH—EFl-MCS—T2A—GFP lentiviral vector (System Biosciences). This lentiviral vector expresses the full length PTK7 protein fused to a T2A ribosomal skip e and a GFP selectable marker, ng multicistronic expression in transduced cells. This lentiviral vector was used to transduce 293T cells or BALE/c 3T3 cells according to standard protocols. in addition, pCMVé-XL4—PTK7 was used to transiently express PTK7 protein on the surface of 293T cells 48-hours after transfection of the cells using polyethenimine. Plasma membrane preparations were obtained from P'l‘K7 over-expressing cells using differential centrifugation. [0290} in other instances, soluble PTK7 immunogens were prepared and expressed using the pEE12.4 expression vector (Lonza AG) into which the portion of the PTK7 CDNA ng the extracellular domain (ECD) of the protein, encoded by the sequence denoted by the underlined amino acids in FIG. IB). in a first instance the ECD fragment was subcloned iii-frame downstream of an IgK leader sequence and am of an SxHis epitOpe tag (SEQ ID NO: 8). Soluble Hisw tagged PTK7 ECD immunogen was produced by transient transfection of CHOKSV cells, and the secreted protein purified from the cell supernatant using Ni-NTA resins and rd methods (Qiagen Inc). In addition to the aforementioned PTK7~ECD~His construct, plasma preps and ected cells bed above, a Fc-PTK7-ECD construct was also generated and sed.
This process was initiated by PCR amplification of the ECD fragment set forth in FIG. [8 using the high fidelity KOD l—Iot Start DNA Polymerase (EMD Chemicals). The forward primer used in this PCR reaction had PTK7 sequence: GCCATTGTCTTCATCAAGCAGCC (SEQ lD NO: 9) and also included a 5’ HindIII restriction site and marine IgG Kappa signal peptide / leader sequence for secretion of the product into the e atant. The e primer used to amplify these ucts had PTK? sequence: CTGGATCATCTFGTAGGGGGGAG (SEQ ID NO: 10) and included a 5’ DraIIl and Bglll restriction site allowing for cioning upstream of the human IgG2 Fe protein which was ordered as a synthesized gene (DNA 2.0 Inc.).
Amplified or sub-cloned products were then moved into the final expression vector pEE12.4 (Lonza AG) using Hindlll and EcoRI restriction sites, and ty was confirmed by DNA sequencing. Plasmids were transiently transfected into either (THO—S or 293T suspension cells and ed by either nickel affinity column for His-lagged protein or Protein A for the Fe fusion product. The products were further purified by size exclusion chromatography using a SuperdexZOO column (GE Healthcare) in phosphate buffered saline (PBS), pH 7.2 with the purified fusion protein being quantified using the Bradford method ord, 1976: PMID 94205l).
Example 7 Generation of anti-PTK7 Antibodies Using hPTK7 gens PTK-7 modulators in the form of marine antibodies were ed in accordance with the teachings herein through inoculation, respectively, with BALE/3T3 or HEK 293 cells over expressing full length hPTK7, hPTK7-His or hP'I‘K7-Fc fabricated as set forth in the previous Example. In this respect three strains of female mice (3 each: Bath/c, CD—I, FVB) were immunized with preparations of the aforementioned PTK7 immunogens. The mice were all immunized via the d route with l0 pg of the selected PTK7 construct or leO0 cells in each case emulsified with an equal volume of TiterMax® or alum adjuvant. 1,0293} Either FACS or solid-phase ELISA assays was used to Screen mouse sera for mouse IgG antibodies specific for human PTK7. For the ELISAs, plates were coated with PTK7—His at different concentrations ranging from 0.01—1 ug/mL in PBS overnight. After washing with PBS containing 0.02% (v/v) Tween 20, the wells were blocked with 3% (w/v) BSA in PBS or 2% FCS in PBS, 200 uL/well for I hour at RT. Mouse serum dilutions were incubated on the PTK7-His coated plates at 50 uUwcll at RT for I hour. The plates are washed and then incubated with 50 pL/well HRP-labeled goat anti-mouse IgG diluted l:l0,000 in 3% BSA~PBS or 2% FCS in PBS for 1 hour at RT. The plates were washed and £00 uL/well of the TMB ate solution (Thermo Scientific 34028) was added for 15 minutes at RT. Finally an equal volume of 2M H2504 was added to stop substrate develoPment and analyzed by spectrophotometer at OD 450. [0294} As indicated murine sera were also tested for anti-PTK? dies by FACS against cells over expressing human PTK7 co—transduced with GFP. Briefly lx l05 BALE/3 3cells per well were uced with human PTK7 and GFP were incubated for 30 minutes with l00ul mouse serum diluted l:l00 in FCS. Cells were washed PBS/295FCS and then incubated with SOuL per sample DyeLight 649 labeled goat—anti-mouse IgG, Fc fragment specific secondary diluted 1:200 in PBS/2%FCS. After a 15 minute incubation cells were washed 2 times with FCS and re-suspended in PBS/2%ch with DAPI and analyzed by FACS. [0295) Sera positive immunized mice were sacrificed and draining lymph nodes (poplitcal and inguinal, if enlarged) were dissected out and used as a source for antibody producing cells. Single cell suspension ofB cells {375xl06 cells) were fused with nonsecreting P3X63Ag8.653 a cells (ATCC #CRL—ISSO) at a ratio of 1:1 by electrofusion. Cell electrofusion was med using the BTX Hybrimmune System or an ECMZOO], (both BTX Harvard Apparatus) as per the manufacturer’s instructions Following electrofusion cells were resuspended in hybridoma selection medium supplemented with Azaserine (Sigma #A9666) (DMEM (Cellgro cattll 5-017— CM) medium containing, 15% Fetal Clone 1 serum (Hyclone), l0% BM Condimed (Roche Applied Sciences), l mM sodium pyruvate, 4 mM L-glutamine, 100 IU Fenici”in-Streptomycin, 50 Md 2- mercaptoethanol, and 100 uM hypoxanthine). In a first fusion cells were plated at 2XIO4/well in flat bottom iter , followed by two weeks incubation in selective HAT medium , CRL P-7185). In a second fusion the cells were plated post fusion in four T225 flasks at 90 ml ion medium per flask. The flasks were then placed in a humidified 37°C incubator containing % CO 3 and 95% air for 6—7 days. [0296} After growth the library comprising the cells from the second fusion in the T2253 is sorted using a FACSAria 1 cell sorter and plated at one cell per well in Falcon 96 well U-bottom plates (both BD Biosciences). Any remaining unused doma library cells were frozen for future testing if necessary. The selected omas were then grown in 200 uL of culture medium containing 15% Fetal Clone I serum (Hyclone). l0% BM-Condimed (Roche Applied Sciences), 1 mM sodium pyruvate, 4 mM L-glutamine, 100 IU Penecillin-Streptamycin, 50 uM 2- mercaptoethanol, and 100 ttM hypoxanthine. After 10—14 days of growth for both fusions in 96 well plates the supernatants from each well were d for antibodies reactive for marine PTK7 using an ELISA or FACS assay. y, 96 well plates (VWR, 610744) were coated with 1 pg/ttiL murine PTK7-His in sodium carbonate buffer overnight at 4°C. The plates were washed and blocked with 2% PCS-PBS for one hour at 37°C and used immediately or kept at 4°C. Undiluted liybridoma supernatants were incubated on the plates for one hour at RT. The plates are washed and probed with HRP labeled goat anti-mouse lgG diluted 1:10.000 in l% BSA~PBS for one hour at RT. Following incubation with ate solution as described above the plates were read at OD 450.
