NZ624872B2 - Dihydro-benzo-oxazine and dihydro-pyrido-oxazine derivatives - Google Patents

Abstract

The disclosure relates to dihydro-benzo-oxazine and dihydro-pyrido-oxazine compounds of the formula (I) and/or pharmaceutically acceptable salts and/or solvates thereof, wherein Y, V, W, U, Q, R1, R5, R7 and R30 are as defined in the description. Such compounds are suitable for the treatment of a disorder or disease which is mediated by the activity of the PI3K enzymes. An example of the compounds is {(S)-3-[4-(5-difluoromethyl-6-methoxy-pyridin-3-yl)-5-methyl-3,4-dihydro-2H-benzo[1 ,4]oxazin-6-yloxy]-pyrrolidin-1-yl}-(1,1-dioxo-hexahydro-1Iambda*6*thiopyran-4-yl)-methanone. sorder or disease which is mediated by the activity of the PI3K enzymes. An example of the compounds is {(S)-3-[4-(5-difluoromethyl-6-methoxy-pyridin-3-yl)-5-methyl-3,4-dihydro-2H-benzo[1 ,4]oxazin-6-yloxy]-pyrrolidin-1-yl}-(1,1-dioxo-hexahydro-1Iambda*6*thiopyran-4-yl)-methanone.

Description

Dihydro—Benzo-Oxazine and Dihydro-Pyrido-Oxazine Derivatives FIELD OF THE INVENTION The invention relates to the preparation and use of new dihydro-benzo-oxazine and dihydro-pyrido-oxazine derivatives as drug candidates in free form or in pharmaceutically acceptable salt form with valuable druglike properties, such as e.g. metabolic stability and le cokinetics, form for the modulation, notably the tion of the activity or function of the phosphoinositide 3’ OH kinase family (hereinafter PI3K).

BACKGROUND OF THE INVENTION Members of the phosphoinositide-3 kinase (PI3K) family are involved in cell growth, entiation, survival, cytoskeletal remodeling and the cking of intracellular organelles in many different types of cells (Okkenhaug and Wymann, Nature Rev.

Immunol. 3:317 (2003).

To date, eight mammalian PI3Ks have been identified, divided into three main classes (I, II and III) on the basis of their genetic sequence, structure, adapter les, expression, mode of activation, and ed substrate.

PI3K8 is a lipid kinase belonging to the class I PI3K family (PI3K 0L, [3, y and 8) that tes second messenger signals downstream of tyrosine kinase-linked receptors.

P|3K8 is a heterodimer composed of an adaptor protein and a p1108 tic t which converts phosphatidylinositol-4,5-bis—phosphate (PtdlnsP2) to atidylinositol-3,4,5-tri-phosphate (PtdlnsP3). Effector proteins interact with PtdlnsP3 and trigger specific signaling pathways involved in cell activation, differentiation, migration, and cell survival.

Expression of the p1108 and p110y catalytic subunits is ential to leukocytes.

Expression is also observed in smooth muscle cells, myocytes and endothelial cells. In contrast, p1100c and p110B are expressed by all cell types (Marone et al. Biochimica et Biophysica Acta 1784:159 (2008)).

P|3K8 is associated with B cell development and function (Okkenhaug et al. Science 297:1031 (2002)).

B cells play also a critical role in the pathogenesis of a number of autoimmune and allergic diseases as well as in the process of transplant rejection (Martin and Chan, Annu. Rev. Immunol. 24:467 (2006)).

Chemotaxis is involved in many autoimmune or inflammatory diseases, in angiogenesis, invasion/metastasis, neurodegeneration or woud healing (Gerard et al. Nat. lmmunol. 2:108 ). Temporarily distinct events in leukocyte ion in se to chemokines are fully dependent on P|3K8 and P|3Ky (Liu et al. Blood 91 (2007)).

P|3Koc and P|3KB play an essential role in maintaining homeostasis and pharmacological inhibition of these molecular targets has been associated with cancer therapy (Maira et al. Expert Opin. Ther. s 12:223 (2008)).

P|3Koc is ed in insulin signaling and cellular growth pathways (Foukas et al. Nature 441 :366 (2006)). P|3K8 isoform-selective tion is expected to avoid potential side effects such as hyperglycemia, and metabolic or growth disregulation.

Parasitic infections still represent one of the most important causes of morbidity and mortality worldwide. Among the tes that cause human and animal pathology the phylum apicomplexa ses a group of vector-borne parasites that is responsible for a wide y of serious illnesses including but not limited to malaria, leishmaniasis and trypanosomiasis. Malaria alone infects 5-10% of humanity and causes around two milion deaths per year. [Schofle/d et al, “Immunological processes in malaria pathogenesis”, Nat Rev [mm 2005], [Schofiled L, “lntravascular infiltrates and organ-specific inflammation in malaria pathogenesis], [Mishra et al, “TLRs in CNS Parasitic infections”, Curr Top Micro Imm 2009],[Bottieau et al, “Therapy of vector-borne protozoan infections in nonendemic settings”, Expert Rev. Anti infect. Ther., 2011].

Toll-like ors (TLRs) are germ-line encoded, phylogenetically ancient molecules that recognize evolutionary conserved structural relevant molecules (known as pathogen — associated molecular ns (PAMPs)) within microbial pathogens. Various different cell types including cells of the immune system express TLRs and are thereby able to detect the presence of PAMPs. Sofar 10 functional TLR family members (TLR1-10) have been bed in humans, all of which recognize specific PAMP molecules. Following recognition of these specific PAMPs TLRs induce and orchestrate the immuneresponse of the host to infections with bacteria, viruses, fungi and parasites. [Hedayat et al, “Targeting of TLRs: a decade of progress in combating infectious disease”, review, Lancet Infectious disease 2011], [Kwai et al, “TLR3 and their crosstalk with other innate ors in infection and immunity”, review, ty May-2011].

The immune system of the infected host responds to infection with the TLR induced production of pro-inflammatory cytokines mainly of the T-helper 1 type (Th1). While adequate amounts of these cytokines are benefical and ed to clear the infection an overproduction of these mediators is harmful to the host and associated with immune mediated pathology including neuropathology and tissue damage with severe and often fatal consequences. One prominent and highly relevant example of such immune mediated pathology is acute and cerebral malaria (CM) which causes severe clinical symptoms and is often fatal. [Schofie/d et al, “Immunological processes in malaria pathogenesis”, Nat Rev [mm 2005], [Schoflled L, “Intravascularinfiltrates and specific ation in malaria pathogenesis], [Mishra et al, “TLRs in CNS Parasitic infections”, Curr Top Micro [mm 2009], [Bottieau et al, “Therapy of vector-borne protozoan infections in emic settings”, Expert Rev. Anti infect. Ther., 2011] [Hedayat et al, “Targeting of TLRs: a decade of progress in combating ious disease”, review, Lancet Infectious disease 2011]. Despite progress made in treatment and eradication of malaria, the mortality rate that is associated with severe malaria, including CM remains ptably high. gies directed solely at the eradication of the parasite in the host might therefore not be sufficient to prevent neurological cations and death in all cases of CM. Development of new innovative adjunct therapeutic strategies to efficiently reduce the CM-associated mortality and morbidity that is caused, in part, by host-mediated immunopathology s therefore an urgent l need. [Higgins et al, “Immunopathogenesis of falciparum malaria: implications for adjunctive therapy in the management of severe and cerebral malaria”, Expert Rev. Anti . Ther. 2011] Recently further evidence has been provided that TLR9 plays a key role in the recognition and response to parasites including but not d to dium, Leishmania, Trypanosoma and Toxoplasma [Gowda et al, “The Nucleosome is the TLR9-specific lmmunostimulatory component of plasmodium falciparum that activates DCs”, PLoS ONE, June 2011], [Peixoto-Rangel et al, ”Candidate gene analysis of ocular toxop/asmosis in Brazil: evidence for a role for TLR9”, Mem Inst Oswaldo Cruz 2009], [Pellegrini et al, “The role of TLR3 and adoptive ty in the development of protective or pathological immune response triggered by the osoma cruzi protozoan”, Future iol 2011] and that interference with the activation of TLRs including TLR9 represents a promising gy to prevent the deleterious inflammatory responses in severe and cerebral malaria [Franklin et al, ”Therapeutical targeting of nucleic ensing TLRs prevents experimental cerebral malaria”, PNAS 2011] Malaria is an infectious disease caused by four protozoan parasites: Plasmodium falciparum; Plasmodium vivax; Plasmodium ovale; and Plasmodium malaria. These four parasites are typically transmitted by the bite of an infected female Anopheles mosquito. Malaria is a W0 2013/093849 problem in many parts of the world and over the last few s the malaria burden has steadily increased. An ted 1-3 million people die every year from malaria — mostly children under the age of 5. This increase in a mortality is due in part to the fact that Plasmodium falciparum, the deadliest malaria parasite, has acquired resistance against nearly all available antimalarial drugs, with the exception of the artemisinin derivatives.

Leishmaniasis is caused by one or more than 20 varieties of parasitic protozoa that belong to the genus Leishmania, and is itted by the bite of female sand flies. Leishmaniasis is endemic in about 88 ies, including many tropical and sub-tropical areas. There are four main forms of Leishmaniasis. Visceral leishmaniasis, also called kala-azar, is the most serious form and is caused by the parasite Leishmania donovani. Patients who develop visceral leishmaniasis can die within months unless they e treatment. The two main therapies for visceral leishmaniasis are the antimony derivatives sodium stibogluconate (Pentostam®) and meglumine antimoniate (Glucantim®). Sodium stibogluconate has been used for about 70 years and resistance to this drug is a growing problem. In addition, the treatment is relatively long and painful, and can cause undesirable side effects.

Human African Trypanosomiasis, also known as sleeping sickness, is a vector-borne parasitic disease. The parasites concerned are oa belonging to the Trypanosoma Genus. They are transmitted to humans by tsetse fly (Glossina Genus) bites which have acquired their infection from human beings or from animals ing the human enic parasites.

Chagas disease (also called American Trypanosomiasis) is another human parasitic disease that is endemic amongst poor populations on the American continent. The disease is caused by the protozoan parasite osoma cruzi, which is itted to humans by blood- sucking insects. The human disease occurs in two stages: the acute stage, which occurs shortly after ion and the chronic stage, which can develop over many years. Chronic ions result in s neurological disorders, including dementia, damage to the heart muscle and sometimes dilation of the digestive tract, as well as weight loss. Untreated, the chronic disease is often fatal. The drugs currently available for treating Chagas disease are Nifurtimox and benznidazole. However, problems with these current therapies include their diverse side effects, the length of treatment, and the requirement for l supervision during treatment. Furthermore, treatment is really only effective when given during the acute stage of the disease. Resistance to the two frontline drugs has y occurred. The antifungal agent Amphotericin b has been proposed as a second-line drug, but this drug is costly and relatively toxic.

Toxoplasmosis is endemic through most of the world, which can infect a large proportion of the adult population.1,2 However, its prevalence differs in different ies.3 It is estimated to infect at least 10% of adults in northern temperate countries and more than half of adults in Mediterranean and tropical contries.4 Toxoplasma gondii is a ubiquitous, obligate ellular protozoan and is considered to be the most common cause of infective retinitis in humans, which depends on a variety of s, including climate, hygiene, and dietary habits.5—7 The course of disease in immunocompetent adults is y asymptomatic and self-limiting. As soon as infection has ed, the parasite forms latent cysts in the retina and in other organs of the body, which can reactivate years after the initial infection giving rise to acute retinochoroiditis and the formation of new retinochoroidal lesions.

[Areva/o et al, “Ocular asmosis in the developing world”, at. Ophthal. Clin 2010] Neurocysticercosis is the most common parasitic disease of the CNS (incidence ~2.5 milion worldwide) caused by the larvae of Taenia solium. The disease has a long omatic phase in humans characterized by the absence of a detectable inflammatory response surrounding the parasite. The overall immune se during the asymptomatic phase is of the Th2 phenotype. However, the destruction of larvae by therapeutic treatment or by normal parasite ion causes a strong inflammatory response, often consisting of a chronic granulomatous reaction and manifestation of typical symptoms of the disease. The immune response in the CNS of symptomatic patients consists of an overt Th1 phenotype or a mixed Th1, Th2, and Th3 se, depending upon the absence or presence of granulomas. The hyperinflammatory response prevailing during the symptomatic phase in the CNS is sible for the severe neuropathology and mortality associated with neurocysticercosis .

[Mishra et al, “TLRs in CNS Parasitic infections”, Curr Top Micro [mm 2009] There is a need to provide new P|3K inhibitors that are good drug candidates. In particular, compounds of the invention should bind potently to P|3K whilst showing little affinity for other receptors and show functional activity as inhibitors. They should be well absorbed from the gastrointestinal tract, be lically stable and possess favourable pharmacokinetic properties. When targeted against receptors in the central nervous system they should cross the blood brain barrier freely and when targeted selectively against receptors in the eral nervous system they should not cross the blood brain barrier. They should be non-toxic and demonstrate few side-effects. Furthermore, the ideal drug candidate will exist in a physical form that is stable, non-hygroscopic and easily formulated.

The compounds of the invention show a certain level of selectivity against the different gs P|3K on, B, y and 8. In particular, show a certain level of selectivity for the isoform Pl3K8.

The compounds of the present invention are therefore potentially useful in the treatment of a wide range of disorders, particularly disorders including but not d to autoimmune disorders, inflammatory diseases, allergic diseases, disease or infection associated pathologies, ainNay diseases, such as asthma and COPD, transplant rejection, cancers eg of hematopoietic origin or solid tumors.

The invention also relates to the treatment, either alone or in ation, with one or more other cologically active compounds, includes methods of treating conditions, diseases or disorders in which one or more of the functions of B cells such as dy production, antigen presentation, cytokine production or lymphoid genesis are abnormal or are rable including rheumatoid arthritis, pemphigus vulgaris and related diseases, idiopathic thrombocytopenia purpura, ic lupus erythematosus, multiple sclerosis, myasthenia gravis, n‘s syndrome, autoimmune hemolytic anemia, ANCA—associated vasculitides, cryoglobulinemia, thrombotic thrombocytopenic purpura, chronic autoimmune urticaria, allergy (atopic dermatitis, contact dermatitis, allergic rhinitis), goodpasture's syndrome, AMR (antibody- ed transplant rejection), B cell-mediated hyperacute, acute and chronic transplant rejection and cancers of opoietic origin including but not limited to multiple myeloma; acute myelogenous leukemia; chronic myelogenous leukemia; lymphocytic leukemia; myeloid leukemia; non-Hodgkin lymphoma; lymphomas; polycythemia vera; essential ocythemia; myelofibrosis with myeloid metaplasia; and Walden stroem disease as well as in disease or infection associated immunopathology.

SUMMARY OF THE ION The ion relates to o-benzo-oxazine and dihydro-pyrido-oxazine compounds of the formula (I) and/or pharmaceutically acceptable salts and/or solvates f, Q R u/ \ / 5 R R30 so R R N Y R5 \ I W R5 / /V N s o R \R1 wherein Y is selected from O or NH; V is selected from CR5 or N; W is selected from CH2, or O; U is selected from N or CH; Q is selected from N or CR5; wherein U and Q are not both N; R1 is selected from phenyl, pyridyl, pyrimininyl, pyrazinyl, pyridazinyl, 1,2,3-triazinyl, 1,2,4- triazinyl, 1,3,5-triazinyl, or -X-R4 wherein X is selected from C(O), S(O)2 or CH2 R4 is ed from C1-Cg-alkyl, halo-C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, C1-Cg-alkoxy- C1-Cg-alkyl, cyano-C1-Cg-alkyl, N,N-di-C1-C4-alkyl-amino-C1-Cg-alkyl, alkyl- sulfonyl-C1-Cg-alkyl, phenyl, heterocyclyl, heterocyclyl-oxy, heterocyclyl-C1-Cg-alkyl, -cycloalkyl, Cs-C12-cycloalkyl-oxy, Cs-C12-cycloalkyl-C1-Cg-alkyl, heteroaryl, heteroaryl-oxy, heteroaryl-C1-Cg-alkyl, hydroxy, C1-Cg-alkoxy, amino, N-C1-Cg-alkyl- amino or N,N-di-C1-Cg-alkyl-amino, wherein C1-Cg-alkyl in N-C1-Cg-alkyl-amino and in N,N-di-C1-Cg-alkyl-amino may be unsubstituted or substituted by halogen, hydroxy or C1-C4-alkoxy, wherein Cs-C12-cycloalkyl in Cs-C12-cycloalkyl and in Cs-C12-cycloalkyl-C1-Cg-alkyl may be unsubstituted or substituted by by 1-5 substituents selected from halogen, hydroxy or C1-C4-alkoxy; wherein ‘heterocyclyl’ is a 3 to 7 membered saturated or partially unsaturated monocyclic ring system ning 1 to 3 heteroatoms selected from N, O or 8, each of which is unsubstituted or substituted by 1-5 substituents selected from oxo, halogen, alkyl, 1-Cg-alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1-Cg-alkyl, amino, N-C1-Cg-alkyl-amino, -C1-Cg-alkyl-amino, C1- Cg-alkyl-carbonyl, 1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or C1'Cg' alkoxy-C1-Cg-alkyl-carbonyl; wherein ‘heterocyclyl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states, wherein ‘heteroaryl’ is a 3 to 7 membered fully unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, or pyrazolo[1,5-a]pyrimidine or imidazo[2,1-b]thiazole, each of which is unsubstituted or substituted by 1-5 substituents selected from halogen, C1-Cg-alkyl, halo-C1-Cg-alkyl, y-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1-Cg-alkyl, amino, N-C1-Cg-alkyl-amino, N,N-di- C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo-C1-Cg-alkyl-carbonyl, hydroxy-C1-Cg- alkyl-carbonyl or C1-Cg-alkoxy—C1-Cg-alkyl-carbonyl; wherein ‘heteroaryl’ can be attached at a atom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be ed to various oxidation states; R6 is selected from hydrogen, halogen, C1-C4-alkyl, halo-C1-C4-alkyl, C1-C4-alkoxy, C1-C4- alkyl-sulfonyl, alkyl-sulfinyl, C1-C4-alkyl-sulfanyl, halo-C1-C4-alkoxy, C1-C4-alkoxy-C1- C4-alkyl, amino, g-alkyl-amino, -C1-Cg-alkyl-amino; R7 is selected from hydrogen, halogen, cyano, nitro, C1-C4-alkyl, halo-C1-C4-alkyl, C1-C4- alkoxy, N(R8)2-sulfonyl, alkyl-sulfonyl, C1-C4-alkyl-sulfonyl-amino, C1-Cg-alkoxy-C1-Cg- alkyl, amino, N-C1-Cg-alkyl-amino, or N,N-di-C1-Cg-alkyl-amino; or R6 and R7, together are CH=CH-CH=CH, wherein R8 is independently selected from hydrogen, C1-C4-alkyl, C1-C4-alkoxy or two R8 together with the nitrogen they are attached to form a 4 to 7 membered heterocyclic ring containing 1-2 heteroatoms selected from N, O, S, which is unsubstituted or substituted by 1-3 substituents selected from C1-C4-alkyl; R5 is independently selected from H, D, F or C1-Cz-alkyl; R30 is ndently selected from H, D or F.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is the X-ray Powder Diffraction Pattern of Example F1, crystalline anhydrous form Figure 2 is the differential scanning calorimetry graph of Example Example F1, crystalline anhydrous form DETAILED PTION OF THE INVENTION Unless specified othenNise, the term “compounds of the present invention” refers to compounds of formula (I) and subformulae thereof, salts of the compound, hydrates or soIvates of the compounds and/or salts, as well as all stereoisomers (including diastereoisomers and enantiomers), tautomers and isotopically labeled compounds (including deuterium substitutions). Compounds of the t invention further comprise rphs of compounds of formula (I) (or subformulae thereof) and salts thereof. Where nds of formula (I) are mentioned, this is meant to include also the tautomers and N- oxides of the compounds of formula (I).

The invention may be more fully appreciated by reference to the following description, including the following glossary of terms and the concluding examples. As used herein, the terms "including , containing" and ising" are used herein in their open, non- limiting sense.

Tautomers, such as tautomers between keto- and enol form, Iactam- and Iactim form, amid form and imidic acid form or enamine form and imine form, can be t for example in the R1 portion of compounds of formula (I). en containing heterocyclyl and heteroaryl residues may form es.

Where the plural form is used for compounds, salts, and the like, this is taken to mean also a single compound, salt, or the like.

The general terms used before and hereinafter preferably have within the t of this disclosure the following meanings, unless otherwise indicated: As used herein, the term “alkyl” refers to a fully saturated branched, including single or multiple branching, or unbranched hydrocarbon moiety having up to 20 carbon atoms.

Unless othenNise provided, alkyl refers to hydrocarbon moieties having 1 to 16 carbon atoms, 1 to 10 carbon atoms, 1 to 7 carbon atoms, or 1 to 4 carbon atoms.

Representative es of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n—butyl, sec-butyl, iso-butyl, tert—butyl, n-pentyl, isopentyl, neopentyl, l, 3-methylhexyl, 2,2- dimethylpentyl, 2,3-dimethylpentyl, yl, n-octyl, n-nonyl, n-decyl and the like. Typically, alkyl groups have 1-7, more preferably 1-4 carbons.

As used herein, the term “halo-alkyl” refers to an alkyl as defined herein, which is substituted by one or more halo groups as defined . The halo-alkyl can be mono- halo-alkyl, di-halo-alkyl or poly-halo-alkyl including per-halo-alkyl. A mono-halo-alkyl can have one iodo, bromo, chloro or fluoro within the alkyl group. Di-halo-alky and poly-halo- alkyl groups can have two or more of the same halo atoms or a combination of different halo groups within the alkyl. Typically the poly-halo-alkyl ns up to 12, or 10, or 8, or 6, or 4, or 3, or 2 halo . Non-limiting es of halo-alkyl include fluoromethyl , di-fluoro-methyl, tri-fluoro-methyl, chloro-methyl, di-chloro-methyl, tri-chloro- , penta-fluoro-ethyl, hepta-fluoro-propyl, di-fluoro-chloro-methyl, di-chloro-fluoro- methyl, di-fluoro-ethyl, di-fluoro-propyl, oro-ethyl and dichloro-propyl. A per-halo- alkyl refers to an alkyl having all hydrogen atoms replaced with halo atoms.

As used herein, the term “heterocyclyl” or “heterocyclic” refers to a 3 to 7 ed monocyclic or 7 to 10 membered saturated or partially ted ring or ring system, which ns at least one heteroatom selected from N, O and S, where the N and S can also optionally be oxidized to various oxidation states. ‘Heterocyclyl’ can be attached at a heteroatom or a carbon atom. ‘Heterocyclyl’ can include fused or bridged rings as well as yclic rings.

In the context of R4, examples of heterocycles include oxiranyl, aziridinyl, oxetanyl, thiethanyl, acetitinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, 2,3- dihydrofuranyl, 2,5-dihydrofuranyl, 2,3-dihydrothiophenyl, 1-pyrrolinyl, olinyl, 3- pyrrolinyl, tetrahydropyranyl, piperidinyl, tetrahydrothiopyranyl, morpholinyl, thiomorpholinyl, oxathianyl, dioxanyl, piperazinyl, dihydropyranyl, tetrahydropyridinyl, dihydrothiopyranyl, azepanyl, thiepanyl and oxepanyl.

In the context of R8, examples of heterocycles include pyrrolinyl, piperidinyl, linyl, thiomorpholinyl, piperazinyl, tetrahydropyridinyl and azepanyl.

As used herein, the term “heteroaryl” or “heteroarylic” refers to a 4-, 5-, 6-, or 7-membered monocyclic, 7-, 8-, 9-, 10-, 11-, or 12—membered bicyclic or 10-, 11-, 12-, 13-, 14- or 15-membered tricyclic unsaturated ring or ring system - carrying the highest possible number of conjugated double bonds in the ring(s), which contains at least one heteroatom ed from N, O and 8, wherein the N and S can also optionally be oxidized to various oxidation states. ‘Heteroaryl’ can be attached at a heteroatom or a carbon atom. ‘Heteroaryl’ can include fused or bridged rings as well as spirocyclic rings.

Examples of heteroaryl e furanyl, enyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,3- oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,5-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,3-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, 1,2,4-triazinyl and 1,3,5-triazinyl.

As used herein, the term "cycloalkyl" refers to ted or partially unsaturated monocyclic, bicyclic or lic hydrocarbon groups of 3-12 carbon atoms. Unless othenNise ed, cycloalkyl refers to cyclic hydrocarbon groups having between 3 and 10 ring carbon atoms or between 3 and 7 ring carbon atoms. Exemplary bicyclic hydrocarbon groups include octahydroindyl, decahydronaphthyl. Exemplary tricyclic hydrocarbon o[2.1.1]hexyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.1]heptenyl, 6,6- dimethylbicyclo[3.1.1]heptyl, trimethylbicyclo[3.1.1]heptyl, bicyclo[2.2.2]octy.

Exemplary yclic hydrocarbon groups include adamantyl.

As used herein, the term “oxy” refers to an -O- linking group.

As used herein, the term “carboxy” or “carboxyl” is —COOH.

As used herein, all substituents are written in a way to show the order of functional groups (groups) they are composed of. The functional groups are defined herein above.

Various enumerated embodiments of the invention are described herein. It will be recognized that features specified in each embodiment may be combined with other specified features to provide further embodiments of the present invention.

In one embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a nd of the formula (l’) Q R u/ \ / 5 R 30 F: R30 N v R \ I w R5 /v N/ s o R \ wherein R1, R5, R7, R30, Y, V, W, U and Q are as defined above.

In one embodiment, the invention es a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, ed from a nd of the formula (la) Q R7 u/ \ R5 R30 R30 N Y R5 \ R5 /v N R5 0 \ (I a > 5 wherein R1, R5, R7, R30, Y, V, U and Q are as defined above.

In one embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (la’) Q R7 u/ \ R5 R30 30 N Y R5 \ | R /V N O R \R1 ('8’), wherein R1, R5, R7, R30, Y, V, U and Q are as defined above.

In another embodiment, the invention provides a compound of the a (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (lb) Q R u/ \ R5 R30 R30 N O R \ I W R5 /v N/ O R \R1 wherein R1, R5, R7, R30, V, W, U and Q are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the a (lb’) Q R u/ \ R5 R30 R30 N o R \ I w R5 /V N/ R5 0 \1 (W), wherein R1, R5, R7, R30, V, W, U and Q are as defined above.

In another embodiment, the ion provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, ed from a compound of the formula (lc) u/Q\ R7 [N I :1 ODN O \ (lc), wherein R1, R5, R7, U and Q are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically able salt and/or a solvate thereof, selected from a compound of the formula (lc’) Q R7 u/ \ [N 0‘0 0 \ wherein R1, R5, R7, U and Q are as defined above.

In another embodiment, the invention provides a compound of the a (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (Id) ul/Q\ R7 (“beI /N D 0 \R1 (Id), wherein R1, R5, R7, U and Q are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, ed from a compound of the formula (ld’) u/Q\ R N o E |\ / N \C} O N\ (Id’), wherein R1, R5, R7, U and Q are as defined above.

In another embodiment, the invention provides a nd of the formula (I) and/or a pharmaceutically able salt and/or a solvate thereof, selected from a compound of the formula (le) (”U030 N\ 2012/057554 wherein R1, R5, R6 and R7 are as defined above.

In another embodiment, the ion provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate f, selected from a compound of the formula (le’) NI \ {METRONO (Ie’), wherein R1, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (If) (“beI /N DO N\ (If), wherein R1, R5, R6 and R7 are as defined above.

In another embodiment, the invention es a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (lf’) EN O /N \[5 O N\ (Ir), wherein R1, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the a (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (lg) (lg), wherein X, R4, R5, R6 and R7 are as d above.

In another ment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (lg’) E015N o\E> ('9’), wherein X, R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a ceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (lh) NI \ [N350| /N D O N\ /R4 (lh), wherein X, R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention es a nd of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (lh’) N o E )6 10N/ O N\ /R4 (lh’), wherein X, R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a ceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (Ii) £20K, wherein R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a ceutically acceptable salt and/or a solvate thereof, selected from a compound of the formula (li’) (In, wherein R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate f, selected from a nd of the formula (lj) CUI}0 wherein R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention es a nd of the formula (I) and/or a pharmaceutically acceptable salt and/or a solvate thereof, selected from a compound of the a (lj’) [N16 ‘0N 0 / O N%R4 (In, wherein R4, R5, R6 and R7 are as defined above.

In another embodiment, the invention provides a compound of the ae (l), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('8’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), ('1') 0r (lj’) and/or a pharmaceutically able salt and/or a solvate thereof, wherein R4 is selected from C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, C1-Cg-alkoxy-C1-Cg-alkyl, cyano-C1-Cg- alkyl, N,N-di-C1-C4-alkyl-amino-C1-Cg-alkyl, C1-C4-alkyl-sulfonyl-C1-Cg-alkyl, phenyl, heterocyclyl, heterocyclyl-C1-Cg-alkyl, Cg-C12-cycloalkyl, heteroaryl, heteroaryl-C1-Cg-alkyl, C1-Cg-alkoxy, wherein C1-Cg-alkyl in N-C1-Cg-alkyl-amino and in N,N-di-C1-Cg-alkyl-amino may be unsubstituted or tuted by halogen, hydroxy or C1-C4-alkoxy, wherein Cs-C12-cycloalkyl in Cs-C12-cycloalkyl and in Cs-C12-cycloalkyl-C1-Cg-alkyl may be unsubstituted or substituted by halogen, hydroxy or C1-C4-alkoxy; wherein ‘heterocyclyl’ is a 3 to 7 membered saturated or partially unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, which is unsubstituted or substituted by 1-5 tuents selected from oxo, halogen, C1-Cg- alkyl, halo-C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1- Cg-alkyl, amino, g-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, 1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or C1-Cg-alkoxy-C1-Cg-alkyl- carbonyl; n ‘heterocyclyl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states, wherein ‘heteroaryl’ is a 3 to 7 membered fully unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, or lo[1,5- midine or imidazo[2,1-b]thiazole, each of which is unsubstituted or substituted by 1-5 substituents selected from halogen, C1-Cg-alkyl, halo-C1-Cg- alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1-Cg-alkyl, amino, N-C1-Cg-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo- alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or C1-Cg-alkoxy-C1-Cg-alkyl- yl; wherein ‘heteroaryl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states.

In another embodiment, the invention provides a compound of the formulae (l), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('8’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), ('1') 0r (lj’) and/or a pharmaceutically acceptable salt and/or a solvate f, wherein R4 is selected from C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, C1-Cg-alkoxy-C1-Cg-alkyl, cyano-C1-Cg- alkyl, N,N-di-C1-C4-alkyl-amino-C1-Cg-alkyl, C1-C4-alkyl-sulfonyl-C1-Cg-alkyl, phenyl, heterocyclyl, heterocyclyl-C1-Cg-alkyl, Cg-C12-cycloalkyl, heteroaryl, heteroaryl-C1-Cg-alkyl, C1-Cg-alkoxy, wherein C1-Cg-alkyl in N-C1-Cg-alkyl-amino and in N,N-di-C1-Cg-alkyl-amino may be unsubstituted or substituted by n, hydroxy or alkoxy, wherein Cs-C12-cycloalkyl in Cs-C12-cycloalkyl and in Cs-C12-cycloalkyl-C1-Cg-alkyl may be unsubstituted or substituted by halogen, y or C1-C4-alkoxy; wherein ‘heterocyclyl’ is selected from idinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, piperidinyl, tetrahydrothiopyranyl, morpholinyl, dioxanyl or opyranyl, each of which is unsubstituted or substituted by 1-3 substituents selected from oxo, C1-Cg-alkyl or C1-Cg-alkyl-carbonyl; wherein ‘heterocyclyl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states, wherein ‘heteroaryl’ is selected from imidazolyl, pyrazolyl, thiazolyl, oxazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, pyridyl, pyrimidinyl, pyrazinyl, lo[1,5- a]pyrimidine or o[2,1-b]thiazole, each of which is unsubstituted or substituted by 1-3 substituents selected from C1-Cg-alkyl, hydroxyl or amino; n ‘heteroaryl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states.

In r embodiment, the invention provides a compound of the formulae (I), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('8’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), (U) or (Ij’) and/or a pharmaceutically able salt and/or a solvate thereof, wherein R6 is selected from halogen, C1-C4-alkoxy, C1-C4-alkyI-sulfonyl or halo-C1-C4-alkoxy.

In another embodiment, the ion provides a compound of the formulae (l), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('6’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), ('1') 0r (Ij’) and/or a pharmaceutically acceptable salt and/or a solvate thereof, wherein R7 is selected from en, halogen, cyano, C1-C4-alkyl, 1-C4-alkyl or C1-C4- alkoxy.

In r embodiment, the invention provides a compound of the ae (l), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('8’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), ('1') 0r (Ij’) and/or a ceutically acceptable salt and/or a solvate thereof, wherein R4 is selected from C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, C1-Cg-alkoxy-C1-Cg-alkyl, cyano-C1-Cg- alkyl, N,N-di-C1-C4-alkyl-amino-C1-Cg-alkyl, C1-C4-alkyl-sulfonyl-C1-Cg-alkyl, phenyl, heterocyclyl, cycIyI-C1-Cg-alkyl, Cg-C12-cycloalkyl, heteroaryl, heteroaryI-C1-Cg-alkyl, C1-Cg-alkoxy, wherein C1-Cg-alkyl in N-C1-Cg-alkyl-amino and in N,N-di-C1-Cg-alkyl-amino may be unsubstituted or substituted by halogen, hydroxy or C1-C4-alkoxy, n Cs-C12-cycloalkyl in Cs-C12-cycloalkyl and in Cs-C12-cycloalkyI-C1-Cg-alkyl may be unsubstituted or substituted by halogen, hydroxy or C1-C4-alkoxy; wherein ‘heterocyclyl’ is a 3 to 7 membered saturated or partially unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, which is unsubstituted or substituted by 1-5 substituents selected from oxo, halogen, C1-Cg- alkyl, halo-C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1- Cg-alkyl, amino, N-C1-Cg-alkyl-amino, -C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo-C1-Cg-alkyI-carbonyl, hydroxy-C1-Cg-alkyI-carbony| or C1-Cg-alkoxy-C1-Cg-alkyl- carbonyl; wherein ‘heterocyclyl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states, wherein ‘heteroaryl’ is a 3 to 7 membered fu||y unsaturated monocyclic ring system containing 1 to 3 atoms selected from N, O or S, or pyrazo|o[1,5- a]pyrimidine or imidazo[2,1-b]thiazo|e, each of which is unsubstituted or substituted by 1-5 substituents selected from halogen, C1-Cg-alkyl, halo-C1-Cg- alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1-Cg-alkyl, amino, N-C1-Cg-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo- WO 93849 C1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or alkoxy-C1-Cg-alkyl- carbonyl; wherein ‘heteroaryl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be ed to various oxidation states; and R6 is selected from halogen, C1-C4-alkoxy, C1-C4-alkyl-sulfonyl or 1-C4-alkoxy.

In another embodiment, the invention provides a compound of the formulae (l), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('8’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), ('1') 0r (lj’) and/or a pharmaceutically acceptable salt and/or a solvate thereof, wherein R4 is selected from C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, alkoxy-C1-Cg-alkyl, cyano-C1-Cg- alkyl, N,N-di-C1-C4-alkyl-amino-C1-Cg-alkyl, C1-C4-alkyl-sulfonyl-C1-Cg-alkyl, phenyl, heterocyclyl, heterocyclyl-C1-Cg-alkyl, -cycloalkyl, heteroaryl, heteroaryl-C1-Cg-alkyl, C1-Cg-alkoxy, wherein C1-Cg-alkyl in N-C1-Cg-alkyl-amino and in N,N-di-C1-Cg-alkyl-amino may be unsubstituted or substituted by halogen, hydroxy or C1-C4-alkoxy, wherein Cs-C12-cycloalkyl in -cycloalkyl and in Cs-C12-cycloalkyl-C1-Cg-alkyl may be unsubstituted or tuted by halogen, hydroxy or C1-C4-alkoxy; wherein ‘heterocyclyl’ is a 3 to 7 membered saturated or partially unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, which is unsubstituted or substituted by 1-5 tuents selected from oxo, halogen, C1-Cg- alkyl, halo-C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1- Cg-alkyl, amino, N-C1-Cg-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo-C1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or C1-Cg-alkoxy-C1-Cg-alkyl- carbonyl; wherein ‘heterocyclyl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states, wherein ‘heteroaryl’ is a 3 to 7 ed fully unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, or pyrazolo[1,5- a]pyrimidine or imidazo[2,1-b]thiazole, each of which is unsubstituted or substituted by 1-5 substituents selected from halogen, C1-Cg-alkyl, halo-C1-Cg- alkyl, hydroxy-C1-Cg-alkyl, yl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1-Cg-alkyl, amino, g-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo- C1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or C1-Cg-alkoxy-C1-Cg-alkylcarbonyl ; wherein ‘heteroaryl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to various oxidation states; and R7 is selected from hydrogen, n, cyano, C1-C4-alkyl, halo-C1-C4-alkyl or C1- C4-alkoxy.

In another embodiment, the invention provides a compound of the formulae (l), (l’), (la), ('8’), (lb), (lb’) ('0), ('0’), (Id), (W), ('8), ('8’), (If), (lf’), ('9), ('9’), (lh), (lh’), (Ii), (W), ('1') 0r (lj’) and/or a pharmaceutically acceptable salt and/or a solvate thereof, wherein R4 is selected from C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, C1-Cg-alkoxy-C1-Cg-alkyl, cyano-C1-Cg- alkyl, N,N-di-C1-C4-alkyl-amino-C1-Cg-alkyl, alkyl-sulfonyl-C1-Cg-alkyl, phenyl, heterocyclyl, heterocyclyl-C1-Cg-alkyl, Cg-C12-cycloalkyl, heteroaryl, heteroaryl-C1-Cg-alkyl, C1-Cg-alkoxy, wherein alkyl in N-C1-Cg-alkyl-amino and in N,N-di-C1-Cg-alkyl-amino may be unsubstituted or substituted by halogen, hydroxy or alkoxy, wherein Cs-C12-cycloalkyl in Cs-C12-cycloalkyl and in Cs-C12-cycloalkyl-C1-Cg-alkyl may be unsubstituted or substituted by halogen, hydroxy or C1-C4-alkoxy; wherein ‘heterocyclyl’ is a 3 to 7 membered saturated or partially unsaturated monocyclic ring system containing 1 to 3 heteroatoms ed from N, O or S, which is unsubstituted or substituted by 1-5 substituents selected from oxo, halogen, C1-Cg- alkyl, halo-C1-Cg-alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1- yl, amino, g-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo-C1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or alkoxy-C1-Cg-alkyl- carbonyl; n ‘heterocyclyl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 atoms can also optionally be oxidized to various oxidation states, wherein ‘heteroaryl’ is a 3 to 7 membered fully unsaturated monocyclic ring system containing 1 to 3 heteroatoms selected from N, O or S, or pyrazolo[1,5- a]pyrimidine or imidazo[2,1-b]thiazole, each of which is unsubstituted or substituted by 1-5 substituents selected from n, C1-Cg-alkyl, 1-Cg- alkyl, hydroxy-C1-Cg-alkyl, hydroxyl, C1-Cg-alkoxy, C1-Cg-alkoxy-C1-Cg-alkyl, amino, N-C1-Cg-alkyl-amino, N,N-di-C1-Cg-alkyl-amino, C1-Cg-alkyl-carbonyl, halo- C1-Cg-alkyl-carbonyl, hydroxy-C1-Cg-alkyl-carbonyl or C1-Cg-alkoxy-C1-Cg-alkyl- carbonyl; wherein ‘heteroaryl’ can be attached at a heteroatom or a carbon atom and where the N and/or 8 heteroatoms can also optionally be oxidized to s oxidation states; R6 is selected from halogen, C1-C4-alkoxy, C1-C4-alkyl-sulfonyl or halo-C1-C4-alkoxy and R7 is selected from hydrogen, halogen, cyano, C1-C4-alkyl, halo-C1-C4-alkyl or C1- C4-alkoxy.

In another ment individual compounds according to the invention are those listed in the Examples section below.

As used herein, the term “an optical isomer” or “a stereoisomer” refers to any of the various stereo isomeric urations which may exist for a given compound of the present invention and includes geometric isomers. It is understood that a substituent may be attached at a chiral center of a carbon atom. The term "chiral" refers to molecules which have the ty of non-superimposability on their mirror image r, while the term "achiral" refers to molecules which are superimposable on their mirror image partner. ore, the invention includes enantiomers, diastereomers or racemates of the compound. “Enantiomers” are a pair of stereoisomers that are non- superimposable mirror images of each other. A 1:1 mixture of a pair of omers is a "racemic” mixture. The term is used to designate a racemic mixture where appropriate.

"Diastereoisomers” are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other. The absolute stereochemistry is specified according to the Cahn- lngold- Prelog R-S system. When a compound is a pure enantiomer the chemistry at each chiral carbon may be specified by either R or 8.

Resolved compounds whose absolute configuration is unknown can be designated (+) or (-) depending on the direction o— or levorotatory) which they rotate plane polarized light at the wavelength of the sodium D line. Certain compounds described herein n one or more asymmetric s or axes and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)— or (S)—.

Depending on the choice of the starting materials and procedures, the compounds can be present in the form of one of the possible isomers or as mixtures thereof, for example as pure optical isomers, or as isomer mixtures, such as racemates and diastereoisomer mixtures, depending on the number of asymmetric carbon atoms. The present invention is meant to include all such possible isomers, including racemic mixtures, diasteriomeric mixtures and lly pure forms. lly active (R)— and (S)— isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. If the compound contains a double bond, the substituent may be E or Z uration. If the compound contains a tituted cycloalkyl, the cycloalkyl substituent may have a cis- or trans-configuration. All tautomeric forms are also intended to be included.

As used , the terms “salt” or “salts” refers to an acid addition or base addition salt of a compound of the ion. “Salts” include in particular “pharmaceutical acceptable salts”. The term “pharmaceutically acceptable salts” refers to salts that retain the biological effectiveness and properties of the compounds of this invention and, which typically are not biologically or othenNise undesirable. In many cases, the compounds of the present invention are capable of forming acid and/or base salts by virtue of the presence of amino and/or yl groups or groups similar thereto.

Pharmaceutically able acid addition salts can be formed with inorganic acids and organic acids, e.g., acetate, aspartate, benzoate, besylate, bromide/hydrobromide, onate/carbonate, bisulfate/sulfate, camphorsulfonate, chloride/hydrochloride, chlortheophyllonate, citrate, ethandisulfonate, fumarate, gluceptate, gluconate, glucuronate, hippurate, hydroiodide/iodide, isethionate, lactate, lactobionate, laurylsulfate, malate, maleate, malonate, mandelate, mesylate, methylsulphate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, polygalacturonate, propionate, stearate, succinate, alicylate, tartrate, tosylate and trifluoroacetate salts. lnorganic acids from which salts can be derived include, for example, hydrochloric acid, romic acid, ic acid, nitric acid, phosphoric acid, and the like. c acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, sulfonic acid, toluenesulfonic acid, sulfosalicylic acid, and the like.

Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. lnorganic bases from which salts can be derived e, for example, ammonium salts and metals from columns | to XII of the periodic table. In certain embodiments, the salts are derived from sodium, potassium, um, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, ium, , calcium and ium salts.

Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like. Certain organic amines include isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine and tromethamine.

The ceutically acceptable salts of the present invention can be synthesized from a basic or acidic moiety, by conventional al methods. Generally, such salts can be prepared by ng free acid forms of these compounds with a iometric amount of the appropriate base (such as Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate or the like), or by reacting free base forms of these compounds with a stoichiometric amount of the appropriate acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two. Generally, use of non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile is desirable, where practicable. Lists of additional suitable salts can be found, e.g., in “Remington's Pharmaceutical Sciences”, 20th ed., Mack Publishing Company, Easton, Pa., (1985); and in “Handbook of Pharmaceutical Salts: Properties, Selection, and Use” by Stahl and Wermuth (Wiley-VCH, Weinheim, y, 2002).

Any formula given herein is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. lsotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of es that can be incorporated into compounds of the ion e isotopes of hydrogen, carbon, nitrogen, oxygen, orous, ne, and chlorine, such as 2H, 3H, 11C, 13C, 14C, 15N, 18F 31P, 32P, 358, 36Cl, 125l respectively. The invention includes various isotopically labeled compounds as defined herein, for example those into which radioactive isotopes, such as 3H and 14C, or those into which non-radioactive isotopes, such as 2H and 13C are present. Such isotopically labelled compounds are useful in metabolic studies (with 14C), reaction kinetic studies (with, for example 2H or 3H), detection or imaging techniques, such as positron emission tomography (PET) or single- photon emission computed tomography (SPECT) including drug or ate tissue distribution , or in ctive treatment of patients. In particular, an 18F or labeled compound may be ularly desirable for PET or SPECT studies. lsotopically-labeled compounds of formula (I) can generally be prepared by conventional ques known to those skilled in the art or by processes analogous to those described in the accompanying Examples and Preparations using an appropriate ically-labeled reagent in place of the non-labeled reagent previously employed. 2012/057554 Further, tution with r isotopes, particularly deuterium (i.e., 2H or D) may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements or an improvement in therapeutic index. It is tood that deuterium in this context is regarded as a substituent of a compound of the formula (I). The concentration of such a heavier isotope, specifically deuterium, may be defined by the isotopic enrichment factor. The term "isotopic enrichment factor" as used herein means the ratio between the isotopic abundance and the l abundance of a specified isotope. If a substituent in a compound of this invention is denoted deuterium, such compound has an isotopic ment factor for each ated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 (60% deuterium oration), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% ium incorporation).

Pharmaceutically acceptable solvates in accordance with the invention include those n the solvent of crystallization may be isotopically substituted, e.g. D20, d6- acetone, DMSO-d6.

Compounds of the invention, i.e. compounds of formula (I) that contain groups capable of acting as donors and/or acceptors for hydrogen bonds may be capable of g co- crystals with suitable co-crystal formers. These co-crystals may be prepared from nds of formula (I) by known stal forming procedures. Such procedures include grinding, heating, co-subliming, co-melting, or contacting in solution compounds of formula (I) with the co-crystal former under crystallization conditions and isolating co- ls y formed. Suitable stal formers include those described in WO 2004/078163. Hence the invention further provides co-crystals comprising a compound of formula (I).

As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, vatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring , dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329).

Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

The term "a eutically effective amount" of a compound of the present invention refers to an amount of the compound of the present invention that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a n activity, or ameliorate symptoms, alleviate ions, slow or delay disease progression, or prevent a disease, etc. In one non-limiting embodiment, the term “a therapeutically effective amount” refers to the amount of the compound of the present invention that, when administered to a subject, is effective to (1) at least partially alleviate, t, prevent and/or ameliorate a condition, or a disorder or a disease (i) mediated by P|3K or (ii) ated with PI3K activity, or (iii) characterized by activity (normal or abnormal) of PI3K or (2) reduce or inhibit the activity of PI3K or (3) reduce or inhibit the expression of PI3K. In another non-limiting embodiment, the term “a therapeutically effective amount” refers to the amount of the nd of the present invention that, when administered to a cell, or a tissue, or a llular biological material, or a medium, is effective to at least partially reducing or inhibiting the activity of PI3K; or at least partially reducing or inhibiting the expression of PI3K. The meaning of the term “a therapeutically effective amount” as illustrated in the above embodiment for P|3K also applies by the same means to any other relevant proteins/peptides/enzymes.

As used herein, the term “subject” refers to an animal. Typically the animal is a mammal. A subject also refers to for example, primates (e.g., humans, male or female), cows, sheep, goats, horses, dogs, cats, s, rats, mice, fish, birds and the like. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.

As used herein, the term “inhibit”, ition" or “inhibiting” refers to the reduction or suppression of a given condition, symptom, or disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process.

As used herein, the term “treat”, “treating" or ment" of any disease or disorder refers in one embodiment, to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms f). In another ment “treat”, "treating" or "treatment" refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet r embodiment, ”, "treating" or WO 93849 "treatment" refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical ter), or both. In yet another embodiment, “treat”, "treating" or "treatment" refers to preventing or delaying the onset or development or progression of the disease or disorder.

As used herein, a t is “in need of’ a treatment if such subject would benefit biologically, medically or in quality of life from such ent.

As used herein, the term "a, an,” "the” and similar terms used in the context of the present invention (especially in the t of the claims) are to be construed to cover both the singular and plural unless othenNise indicated herein or clearly contradicted by the context.

All methods described herein can be performed in any suitable order unless othenNise indicated herein or othenNise clearly contradicted by context. The use of any and all examples, or exemplary ge (e.g. "such as”) provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed.

Any asymmetric atom (e.g., carbon or the like) of the compound(s) of the present ion can be present in racemic or enantiomerically enriched, for example the (R)—, (S)— or (R,S)— configuration. In certain embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R)— or (8)- configuration. tuents at atoms with unsaturated double bonds may, if possible, be present in cis- (Z)— or trans- (E)- form.

Accordingly, as used herein a compound of the present invention can be in the form of one of the possible isomers, rotamers, atropisomers, tautomers or mixtures thereof, for example, as substantially pure ric (cis or trans) isomers, diastereomers, optical isomers (antipodes), tes or mixtures thereof.

Any resulting mixtures of isomers can be separated on the basis of the physicochemical differences of the constituents, into the pure or ntially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and/or onal crystallization.

Any resulting racemates of final products or intermediates can be resolved into the optical antipodes by known methods, e.g., by separation of the diastereomeric salts thereof, obtained with an optically active acid or base, and liberating the optically active acidic or basic compound. In particular, a basic moiety may thus be employed to resolve the nds of the present invention into their l antipodes, e.g., by fractional crystallization of a salt formed with an optically active acid, e.g., tartaric acid, dibenzoyl tartaric acid, diacetyl tartaric acid, di-0,0’-p-toluoyl tartaric acid, mandelic acid, malic acid or camphor—10-sulfonic acid. Racemic products can also be resolved by chiral chromatography, e.g., high pressure liquid tography (HPLC) using a chiral adsorbent.

Furthermore, the compounds of the present invention, including their salts, can also be obtained in the form of their hydrates, or include other ts used for their crystallization.

The compounds of the present invention may inherently or by design form solvates with pharmaceutically acceptable ts (including water); therefore, it is ed that the invention embrace both solvated and unsolvated forms. The term "solvate" refers to a molecular complex of a compound of the present invention (including pharmaceutically acceptable salts thereof) with one or more solvent molecules. Such solvent les are those commonly used in the pharmaceutical art, which are known to be innocuous to the recipient, e.g., water, ethanol, and the like. The term "hydrate" refers to the complex where the solvent molecule is water.

The nds of the present invention, including salts, hydrates and solvates thereof, may inherently or by design form polymorphs.

Typically, the compounds of formula (I) can be ed according to the methods provided infra.

WO 93849 SchemeA R30 w \ 5 1 21 OH Act2\ N‘PG R5 Y 1) step e) (B) R55 a) 2) step b) Q R u/ \ R5 R30 Q R / R UI \ R5 H XI N Y \ / | w R5 (D) / / V N R5 N O R5 0 \ 5 PG1 \ \PGZ R5 5 l (C) R5 0 Q R7 u/ \ / b) 1) step f) X' UI/ \ 2) step a) (D) / R30 R 30 W R E N \N‘PG Act2 /W N (B) R5 ° \PG1 WO 93849 In one embodiment, the ion relates to a process for manufacturing a compound of formula (I) (Method A) comprising steps a, b, c, d.

The compound of formula (I) is obtained via the step c of deprotecting PG1 from the compound of formula (F), wherein PG1 represents a suitable protecting group, such as a Boc group, and the other substituents are as defined above, Q R u/ \ / 5 R R30 30 N Y R5 \ I w R5 /V N/ R5 0 \ followed by coupling reaction step d with R1-Act1, step c1: Where R1 is -C(O)—R4, )2-R4, wherein R4 is defined above, and Act1 represents an ting group or a hydroxy group: The coupling reaction is an amide, urea, carbamic ester or amid formation. There are many known ways of preparing amides, urea carbamic esters or sulfonamids. The coupling reaction step can be carried out with Act1 representing an activating group, preferably in a one step procedure or with Act1 representing a hydroxy group either involving a one or two step procedure. For examples of amide bond formations, see Mantalbetti, C.A.G.N and Falque, V., Amide bond formation and peptide coupling, Tetrahedron, 2005, 61(46), pp10827-10852 and references cited therein. For examples of urea synthesis, see Sartori, G.; Maggi, R. c and cyclic ureas, Science of Synthesis , 18, 665-758; Gallou, Isabelle.

Unsymmetrical ureas Synthetic methodologies and application in drug design, Organic Preparations and Procedures International (2007), 39(4), 355-383. For examples of carbamate synthesis see Adams, ; Baron, Frank A. Esters of carbamic acid, Chemical Reviews (1965), 65(5), 567-602. The examples provided herein are thus not intended to be exhaustive, but merely illustrative; step c2: Where R1 is selected from , pyridyl, pyrimidinyl, nyl, zinyl, 1,2,3-triazinyl, 1,2,4-triazinyl or 1,3,5-triazinyl and Act1 represents halogen, particularly iodo or bromo: The coupling reaction is carried out in the presence of an amine base such as N,N-diisopropylethylamine. The reaction is carried out in the presence of an organic solvent or without a solvent under microwave heating. atively, the reaction is carried out under customary Buchwald-Hartwig conditions such as the conditions described above. The reaction is preferably carried out under an inert gas such as nitrogen or argon.

The compound of formula (F) is ed via the step b of coupling the nd of formula (C), wherein PG1 represents a suitable protectiong group, such as a Boc, and the other substituents are as defined above, x 2: with a compound of formula (D), wherein X’ ents halogen, such as iodo or bromo and the other substituents are as defined above, Q R7 under ary Buchwald-Hartwig ions using a suitable Pd catalyst/ligand combination such as Pd2(dba)3/2-(dicyclohexylphosphino)bipheny| or Pd2(dba)3/2- dicyclohexylphosphino-2’,4’,6’-triisopropyl-biphenyl, Pd2(dba)3/X-Phos, Pd2(dba)3/(rac)- BINAP, Pd(OAc)2/(rac)-B|NAP or bis(tri-t-buty|phosphine)palladium and a suitable base, such as NaOtBu, Cs2003 or K3PO4 and organic solvent such as toluene, dioxane or THF. The reaction is stirred at a temperature of approximately 60-140°C, for example at 100°C to 110°C and is optionally performed in a microwave reactor. The reaction is preferably carried out under an inert gas such as nitrogen or argon.

The compound of formula (C) is ed via the step a of coupling the compound of formula (A), wherein the substituents are as defined above with a compound of formula (B), wherein PG1 represents a suitable protectiong group, such as a Boc group and Act2 is an ting group or H, and the other substituents are as defined above, R5 H N OH R5 \ R5 /v R5 0 R30 W 2 N~PG1 Act\Y step a1: Where Y is O and Act2 represents an activating group such as a te: The reaction takes place in the ce of a suitable base such as sodium hydroxide (NaH), K2C03 or potassium t-butoxide (tBuOK) in a suitable polar organic solvent such as DMF, THF, yltetrahydrofuran or e at a suitable temperature such as rt - 100°C. step a2: Where Y is O and Act2 represents H: The reaction takes place using customary Mitsunobu conditions, for example using Ph3P and DEAD in organic solvent such as THF under inert gas conditions at ed temperature such as 70°C. step a3: Where Y is NH and and Act2 represents H: A base promoted phosphonium coupling reaction is employed, whereby a compound of the formula (A) in a suitable solvent such as acetonitrile is reacted with a phosphonium salt such as benzotriazol yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP) in the presence of a base such as 1,8-diazabicyclo[5.4.0]undecene (DBU) followed by on of a compound of the formula (B). The reaction e is stirred at a temperature of 20°C to 100°C.

In another embodiment, the invention relates to a process for manufacturing a compound of formula (I) (Method A—a) sing steps a and b as d above for Method A, using a compound of formula (B) wherein PG1 represents R1.

In another embodiment, the invention relates to a process for cturing a compound of formula (I) (Method B) comprising steps e, b, f, a, c and d.

The compound of formula (I) is obtained via the steps c and d as described above for Method A from the compound of formula (F).

The compound of formula (F) is obtained via the step f of deprotecting P62 from the compound of formula (E), wherein P62 is a suitable protecting group, such as a silyl protecting group, and the other substituents are as defined above Q R7 u/ \ N o R5 \ \PGZ R5 /v R5 0 followed by coupling reaction step a, as described above for Method A, with the compound of formula (B).

The compound of formula (E) is obtained via the step e of protecting the compound of formula (A) with a le protecting group PGZ, ed by from the compound of formula (E), wherein P62 is a suitable protecting group, such as a silyl protecting group, followed by coupling reaction step b, as described above for Method A with the compound of formula (D).

In another embodiment, the invention relates to a process for manufacturing a compound of formula (I) (Method B-a) comprising steps e, b and f as d above for Method B, using a nd of formula (B) wherein PG1 represents R1.

In another embodiment, the invention relates to a process for manufacturing a compound of formula (I) (Method C).using a compound of formula (A), wherein X” represents halogen and the other substituents are as defined above s H E N x" R \ R5 /v R5 0 (A') comprising steps b, c and d as defined above for Method B, using a compound of a (B) and a modified step a4: step a4: Where Y is NH and Act2 is H: The reaction takes place in the presence of a suitable base such as for example potassium carbonate or a suitable amine base such as triethylamine or N,N-diisopropylethylamine at elevated temperature such as 100°C to 140°C. atively, the reaction is carried out under customary Buchwald-Hartwig conditions such as the conditions described above. The reaction is preferably d out under an inert gas such as nitrogen or argon.

In another embodiment, the invention relates to a s for manufacturing a compound of formula (I) (Method C-a) comprising steps b, a4, c and d as defined above for Method B1, using a compound of formula (B) wherein PG1 represents R1.

The term “activating group” as used herein relates to a group that can activate a carboxylic acid, carbonic acid or carbamic acid derivative, for ng with an amine moiety to form an amide, urea or carbamic ester moiety, tively (Act1) or to a group that can activate a hydroxy group for coupling with anothe hydroxy moiety to form an ether (Act2).

Groups that can activate a carboxylic acid, carbonic acid or carbamic acid derivative, for coupling with an amine moiety to form an amide, urea or carbamic ester moiety are chlorides, or groups resulting from the reaction of the acid derivative with an activating agent. Suitable activating agents are known to the skilled person, examples of such activating ts are carbodiimide derivatives, pentafluorophenyl ester derivatives, triazole derivatives, imidazole tives.

Groups that can activate a hydroxy group for coupling with anothe hydroxy moiety to form an ether are groups are known to the skilled person, examples of such activating groups are mesylates and tosylates.

The term “protecting group” as used herein relates to a group that protects a onal group which is present in the starting materials and is not ed to take part in the reaction. In additional process steps, carried out as desired, functional groups of the starting compounds which should not take part in the reaction may be present in unprotected form or may be protected for example by one or more protecting groups.

The protecting groups are then wholly or partly removed according to one of the known methods. Protecting groups, and the manner in which they are introduced and removed are described, for example, in "Protective Groups in Organic Chemistry", Plenum Press, London, New York 1973, and in "Methoden der organischen Chemie", -Weyl, 4th edition, Vol. 15/1, Thieme-Verlag, Stuttgart 1974 and in Theodora W. Greene, "Protective Groups in Organic Synthesis", John Wiley & Sons, New York 1981. A characteristic of protecting groups is that they can be removed readily, i.e. without the occurrence of undesired ary reactions, for example by solvolysis, reduction, ysis or atively under physiological conditions.

The invention further includes any variant of the present ses, in which an intermediate product obtainable at any stage thereof is used as starting material and the remaining steps are carried out, or in which the starting materials are formed in situ under the on conditions, or in which the on components are used in the form of their salts or optically pure material.

Compounds of the invention and intermediates can also be converted into each other according to methods generally known to those skilled in the art.

Intermediates and final products can be worked up and/or purified according to standard methods, e.g. using chromatographic methods, distribution methods, (re-) llization, and the like.

The following applies in general to all processes mentioned herein before and hereinafter.

All the above-mentioned process steps can be carried out under reaction conditions that are known to those skilled in the art, including those mentioned specifically, in the absence or, arily, in the ce of solvents or diluents, including, for example, solvents or diluents that are inert s the reagents used and dissolve them, in the absence or presence of catalysts, condensation or lizing agents, for example ion exchangers, such as cation exchangers, e.g. in the H+ form, depending on the nature of the reaction and/or of the reactants at reduced, normal or elevated temperature, for example in a temperature range of from about -100 0C to about 190 0C, including, for example, from approximately -80 0C to approximately 150 0C, for example at from -80 to -60 0C, at room temperature, at from -20 to 40 0C or at reflux ature, under atmospheric re or in a closed vessel, where appropriate under pressure, and/or in an inert atmosphere, for example under an argon or nitrogen atmosphere.

At all stages of the reactions, mixtures of isomers that are formed can be ted into the individual isomers, for example diastereoisomers or enantiomers, or into any desired mixtures of isomers, for example racemates or mixtures of diastereoisomers, for example analogously to the s described herein above.

The solvents from which those solvents that are suitable for any particular on may be selected e those mentioned specifically or, for example, water, esters, such as lower alkyl-lower ates, for example ethyl acetate, ethers, such as aliphatic ethers, for example diethyl ether, or cyclic ethers, for example tetrahydrofuran or dioxane, liquid aromatic hydrocarbons, such as e or toluene, alcohols, such as methanol, ethanol or 1- or 2-propanol, nitriles, such as acetonitrile, halogenated hydrocarbons, such as methylene chloride or chloroform, acid amides, such as dimethylformamide or dimethyl acetamide, bases, such as heterocyclic nitrogen bases, for example pyridine or N-methylpyrrolidinone, carboxylic acid anhydrides, such as lower alkanoic acid anhydrides, for example acetic anhydride, cyclic, linear or branched hydrocarbons, such as cyclohexane, hexane or isopentane, methycyclohexane, or mixtures of those solvents, for example aqueous solutions, unless othenNise indicated in the description of the ses. Such t mixtures may also be used in working up, for example by chromatography or partitioning.

The compounds, including their salts, may also be obtained in the form of hydrates, or their crystals may, for example, include the solvent used for crystallization. Different lline forms may be present.

The invention relates also to those forms of the process in which a nd obtainable as an intermediate at any stage of the process is used as starting material and the remaining process steps are carried out, or in which a ng material is formed under the on conditions or is used in the form of a derivative, for example in a protected form or in the form of a salt, or a compound obtainable by the process according to the invention is produced under the process conditions and processed further in situ.

In another aspect, the present invention provides a pharmaceutical composition comprising a compound of the present invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. The ceutical composition can be formulated for particular routes of administration such as oral administration, parenteral administration, and rectal administration, etc. In addition, the pharmaceutical compositions of the present invention can be made up in a solid form (including t limitation capsules, s, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, sions or emulsions). The pharmaceutical compositions can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifers and buffers, etc. lly, the pharmaceutical compositions are tablets or n capsules comprising the active ingredient together with a) diluents, e.g., lactose, dextrose, e, ol, sorbitol, cellulose and/or e; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol; for tablets also c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone; if desired d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and/or e) absorbents, colorants, flavors and sweeteners.

Tablets may be either film coated or enteric coated ing to methods known in the art.

Suitable compositions for oral administration include an effective amount of a compound of the invention in the form of tablets, lozenges, aqueous or oily suspensions, dispersible s or granules, emulsion, hard or soft capsules, or syrups or s. Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of sweetening agents, flavoring , coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. s may contain the active ingredient in admixture with nontoxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.

These excipients are, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, , gelatin or acacia; and ating agents, for example magnesium stearate, stearic acid or talc. The tablets are uncoated or coated by known techniques to delay disintegration and absorption in the intestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl earate or glyceryl distearate can be employed. Formulations for oral use can be presented as hard n capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules n the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil.

Certain able compositions are aqueous isotonic solutions or suspensions, and suppositories are ageously prepared from fatty ons or suspensions. Said compositions may be ized and/or contain adjuvants, such as preserving, izing, wetting or emulsifying agents, on ers, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.

Said compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1-75%, or contain about 1-50%, of the active ingredient.

Suitable compositions for transdermal application include an effective amount of a compound of the invention with a suitable carrier. Carriers suitable for transdermal delivery include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host. For example, transdermal devices are in the form of a bandage comprising a backing member, a oir containing the compound optionally with carriers, optionally a rate controlling r to deliver the nd of the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin.

Suitable compositions for topical application, e.g., to the skin and eyes, include aqueous solutions, suspensions, ointments, creams, gels or sprayable ations, e.g., for delivery by aerosol or the like. Such topical delivery systems will in particular be appropriate for dermal application, e.g., for the treatment of skin cancer, e.g., for prophylactic use in sun creams, lotions, sprays and the like. They are thus particularly suited for use in topical, including cosmetic, formulations well-known in the art. Such may contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives.

As used herein a topical application may also pertain to an inhalation or to an intranasal application. They may be conveniently delivered in the form of a dry powder (either alone, as a mixture, for example a dry blend with lactose, or a mixed component particle, for e with phospholipids) from a dry powder inhaler or an aerosol spray presentation from a rised container, pump, spray, atomizer or nebuliser, with or without the use of a suitable propellant.

The t invention further provides anhydrous pharmaceutical compositions and dosage forms comprising the compounds of the present invention as active ingredients, since water may facilitate the degradation of certain compounds.

Anhydrous pharmaceutical compositions and dosage forms of the invention can be prepared using anhydrous or low moisture containing ingredients and low moisture or low humidity conditions. An anhydrous pharmaceutical composition may be prepared and stored such that its anhydrous nature is maintained. Accordingly, ous compositions are packaged using materials known to prevent exposure to water such that they can be included in suitable formulary kits. Examples of le packaging include, but are not limited to, hermetically sealed foils, plastics, unit dose ners (e. g., vials), r packs, and strip packs.

The ion further provides pharmaceutical compositions and dosage forms that comprise one or more agents that reduce the rate by which the compound of the present invention as an active ingredient will ose. Such agents, which are ed to herein as "stabilizers,” include, but are not d to, antioxidants such as ascorbic acid, pH buffers, or salt buffers, etc.

The compounds of formula I in free form or in salt form, exhibit valuable pharmacological properties, e.g. P|3K modulating properties, e.g. as indicated in in vitro and in vivo tests as provided in the next sections, and are therefore indicated for therapy or for use as research chemicals, e.g. as tool compounds.

Compounds of the ion may be useful in the treatment of conditions, diseases or ers including disease or infection associated immunopathology in which one or more of the functions of B cells such as antibody production, antigen presentation, cytokine production or lymphoid organogenesis are abnormal or are undesirable including rheumatoid arthritis, pemphigus vulgaris and related diseases, idiopathic thrombocytopenia purpura, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, n‘s syndrome, mune hemolytic anemia, ANCA- associated vasculitides, cryoglobulinemia, thrombotic thrombocytopenic purpura, chronic mune urticaria, allergy (atopic dermatitis, contact dermatitis, allergic rhinitis), goodpasture's me, AMR (antibody-mediated transplant rejection), B cell-mediated hyperacute, acute and chronic transplant rejection and cancers of haematopoietic origin including but not limited to multiple myeloma; acute myelogenous leukemia; chronic myelogenous leukemia; lymphocytic leukemia; myeloid leukemia; non-Hodgkin lymphoma; lymphomas; themia vera; essential thrombocythemia; myelofibrosis with d asia; and Walden stroem disease.

The invention includes methods of treating conditions, diseases or disorders in which one or more of the functions of neutrophils, such as superoxide release, stimulated exocytosis, or chemoatractic migration are al or are undesirable including rheumatoid arthritis, sepsis, pulmonary or resporatory ers such as asthma, inflammatory dermatoses such as psoriasis, as well as in e or infection associated immunopathology and others.

The invention includes methods of treating conditions, diseases or disorders in which one or more of the functions of basophil and mast cells such as chemoatractic migration or allergen-lgE-mediated ulation are abnormal or are undesirable including ic diseases c dermatitis, contact dermatitis, allergic rhinitis) as well as other ers such as COPD, asthma or ema.

The invention includes methods of treating conditions, diseases or disorders in which one or more of the functions of T cells such as cytokine production or cell-mediated cytotoxicity abnormal or are undesirable including rheumatoid arthritis, multiple sis, acute or chronic rejection of cell tissue or organ grafts or s of haematopoietic origin as well as in e or infection associated immunopathology. r, the invention includes s of treating neurodegenerative diseases, cardiovascular es and platelet aggregation.

Further, the invention includes methods of treating skin diseases such as porphyria cutanea tarda, polymorphous light eruption, omyositis, solar urticaria, oral lichen planus, panniculitis, scleroderma, urticarial vasculitis.

Further, the ion includes methods of treating chronic matory diseases such as sarcoidosis, granuloma annulare.

In other embodiments, the condition or er (e.g. Pl3K-mediated) is selected from the group consisting of: polycythemia vera, essential thrombocythemia, myelofibrosis with myeloid metaplasia, asthma, COPD, ARDS, Loffler's syndrome, eosinophilic pneumonia, parasitic (in particular metazoan) infestation (including al eosinophilia), bronchopulmonary aspergillosis, polyarteritis nodosa (including Churg-Strauss syndrome), eosinophilic granuloma, eosinophil-related disorders affecting the always occasioned by drug-reaction, psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis iformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus matosus, pemphigus, epidermolysis bullosa acquisita, autoimmune haematogical disorders (e.g. haemolytic anaemia, ic anaemia, pure red cell anaemia and idiopathic thrombocytopenia), systemic lupus erythematosus, polychondritis, scleroderma, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia , -Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g. ulcerative colitis and Crohn's e), endocrine opthalmopathy, Grave's disease, sarcoidosis, itis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), interstitial lung fibrosis, tic arthritis, glomerulonephritis, cardiovascular diseases, atherosclerosis, hypertension, deep venous thrombosis, stroke, myocardial infarction, unstable angina, thromboembolism, pulmonary embolism, thrombolytic diseases, acute arterial ischemia, peripheral thrombotic occlusions, and coronary artery disease, reperfusion injuries, retinopathy, such as diabetic retinopathy or hyperbaric oxygen-induced retinopathy, and conditions characterized by elevated intraocular pressure or secretion of ocular aqueous humor, such as glaucoma.

In another embodiment, the compounds of the present invention are useful in the treatment, tion, or amelioration of autoimmune disease and of inflammatory conditions, in particular inflammatory conditions with an aetiology including an autoimmune component such as arthritis (for example rheumatoid tis, arthritis chronica progrediente and arthritis deformans) and tic diseases, including inflammatory conditions and rheumatic diseases involving bone loss, inflammatory pain, spondyloarhropathies including ankolsing spondylitis, Reiter syndrome, reactive arthritis, psoriatic arthritis, and enterophathics arthritis, hypersensitivity ding both airways hypersensitivity and dermal hypersensitivity) and allergies. Specific auto-immune diseases for which antibodies of the invention may be employed include autoimmune haematological disorders (including e.g. hemolytic anaemia, ic anaemia, pure red cell anaemia and idiopa-thic thrombocytopenia), acquired hemophilia A, cold agglutinin disease, cryoglobulinemia, thrombotic thrombocytopenic a, Sjogren’s me, systemic lupus erythematosus, inflammatory muscle disorders, polychondritis, sclerodoma, anti-neutrophil cytoplasmic antibody- associated vasculitis, lgM mediated neuropathy, opsoclonus myoclonus syndrome, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Steven-Johnson syndrome, pemphigus vulgaris, pemphigus foliacius, idio-pathic sprue, mune inflammatory bowel disease (including e.g. tive colitis, Crohn's disease and Irritable Bowel Syndrome), endocrine lmopathy, Graves’ disease, sarcoidosis, multiple sclerosis, neuromyelitis optica, y y cirrhosis, juvenile diabetes (diabetes mellitus type I), uveitis (anterior, intermediate and posterior as well as panuveitis), keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial lung fibrosis, psoriatic arthritis and glomerulonephritis (with and without nephrotic syndrome, e.g. ing idiopathic nephro-tic syndrome or minimal change nephropathy), tumors, inflammatory disease of skin and cornea, myositis, loosening of bone implants, metabolic disorders, such as sclerosis, diabetes, and dislipidemia.

In another embodiment, the compounds of the present invention are useful in the treatment of conditions or disorders ed from the group consisting of, primary cutaneous B-cell lymphoma, immunobullous disease, gus vulgaris, pemphigus foliaceus, endemic form of ian pemphigus (Fogo selvagem), paraneoplastic pemphigus, bullous pemphigoid, mucous ne pemphigoid, epidermolysis bullosa acquisita, chronic graft versus host disease, dermatomyositis, systemic lupus erythematosus, vasculitis, small vessel vasculitis, hypocomplementemic urticarial vasculitis, antineutrophil cytoplasmic antibody-vasculitis, cryoglobulinemia, Schnitzler syndrome, Waldenstrom’s macroglobulinemia, angioedema, vitiligo, systemic lupus erythematosus, idiopathic ocytopenic purpura, le sclerosis, cold agglutinin 2012/057554 disease, autoimmune tic anemia, antineutrophil cytoplasmic antibody— associated vasculitis, graft versus host disease, cryoglobulinemia and thrombotic thrombocytopenic.

Thus, as a further embodiment, the present ion provides the use of a compound of formulae (I), (l’), (la), (la’), (lb), (lb’) (lc), (lc’), (ld), (ld’), (le), (le’), (If), (If), (lg), (lg’), (lh), (lh’), (li), (li’), (lj) or (lj’) in therapy. In a further embodiment, the y is selected from a disease which may be treated by inhibition of PI3K. In another embodiment, the disease is selected from the afore-mentioned list, suitably from mune disorders, inflammatory diseases, allergic diseases, ainNay diseases, such as asthma and COPD, transplant rejection; antibody production, antigen presentation, cytokine production or lymphoid organogenesis are abnormal or are undesirable including rheumatoid arthritis, gus vulgaris, idiopathic thrombocytopenia purpura, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, n‘s syndrome, autoimmune hemolytic anemia, ANCA—associated itides, cryoglobulinemia, thrombotic thrombocytopenic purpura, chronic autoimmune urticaria, allergy c dermatitis, contact dermatitis, allergic rhinitis), goodpasture's syndrome, AMR (antibody-mediated transplant rejection), B ediated hyperacute, acute and chronic transplant rejection and cancers of haematopoietic origin including but not limited to multiple myeloma; a leukaemia; acute myelogenous leukemia; chronic myelogenous leukemia; lymphocytic leukemia; myeloid leukemia; non-Hodgkin lymphoma; lymphomas; polycythemia vera; essential thrombocythemia; myelofibrosis with d metaplasia; and Walden stroem disease; more suitably from toid arthritis (RA), pemphigus vulgaris (PV), idiopathic thrombocytopenia purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune hemolytic anemia (AIHA), ed hemophilia type A (AHA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), myasthenia gravis (MG), Sjogren‘s syndrome (88), ANCA- associated vasculitides, cryoglobulinemia, chronic autoimmune urticaria (CAU), allergy (atopic itis, contact dermatitis, ic rhinitis), goodpasture's syndrome, transplant rejection and cancers of haematopoietic origin as well as in disease or infection ated immunopathology, for example in severe and cerebral malaria, trypanosomiasis, leishmaniasis, toxoplasmosis and neurocysticercosis.