Growth positive hybridoma wells secreting mouse immunoglobulins were also screened for human PTK7 specificity using a FACS assay similar to that described above. Briefly 1x10S per well BALE/3T3cells transduced with human PTK7 and GP? were incubated for 30 minutes with — 100 uL hybridoma supernatant. Cells were washed PBS/2%FCS twice and then incubated with 50 uL per sample DyeLight 649 labeled nti-mouse IgG, Fe fragment specific secondary diluted 1:200 in PBS/2%FCS. After a 15 minute tion cells were washed 2 times with PB S/B‘P’rFCS and re~snspended in PBSIZG’rFCS with DAPI (Life Technologies) and ed by FACS‘.- For the second fusion the resulting PTK7 specific clonal omas were expanded and cryopreserved in CS-lO freezing medium (Biolife Solutions) and stored in liquid nitrogen. {0299] For the first fusion oning was performed on selected antigen~positive wells using limited dilution plating. Plates were visually inspected for the presence of single colony growth and supernatants from single colony wells then screened by antigen-specific ELISAS and FACS mation as described above. The resulting clonal populations were expanded and cry0preserved in freezing medium (90% PBS, 10% DMSO) and stored in liquid nitrogen. [0300} For the first fusion PTK7 secreting hybridomas from positive wells (4 hits OD405@20min >O.75) were selected for further characterization.
A second fusion seeded over 48 plates (4608 wells) resulted in approximately a 65% cloning ency with hundreds of hits. ed clones provided several dozen murine antibodies that were immunospecific for human PTK7, some of which also cross-reacted with murine PTK7.
Example 8 Sequencing and Humanization of PTK7 Modulators 8(a) Sequencing: Based on the foregoing, a number of exemplary distinct monoclonal antibodies that bind immobilized human and antibodies that cross-react with the mouse PTK7 with apparently high affinity were selected for sequencing and r analysis. As shown in a tabular fashion in FIGS. 6A and 6B, sequence analysis of the light chain variable regions () and heavy chain variable regions () from selected monoclonal antibodies generated in Example 7 confirmed that many had novel complementarity determining regions and often displayed novel VDJ arrangements. Note that the complementarity ining regions set forth in FIGS. 6A and 6B were derived from VBASE2 analysis.
More specifically, depicts the contiguous amino acid sequences of twentyone novel murine light chain variable regions from anti-PTK7 antibodies (SEQ ID NOS: 20 – 60, even numbers) and four humanized light chain variable regions (SEQ ID NOS: 62 – 68, even numbers) derived from representative murine light chains. Similarly, depicts the contiguous amino acid ces of twenty-one novel murine heavy chain le regions (SEQ ID NOS: 21 – 61, odd s) from the same anti-PTK7 antibodies and four humanized heavy chain variable regions (SEQ ID NOS: 63 – 69, odd numbers) from the same murine antibodies as those providing the humanized light chains. Thus, taken together FIGS. 6A and 6B provide the annotated sequences of twenty-one murine anti-PTK7 dies (termed SC6.2.35, SC6.10.2, SC6.4.1, SC6.50.1, SC6.3, SC6.4, SC6.6, SC6.7, SC6.13, SC6.14, SC6.15, SC6.19, , , SC6.23, SC6.24, SC6.26, , SC6.41, SC6.58 and SC6.59) and four humanized antibodies (termed hSC6.23, hSC6.24, 1 and hSC6.58). Note that the ations SC6.4.1 and SC6.4 merely reflect a naming anomaly and that the modulators actually comprise two discrete antibodies with novel heavy and light chain variable region sequences. 102a For the purposes of the instant application the SEQ ID NOS of each particular antibody are sequential. Thus mAb 35 comprises SEQ ID NOS: 20 and 21 for the light and heavy chain variable s respectively. In this regard SC6.10.2 comprises SEQ ID NOS: 22 and 23, SC6.4.1 comprises SEQ ID NOS: 24 and 25, and so on. Moreover, corresponding nucleic acid sequences for each antibody amino acid sequence in FIGS. 6A and 6B are included in the instant application as a sequence listing appended hereto. The included nucleic acid sequences se SEQ ID NOS that are one d greater than the corresponding amino acid sequence (heavy or light chain). Thus, nucleic acid sequences encoding the heavy and light chain variable region amino acid sequences of mAb SC6.2.35 (i.e., SEQ ID NOS: 20 and 2 l) comprise SEQ ID NOS: 120 and till. The other antibody nucleic acid sequences, including those encoding zed constructs are numbered similarly.
} As a first step in sequencing ary modulators the selected hybridoma cells were lysed in Trizol@ reagent (Life Technologies) to prepare the RNA. In this regard between 104 and lO‘S cells were ended in l ml Trizol and shaken vigorously after addition of 200 pl. of chloroform. Samples were then centrifuged at 4°C for l0 minutes and the aqueous phase was transferred to a fresh microfuge tube where an equal volume of isopropanol was added. The tubes were again shaken vigorously and allowed to incubate at room temperature for l0 minutes before being centrifuged at 4°C for 10 minutes. The resulting RNA pellets were washed once with I ml of 70% ethanol and dried briefly at room ature before being resuspended in 40 uL of DEPC— treated water. The quality of the RNA preparations was determined by fractionating 3 id. in a l% agarose gel before being stored at — 80°C until used. {0306} The le region of the Ig heavy chain of each hybridoma was amplified using a 5’ primer mix comprising thirty—two mouse specific leader sequence primers, designed to target the complete mouse VI—I repertoire, in combination with 3' mouse Cy primer ic for all mouse lg isotypcs. A 400 hp PCR nt of the VB was sequenced from both ends using the same PCR primers. Similarly thirty—two 5’ Vk leader sequence primer mix designed to amplify each of the Vk mouse families combined with a single reverse primer specific to the mouse kappa constant region were used to amplify and sequence the kappa light chain. The VH and VL transcripts were amplified from lOO ng total RNA using e transcriptase polymerase chain reaction (RTPCRll [0307} A total of eight RT—PCR reactions were run for each hybridoma: four for the V kappa light chain and four for the V gamma heavy chain (yl). The QIAGEN One Step RT~PCR kit was used for amplification, (Qiagen, Inc). This kit provides a blend of cript and Omniscript Reverse Transcriptases, HotStat‘Taq DNA Polymerase, dNTP mix, buffer and Q-Solution, a novel additive that enables efficient amplification of cult" (e.g., GC-rich) templates. The extracted PCR products were directly sequenced using specific V region primers. Nucleotide sequences were analyzed using IMGT to identify germ line V, D and I gene members with the highest sequence homology. The derived sequences were compared to known germ line DNA sequences of the Ig V- and .I-rcgions using V-BASEZ (Retter et al., supra) and by alignment of VH and VL genes to the mouse germ line database.
Reaction mixtures were prepared that included 3 itL of RNA. 0.5 of 100 itM of either heavy chain or kappa light chain primers 5 til. of 5x RT—PCR buffer, 1 uL dNTPs, 1 rd. of enzyme mix containing reverse transcriptase and DNA polymerase, and 0.4 ill. of ribonuclease inhibitor RNasin (Promega BioSysteins.). The reaction e contains all of the reagents required for both reverse ription and PCR. The thermal cycler program was RT step 50°C for 30 minutes 95°C for [5 minutes followed by 30 cycles of (95°C for 30 seconds, 48°C for 30 seconds, 72°C for LG minutes). There was then a final incubation at 72°C for i0 minutes.
To e the PCR products for direct DNA sequencing, they were purified using the QIAquick”l PCR Purification Kit according to the manufacturer's protocol. The DNA was eluted from the spin column using 50 id, of sterile water and then sequenced directly from both strands.