In another embodiment, the invention provides a method of treating a disease which is treated by tion of P|3K comprising administration of a therapeutically acceptable amount of a compound of formulae (l), (l’), (la), (la’), (lb), (lb’) (lc), (lc’), (ld), (ld’), (le), (le’), (If), (If), (lg), (lg’), (lh), (lh’), (li), (li’), (lj) or (lj’). In a further embodiment, the disease is selected from the afore-mentioned list, ly from autoimmune disorders, inflammatory diseases, allergic es, airway diseases, such as asthma and COPD, transplant rejection; antibody production, antigen presentation, cytokine tion or lymphoid organogenesis are abnormal or are undesirable including rheumatoid arthritis, gus vulgaris, idiopathic thrombocytopenia purpura, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, Sjogren‘s syndrome, autoimmune hemolytic anemia, ANCA- associated vasculitides, cryoglobulinemia, otic thrombocytopenic purpura, chronic autoimmune urticaria, allergy (atopic dermatitis, t dermatitis, allergic rhinitis), goodpasture's syndrome, AMR (antibody-mediated transplant rejection), B cell-mediated hyperacute, acute and chronic transplant rejection and cancers of haematopoietic origin including but not limited to multiple myeloma; a mia; acute myelogenous leukemia; chronic myelogenous leukemia; lymphocytic leukemia; myeloid leukemia; non-Hodgkin lymphoma; lymphomas; polycythemia vera; essential thrombocythemia; myelofibrosis with myeloid metaplasia; and Walden stroem disease; more suitably from rheumatoid arthritis (RA), pemphigus is (PV), idiopathic thrombocytopenia purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune hemolytic anemia (AIHA), acquired hemophilia type A (AHA), systemic lupus erythematosus (SLE), le sis (MS), myasthenia gravis (MG), Sjogren‘s syndrome (88), ANCA-associated vasculitides, cryoglobulinemia, chronic autoimmune urticaria (CAU), allergy (atopic dermatitis, contact dermatitis, allergic rhinitis), goodpasture's syndrome, transplant rejection and cancers of haematopoietic origin as well as in disease or infection ated pathology, for example in severe and cerebral malaria, osomiasis, leishmaniasis, toxoplasmosis and ysticercosis.

Thus, as a further embodiment, the present invention es the use of a compound of formulae (l), (l’), (la), (la’), (lb), (lb’) (lc), (lc’), (ld), (ld’), (le), (le’), (If), (If), (lg), (lg’), (lh), (lh’), (li), (li’), (lj) or (lj’) for the manufacture of a medicament. In a further embodiment, the ment is for treatment of a disease which may be treated inhibition of PI3K. In another embodiment, the disease is selected from the afore-mentioned list, suitably from autoimmune disorders, inflammatory diseases, allergic es, airway diseases, such as asthma and COPD, transplant rejection; antibody production, antigen presentation, cytokine production or lymphoid organogenesis are abnormal or are undesirable including rheumatoid arthritis, pemphigus vulgaris, idiopathic thrombocytopenia purpura, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, Sjogren‘s syndrome, autoimmune hemolytic anemia, ANCA-associated itides, cryoglobulinemia, otic thrombocytopenic purpura, chronic autoimmune urticaria, allergy (atopic dermatitis, contact dermatitis, allergic rhinitis), sture's syndrome, AMR (antibody-mediated transplant rejection), B cell-mediated hyperacute, acute and chronic transplant rejection and cancers of haematopoietic origin including but not limited to multiple myeloma; a mia; acute myelogenous leukemia; c myelogenous leukemia; lymphocytic leukemia; d leukemia; non-Hodgkin lymphoma; lymphomas; polycythemia vera; essential thrombocythemia; myelofibrosis with myeloid metaplasia; and Walden stroem disease; more suitably from rheumatoid tis (RA), gus vulgaris (PV), thic thrombocytopenia purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune tic anemia , acquired hemophilia type A (AHA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), myasthenia gravis (MG), Sjogren‘s syndrome (88), ANCA-associated vasculitides, cryoglobulinemia, chronic autoimmune urticaria (CAU), y (atopic itis, contact dermatitis, allergic rhinitis), goodpasture's syndrome, transplant rejection and cancers of haematopoietic origin as well as in disease or infection associated immunopathology, for example in severe and cerebral malaria, trypanosomiasis, leishmaniasis, toxoplasmosis and neurocysticercosis.

The pharmaceutical composition or combination of the present invention can be in unit dosage of about 1-1000 mg of active ient(s) for a subject of about 50-70 kg, or about 1-500 mg or about 1-250 mg or about 1-150 mg or about 0.5-100 mg, or about 1- 50 mg of active ingredients. The therapeutically effective dosage of a compound, the ceutical composition, or the combinations thereof, is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A ian, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the er or disease.

The cited dosage properties are demonstrable in vitro and in vivo tests using ageously mammals, e.g., mice, rats, dogs, monkeys or isolated organs, tissues and preparations thereof. The compounds of the present invention can be applied in vitro in the form of solutions, e.g., aqueous solutions, and in vivo either enterally, parenterally, advantageously intravenously, e.g., as a suspension or in aqueous solution.

The dosage in vitro may range between about 10'3 molar and 10'9 molar concentrations.

A therapeutically effective amount in vivo may range depending on the route of administration, between about 0.1-500 mg/kg, or between about 1-100 mg/kg.

The compound of the present invention may be administered either simultaneously with, or before or after, one or more other therapeutic agent. The compound of the present invention may be administered separately, by the same or ent route of administration, or together in the same pharmaceutical composition as the other agents.

In one embodiment, the invention provides a t comprising a compound of formula (I) and at least one other therapeutic agent as a combined preparation for simultaneous, separate or sequential use in therapy. In one embodiment, the y is the treatment of a disease or condition mediated by the activity of the P|3K enzymes. Products provided as a combined preparation include a composition comprising the compound of formula (I) and the other therapeutic agent(s) together in the same pharmaceutical composition, or the compound of formula (I) and the other therapeutic agent(s) in separate form, e.g. in the form of a kit.

In one embodiment, the invention provides a pharmaceutical composition comprising a compound of formula (I) and another therapeutic agent(s). Optionally, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier, as described above.

In one embodiment, the ion provides a kit comprising two or more separate ceutical compositions, at least one of which contains a compound of formula (I). In one embodiment, the kit comprises means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet. An example of such a kit is a blister pack, as typically used for the packaging of s, capsules and the like.

The kit of the invention may be used for administering different dosage forms, for e, oral and eral, for administering the separate compositions at different dosage als, or for titrating the te compositions against one another. To assist compliance, the kit of the invention lly comprises directions for administration.

In the combination therapies of the ion, the compound of the ion and the other therapeutic agent may be manufactured and/or formulated by the same or different manufacturers. Moreover, the compound of the invention and the other therapeutic may be brought together into a ation therapy: (i) prior to release of the combination product to physicians (e.g. in the case of a kit comprising the compound of the invention and the other eutic ; (ii) by the physician themselves (or under the guidance of the physician) shortly before administration; (iii) in the patient themselves, e.g. during sequential administration of the compound of the invention and the other therapeutic agent.

Accordingly, the invention provides the use of a compound of formula (I) for ng a disease or condition mediated by the activity of the P|3K enzymes, wherein the medicament is prepared for administration with another therapeutic agent. The invention also provides the use of another therapeutic agent for treating a disease or condition mediated by the activity WO 93849 2012/057554 of the P|3K enzymes, n the medicament is administered with a compound of formula The ion also provides a compound of formula (I) for use in a method of treating a disease or condition mediated by the activity of the P|3K enzymes, wherein the compound of formula (I) is prepared for administration with another eutic agent. The invention also es another eutic agent for use in a method of ng a disease or condition mediated by the activity of the P|3K enzymes, wherein the other therapeutic agent is prepared for stration with a compound of formula (I). The ion also provides a compound of a (I) for use in a method of treating a disease or condition mediated by the activity of the P|3K enzymes wherein the compound of formula (I) is administered with another therapeutic agent. The invention also provides another therapeutic agent for use in a method of treating a disease or condition mediated by the activity of the P|3K enzymes n the other therapeutic agent is administered with a compound of formula (I).

The invention also provides the use of a compound of formula (I) for treating a disease or condition mediated by the activity of the P|3K enzymes, wherein the patient has previously (e.g. within 24 hours) been treated with another therapeutic agent. The invention also provides the use of another therapeutic agent for treating a disease or condition mediated by the activity of the P|3K enzymes, wherein the patient has previously (e.g. within 24 hours) been treated with a compound of formula (I).

The compounds of formula I may be administered as the sole active ingredient or in conjunction with, e.g. as an adjuvant to, other drugs e.g. suppressive or immunomodulating agents or other anti-inflammatory agents, e.g. for the treatment or prevention of allo- or xenograft acute or chronic rejection or inflammatory or autoimmune disorders, or a chemotherapeutic agent, e.g a ant ce|| anti-proliferative agent. For example, the nds of formula I may be used in combination with a calcineurin inhibitor, e.g. cyclosporin A or FK 506; a mTOR inhibitor, e.g. rapamycin, 40-O-(2— hydroxyethyl)—rapamycin, CCI779, ABT578, AP23573, TAFA-93, biolimus—7 or us- 9; an ascomycin having immuno-suppressive properties, e.g. ABT-281, ASM981, etc.; corticosteroids; cyclophosphamide; azathioprene; methotrexate; leflunomide; mizoribine; mycophenolic acid or salt; mycophenolate mofetil; 15-deoxyspergualine or an immunosuppressive homologue, analogue or derivative thereof; a PKC inhibitor, e.g. as disclosed in WO 61 or WO 03/82859, e.g. the compound of Example 56 or 70; a JAK3 kinase inhibitor, e.g. N-benzyI-3,4-dihydroxy-benzylidene-cyanoacetamide 0c- cyano-(3,4-dihydroxy)—]N-benzylcinnamamide (Tyrphostin AG 490), prodigiosin 25-C (PNU156804), [4-(4'-hydroxyphenyl)-amino-6,7-dimethoxyquinazoline] (WHl-P131), [4- omo-4'-hydroxylphenyl)—amino-6,7-dimethoxyquinazoline] (WHl-P154), [4-(3',5'- o-4'-hydroxylphenyl)—amino-6,7-dimethoxyquinazoline] WHl-P97, KRX—21 1, 3- {(3R,4R)—4-methyl[methyl-(7H-pyrrolo[2,3-d]pyrimidinyl)-amino]-piperidiny|} oxo-propionitrile, in free form or in a pharmaceutically acceptable salt form, e.g. mono- citrate (also called CP-690,550), or a nd as disclosed in WO 359 or WO 05/066156; immunosuppressive monoclonal antibodies, e.g., monoclonal antibodies to leukocyte receptors, e.g., MHC, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40, CD45, CD52, CD58, CD80, CD86 or their ligands; other immunomodulatory compounds, e.g. a recombinant binding molecule having at least a portion of the ellular domain of CTLA4 or a mutant thereof, e.g. an at least ellular portion of CTLA4 or a mutant thereofjoined to a non-CTLA4 protein sequence, e.g. g (for ex. designated ATCC 68629) or a mutant thereof, e.g. LEA29Y; adhesion molecule inhibitors, e.g. LFA- 1 antagonists, lCAM-1 or -3 antagonists, VCAM-4 antagonists or VLA—4 nists; or antihistamines; or antitussives, or a bronchodilatory agent; or an angiotensin or blockers; or an anti-infectious agent.

Where the compounds of formula I are administered in conjunction with other immunosuppressive/ immunomodulatory, anti-inflammatory, chemotherapeutic or anti- infectious therapy, dosages of the co-administered immunosuppressant, immunomodulatory, anti-inflammatory, chemotherapeutic or anti-infectious compound will of course vary depending on the type of co-drug employed, e.g. whether it is a steroid or a calcineurin tor, on the specific drug employed, on the condition being treated and so forth.

A compound of the formula (I) may also be used to advantage in combination with each other or in ation with other therapeutic agents, especially other antiproliferative agents. Such antiproliferative agents include, but are not limited to, aromatase inhibitors; trogens; topoisomerase I inhibitors; topoisomerase II inhibitors; microtubule active agents; ting ; histone deacetylase inhibitors; compounds, which induce cell differentiation processes; cyclooxygenase inhibitors; MMP inhibitors; mTOR inhibitors; antineoplastic antimetabolites; platin compounds; compounds targeting/decreasing a protein or lipid kinase activity and further anti-angiogenic compounds; compounds which , decrease or inhibit the activity of a protein or lipid phosphatase; gonadorelin ts; anti-androgens; methionine aminopeptidase inhibitors; bisphosphonates; biological response modifiers; antiproliferative antibodies; heparanase inhibitors; inhibitors of Ras oncogenic isoforms; telomerase inhibitors; proteasome inhibitors; agents used in the treatment of hematologic malignancies; compounds which target, decrease or inhibit the activity of Flt-3; Hsp90 inhibitors; temozolomide (TEMODAL®); and Ieucovorin.

The term "aromatase inhibitor", as used herein, s to a compound which inhibits the estrogen production, i.e., the sion of the substrates androstenedione and testosterone to estrone and estradiol, respectively. The term es, but is not limited to, steroids, especially atamestane, exemestane and formestane; and, in particular, non- steroids, especially aminoglutethimide, roglethimide, pyridoglutethimide, trilostane, testolactone, ketoconazole, le, fadrozole, anastrozole and letrozole. tane can be administered, e.g., in the form as it is marketed, e.g., under the trademark AROMASIN. Formestane can be administered, e.g., in the form as it is ed, e.g., under the trademark LENTARON. Fadrozole can be administered, e.g., in the form as it is marketed, e.g., under the trademark AFEMA. Anastrozole can be administered, e.g., in the form as it is marketed, e.g., under the trademark ARIMIDEX. Letrozole can be administered, e.g., in the form as it is marketed, e.g., under the trademark FEMARA or FEMAR. Aminoglutethimide can be administered, e.g., in the form as it is marketed, e.g., under the trademark ORIMETEN. A combination of the ion comprising a chemotherapeutic agent which is an aromatase inhibitor is particularly useful for the treatment of hormone or positive tumors, e.g., breast tumors.

The term "anti-estrogen", as used herein, relates to a compound which antagonizes the effect of estrogens at the estrogen receptor level. The term includes, but is not limited to, tamoxifen, fulvestrant, fene and raloxifene hydrochloride. fen can be administered, e.g., in the form as it is marketed, e.g., under the trademark NOLVADEX.

Raloxifene hydrochloride can be administered, e.g., in the form as it is marketed, e.g., under the trademark EVISTA. Fulvestrant can be formulated as disclosed in U.S. Patent No. 4,659,516 or it can be administered, e.g., in the form as it is marketed, e.g., under the trademark FASLODEX. A combination of the invention comprising a chemotherapeutic agent which is an antiestrogen is particularly useful for the treatment of estrogen receptor positive tumors, e.g., breast tumors.

The term "anti-androgen", as used herein, relates to any substance which is capable of inhibiting the biological effects of androgenic es and includes, but is not limited to, bicalutamide (CASODEX), which can be formulated, e.g., as sed in U.S. Patent No. 4,636,505.

The term "gonadorelin agonist", as used herein, includes, but is not limited to, abarelix, lin and goserelin acetate. Goserelin is disclosed in U.S. Patent No. 4,100,274 and can be administered, e.g., in the form as it is marketed, e.g., under the trademark ZOLADEX. Abarelix can be formulated, e.g., as disclosed in U.S. Patent No. 5,843,901.

The term "topoisomerase I inhibitor", as used herein, includes, but is not limited to, topotecan, gimatecan, irinotecan, camptothecian and its analogues, 9-nitrocamptothecin and the macromolecular thecin conjugate PNU-166148 (compound A1 in WO 99/17804). lrinotecan can be administered, e.g., in the form as it is ed, e.g., under the trademark CAMPTOSAR. Topotecan can be stered, e.g., in the form as it is marketed, e.g., under the trademark HYCAMTIN.

The term "topoisomerase II inhibitor", as used herein, includes, but is not limited to, the anthracyclines, such as doxorubicin, including liposomal formulation, e.g., CAELYX; daunorubicin; epirubicin; icin; bicin; the anthraquinones mitoxantrone and |osoxantrone; and the illotoxines etoposide and teniposide. Etoposide can be administered, e.g., in the form as it is marketed, e.g., under the trademark ETOPOPHOS. Teniposide can be stered, e.g., in the form as it is marketed, e.g., under the trademark VM 26-BRISTOL. Doxorubicin can be administered, e.g., in the form as it is marketed, e.g., under the trademark ADRIBLASTIN or ADRIAMYCIN.

Epirubicin can be administered, e.g., in the form as it is marketed, e.g., under the trademark FARMORUBICIN. icin can be administered, e.g., in the form as it is marketed, e.g., under the trademark ZAVEDOS. Mitoxantrone can be administered, e.g., in the form as it is marketed, e.g., under the trademark NOVANTRON.

The term "microtubule active agent" relates to microtubule stabilizing, microtubule destabilizing agents and microtublin polymerization inhibitors including, but not d to, taxanes, e.g., paclitaxel and docetaxel; vinca alkaloids, e.g., stine, especially vinblastine sulfate; vincristine, especially vincristine sulfate and vinorelbine; discodermolides; cochicine; and epothilones and derivatives thereof, e.g., lone B or D or derivatives thereof. Paclitaxel may be administered, e.g., in the form as it is marketed, e.g., TAXOL. Docetaxel can be administered, e.g., in the form as it is ed, e.g., under the ark TAXOTERE. Vinblastine sulfate can be administered, e.g., in the form as it is marketed, e.g., under the trademark VINBLASTIN R.P. Vincristine sulfate can be administered, e.g., in the form as it is marketed, e.g., under the ark FARMISTIN. Discodermolide can be obtained, e.g., as disclosed in U.S. Patent No. 5,010,099. Also included are epothilone derivatives which are disclosed in WO 98/10121, U.S. Patent No. 6,194,181, WO 98/25929, WO 98/08849, WO 99/43653, WO 98/22461 and WO 00/31247. Especially preferred are epothilone A and/or B.

The term "alkylating agent", as used herein, es, but is not limited to, cyclophosphamide, ifosfamide, melphalan or nitrosourea (BCNU or Gliadel). hosphamide can be administered, e.g., in the form as it is marketed, e.g., under 2012/057554 the trademark CYCLOSTIN. mide can be administered, e.g., in the form as it is marketed, e.g., under the trademark HOLOXAN.

The term "histone ylase inhibitors" or "HDAC inhibitors" relates to nds which inhibit the histone deacetylase and which possess antiproliferative activity. This includes compounds disclosed in WO 02/22577, especially N-hydroxy[4-[[(2- hydroxyethyl)[2-(1H-indolyl)ethyl]—amino]methyl]phenyl]-2E—2-propenamide, N- hydroxy[4-[[[2-(2—methyl-1H-indolyl)-ethyl]-amino]methyl]phenyl]-2Epropenamide and ceutically acceptable salts thereof. It further especially includes suberoylanilide hydroxamic acid (SAHA).

The term "antineoplastic antimetabolite" includes, but is not limited to, 5-fluorouracil or 5- FU; capecitabine; gemcitabine; DNA ylating agents, such as 5-azacytidine and decitabine; rexate and edatrexate; and folic acid antagonists, such as pemetrexed. Capecitabine can be administered, e.g., in the form as it is marketed, e.g., under the trademark XELODA. Gemcitabine can be administered, e.g., in the form as it is marketed, e.g., under the trademark GEMZAR. Also included is the monoclonal antibody zumab which can be administered, e.g., in the form as it is marketed, e.g., under the trademark HERCEPTIN.

The term "platin compound", as used herein, includes, but is not limited to, carboplatin, cis—platin, cisplatinum and oxaliplatin. Carboplatin can be administered, e.g., in the form as it is ed, e.g., under the trademark CARBOPLAT. Oxaliplatin can be stered, e.g., in the form as it is marketed, e.g., under the trademark ELOXATIN.

The term "compounds ing/decreasing a protein or lipid kinase activity; or a protein or lipid phosphatase activity; or further anti-angiogenic compounds", as used herein, includes, but is not d to, protein tyrosine kinase and/or serine and/or threonine kinase inhibitors or lipid kinase inhibitors, e.g., a) compounds targeting, decreasing or inhibiting the activity of the platelet- derived growth factor-receptors (PDGFR), such as compounds which target, decrease or t the activity of PDGFR, ally compounds which inhibit the PDGF receptor, e.g., a N-phenyl-2—pyrimidine-amine derivative, e.g., imatinib, SU101, SU6668 and GFB-111; b) compounds targeting, decreasing or inhibiting the activity of the fibroblast growth factor-receptors (FGFR); c) compounds targeting, decreasing or inhibiting the activity of the insulin-like growth factor receptor l (lGF-IR), such as compounds which target, decrease or t the activity of lGF-IR, especially compounds which inhibit the lGF-IR receptor, such as those compounds disclosed in WC 02/092599; d) compounds targeting, sing or inhibiting the activity of the Trk receptor tyrosine kinase family; e) compounds targeting, decreasing or inhibiting the activity of the Axl receptor tyrosine kinase family; f) compounds targeting, decreasing or inhibiting the activity of the c-Met g) compounds targeting, decreasing or inhibiting the activity of the Kit/SCFR receptor tyrosine kinase; h) compounds targeting, decreasing or ting the activity of the C-kit receptor tyrosine kinases - (part of the PDGFR family), such as compounds which target, decrease or inhibit the activity of the c-Kit receptor tyrosine kinase family, ally compounds which inhibit the c-Kit or, e.g., imatinib; i) compounds targeting, decreasing or inhibiting the activity of members of the c- Abl family and their gene-fusion products, e.g., BCR-Abl kinase, such as compounds which target se or inhibit the activity of c-Abl family members and their gene fusion products, e.g., a N-phenylpyrimidine-amine derivative, e.g., imatinib, PD180970, AG957, NSC 680410 or PD173955 from ParkeDavis; j) compounds targeting, decreasing or inhibiting the activity of members of the protein kinase C (PKC) and Raf family of serine/threonine kinases, members of the MEK, SRC, JAK, FAK, PDK and Ras/MAPK family members, or Pl(3) kinase family, or of the Pl(3)-kinase-related kinase , and/or members of the cyclin- dependent kinase family (CDK) and are especially those staurosporine derivatives disclosed in U.S. Patent No. 5,093,330, e.g., aurin; es of further compounds include, e.g., UCN-01; safingol; BAY 43-9006; Bryostatin 1; Perifosine; llmofosine; RO 318220 and R0 320432; GO 6976; lsis 3521; LY333531/LY379196; isochino|ine nds, such as those sed in WO 00/09495; FTls; 52; or QAN697 (a P13K inhibitor); k) compounds targeting, sing or inhibiting the activity of protein-tyrosine kinase inhibitors, such as compounds which target, decrease or inhibit the activity of protein-tyrosine kinase inhibitors include imatinib mesylate (GLEEVEC) or tyrphostin. A tyrphostin is preferably a low molecular weight (Mr < 1500) compound, or a pharmaceutically acceptable salt thereof, especially a compound selected from the benzylidenemalonitrile class or the S—arylbenzenemalonirile or bisubstrate quinoline class of compounds, more especially any compound selected from the group consisting of Tyrphostin A23/RG-50810, AG 99, Tyrphostin AG 213, Tyrphostin AG 1748, Tyrphostin AG 490, Tyrphostin B44, Tyrphostin B44 (+) enantiomer, Tyrphostin AG 555, AG 494, Tyrphostin AG 556, AG957 and adaphostin (4-{[(2,5-dihydroxyphenyl)methyl]amino}-benzoic acid tyl ester, NSC 680410, adaphostin; and I) compounds targeting, decreasing or inhibiting the ty of the epidermal growth factor family of receptor tyrosine kinases (EGFR, ErbB2, ErbB3, ErbB4 as homo- or hetero-dimers), such as compounds which target, decrease or inhibit the activity of the epidermal growth factor receptor family are especially compounds, proteins or antibodies which inhibit members of the EGF receptor tyrosine kinase family, e.g., EGF receptor, ErbB2, ErbB3 and ErbB4 or bind to EGF or EGF related s, and are in ular those compounds, proteins or monoclonal antibodies generically and specifically disclosed in WO 97/02266, e.g., the compound of Example 39, or in EP 0 564 409; WO 99/03854; EP 0520722; EP 0 566 226; EP 0 787 722; EP 0 837 063; U.S. Patent No. 5,747,498; WO 98/10767; WO 97/30034; WO 97/49688; WO 97/38983 and, especially, WO 96/30347, e.g., compound known as CP 358774; WO 96/33980, e.g., compound ZD 1839; and WO 95/03283, e.g., compound ZM105180, e.g., trastuzumab (HERCEPTIN), cetuximab, lressa, Tarceva, OSl-774, Cl-1033, EKB-569, GW—2016, E1.1, E24, E25, E62, E64, E2.11, E6.3 or E763; and 7H-pyrrolo-[2,3-d]pyrimidine derivatives which are disclosed in WC 03/013541.

Further anti-angiogenic compounds include compounds having another mechanism for their activity, e.g., ted to n or lipid kinase inhibition, e.g., thalidomide (THALOMID) and TNP-470.

Compounds which target, decrease or inhibit the activity of a protein or lipid phosphatase are, e.g., inhibitors of phosphatase 1, phosphatase 2A, PTEN or CDC25, e.g., c acid or a derivative thereof.

Compounds which induce cell entiation processes are e.g. retinoic acid, oc- y- or 8-tocopherol or oc- y- or 8-tocotrienol.

The term cyclooxygenase inhibitor, as used herein, includes, but is not limited to, e.g., Cox-2 inhibitors, 5-alkyl substituted 2-arylaminophenylacetic acid and derivatives, such as celecoxib (CELEBREX), xib ), etoricoxib, valdecoxib or a l arylaminophenylacetic acid, e.g., 5-methyl(2'-chloro-6'-fluoroani|ino)pheny| acetic acid or lumiracoxib.

The term osphonates", as used herein, es, but is not limited to, etridonic, clodronic, tiludronic, pamidronic, alendronic, ibandronic, risedronic and zoledronic acid.

"Etridonic acid" can be administered, e.g., in the form as it is marketed, e.g., under the trademark DIDRONEL. "Clodronic acid" can be administered, e.g., in the form as it is marketed, e.g., under the trademark S. "Tiludronic acid" can be administered, e.g., in the form as it is marketed, e.g., under the trademark SKELID. "Pamidronic acid" can be stered, e.g., in the form as it is marketed, e.g., under the trademark AREDIAT'V'. "Alendronic acid" can be administered, e.g., in the form as it is marketed, e.g., under the ark X. "Ibandronic acid" can be administered, e.g., in the form as it is marketed, e.g., under the trademark BONDRANAT. "Risedronic acid" can be administered, e.g., in the form as it is marketed, e.g., under the trademark ACTONEL.

"Zoledronic acid" can be administered, e.g., in the form as it is marketed, e.g., under the trademark ZOMETA.

The term "mTOR inhibitors" relates to nds which inhibit the mammalian target of rapamycin (mTOR) and which possess antiproliferative activity, such as siro|imus (Rapamune®), everolimus (CerticanT'V'), CCl-779 and ABT578.

The term "heparanase inhibitor", as used herein, refers to compounds which target, decrease or inhibit heparin sulphate degradation. The term es, but is not limited to, Pl-88.

The term "biological response modifier", as used herein, refers to a lymphokine or interferons, e.g., interferon y.

The term "inhibitor of Ras oncogenic isoforms", e.g., H-Ras, K-Ras or N-Ras, as used herein, refers to compounds which target, decrease or inhibit the oncogenic activity of Ras, e.g., a "farnesyl transferase inhibitor", e.g., L-744832, DK8G557 or R115777 (Zarnestra).

The term "te|omerase inhibitor", as used herein, refers to compounds which , decrease or t the activity of te|omerase. Compounds which target, decrease or inhibit the activity of te|omerase are especially compounds which inhibit the te|omerase receptor, e.g., te|omestatin.

The term "methionine aminopeptidase inhibitor", as used herein, refers to compounds which target, decrease or inhibit the ty of methionine aminopeptidase. Compounds which target, decrease or inhibit the activity of nine eptidase are, e.g., ide or a derivative thereof.

The term "proteasome tor", as used herein, refers to compounds which target, decrease or inhibit the activity of the proteasome. Compounds which target, decrease or inhibit the activity of the some include, e.g., PS—341 and MLN 341.

The term "matrix metalloproteinase inhibitor" or "MMP inhibitor", as used , includes, but is not limited to, collagen peptidomimetic and nonpeptidomimetic inhibitors, tetracycline derivatives, e.g., hydroxamate peptidomimetic inhibitor stat and its orally bioavailable analogue marimastat (BB-2516), prinomastat (AG3340), metastat (NSC 683551) EMS-279251, BAY 12-9566, TAA211, MM|27OB or AAJ996. 2012/057554 The term "agents used in the treatment of hematologic malignancies", as used herein, includes, but is not limited to, FMS-like tyrosine kinase inhibitors, e.g., compounds targeting, decreasing or inhibiting the activity of FMS-like tyrosine kinase receptors (Flt- 3R); interferon, 1-b-D-arabinofuransylcytosine (ara-c) and an; and ALK inhibitors, e.g., compounds which target, decrease or inhibit anaplastic lymphoma kinase.

Compounds which target, decrease or inhibit the activity of FMS-like tyrosine kinase receptors (Flt-3R) are especially compounds, proteins or antibodies which inhibit members of the Flt-3R receptor kinase family, e.g., PKC412, midostaurin, a staurosporine derivative, SU11248 and MLN518.

The term "HSP90 inhibitors", as used , includes, but is not d to, nds ing, decreasing or inhibiting the intrinsic ATPase activity of HSP90; degrading, targeting, decreasing or inhibiting the HSP90 client proteins via the ubiquitin proteasome pathway. nds targeting, decreasing or inhibiting the intrinsic ATPase activity of HSP90 are ally compounds, proteins or dies which inhibit the ATPase ty of HSP90, e.g., 17-allylamino,17-demethoxygeldanamycin (17AAG), a geldanamycin derivative, other geldanamycin d compounds, radicicol and HDAC inhibitors.

The term "antiproliferative antibodies", as used herein, includes, but is not limited to, trastuzumab (HerceptinT'V'), Trastuzumab-DM1, erlotinib (TarcevaT'V'), bevacizumab (AvastinT'V'), rituximab (Rituxan®), PRO64553 (anti-CD40) and 204 antibody. By dies is meant, e.g., intact monoclonal antibodies, onal antibodies, multispecific antibodies formed from at least two intact antibodies, and antibodies fragments so long as they exhibit the desired biological activity.

For the treatment of acute myeloid ia (AML), nds of formula (I) can be used in combination with standard leukemia therapies, especially in combination with therapies used for the treatment of AML. In particular, compounds of a (I) can be administered in combination with, e.g., farnesyl transferase inhibitors and/or other drugs useful for the treatment of AML, such as Daunorubicin, Adriamycin, Ara-C, VP-16, Teniposide, Mitoxantrone, ldarubicin, Carboplatinum and PKC412.

A compound of the formula (I) may also be used to advantage in combination with each other or in combination with other therapeutic agents, especially other anti-malarial agents. Such anti-malarial agents include, but are not d to proguanil, chlorproguanil, trimethoprim, chloroquine, mefloquine, lumefantrine, atovaquone, pyrimethamine-sulfadoxine, pyrimethamine-dapsone, halofantrine, quinine, quinidine, amodiaquine, oquine, sulphonamides, artemisinin, ene, artemether, artesunate, primaquine, inhaled NO, L-arginine, Dipropylenetri-amine NONOate (NO donor), Rosiglitzone (PPARy t), activated charcoal, Erythropoietin, Levamisole, and pyronaridine.

A compound of the formula (I) may also be used to advantage in combination with each other or in combination with other therapeutic agents, such as used for the treatment of Leishmaniosis, Trypanosomiasis, Toxoplasmosis and Neurocysticercosis. Such agents include, but are not limited to quine sulfate, atovaquone-proguanil, artemether— lumefantrine, quinine-sulfate, artesunate, quinine, doxycycline, clindamycin, meglumine antimoniate, sodium stibogluconate, miltefosine, ketoconazole, pentamidine, amphotericin B (AmB), liposomal-AmB, paromomycine, eflornithine, nifurtimox, n, melarsoprol, prednisolone, benznidazole, sulfadiazine, pyrimethamine, clindamycin, trimetropim, sulfamethoxazole, azitromycin, atovaquone, thasone, praziquantel, albendazole, beta-lactams, fluoroquinolones, macrolides, aminoglycosides, sulfadiazine and pyrimethamine.

The structure of the active agents identified by code nos., generic or trade names may be taken from the actual edition of the standard compendium "The Merck Index" or from databases, e.g., Patents International, e.g., IMS World Publications.

The above-mentioned compounds, which can be used in combination with a compound of the formula (I), can be ed and administered as described in the art, such as in the documents cited above.

A compound of the formula (I) may also be used to advantage in combination with known therapeutic processes, e.g., the administration of hormones or ally radiation.

A compound of formula (I) may in particular be used as a radiosensitizer, especially for the treatment of tumors which exhibit poor sensitivity to radiotherapy.

By "combination", there is meant either a fixed combination in one dosage unit form, or a kit of parts for the combined administration where a nd of the formula (I) and a combination partner may be administered independently at the same time or separately within time als that ally allow that the combination partners show a cooperative, e.g., synergistic, effect or any ation thereof. The terms “co- administration” or “combined administration” or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to e treatment ns in which the agents are not necessarily stered by the same route of administration or at the same time. The term “pharmaceutical combination” as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term “fixed combination” means that the active ingredients, e.g. a compound of formula I and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage. The term “non-fixed combination” means that the active ients, e.g. a nd of formula (I) and a combination r, are both stered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more active ingredients.

EXAMPLES Experimental details: The following examples are intended to rate the invention and are not to be construed as being limitations thereon. Temperatures are given in degrees Celsius. If not mentioned otherwise, all evaporations are performed under reduced re, typically between about mm Hg and 100 mm Hg (= 20-133 mbar). The structure of final products, intermediates and starting als is confirmed by standard analytical methods, e.g., microanalysis and spectroscopic characteristics, e.g., MS, IR, NMR. Abbreviations used are those conventional in the art.

All starting materials, building blocks, reagents, acids, bases, dehydrating , solvents, and catalysts utilized to synthesis the compounds of the present invention are either commercially available or can be produced by organic synthesis methods known to one of ordinary skill in the art (Houben-Weyl 4th Ed. 1952, Methods of Organic Synthesis, Thieme, Volume 21). Further, the compounds of the present invention can be produced by organic sis methods known to one of ry skill in the art as shown in the following examples. iations ACN acetonitrile AcOH acetic acid aq. aqueous Boc tert—butoxycarbonyl Boc20 di-tert—butyl dicarbonate tBu tert—butyl tBuOH tert—butanol BrettPhos 2-(Dicyclohexylphosphino)—3,6-dimethoxy-2'-4'-6'-triisopropyl-1,1'- biphenyl br s broad singlet COMU (1 ethoxyoxoethylidenaminooxy)dimethylamino- morpholino-carbenium hexafluorophosphate conc. trated d day(s) d doublet 2012/057554 dd doublet of doublets dba dibenzylideneacetone DCM dichloromethane DEA diethylamine DEAD l azodicarboxylate DEAP diethylaminopyridine DIPEA diisopropylethylamine DMF dimethylformamide DMME dimethoxymethane DMSO dimethylsulfoxide DPPA diphenylphosphoryl azide DPPF 1,1’-bis(diphenylphosphino)ferrocene EDC 1-(3-dimethylaminopropyl)ethylcarbodiimide hydrochloride eq. equivalent(s) ESI ospray ionisation Et3N triethylamine EtZO diethylether EtOAc ethyl acetate EtOH ethanol hour(s) HATU O-(7-azabenzotriazolyl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate HBTU O-(1H-benzotriazolyl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate HMDS hexamethyldisilazane HOBT 1-hydroxy-benztriazole HPLC high performance liquid chromatography IPA isopropanol LCMS liquid chromatography with mass spectrometry mCPBA hloroperoxybenzoic acid MeOH methanol multiplet min minute(s) MS mass spectrometry mw microwave NMR nuclear magnetic resonance spectrometry NaOtBu sodium tert-butoxide WO 93849 NP normal phase OBD optimum bed density Pd2(dba)3 tris(dibenzylideneacetone)dipalladium PL-HCOs MP SPE Polymer-supported bicarbonate cartridge for acid removal prep. preparative PPh3 triphenylphosphine q quartet Rac-BINAP racemic 2,2’-bis(di-p-tolylphosphino)—1,1’-binaphthyl RP reversed phase Rt retention time rt room temperature Ru Phos clohexylphosphino-2',6'—di-isopropoxy-1,1'-biphenyl sat. saturated SCX—2 polymer supported sulfonic acid macroporous polystyrene soln. solution t triplet TBME tert—butyl methyl ether TBAF tetrabutylammonium de TBDMSCI tert-butyldimethylsilylchloride Tetramethyl-t-butyl -XPhos 2-di-t-butylphosphino-3,4,5,6-tetramethyl-2’,4’,6’-triisopropylbiphenyl TFA trifluoroacetic acid THF ydrofuran TLC thin layer chromatography UPLC ultra performance liquid chromatography XPhos 2-dicyclohexylphosphino-2’,4’,6’-triisopropylbiphenyl Pd[RuPhos] (2-dicyclohexylphosphino-2' 6'-diisopropyl-1 1'-biphenyl)(2—(2- aminoethyl)phenyl)palladium(ll) Microwave equipment used is a e lnitiator® All compounds are named using AutoNom.

Preparation of Examples — General Procedures Scheme1 HO HO 0 b 0-§-0 \CNH L, N——/( o O EN44 R rrolidinol II 4 R N O R I c d R4 m —» N 0' «a (“OOH O V R2: III 7 0 \ VI IV UcQ a) rrolidinol and an acid chloride of formula R4C(O)Cl or carboxylic acid of formula R4C(O)OH were reacted to prepare an amide of general formula II. Those skilled in the art will appreciate that there are many known ways of preparing amides. For example, see Mantalbetti, C.A.G.N and Falque, V., Amide bond formation and peptide coupling, Tetrahedron, 2005, 61 (46), pp10827-10852 and references cited therein. The ing general methods i — ii have been used. i. A soln. of the carboxylic acid and DMF (1 eq.) in DCM was treated with oxalyl de (1.5 eq.) for 1 h at 3°C. The reaction mixture was trated under reduced pressure, dissolved in DCM and added to a soln. of (R)—pyrrolidinol hydrochloride (1.0 eq.) and Et3N (2.5 eq.) in DCM at 3°C. The resulting mixture was stirred vigorously at 3°C for 1h, then concentrated under d pressure. The residue was treated with EtOAc and filtered. The residue was washed with EtOAc, and the combined filtrates were concentrated under d pressure and purified by flash tography. ii. A soln. of a commercial acid chloride (1.0 eq.) in DCM was added to a soln. of (R)- pyrrolidinol hydrochloride (1.0 eq.) and Et3N (2.5 eq.) in DCM at 3°C. The resulting mixture was stirred vigorously at 3°C for 1 h, then concentrated under reduced pressure. The residue was treated with EtOAc and filtered. The residue was washed with EtOAc, and the combined tes were concentrated under reduced pressure and purified by flash chromatography.

Typical conditions for amid bond formation reactions are exemplified in the section B) Amide bond formation conditions below. b) The mesylates of compounds of general formula II were prepared by costumary conditions, perferably by reaction of II with methane sulfonyl chloride (2 eq.) and Et3N (2 eq.) in DCM at 0°C. c) Compounds of general a V were prepared by reacting 3,4-dihydro—2H- benzo[1,4]oxazinol IV with compounds of general formula III in the presence of a suitable base such as sodium hydride (NaH) and polar organic solvent such as DMF under inert gas conditions at 50°C. Typical conditions for such reactions are exemplified in the n C) Side chain introduction conditions below. d) Buchwald-Hartwig cross-coupling between V and an aryl halogenide of the general formula RZ-X’ where X’=bromo or iodo was performed under ary ld-Hartwig conditions using a Pd catalyst/ligand ation such as preferably Pd2(dba)3/2- (dicyclohexylphosphino)biphenyl or Pd2(dba)3/2-dicyclohexylphosphino-2’,4’,6’-triisopropyl- yl or bis(tri-t-butylphosphine)palladium and a base, such as preferably NaOtBu, and c solvent such as preferably toluene. The reaction was preferably stirred at a temperature of approximately 80-120°C, ably 110°C and was perferably performed in a microwave reactor. The reaction was preferably carried out under an inert gas such as nitrogen or argon. The final compounds were purified by normal or reversed phase chromatography. Typical conditions for Buchwald-Hartwig cross-coupling reactions are exemplified in the section A) Buchwald aminations or hydroxylations below.

Scheme2 H H N OH a N 0,, 0 [U 11> w 4,0 o o R110 0 VIII IV ‘040 R11=Ms,H N o, O _,. [1304 —»° R2_Xl R2: [I 7 , |\ E 0 I32 (I) OH —> (I)’ d R4 N o, WO 93849 2012/057554 a) (S)-tert-butyl 3-((3,4-dihydro-2H-benzo[b][1,4]oxazinyl)oxy)pyrrolidinecarboxylate (compound VIII) was prepared by reacting hydro—2H-benzo[1,4]oxazinol IV with a compound of l formula VII by one of the following s 1) for X=mesylate, compounds IV and V" were reacted in the presence of a le base such as sodium hydride (NaH) and a polar organic solvent DMF under inert gas ions at room temperature ii) for X = H, compounds of general formula IV and V" were reacted using customary Mitsunobu conditions, preferably using Ph3P (1.4 eq.) and DEAD (1.4 eq.) in organic solvent such as THF under inert gas conditions at a temperature of preferably 70°C.

Typical conditions for such reactions are exemplified in the section C) Side chain introduction conditions below. b) Buchwald-Hartwig cross-coupling between VIII and an aryl halogenide of the general formula RZ-X’ where X’=bromo or iodo was performed under customary Buchwald-Hartwig conditions using a Pd catalyst/ligand combination such as preferably Pd2(dba)3/X-Phos, Pd2(dba)3/(rac)-B|NAP, Pd(OAc)2/(rac)-B|NAP or bis(tri-t-buty|phosphine)palladium and a base, such as preferably NaOtBu, Cs2003 or K3PO4 and an organic t such as preferably toluene, dioxane or TH F. The reaction was preferably stirred at a ature of approximately 60-120°C and was perferably be performed in a microwave reactor. The reaction was preferably carried out under an inert gas such as nitrogen or argon. Typical conditions for Buchwald-Hartwig cross-coupling reactions are exemplified in the n A) Buchwald aminations or ylations below. c) N-BOC ection of compounds of general formula IX was performed under customary BOC deprotection conditions using among the possible acids preferably trifluoro-actetic acid and organic solvent, preferably DCM. The reactionwas preferably med at room temperature. d) A compound of the general formula X and an acid chloride of formula R4C(O)Cl or a carboxylic acid of formula formula R4C(O)OH wereare reacted to prepare an amide of general a VI using costumary amide coupling conditions: in addition to the methods decribed in Scheme 1, step a) preferred coupling reagents were HBTU, HOBt/EDC, COMU/DIPEA. The couplings were performed in an organic solvent such as preferably DMF or DCM and the final compounds were purified by normal or ed phase chromatography. Typical conditions for amid bond formation reactions are exemplified in the section B) Amide bond formation conditions below.

Scheme3 H H N OH a N o../ [O —> IO M O 0 F32 F32 b N o../ C #10 N OH /\,<8' #10 RZ-X' O O 2 ,' R 7 - x R X" \ XIII d IN 0, O \ 'I t 0 mR I, \O O a) hydro-2H-benzo[1,4]oxazinol IV was O-protected using standard silylation procedures, using a silylating reagent, preferably TBDMSCI and a base, preferably NaH, in an organic solvent, preferably THF at room ature. b) Buchwald-Hartwig cross-coupling between XI and an aryl halogenide of the general formula RZ-X’ where X’=bromo or iodo was performed under customary Buchwald-Hartwig conditions using a Pd catalyst/ligand combination such as preferably Pd2(dba)3/X-Phos, Pd2(dba)3/dicyclohexylphosphino—2’,4’,6’-triisopropylbiphenyl or bis(tri-t-butylphosphine)— palladium and a base, such as preferably NaOtBuand an organic solvent such as preferably toluene. The reaction was preferably d at a temperature of approximately 0°C and was ably performed in a microwave reactor. The reaction was preferably carried out under an inert gas such as nitrogen or argon. Typical conditions for Buchwald-Hartwig cross-coupling reactions are exemplified in the section A) Buchwald ions or hydroxylations below. c) O-TBDMS deprotection of compounds of general formula XII was performed under customary deprotection conditions using perferably TBAF and an organic solvent, ably THF. The reaction was ably performed at room temperature 2012/057554 d) Compounds of general formula Xlll were coupled with mesylates of general formula III using a suitable base such as preferably sodium hydride (NaH) or K2C03 and polar c solvent such as DMF under inert gas ions at room temperature or elevated atures up to 100°C. The final compounds were purified by normal or reversed phase chromatography. Typical conditions for such reactions are exemplified in the section C) Side chain introduction conditions below.

Scheme 4 R2 R2 N OH 0 a N 0,, E U E U FH JVW 0 0 O XI" R11/0TINJ< VII W O W=O,CH2 R11=Ms,H R2: I, 7 , \ '32 R2 b c . ~10 VIM—TU?“N O,’ N O 0 W 4 o w R w a) Compounds of general formula Xlll (prepared as described in Scheme 3) were reacted with nds of general formula by one of the following methods 1) for X=mesylate, compounds XIII and VII were reacted in the presence of a suitable base such as sodium hydride (NaH) and a polar organic solvent DMF under inert gas conditions at room temperature ii) for X = H, compounds of general formula XIII and VII were reacted using customary Mitsunobu ions, preferably using Ph3P (1.4 eq.) and DEAD (1.4 eq.) in organic solvent such as THF under inert gas conditions at a temperature of preferably 70°C.

Typical conditions for such reactions are exemplified in the section C) Side chain introduction conditions below. b) N-BOC deprotection was performed under customary BOC deprotection ions using among the possible acid preferably trifluoro-actetic acid and organic solvent preferably CH2C|2. The reaction was preferably performed at room temperature. c) Amide bond formation was performed using compounds of general formula XV and an acid chloride of formula R4C(O)Cl or carboxylic acid of formula OH to prepare an amide of general formula VI; customary amide bond ng conditions, as described in Scheme 1, step a) have been used. In addition to the methods decribed in Scheme 1, step a), ng of carboxylic acids using HOBt/EDC or coupling using chloroformates or carbamic chlorides were used. The couplings were performed in an organic solvent such as preferably DMF or DCM and the final compounds were purified by normal or reversed phase chromatography. Typical conditions for amid bond formation ons are exemplified in the section B) Amide bond formation conditions below.

Scheme5 H H o N Cl a N Cl T U a / b / E \l —> o o RZ-X' XVI XVII R2: ’1' 7 , |\ F52 F52 N Cl \ C N OH E I /N E I O o XVIII mx d F5 R2 R2 [{1 O f Ill 0 O I \ \ I 0H —» E l 044 2012/057554 a) 7-Chloro—2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine XVII was prepared from ro-1H- [3,4-b][1,4]oxazinone XVI by costumary reduction methods, using as reducing agent ably BH3*THF and as solvent preferably THF. XVI is available via flow nitration of 2- ch|oro(2-methoxyoxoethoxy)pyridineoxide, ed by reduction and cyclisation. b) Cross-coupling between XVII and an aryl halogenide of the general a RZ-X’ where X’=bromo or iodo was performed under customary Buchwald-Hartwig conditions using a Pd catalyst/ligand combination such as preferably Pd2(dba)3/X-Phos, and a base, such as preferably Cs2003 and an c t such as preferably dioxane. The reaction was ably stirred at a temperature of approximately 100°C and could be performed in a microwave reactor. The reaction was preferably carried out under an inert gas such as nitrogen or argon. l conditions for Buchwald-Hartwig cross-coupling reactions are ified in the section A) Buchwald aminations or hydroxylations below. c) Hydroxylation of XVIII was performed using aq. KOH and a Pd catalyst/ligand combination such as preferably Pd2(dba)3/tetramethyl-tert-butyI-Xphos and an organic solvent such as preferably dioxane. The reaction was preferably stirred at a temperature of approximately 100°C. The reaction was preferably carried out under an inert gas such as nitrogen or argon. d) Coupling of a compound of general formula XIX with a compound of general formula VII was performed using a suitable base such as sodium hydride (NaH, CSzCOs, K2003) and polar organic solvent such as DMF under inert gas conditions at a temperature of perferably 60-80°C. Typical conditions for such reactions are exemplified in the section C) Side chain introduction conditions below. e) N-BOC ection was performed under customary BOC deprotection conditions using among the possible acid preferably oro-actetic acid and organic solvent preferably CHZCIZ. The reaction was preferably med at room temperature. f) Amide bond formation was performed using compounds of general formula XXI and an acid chloride of formula R4C(O)C| or carboxylic acid of formula R4C(O)OH to prepare an amide of general formula XXII; customary amide bond coupling conditions, as described in Scheme 1, step a) have been used, in addotion coupling of carboxylic acids using DC was applied. The couplings were performed in an organic t such as preferably DMF or DCM and the final compounds were purified by normal or reversed phase chromatography.

Typical conditions for amid bond formation reactions are exemplified in the section B) Amide bond formation conditions below.

Scheme 6 E:UC _> E:Uig o m. O‘S‘Dfldot N4: Ill 0 0 \ 4 /N I N 0% R2_X' /N R2 = R7 xx ’ \ N e E O O \ 0,“ \ ,, | CNH ——> E | CW44 XXII a) Hydroxylation of 7-chloro-2,3-dihydro-1 H-pyrido[3,4-b][1,4]oxazine XVII to give 2,3- dihydro-1H-pyrido[3,4-b][1,4]oxazinol XXIII was performed using aq. KOH and a Pd catalyst/ligand ation such as preferably Pd2(dba)3/tetramethyl-tert-butyl-Xphos and an organic solvent such as preferably dioxane. The reaction was preferably stirred at a temperature of approximately 100°C. The reaction was preferably carried out under an inert gas such as nitrogen or argon. b) Coupling of compound XXIII with mesylate VII was effected using a suitable base such as sodium hydride (NaH) and polar organic solvent such as DMF under inert gas conditions at a temperature of preferably 80°C. l conditions for such reactions are exemplified in the section C) Side chain introduction conditions below. c) Cross-coupling n XXIV and an aryl halogenide of the general formula RZ-X’ where mo or iodo was performed under customary ld-Hartwig conditions using a Pd catalyst/ligand combination such as preferably Pd2(dba)3/X-Phos or Pd2(dba)3/(rac)-B|NAP, and a base, such as preferably Cs2C03 or NaOtBuand an organic solvent such as preferably e or toluene. The reaction was preferably stirred at a temperature of approximately 100°C and could be performed in a microwave reactor. The on was preferably carried out under an inert gas such as nitrogen or argon. Typical conditions for Buchwald-Hartwig cross-coupling ons are exemplified in the section A) Buchwald aminations or hydroxylations below. d) N-BOC deprotection was performed under customary BOC deprotection conditions using among the possible acid preferably trifluoro—actetic acid and organic solvent preferably CH2C|2. The reaction was preferably performed at room temperature e) Amide bond formation was performed using compounds of l formula XXI and an acid chloride of formula R4C(O)Cl or carboxylic acid of formula R4C(O)OH to prepare an amide of general a XXII; customary amide bond coupling conditions, as described in Scheme 1, step a) have been used or coupling of carboxylic acids using HBTU, HOBt/EDC or HATU was applied. The couplings were performed in an organic solvent such as preferably DMF or DCM and the final nds were purified by normal or reversed phase chromatography. Typical conditions for amid bond formation ons are ified in the section B) Amide bond formation conditions below.

General chromatography information LCMS method M1 (Rtm) HPLC-column dimensions: 2.1 x 50 mm HPLC-column type: Acquity UPLC HSS T3, 1.8 pm luent: A) water + 0.05 Vol.-% formic acid + 3.75 mM ammonium acetate B) ACN + 0.04 Vol.-% formic acid HPLC-gradient: 2 - 98% B in 1.4 min, 98% B 0.45 min, flow = 1.2 ml / min olumn temperature: 50 0C LCMS method M2 (RtMZ) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18, 2.7 pm HPLC-eluent A) water + 0.05 Vol.-% formic acid + 3.75 mM ammonium acetate B) ACN + 0.04 Vol.-% formic acid HPLC-gradient: 2 - 98% B in 1.4 min, 0.75 min 98% B, flow = 1.2 ml / min HPLC-column temperature: 50 °C LCMS method M3 (RtM3) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18, 2.7 pm HPLC-eluent A) water + 0.05 Vol.-% formic acid + 3.75 mM ammonium acetate B) ACN + 0.04 Vol.-% formic acid HPLC-gradient: 2 - 98% B in 8.5 min, 1 min 98% B, flow = 1.2 ml / min HPLC-column temperature: 50 °C LCMS method M4 (RtM4) HPLC-column ions: 4.6 x 50 mm HPLC-column type: SunFire C18, 5 pm luent A) water + 0.1 Vo|.-% TFA, B) ACN + 0.1 Vo|.-% TFA HPLC-gradient: 5 - 100% B in 8.0 min B, flow = 2 ml / min HPLC-column temperature: 40 °C LCMS method M5 (RtM5) HPLC-column ions: 0.46x25 cm HPLC-column type: Chiralcel OJ-H (1189) HPLC-eluent EtOH/MeOH 60:40 HPLC-gradient: isocratic, flow=0.5mI/min Detector: UV 220 nm LCMS method M6 (RtMG) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis s C18, 2.7 pm HPLC-eluent A) water + 0.05% TFA, B) ACN + 0.04% TFA HPLC-gradient: 2 - 98% B in 1.4 min, 0.75 min 98% B, flow = 1.2 ml / min HPLC-column temperature: 50 °C LCMS method M7 (RtM7) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18, 2.7 pm HPLC-eluent A) water + 0.05% TFA, B) ACN + 0.04% TFA HPLC-gradient: 10 - 95% B in 3.0 min, 1 min 95% B, flow =1.2 m| / min HPLC-column temperature: 50 °C LCMS method M8 (Rtmg) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18 2.7 pm luent: A) water + 0.05% formic acid + 3.75 mM ammonium acetate, B) acetonitrile +0.04% formic acid HPLC-gradient: 10 - 95% B in 3.0 min, flow =1.2 mI/min LCMS method M9 (RtMQ) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18 2.7 pm HPLC-eluent: A) water + 0.05% formic acid + 3.75 mM ammonium acetate, B) acetonitrile +0.04% formic acid radient: 10% B from 0.0 to 0.5 min then from 0.5 min to 3.0 min gradient 10 - 95% B, flow = 1.2 ml/min LCMS method M10 (Rtmo) HPLC-column dimensions: 2.1 x 50 mm HPLC-column type: Acquity UPLC BEH C181.7 pm HPLC-eluent: A) water + 0.1 Vo|.-% formic acid, B) acetonitrile HPLC-gradient: 20 - 25% B in 1.00 min, then 25 - 95% B in 3.20 min, then 95 - 100% B in 0.10 min, then 100% for 0.20 min, flow = 0.7 mI/min LCMS method M11 (Rtwm) HPLC-column dimensions: 2.1 x 50 mm HPLC-column type: Acquity UPLC BEH C181.7 pm HPLC-eluent: A) water + 0.1 Vo|.-% formic acid, B) acetonitrile HPLC-gradient: 5 -10% B in 1.00 min, then 10 - 90% B in 3.00 min, then 90 - 100% B in 0.10 min, then 100% for 0.40 min, flow = 0.7 mI/min LCMS method M12 (Rtmz) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18 2.7 pm HPLC-eluent: A) water + 0.1 Vo|.-% TFA, B) itrile radient: 10 -95% B over 1.7 min and 1.2 mL/min as solvent flow and then 95 5 B over 0.7 min, flow = 1.4 mL/min.

LCMS method M13 (Rtm13) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: is Express C18 2.7 pm HPLC-eluent: A) water + 0.05% formic acid + 3.75 mM ammonium acetate, B) acetonitrile +0.04% formic acid HPLC-gradient: 10 - 95% B in 3.7 min, flow =1.2 m| / min LCMS method M14 (Rtm4) HPLC-column dimensions: 2.1 x 30 mm HPLC-column type: Ascentis Express C18, 2.7 pm luent A) water + 0.05% formic acid + 3.75 mM ammonium acetate, B) acetonitrile +0.04% formic acid HPLC-gradient: 10 - 95% B in 1.5 min, 1 min 95% B, flow = 1.2 ml / min LCMS method M15 (Rtms) HPLC-column dimensions: 5 cm HPLC-column type: Chiralcel OD-H (1194) HPLC-eluent Hexan/EtOH 50:50 + 0.05% DEA HPLC-gradient: isocratic, flow=0.5mI/min or: UV 220 nm LCMS method M16 (Rtms) HPLC-column dimensions: 2.1 x 50 mm HPLC-column type: Acquity UPLC HSS T3, 1.8 pm luent: A) water + 0.05 Vol.-% formic acid + 3.75 mM ammonium acetate B) ACN + 0.04 Vol.-% formic acid HPLC-gradient: 5 - 98% B in 1.4 min, 98% B 0.4 min, flow = 1.0 ml / min HPLC-column temperature: 60 oC X-ray Powder Diffraction Instrumentation: Method X1 Instrument Bruker D8 GADDS Discover Irradiation CuKoc (40 kV, 40 mA) Detector Hl-STAR Area detector Scan range 6°-39° (2 theta value) Melting Point determination: Melting point was ined by Differential Scanning calorimetry (DSC). DSC was as recorded on a TA Instruments DSC Q2000 using a heating rate of 10°C/min. A sample of 0.6 mg was weighed into standard ium pan (pan + lid, TA 900786.901, 900779.901). The instrument was operated using the Thermal Advantage Q-Series software V.2.6.0.367 and the Thermal Advantage software v4.6.9. Thermal events were characterized using Universal is V4.3A Build 4.3.0.6. The s was measured against sample pan without pin hole. The sample was treated according to the protocol below: Step 1: BRATE AT 0°C Step 2: Ramp 10°C/min to 300°C Preparation of examples Where it is stated that nds were prepared in the manner described for an earlier example, the skilled person will appreciate that reaction times, number of lents of reagents and reaction temperatures may be modified for each specific reaction, and that it may heless be necessary or desirable to employ different work-up or purification conditions.

EU 0N 0,,“ g7 Example A1: (S)-(3-((4-(6-methoxymethylpyridinyl)-3,4-dihydro-2H- benzo[b][1,4]oxazinyl)oxy)pyrrolidiny|)(tetrahydro-2H-pyranyl)methanone (according to Scheme 1) a1) (R)-(3-hydroxypyrrolidiny|)(tetrahydro-2H-pyranyl)methanone A stirred on of tetrahydro-2H-pyrancarboxylic acid (CAS registry 53371) (0.200 g, 1.537 mmol) and DMF (0.012 ml, 0.154 mmol) in DCM (3 ml) was treated with oxalyl chloride (0.202 ml, 2.305 mmol) at 3°C. After 1 h at 3°C, the reaction mixture was concentrated under reduced pressure. The residue was then dissoved in DCM (2 ml), and added to a stirred solution of (R)—pyrrolidinol hydrochloride (CAS registry 1047060) (0.190 g, 1.537 mmol), Et3N (0.535 ml, 3.84 mmol) in DCM (3 ml) at 3°C. After 1 h at 3°C, the reaction mixture was concentrated under reduced pressure. The residue was treated with EtOAc (10ml) and filtered. The residue was washed with EtOAc, and the combined filtrates were concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel (DCM / ol gradient) to provide the title nd as a white solid.

ESIMS: 200 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 4.51-4.50 (m, 1H), 4.10-4.02 (m, 2H), 3.77-3.40 (m, 6H), 2.70- 2.53 (m, 1H), 2.20-1.85 (m, 4H), 1.75-1.59 (m, 3H). alternative method a2: d of preparing the acid chloride in situ, a commercially available acid chloride like oyl chloride (CAS registry 798) was used. b1) (R)(tetrahydro-2H-pyrancarbonyl)pyrrolidinyl methanesulfonate A stirred solution of (R)-(3-hydroxypyrrolidinyl)(tetrahydro-2H-pyranyl)methanone (0.245 g, 1.230 mmol) in DCM (10 ml) was treated with Et3N (0.343 ml, 2.459 mmol) and methanesulfonyl chloride (0.192 ml, 2.459 mmol) at 0 °C. After 1 h at 0 °C, water (20 ml) was added. The c layer was washed with a saturated NaCl solution (20 ml), dried with MgSO4, filtered and concentrated under reduced pressure. The crude product was purified by trituration with diethyl ether to provide the title compound as a white solid.

ESIMS: 278 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 5.29 (m, 1H), 4.10-4.02 (m, 2H), 3.94-3.87 (m, 1H), 3.82- 3.56 (m. 3H), 3.52-3.41 (m, 2H), .04 (m, 3H), 2.70-2.10 (m, 3H), 2.02-2.87 (m, 2H), .57 (m, 2H). c1) (S)-(3-((3,4-dihydro-2H-benzo[b][1,4]oxazinyl)oxy)pyrrolidiny|)(tetrahydro-2H- pyranyl)methanone A stirred solution of 3,4-dihydro-2H-benzoxazinol (CAS registry 260218) (0.140 g, 0.926 mmol) in DMF (3 ml) was d with sodium hydride (60% in mineral oil, 0.445 g, 1.111 mmol) at rt. After 10 min at rt, (R)(tetrahydro-2H-pyrancarbonyl)pyrrolidinyl methanesulfonate (0.283 g, 1.019 mmol) was added. The vial was capped and heated to 50°C for 3 h. After this time, the reaction mixture was concentrated under reduced pressure.

The residue was dissolved in EtOAc (50 ml), and water (50 ml) was added. The organic layer was washed with a saturated NaCl solution (20 ml), dried with MgSO4, filtered and concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel (DCM / methanol gradient) to provide the title compound as a grey amorphous solid.

HPLC Rtm10= 2.07 min; ESIMS: 333 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 6 6.55-6.50 (m, 1H), 6.15-6.11 (m, 1H), 6.07-6.00 (m, 1H), .77 (br s, 1H), 4.88-4.74 (m, 1H), 4.06-4.01 (m, 2H), 3.90-3.22 (m, 10H), 2.75-2.58 (m, 1H), 2.15-1.95 (m, 2H), 1.65-1.45 (m, 4H). d1 ) (S)-(3-((4-(6-methoxymethylpyridinyl)-3,4-dihydro-2H-benzo[b][1,4]oxazin yl)oxy)pyrrolidiny|)(tetrahydro-2H-pyranyl)methanone A stirred solution of (S)-(3-((3,4-dihydro-2H-benzo[b][1,4]oxazinyl)oxy)pyrrolidin y|)(tetrahydro-2H-pyranyl)methanone (0.050 g, 0.150 mmol) in toluene (1 ml) was treated with 5-bromo—2-methoxymethylpyridine (CAS registry 7602072) (0.030 g, 0.150 mmol), NaOtBu (0.022 g, 0.226 mmol), 2-(dicyclohexylphosphino)biphenyl (CAS registry 2479403) and Pd2(dba)3 (0.004 g, 0.005 mmol) at rt under argon. The reaction vial was capped and heated to 110°C in a microwave reactor for 3 h. After this time, the reaction mixture was concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel (cyclohexane/ EtOAc gradient) to provide the title compound as an off-white solid.

HPLC RtWO: 2.85 min; ESIMS: 454 [(M+H)+]. 1H NMR (400 MHz, CD30D): 5 7.90-7.85 (m, 1H), 7.49-7.44 (m, 1H), 6.76-6.69 (m, 1H), .24 (m, 1H), .02 (m, 1H), 4.86-4.73 (m, 1H), 4.29-4.23 (m, 2H), 4.02-3.92 (m, 5H), 3.80-3.40 (m, 8H), 2.85-2.60 (m, 1H), 2.25-1.91 (m, 5H), .50 (m, 4H). alternative method d2: 2-(dicyclohexylphosphino)biphenyl (CAS registry 2479403) was replaced with 2-dicyclohexylphosphino-2’,4’,6’-triisopropylbiphenyl (CAS registry alternative method d3: 2-(dicyclohexylphosphino)biphenyl (CAS registry 2479403) and a)3 was replaced with bis(tri-t—butylphosphine)palladium (CAS registry 531998) es A2 to A43: The compounds listed in Table 1 were prepared by a procedure analogous to that used in Example A1.

HPLC Rt Compound [min] (method) 2.50 (M10) -{6-[(S)—1-(Tetrahydro—pyrancarbonyl)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}-pyridine—3-suIfonic acid ylamide Synthetic route used: a1, b1, 01, d1 (intermediate |A13) 1.10 (M12) ((S){4-[5-(Morpho|inesulfony|)-pyridiny|]- 3,4-dihydro-2H-benzo[1,4]oxazinyloxy}- pyrrolidiny|)-(tetrahydro—pyranyl)— methanone Synthetic route used: a1, b1, 01, d1 (intermediate |A14) 1.78 (M10) 469 {(S)—3-[4-(6-Methy|—5-nitro-pyridinyl)—3,4- o—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d1 (intermediate |A15) 1.03 (M10) 425 {(S)[4-(6-Methy|—pyridinyl)—3,4-dihydro—2H- benzo[1,4]oxazinyloxy]—pyrro|idiny|}- (tetrahydro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d1 (intermediate |A16) (Tetrahydro-pyranyl)-{(S)—3-[4-(5- 1'21 (M12) 479 trifluoromethyI-pyridinyl)—3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy]—pyrro|idiny|}- methanone Synthetic route used: a1, b1, 01, d1 (intermediate |A18) 2.44 (M10) 435 -{6-[(S)—1-(Tetrahydro-pyrancarbony|)- pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Synthetic route used: a1, b1, 01, d2 (intermediate |A17) 1.46 (M8) 432 1-{(S)[4-(6-MethanesulfonyI-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-yl}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A40) 2.80 (M10) 409 2-Methoxy[6-((S)—1-propiony|—pyrrolidin y|0Xy)-2,3-dihydro-benzo[1,4]oxazin—4—y|]- nicotinonitrile tic route used: a2, b1, 01, d2 (intermediate |A12) 2.74 (M11) 452 1-{(S)[4-(6-MethoxytrifluoromethyI-pyridin- 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A21) 2.86 (M10) 402 1-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A10) 3.00 (M10) 418 1-{(S)[4-(5-Ch|oromethoxy—pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A11) 2.93 (M10) 398 1-{(S)[4-(6-Methoxy—5-methyI-pyridinyl)- 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A9) 1.98 (M10) 399 1-{(S)—3-[4-(6-Aminomethoxy-pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A46) 2.76 (M10) 490 2-Methoxy-N,N-dimethyI[6-((S)propiony|— pyrrolidinyloxy)—2,3-dihydro-benzo[1,4]oxazin- 4-y|]-benzenesu|fonamide tic route used: a2, b1, 01, d2 (intermediate |A60) 2.56 (M10) 461 1-{(S)—3-[4-(3-MethanesuIfonyImethoxy- phenyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrro|idiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A59) 2.67 (M10) 437 1-{(S)—3-[4-(6-AminotrifluoromethyI-pyridin y|)-3,4-dihydro-2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a2, b1, 01, d2 (intermediate |A23) 1.60 (M9) 546 {4-[6-Methoxy(4-methyI-piperazine— 1-su|fony|)-pyridinyl]—3,4-dihydro—2H- benzo[1,4]oxaziny|oxy}-pyrro|idiny|)- propanone Synthetic route used: a2, b1, 01, d3 (intermediate |A24) 1.32 (M9) 424 {(S)[4-(2-MethyI-pyridiny|)-3,4-dihydro—2H- benzo[1,4]oxazinyloxy]—pyrro|idiny|}- (tetrahydro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A61) 1.47 (M9) 454 {(S)—3-[4-(6-MethoxymethyI-pyridiny|)-3,4- o—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A25) 1-61 (M9) 478 (Tetrahydro-pyranyl)-{(S)—3-[4-(2— trifluoromethyI-pyridiny|)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]—pyrro|idiny|}- methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A63) 1.43 (M9) 440 {(S)—3-[4-(2—Methoxy-pyridiny|)-3,4-dihydro- 2H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- (tetrahyd ro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A62) F K/o 1'57 (M9) 493 {(S)—3-[4-(6-AminotrifluoromethyI-pyridin y|)-3,4-dihydro-2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-(tetrahydro-pyrany|)- methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A23) 2.04 (M9) 514 1-((S){4-[4-Methy|—3-(piperidinesu|fony|)- phenyl]—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy}-pyrro|idiny|)-propanone tic route used: a2, b1, 01, d3 (intermediate |A31) 1.83 (M9) 532 1-((S){4-[4-Methoxy(morpho|ine suIfonyl)-pheny|]—3,4-dihydro-2H- benzo[1,4]oxazinyloxy}-pyrro|idiny|)- propanoneSynthetic route used: a2, b1, 01, d3 (intermediate |A32) 1.83 (M9) 503 1-((S){4-[5-(Morpho|inesu|fony|)-pyridin y|]-3,4-dihydro-2H-benzo[1,4]oxazinyloxy}- pyrrolidiny|)-propanone Synthetic route used: a2, b1, 01, d3 (intermediate |A33) 2.22 (M9) 545 {4-[4-Methoxy(4-methyI-piperazine— 1-su|fony|)-pheny|]—3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy}-pyrro|idiny|)- propanone Synthetic route used: a2, b1, 01, d3 (intermediate |A34) 2.08 (M9) 516 1-((S){4-[5-(4-Methy|—piperazine—1-su|fony|)- pyridiny|]-3,4-dihydro-2H-benzo[1,4]oxazin y|oxy}-pyrro|idiny|)-propanone tic route used: a2, b1, c1, d3 (intermediate |A35) 2.82 (M9) 506 2,N-Dimethoxy-N-methyI[6-((S)propiony|— pyrrolidiny|oxy)-2,3-dihydro- benzo[1,4]oxaziny|]-benzenesulfonamide Synthetic route used: a2, b1, c1, d3 (intermediate |A36) 2.69 (M9) 477 -[6-((S)—1-Propiony|—pyrrolidiny|oxy)-2,3- dihydro—benzo[1,4]oxaziny|]—pyridine sulfonic acid methoxy-methyI-amide Synthetic route used: a2, b1, c1, d3 (intermediate |A37) 2.72 (M9) 492 2,N-Dimethoxy[6-((S)—1-propiony|—pyrro|idin- 3-y|oxy)-2,3-dihydro-benzo[1,4]oxaziny|]— esulfonamide Synthetic route used: a2, b1, 01, d3 (intermediate |A65) 2.49 (M9) 379 -[6-((S)—1-Propiony|—pyrrolidiny|oxy)-2,3- dihydro-benzo[1,4]oxaziny|]—nicotinonitrile Synthetic route used: a2, b1, 01, d3 (intermediate |A17) 1.54 (M9) 440 {(S)—3-[4-(5-Methoxy-pyridiny|)-3,4-dihydro- 2H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- (tetrahydro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A38) 1.76 (M9) 444 {(S)—3-[4-(5-Ch|oro-pyridiny|)-3,4-dihydro— zo[1,4]oxazinyloxy]—pyrro|idiny|}- (tetrahydro-pyrany|)-methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A39) 1.24 (M6) 413 1-{(S)—3-[4-(3,4-Dimethoxy-phenyl)-3,4-dihydro- 2H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- propanone Synthetic route used: a1, b1, 01, d3 (intermediate |A66) O 1.02(M6) 404 1-[(S)(4-Quino|iny|—3,4-dihydro-2H- benzo[1,4]oxazinyloxy)—pyrrolidiny|]- propanone Synthetic route used: a1, b1, 01, d3 (intermediate |A54) 1.03 (M6) 432 1-{(S)[4-(5-MethanesulfonyI-pyridiny|)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-propanone Synthetic route used: a1, b1, c1, d3 (intermediate |A55) 1.24 (M6) 422 1-{(S)[4-(5-Trif|uoromethyI-pyridiny|)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-propanone Synthetic route used: a1, b1, c1, d3 (intermediate |A18) 1.13 (M6) 461 -[6-((S)—1-Propiony|—pyrrolidiny|oxy)-2,3- o—benzo[1,4]oxaziny|]—pyridine sulfonic acid dimethylamide Synthetic route used: a1, b1, c1, d3 (intermediate |A13) [wow 1.33 (M6) 392 hyl[6-((S)propionyI-pyrrolidin y|0Xy)-2,3-dihydro-benzo[1,4]oxazin—4—y|]- itrile Synthetic route used: a1, b1, 01, d3 (intermediate |A56) [2000wa 1.44 (M6) 451 1-{(S)[4-(4-Methoxy—3-trifluoromethyI-pheny|)- 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Synthetic route used: a1, b1, 01, d3 (intermediate |A57) 1.82 (M6) 478 (Tetrahyd ro-pyranyl)-{(S)—3-[4-(6- trifluoromethyI-pyridiny|)-3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy]—pyrro|idiny|}- methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A26) o 1.44 (M6) 488 {(S)—3-[4-(6-MethanesulfonyI-pyridinyl)—3,4- dihydro-2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro—pyranyl)—methanone Synthetic route used: a1, b1, 01, d3 (intermediate |A40) EZUO'CN Example B1: -[4-(6-Methanesulfonylmethyl-pyridinyl)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrro|idiny|}-(tetrahydro-pyranyl)-methanone (according to Scheme 2) o870* N4 ,% / IO 0 H H [D/N OH [UN o,,, 0 NaH,DMF,rt,22h 'CN—4 %o o 8) o _N$IJ Br\/5_S Pd23,(dba) XPhos, NaOtBu, N \ dioxane, 110°C, 12h / b) [2003 TFA, DCM, | EtN DCM, I rt 1h / rt, 15 min E21)m N O, O E U o a) (S)(3,4-Dihydro-2H-benzo[1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert- butyl ester A solution of 3,4-dihydro-2H-benzo[1,4]oxazinol (CAS registry 260218) (4.0 g, 26.5 mmol) in DMF (150 ml) was treated with NaH (2.117 g, 52.9 mmol) for 20 min at 20 °C. (R)- anesulfonyloxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry 127423 4) (9.13 g, 34.4 mmol) was added. After stirring for 22 h at rt the reaction mixture was concentrated to dryness, then taken up with EtOAc, filtered through hyflo and the te was washed with sat. aq. Na2003 solution. Combined organic layers were washed with brine, dried over NaZSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica gel (cyclohexane / isopropanol 100:0 to 85:15 in 40 min) to provide the title compound as a yellow oil.