Again the resulting DNA sequences were analyzed using VBASE2 (data not shown) to provide the annotated sequences set forth in FIGS. 6A and 613. More specifically, as sed above, the annotated amino acid sequences of twenty-one murine anti~PTK7 dy heavy and light chain le regions are set forth FIGS. 6A and 613. 8(b) zation: Four of the marine antibodies generated in Example 7 were humanized using complementarity determining region (CDR) grafting. Human frameworks for heavy and light chains were selected based on sequence and structure similarity with respect to functional human germline genes. In this regard structural rity was ted by comparing the mouse cal CDR structure to human candidates with the same canonical structures as described in Chothia et al. (supra). {03l ll More particularly murine antibodies SC6.23, SC624, SC6.41 and SC6.58 were humanized using a computer-aided CDR~grafting method (Abysis Database, UCL Business Plc.) and standard molecular engineering techniques to provide hSC623, 118C624. liSC6.-’ll and hSC6.58 tors. The human frameviIork regions of the variable regions were selected based on their highest Sequence homology to the mouse framework sequence and its canonical structure. For the purposes of the analysis the assignment of amino acids to each of the CDR s is in ance with the Kabat et al. numbering. Several zed antibody variants were made in order to generate the optimal humanized antibody with the humanized antibodies generally retaining the antigen—binding complementarity~determining regions (CDRS) from the mouse hybridoma in association with human framework regions. Ultimately it was feund that humanized SC6.23, $03.24. SC6.4l and SC6.58 mAbs bind to the human PTK? antigen with similar affinity to their murine counterparts as measured using the e system. {0312} Moiecular engineering procedures were conducted using art-recognized techniques. To that end total mRNA was extracted from the hybridomas according to the manufacturer's protocol (Trizol® Plus RNA Purification System, Life Technologies). A sequence specific 5‘ leader sequence primer, ed to amplify each hybridoma, was used in ation with 3’ human C71 primer to amplify and clone the variable regions of each humanized antibody. Similarly a 5' Vk leader sequence designed specifically to y each of the Vk regions combined with a single reverse primer ic to the human kappa constant region were used to y and clone the kappa light chain. The amplified fragments were cloned as chimeric human gammal/kappa chains and served as a bench mark for each immunized mAb. {0313] From the nucleotide sequence information, data regarding V, D and 5 gene segments of the heavy and light chains of SC6.23, SC6.24. SC6.4l and SC6.58 were obtained. Based on the sequence data new primer sets Specific to the leader sequence of the Ig V1,; and VK chain of the antibodies were designed for g of the recombinant monoclonal antibody. Subsequently the V-(D)-J sequences were aligned with mouse lg germ line sequences. Heavy chain genes of SC6.23 were identified as VH36096 (V), DSP2.3 (D) and JHS. The heavy chain genes of SC6.2~’l were identified as VHJ558 ( V ). DSP2.7 (D) and 11-14. The heavy chain genes of SC6.4l were identified as IGHVI4—4 (V), DFLl6.1 (D) and JHZ. The heavy chain genes of 5C658 were identified as IGHV4—I (V), DFLI6.l (D) and 11-14. All four light chains were K class. Light chains genes were identified as IGKV [4—1 1 land JKS for the SC6.23 mAb, IGKV3—5 and JKI for the. SC6.24 mAb, IGKV2~l37and JK4 germ line sequence for the SC6.4l mAb and IGKVI7-l2l and 1K4 germ line sequences for SC6.58 kappa light chain. These results are summarized in the TABLE 1 immediately below.
TABLE 1 Clone DH see 73 VH3609 DSP2.3 IGKV 14-: ll JKS SC6.24 VHJSSS DSP2.7 1H4 5 1K1 SC6.41 IGHVl4-4 DFL16.1 1112 IGKV2— [37 scess IGHV4—l DFL16.1 H4 IGKV 17- 121 The obtained heavy and light chain sequences from all four clones were aligned to the functional human variable region sequences and reviewed for homology and canonical structure.
The result the heavy and light chain analysis are shown below in TABLES 2 and 3 reSpectively.
TABLE 2 ‘56 homology to % homology human human human human germ line to mouse mAb VH DH JI-l se uence seuence llSC6.23 VH2-S IGHDS—S 1H4 81 4 VI—Il-3 mum-23 82 hSC6.41 VH1 -46 IGHD4-23 1H4 79 88 hSC6.58 VH3-7 IGHDZ—S J H6 86 88 TABLE 3 --% homology to human ”/0 homology to mAh VK IK erm line se uence mouse se uence "Ii-=1-82 hscass -——-§- {0315} As the germ line selection and CDR grafting processes provided dies that generally ed their binding characteristics, there was apparently little need to insert murine residues in most of the constructs. [0316} As alluded to above the amino acid sequences of the humanized heavy variable region chains and the humanized kappa light chains for all four antibodies are shown in FIGS. 6A and 613 (SEQ ID NOS: 62 - 69) and the corresponding nucleic acid sequences (SEQ ID NOS: 162 «169) are set forth in the appended sequence listing.
More particularly the amino acid ces and ponding nucleic acid sequences oftlte humanized $136.23 light chain (SEQ ID NOS: 62 and 162), and the humanized heavy chain (SEQ ID NOS: 63 and 163) are shown in FIGS. 6A and 6B and in the sequence listing. Similarly, the amino acid sequences and corresponding nucleic acid sequences of the humanized SC6.24 light chain (SEQ ID NOS: 64 and 164), and the humanized heavy chain (SEQ ID NOS: 65 and I65) are shown in the same manner. Another embodiment of the invention is illustrated by the amino acid ces and corresponding c acid sequences of the humanized SC6.4l light chain (SEQ ID NOS: 66 and 166), and the humanized heavy chain (SEQ ID NOS: 67 and 167). In yet another embodiment the amino acid sequences and corresponding nucleic acid sequences of the humanized SC6.58 light chain (SEQ ID NOS: 68 and 168), and the humanized heavy chain (SEQ ID NOS: 69 and 169) are depicted. As demonstrated in the Examples below each of the aforementioned humanized antibodies functions as an effective PTK7 modulator in accordance with the ngs herein. {0318] In any event the disclosed modulators were expressed and isolated using art recognized techniques. To that end synthetic zed variable DNA fragments rated DNA Technologies) of both heavy chains were cloned into human IgGl expression vector. The variable light. chain nts were cloned into human a expression vector. dies were sed by co-transfeetion of the heavy and the light chain into CHO cells. [0319} More particularly, for antibody production directional cloning of the marine and zed variable gene PCR products into human immunoglobulin expression vectors was undertaken. All primers used in lg pecific PCRs included restriction sites (Agel and XhoI t"or IgH, XmaI and DraIII for IgK, which allowed direct cloning into expression vectors containing the human IgGl, and IGK constant regions, respectively. in brief, PCR products were purified with Qiaquick PCR purification kit (Qiagen, Inc.) followed by digestion with Agel and Xhol (lgH), Xmal and Dralli (ng), respectively. Digested PCR products were purified prior to ligation into expression vectors. Ligation reactions were performed in a total volume of 10 pl. with ZOOU T4- DNA Ligase (New England Biolabs), 7.5 ttL of digested and purified gene-specific PCR product and 25ng linearized vector DNA. Competent E. coli DHlOB bacteria (Life Technologies) were transformed via heat shock at 42°C with 3 uL ligation product and plated onto ampicillin plates (100 ). The AgeI-EcoRI fragment of the V“ region was than inserted into the same sites of pEE6.4HngGl (Lonza AG) expression vector while the synthetic XmaLDrallI VK insert was cloned into the Xmal-Dralli sites of -the respective pEE12.4Hu-Kappa expression . {0320] Cells producing humanized antibodies were generated by transfection of I-IEK 293 cells with the appropriate plasmids using 293fectin. In this respect plasmid DNA was purified with QlAprcp Spin columns (Qiagen). liunian embryonic kidney (HEK) 293T (ATCC No CRL-l 1368) cells were ed in lSOmm plates (Falcon, Becton Dickinson) under standard conditions in Dulbecco’s Modified Eagle's Medium (DMEM) mented with 10% heat inactivated FCS, 100 ug/mL omycin, 100 U/mL penicillin G (all from Life Technologies). [032i] For transient transfections cells were grown to 80% confluency. Equal amounts of lgI—I and corresponding IgL chain vector DNA (12.5 ttg of each vector DNA) was added to 1.5 mL Opti- MEM mixed with 50 pL HEK 293 transfection reagent in LS mL opti-MEM. The mix was incubated for 30 min at room temperature and distributed evenly to the culture plate. Supernatants were harvested three days after transfection, replaced by 20 mL of fresh DMEM supplemented with % FBS and harvested again at day 6 after transfection. Culture supernatants were cleared from cell debris by centrifugation at SOOxg for 10 min and stored at 4°C. Recombinant chimeric and humanized antibodies were purified with Protein G beads (GE Healthcare).