HPLC RtMg=1.84 min; ESIMS: 321 [(M+H)+]. 1H NMR (400 MHz, DMSO): 6.52 (d, 1H), 6.12 (d, 1H), 6.02 (m, 1H), 5.76 (m, 1H), 4.75 (br s, 1H), 4.01-40.5 (m, 2H), .50 (m, 4H), 3.22-3.26 (m, 2H), 1.95-2.08 (m, 2H), 1.39 (m, 9H). 2012/057554 b) (S)[4-(6-Methanesulfonylmethyl-pyridiny|)-3,4-dihydro-2H-benzo[1,4]oxazin- 6-yloxy]-pyrrolidinecarboxylic acid tert-butyl ester A mixture of (S)(3,4-dihydro-2H-benzo[1,4]oxazinyloxy)—pyrrolidinecarboxylic acid tert-butyl ester (2.12 g, 6.62 mmol), omethanesulfonylmethyl-pyridine (Intermediate IA1) (2.091 g, 7.94 mmol), NaOtBu (1.272 g, 13.23 mmol), XPhos ligand (0.158 g, 0.331 mmol) and Pd2(dba)3 (0.303 g, 0.331 mmol) in dioxane (3.5 ml) was degassed and stirred for 12 h at 110 °C. Sat. aq. NaHCOs on was added and the reaction mixture was extracted with EtOAc. Combined organic layers were washed with brine, dried over NaZSO4, ed and evaporated. The crude product was purified by flash chromatography on silica gel (cyclohexane / EtOAc 100:0 to 50:50) to provide the title compound.

HPLC 1.25 min; ESIMS: 490 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 8.33 (d, 1H), 7.43 (d, 1H), 6.86 (d, 1H), 6.59 (d, 1H), 6.47 (m, 1H), 4.69-4.73 ), 4.23-4.28 (m, 2H), 3.73-3.78 (m, 2H), 3.41-3.58 (m, 4H), 3.34 (s, 3H), 2.69 (s, 3H), 1.96-2.17 (m, 2H), 1.46 (s, 9H). c) ethanesulfonylmethyl-pyridinyl)((S)-pyrrolidinyloxy)-3,4-dihydro- 2H-benzo[1,4]oxazine A solution of (S)[4-(6-methanesulfonylmethyl-pyridinyl)—3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinecarboxylic acid tert—butyl ester (1.5 g, 3.06 mmol) and TFA (0.236 ml, 3.06 mmol) in DCM (15 ml) was stirred for 1 h at rt. The reaction mixture was cooled down to 0°C, sat. Na2C03 solution was added and the reaction mixture was extracted with DCM. Combined organic layers were dried over NaZSO4, filtered and evaporated to provide the title compound.

HPLC RtM2 =0.66 min; ESIMS: 390 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 8.33 (d, 1H), 7.43 (d, 1H), 6.86 (d, 1H), 6.58 (d, 1H), 6.47 (m, 1H), 4.68 (m, 1H), 4.22-4.27 (m, 2H), 3.73-3.78 (m, 2H), 3.33 (s, 3H), 3.12-3.22 (m, 2H), 2.86-3.04 (m, 2H), 2.68 (s, 3H), 1.88-2.08 (m, 2H). d) {(S)[4-(6-Methanesulfonylmethyl-pyridiny|)-3,4-dihydro-2H-benzo[1,4]oxazin- 6-yloxy]-pyrrolidiny|}-(tetrahydro-pyranyl)-methanone A mixture of 4-(6-methanesulfonylmethyl-pyridinyl)—6-((S)—pyrrolidinyloxy)—3,4- dihydro-2H-benzo[1,4]oxazine (0.085 g, 0.218 mmol), tetrahydro-2H-pyrancarbonyl chloride (CAS registry 401910) (0.049 mg, 0.327 mmol) and Et3N (0.046 ml, 0.327 mmol) in DCM (4 ml) was stirred at rt for 15 min. The reaction mixture was concentrated to dryness.

The crude product was purified by prep. RP-HPLC (column SunFire C18, H20 + 0.1% TFA/ ACN + 0.1% TFA 90:10 to 30:70 in 12 min) to provide the title compound as a white solid.

HPLC RtM7=1.62 min; ESIMS: 502 +]. 1H NMR (400 MHz, DMSO): 6 8.38-8.42 (m, 1H), 7.72 (m, 1H), 6.84 (d, 1H), 6.67 (m, 1H), 6.50-6.57 (m, 1H), 4.82-4.94 (m, 1H), 4.20 (m, 2H), 3.31 (s, 3H), 3.28-3.88 (m, 10H), 2.59- 2.73 (m, 1H), 2.56 (s, 3H), 1.95-2.13 (m, 2H), 1.44-1.62 (m, 4H).

Examples B2 to B122: The compounds listed in Table 2 were prepared by a procedure analogous to that used in Example B1.

Table 2 HPLC Rt MS nd I Example [min] [mlz; Reaction Conditions (method) (M+1)+] {(S)—3-[4-(6-Ethoxymethyl-pyridinyl) 3,4dihydro-2H-benzo[1,4]oxazinyloxy]— pyrrolidiny|}-(tetrahydro-pyranyl)- methanone Buchwald amination condition: CA6 Amide bond condition: CB6 Side chain introduction ion: CC2 Precursors used: CAS 260218 ,127423 4, lA19, 401910 4-[6-((S)—1-Propiony|—pyrrolidinyloxy)—2,3- dihydro—benzo[1,4]oxaziny|]—pyridine carbonitrile Buchwald amination condition: CA12 Amide bond condition: CB6 Side chain introduction condition: Precursors used: CAS 260218 ,127423 4, IA30, 79—03-8 1-{(S)—3-[4-(5,6-Dimethoxy-pyridinyl)—3,4- o—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-yl}-propanone Buchwald amination condition: CA8 Amide bond condition: CB6 Side chain introduction condition: CCZ sors used: CAS 260218 ,127423 4, IA31, 79—03-8 1-((S){4-[5-(Propanesu|fony|)-pyridiny|]— 3,4-dihydro—2H-benzo[1,4]oxazinyloxy}- pyrrolidiny|)-propanone Buchwald amination condition: CA8 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218 ,127423 4, |A30, 79—03-8 ‘S\ N O K/o ((S)—3-{4-[5-(Propane—2—su|fony|)-pyridiny|]— 3,4-dihydro—2H-benzo[1,4]oxazinyloxy}- pyrrolidinyl) -(tetrahydro-pyrany|)-methanone Buchwald amination ion: CA8 Amide bond condition: CB6 Side chain uction condition: CCZ Precursors used: CAS 260218 ,127423 4, |A30, 40191-32—0 -[4-(6-EthanesuIfinyl-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyrany|)-methanone Buchwald amination condition: CA13 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218 ,127423 4, |A58, 401910 {(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-(1-methy|—1H-imidazoIy|)- methanone Buchwald amination condition: CA14 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 3 4, |A1,41716-18—1 {(S)—3-[4-(6-MethanesuIfonyImethoxy-pyridin- 3-y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— idiny|}-(tetrahydro-pyrany|)- methanone Buchwald amination ion: CA14 Amide bond condition: CB6 Side chain introduction ion: CCZ Precursors used: CAS 260218 ,127423 4, |A45, 401910 (4,4-Difluoro-cyclohexyl)-{(S)—3-[4-(6- methanesuIfonyImethoxy-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-methanone Buchwald amination condition: CA14 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218 ,127423 4, |A45, 1226658 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran S)[4-(5-f|uoromethoxy-pyridiny|)- 167 (M8) 506 3,4-dihydro—2 H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A10 / 640963 {(S)—3-[4-(5-Ch|oromethoxy-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1'80 (M8) 522’ 524 1-y|}-(1, 1-dioxo—hexahydro—1|ambda*6*—thiopyrany|)- methanone ld amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 4/ |A11 /640963 1 00 (1,1-Dioxo—tetrahydro-1|ambda*6*—thiophen y|)-{(S)[4-(6-methoxymethyI-pyridiny|)- 1J4 (M8) 488 3,4-dihydro—2 H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- methanone Buchwald amination condition: CA16 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 4/ |A9 /47855 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran y|)-{(S)[4-(6-methoxy—5-trifluoromethyI-pyridin- 1-95 (M8) 556 3-y|)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain uction condition: CCZ Precursors used: CAS 260218 / 4 / |A21 /640963 1 01 {(S)—3-[4-(6-Methoxymethyl-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-89 (M7) 440 1-y|}-(tetrahydro-furanyl)—methanone Buchwald amination condition: CA6 Amide bond ion: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A9 / 893648 Chiral separation: CD9 {(S)—3-[4-(6-Methoxymethyl-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-89 (M7) 440 1-y|}-(tetrahydro-furanyl)—methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction ion: CCZ Precursors used: CAS 260218 / 127423-614 / |A9 / 893648 Chiral separation: CD9 1 02 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran 1.88 (M8) 516 y|)-{(S)[4-(6-ethoxymethyI-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB7 Side chain introduction condition: CC2 Precursors used: CAS 57-8 / 127423 4 / IA19 / 87-3 ({(S)—3-[4-(5-F|uoromethoxy-pyridinyl)—3,4- 1.86 (M7) 458 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(te trahydro-pyrany|)-methanone Buchwald amination condition: CA6 Amide bond ion: CB6 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4 / |A10 / 401910 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran y|)-{(S)[4-(5-ethy|—6-methoxy-pyridiny|)-3,4- 1.04 (M2) 516 dihyd ro-2H -benzo[1,4]oxazinyloxy]—pyrro|idiny|}- methanone Buchwald ion condition: CA8 Amide bond condition: CB1 Side chain uction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A48 / 640963 {(S)—3-[4-(6-MethoxymethyI-pyridinyl)—3,4- 1_70 (M8) 450 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1- methyl-1H-pyrazoIyl)-methanone ld amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A9 / 59521 1 04 {(S)—3-[4-(6-MethoxymethyI-pyridinyl)—3,4- 1.87 (M8) 450 o—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1- methyl-1H-pyrazoIyl)-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A9 / 250160 {(S)—3-[4-(6-MethanesulfonyImethyI-pyridin 0.85 (M6) 495 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidin-1 -y|}-pyridinyI-methanone Buchwald amination ion: CA6 Amide bond condition: CB4 Side chain introduction ion: CCZ Precursors used: CAS 260218 / 127423 4/ |A1 /55-22—1 1 05 {(S)—3-[4-(6-MethanesulfonyImethyI-pyridin 0.92 (M6) 496 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidin-1 -y|}-pyrimidinyI-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 4 / |A1 /45953 {(S)_3_[4-(6-MethanesuIfonyImethyI-pyridin'3' 095 (M6) 485 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidin-1 -y|}-oxazo|y|—methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 57-8 / 127423 4 / |A1 /23012—13-7 1 06 {(S)—3-[4-(6-MethanesulfonyImethyI-pyridin 0.94 (M6) 485 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidin-1 -y|}-oxazo|y|—methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 57-8 / 127423 4/ |A1 / 1189944 (2,2—Dimethyl-tetrahydro-pyranyl)-{(S)—3-[4-(6- 1.01 (M6) 530 methanesuIfonyImethyI-pyridinyl)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-methanone ld amination condition: CA6 Amide bond condition: CB4 Side chain uction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A1 /529162 1 07 (1,1-Dioxo—tetrahydro-1lambda*6*—thiophen yl)-{(S)[4-(6-methoxymethyl-pyridinyl)— 1.62 (M2) 488 3,4-dihydro—2 H-benzo[1,4]oxazinyloxy]—pyrrolidiny|}- methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ sors used: CAS 260218 / 127423 4 / |A9 /47855 Chiral separation : CD8 (1,1-Dioxo—tetrahydro-1lambda*6*—thiophen S)[4-(6-methoxymethyl-pyridinyl)— 1.62 (M2) 488 3,4-dihydro—2 H-benzo[1,4]oxazinyloxy]—pyrrolidiny|}- Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A9 / 47855 Chiral separation: CD8 2012/057554 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran y|)-((S){4-[5-(propanesulfony|)-pyridiny|]- 153 (M6) 564 3,4-dihyd ro-2H-benzo[1,4]oxazinyloxy}-pyrrolidiny|)- methanone Buchwald amination condition: CA8 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A30/ 640963 1.50 (M9) 464 2-Methoxy{6-[(S)—1-(1-methy|-1H-imidazole—4- carbonyl)—pyrrolidinyloxy]—3,3-dideutero—2,3- dihydro—benzo[1,4]oxaziny|}-nicotinonitri|e Buchwald amination ion: CA15 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: ID1, CAS 1274234, |A12, CAS 41716-18—1 {(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin 0.94 (M5) 488 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-(tetrahydro-furany|)- methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218, CAS 1274234, IA1, CAS 893648 0'92 (M6) 462 1-{(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin- 3-y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methoxy-ethanone Buchwald ion condition: CA6 Amide bond condition: CB4 Side chain introduction ion: CCZ Precursors used: CAS 260218, CAS 1274234, IA1, CAS 6256 1'01 (M6) 460 1-{(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin- 3-y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methy|—propanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218, CAS 1274234, IA1, CAS 79—31-2 1.05 (M6) 494 {(S)—3-[4-(6-MethanesulfonyImethyI-pyridin 4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-phenyI-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218, CAS 1274234, IA1, CAS 650 1 1 1 (1,1-Dioxo—tetrahydro-1|ambda*6*—thiophen 0-87 (M2) 536 y|)-{(S)—3-[4-(6-methanesuIfonyImethyl- pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrro|idiny|}-methanone Buchwald amination ion: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ sors used: CAS 260218, CAS 1274234, IA1, CAS 47855 [1,4]DioxanyI-{(S)[4-(6-methanesuIfonyI 0-88 (M2) 504 methyl-pyridinyl)—3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy]—pyrro|idiny|}- Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218, CAS 1274234, IA1, CAS 893640 0'88 (M2) 476 —3-[4-(6-MethanesuIfonyImethyI-pyridin- 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methoxy-propanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: CAS 260218, CAS 1274234, IA1, CAS 25441 0.93 M2( ) 470 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyrany|)-methanone Buchwald amination condition: CA8 Amide bond condition: CB6 Side chain introduction condition: CC2 Precursors used: CAS 260218, CAS 1274234, |A29, acyl chloride 401910 1 13 [jrj‘iiswg 0.91 (M2) 472 {(S)—3-[4-(5,6-Dlmethoxy-pyrldIny|)-3,4-I I I dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-[1,4]dioxany|—methanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A29 / 41-0 0'92 (M2) 456 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-furany|)-methanone Buchwald ion condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A29 / 893648 1 14 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0_91 (M2) 504 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1,1-dioxo—tetrahydro-1|ambda*6*—thiophen- 3-y|)-methanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction ion: CCZ Precursors used: CAS 260218 / 127423 4/ |A29 / 47855 -[4-(6-MethanesulfonyImethyI-pyridin 0-91 (M2) 502 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— idiny|}-(tetrahydro-pyrany|)- methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A1 /8733973 2012/057554 1 15 0.96 M2( ) 470 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyranyl)—methanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4/ |A29 / 8733973 1-{(S)—3-[4-(5,6-Dimethoxy-pyridinyl)—3,4- 0.90 (M2) 430 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}methoxy-ethanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4 / |A29 / 6256 1 16 0.89 M2( ) 492 1-{(S)—3-[4-(5,6-Dimethoxy-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}methanesuIfonyI-propanone Buchwald ion condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 57-8 / 127423 4 / |A29 / 6450 1-{(S)—3-[4-(5,6-Dimethoxy-pyridinyl)—3,4- 0.92 (M2) 444 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}methoxy-propanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A29 / 25441 WO 93849 1 17 0-90 (M2) 518 {(S)'3'[4-(5,6-Dimethoxy—pyridinyl)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- (1,1-dioxo-hexahydro—1|ambda*6*— thiopyrany|)-methanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A29 / 640963 N\O\ N 0H 0 E U N 0 /\ 0.85 (M2) 466 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1-methy|-1H-imidazoIy|)-methanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/IA29/417161 WO 93849 1 18 CyclohexyI-{(S)[4-(6-methanesulfonyI 1-06 (M2) 500 methyl-pyridinyl)—3,4-dihydro—2H- 1,4]oxazinyloxy]—pyrro|idiny|}- methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A1 /98—89—5 0.86 (M2) 516 (4-Hydroxy-cyclohexyl)-{(S)—3-[4-(6- methanesuIfonyImethyl-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A1 /36855 1 19 0.89 M2( ) 516 (4-Hydroxy-cyclohexyl)-{(S)—3-[4-(6- methanesuIfonyImethyl-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A1 /3685-22—1 -[4-(6-MethanesuIfonyImethyI-pyridin 0.88 (M2) y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— 15.13 (CD10) pyrrolidiny|}-(tetrahydro-furany|)- Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ sors used: CAS 260218 / 127423 4/ |A1 /893648 Chiral separation: CD4 {(S)—3-[4-(6-Methanesulfonylmethyl-pyridin 0.88 (M2) yl)—3,4-dihydro—2H-benzo[1,4]oxazinyloxy]— 18.70 (CD10) pyrrolidiny|}-(tetrahydro-furanyl)— methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: CAS 57-8 / 127423 4 / |A1 /893648 Chiral separation: CD4 {(S)—3-[4-(6-Chloromethoxy-pyridinyl)—3,4- 3-21 (M3) 474, 476 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-y|}-(tetrahydro-pyranyl)—methanone Buchwald amination condition: CA9 Amide bond condition: CB6 Side chain uction condition: CC2 Precursors used: CAS 260218 / 127423 4 / |A49 / Acyl chloride: 40191-32—0 3'30 (M3) 418’ 420 1-{(S)[4-(6-Ch|oromethoxy-pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Buchwald amination condition: CA9 Amide bond condition: CB6 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4/ |A49 / Acyl chloride: 798 {(S)—3-[4-(6-Ch|oromethoxy-pyridinyl)—3,4- 302 (M3) 522, 524 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- (1,1-dioxo-hexahydro—1|ambda*6*— thiopyrany|)-methanone Buchwald ion condition: CA9 Amide bond condition: CB5 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 4/ IA49 / 640963 2012/057554 1-{(S)[4-(6-Ch|oromethoxy—pyridinyl)— 0.88 (M2) 434, 436 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}hydroxy-propanone ld amination condition: CA9 Amide bond condition: CB5 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4 / |A49 / 5032 {(S)—3-[4-(6-Ch|oromethyl-pyridinyl)-3,4- 3-36 (M3) 458, 460 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyrany|)-methanone Buchwald amination condition: CA9 Amide bond condition: CB6 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4 / |A50 / Acyl chloride: 40191-32—0 1-{(S)[4-(6-Ch|oromethy|-pyridinyl)—3,4- 3_47 (M3) 402, 404 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-yl}-propanone Buchwald amination condition: CA9 Amide bond ion: CB6 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4 / |A50 / Acyl chloride: 798 {(S)—3-[4-(6-Ch|oromethyl-pyridinyl)-3,4- 3_17 (M3) 506, 508 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1,1-dioxo-hexahydro—1|ambda*6*— thiopyrany|)-methanone Buchwald amination condition: CA9 Amide bond ion: CB5 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4/ |A50 / 640963 [20%le 1-{(S)[4-(6-Ch|oromethy|-pyridinyl)—3,4- 0_91 (M2) 418, 420 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}hydroxy—propanone Buchwald amination ion: CA9 Amide bond condition: CB5 Side chain introduction condition: CC2 sors used: CAS 260218 / 127423 4/ |A50 / 5032 2.59 (M3) 469 {(S)—3-[4-(6-Ch|oromethoxy-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1-methy|-1H-imidazoIy|)-methanone Buchwald amination condition: CA9 Amide bond condition: CB1 Side chain introduction condition: CC2 Precursors used: CAS 260218 / 127423 4/ |A49/41716-18—1 WO 93849 -{(S)[4-(6-Ch|oromethoxy—pyridinyl)— 2.85 (m3) 482, 483 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidine—1-carbony|}-1H-pyridin-2—one Buchwald amination condition: CA9 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A49 / 50066 2.71 (M3) 453 {(S)—3-[4-(6-Ch|oromethyl-pyridinyl)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1-methy|-1H-imidazoIy|)-methanone Buchwald amination condition: CA9 Amide bond condition: CB1 Side chain introduction condition: CCZ sors used: CAS 260218 / 127423 4/ |A50/41716-18—1 2.97 (M3) 466, 468 -{(S)[4-(6-Ch|oromethy|-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidine—1-carbony|}-1H-pyridin-2—one Buchwald amination condition: CA9 Amide bond ion: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A50 / 6-6 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0.88 (M2) 484 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(4-hydroxy-cyclohexy|)-methanone Buchwald amination condition: CA8 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A29 / 36855 {(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin 0.86 (M2) 509 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-(3-methy|—pyridiny|)- methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A1 /4021-12—9 0'77 (M2) 509 1-{(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin- 3-y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}pyridinyI-ethanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain uction condition: CCZ sors used: CAS 260218 / 127423 4/ |A1 /6622—91-9 {(S)—3-[4-(6-Methanesulfonyltrifluoromethyl- 0-93 (M1) 556 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrrolidiny|}-(tetrahydro-pyranyl)— ld amination condition: CA10 Amide bond condition: abbreviate: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A3 / Acyl chloride: 40191-32—0 -[4-(5-Difluoromethylmethanesulfonyl- 0.91 (M1) 538 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald amination condition: CA10 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A4 / Acyl chloride: 40191-32—0 {(S)—3-[4-(5-F|uoromethyImethanesulfonyl- 0-88 (M1) 520 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin yloxy]-pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald amination condition: CA10 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A5 / Acyl chloride: 40191-32—0 [20(00thO {(S)—3-[4-(6-Difluoromethoxymethyl-pyridin 1.07 (M1) 490 yl)—3,4-dihydro-2H-benzo[1,4]oxazinyloxy]— pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald ion ion: CA2 Amide bond ion: CB6 Side chain introduction condition: CC4 Precursors used: CAS 260218 / 109431 0/ |A8 / Acyl chloride: 40191-32—0 2012/057554 1 30 {(S)—3-[4-(6-Difluoromethoxymethyl-pyridin 1.01 (M1) 538 y|)-3,4-dihydro-2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-(1,1-dioxo—hexahydro—6- thiopyrany|)-methanone Buchwald amination condition: CA2 Amide bond condition: CBB Side chain introduction condition: CC4 sors used: CAS 260218 / 109431 0/ |A8 / 640963 {(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin 0.81 (M1) 534 y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— idiny|}-(1-methy|—1H-imidazoIy|)- methanone Buchwald amination condition: CA10 Amide bond condition: CBB Side chain introduction condition: CC4 Precursors used: CAS 260218 / 109431 0/ |A4/41716-18—1 0.88 (M1) 524 {(S)—3-[4-(5-DIfluoromethyImethanesulfonyl-. pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrro|idiny|}-(R)—tetrahydro-furanyl- methanone Buchwald amination condition: CA10 Amide bond ion: CB4 Side chain introduction condition: CC4 Precursors used: CAS 260218 / 109431 0 / |A4 / |B1 -[4-(5-DifluoromethyImethanesulfonyl- 0.88 (M1) 524 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrro|idiny|}-(S)-tetrahydro-furany|— methanone Buchwald amination condition: CA10 Amide bond condition: CB4 Side chain introduction condition: CC4 Precursors used: CAS 260218 / 109431 0 / |A4 / IBZ {(S)—3-[4-(6-Methanesulfonylmethylamino- 0.85 (M1) 517 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald amination condition: CA10 Amide bond condition: CB6 Side chain introduction condition: CC4 Precursors used: CAS 260218 / 109431 0 / |A51 /Acy| chloride: 401910 {(S)—3-[4-(5-Dimethylaminomethanesulfonyl- 0.86 (M1) 531 nyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald amination condition: CA10 Amide bond condition: CB6 Side chain introduction ion: CC4 sors used: CAS 260218 / 109431 0 / |A52 / Acyl chloride: 401910 1 33 {(S)—3-[4-(5-ChIoromethanesuIfonyI-pyridin 0-98 (M1) 522 4-dihydro-2H-benzo[1,4]oxazinyloxy]— pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald amination condition: CA10 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, lA53, acyl chloride 32—0 CyclopropyI-{(S)[4-(6-methanesulfonyI 0_94 (M1) 458 methyl-pyridinyl)—3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy]—pyrrolidiny|}- methanone Buchwald amination condition: CA4 Amide bond condition: CB6 Side chain introduction ion: CCZ Precursors used: CAS 260218, 127423 4, lA1, acyl chloride 40231 1 34 0.95 (M1) 538 4-(6-Methanesulfonylmethyl-pyridinyl) [(S)(tetrahydro-pyransulfonyl)-pyrrolidin yloxy]-3,4-dihydro-2H-benzo[1,4]oxazine Buchwald amination condition: CA4 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, lA1, sulfonyl chloride 3384537 0.99 (M1) 496 4-(6-Methanesulfonylmethyl-pyridinyl) [(S)(propanesulfonyl)—pyrrolidinyloxy]— 3,4-dihydro—2H-benzo[1,4]oxazine Buchwald ion condition: CA4 Amide bond condition: CB6 Side chain introduction condition: CCZ sors used: CAS 57-8, 127423 4, lA1, sulfonyl chloride 101472 1 35 0'96 (M1) 494 6-((S)—1-Cyc|opropanesulfonyI-pyrrolidin yloxy)(6-methanesulfonylmethyl-pyridin yl)—3,4-dihydro—2H-benzo[1,4]oxazine Buchwald amination condition: CA4 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218, 4, lA1, sulfonyl chloride 139631-62—2 6-((S)—1-EthanesuIfonyI-pyrrolidinyloxy)—4-(6- 0-94 (M1) 482 methanesulfonylmethyl-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazine Buchwald amination condition: CA4 Amide bond condition: CB6 Side chain introduction ion: CCZ Precursors used: CAS 260218, 127423 4, lA1, sulfonyl de 5945 1 36 1 .08 (M1 ) 494 (S)[4-(5-F|uoromethanesuIfonyI-pyridin yl)—3,4-dihydro-2H-benzo[1,4]oxazinyloxy]— pyrrolidine—1-carboxylic acid tert-butyl ester Buchwald amination condition: CA10 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 {(S)—3-[4-(5-F|uoromethanesulfonyI-pyridin y|)-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]— 0-80 (M1) 506 idiny|}-(tetrahydro-pyranyl)— methanone ld amination condition: CA10 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, IA2, acyl chloride 40191-32—0 BOC ge with HCI in dioxane instead of 1 37 1.57 (M7) 502 {(S)—3-[4-(6-EthanesulfonyI-pyridinyl)—3,4- o—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-pyrany|)-methanone Buchwald amination condition: CA13 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, |A58, acyl chloride 40191-32—0 {(S)—3-[4-(6-MethoxymethyI-pyridinyl)—3,4- 1-45 (M8) 450 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin 1-y|}-(3-methy|—3H-imidazoIy|)-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction ion: CCZ Precursors used: CAS 260218, 127423 4, IA9, 418060 1 38 1'52 (M8) 450 {(S)—3-[4-(6-MethoxymethyI-pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1-methy|-1H-imidazoIy|)-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ sors used: CAS 260218, 127423 4, IA9, 41716-18—1 1.69 (M8) 495 1-(4-{(S)[4-(6-Methoxy—5-methyI-pyrldinyl )-. 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidine—1-carbony|}-piperidiny|)-ethanone ld amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, IA9, 255036 1 39 1 .53 (M8) 463 4-{(S)[4-(6-Methoxy—5-methyI-pyrldInyl)-. . hydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidine—1-carbony|}-1H-pyridin-2—one Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction ion: CCZ Precursors used: CAS 260218, 127423 4, IA9, 22282-72—0 -{(S)[4-(6-Methoxy—5-methyI-pyridinyl)- 1-54 (M8) 453 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidine—1-carbony|}-1H-pyridin-2—one Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, IA9, 50066 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran 1_71 (M8) 502 y|)-{(S)[4-(6-methoxymethyI-pyridiny|)- 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, IA9, 640963 {(S)—3-[4-(6-MethoxymethyI-pyridinyl)—3,4- 1.88 (M8) 440 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-furany|)-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ sors used: CAS 260218, 4, IA9, 893648 -{(S)[4-(6-Methoxy—5-methyI-pyridinyl)- 1.59 (M8) 477 hydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidine—1-carbony|}methy|—1H-pyridin Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain uction condition: CCZ Precursors used: CAS 260218, 127423 4, IA9, 37197 1'50 (M7) 446 1-{(S)[4-(6-EthanesulfonyI-pyridiny|)-3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-yl}-propanone Buchwald amination condition: CA13 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218, 127423 4, |A58, acyl chloride 798 1'53 (M8) 446 1-{(S)—3-[4-(6-MethanesuIfonyImethyI-pyridin- 3-y|)-3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-propanone Buchwald amination condition: CA6 Amide bond condition: CB6 Side chain introduction condition: CC2 Precursors used: CAS 260218, 127423 4, IA1, acyl chloride 798 EZUO""C~%O 1-83 (M7) 444 {(S)—3-[4-(5-F|uoromethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(tetrahydro-furany|)-methanone Buchwald amination condition: CA6 Amide bond ion: CB5 Side chain introduction condition: CC2 Precursors used: CAS 57-8 / 127423 4/ |A10 / 893648 1-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 177 (M7) 418 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methoxy—ethanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain uction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A10 / 6256 N o,“ E U 0% o Nwo 1-87 (M7) 441 -[4-(5-F|uoromethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-oxazo|y|-methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A10/23012—13-7 (1,1-Dioxo—tetrahydro-1|ambda*6*—thiophen 1.81 (M7) 492 y|)-{(S)[4-(5-f|uoromethoxy-pyridiny|)- 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction ion: CCZ Precursors used: CAS 260218 / 127423 4 / |A10 / 47855 1.48 (M7) 453 {(S)—3-[4-(5-F|uoromethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(1-methy|-1H-imidazoIy|)-methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 4/IA10/417161 [U 0%oN o,“ O\//N 1-80 (M7) 441 {(S)—3-[4-(5-F|uoromethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- oxazo|y|—methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ sors used: CAS 260218 / 127423 4 / |A10 / 1189944 1.75 (M7) 452 {(S)—3-[4-(5-Fluoromethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-pyrimidinyI-methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A10 / 45953 {(S)—3-[4-(5-Ch|oromethoxy-pyridinyl)—3,4- 1.84 (M8) 508, 510 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- (1,1-dioxo—tetrahydro-1|ambda*6*—thiophen- 3-y|)-methanone Buchwald amination condition: CA6 Amide bond ion: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A11 /47855 1.78 (M8) 496, 498 1-{(S)[4-(5-Ch|oromethoxy-pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methanesulfonyI-propanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A11 /6450 1-{(S)[4-(5-Ch|oromethoxy—pyridinyl)— 167 (M8) 434, 436 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— idiny|}hydroxy-propanone Buchwald amination condition: CA6 Amide bond ion: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A11 /5032 {(S)—3-[4-(5-Ch|oromethoxy-pyridinyl)—3,4- 1.84 (M8) 457, 459 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-oxazo|y|—methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A11 / 1189944 3-{(S)[4-(5-Ch|oromethoxy-pyridiny|)- 188 (M8) 429, 431 hydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}oxo-propionitrile ld amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A11 /372-09—8 1-{(S)[4-(5-Ch|oromethoxy—pyridinyl)— 1.90 (M8) 482 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methanesulfonyI-ethanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A11 /25164 1-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 1-70 (M8) 466 hydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methanesulfonyI-ethanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A10 / 25164 1-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 1-77 (M8) 480 hydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methanesulfonyI-propanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4/ |A10 / 6450 1 50 1-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 1-57(M8) 418 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}hydroxy-propanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction ion: CCZ Precursors used: CAS 260218 / 4 / |A10 / 5032 1-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 1.84 (M8) 432 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}methoxy-propanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A10 / 25441 1 51 1'83 (M8) 459 [1,4]Dioxan-2—yI-{(S)[4-(5-f|uoromethoxypyridinyl dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrro|idiny|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction ion: CCZ Precursors used: CAS 260218 / 127423 4 / |A10 / 893640 3-{(S)[4-(5-Fluoromethoxy-pyridinyl)— 1.85 (M8) 413 3,4-dihydro—2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}oxo-propionitrile Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A10 / 372—09—8 1 52 3.13 (M3) 472 {(S)—3-[4-(5-Fluoromethoxy—pyrldIny|)-3,4-. . dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(4-hydroxy-cyclohexy|)-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 57-8 / 127423 4 / |A10 / 6-5 3.40 (M3) 472 {(S)—3-[4-(5-Fluoromethoxy—pyridinyl)—3,4- dihydro—2H-benzo[1,4]oxazinyloxy]—pyrro|idin- 1-y|}-(4-hydroxy-cyclohexy|)-methanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4 / |A10 / 36851 1 53 {(S)—3-[4-(5-DifluoromethyImethoxy-pyridin 0.97 (M1) 538 4-dihydro-2H-benzo[1,4]oxaziny|oxy]— idiny|}-(1,1-dioxo—hexahydro—6- thiopyrany|)-methanone Buchwald amination condition: CA2 Amide bond condition: CBB Side chain introduction ion: CCZ Precursors used: CAS 9281188/ 127423- 61-4/IA6/ 640963 {(S)—3-[4-(5-DifluoromethyImethoxy-pyridin y|)-3,4-dihydro-2H-benzo[1,4]oxaziny|oxy]— 1.03 (M1) 490 pyrrolidiny|}-(tetrahydro-pyrany|)- methanone Buchwald amination condition: CA2 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 9281188/ 127423- 61-4 / |A6 / Acyl chloride 401910 1 54 1-{(S)[4-(6-Ethanesulfinyl-pyridinyl)—3,4- 1_42 (M8) 430 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-yl}-propanone Buchwald amination condition: CA14 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: CAS 260218 / 127423 4, lA44, acyl de CAS 798 1-((R)—3-{(S)—3-[4-(6-Methoxymethyl-pyridin yl)—3,4-dihydro-2H-benzo[1,4]oxazinyloxy]— 1.66 (M8) 481 pyrrolidine—1-carbonyl}-pyrrolidinyl)-ethanone Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CCZ sors used: CAS 260218 / 127423 4, IA9, CAS 729257, Product obtained after Deboc reaction using TFA in CHZCIZ done in conventional way and final acylation in analogy to example J 1 55 [200010 Example C1 : 2-Methoxy{6-[(S)(tetrahydro-pyrancarbonyl)-pyrrolidinyloxy]- 2,3-dihydro-benzo[1,4]oxaziny|}-nicotinonitri|e (according to Scheme 3) XPhos, Pd2dba3 NaH TBDMSCI NaOtBu, e, [:UO THF,1h,i‘—t—> [NU/41h11—090Cb O" O 4“ /N TBAF, THF, N \ NaH, DMF, ' 0 / 30 min, rt / 5 h, 50°C {1< c [:00 d a) 6-(tert-Butyl-dimethy|-si|any|oxy)-3,4-dihydro-2H-benzo[1,4]oxazine Under argon, NaH (2.96 g, 74.1 mmol) was portionwise added to a solution of 3,4-dihydro- 2H-benzo[1,4]oxazinol (CAS registry 260218) (5.60 g, 37.0 mmol) in THF (200 ml).

After stirring at rt for 20 min, TBDMSCI (CAS registry 18162-48—6) (7.26 g, 48.2 mmol) was slowly added and stirring was continued for 1 h. The reaction mixture was diluted with EtZO, washed with a sat. aq. NaHCOs soln. and brine. The organic phase was dried over MgSO4, concentrated and the title compound was obtained after flash chromatography on silica gel (cyclohexane/ EtOAc 100:0 to 60:40 over 15 min) as a yellow oil (9.20 g, 94% yield).

HPLC RtM10= 3.65 min; ESIMS: 266 +]. 1H NMR (400 MHz, DMSO-ds): 5 6.46 (d, 1H), 6.08 (d, 1H), 5.91 (m, 1H), 5.71 (br s, 1H), 3.91-4.12 (m, 2H), .28 (m, 2H), 0.87-1.01 (s, 9H), 0.03-0.21 (s, 3H). 1 56 b) 5-[6-(tert-Butyl-dimethyl-silanyloxy)-2,3-dihydro-benzo[1,4]oxazinyl]methoxy nicotinonitrile Under argon, XPhos (CAS registry 5644837) (0.79 g, 1.7 mmol) and Pd2(dba)3 (CAS registry 513643) (1.52 g, 1.7 mmol) were added to a sion of 6-(tert-butyl-dimethylsilanyloxy )—3,4-dihydro-2H-benzo[1,4]oxazine (9.00 g, 33.2 mmol), 5-bromomethoxy- nicotinonitrile (CAS registry 9412948) (7.79 g, 36.6 mmol), NaOtBu (4.79 g, 49.8 mmol) in toluene (270 ml). The reaction mixture was stirred at 110°C for 1 h and was concentrated to afford a brown solid which was washed with a mixture of DCM/MeOH (8:2) and filtered off.

The filtrate was concentrated, the obtained residue was dissolved in DCM/MeOH (8:2), filtered over hyflo, the filtrate was concentrated and triturated with MeOH to afford the title compound as yellow solid (10.14 g, 77% yield).

HPLC RtM11=3.89 min; ESIMS: 398 +]. 1H NMR (400 MHz, DMSO-da): 6 8.35-8.51 (m, 1H), 8.16-8.31 (m, 1H), 6.60-6.79 (m, 1H), 6.15-6.32 (m, 1H), .09 (m, 1H), 4.00 (s, 3H), 3.51-3.74 (m, 2H), 0.87 (s, 9H), 0.07 (s, 6H). c) 5-(6-hydroxy-2,3-dihydro-benzo[1,4]oxazinyl)methoxy-nicotinonitrile TBAF (1 M in THF) (37.7 ml, 37.7 mmol) was added to a solution of 5-[6-(tert—butyl-dimethyl- loxy)—2,3-dihydro-benzo[1,4]oxaziny|]methoxy-nicotinonitrile (10 g, 25.2 mmol) dissolved in THF (200 ml). The on was stirred at rt for 30 min, diluted with EtOAc, washed with sat. aq. NaHCOs soln. and brine. The aqueous layers were back ted with EtOAc, concentration of the organic phases after drying over MgSO4 afforded a brown residue which was dissolved in DCM/MeOH (1:1) and filtered over hyflo. Concentration and ation with EtZO of the filtrate afforded the title compound as brown solid (6.63 g, 93% yield).

HPLC Rtm10=2.56 min; ESIMS: 284 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 8.70 (br. s, 1H), 8.44 (d, 1H), 8.28 (d, 1H), 6.62 (d, 1H), 6.12 (m, 1H), 6.01 (d, 1H), 4.11-4.32 (m, 2H), 4.01 (s, 3H), 3.54-3.68 (m, 2H). d) 2-Methoxy{6-[(S)(tetrahydro-pyrancarbonyl)-pyrrolidinyloxy]-2,3-dihydrobenzo [1,4]oxazinyl}-nicotinonitrile Under argon, NaH (31 mg, 0.78 mmol) was added to a solution of 5-(6-hydroxy-2,3-dihydro- benzo[1,4]oxazinyl)methoxy-nicotinonitrile (100 mg, 0.35 mmol) in DMF (2 ml) and stirred at rt for 5 min. Methanesulfonic acid (R)—1-(tetrahydro-pyrancarbonyl)-pyrro|idinyl ester (intermediate IC1) (98.0 mg, 0.35 mmol) was added and the reaction mixture was stirred at 50°C for 4 h. After cooling, NaH (0.5 eq., 8.47 mg, 0.21 mmol) was added, the 1 57 reaction mixture was stirred at rt for 5 min and methanesulfonic acid (R)—1-(tetrahydro-pyran- onyl)-pyrrolidinyl ester (intermediate IC1) (49.0 mg, 0.18 mmol) was added. The reaction mixture was stirred at 50°C for 1 h. tration and purification by prep. RP- HPLC (Sunfire PrepC18 OBD 30x100mm, 5 um; solvent A: H20+0.1 Vol.-% TFA; solvent B: CH3CN +0.1 Vol.-% TFA) afforded, after basification of the combined fractions and extraction with EtOAc, the title compound as a yellow solid (72 mg, 43% yield).

HPLC Rtm10=2.72 min; ESIMS: 465 [(M+H)+]. 1H NMR (400 MHz, CD30D): 6 8.36 (d, 1H), 8.06 (t, 1H), 6.78 (m, 1H), 6.37 (m, 1H), 6.17 (m, 1H), 4.81 (br s, 1H), 4.17-4.37 (m, 2H), 4.08 (s, 3H), 3.90-4.03 (m, 2H), 3.56-3.81 (m, 5H), 3.39-3.54 (m, 3H), 2.59-2.89 (m, 1H), 1.87-2.29 (m, 2H), 1.48-1.87 (m, 4H).

Examples C2 to C26: The compounds listed in Table 3 were prepared by a ure ous to that used in Example C1.

Table 3 UPLC Rt Compound [min] 2.71 (M10) 465 2-Methoxy{6-[(R)—1-(tetrahydro-pyran yl)—pyrrolidinyloxy]-2,3-dihydro— benzo[1,4]oxazinyl}-nicotinonitrile Buchwald amination condition: CA6 Side chain introduction condition: CC2 Precursors used: |C2 1 58 2.71 (M10) 384 1-{(R)—3-[4-(6-Methoxy-pyridinyl)—3,4-dihydro— 2H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- one Buchwald amination ion: CA7 Side chain introduction condition: CC3 Precursors used: ICB 2.71 (M10) 384 1-{(S)[4-(6-Methoxy-pyridinyl)—3,4-dihyd ro- 2H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- propanone Buchwald amination condition: CA7 Side chain introduction condition: CC3 Precursors used: |C4 1 59 2-Methoxy{3-methyl[(S)—1-(tetrahydro- pyrancarbonyl)-pyrrolidinyloxy]—2,3- dihydro—benzo[1,4]oxazinyl}-nicotinonitrile Buchwald amination condition: CA6 Side chain introduction condition: CCZ Precursors used: CAS 7048794, |C1 Chiral separation: CD3 oxy{3-methyl[(S)—1-(tetrahydro- pyrancarbonyl)-pyrrolidinyloxy]—2,3- dihydro—benzo[1,4]oxazinyl}-nicotinonitrile Buchwald amination ion: CA6 Side chain introduction condition: CCZ Precursors used: CAS 7048794, |C1 Chiral separation : CD3 2012/057554 1 60 4.13 M4( ) 449 -{6-[(S)—1-(Furazancarbonyl)—pyrrolidin y|oxy]-2,3-dihydro—benzo[1,4]oxaziny|} methoxy-nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 127423 4 / |A12 / 88598-08—7 4.11 (M4) 461 2—Methoxy{6-[(S)—1-(2-methy|—2H-pyrazoIe y|)-pyrro|idinyloxy]—2,3-dihydro— enzo[1,4]oxaziny|}-nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 127423 4 / |A12 / 160341 1 61 N 0,,“ 0 [00/ CN$0?“ 4'17 (M4) 448 -{6-[(S)—1-(|soxazoIecarbonyl)-pyrro|idin -2,3-dihydro—benzo[1,4]oxaziny|} methoxy-nicotinonitrile Buchwald amination condition: CA6 Amide bond ion: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 127423 4 / |A12/211691 N 0,,“ O [0 NF \ ,NH 3.60 (M4) 447 2-Methoxy{6-[(S)—1 -(1 H-pyrazoIecarbony|)- pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 127423 4/IA12/377189 1 62 N 0,,“ 0 [ do 0 ‘T -{6-[(S)—1-(2-Methanesu|fony|-acety|)-pyrro|idin- 3-73 (M4) 473 3-yloxy]—2,3-dihydro-benzo[1,4]oxaziny|}-2— methoxy-nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 4 / |A12 / 25164 mom: 0 N 4.02 (M4) 463 2-Methoxy{6-[(S)—1-(5-methy|- [1 ,3,4]oxadiazole—2-carbonyl)-pyrro|idiny|oxy]— 2,3-dihydro—benzo[1,4]oxazinyI}-nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 127423 4 / |A12 / 518048—06-1 N 0,," 0 ECU 94% 3.72 (M4) 459 2—Methoxy{6-[(S)—1-(pyrImIdInecarbony|)-. . . pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218 / 4 / IA12 / 45953 4.02 M4( ) 464 2—Methoxy{6-[(S)—1-(thiazo|ecarbony|)— pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, IA12, 1274234, 145274 [ZOOMCN€15 4.03 M3( ) 459 2—Methoxy{6-[(S)—1-(pyrazine-2—carbony|)— pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- nicotinonitri|e ld amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 1339899—95-4 3.27 M3( ) 458 2—Methoxy{6-[(S)—1-(pyridine—3-carbony|)— pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 596 2012/057554 1 65 3.20 (M3) 458 2-Methoxy{6-[(S)—1-(pyrIdInecarbony|)-. . pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-nicotinonitriIeBuchwaId amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 5-22—1 3.91 (M3) 475 -{6-[(S)—1-(1,3-DimethyI-1H-pyrazole—4- carbony|)-pyrro|idinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}methoxy-nicotinonitri|e ld amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 787034 1 66 3.44 (M3) 464 2—Methoxy{6-[(S)—1-(5-oxo-pyrro|idine—3- carbony|)-pyrro|idinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile ld amination condition: CA6 Amide bond ion: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 72681 N o,“ 0 EU CW4 4.27 (M3) 476 -{6-[(S)—1-(2,4-Dimethyl-oxazolecarbony|)- pyrrolidinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-2—methoxy—nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 25104 WO 93849 1 67 4.33 (M3) 505 -{6-[(S)—1-(6,6-Dimethyloxo—5,6-dihydro-4H- pyran-2—carbonyl)-pyrro|idinyloxy]—2,3- dihydro—benzo[1,4]oxaziny|}methoxy- nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 808669 N 0,,“ 0 o C“?/ \ ’N N N 3.87 (M3) 498 2—Methoxy{6-[(S)—1-(pyrazo|o[1 ,5- a]pyrimidinecarbonyl)—pyrrolidinyloxy]—2,3- dihydro—benzo[1,4]oxaziny|}-nicotinonitri|e Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain uction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 259406 3-47 (M3) 464 2''V'ethOXy{6-[(S)(5-oxo-pyrrolidine—2. carbony|)-pyrro|idinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile Buchwald amination ion: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 1491 2.68 (M10) -{6-[(S)—1-([1,4]Dioxanecarbony|)-pyrro|idin- 22.58 (CD7) 3-yloxy]—2,3-dihydro-benzo[1,4]oxaziny|} methoxy-nicotinonitrile Buchwald ion condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 893640 Chiral separation : CD7 [$300ch$143 2.68 (M10) -{6-[(S)—1-([1,4]Dioxanecarbony|)-pyrro|idin- 33.80 3-yloxy]—2,3-dihydro-benzo[1,4]oxaziny|}-2— (CD7) methoxy-nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 260218, |A12, 1274234, 41-0 Chiral separation : CD7 1 .57 M9( ) 465 2-Methoxy{6-[(S)—1-(tetrahydro-pyran carbony|)-pyrro|idinyloxy]—2,3-dihydro— 1,4]oxaziny|}-nicotinonitrile Buchwald ion condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: CAS 260218, |A12, 1274234, 8733973 2012/057554 1 70 [U mmN o,“ 0 NVN\ Example D1: (S)methoxy(6-((1-(1-methyl-1H-imidazolecarbonyl)pyrro|idin yl)oxy)-2H-benzo[b][1,4]oxazin-4(3H)-yl)nicotinonitrile (according to Scheme 4) a1) 6-((tert-butyldimethylsilyl)oxy)-3,4-dihydro-2H-benzo[b][1,4]oxazine A stirred solution of 3,4-dihydro-2H-1,4-benzoxazinol (CAS registry 2260218) (6.00 g, 39.70 mmol) in THF (200 ml) was treated with sodium hydride (60% in mineral oil, 3.18 g, 79.00 mmol) at rt. After 20 min at rt, TBDMSCI (7.78 g, 51.6 mmol) was added, and the on mixture was stirred at rt for 1.5 h. After that time, diethyl ether (500 ml) and a sat. aq. NaHCOs soln. (100 ml) were added. The aq. layer was extracted with diethyl ether, and the combined organic extracts were dried with MgSO4, filtered and concentrated under reduced pressure. The crude t was purified by flash chromatography on silica gel (cyclohexane/ EtOAc gradient) to provide the title compound as a yellow oil.

HPLC Rtwm = 3.37 min; ESIMS: 266 +]. 1H NMR (400 MHz, DMSO-ds): 6 6.48-6.44 (m, 1H), 6.09-6.05 (m, 1H), 5.94-5.89 (m, 1H), .76-5.70 (m, 1H), 4.06-4.00 (m, 2H), .19 (m, 2H), 0.92 (s, 9H), 0.12 (s, 6H). b1 ) 5-(6-((tert-butyldimethylsilyl)oxy)-2H-benzo[b][1,4]oxazin-4(3H)-yl) methoxynicotinonitrile A stirred solution of 6-((tert—butyldimethylsilyl)oxy)—3,4-dihydro-2H-benzo[b][1,4]oxazine (8.88 g, 32.80 mmol) in toluene (270 ml) was treated with 5-bromomethoxynicotinonitrile (CAS registry 9412948) (7.68 g, 36.10 mmol), NaOtBu (4.87 g, 49.2 mmol), 2- dicyclohexylphosphino-2’,4’,6’-triisopropylbiphenyl (CAS registry 5644837) (0.806 g, 1.64 mmol), and 3 (1.501 g, 1.64 mmol) at rt under argon. The reaction mixture was heated to 110°C for 1.5 h. After that time, the reaction mixture was trated under reduced pressure. The residue was dissolved in DCM (200 ml), filtered through a pad of celite, and concentrated under reduced pressure. The residue was dissolved in MeOH, and sonicated several times to give a yellow/orange precipitate. The residue was filtered, washed with methanol, and dried under vacuum to e the title compound as a yellow solid.

HPLC RtM11= 3.90 min; ESIMS: 398 [(M+H)+]. 1 71 1H NMR (400 MHz, DMSO-da): 6 8.45-8.42 (m, 1H), 8.28-8.24 (m, 1H), 8.72-8.88 (m, 1H), 8.24-8.19 (m, 1H), 8.08-8.03 (m, 1H), 4.24-4.18 (m, 2H), 4.00 (s, 3H), 3.88-3.81 (m, 2H), 0.87 (s, 9H), 0.07 (s, 8H). alternative method b2: dicyclohexylphosphino-2’,4’,6’-triisopropylbiphenyl (CAS registry 7) and a)3 were replaced with bis(tri-t-buty|phosphine)pa|ladium (CAS registry 531998) c1) 5-(6-hydroxy-2H-benzo[b][1,4]oxazin-4(3H)-yl)methoxynicotinonitrile A stirred solution of 5-(6-((tert—butyldimethylsilyl)oxy)—2H-benzo[b][1,4]oxazin-4(3H)—yl)—2- methoxynicotinonitrile (10.85 g, 27.30 mmol) in THF (220 ml) was treated with TBAF (1.0 M in THF, 40.9 ml, 40.90 mmol) at rt. After 40 min at rt, EtOAc (300 ml) and a sat. aq. NaHCOs soln. (200 ml) were added. The organic extracts were dried with MgSO4, filtered and concentrated under reduced pressure. The crude product was purified by trituration with l ether to provide the title compound as a pale brown solid.

HPLC Rtwm = 2.00 min; ESIMS: 284 +]. 1H NMR (400 MHz, DMSO-da): 6 8.71 (s, 1H), 8.44 (d, 1H), 8.29 (d, 1H), 6.61 (d, 1H), 6.12 (dd, 1H), 6.01 (d, 1H), 4.21-4.16 (m, 2H), 4.01 (s, 3H), .59 (m, 2H). d1) (S)-tert-buty| 3-((4-(5-cyanomethoxypyridinyl)-3,4-dihydro-2H- benzo[b][1,4]oxazinyl)oxy)pyrro|idinecarboxylate A stirred solution of 5-(6-hydroxy-2H-benzo[b][1,4]oxazin-4(3H)-yl)methoxynicotinonitrile (3.70 g, 13.06 mmol) in DMF (60 ml) was treated with sodium e (60% in mineral oil, 1.31 g, 32.70 mmol) at rt. The reaction mixture was stirred at rt for 15 min. After that time, (R)—1-Bocmethanesulfonyloxypyrrolidine (CAS registry 1416992) (5.36 g, 19.59 mmol) was added, and the reaction mixture was d at 50°C for 3 h. After that time, the reaction mixture was concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel (cyclohexane / acetone gradient) to provide the title compound as a yellow solid.

HPLC RtM11= 3.13 min; ESIMS: 453 [(M+H)+]. 1H NMR (400 MHz, : 6 8.31 (d, 1H), 7.81 (d, 1H), 6.82 (d, 1H), 6.32 (dd, 1H), 6.14 (d, 1H), 4.74-4.68 (m, 1H), 4.32-4.28 (m, 2H), 4.09 (s, 3H), 3.67-3.62 (m, 2H), 3.59-3.39 (m, 4H), 2.17-1.92 (m, 2H), 1.47 (s, 9H). alternative method d2: the mesylated alcohol, sodium hydride and DMF were replaced with the corresponding hydroxy—isoxazolidine, DEAD and THF using Mitsunobu conditions described in method CC4 1 72 e1) (S)methoxy(6-(pyrrolidinyloxy)-2H-benzo[b][1,4]oxazin-4(3H)- yl)nicotinonitrile A stirred on of (S)-tert-butyl (5-cyanomethoxypyridiny|)-3,4-dihydro-2H- benzo[b][1,4]oxazinyl)oxy)pyrrolidinecarboxylate (4.35 g, 9.32 mmol) in DCM (160 ml) was treated with TFA (35.9 ml, 466 mmol) at rt. The reaction mixture was stirred at rt for 2 h.

After that time, the reaction mixture was concentrated under reduced pressure. The residue was dissolved in DCM (500 ml), and a saturated aqueous NaHCOs solution (500 ml) was added. The organic extracts were washed with a saturated aqueous NaCI solution (50 ml), dried with MgSO4, filtered and concentrated under reduced pressure. The crude product (title compound, yellow solid) was used in the next step without further purification.

HPLC RtWO: 2.06 min; ESIMS: 353 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 8.31 (d, 1H), 7.82 (d, 1H), 6.82 (d, 1H), 6.32 (dd, 1H), 6.12 (d, 1H), 4.71-4.65 (m, 1H), 4.32-4.27 (m, 2H), 4.09 (s, 3H), 3.67-3.62 (m, 2H), 3.22-2.90 (m, 4H), 2.08-1.88 (m, 2H). f1) (S)methoxy(6-((1-(1-methyl-1H-imidazolecarbonyl)pyrrolidinyl)oxy)-2H- benzo[b][1,4]oxazin-4(3H)-yl)nicotinonitrile A stirred solution of 1-methyl-1H-imidazolecarboxylic acid (CAS registry 18-1) (0.578 g, 4.45 mmol) in DMF (40 ml) was treated with HOBT (0.695 g, 4.45 mmol), EDC (0.870 g, 4.45 mmol) and Et3N (1.24 ml, 8.90 mmol) at rt. The on mixture was stirred at rt for 15 min. After that time, (S)methoxy(6-(pyrrolidinyloxy)-2H-benzo[b][1,4]oxazin- 4(3H)-y|)nicotinonitrile (1.10 g, 2.97 mmol) was added, and the reaction e was stirred for 3 h 15 min at rt. After that time, the reaction mixture was concentrated under reduced pressure. The residue was dissolved in DCM (200 ml), and a sat. aq. NaHCOs soln. (200 ml) was added. The organic extracts were dried with MgSO4, filtered and concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel (DCM / ol gradient) and preparative HPLC (SunFire C18 column, CH3CN / 1%TFA in H20 gradient, pure ons were treated with DCM and a saturated aqueous NaHCOs solution; the combined organic extracts were dried with MgSO4, filtered and concentrated under reduced pressure) to e the title compound as a yellow solid.

HPLC RtWO: 2.27 min; ESIMS: 461 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 8.46-8.41 (m, 1H), 8.30-8.26 (m, 1H), 7.66-7.59 (m, 2H), 6.77-6.72 (m, 1H), .29 (m, 1H), 6.14-6.07 (m, 1H), 4.90-4.79 (m, 1H), 4.25-4.11 (m, 3H), 3.99 (s, 3H), .78 (m, 1H), 3.70-3.41 (m, 7H), 2.10-1.93 (m, 2H). alternative method f2: the carboxylic acid, HOBT, EDC and DMF were replaced with the carboxylic acid chloride and DCM 1 73 alternative method f3: the carboxylic acid, HOBT, EDC and DMF were replaced with a chloroformate and DCM alternative method f4: the carboxylic acid, HOBT and EDC were replaced with a carbamic Examples D2 to D40: The compounds listed in Table 4 were prepared by a procedure analogous to that used in Example D1.

Table 4 HPLC Rt MS Example Compound [min] [mlz; (method) ] 2.07 (M10) 455 1-{(S)[4-(6-Methoxy-pyridinyl)—3,4-dihyd ro- 2H-benzo[1,4]oxazinyloxy]—pyrrolidinyl} morpholinyl-ethanone Synthetic route used: a1, b2 (intermediate: CAS registry 163129-79—1), c1, d1, e1, f1 (intermediate: CAS registry 89531-58—8) 1 74 2.08 (M10) 413 2-Dimethylamino—1-{(S)[4-(6-methoxy-pyridin- 3,4-dihydro-2H-benzo[1,4]oxaziny|oxy]— pyrrolidiny|}-ethanone Synthetic route used: a1, b2 (intermediate: CAS registry 163129-79—1), 01, d1, e1, f1 (intermediate: CAS registry 11189) 2.72 (M10) 465 2—Methoxy{6-[(S)—1-(tetrahydro—pyran carbonyl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b2 (intermediate |A12), 01, d1, e1, f2 (intermediate: CAS registry 40191- 32-0) 1 75 N o,“ 0 E U CN k...— 0 2.61 (M10) 506 -{6-[(S)—1-(1-AcetyI-piperidine—4-carbonyl)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}methoxy—nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 255036) N o,,, 0 [U C KN' N / o \ 2.22 (M10) 438 -{6-[(S)—1-(2-Dimethy|amino—acetyl)—pyrro|idin- 3-yloxy]—2,3-dihydro-benzo[1,4]oxaziny|} methoxy-nicotinonitrile tic route used: a1, b1 mediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 11189) 1 76 2.14 (M10) 480 2-Methoxy{6-[(S)—1-(2-morpholinyI-acetyl)- pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}-nicotinonitri|e tic route used: a1, b1 (intermediate CAS ry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 89531-58—8) COW; 2.14 (M10) 480 -[6-((S)—1-|sobutyryI-pyrrolidinyloxy)—2,3- dihydro—benzo[1,4]oxaziny|]methoxy- nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f2 (intermediate: CAS registry 89531-58—8) 1 77 3.19 (M10) 451 -{6-[(S)—1-(3,3-DimethyI-butyry|)-pyrro|idin y|oxy]-2,3-dihydro-benzo[1,4]oxaziny|} methoxy-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f2 (intermediate: CAS registry 70655) {20‘3""04! 3.06 (M10) 437 oxy{6-[(S)—1-(3-methy|-butyry|)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f2 (intermediate: CAS ry 108—12—3) 1 78 N o,,, 0 [O CHo_. 2.96 (M10) 411 (S)[4-(5-Cyano—6-methoxy-pyridiny|)-3,4- o-2H-benzo[1,4]oxaziny|oxy]— pyrrolidinecarboxylic acid methyl ester Synthetic route used: a1, b1 (intermediate CAS ry 9412948), c1, d1, e1, f3 (intermediate: CAS registry 79—22—1) [:UO“C~J€,O\ 2.63 (M10) 425 2—Methoxy{6-[(S)—1-(2—methoxy-acety|)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), c1, d1, e1, f2 (intermediate: CAS registry 38870-89—2) 1 79 E31300€03 3.22 (M10) 463 -[6-((S)—1-Cyc|ohexanecarbonyI-pyrrolidin y|oxy)-2,3-dihydro—benzo[1,4]oxaziny|]—2— methoxy-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f2 (intermediate: CAS registry 27199) N 0,,“ 0 EU 0 2.23 (M10) 478 2—Methoxy{6-[(S)—1-(1-methy|-piperidine carbonyl)—pyrrolidinyloxy]—2,3-dihydro— 1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 689473) 1 80 1:000ng 2.67 (M10) 439 -{6-[(S)—1-(2-HydroxymethyI-propionyl)- idinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}methoxy—nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 8), 01, d1, e1, f1 (intermediate: CAS registry 5946) 1.62 (M8) 513 -{6-[(S)—1-(1,1-Dioxo—hexahydro—1|ambda*6*— thiopyrancarbonyl)-pyrro|idinyloxy]—2,3- dihydro—benzo[1,4]oxaziny|}methoxy- nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 640963) 2012/057554 1 81 1.55 (M13) 488 2—Methoxy{6-[(S)—1-(1-methy|oxo—1 ,6- dihydro-pyridinecarbonyl)-pyrro|idinyloxy]— 2,3-dihydro—benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 3719- 1.75 (M13) 448 2—Methoxy{6-[(S)—1-(oxazo|ecarbony|)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 8), 01, d1, e1, f1 (intermediate: CAS registry 23012—13-7) 1 82 1.56 (M13) 488 2-Methoxy{6-[(S)—1-(1-methy|oxo—1 ,2- dihydro-pyridinecarbonyl)-pyrro|idinyloxy]— 2,3-dihydro—benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS ry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 339723) 1.60 (M8) 474 2-Methoxy{6-[(S)—1-(6-oxo—1,6-dihydro— pyridinecarbonyl)-pyrro|idiny|oxy]—2,3- dihydro-benzo[1,4]oxaziny|}-nicotinonitri|e Synthetic route used: a1, b1 mediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 50066) 1 83 1.50 (M13) 474 2-Methoxy{6-[(S)—1-(2-oxo—1,2—dihydro— pyridinecarbonyl)-pyrro|idiny|oxy]—2,3- dihydro-benzo[1,4]oxaziny|}-nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 22282-72—0) 3.01 (M10) 467 2-Methoxy{6-[(R)—2—(tetrahyd ro-pyran carbonyl)—isoxazolidiny|oxy]-2,3-dihyd ro- benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 8), 01, d2 (intermediate CAS registry 8783859), e1, f2 (intermediate: CAS ry 40191-32—0) 3'11 (M10) 411 2-Methoxy[6-((R)—2-propiony|—isoxazo|idin y|oxy)-2,3-dihydro—benzo[1,4]oxaziny|]— nicotinonitrile tic route used: a1, b1 (intermediate CAS registry 9412948), 01, d2 (intermediate CAS registry 8783859), e1, f2 (intermediate: CAS registry 79—03-8) 1-53 (M9) 467 2-Methoxy{6-[(S)(tetrahydro-pyran carbonyl)—isoxazolidiny|oxy]-2,3-dihyd ro- benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 mediate CAS registry 9412948), 01, d2 (intermediate CAS registry 10924546), e1, f2 (intermediate: CAS registry 40191-32—0) WO 93849 1'66 (M9) 41 1 2"V'e’ih0Xy—5-[5-((3)propionyI-isoxazolidin y|0Xy)-2,3-dihydro-benzo[1,4]oxazin—4—y|]- nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d2 (intermediate CAS registry 10924546), e1, f2 (intermediate: CAS ry 798) 2.31 (M10) 463 2—Methoxy{6-[(R)—2—(1-methy|-1H-imidazoIe carbony|)-isoxazo|idiny|oxy]-2,3-dihydro- benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 41716-18—1) 2.62 (M10) 461 2—Methoxy{6-[(S)—1-(1-methy|-1H-pyrazoIe carbonyl)—pyrrolidinyloxy]—2,3-dihydro— 1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 59521) EZUO'WOCO 2.68 (M10) 451 2—Methoxy{6-[(S)—1-(tetrahyd ro-fu ran carbonyl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 8), 01, d1, e1, f1 (intermediate: CAS registry 893648).

Isomer 1 1 87 (imam; 2.68 (M10) 451 2—Methoxy{6-[(S)—1-(tetrahyd ro-fu ran yl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 893648).

Isomer 2 2.63 (M10) 440 {(S)—3-[4-(6-Methoxy-pyridinyl)—3,4-dihydro— 2H-benzo[1,4]oxazinyloxy]—pyrro|idiny|}- (tetrahydro—pyranyl)—methanone Synthetic route used: a1, b2 (intermediate CAS registry 163129-79—1), 01, d1, e1, f2 (intermediate: CAS ry 40191-32—0) 1 88 2.24 (M10) 461 2-Methoxy{6-[(S)—1-(3-methyI-3H-imidazole—4- carbonyl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile tic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 418060) 1.69 (M13) 448 2—Methoxy{6-[(S)—1-(oxazo|ecarbony|)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 1189944) 1 89 1.80 (M13) 462 2-Methoxy{6-[(S)—1-(4-methy|-oxazo|e carbonyl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxaziny|}-nicotinonitrile Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 25109) 1.77 (M13) 466 2-Methoxy{6-[(S)—1-(morpho|inecarbonyl)— pyrrolidinyloxy]—2,3-dihydro-benzo[1,4]oxazin- nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f4 (intermediate: CAS registry 15159—40-7) 1 90 EZUO'CNEKCLQ 1.90 (M13) 493 2-Methoxy{6-[(S)—1-(4-methoxy- cyclohexanecarbonyl)-pyrro|idinyloxy]—2,3- dihydro-benzo[1,4]oxaziny|}-nicotinonitri|e Synthetic route used: a1, b1 mediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 12-8) Isomer 1 [20003th 2.01 (M13) 493 2-Methoxy{6-[(S)—1-(4-methoxy- cyclohexanecarbonyl)-pyrro|idinyloxy]—2,3- dihydro-benzo[1,4]oxaziny|}-nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), 01, d1, e1, f1 (intermediate: CAS registry 952338) Isomer 2 WO 93849 1 91 N O,“ E U 0 O N\\ \/N\ 1.28 (M13) 475 2-Methoxy(6-{(S)—1-[2-(1-methy|—1H-imidazol- acety|]-pyrro|idinyloxy}-2,3-dihydro- benzo[1,4]oxaziny|)-nicotinonitri|e Synthetic route used: a1, b1 (intermediate CAS registry 9412948), c1, d1, e1, f1 (intermediate: CAS registry 26252) N 0,,“ O E U C“ 2-Methoxy{6-[(S)—1-(piperidine—4-carbony|)- pyrro|idinyloxy]—2,3-dihydro—benzo[1,4]oxazin- 4-y|}-nicotinonitri|e Synthetic route used: a1, b1 intermediate |A12, c1, d1 CAS registry 1274234, f1 CAS registry 843584 last step : removal of Boc protecting group using TFA in a conventional way.

WO 93849 1 92 2-Methoxy{6-[(S)—1-((S)-pyrrolidine—3- carbonyl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxazinyl} -nicotinonitrile Synthetic route used: a1, b1 intermediate CAS registry |A12, c1, d1 CAS registry 4, f1 CAS registry 140148—70-5 last step : removal of Boc protecting group using TFA in a conventional way. 2-Methoxy{6-[(S)—1-((R)-pyrrolidine carbonyl)—pyrrolidinyloxy]—2,3-dihydro— benzo[1,4]oxazinyl} -nicotinonitrile Synthetic route used: a1, b1 intermediate |A12, c1, d1 CAS registry 1274234, f1 CAS registry 729257, last step : removal of Boc protecting group using TFA in a conventional way. 2012/057554 1 93 N \ o,“ 0 [DU 04%,» Example E1: {(S)[1-(6-Methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4- b][1,4]oxazinyloxy]-pyrro|idiny|}-(1-methyl-1H-imidazolyl)-methanone (according to Scheme 5) BH3*THF THF 082003, Pd2(dba)3, XPhOS OZTI Br 2 h 80°c dioxane, 3.5 h, 100°C / N [:l / N b) N \ KOH aq., Pd2(dba)3,’[e’[rame’[hyl- \ / t—butyl--XPhos, dioxane, 17.5h 100°C / [N |\ CI /N /N O 00\ N4 0 NI \ NaH, DMF, 19 h, 60°C, 18 h, 80°C rt N o o TFA, DCM, 18 h, \ _/< ——> d) E | C“ e) /N O o O \0 “1 \ / '3 N \ N) I / / N o I o \ 1,, N o \ I, HBTU, DIPEA, DMF, 20 h,rt ' /N CNH | /N N O O / f) \ 1 94 a) 7-Chloro-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine A mixture of 7-chloro-1H-pyrido[3,4-b][1,4]oxazinone (CAS registry 9281188) (630 mg, 3.41 mmol) and F (1 M in THF) (10.2 ml, 10.2 mmol) in THF (20 ml) was stirred for 2 h at 80°C. The reaction mixture was quenched with MeOH, NaOH aq. solution 1 M was added and the mixture was extracted with EtOAc. Combined organic layers were washed with brine, dried over NaZSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica gel (heptane/ EtOAc 100:0 to 50:50 in 12 min) to provide the title compound as a white solid (432 mg, 74% yield).

HPLC RtM1=0.47 min; ESIMS: 171 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 7.74 (s, 1H), 6.46 (s, 1H), 4.43 (br s, 1H) 4.21-4.25 (m, 2H), 3.48-3.51 (m, 2H). b) 7-Chloro(6-methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]- oxazine A mixture of ro-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine (127 mg, 0.74 mmol), 5- bromomethoxymethylpyridine (CAS registry 2) (0.196 g, 0.986 mmol), Cs2C03 (534 mg, 1.64 mmol) and XPhos (28 mg, 0.06 mmol) in dioxane (3.5 ml) was degassed with argon and Pd2(dba)3 (27 mg, 0.03 mmol) was added. After ng for 3.5 h at 100 °C the on mixture was filtered over hyflo, sat. aq. NaHCOs soln. was added and the mixture was extracted with EtOAc. Combined organic layers were washed with brine, dried over NaZSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica gel (heptane / EtOAc 95:5 to 40:60 in 14 min) to provide the title compound as a pale colored solid (190 mg, 87% yield).

HPLC Rtm1=1.04 min; ESIMS: 292 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.94 (d, 1H), 7.80 (s, 1H), 7.31 (d, 1H), 6.31 (s, 1H), .37 (m, 2H), 4.01 (s, 3H), 3.68-3.72 (m, 2H), 2.24 (s, 3H). c) 1-(6-Methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinol A mixture of 7-chloro(6-methoxymethyl-pyridinyl)—2,3-dihydro-1H-pyrido[3,4- b][1,4]oxazine (190 mg, 0.65 mmol), ethyl-t-butyl-XPhos (13 mg, 0.03 mmol) in dioxane (3 ml) and 5M aq. KOH soln. (0.04 ml, 1.95 mmol) was degassed with argon and Pd2(dba)3 (6 mg, 0.01 mmol) was added. After stirring for 17.5 h at 100°C the reaction mixture was filtered over hyflo, the filtrate was dried over NaZSO4, filtered and evaporated.

The crude product was purified by flash chromatography on silica gel (EtOAc/ MeOH 100:0 to 85:15 in 17 min) to provide the title compound as a white solid (111 mg, 62% yield).

HPLC .67 min; ESIMS: 274 [(M+H)+]. 1 95 1H NMR (400 MHz, CDCI3):510.32(br s, 1H), 8.02 (d, 1H), 7.62 (m, 1H), 6.89 (s, 1H), 4.84 (s, 1H), 4.17-4.21 (m, 2H), 3.91 (s, 3H), 3.61-3.66 (m, 2H), 2.17 (s, 3H). d) (S)[1-(6-Methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin yloxy]-pyrro|idinecarboxy|ic acid tert-butyl ester A solution of 1-(6-methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinol (111 mg, 0.41 mmol) in DMF (3 ml) was treated with NaH (33 mg, 0.81 mmol) for 10 min at °C. (R)—3-Methanesulfonyloxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry 1274234) (162 mg, 0.61 mmol) was added. After stirring for 19 h at 60°C and 18 h at 80°C sat. aq. NaHCOs soln. was added and the reaction mixture was extracted with TBME.

Combined organic layers were washed with brine, dried over NaZSO4, filtered and evaporated. The crude product was ed by flash chromatography on silica gel ne/ EtOAc 93:7 to 40:60 in 13.5 min) to provide the title compound as a pale yellow oil (107 mg, 59% yield).

HPLC Rtm1=1.21 min; ESIMS: 443 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.93 (d, 1H), 7.61 (br s, 1H), 7.32 (br s 1H), 5.71 (s, 1H), 5.41 (br s, 1H), 4.32 (br s, 2H), 3.99 (s, 3H), 3.65-3.70 (m, 2H), .61 (m, 4H), 2.23 (s, 3H), 1.58 (s, 9H), 0.82-0.97 (m, 2H). e) 1-(6-Methoxymethyl-pyridinyl)((S)-pyrro|idinyloxy)-2,3-dihydro-1H- pyrido[3,4-b][1,4]oxazine A solution of [1-(6-methoxymethyl-pyridinyl)—2,3-dihydro-1H-pyrido[3,4-b][1,4]— oxazinyloxy]-pyrrolidinecarboxylic acid tert-butyl ester (103 mg, 0.23 mmol) and TFA (0.179 ml, 2.33 mmol) in DCM (1.8 ml) was stirred for 18 h at rt. Sat. aq. Na2C03 soln. was added and the reaction mixture was extracted with DCM. Combined organic layers were washed with brine, dried over NaZSO4, filtered and evaporated, the title nd was as a pale yellow foam (72 mg, 90% yield).

HPLC Rtm1=0.64 min; ESIMS: 343 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.93 (d, 1H), 7.62 (s, 1H), 7.32 (m, 1H), 5.70 (s, 1H), 5.29-5.35 (m, 1H), 4.29-4.33 (m, 2H), 3.99 (s, 3H), 3.65-3.69 (m, 2H), .14 (m, 4H), 2.22 (s, 3H), .10 (m, 2H). f) {(S)[1-(6-Methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin yloxy]-pyrro|idiny|}-(1-methyl-1H-imidazolyl)-methanone A mixture of 1-methyl-1H-imidazolecarboxylic acid (CAS registry 417161) (15 mg, 0.12 mmol), HBTU (53 mg, 0.14 mmol) and DIPEA (0.025 ml, 0.14 mmol) in DMF (0.6 ml) was stirred at rt for 5 min. A solution of 1-(6-methoxymethyl-pyridinyl)((S)-pyrrolidin- WO 93849 1 96 3-yloxy)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine (0.037 g, 0.11 mmol) in DMF (0.6 ml) was added. After stirring for 20 h at rt water was added and the reaction mixture and was ted with EtOAc. Combined organic layers were washed with brine, dried over NaZSO4, filtered and evaporated. The crude product was purified by prep. RP-HPLC (column SunFire C18, H20 + 0.1% TFA / ACN + 0.1% TFA 90:10 to 60:40 in 16 min) to provide the title compound as a pale yellow foam (24 mg, 49% yield).

HPLC Rtm1=0.74 min; ESIMS: 451 +]. 1H NMR (400 MHz, DMSO): 6 8.00 (m, 1H), 7.58-7.63 (m, 3H), 7.53 (d, 1H), 5.51 (d, 1H), .29-5.40 (m, 1H), 4.23-4.29 (m, 2H), 3.99 (s, 3H), 3.77-4.19 (m, 2H), 3.66 (m, 5H), 3.39- 3.63 (m, 2H), 2.15 (s, 3H), 1.89-2.11 (m, 2H).

Examples E2 to 11: The compounds listed in Table 5 were prepared by a procedure analo- gous to that used in Example E1.