Example 9 Characteristics of PTK7 Modulators 9(a) General Modulator teristics {0322] Various methods were used to analyze the immunochemical characteristics of selected PTK7 tors (both marine and humanized) generated as set forth above. Specifically, a number of these antibodies were characterized as to affinity. kinetics. binning, and cross reactivity with regard to cynomolgus and marine homologs (e.g., by io). The reactivity of the modulators was also measured by Western blot using reduced and non-reduced samples to provide some indication as to whether es were linear or not. In addition to the marine and human antigen binding data set forth in , results of the antibody characterization for selected murine modulators are set forth in tabular form in 3. Finally, as shown in FIGS. 7C — 7E affinities for selected inurine had humanized modulators were ed using biodayer interferometry analysis on a ForteBio RED Bio, Inc.) with a standard antigen concentration series. In general, the selected modulators exhibited relatively high affinities in the nanomolar range.
In accordance with the instant invention modulator ty was measured in three ways to ensure accuracy. First, binding signal was measured for a fixed amount of antibody probed against serial dilutions of antigen in an ELISA to ine ve modulator activity (data not shown). Second, the affinities and kinetic constants kon and k0“ of the selected effectors were then measured using bio~layer interferometry is on a ForteBio RED (ForteBio, Inc.) with a standard antigen concentration series. Finally, the affinity of selected modulators was measured by surface plasmon resonance (Biacore System, GE Healthcare). Bascd on a standard antigen concentration series and using a 1:1 Langmuir binding model, the Kd of the antibody binding to antigen and the kinetic constants kg.I and kg” were determined (e.g., see FIGS. 7C and 713) using techniques common in the art. lly the selected effectors, whether marine or humanized, exhibited relatively high affinities in the nanomolar range. In the table in :1 superscript B designates affinity measurements made on Biacore while superscript F designates measurements made on ForteBio.
Preliminary work was also conducted to determine r the epitope recognized by the PTK'i effector comprises contiguous amino acids or is formed by tiguous amino acids juxtaposed by ary structure of the antigen. In this respect Western blots were run under reducing (cg, using 0.5M DTT) and non~reducing conditions. More specifically, using standard electrophoresis techniques well known in the art, PTK7 antigen in both states was run on gels and blotted before exposure to the ed modulators. As set forth in two PTK? modulators were tested that apparently reacted only with antigen where disulphide bonds were intact (NR).
The remaining PTK7 modulators were not tested for Western blot activity.
With regard to antibody g, a ForteBio Octet Red96 Analyzer (ForteBio, Inc.) was used per manufacturer’s instructions and an art recognized sandwich method [Analytical Biochemistry 386: l72~l 80 (2009) to identify antibodies which bound to the same or different bins. , an antibody (Abl) was captured onto an anti-mouse capture chip before a high concentration of nonbinding antibody at . ( lOOnM) was used to block the chip and establish a baseline. Monomeric recombinant hPTK7~Hi$ (isoform :1) as ed for in e 6 (at SOOnM) was then captured by the specific antibody (Ab!) and the tip was dipped into a well with either the same antibody (Abl) as a control or into a well with a different antibody (Ab2) where both antibodies are at l. (2511M). If onal binding was observed with a new dy, then Abl and Ab“). were determined to be in a ent bin. If no further binding occurred, similar to the control Ab 1, then Ab2 was determined to be in the same bin. This process can be expanded to screen large libraries of unique antibodies using a full row of antibodies representing unique bins in a 96—well plate. Exemplary data for three representative modulators is shown in for both human and marine PTK7 antigen. illustrates that while SC6.lO.2 did not bind mouse at all, SC6.2.35 bound at about l0% of human and .I bound to mouse PTK7-His with identical affinity (note; the antibodies are denoted 1-12.35, H102 and H25] in ). it was further determined that each of these tested antibodies resided in a different bin. In a similar manner binning analysis was conducted for nine additional PTK7 modulators with the results shown in . These data identified at least seven ct bins recognized by the tested modulators. ND in the tables indicates that the data was not determined.
Finally, cross—reactivity with regard to cynomolgus and murine PTK’I homologs were evaluated in with a ForteBio using a concentration series comprising recombinantly sed, monomeric antigen. As listed in :1 number of the exemplary modulators were reactive with mouse PTK7, while all antibodies cross-reacted with the highly similar cynomolgus PTK'I. 9(1)) Humanized Modulator Characteristics Using techniques set forth above in this e the humanized constructs 3, hSC6.24, hSC6.4l and hSC6.58 were analyzed to determine their binding characteristics.
Additionally, humanized antibody binding was directly compared with the parent murine antibody for both antibodies to identify any subtle changes in rate constants brought about by the humanization process. {0328] More specifically, the affinity of murine SC6.23 was measured by a Biacore using surface plasmon resonance (SPR) to provide the results set forth in . Based on a concentration series of 25, I25, and 6.25 nM (generating the curves from top to bottom in the FIGS. 7C and 7D) and using a lzl Langmuir binding model, the Kd of the dy binding to n was estimated to be 2.3 nM. Similar experiments then run with the immunized SC6.23 construct showed equivalent results () indicating that the zation process had not adversely impacted the affinity. In this regard the measurements indicated that the humanized construct had an affinity of 3.9 nM which is well within the acceptable limits for therapeutic antibodies. Similar measurements for each of the humanized constructs described in Example 8 are set forth in and, atong with the other techniques set out in this Example, show that the disclosed humanized PTK7 modulators possess desirable qualities for therapeutic antibodies. e 10 Epitope ination of Selected PTK7 tors {0329] In order to further refine binning data and determine the epitope regions defined by selected PTK'I modulators generated as set forth above, several ent variants of the PTK? ECD were constructed and expressed. More specifically PTK? deletion mutants were designed using primers which amplified various PTK7 Ig domains and fused these to the Bglll ction site am of the human IgG2 Fc domain, ordered as a synthetic gene (DNA 2.0). These Fe fusion proteins were then cloned into the pEEl 2.4 expressiori vector (Lonza AG) using HindIII and EcoRI restriction sites. Isolated endotoxin free Plasmids DNA (Qiagen Inc.) were used for transfection of adherent 293 cell using 293Fcctin (Life Technologies). atants from 293 transl‘ected cells were harvested 72 hours post transfection. Specit’ically the following deletion constructs fused to the Fc region were ed: I. PTK’] ECD 1g domains 1-2 (SEQ ID NO: 70) 2. PTK‘I ECD lg domains 3—7 (SEQ ID NO: 7 1) FIG. SB 3. PTK7 ECD Ig domains 16 (SEQ ID NO: 72) 4. PTK7 ECD Ig domains 6—7 (SEQ ID NO: 73) . PTK7 ECD lg domains 2-3 (SEQ ID NO: 74) 6. PTK7 ECD Ig s 1-4 (SEQ ID NO: 75) 7. PTK'Y ECD Ig domains 1—7 (SEQ ID NO: 3) FIG. lC -ECD {0330} Amino acid sequences for the first six of these constructs are set forth in FIGS. 8A-8F (comprising the selected PTK'] ECD along, with the Fc region). The sequence for the seventh construct comprises the extracellular domain of m a (SEQ ID NO: 3) as set forth in FIG. lC fused to the Fe domain. [033 l] Using these constructs several modulators were tested for their ability to recognize WK? proteins with ons of defined lg domains. Through an ELISA assay comprising the use of domain deleted constructs and run under standard conditions. In this regard PTK7 Ig domain Fe fusions were captured on ELISA plate coated with goat anti-human IgG eifie (Jackson Immunoresearch) antibody. The ability of each murine anti-PTK7 antibody to bind the various deletion Fe fusion ns was then detected with HRP—Iabeled goat anti—mouse Fc-specilie antibody.