Table 5 HPLC Rt Compound I [min] Reaction ions (method) (S)[1-(6-Methoxymethyl-pyridinyl)-2,3- 1.19 (M1) 443 dihydro—1H-pyrido[3,4-b][1,4]oxazinyloxy]— pyrrolidinecarboxylic acid tert-butyl ester Buchwald amination condition: CA4 Side chain introduction condition: CC1 Precursors used: CAS 9281188, lA9, 1274234 1 97 0,,“ O / N CN {(S)—3-[1-(6-MethoxymethyI-pyridinyl)—2,3- 0.84 (M1) 455 dihydro—1H-pyrido[3,4-b][1,4]oxaziny|oxy]— pyrrolidiny|}-(tetrahydro-pyrany|)- methanone Buchwald amination condition: CA4 Amide bond ion: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188, 4, |A9, acyl chloride 40191-32—0 1.09 (M1) 328 {(S)—3-[1-(6-Difluoromethoxymethyl-pyridin y|)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-(1,1-dioxo—hexahydro— 1lambda*6*—thiopyrany|)-methanone ld amination condition: CA4 Amide bond condition: CB4 Side chain introduction condition: CC1 Precursors used: CAS 9281188, IA8, 1274234, 640963 1 98 0'79 (M1) 523 {(S)—3-[1-(5-Ch|oromethoxy-pyridinyl)—2,3- dihydro—1H-pyrido[3,4-b][1,4]oxaziny|oxy]— pyrrolidiny|}-(1,1-dioxo—hexahydro— 1|ambda*6*—thiopyrany|)-methanone Buchwald amination ion: CA4 Amide bond ion: CB1 Side chain introduction condition: CC1 Precursors used: CAS 9281188, 127423 4, |A11, 640963 0'92 (M1) 557 (1 ,1-Dioxo—hexahydro—1|ambda*6*—thiopyran y|)-{(S)—3-[1-(6-methoxy—5-trif|uoromethyI-pyridin- 3-yl)—2,3-dihydro—1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-methanone Buchwald amination condition: CA4 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4 / |A21 /640963 1 99 0'87 (M1) 505 {(S)—3-[1-(6-MethoxytrifluoromethyI-pyridin y|)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin -pyrro|idiny|}-(1-methy|—1H-imidazoI y|)-methanone Buchwald amination condition: CA4 Amide bond condition: CB1 Side chain introduction condition: CC1 sors used: CAS 9281188 / 127423- 61-4/IA21/41716-18—1 0-75 (M1) 471 {(S)[1-(5-Ch|oromethoxy-pyridinyl)—2,3- dihydro—1H-pyrido[3,4-b][1,4]oxaziny|oxy]— pyrrolidiny|}-(1-methy|—1H-imidazoIy|)- methanone Buchwald amination condition: CA4 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 8, 127423 4, |A11, 41716-18—1 WO 93849 o 0 / N CN 0'95 (M1) 491 {(S)—3-[1-(6-Difluoromethoxymethyl-pyridin y|)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-(tetrahydro-pyrany|)- methanone Buchwald amination ion: CA4 Amide bond condition: CB1 Side chain introduction condition: CC1 sors used: CAS 9281188 / 127423- 61-4 / |A8 / 53371 0.84 (M1) 487 {(S)—3-[1-(6-Difluoromethoxymethyl-pyridin y|)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-(1-methy|—1H-imidazoI y|)-methanone Buchwald amination condition: CA4 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4/ IA8/417161 1.01 (M1) 447 Cyclopropyl-{(S)—3-[1-(6-difluoromethoxy—5- -pyridinyl)—2,3-dihydro-1H-pyrido[3,4- b][1,4]oxazinyloxy]—pyrrolidiny|}-methanone Buchwald amination condition: CA4 Amide bond condition: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4 / |A8 / Acyl chloride: 40231 Reference Examples E12 to E13: The compounds listed in Table 5a were prepared by a procedure analogous to that used in Example E1, applying adequate ting group strategies.

Table 5a HPLC Rt Reference Compound I [min] Example on Conditions (method) (1,1-Dioxo-hexahydro-1|ambda*6*—thiopyran 0-54 (M16) 489 y|)-{(S)—3-[1-(6-hydroxymethyI-pyridinyl)- 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-methanone Buchwald amination condition: CA2 Amide bond condition: CB7 Side chain uction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4 / |A69 / 640963 (1 ,1-Dioxo-hexahydro-1 |ambda*6*—thiopyran y|)-{(S)—3-[1-(5-hydroxymethyImethoxy- 0-63 (M16) pyridinyl)—2,3-dihydro—1H-pyrido[3,4- b][1,4]oxazinyloxy]—pyrro|idiny|}- methanone Buchwald amination condition: CA2 Amide bond ion: CB7 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / - 61-4 / |A70 / 640963 Example F1 : (1 ,1-Dioxo-hexahydro-1lambda*6*-thiopyranyl)-{(S)[1 -(6-methoxy-5 -methyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy]-pyrrolidiny|}- methanone (according to Scheme 6) Pd2(dba)3 (CH3)4-t-butyl-X-Phos (”HEW—>3?1h,75°C H BHT,HF THF, CI N KOH, dioxane/ H 0 fl] 2 5h,100°C O b) 0.sjox N’4 / O O H H N OH NaH DMF N o, O E \ 1 1 E \ 1,, | 18 h, 80°C | /N /N CNJ<O Pd2(dba) XPhos, I TFA, DCM, NaOtBu, e, 18 h, rt 2 h 100°C N o O 1 \ I” —+ I e) d ) E / N o Chi—40% N \ SE | I O / HBTU, DIPEA, N O N ,rt \O’ \ NH | I /N CN /N f) o a) 7-Chloro-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine A solution of 7-chloro-1H-pyrido[3,4-b][1,4]oxazinone (CAS registry 9281188) (3.70 g, mmol) in THF (63 ml) was treated with BH3*THF (1M in THF, 47 ml, 47 mmol). The reaction mixture was stirred at 75°C for 1 h, then cooled down to rt and quenched with methanol (24 ml, 600 mmol). The reaction mixture was concentrated under d pressure and the residue was taken up with EtOAc and washed with sat. aq. NaHCOs soln. The c layer was dried over MgSO4, filtered and concentrated under d pressure to afford the title product as a pale yellow solid (3.3 g, 96% yield).

UPLC RtM1=0.47 min; ESIMS: 171 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 7.53 (s, 1H), 7.11 (br s, 1H), 6.47 (s, 1H), 4.09 (t, 2H), 3.17- 3.38 (m, 2H). b) 2,3-Dihydro-1H-pyrido[3,4-b][1,4]oxazinol A mixture of 7-chloro—2,3-dihydro—1H-pyrido[3,4-b][1,4]oxazine (1.08 g, 6.33 mmol), aq. KOH soln. (1.07 g, 19 mmol KOH in 5.4 ml water), 2-di-t-butylphosphino-3,4,5,6-tetramethyl- 2’,4’,6-tri-i-propylbiphenyl 98% (0.30 g, 0.63 mmol) and Pd2(dba)3 (0.29 g, 0.32 mmol) in dioxane (32.5 ml) was degassed three times with nitrogen, the tube was sealed and the reaction mixture was stirred at 100°C for 5 h. After cooling to rt, the on mixture was filtered through hyflo, rinsed with EtOAc and methanol. The tes were concentrated and the title compound was obtained after flash tography on silica gel (DCM / MeOH, 98:2 to 75:25) as an orange residue (660 mg, 69% yield) UPLC Rtm1=0.34 min; ESIMS: 153 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds):610.33(br s, 1H), 7.03 (br s, 1H), 6.71 (s, 1H), 5.15 (s, 1H), 3.95 (t, 2H), 3.25 (m, 2H). c) (S)(2,3-Dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert-butyl ester A dry solution of 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinol (0.66 g, 4.34 mmol) and (R)—3- methanesulfonyloxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry 1274234) (1.73 g, 6.51 mmol) in DMF (40 ml) was treated with sodium hydride (60% in mineral oil, 0.21 g, 8.68 mmol) and the reaction mixture was stirred at 80°C for 18 h. After cooling to rt, the reaction mixture was d with TBME and washed with sat. aq. NaHCOs soln.. The organic layer was dried over MgSO4, filtered, concentrated and the title compound was obtained after flash tography on silica gel (cyclohexane/ EtOAc, 95:5 to 30:70) as a yellow oil (1.035 g, 75% purity,, 56% yield) UPLC RtM1=0.65 min; ESIMS: 322 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 7.54 (s, 1H), 5.86 (s, 1H), 5.42 (br s, 1H), 4.25-4.41 (m, 1H), 4.19 (t, 2H), 3.38-3.66 (m, 6H), 2.00-2.18 (m, 2H), 1.46 (d, 9H). d) (S)[1-(6-Methoxymethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin yloxy]-pyrrolidinecarboxylic acid tert-butyl ester A mixture of (S)(2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert-butyl ester (254 mg, 0.79 mmol), 5-bromomethoxy—3-methylpyridine (CAS registry 7602072) (208 mg, 1.03 mmol), XPhos (30 mg, 0.06 mmol), and NaOtBu (167 mg, 1.74 mmol) in dioxane (6 ml) was ed with argon for 5 min, then Pd2(dba)3 (29 mg, 0.03 mmol) was added. The tube was filled with argon, sealed and the reaction mixture was stirred at 100°C for 2 h. After cooling to rt, the reaction mixture was filtered through hyflo, rinsed with EtOAc and the filtrates were washed with sat. aq. NaHCOs soln.. The aq. layer was twice reextracted with EtOAc, the combined organic layers were dried over , filtered, concentrated and the title compound was obtained after flash chromatography on silica gel ne/ EtOAc, 100:0 to 50:50) as a clear gum (274 mg, 78% yield).UPLC Rtm =1.20 min; ESIMS: 443 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 7.93 (d, 1H), 7.61 (br s, 1H), 7.30-7.35 (m, 1H), 5.71 (s, 1H), .34-5.46 (m, 1H), 4.31 (br s, 2H), 3.99 (s, 3H), 3.68 (t, 2H), 3.34-3.62 (m, 4H), 2.23 (s, 3H), 2.01-2.09 (m, 2H), 1.44 (s, 9H). e) 1-(6-Methoxymethyl-pyridinyl)((S)-pyrrolidinyloxy)-2,3-dihydro-1H- pyrido[3,4-b][1,4]oxazine A solution of (S)[1-(6-methoxymethyl-pyridinyl)—2,3-dihydro-1H-pyrido[3,4- b][1,4]oxazinyloxy]-pyrrolidinecarboxy|ic acid tert-butyl ester (364 mg, 0.82 mmol) in DCM (6 ml) was treated with TFA (0.63 ml, 8.23 mmol) and the reaction e was stirred at rt for 18 h, then quenched with sat. aq. NaHCOs soln. and extracted with DCM. The organic layer was dried over MgSO4, filtered and trated under reduced pressure to afford the title product as a red oil, which was used in the next step without further purification (313mg, 90% purity, quantitative yield).

UPLC Rtm1=0.65 min; ESIMS: 343 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.93 (d, 1H), 7.62 (s, 1H), 7.32 (d, 1H), 5.70 (s, 1H), 5.26-5.36 (m, 1H), 4.31 (t, 2H), 3.99 (s, 3H), 3.67 (t, 2H), .15 (m, 3H), 2.81-2.92 (m, 1H), 2.22 (s, 3H), 1.98-2.10 (m, 1H), 1.79-1.90 (m, 1H). f) (1,1 -Dioxo-hexahydro-1 lambda*6*-thiopyranyl)-{(S)[1-(6-methoxymethylpyridinyl )-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy]-pyrrolidiny|}- A solution of 1,1-dioxo-hexahydro-1lambda*6*—thiopyrancarboxylic acid (CAS registry 640963) (106 mg, 0.59 mmol) in DMF (4 ml) was treated with HBTU (225 mg, 0.59 mmol) and DIPEA (0.24 ml, 1.37 mmol). The ing orange solution was stirred at rt for 5 min, then a solution of 1-(6-methoxymethyl-pyridinyl)((S)-pyrrolidinyloxy)—2,3- dihydro-1H-pyrido[3,4-b][1,4]oxazine (156 mg, 0.46 mmol) in DMF (2 ml) was added. The reaction mixture was stirred at rt for 1 h then concentrated under reduced pressure and the e was taken up with DCM and washed with sat. aq. NaHCOs soln.. The organic layer was dried by passing it through a phase separating cartridge, concentrated and the title compound was obtained after SFC chromatography (column DEAP (250mm x 30mm, 60A, 5pm) Princeton, nt 11 - 16% of methanol in supercritical C02 in 6 min) as a slightly coloured solid (112 mg, 49% yield).

UPLC Rtm1=0.81 min; ESIMS: 503 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 5 8.01 (s, 1H), 7.61 (m, 1H), 7.52 (d, 1H), 5.52 (d, 1H), 5.24- .43 (m, 1H), 4.26 (br s, 2H), 3.89 (s, 3H), 3.59-3.79 (m, 3H), 3.41-3.56 (m, 2H), 3.21-3.39 (m, 1H), 2.98-3.21 (m, 4H), 2.67-2.83 (m, 1H), 1.84-2.20 (m, 9H). 1H NMR (600 MHz, DMSO-da): 5 8.01 (s, 1H), 7.63-7.59 (m, 1H), 7.55-7.51 (m, 1H), 5.55- .51 (m, 1H), 5.43-5.24 (m, 1H), 4.29-4.22 (m, 2H), 3.90 (s, 3H), 3.80-3.60 (m, 2H), 3.56- 3.37 (m, 3H), 3.28-2.99 (m, 5H), 2.89-2.66 (m, 1H), .09 (m, 4H), 2.08-1.98 (m, 2H), 1.98-1.86 (m, 3H).

Crystallization of Example F1 by heating and g in isopropanol ldiethyl ether 474mg of amorphous Example F1 was suspended in 1.4mL of isopropanol. The mixture was heated to 70°C and stirredat 70°C to allow complete dissolution of e F1. The solution was cooled down to RT, a glue residue was . 2mL of diethyl ether was added and the slurry was stirred for 48h. A white suspension was formed. The suspension was filtered and the solid was dried at 40°C, 15mbar. A fine, white powder was obtained. The material ns only slight residual solvent (<0.5%). A crystalline anhydrous form of Example F1 with an onset melting of 148.77°C was obtained.

List of most significant 2-Theta peaks from X-ray Powder Diffraction Pattern with tolerances $0.5 of Example F1 anhydrous form (Method M1) (including low/weak peaks for information).

Note: This list of peaks is not exhaustive but are only “inter alia”. a in deg Intensity 17.7 unresolved Medium, Medium, Examples F2 to F15: The nds listed in Table 6 were prepared by a procedure analogous to that used in Example F1.

Table 6 HPLC Rt Compound I [min] Reaction Conditions (method) 0'79 (M1) 507 (1,1-Dioxo-hexahydro-1|ambda*6*—thiopyran y|)-{(S)—3-[1-(5-f|uoromethoxy-pyridiny|)- 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxaziny|oxy]— pyrrolidiny|}-methanone Buchwald amination condition: CA2 Amide bond condition: CBZ Side chain uction condition: CC1 sors used: CAS 9281188 / 127423- 61-4 / |A10 / 640963 {(S)—3-[1-(5-F|uoromethoxy-pyridinyl)—2,3- 0-73 (M1) 455 dihydro-1H-pyrido[3,4-b][1,4]oxaziny|oxy]— idiny|}-(1-methy|—1H-imidazoIy|)- methanone Buchwald amination condition: CA2 Amide bond condition: CBZ Side chain introduction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4 / |A10 / 41716-18—1 0.83 (M1) 466 2—Methoxy{7-[(S)—1-(tetrahydro-pyran carbonyl)-pyrro|idiny|oxy]—2,3-dihydro- pyrido[3,4-b][1,4]oxaziny|}-nicotinonitri|e Buchwald amination condition: CA2 Amide bond ion: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188, 127423 4, IA12, acyl chloride 40191-32—0 0.73 (M1) 462 2—Methoxy{7-[(S)—1-(1-methy|—1H-imidazoIe carbonyl)-pyrro|idiny|oxy]—2,3-dihydropyrido [3,4-b][1,4]oxaziny|}-nicotinonitri|e ld amination condition: CA2 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 9281188, 127423 4, IA12, 41716-18—1 WO 93849 21 0 {(S)—3-[1-(6-MethanesuIfonyImethyI-pyridin 0-75 (M1) 503 y|)-2,3-dihydro—1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-(tetrahydro-pyrany|)- methanone Buchwald amination condition: CA4 Amide bond condition: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188, 4, |A1, acyl chloride 40191-32—0 0.82 (M1) 539 {(S)—3-[1-(5-DifluoromethyImethoxy-pyridin y|)-2,3-dihydro—1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-(1,1-dioxo-hexahydro- 1|ambda*6*—thiopyrany|)-methanone Buchwald amination condition: CA2 Amide bond condition: CBZ Side chain introduction condition: CC1 sors used: CAS 9281188 / 127423- 61-4 / |A6 / 640963 21 1 -[1-(5-Difluoromethylmethoxy-pyridin 0.88 (M1) 491 yl)-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrrolidiny|}-(tetrahydro-pyranyl)— methanone Buchwald amination ion: CA2 Amide bond condition: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / - 61-4 / |A6 / Acyl chloride 401910 1-{(S)—3-[1-(5-Difluoromethylmethoxy-pyridin- 083 (M1) 451 3-yl)—2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrrolidiny|}methoxy-ethanone Buchwald amination condition: CA2 Amide bond condition: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4 / |A6 / Acyl chloride: 38870-89—2 21 2 0.77 (M1) 487 {(S)—3-[1-(5-DifluoromethyImethoxy-pyridin y|)-2,3-dihydro—1H-pyrido[3,4-b][1,4]oxazin y|oxy]-pyrro|idiny|}-(1-methy|—1H-imidazoI y|)-methanone Buchwald amination condition: CA2 Amide bond condition: CBB Side chain introduction condition: CC1 sors used: CAS 9281188 / - 61-4 / |A6 / 41716-18—1 1-{(S)—3-[1-(5-DifluoromethyImethanesuIfonyl- 0.76 (M1 ) 499 pyridinyl)—2,3-dihydro—1H-pyrido[3,4- ]oxazinyloxy]—pyrro|idiny|}methoxy- ethanone Buchwald amination condition: CA1 Amide bond condition: CB6 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / 127423- 61-4 / |A4 / Acyl chloride: 38870-89—2 21 3 0'81 (M1) 503 (1,1-Dioxo-hexahydro-1|ambda*6*—thiopyran y|)-{3-[1-(6-methoxy—5-methyI-pyridinyl)—2,3- dihydro-1H-pyrido[3,4-b][1,4]oxaziny|oxy]— pyrrolidiny|}-methanone Buchwald amination condition: CA4 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 9281188 / - 57-2 / |A9 / 87-3 1-12 (M1) 454 -{7-[(S)—1-(1,1-Dioxo—hexahydro—1|ambda*6*— thiopyrancarbonyl)-pyrro|idinyloxy]—2,3- dihydro-pyrido[3,4-b][1,4]oxaziny|}-2— methoxy-nicotinonitrile Buchwald amination condition: CA2 Amide bond condition: CB1 Side chain introduction condition: CC1 sors used: CAS 9281188, 127423 4, |A12,640963 21 4 (1,1-Dioxo-hexahydro-1|ambda*6*—thiopyran 0-89 (M1) y|)-{(R)—3-f|uoro[1-(6-methoxymethy|— 35_9 (CD12) pyridinyl)—2,3-dihydro—1H-pyrido[3,4- b][1,4]oxazinyloxy]—pyrro|idiny|}-methanone Buchwald amination ion: CA2 Amide bond condition: CB4 Side chain introduction condition: CC1 Precursors used: CAS 8694816 / 1174020- 51-9 Chiral separation method: CD12 21 5 (1,1-Dioxo-hexahydro-1|ambda*6*—thiopyran 0.89 (m1) y|)-{(R)—3-f|uoro[1-(6-methoxymethy|— 45.8 (CD12) pyridinyl)—2,3-dihydro—1H-pyrido[3,4- b][1,4]oxazinyloxy]—pyrro|idiny|}-methanone Buchwald amination ion: CA2 Amide bond condition: CB4 Side chain introduction condition: CC1 Precursors used: CAS 8694816 / 1174020- 51-9 Chiral separation method: CD12 21 6 Example G1 : lmidazo[2,1-b]thiazolyl-{(S)[1-(6-methoxytrifluoromethyl-pyridin- 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy]-pyrrolidinyl}-methanone CIJLO H KG BrfiNTO—>BHT,HF THF BU: NaH, THF o .5h j rt 20h KOH aq. soln. 3‘ Pd2(dba)3, on o o Y H tetramethyl- 0|)N,4O Br N t-butyI-X-Phos \ \ I I NaH, DMF _ / N N / dioxane, 100°C, 19 h 0 O 80°C, 17 h \o F / _\ Br NI \ F E:U0INCNO—/(JV NaOtBu, XPhos, Pd2(dba)3 N o o dioxane, 100°C, 2 h 1 H CH J,/ O 0 s N o F 0 F f) N \ F g) <\/WW / F | N \ F TFA, DOM [El I HBTU, DIPEA, DMF / rt 17h O”"CNH rt,17h N \ 0,, O /N E U EN/ N O / X N s a) 7-Bromo-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine A solution of 7-bromo-1 H-pyrido[3,4-b][1,4]oxazin-2—one (CAS registry 943995-72—0) (2.93 g, 12.79 mmol) in THF (40 ml) was treated with BH3*THF (1M in THF, 30 ml, 30 mmol). The reaction mixture was stirred at 80°C for 1.5 h, then cooled down to rt and quenched with methanol. The reaction mixture was concentrated under reduced pressure and the e was taken up with EtOAc and washed with aq. 1M NaOH so|n. The organic layer was dried WO 93849 21 7 over NaZSO4, filtered and concentrated under reduced pressure to afford the title product as a white solid. (2.48 g, 90% yield).

UPLC Rtm1=0.49 min; ESIMS: 217 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.72 (s, 1H), 6.60 (s, 1H), 4.42 (br s, 1H), 4.20-4.24 (m, 2H), 3.49 (m, 2H). b) o-2,3-dihydro-pyrido[3,4-b][1,4]oxazinecarboxylic acid benzyl ester A dry solution of 7-bromo-2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine (1.85 g, 8.60 mmol) in THF (50 ml) was portionwise treated at 0°C with 60% NaH in mineral oil (0.52 g, 12.90 mmol) and the reaction mixture was stirred at 0°C for 1 h. Benzyl chloroformate (CAS registry 501- 53-1) (1.40 ml, 9.85 mmol) was dropwise added and the reaction mixture was allowed to warm to rt and to stir for 20 h, y quenched with ol and then diluted with sat. aq.

NaHC03 soln. and extracted with EtOAc. The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was obtained after after flash chromatography on silica gel (heptane/ EtOAc, 100:0 to 60:40) as a white solid (2.06 g, 68% yield).

UPLC .14 min; ESIMS: 349 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 8.28 (br s, 1H), 7.98 (s, 1H), 7.35-7.46 (m, 5H), 5.30 (s, 2H), 4.20-4.27 (m, 2H), 3.92-4.01 (m, 2H). c) 2,3-Dihydro-1H-pyrido[3,4-b][1,4]oxazinol A mixture of 7-bromo-2,3-dihydro-pyrido[3,4-b][1,4]oxazinecarboxylic acid benzyl ester (1.27 g, 3.63 mmol), aq. KOH soln. (0.90 g, 16 mmol KOH in 3.2 ml water), 2-di-t- butylphosphino-3,4,5,6-tetramethyl-2’,4’,6-tri-i-propylbiphenyl 98% (0.26 g, 0.54 mmol) in dioxane (16 ml) was degassed with argon for 5 min, then Pd2(dba)3 (0.25 g, 0.27 mmol) was added. The tube was filled with argon, then sealed and the reaction mixture was stirred at 100°C for 19 h. After cooling to rt, the reaction mixture was filtered h hyflo, rinsed with EtOAc and methanol. The filtrates were dried over NaZSO4, filtered, trated and the title compound was ed after flash chromatography on silica gel (DCM / MeOH, 95:5 to 60:40) as an orange residue (262 mg, 47% yield).

UPLC RtM1=0.32 min; ESIMS: 153 [(M+H)+] 1H NMR (400 MHz, DMSO-ds):510.33(br.s, 1H), 7.03 (br.s, 1H), 6.71 (s, 1H), 5.15 (s, 1H), 3.95 (t, 2H), 3.25 (td, 2H). d) (S)(2,3-Dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert-butyl ester A dry solution of 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinol (200 mg, 0.66 mmol) and (R)—3- methanesulfonyloxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry 1274234) 21 8 (262 mg, 0.99 mmol) in DMF (6 ml) was treated with sodium hydride 60% in mineral oil (53 mg, 1.33 mmol) and the reaction mixture was stirred at 80°C for 17 h. After cooling to rt, the reaction e was diluted with TBME and washed with sat. aq. NaHCOs so|n.. The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was obtained after flash tography on silica gel (heptane/ EtOAc, 88:12 to 0:100) as an oil (140 mg, 66% yield).

UPLC .66 min; ESIMS: 322 [(M+H)+]. 1H NMR (400 MHz, : 6 7.54 (s, 1H), 5.86 (s, 1H), 5.42 (br.s, 1H), 4.25-4.41 (m, 1H), 4.19 (t, 2H), 3.38-3.66 (m, 6H), 2.00-2.18 (m, 2H), 1.46 (d, 9H). e) (S)[1-(6-Methoxytrifluoromethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4- ]oxaziny|oxy]-pyrrolidinecarboxylic acid tert-butyl ester A mixture of (2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert-butyl ester (115 mg, 0.36 mmol), 5-bromomethoxytrifluoromethylpyridine (CAS registry 12143770) (119 mg, 0.47 mmol), XPhos (14 mg, 0.03 mmol), and NaOtBu (76 mg, 0.79 mmol) in e (2.5 ml) was degassed with argon for 5 min, then Pd2(dba)3 (13 mg, 0.01 mmol) was added. The tube was filled with argon, then sealed and the reaction mixture was stirred at 100°C for 2 h. After cooling to rt, the reaction mixture was filtered through hyflo, rinsed with EtOAc and the filtrates were washed with sat. aq. NaHC03 so|n..

The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was obtained after flash chromatography on silica gel (heptane/ EtOAc, 93:7 to 40:60) as a clear gum. (91 mg, 51% yield).

UPLC Rtm1=1.27 min; ESIMS: 497 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 8.29 (d, 1H), 7.79 (d, 1H), 7.64 (d, 1H), 5.70 (s, 1H), 5.36-5.46 (m, 1H), 4.34 (br s, 2H), 4.09 (s, 3H), 3.70 (t, 2H), 3.34-3.62 (m, 4H), 2.02-2.11 (m, 2H), 1.44 (s, 9H). f) 1-(6-Methoxytrifluoromethyl-pyridinyl)((S)-pyrrolidinyloxy)-2,3-dihydro-1H- pyrido[3,4-b][1,4]oxazine A solution of (S)[1-(6-methoxytrifluoromethyl-pyridinyl)-2,3-dihydro-1H-pyrido[3,4- b][1,4]oxazinyloxy]-pyrrolidinecarboxylic acid tert-butyl ester (88 mg, 0.18 mmol) in DCM (1.3 ml) was treated with TFA (0.14 ml, 1.77 mmol) and the reaction mixture was stirred at rt for 17 h, then quenched with sat. aq. Na2C03 soln. and extracted with DCM. The organic layer was dried over NaZSO4, filtered and concentrated under reduced pressure to afford the title compound (66 mg, 94% yield).

UPLC RtM1=0.72 min; ESIMS: 397 [(M+H)+]. 21 9 1H NMR (400 MHz, 00013): 5 8.28 (d, 1H), 7.79 (d, 1H), 7.65 (s, 1H), 5.68 (s, 1H), 5.31-5.39 (m, 1H), 4.31-4.37 (m, 2H), 4.08 (s, 3H), .72 (m, 2H), 3.01-3.18 (m, 3H), 2.85-2.97 (m, 1H), 2.01-2.13 (m, 1H), 1.82-1.95 (m, 1H). 9) lmidazo[2,1-b]thiazolyl-{(S)[1-(6-methoxytrifluoromethyl-pyridinyl)-2,3- dihydro-1H-pyrido[3,4-b][1,4]oxazinyloxy]-pyrrolidiny|}-methanone A solution of imidazo[2,1-b]thiazolecarboxylic acid, romide (1:1) (CAS registry 725234-39—9) (25 mg, 0.10 mmol) in DMF (0.45 ml) was treated with HBTU (41 mg, 0.11 mmol) and DIPEA (0.04 ml, 0.21 mmol). The resulting orange solution was stirred at rt for 5 min, then a solution of ethoxytrifluoromethyl-pyridinyl)((S)-pyrrolidinyloxy)— 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxazine (32 mg, 0.08 mmol) in DMF (0.45 ml) was added.

The reaction mixture was stirred at rt for 17 h, then concentrated under reduced pressure and the residue was taken up with EtOAc and washed with brine. The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was ed after RP prep.

HPLC (Sunfire PrepC18 30x100 mm, 5 gm; solvent A: H20+0.1 Vol.-% TFA; solvent B: CH3CN +0.1 Vol.-% TFA, gradient 15—45% B in 16 min).After filtration over an Agilent PL- HC03 MP SPE cartridge, the title compound was obtained as a solid (23 mg, 52% yield).

UPLC RtM1=1.00 min; ESIMS: 547 [(M+H)+]. 1H NMR (400 MHz, a): 5 8.49 (dd, 1H), 8.16-8.20 (m, 2H), 7.92 (dd, 1H), 7.57 (d, 1H), 7.37 (dd, 1H), 5.63 (d, 1H), 5.33-5.45 (m, 1H), 4.25-4.31 (m, 2H), 3.52-4.14 (m, 9H), 1.88-2.12 (m, 2H).

Examples 62 to G3: The nds listed in Table 7 were prepared by a procedure analo- gous to that used in Example G1.

Table 7 HPLC Rt nd I [min] Reaction Conditions (method) (1 ,1-Dioxo-hexahydro—1|ambda*6*—thiopyran 0-80 (M1) 503 y|)-{(R)—3-[1-(6-methoxymethyI-pyridiny|)- 2,3-dihydro-1H-pyrido[3,4-b][1,4]oxaziny|oxy]— idiny|}-methanone Buchwald amination condition: CA2 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 943995-72—0 / 132945- 75-6 / |A9 / 640963 2012/057554 (5-AminomethyI-1H-imidazoIyl)-{(S)—3-[1- (6-methoxytrifluoromethyI-pyridiny|)-2,3- 0-85 (MM/'1) 520 o—1H-pyrido[3,4-b][1,4]oxaziny|oxy]— pyrrolidiny|}-methanone Buchwald amination condition: CA2 Amide bond condition: CB1 Side chain introduction condition: CC1 Precursors used: CAS 9439950 / 127423- 61-4 / |A21)/ |B3)/ Product obtained after Deboc reaction using TFA in CHZCIZ done in conventional way Examples H1 to H16: The compounds listed in Table 8 were prepared by chromatographic diastereomer separation.

Table 8 HPLC Rt Compound I [min] Reaction Conditions (method) 0.87 (M2) 531 ioxo—tetrahydro-1lambda*6*-thiophen y|)-{(S)—3-[1-(6-methanesulfonylmethyl- pyridinyl)—2,3-dihydro—1H-pyrido[3,4- ]oxazinyloxy]—pyrrolidiny|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: |A1,CAS 1274234 / 64096- 87-3 Chiral separation method: CD5 (1,1-Dioxo—tetrahydro-1lambda*6*—thiophen yl)—{(S)—3-[1-(6-methanesulfonylmethyl- 0-87 (M2) 536 pyridinyl)—2,3-dihydro—1H-pyrido[3,4- b][1,4]oxazinyloxy]—pyrrolidiny|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain uction ion: CC2 Precursors used: |A1,CAS 1274234 / 64096- 87-3 Chiral separation method: CD5 [1 ,4]Dioxanyl-{(S)[4-(6-methanesulfonyl 0.88 (M2) 504 methyl-pyridinyl)—3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy]—pyrrolidiny|}- methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: |A1,CAS 1274234 / 89364- 41-0 Chiral separation method: CD6 [1 ,4]Dioxanyl-{(S)[4-(6-methanesulfonyl 0.88 (M2) 504 methyl-pyridinyl)—3,4-dihyd ro-2H- benzo[1,4]oxazinyloxy]—pyrrolidiny|}- Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: |A1),CAS 1274234/ 893640 Chiral separation method: CD6 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0.91 (M2) 472 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- [1,4]dioxanyl-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: |A31, CAS 52605-98—8, 1274234 / 41-0 Chiral separation method: CD1 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0.91 (M2) 472 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-yl}-[1,4]dioxanyl-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ sors used: |A31,CAS 52605-98—8, 4 / 893640 Chiral separation method: CD1 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0_91 (M2) 472 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-y|}-(tetrahydro-furanyl)—methanone Buchwald amination condition: CA9 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: IA29, CAS 52605-98—8, 1274234 / 36 Chiral separation method: CD1 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0_91 (M2) 472 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-y|}-(tetrahydro-furanyl)-methanone Buchwald amination condition: CA6 Amide bond condition: CB4 Side chain introduction condition: CC2 Precursors used: IA29, CAS 52605-98—8, 1274234 / 12642936 Chiral separation method: CD1 {(S4-5,6-D') [ ( Imeth0Xy pyrl- 'd'In V)|-3,4- 091 (M2) 504 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-yl}-(1,1-dioxo—tetrahydro-1lambda*6*—thiophen- 3-yl)—methanone Buchwald amination ion: CA6 Amide bond condition: CB4 Side chain introduction condition: CC2 sors used: IA29, CAS 52605-98—8, 4 / 640963 Chiral separation method: CD1 WO 93849 {(S)—3-[4-(5,6-Dimethoxy—pyridinyl)—3,4- 0.91 (M2) 504 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-yl}-(1,1-dioxo—tetrahydro-1lambda*6*—thiophen- 3-yl)—methanone Buchwald amination ion: CA6 Amide bond condition: CB4 Side chain introduction condition: CCZ Precursors used: IA29, CAS 52605-98—8, 1274234 / 640963 Chiral separation method: CD1 (1,1-Dioxo—tetrahydro-1lambda*6*—thiophen 3.26 (M2) 492 yl)-{(S)[4-(5-fluoromethoxy-pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxazinyloxy]— pyrrolidiny|}-methanone Buchwald ion condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CCZ Precursors used: |A10,CAS 1244328, 1274234 / 640963 Chiral separation method: CD1 (1,1-Dioxo—tetrahydro-1lambda*6*—thiophen 3.25 (M2) 492 yl)-{(S)[4-(5-fluoromethoxy-pyridinyl)— 3,4-dihydro—2H-benzo[1,4]oxazinyloxy]— pyrrolidiny|}-methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CC2 Precursors used: |A10,CAS 1244328, 1274234 / 640963 Chiral separation : CD1 -[4-(5-Chloromethoxy-pyridinyl)—3,4- 3.52 (M2) 508 dIhydro-2H-benzo[1,4]ovaInyloxy]—pyrrolldIn-I I I I 1-yl}-(1,1-dioxo—tetrahydro-1lambda*6*—thiophen- 3-yl)—methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CC2 sors used: |A11,CAS 848366-28—9, 1274234 / 640963 Chiral separation method: CD2 WO 93849 {(S)—3-[4-(5-Chloromethoxy-pyridinyl)—3,4- 3.52 (M2) 508 dihydro—2H-benzo[1,4]oxazinyloxy]—pyrrolidin- 1-yl}-(1,1-dioxo—tetrahydro-1lambda*6*—thiophen- 3-yl)—methanone Buchwald amination condition: CA6 Amide bond condition: CB5 Side chain introduction condition: CC2 Precursors used: |A11,CAS 848366-28—9, 1274234 / 640963 Chiral separation method: CD2 [1 ,4]DioxanyI-{(S)[4-(5-f|uoro—6-methoxy- 3.28 (M2) 460 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrrolidiny|}-methanone ld amination ion: CA6 Amide bond condition: CB5 Side chain introduction condition: CC2 Precursors used: |A10,CAS 1244328, 1274234 / 893640 Chiral separation method: CD1 [1 ,4]DioxanyI-{(S)[4-(5-f|uoro—6-methoxy- 3.32 (M2) 460 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrro|idiny|}-methanone Buchwald amination condition: CA6 Amide bond ion: CB5 Side chain introduction condition: CCZ Precursors used: |A10,CAS 1244328, 1274234 / 893640 Chiral separation method: CD1 Example l1: (1,1-Dioxo-hexahydro-1lambda*6*-thiopyranyl)-{(S)[5-fluoro(6- methoxymethyl-pyridinyl)-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]-pyrrolidin yl}-methanone 8‘) b) F F H NaOMe 30°/° H Br N o Cul BBrs CH2CI2 H0 N 0 T —» if T O 0 C to rt 17 h O MeOH, 80°C, 20 h HO13M:+ Ho H BH-THF,THF 0°Ctort,17h fl] WE :EOM THF, 0°C to 60°C 19 h NI \ 0/ 0/ e) / f) N \ N \ Br I | / HCI 4N in dioxane / [RuPhos]palladacycle, F F RuPhos H N O O CHZCI2 H N o —> —> NaOtB d' EN'4 % rt 3d u, meme, O . E ENH 100°C, 23 h 0 HO ,9 o o I TEA, HATU, H CHZCIZ ___, E got 0°C, 1.5 h 0 1%» ,:-==0 a) 5-Fluoromethoxy-4H-benzo[1,4]oxazinone A solution of 6-bromofluoro-4H-benzo[1,4]oxazinone (CAS registry 10294210) (5.0 g, 20 mmol) in MeOH (10 ml) was treated with sodium ide solution (30% in MeOH, 11.3 ml, 61 mmol) and Cul (0.4 g, 2 mmol). After stirring for 20 h at 80°C, the reaction was quenched with sat. aq. NaHCOs soln and extracted with EtOAc. The organic layer was dried over NaZSO4, filtered and concentrated under reduced re to obtain a pale yellow solid. (2.2 g, 92% yield).