Using this assay exemplary modulators were identified as being directed t ular PTK? 1g s. An example of ELISA results defines each representative detected epitope or binding pattern and is included in TABLE 4 immediately below.
TABLE 4 1g Domains 6-7 see-2.35 .— + .l - 5C6 10 2 10333] The anti-i’TK7 monoclonal antibodies apparently recognize several different epitopes based on the different patterns of positive binding in the ELISA assay (Table 4 and 3).
Note that in the modulators are listed as 6M rather that 8C6 and SC6.2.3S and 303.102 are listed as H235 and H102. None of the antibodies bind only to an e within lg domains 6- 7, but these two domains may contribute to the secondary/tertiary structure of the Ig3—7 Fe fusion construct which was bound by SC6.lS and SC6.3l (NOT IN TABLE). er, three antibodies (SC6.2.35, SC6.4_1 and SC6.10.2) recognize an epitope in the first four {g domains and none of the antibodies bind to an epitope in within lg domains 6—7. In the first four Ig domains SC6.2.35 binds to an epitope within domains i-Z. SC6.4.l recognizes an epitope within the boundaries of Ig domains 2 and 3. sely 3C6. l0.2 appears sensitive to any deletions within the first four lg domains, and therefore all four lg like domains are likely involved in defining the epitope ll”? SC6.10.2. Similarly some antibodies only bound to the ength construct, lg domains l—7, ting that the lg deletions may have disrupted some of the binding sites or secondary structure of these epitopes. provides a schematic representation of these binding patterns including additional antibodies and comparable data showing binding localization of the disclosed tors where the 7 lg domains of PTK’] ECD are represented in block form and brackets are used to note the elucidated epitope position within this ECD of the tive TK7 antibodies. e 11 PTK7 Protein Expression in Exemplary Tumor Samples {0334} After documenting elevated gene expression levels and generating antibodies against PTK7 in the previous Examples, evidence was sought for corresponding P'l‘K'l protein expression in selected patient tumor tions. In this respect, reverse phase cancer protein lysate arrays (ProteoScan'M Arrays; OriGene Technologies) comprising 4 dilutions of 432 tissue lysates from I l tumor types, or their respective normal adjacent tissue, were provided along with controls consisting of HEK 293 cells without or with TP53~overexpression driven by an exogenous promoter. PTK7 protein expression in the lysates on this array was ed using a mouse monoclonal PTK7 antibody generated as set forth in Example 7 and that recognizes PTK7 protein by Western Blot (cg. clone SC6.2.35). Colorimetric detection reagents and protocols were provided by the manufacturer of the ProteoScan , spots on the fabricated array were converted to a digital image using a flatbed scanner using BZScanZ Java Software (INSERM- TAGC) to quantify spot intensity.
Results of such assays indicate that expression of the PTK7 protein is upregulated in a subset of ma, all cell lung carcinoma (NSCLC), small cell lung carcinoma (SCLC), coloreetal, pancreatic, breast and ovarian cancer patient-derived tumor samples. Exemplary data from these assays for selected tumors are shown in FIGS. 9A~9D. More ically, shows that PTK7 protein expression appears significantly elevated in a subset of colorectal tumor ens; CSpecially in patients with Stage IV e when compared to normal adjacent tissue or tumor tissue from specimens obtained from earlier stages of disease. As shown in PTK7 protein expression was also elevated in most neuroendocrine atic tumors, as well as in subsets of patients with breast () and ovarian () cancer, respectively. Data was ted as described above and represented as average pixel intensity per spot (spot intensity).
The horizontal black bar in each sample represents the mean for specimens in each respective category.
These data support the observations in above Examples that PTK7 overexpression is associated with TIC and/or TPC in colorectal cancer, and may be involved in proliferation and/or survival. In View of the forgoing Examples showing: a) PTK7 gene expression is predominantly associated with the TPC cell suprpulation in colorectal cancer and the TG cell subpopulation in pancreatic tumors; b) that PTK7 protein expression is higher on the TIC cell subpopulation; c) PTK7 protein expression is ed in whole tumor Specimens from late stage colorectal cancer; and d) the general observation is that TlC are more frequent in late stage tumors, it appears that P'l‘K7 is associated with those cells underlying tumor growth, resistance to therapy and tumor recurrence, thus reinforcing the proposition that PTK7 may play in integral role in supporting TPC and/or TIC in the aforementioned tumors. [0337} in view of these results expression of PTK7 was assessed within the non-tumorigenic (NTG) and cancer stem cell (CSC) populations of human breast (BR), lung (LU), ovary (0V), colon (CR), and kidney (KDY) tumor afts using flow try. As set forth in Example I NTG and CSC-enriched tions may be identified, monitored and enriched using phenotypic markers CD46""’CD324' and CD46hiCD324‘} respectively. Accordingly, human tumor xenografts from immunocompromised mice were harvested, dissociated, and (so-stained with commercially available anti-CD46, ariti-CD324, and anti»PTK7 (Miltenyi Biotech) antibodies before assessing PTK7 expression using flow cytometry in the CD46’"°CD324‘ NTG population and co4o'”c0324* CSC population. More specifically, flow cytometry analysis was conducted using standard techniques on a BB nto’“ It flow cytometer (BD ences) with e—stained and fluorescence minus one (FMO) controls employed to m staining specificity. 10338] The results for exemplary breast, lung, ovarian, colorectal and kidney tumors samples are showu in 3 where the e control is marked in solid grey, the NTG cell population is represented by the hatched line and the riched population is shown by the solid line. It will be appreciated that, s surface PTK7 staining was relatively low in the NTG populations of each of these , surface PTK'] staining was markedly elevated in the CSC~enriched populations. These results have since been confirmed (data not shown) using a number of the sed modulators and is representative of more than twenty five unique NTX lines tested (comprising various solid tumors). [0339} The correlated expression pattern of PTK7 with other surface markers of TPC was further delineated functionally in tumorigenicity studies in NSCLC and ovarian cancer. PTKT and PTKT” tumor populations were isolated from dissociated human tumor xenografts stained as described above by fluorescence activated cell sorting (FACS), and equivalent numbers were mixed with Matrigel (BD ences) and subcutaneously lanted into ID recipient mice.
Whereas PTKT cells failed to e tumors in recipient mice, PTKT' tumor cells tently produced rapidly growing tumors with both NSCLC and ovarian carcinomas. Thus, in accordance with the ngs herein PTK7 functionally delineates TPC in ovarian cancer and NSCLC and provides further evidence as to the y of the sed modulators as diagnostic and theragnostic agents.
Example 12 Selected PTK7 Modulators Are Internalized by K562 and G401 Cells PTK'7 modulators from ltybridomas that were generated by immunizing mice as described above were ed for their ability to internalize in K562 and G40! cells. [034” In this regard K562 cells at a starting concentration of lOGImL (single cell suspension) were blocked with Human TruStain (Biolegcnd, Inc., 422302) for 10 minutes at room temperature.
Cells were diluted to 50x 103 cells per reaction. Duplicate samples were stained for 30 minutes on ice with antibody supernatant fora final volume of 50 uL, then washed with FACS staining medium (FSM; 2% fetal bovine serum/Hank's buffered saline on/ZSmM HEPES [pH7.4]; Mediatcch, inc.) to remove unbound antibody. This was followed by a second stain with donkey anti—mouse Alexa647 (Life Technologies) for 30 minutes on ice. Cells were then washed again to remove unbound antibody and samples were i‘esrt3pended in internalization medium (2% fetal bovine serum/ lscovc‘s Modified Dulbecco‘s Medium) and incubated in 5% C02 @ 37°C (or 4°C for the control) for l hour to allow internalization. The reaction was stopped by transferring samples to ice and adding ice cold FSM. To remove any antibody that did not internalize and ed on the cell surface. samples were treated with low pH phosphate buffered saline (PBS {pl-12.01) for l0 minutes on ice. Following this "acid-strip" step, samples were washed extensively with FSM, tesuspended in lSO ill. of FSM containing Eng/ml of DAPI (Life Technologies) and ed on a BD FACS Canto flow cytometer. Any increase in fluorescence over that detected from cells incubated on ice in this experiment resulted from the ability of antibody internalization, which protects the scent molecule from being stripped off the cell surface during the low pH phosphate buffer treatment. All incubations were performed in FACS staining medium unless otherwise .
When ing individual clones of PTK? antibody—containing hybridoma supernatants using the acid strip protocol described above, several supernatants showed a positive shift in fluorescence vs. ned cells and IgG negative control antibodies (FIGS. 10A and lOB).
Antibody internalization was ed with several anti—PTK? antibodies, as demonstrated by the ability of these antibodies to t the Alexa647 secondary antibody from acid stripping and resulting in a shift in fluorescence to the right. Antibody clone SC6.lO.2 (i.e., H10 in C) is an example of typical alization y by anti-PTK7 antibodies with this activity. Compared to the IgG controls, approximately 15% of the PTK7 antibody-containing supernatants (4 of 27) induced internalization. Using the K562 cells this data demonstrates that a subset of antibodies able to bind PTK7 ECD engage the antigen as it is presented on cells and are able to internalize efficiently. [0343} Further ce indicating that the disclosed modulators can e internalization in various exemplary cell lines is showu in FIG. lOD. More ically a glioblastoma cell line (G40! Wilm’s Tumor cells) was found to express high levels of PTK7 (data not shown) suggesting that this cell line may be may be more sensitive under selected assay conditions and therefore able to more effectively identify modulators able to induce internalization. Generally using these cells with the aforementioned acid—strip procedure l70 unique hybridoma supernatants from Example 7 were screened to determine if they contained alizing antibodies. ed antibodies SC6.2.35, SC6.10.2 and SC6.25.3 (denoted H235, 1-1102 and H253 in FIG. lOD) which were identified in the above mentioned screen were used as positive controls (FIG. lOD). The internalization capacity of modulators present in six exemplary supernatants (identified by well designation) are shown immediately below the controls. With this more refined assay the data shows that numerous modulators provided by the immunization procedure discussed above were able to bind PTK7 and internalize (as evidenced by lAO2, IFOZ, 2AO3 and 2F10) although not every clone (2Fl l and 2F09) possessed this ability.
In yet a further demonstration as to the properties of the disclosed modulators, all ed antibodies that bound to the G401 cells in a significant way were found to internalize to some extent (FIG. lOE). As represented by the dashed line in FIG. lOE. positive cell staining was set to 4‘2?- basetl on mouse isotype control antibodies which showed nonspecific staining nfO-BQ’r of cells. ‘Mean fluorescent intensities of G401 cells stained with each antibody were measured after the acid-strip step (i.e., post internalization) at 37°C and 4°C and interpolated to relative or numbers per cells using 8-peak w beads (BD Spherotech #559123) which contain known numbers of fluorescent molecules. Numbers of internalized receptors were calculated by subtracting receptor s obtained from s oing the internalization step at the 4°C (control) from the one at 37°C. It was noted that PTK7 specific antibodies are heterogeneous in their ability to induce internalization given a ten-fold difference in numbers of alized ors independent of the level of cell binding (upper right quadrant of E).
Example 13 PTK7 Modulators Facilitate Delivery of Cytotoxic Agents ing of a cytotoxic drug stably linked to an antibody represents an empowered antibody approach that might have great therapeutic benefit for patients with solid tumors. To ine whether the internalizing PTK7aspecific antibodies described above were able to mediate the delivery of a cytotoxic agent to live cells, an in vitro cell killing assay was performed wherein streptavidin conjugated to the ribosome~inactivating protein saporin (Advanced Targeting Systems) was bound to biotinylated PTK7 antibodies, and the ability of these n complexes to internalize and kill cells was ed 72 hours later by measuring cell ity. 10346] Specifically, Ix l04 G40l Wilin’s Tumor cells per well were plated in wells of a l plate. PTK7 modulators in the form of anti-PTK7 antibodies as described above were purified from supernatants, biotinylated and then d to 20 uglmL. An aliquot of each antibody was mixed [:1 with streptavidin-ZAP ced Targeting Systems), vortexed for 5 seconds and then incubated at room temperature for I hour. Three additional serial lO-fold dilutions of the antibody~ saporin complexes were then made and 50 ill. of each mixture, respectively, was added to G40! cell containing wells. The cell/antibody-saporin mixture was then incubated at 37°C/5‘76C03 for 24 hours. Following this incubation, cells were spun down in round-bottom 96-well plates, supernatant was removed, and IOO uL of fresh culture medium was added to each well. The cells were then incubated for an additional 72 heurs before viable cell numbers were enumerated using CcllTiter-Glo ga Inc.) per the cturer’s protocol. [0347} Using the cell killing assay described above, exemplary internalizing PTK7 modulators comprising antibodies from clones SC6.2.35,SC6.10.2 and SC6.25.3 ed H235, H 10.2 and - HZS.3 in FIG 1 1A) were shown to mediate saporin toxin alization and cell killing. More particularly FIG. llA clearly demonstrate the ability of these modulators effectcell killing through FTK’? mediated internalization as Opposed to a non-specific isotypc control antibody (i.e. MOPC).
Such data demonstrates that the disclosed modulators are immunospecific for PTK7 and are effectively able to mediate the ry of a cytotoxic payload and kill PTK? positive cells through cell surface association. [0348} In an extension of the aforementioned killing assay the delivery of a cytotoxic payload via PTK? specific antibodies was demonstrated using four more exemplary modulators (SC6.23, SC6.41, SC6.51 and SC6.58) with SC6.IO.2 used as a positive control. To this end the following cell types were plated into 96 well tissue culture plates in their tive culture media (500 cells per well) one day before the addition of antibodies and toxin: G40] Wilm’s Tumor cells, HEK293T engineered using retroviral transduction to express PTK’] molecules on their cell surface (herein denoted as 293.PTK7 cells) and HEK293T which on as a control.
For this assay purified PTK? modulators at various concentrations were added to the wells containing the plated cells. Following addition of the modulators a fixed amount of anti— mouse IgG Fab fragment covalently linked to n (Fab~ZAP, Advanced Targeting Systems, #IT-48) at a concentration of 411M was added to the wells and the cultures were incubated for 72 hours. Viable cell s were determined as described above using CellTiter-Glo. Raw luminescence counts using cultures containing cells with the saporin-Fab fragment (but no modulator) were set as l00% reference values and all other counts calculated accordingly (referred to as “Normalized RLU”). {0350] Using this assay, it was trated that all tested PTK7 dies (but not isotype control antibodies) were able to kill target cells (FIGS. llB — 1 11)) where FIGSA l 113, l 1C and 1 1D rate the modulator impact on G401 cells. 293.PTK7 cells and HEK293T cells respectively. It will be appreciated that modulator mediated internalization and killing is dependent on cell type (compare FIGS. l 1B — G401 cells and 1 1D - HEK293T cells), sion level of PTK? on the target cells (compare Fig. 1 1C - 293.PTK7 cells and l ID —- HEK293T cells) and the intrinsic ability of the various modulators to internalize. The assay further demonstrates that internalization primarily occurs because of binding of the PTK7- specific antibody to the cell surface without the need for additional crosslinking. Based on the data used to generate the dose response curves of FIGS. 1 [B — 1 1D (and similarly derived values for additional tors — not shown) the half- maximal effective concentration (“ECSO”) was determined for each of the tested modulators / target cell combination. More specifically TABLE 5 immediately below lists the EC50 (in pM) for thirteen modulators as determined for each of the three target cells using the assay described immediately above. ND tes that value was not determined.
TABLE 5 PTK7 Modulator Mediated Delivery of a Cytotoxic Agent Modulator G401 Cells 293.1’TK7 Cells HEK293T Cells No killing .5... . e4... 0.65 0.45 ..... KJI C\ 223 \D Dc, O\ \J ~ 00 ~200 we) sous:-C‘ g ~- as cm . \J [0-— U).— ~w 7‘00 314 .‘9 \) ~-G [\J DJ U! \ol‘J‘ u x.) SC6.51 105 i00 oo 4:.fU J}. 00m w While some variation as to killing was noted among the individual modulators there were some general trends that are evident from the data in TABLE 5. In this regard the modulators were generally more effective in mediating cell g of the engineered PTK overexpressing 293 cells than either the G401 cells or wild type 293 cells. Of interest, many of the tested modulators were vely effective at ing the killing of non-engineered G40l tumor cells that are known to express PTK7 on the cell surface. Such reproducible results are indicative as to the therapeutic potential of a broad range of internalizing PTK7 modulators as exemplified herein.
Example 14 PTK7 Modulators Facilitate Delivery of Cytotoxic Agents to 'l‘umorigeuic Cells {0352] To corroborate the results of the previous Example and demonstrate that PTK7 modulators can e toxin internalization and cell killing of primary human tumor cells, mouse lineage—depleted NTX cells (i.e. human tumor cells propagated as low-passage xenografts in immunocompromised mice) were plated and subsequently exposed to anti-PTK7 antibodies and Fab-ZAP. [0353} Specifically, NTX tumors d from lung (LU), ovarian (0V) cancer and melanoma (SK) patients were dissociated into a single cell suspension and plated on iaT‘“ plates (BD Biosciences) in growth factor supplemented serum free media using common art recognized techniques that favor cancer stem cell proliferation. After3-5 days of culture at 37°C/59’oCOg/5‘7a03 the cells were contacted with an isotype control (IgG2a) antibody or one of three murine anti~PTK7 antibodies (SCG.2.35, SC6.l0.?., or .l at 0.1 nM; - labeled SC6.H?., SC6.HIO and SC6.H25), and P (at 4011M) as generally set forth in the previous Example. Modulator—mediated saporin cytotoxicity was then assessed by quantifying the remaining number of cells using CellTiter Glo as per the manufacturer’s instructions 5~7 days later. The results were normalized to untreated cells.
As seen in exposure to each of the tested modulators (though not the isotype control) resulted in reduced viable cell numbers for all tumor types. In this respect it will be appreciated that the amount ofcell killing is apparently dependant on the specific tumor cell line as well as on the particular modulator. These data indicate that the modulators of the instant ion can innnunospecificall y associate with various antigen expressing cells from various tumor types, internalize and thereby mediate the killing ofthe constituent cells. Moreover. the y of the disclosed modulators to do this with t to NTX tumor cell lines cultured under conditions that favor cancer stem cell eration as previously bed is ly indicative of their ability to selectively eliminate cancer stem cells.
Example 15 PTK7 Modulators Reduce Cancer Stem Cell Tumorigenicity To further confirm the ability of the disclosed tors to reduce the frequency of cancer stem cells and impact their tumorigenic potential, NTX breast tumor cells were treated with and subsequently implanted into immunocompromised mice. {0356] In this regard two breast cancer patient—derived NTX tumors (BRlB and BR64) were iated and the human tumor cells were cultured under conditions known in the art to in tumorigenic cells, and treated with a PTK7 modulator (and isotype control) and Fab~ZAP as set forth in the previous Example. Cytotoxicity was then measured in terms ofcell viability using Cell Titer Glo per the manufacturer’s instructions fourteen days post treatment. Again the results were normalized to untreated cells. {0357} As seen in FIGS. 13A and l3B respectively the breast tumor cells derived from BR13 (A) and from BR64 (B) were largely eliminated through the PTK7 modulator mediated immunospecific association and internalization of the saporin cytotoxic agent. More Specifically treatment with the PTK7 modulator 35 (SC6.H2) at 0.2 nM resulted in the elimination of approximately 70—80% of the cells whereas the lgGZa control treated cells were largely unaffected. The findings are consistent with results seen in Example l3 and further demonstrate the broad applicability of the instant invention based on the ability of the disclosed modulators to ate tumor perpetuating cells derived from a y of tumors.
In order to confirm that the disclosed modulators ate tumor initiating cells, the treated preparations from the two breast cancer cell lines were lanted into mice to determine r tumor initiating cells remained alive. More specifically, cells from triplicate wells were each harvested independently, washed in PBS containing 2% BSA, resuspcnded in mom and then transplanted into individual immunocompromised mice lly using the procedures set forth in Example I. Mice were monitored weekly for tumor growth and any tumors that arose were measured to calculate their volume. Only mice transplanted with NTX BRl3 and BR64 cells treated with the lgG control developed tumors s those transplanted with cells ted with PTK7 modulators did not. These results demonstrate that TIC are eliminated by PTK7 modulators able to mediate toxin deliver (C).
A review of the data shows that the implantation of live cells remaining after treatment of either breast cancer cell line with PTK7 modulator and saporin does not result in the formation of tumors. Conversely, the control cells from both breast cancer cell lines (i.e., those that were treated with the e control antibody) were able to reinitiate tumor growth upon implantation.
In particular, two of the three mice implanted with each control cell line (BR22 and BR64) developed measurable tumors indicating that the implanted cells included tumor perpetuating cells.
More significantly, the inability of the modulator treated cells to form tumors strongly implies that the cells that were implanted did not include tumor perpetuating cells. That is, it is likely that treatment: with the PTK? modulator / n combination selectively targeted and eliminated tumor perpetuating cells in accordance with the instant invention. In any event these data demonstrate that treatment with the disclosed tors is effectivo at reducing the genic potential of tumor cells Example 16 Humanized P'I‘K7 Modulators Mediate The Delivery of Cytotoxic Agents As preferred ments of the present invention will likely employ humanized PTK7 modulators in a therapeutic setting, work was performed to demonstrate that humanized anti—PTK7 antibodies (fabricated as set forth in Example 8) function as effective mediators of cell killing through ry of cytotoxic . l036l} More particularly, three exemplary humanized PTK7 modulators (hSC6.23, 8 and hSC6.2¢t) were employed to mediate the introduction of a cytotoxic payload and eliminate tumorigenie cells in accordance with the teachings herein. Generally using the protocol set forth in Example 13 above HEK293 cells ered to express PTK7 (i.e. 293.?TK7 cells) were exposed to different concentrations of the selected modulators and saporin linked to an anti—human Fab (Fab-ZAP human, Advanced Targeting Systems). Following incubation the cells were washed and modulator-mediated n cytotoxicity was then assessed by quantifying the remaining number of cells using ter Glo as per the manufacturer‘s instructions 5-7 days later: The s were normalized to untreated cells and are graphically presented in . [0362} Examination of the curves set forth in FIG. l4 shows that all three of the tested PTK'] tors were very effective at inducing internalization of the cytotoxic payload reducing cell viability. In this respect each of the modulators provided a 50% reduction in cell viability at a concentration between i and 10 pM and a reduction of greater than 80% in cell viability at a concentration of 100 pM. Again. in accordance with the instance disclosure these data are indicative of highly effective modulators that can itnmunospecifically mediate the delivery of xic agents to selected cell populations.
Those skilled in the art will further appreciate that the present invention may be embodied in other specific forms without ing from the spirit or central attributes thereof. In that the foregoing description of the present invention discloses only exemplary embodiments f, it is to be understood that other variations are contemplated as being within the scope of the present invention. Accordingly, the present invention is not limited to the particular embodiments that have been described in detail . Rather, reference should be made to the appended claims as indicative of the scope and content of the invention.

Claims (38)

1. An antibody or fragment thereof that specifically binds to human PTK7 comprising three CDRs of a light chain variable region set forth as SEQ ID NO: 62 and three CDRs of a heavy chain variable region set forth as SEQ ID NO: 63.
2. The antibody or fragment thereof according to claim 1, comprising: (a) a light chain variable region comprising three CDRs set forth as residues 24-34 of SEQ ID NO: 62 for VL CDR1, residues 50-56 of SEQ ID NO: 62 for VL CDR2, and residues 89-97 of SEQ ID NO: 62 for VL CDR3; and (b) a heavy chain variable region comprising three CDRs set forth as residues 31-35 of SEQ ID NO: 63 for VH CDR1, residues 50-65 of SEQ ID NO: 63 for VH CDR2, and residues 95-102 of SEQ ID NO: 63 for VH CDR3; wherein the CDR numbering is according to Kabat.
3. The antibody or fragment thereof according to claim 1, comprising: (a) a light chain variable region comprising three CDRs set forth as residues 23-34 of SEQ ID NO: 62 for VL CDR1, residues 50-56 of SEQ ID NO: 62 for VL CDR2, and residues 89-97 of SEQ ID NO: 62 for VL CDR3; and (b) a heavy chain variable region sing three CDRs set forth as residues 26-32 of SEQ ID NO: 63 for VH CDR1, residues 50-58 of SEQ ID NO: 63 for VH CDR2, and residues 95-102 of SEQ ID NO: 63 for VH CDR3; wherein the CDR numbering is according to Chothia.
4. The antibody or fragment f ing to claim 1, comprising: (a) a light chain le region comprising three CDRs set forth as residues 30-36 of SEQ ID NO: 62 for VL CDR1, residues 46-55 of SEQ ID NO: 62 for VL CDR2, and residues 89-96 of SEQ ID NO: 62 for VL CDR3; and (b) a heavy chain variable region comprising three CDRs set forth as residues 30-35 of SEQ ID NO: 63 for VH CDR1, es 47-58 of SEQ ID NO: 63 for VH CDR2, and residues 93-101 of SEQ ID NO: 63 for VH CDR3; wherein the CDR ing is according to MacCallum.
5. The antibody or fragment thereof according to any one of claims 1-4, comprising a light chain variable region having an amino acid sequence that is at least 60% cal to SEQ ID NO: 62 and a heavy chain le region having an amino acid sequence that is at least 60% identical to SEQ ID NO: 63.
6. The antibody or fragment thereof according to any one of claims 1-5, comprising a light chain variable region set forth as SEQ ID NO: 62 and a heavy chain variable region set forth as SEQ ID NO: 63.
7. The antibody or fragment thereof according to any one of claims 1-6, which is a neutralizing antibody, depleting antibody, and/or internalizing antibody.
8. The dy or fragment thereof according to any one of claims 1-7, wherein the isolated antibody is a monoclonal, chimeric, CDR-grafted, humanized, or recombinant human antibody, or fragment thereof.
9. An antibody drug conjugate comprising the antibody or fragment thereof according to any one of claims 1-8, n the antibody or fragment thereof is conjugated, linked, or otherwise associated with a cytotoxic agent.
10. A pharmaceutical composition comprising the isolated antibody or fragment thereof according to any one of claims 1-8.
11. A pharmaceutical composition comprising the antibody drug conjugate according to claim 9.
12. A nucleic acid ng a light chain le region or a heavy chain variable region of the antibody or nt f according to any one of claims 1-8.
13. A nucleic acid encoding a light chain variable region set forth as SEQ ID NO: 48 or 62, and/or a heavy chain variable region set forth as SEQ ID NO: 49 or 63.
14. A vector comprising the nucleic acid according to claim 12 or claim 13.
15. A non-human or ed host cell comprising the nucleic acid according to claim 12 or claim 13.
16. A non-human or isolated host cell comprising the vector of claim 14.
17. Use of the antibody or nt thereof according to any one of claims 1-8 for the manufacture of a medicament for detecting, diagnosing, or monitoring cancer in a subject, wherein the antibody or fragment thereof is ated to a detectable agent.
18. Use according to claim 17, wherein the cancer is breast cancer, ovarian cancer, colorectal cancer, pancreatic cancer, lung cancer, or skin cancer.
19. Use according to claim 17, wherein the cancer is ovarian cancer.
20. Use according to claim 18, wherein the cancer is breast cancer.
21. Use according to claim 18, wherein the lung cancer is non-small cell lung cancer.
22. Use of a therapeutically effective dose of an antibody conjugate comprising the antibody or fragment f ing to any one of claims 1-8 for the manufacture of a medicament for treating cancer in a subject, wherein the antibody or fragment thereof is conjugated, linked, or otherwise associated with a xic agent.
23. Use according to claim 22, wherein the cancer is breast cancer, ovarian cancer, colorectal cancer, pancreatic cancer, lung cancer, or skin cancer.
24. Use according to claim 22, wherein the cancer is ovarian cancer.
25. Use according to claim 23, wherein the cancer is breast cancer.
26. Use according to claim 23, wherein the lung cancer is non-small cell lung cancer.
27. Use of an antibody conjugate comprising the antibody or fragment thereof according to any one of claims 1-8 for the manufacture of a medicament for ng the frequency of tumor initiating cells in a subject, wherein the antibody or fragment thereof is ated, linked, or otherwise ated with a cytotoxic agent.
28. Use according to claim 27, n the cancer is breast cancer, ovarian , colorectal cancer, pancreatic cancer, lung , or skin cancer.
29. Use according to claim 27, wherein the cancer is ovarian cancer.
30. Use according to claim 28, wherein the cancer is breast cancer.
31. Use according to claim 28, wherein the lung cancer is non-small cell lung cancer.
32. The isolated antibody or fragment f according to claim 1 substantially as herein described with reference to any one or more of the examples but excluding ative examples.
33. The dy drug conjugate ing to claim 9 substantially as herein described with nce to any one or more of the examples but excluding comparative examples.
34. The pharmaceutical composition according to claim 10 or claim 11 substantially as herein described with reference to any one or more of the examples but excluding comparative examples.
35. The nucleic acid according to claim 12 or claim 13 substantially as herein described with reference to any one or more of the examples but excluding comparative examples.
36. The vector ing to claim 14 substantially as herein described with reference to any one or more of the examples but excluding comparative examples.
37. The non-human or isolated host cell according to claim 15 or claim 16 substantially as herein described with reference to any one or more of the examples but excluding comparative examples.
38. The use according to any one of claims 17 to 31 substantially as herein described with reference to any one or more of the examples but ing comparative examples.
NZ708615A 2011-02-18 2012-02-17 Novel modulators and methods of use NZ708615B2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US201161444614P 2011-02-18 2011-02-18
US61/444,614 2011-02-18
PCT/US2011/050451 WO2012031280A2 (en) 2010-09-03 2011-09-02 Identification and enrichment of cell subpopulations
USPCT/US2011/050451 2011-09-02
NZ615285A NZ615285B2 (en) 2011-02-18 2012-02-17 Novel modulators and methods of use

Publications (2)

Publication Number Publication Date
NZ708615A NZ708615A (en) 2017-02-24
NZ708615B2 true NZ708615B2 (en) 2017-05-25

Family

ID=

Similar Documents

Publication Publication Date Title
US10836831B2 (en) Anti-PTK7 antibodies and methods of use
US10017565B2 (en) Modulators and methods of use
AU2011293127B2 (en) Notum protein modulators and methods of use
US20130058947A1 (en) Novel Modulators and Methods of Use
AU2011338425A1 (en) Novel modulators and methods of use
NZ708615B2 (en) Novel modulators and methods of use
NZ615285B2 (en) Novel modulators and methods of use