UPLC RtM1=0.64 min. 1H NMR (400 MHz, DMSO-ds): 6 6.74 (m, 2H), 4.53 (s, 2H), 3.79 (s, 3H). b) 5-Fluorohydroxy-4H-benzo[1,4]oxazinone A solution of 5-fluoromethoxy-4H-benzo[1,4]oxazinone (2.0 g, 10 mmol) in DCM (50 ml) was treated at 0°C with boron tribromide (9.6 ml, 101 mmol). The reaction mixture was stirred at rt for 17 h, then cooled down to 0°C and quenched with methanol. The mixture was concentrated under d pressure and the residue was taken up with EtOAc and washed with sat. aq. NaHCOs soln.. The organic layer was washed with 10% aq. Na28204 soln, dried over NaZSO4, filtered and concentrated under reduced pressure. The title compound was obtained after flash tography on silica gel (hexane/ EtOAc, 100:0 to 60:40) as a brown solid (780 mg, 42% yield).

UPLC RtM1=0.49 min; ESIMS: 228 OO)']. 1H NMR (400 MHz, DMSO-ds):511.00(s, 1H), 6.65 (d, 1H), 6.45 (t, 1H), 4.50 (s, 2H). c) 5-Fluoro-3,4-dihydro-2H-benzo[1,4]oxazinol A solution of 5-fluorohydroxy-4H-benzo[1,4]oxazinone (780 mg, 4.2 mmol) in THF (10 ml) was d with F (1M in THF, 12.8 mi, 12.8 mmol). The reaction mixture was stirred at rt for 17 h, then cooled down to 0°C and quenched with methanol (30 ml). The reaction mixture was concentrated under reduced re to obtain a brown oil (720 mg, quantitative yield).

UPLC .54 min; ESIMS: 170 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 8.95 (s, 1H), 6.45 (d, 1H), 6.00 (t, 1H), 4.09 (m, 2H), 3.45 (m, 2H). d) (S)(5-F|uoro-3,4-dihydro-2H-benzo[1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert-butyl ester A solution of triphenylphosphine (1.5 g, 5.7 mmol) in THF (20 ml) was treated at 0°C with DEAD (0.900 ml, 5.69). The orange solution was stirred over 10 min at rt, then 5-fluoro-3,4- dihydro-2H-benzo[1,4]oxazinol (740 mg, 4.37 mmol) and (R)—tert-butyl 3- hydroxypyrrolidinecarboxylate (1065 mg, 5.69 mmol) were added. The reaction mixture was stirred for 19 h at 60°C and then concentrated under reduced re. The title compound was obtained after flash chromatography on silica gel (Hexane/ EtOAc, 100:0 to 70:30) as a colourless oil (1.1 g, 74% yield).

UPLC RtM1=1.07 min; ESIMS: 339 [(M+H)+] 1H NMR (400 MHz, DMSO-ds): 6 6.45 (d, 1H), 6.00 (t, 1H), 5.42 (br.s, 1H), 4.25-4.41 (m, 1H), 4.19 (t, 2H), 3.38-3.66 (m, 6H), 2.00-2.18 (m, 2H), 1.46 (d, 9H) e) (S)[5-fluoro(6-methoxymethyl-pyridinyl)-3,4-dihydro-2H-benzo[1,4]oxazin- 6-yloxy]-pyrrolidinecarboxylic acid tert-butyl ester A mixture of (S)(5-fluoro-3,4-dihydro-2H-benzo[1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert—butyl ester (100 mg, 0.296 mmol), 5-bromomethoxymethylpyridine (CAS registry 7602072, 179 mg, 0.887 mmol), RuPhos (6.90 mg, 0.015 mmol), NaOtBu (85 mg, 0.887 mmol) and (2-dicyclohylphosphino-2' 6'-diisopropyl-1 1'-biphenyl)(2-(2- aminoethyl)phenyl)palladium(|l) (12.07 mg, 0.015 mmol) in dioxane (2 ml) were degassed with argon then sealed and the reaction mixture was stirred at 100°C for 23 h. After g to r.t., the reaction mixture was filtered h hyflo, rinsed with EtOAc and the filtrates were washed with sat. aq. NaHCOs soln.. The organic layer was dried over , filtered, concentrated and the title compound was obtained after flash chromatography on silica gel (Hexane/ EtOAc, 100:0 to 70:30) as a yellow oil(123 mg, 63% .

UPLC Rtm1=1.29 min; ESIMS: 460 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 5 7.75 (d, 1H),7.45 (d, 1H), 6.55 (t, 1H), 6.35 (d, 1H), 4.75 (m, 1H), 4.15 (t, 2H), 3.84 (s, 3H), 3.60 (t, 2H), 3.38-3.66 (m, 4H), 2.12 (s, 3H), 2.00-2.18 (m, 2H), 1.46 (d, 9H). f) 5-Fluoro(6-methoxymethyl-pyridinyl)((S)-pyrrolidinyloxy)-3,4-dihydro- 2H-benzo[1,4]oxazine A solution of [5-f|uoro(6-methoxymethyl-pyridinyl)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinecarboxylic acid tert—butyl ester (123 mg, 0.185 mmol) in DCM (2 ml) was treated with 4N HCl/dioxane (0.046 ml, 0.185 mmol). The reaction mixture was stirred at rt for 3 d, then concentrated under reduced pressure to obtain a black oil (100 mg, 79% yield).

UPLC Rtm1=0.73 min; ESIMS: 360 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 7.75 (d, 1H),7.45 (d, 1H), 6.80 (m, 1H), 6.75 (m, 1H), 5.20 (m, 1H), 4.15 (t, 2H), 3.84 (s, 3H), 3.60 (t, 2H), 3.38-3.66 (m, 4H), 2.12 (s, 3H), 2.00-2.18 (m, 2H). 9) (1,1-Dioxo-hexahydro-1lambda*6*-thiopyranyl)-{(S)[5-fluoro(6-methoxy -pyridiny|)-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]-pyrro|idiny|}- methanone A solution of 1,1-dioxo-hexahydro-1lambda*6*—thiopyrancarboxylic acid (CAS registry 640963) (33.9 mg, 0.15 mmol) in DCM (2 ml) was treated at rt with Et3N (0.061 ml, 0.440 mmol) and HATU (55.7 mg, 0.147 mmol). The resulting orange solution was stirred at rt for min, then a solution of 5-fluoro(6-methoxymethyl-pyridinyl)((S)-pyrrolidin 2012/057554 yloxy)—3,4-dihydro—2H-benzo[1,4]oxazine (100 mg, 0.147 mmol) in DCM (2 ml) was added.

The reaction mixture was stirred at rt for 1.5 h, then diluted with EtOAc and washed with sat. aq. NaHCOs soln. The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was obtained after prep. RP-HPLC (SunFire C18 column OBD 5 mm 30x100mm, nt 25% to 45% ACN in 16 min). The fractions were lyophilized and filtered over a PL-H003 MP SPE cartdrige to give a brown solid (54 mg, 71% yield).

UPLC RtM1=0.94 min; ESIMS: 520 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 6 7.75 (d, 1H),7.45 (d, 1H), 6.55 (t, 1H), 6.35 (d, 1H), 4.75 (m, 1H), 4.15 (t, 2H), 3.84 (s, 3H), 3.59-3.79 (m, 3H), 3.41-3.56 (m, 2H), 3.21-3.39 (m, 1H), 2.98- 3.21 (m, 4H), 2.67-2.83 (m, 1H), 1.84-2.20 (m, 9H). es l2 to l3: The compounds listed in Table 9 were prepared by a procedure analo- gous to that used in Example l1.

HPLC Rt Compound I [min] Reaction Conditions (method) 0'97 (M2) 556 {(S)[4-(5-Difluoromethylmethoxy-pyridin yl)fluoro-3,4-dihydro—2H-benzo[1,4]oxazin yloxy]-pyrrolidiny|}-(1,1-dioxo—hexahydro— 1lambda*6*—thiopyranyl)—methanone ld amination condition: CA11 Amide bond condition: CB3 Side chain introduction condition: CC4 Precursors used: |A6,CAS 37/ 1274234, / 640963 {(S)—3-[5-F|uoro(6-methanesulfonyImethyl- 0-85 (M2) 520 pyridinyl)—3,4-dihydro-2H-benzo[1,4]oxazin y|oxy]-pyrrolidiny|}-(tetrahydro-pyranyl)- methanone Buchwald amination condition: CA11 Amide bond condition: CBB Side chain introduction condition: Precursors used:|A1,CAS 1274234 / Acyl chloride 40191-32—0 Example J: (S)((S)Acetyl-pyrrolidinecarbonyl)-pyrrolidinyloxy]-2,3- dihydro-benzo[1,4]-oxazinyl}methoxy-nicotinonitrile A solution of 2-methoxy{6-[(S)—1-((S)-pyrrolidinecarbonyl)—pyrrolidinyloxy]—2,3- dihydro-benzo[1,4]oxazinyl}-nicotinonitrile (Example D39; 23 mg, 0.051 mmol) in DCM (1 ml) was treated with Et3N (0.014 mi, 10.4 mg, 0.102 mmol). The solution was d at rt for min, then acetyl chloride (0.0044 ml, 4.87 mg, 0.061 mmol) was added. The reaction e was stirred at rt for 1.5 h. Another 2 eq. of Et3N (0.014 mi, 10.4 mg, 0.102 mmol). and 1 eq. of acetyl chloride ((0.003? ml, 4.06 mg, 0.051 mmol) were added, stirring was continued at rt for 1.5 h. The reaction mixture was diluted with DCM and sat. aq. NaHC03 so|n., then passed through a phase separator, the aq. layer was twice extracted with DCM, the combined org. layers were concentrated to give the title compound as a yellow oil which was ed by prep. RP-HPLC (column e C18, 10-85% ACN in 20 min). The ons were extracted with DCM/NaHCO3, dried over MgSO4, concentrated and lyophilized to give the title compound as a yellow foam (14 mg, 53% yield).

HPLC 2.55 min; ESIMS: 492 [(M+H)+].

Example K: (S)—1-((R)Acetyl-pyrrolidinecarbonyl)-pyrrolidinyloxy]-2,3-dihydro- benzo[1,4]oxazinyl}methoxy-nicotinonitrile [ZUQMCW This example was prepared in analogy to Example J, starting from 2-methoxy{6-[(S)—1- ((R)—pyrrolidinecarbonyl)—pyrrolidinyloxy]-2,3-dihydro-benzo[1,4]oxazinyl}- nicotinonitrile (Example D40).

HPLC Rtm10=2.55 min; ESIMS: 492 [(M+H)+].

Example L: 2-Methoxy{6-[(S)—1-((R)methyl-pyrrolidinecarbonyl)—pyrrolidinyloxy]- 2,3-dihydro-benzo[1,4]oxazinyl}-nicotinonitrile N 0,,“ O E U 0 A solution of 2-methoxy{6-[(S)—1-((R)—pyrrolidinecarbonyl)-pyrrolidinyloxy]—2,3- dihydro-benzo[1,4]oxazinyl}-nicotinonitrile (Example D40, 26 mg, 0.058 mmol) in MeOH (1 ml) was treated with a 37% aq. formaldehyde soln. (0.043 mi, 46.9 mg, 0.578 mmol) and acetic acid (0.004 ml, 4.17 mg, 0.0069 mmol). The solution was stirred under argon at rt for 45 min, then NaBH3CN (5.65 mg of a 90% solid, 0.081 mmol) was added. The resulting mixture was stirred at rt for 45 min, diluted with DCM and sat. aq. NaHC03 soln.. The aq. layer was twice reextracted with DCM, the combined org. layers were dried over MgSO4 and concentrated to give the crude title compound that was purified by prep. RP-HPLC (column SunFire C18, gradient 5-75% ACN in 20 min). The fractions were extracted with DCM/sat. aq. NaHCO3 soln, dried over MgSO4, concentrated and lyophilized to give the title compound as a yellow foam (20 mg, 72% yield).

HPLC Rtm11=2.24 min; ESIMS: 464 [(M+H)+].

Example M; 4-(6-Methanesulfonylmethyl-pyridinyl)((S)pyridinyl-pyrrolidin- 3-y|oxy)-3,4-dihydro-2H-benzo[1,4]oxazine (20000 A solution of 4-(6-methanesulfonylmethyl-pyridinyl)—6-((S)—1-pyridinyl-pyrrolidin yloxy)-3,4-dihydro—2H-benzo[1,4]oxazine (prepared as bed in example B1; 60 mg, 0.154 mmol), 2-chloropyridine (CAS -1, 0.017 mi, 21.0 mg, 0.185 mmol), Xphos (8.81 mg, 0.018 mmol) and Cs2C03 (125 mg, 0.385 mmol) in dioxane (1 ml) was degassed with argon, then Pd2(dba)3 (7.05 mg, 0.0077 mmol) was added. The on mixture was heated at 80°C for 6 h, XPhos (8.81 mg, 0.018 mmol) was added, the mixture was again degassed with argon and Pd2(dba)3 (7.05 mg, 0.0077 mmol) was added. Stirring was continued over night at 80°C. The mixture was filtered through celite and concentrated to give the title nd that was purified by NP-HPLC (column Grace Grom Saphir 65 Si, gradient e:EtOAc:MeOH 68:30:2 to 0:65:35 in 12 min), yield 32 mg (45%).

HPLC RtM1=0.72 min; ESIMS: 467 [(M+H)+] 1H NMR (400 MHz, CDCI3): 5 8.32 (d, 1H), 8.14-8.12 (m, 1H), 7.49-7.39 (m, 2H), 6.86 (d, 1H), 6.61 (d, 1H), 6.57-6.46 (m, 2H), 6.37 (d, 1H), 4.92-4.85 (m, 1H), 4.26-4.24 (m, 2H), .74 (m, 2H), 3.71 (d, 2H), 3.63-3.55 (m, 2H), 3.32 (s, 3H), 2.67 (s, 3H), 2.35-2.27 (m, 1H), 2.26-2.15 (m, 1H).

Example N; 4-(6-Methanesulfonylmethyl-pyridinyl)((S)pyrimidinyl- pyrrolidinyloxy)-3,4-dihydro-2H-benzo[1,4]oxazine WO 93849 [NUO'CHN——DN A solution of 4-(6-methanesulfonylmethyl-pyridinyl)((S)pyridinyl-pyrrolidin y|oxy)-3,4-dihydro—2H-benzo[1,4]oxazine (prepared as described in example B1; 60 mg, 0.154 mmol), 2-chloropyrimidine (CAS 17229, 24.7 mg, 0.216 mmol) and DIPEA (0.054 ml, 39.8 mg, 0.308 mmol) in ACN (1 ml) was heated at 140 °C for 30 min in a microwave reactor. The product was extracted with sat. aq. NaHCOs soln. and EtOAc, filtered and concentrated to yield the title compound that was ed by prep. NP-HPLC n Grace Grom Saphir 65 Si, gradient heptane:EtOAc:MeOH 68:30:2 to 0:65:35 in 12 min), yield 45 mg (63%) HPLC Rtm1=0.97 min; ESIMS: 468 [(M+H)+] 1H NMR (400 MHz, CDCI3): 6 8.37-8.26 (m, 3H), 7.44 (d, 1H), 6.87 (d, 1H), 6.62 (d, 1H), 6.56-6.46 (m, 2H), 4.92-4.84 (m, 1H), 4.27-4.25 (m, 2H), 3.90-3.63 (m, 6H), 3.33 (s, 3H), 2.69 (s, 3H), 2.37-2.13 (m, 2H).

Example 01: 2-Methoxy{2-methyl[(S)(tetrahydro-pyrancarbonyl)-pyrrolidin- 3-y|oxy]-2,3-dihydro-benzo[1,4]oxazinyl}-nicotinonitrile .3200616 O b) ”VLOH Q H CI NaH, DMF HZNUO 37M 0 rt’ 1 h HO HATU, TEA, HO DMF, rt, 5 min o N o BH3.THF, THF N 0Q 0:3:0 6) d) ofiNo Pd(OH)2, ammonium formate MeOH,60°C, 15min FLOWU OMJ:NOHU NaH, DMF, 60°C, N|\ N\CN / | Br N o o NaOtBu, XPhos EN Pd2(dba)3, dioxane, O 100°C, 18 h 0 a) N-(5-Benzyloxyhydroxy-phenyl)ch|oro-propionamide A solution of 2-chloro-propionic acid (CAS ry 5987) (0.914 ml, 7.53 mmol) in DMF (20 ml) was treated with Et3N (1.259 ml, 9.03 mmol) and HATU (3.05 g, 8.03 mmol). The resulting on was stirred at rt for 30 min, then 2-aminobenzyloxy-phenol (CAS registry 1025804) (1.08 g, 5.02 mmol) was added. The reaction mixture was stirred at rt for 5 min, diluted with EtOAc and concentrated. The title nd was obtained after flash chromatography on silica gel (cyclohexane/ EtOAc, 100:0 to 50:50) as orange solid (617 mg, 40% yield).

UPLC RtM14 =1.32 min; ESIMS: 306 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 6 9.50 (d, 1H), 7.70 (br,s 1H), 7.45 (m, 5H), 6.80 (d, 1H), 6.65 (dd, 1H), 5.00 (s, 2H), 2.65 (s, 3H). b) 6-Benzyloxymethyl-4H-benzo[1,4]oxazinone A dry solution of N-(5-benzyloxy—2-hydroxy-phenyl)—2-chloro-propionamide (617 mg, 2.0 mmol) in DMF (15 ml) was treated at 0°C with sodium hydride 95% (58.1 mg, 2.4 mmol).

After stirring at rt for 1 h, the on mixture was diluted with DCM and washed with water.

The organic layer was dried over , filtered, concentrated and the title compound was obtained after flash chromatography on silica gel (cyclohexane/ EtOAc, 100:0 to 80:20) as a white solid (146 mg, 27% yield).

UPLC RtM14 =1.30 min; ESIMS: 270 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 6 10.80 (s, 1H), 7.45 (m, 5H), 6.85 (d, 1H), 6.65 (m, 2H), 5.00 (s, 2H), 4.55 (q, 1H), 1.45 (d, 3H). c) yloxymethyl-3,4-dihydro-2H-benzo[1,4]oxazine A solution of 6-benzyloxymethyl-4H-benzo[1,4]oxazinone (146 mg, 0.54 mmol) in THF (4 ml) was treated at 0°C with F (1M in THF, 0.813 ml, 0.813 mmol). After stirring at °C for 1 h, the reaction mixture was cooled down to 0°C, quenched with water (0.5 ml) and an aqueous NaOH 4N soln. (0.5 ml) and then diluted with EtOAc. The organic layer was dried over NaZSO4, ed, concentrated and the title compound was obtained as a white solid (125 mg, 90% yield).

UPLC RtM14=1.40 min; ESIMS: 256 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 6 7.45 (m, 5H), 6.50 (d, 1H), 6.20 (d, 1H), 6.10 (dd, 1H), 5.35 (s, 1H), 4.90 (s, 2H), 4.00 (m, 1H), 3.25 (m, 1H), 2.90 (m, 1H), 1.35 (d, 3H). d) 2-Methyl-3,4-dihydro-2H-benzo[1,4]oxazinol A solution of 6-benzyloxymethyl-3,4-dihydro-2H-benzo[1,4]oxazine (124 mg, 0.486 mmol) in MeOH (10 ml) was treated at rt with ammonium formate (276 mg, 4.37 mmol) and Pd(OH)2 (68.2 mg, 0.486 mmol). The reaction mixture was stirred at 60°C for 15 min. After cooling to rt, the reaction mixture was filtered through hyflo, rinsed with DCM and MeOH and then the filtrates were concentrated. The title compound was obtained after flash chromatography on silica gel (DCM / MeOH, 100:0 to 90:10) as a brown solid. (69.4 mg, 87% .

UPLC RtM14=0.56 min; ESIMS: 166 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 6 8.50 (s, 1H), 6.45 (d, 1H), 6.00 (d, 1H), 5.85 (dd, 1H), 5.25 (s, 1H), 4.00 (m, 1H), 3.25 (m, 1H), 2.90 (m, 1H), 1.35 (d, 3H). e) [(S)(2-Methyl-3,4-dihydro-2H-benzo[1,4]oxazinyloxy)-pyrrolidiny|]- (tetrahydro-pyranyl)-methanone A dry solution of 2-methyl-3,4-dihydro-2H-benzo[1,4]oxazinol (69 mg, 0.42 mmol) and (R)- rahydro-2H-pyrancarbonyl)pyrrolidinyl methanesulfonate (intermediate C1, 209 mg, 0.75 mmol) in DMF (1.4 ml) was treated with sodium hydride 60% in l oil (15.8 mg, 0.63 mmol) and the reaction mixture was stirred at 50°C for 18 h. The reaction mixture was diluted with EtOAc and washed with sat. aq. NaHCOs soln.. The organic layer was dried over , filtered, concentrated and the title compound was obtained after flash chromatography on silica gel (DCM / MeOH, 100:0 to 95:5) as a red orange sticky solid (128 mg, 88% yield).

UPLC Rtm14=1.01 min; ESIMS: 347 +] 1H NMR (400 MHz, DMSO-ds): 5 6.50 (d, 1H), 6.25 (d, 1H), 6.00 (d, 1H), 6.05 (m, 1H), 5.65 (m, 2H), 5.35 (d, 2H), 4.45 (d, 2H), 3.00-4.00 (m, 6H), 2.00-2.40 (m, 4H), 1.5 (m, 4H) f) 2-Methoxy{2-methyl[(S)(tetrahydro-pyrancarbonyl)-pyrrolidinyloxy]-2,3- dihydro-benzo[1,4]oxazinyl}-nicotinonitrile A e of (S)-(3-(2-methyl-3,4-dihydro-2H-benzo[b][1,4]oxazinyloxy)pyrrolidin trahydro—2H-pyranyl)methanone (128 mg, 0.369 mmol), 5-bromo—2- methoxynicotinonitrile (CAS registry 9412948, lA12), (94 mg, 0.443 mmol), XPhos (8.81 mg, 0.018 mmol), NaOtBu (53.3 mg, 0.554 mmol) and a)3 (16.92 mg, 0.018 mmol) in toluene (2.5 ml) was degassed with argon.The reaction mixture was stirred at 80°C for 20 min. After cooling to rt, the reaction mixture was filtered through hyflo, rinsed with EtOAc and the filtrates were washed with sat. aq. NaHCOs soln.. The organic layer was dried over NaZSO4, filtered and concentrated. The title compound was obtained after prep. RP-HPLC (SunFire C18 column OBD 5 mm 30x100mm, gradient 32% to 67% ACN in 15 min). The fractions were lyophilized and filtered over a PL-HCOs MP SPE cartridge to give a brown solid (39.1 mg, 22% yield).

UPLC RtMM =1.10 min; ESIMS: 479 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds, 394 K): 5 8.40-8.30 (m, 1H), 8.10-8.00 (m, 1H), 6.75 (d, 1H), 6.35 (m, 1H), 6.15 (m, 1H), 4.75 (m, 1H), 4.00 (s, 3H), 3.85 (m, 1H), 3.75-3.00 (m, 5H), 2.65 (m, 1H), 2.00 (m, 1H), 1.65 (m, 2H), 1.44 (d, 3H).

Examples 02 to 03: The compounds listed in Table 10 were prepared by chromatographic diastereomer separation.

Table 10 HPLC Rt nd I [min] Reaction Conditions immgioo Peak 1 diastereomer separation 2—Methoxy{(S)methy|—6-[(S)—1-(tetrahydro- pyrancarbonyl)—pyrrolidinyloxy]—2,3- 19.89 (M15) dihydro—benzo[1,4]oxaziny|}-nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB6 Side chain introduction condition: CCZ Precursors used: IO, |A12, CAS 1047060/ acyl chloride 401910 Chromatographic diasteroemer separation: CD11 \ O E“00/“No Peak 2 diastereomer tion oxy{(R)—2—methyl[(S)(tetrahydro- 27.33 (M15) pyrancarbonyl)-pyrrolidinyloxy]—2,3- dihydro—benzo[1,4]oxazinyl}-nicotinonitrile Buchwald amination condition: CA6 Amide bond condition: CB6 Side chain introduction condition: CC2 Precursors used: IO, |A12, CAS 1047060/ Acyl chloride 40191-32—0 Chromatograhic reomer separation: CD11 Example P: 2-Methoxy{6-[(S)(1-methyl-piperidinylmethyl)-pyrrolidinyloxy]- 2,3-dihydro-benzo[1,4]oxazinyl}-nicotinonitrile [U 0N O,“ a) (S)-tert-butyl 4-((3-(4-(5-cyanomethoxypyridinyl)-3,4-dihydro-2H- benzo[b][1,4]oxazinyloxy)pyrrolidinyl)methyl)piperidinecarboxylate A solution of 2-methoxy[6-((S)—pyrrolidinyloxy)—2,3-dihydro-benzo[1,4]oxazinyl]— nicotinonitrile (see analogue B1, c), 95 mg, 0.270 mmol) in DOE (4.5 ml) was treated with tert-butyl 4-formylpiperidinecarboxylate (60 mg, 0.281 mmol). After stirring for 2 d at rt, the reaction mixture was diluted with DCM and sat. aq. NaHCOs so|n. The organic layer was dried over NaZSO4, filtered, concentrated and the title nd was obtained after flash chromatography on silica gel (cyclohexane / EtOAc, 100:0 to 0:100), yield 66 mg, (40%) .

UPLC RtM1=1.66 min; ESIMS: 550 +]. 1H NMR (400 MHz, s): 5 8.35 (d, 1H), 7.75 (d, 1H), 7.35 (s, 1H), 7.85 (d, 1H), 5.35 (dd, 1H), 5.10 (d, 1H), 4.55 (m, 1H), 4.45 (m, 2H), 3.50 (m, 2H), 2.75-2.15 (m, 4H), 1.50 (s, 9H). b) (S)methoxy(6-(1-(piperidinylmethyl)pyrrolidinyloxy)-2H- b][1,4]oxazin-4(3H)-yl)nicotinonitrile A solution of (S)-tert-butyl 4-((3-(4-(5-cyanomethoxypyridinyl)—3,4-dihydro-2H- benzo[b][1,4]oxazinyloxy)pyrrolidinyl)methyl)piperidinecarboxylate) (66 mg, 0.120 mmol) in DCM (2 ml) was treated with TFA (0.093 ml, 1.20 mmol). The reaction mixture was stirred at rt for 17 h, then quenched with sat. aq. Na2C03 soln. and extracted with DCM. The organic layer was dried over NaZSO4, filtered and concentrated under reduced re to afford the title product (36 mg, 67% yield).

UPLC Rtm1=1.03 min; ESIMS: 450 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 8.35 (d, 1H), 7.80 (d, 1H), 7.25 (s, 1H), 6.80 (d, 1H), 6.25 (m, 1H), 6.15 (d, 1H), 4.65 (m, 1H), 4.45 (m, 2H), 3.60 (m, 2H), 2.75-2.15 (m, 4H). c) (S)methoxy(6-(1-((1-methylpiperidinyl)methyl)pyrrolidinyloxy)-2H- benzo[b][1,4]oxazin-4(3H)-yl)nicotinonitrile A solution of (S)methoxy(6-(1-(piperidiny|methyl)pyrrolidinyloxy)—2H- benzo[b][1,4]oxazin-4(3H)-yl)nicotinonitrile (36 mg, 0.080 mmol) in DOE (2 ml) was d with a 37% aq. formaldehyde soln. (8.94 pl, 0.120 mmol). The solution was stirred under argon at rt for 15 min, then NaBH3CN (50.9 mg, 0.240 mmol) was added. The resulting mixture was stirred at rt for 30 min, diluted with DCM and sat. aq. NaHC03 soln.. The organic layer was dried over NaZSO4 and trated. The title compound was obtained after purification by prep. RP-HPLC (column SunFire C18, gradient 15-50% ACN in 15 min). The fractions were extracted with DCM/sat. aq. NaHCO3 soln, dried over NaZSO4, concentrated and lyophilized to give the title compound (18 mg, 48% yield).

UPLC Rtm1=1.04 min; ESIMS: 464 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 8.35 (d, 1H), 7.85 (d, 1H), 7.45 (s, 1H), 6.75 (d, 1H), 6.35 (dd, 1H), 6.15 (d, 1H), 4.65 (m, 1H), 4.45 (m, 2H), 3.25 (m, 2H), 2.75-2.15 (m, 4H), 2.65 (s, 3H), 1.95 (m, 2H), 1.65 (m, 2H). \ o D N 0T U o /KC\0 Example Q: {(S)[4-(6-Methoxymethyl-pyridinyl)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrro|idiny|}-(tetrahydro-pyranyl)-methanone TBDMSCI, imidazole, DMF, LiAlD4, THF, (RENO rt,18h OTWU 0°Ctort,18h 030$“! 0% o" \ D H NaH,DMF, N OH D H rt,2d N o. O D CU o c) CN 0 | N \ NaOtBu, XPhos, Pd2(dba)3 | Br dioxane,100°C,2h d) DDKZKj/OWCN4:% —)>D©/TFA, DCM, N \ Et3 N, DCM, rt, 17h Clfi rt 15min °130H f) DECK)C‘0I)? a) 6-(tert-Butyl-dimethyl-si|any|oxy)-4H-benzo[1,4]oxazinone A solution of 6-hydroxy-2H-benzo[b][1,4]oxazin-3(4H)-one (CAS registry 534127) (1076 mg, 6.52 mmol) in DMF (8 ml) was treated at rt with TBDMSCI (1080 mg, 7.17 mmol) and imidazole (532 mg, 7.82 mmol). After stirring for 18 h at rt, the reaction mixture was diluted with DCM and washed with water. The organic layer was dried over NaZSO4, filtered, concentrated and the title nd was obtained after flash chromatography on silica gel hexane/ EtOAc, 100:0 to 50:50) as a white solid (1.18 g, 65% yield).

UPLC RtM2=1.91 min; ESIMS: 280 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.85 (br,s 1H), 7.35 (s, 1H), 6.85 (d, 1H), 6.45 (m, 1H), 6.30 (d, 1H), 4.50 (s, 2H), 1.00 (s, 9H), 0.25 (s, 6H). b) 3,3-Dideutero-3,4-dihydro-2H-benzo[1,4]oxazinol A solution of 6-(tert-butyl-dimethyl-silanyloxy)-4H-benzo[1,4]oxazinone (8.34 g, 29.8 mmol) in THF (100 ml) was treated at 0°C with lithium aluminium deuteride (2.26 g, 59.7 mmol). After stirring for 18 h at rt the reaction mixture was added to a cold aqueous 1 M Rochelle’s salt soln. and was extracted with EtOAc. The organic layer was dried over NaZSO4, filtered, concentrated and the title nd was obtained after flash chromatography on silica gel (cyclohexane/ EtOAc, 100:0 to 0:100) as a white solid (1.40 g, 31% yield).

UPLC RtM9 =0.69 min; ESIMS: 154 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 8.50 (s 1H), 6.45 (d, 1H), 6.00 (d, 1H), 5.85 (m, 1H), 5.15 (s, 1H), 4.00 (s, 2H). c) (S)(3,3-Dideutero-3,4-dihydro-2H-benzo[1,4]oxazinyloxy)-pyrrolidine carboxylic acid tert-butyl ester A dry on of 3,3-dideutero-3,4-dihydro-2H-benzo[1,4]oxazino| (1.44 g, 9.40 mmol) and (R)—3-methanesulfonyloxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry - 61-4) (5.49 g, 20.68 mmol) in DMF (10 ml) was treated with sodium hydride 60% in mineral oil (0.752 g, 18.80 mmol) and the reaction mixture was stirred at rt for 2 d. The reaction mixture was diluted with EtOAc and washed with sat. aq. NaHCOs soln.. The organic layer was dried over NaZSO4, ed, concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc, 100:0 to 0:100), to yield 4.12 g, (quantitative yield) of the title UPLC RtM1=1.07 min; ESIMS: 323 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 6.65 (m, 1H), 6.15 (m, 2H), 5.35 (m, 1H), 4.85 (m, 2H), 3.50 (m, 4H), 2.15 (m, 2H), 1.50 (s, 9H). d) (S)[4-(6-Methoxymethyl-pyridiny|)-3,3-dideutero-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrro|idinecarboxy|ic acid tert-butyl ester This example was prepared in analogy to Example G1, e).

UPLC .00 min; ESIMS: 444 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 7.95 (br.s, 1H), 7.45 (br.s, 1H), 6.80 (m, 1H), 6.25 (m, 1H), 4.75 (m, 1H), 4.35 (s, 2H), 4.00 (s, 3H), 3.50 (m, 4H), 2.25 (m, 2H), 1.50 (s, 9H). e) 4-(6-Methoxymethyl-pyridinyl)-3,3-dideutero((S)-pyrrolidinyloxy)-3,4- dihydro-2H-benzo-[1,4]oxazine This example was prepared in analogy to Example G1, f).

UPLC RtM1=1.26 min; ESIMS: 342 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 7.95 (br.s, 1H), 7.45 (br.s, 1H), 6.80 (m, 1H), 6.25 (m, 1H), 4.75 (m, 1H), 4.35 (s, 2H), 4.00 (s, 3H), 3.15 (m, 2H), 2.75 (m, 2H), 2.25 (m, 2H). f) {(S)[4-(6-Methoxymethyl-pyridiny|)-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]- idiny|}-(tetrahydro-pyranyl)-methanone This example was prepared in analogy to Example B1, d). UPLC Rtm1=1.65 min; ESIMS: 456 [(M+H)+]. 1H NMR (400 MHz, CDCI3, 298 K): 6 8.45 (m, 1H), 8.29 (s, 1H), 7.21 (t, 1H), 6.20 (t, 1H), 6.10 (s, 1H), 5.00 (d, 1H), 4.37 (t, 2H), 4.00 (m, 3H), 3.39-3.74 (m, 4H), 2.50 (m, 2H), 2.35 (s, 3H), 1.09-2.10 (m, 5H).

Example R: 5-{6-[(S)(4-Hydroxy-cyclohexanecarbonyl)-pyrrolidinyloxy]-2,3- dihydro-benzo[1,4]oxazinyl}methoxy-nicotinonitrile N \ \\N / O 11> CHN O,“ This example was prepared in analogy to Example J, starting from oxy{6-[(S)—1- ((S)-pyrrolidinecarbonyl)—pyrrolidinyloxy]-2,3-dihydro—benzo[1,4]oxazinyl}- nicotinonitrile.

UPLC RtMM =0.91 min; ESIMS: 478 [(M+H)+]. 1H NMR (400 MHz, DMSO-d6): 6 8.43 (d, 1H), 8.28 (d, 1H), 6.73 (m, 1H), 6.34 (m, 1H), 6.08 (dd, 1H), 4.76 (d, 1H), 4.51 (m, 1H), 4.22 (s, 2H), 4.00 (s, 3H), 3.20-3.71 (m, 9H), 1.09-2.10 (m, 10H).

Example S: 2-Methoxy{6-[(S)(2-pyridinyl-acetyl)-pyrrolidinyloxy]-2,3- dihydro-benzo[1,4]oxazinyl}-nicotinonitrile {:0 04:0o,,, \ This example was prepared in analogy to e J, starting from 2-methoxy{6-[(S)—1- ((S)-pyrrolidinecarbonyl)—pyrrolidinyloxy]-2,3-dihydro—benzo[1,4]oxaziny|}- nicotinonitrile.

UPLC RtM14 =0.82 min; ESIMS: 471 [(M+H)+] 1H NMR (400 MHz, DMSO-d6): 6 8.45 (m, 3H), 8.29 (s, 1H), 7.21 (m, 2H), 6.74 (m, 1H), 6.33 (m, 1H), 6.10 (m, 1H), 4.87 (d, 1H), 4.22 (s, 2H), 4.00 (s, 3H), 3.39-3.74 (m, 8H), 1.09-2.10 (m, 2H).

Example T: {(S)[4-(5-Aminomethoxy-pyridinyl)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinyl}-(1-methyl-1H-imidazolyl)-methanone a)5-[6-((S)tert-Butoxycarbony|-pyrro|idinyloxy)-2,3-dihydro-benzo[1,4]oxazin yl]methoxy-nicotinic acid methyl ester o 03< 0 cl) K3PO4,Pd(PtBu)2, o o\ 0” N71 toluene, 110°C, 18 h 0 + o /o —>/ / HN I | K/0 N\ N / N Under argon, K3PO4 (815 mg, 2.00 mmol) and bis-(t-butylphosphine)palladium (29.4 mg. 0.06 mmol) were added to a solution of (S)(3,4-dihydro—2H-benzo[1,4]oxazinyloxy)— pyrrolidinecarboxylic acid tert-butyl ester (prepared as described in step a) example B) (615 mg, 1.92 mmol) and 5-bromomethoxy-nicotinic acid methyl ester (IA 22, CAS ry 4) (614 mg, 1.30 mmol) in toluene (6 ml). The reaction mixture was degassed with argon for 15 min, then stirred at 110°C for 18 h, d with EtOAc and washed with a sat. aq. NaHCOs soln.. The organic layer was dried over MgSO4 and concentrated to afford the crude title compound that was purified by flash chromatography on silica gel (heptane/ EtOAc 90:10 to 0:100) to give a yellow gum (474 mg, 51% yield).

UPLC RtM2=1.36 min; ESIMS: 486 [(M+H)+]. b)5-[6-((S)tert-Butoxycarbonyl-pyrro|idinyloxy)-2,3-dihydro-benzo[1,4]oxazin methoxy-nicotinic acid H O " H NaOH dioxane/H o ’ H \ o h O OH EM /0 / ol< —> /o o3< A solution of 5-[6-((S)—1-tert-butoxycarbonyl-pyrrolidinyloxy)—2,3-dihydro—benzo[1,4]oxazin- 2-methoxy-nicotinic acid methyl ester (483 mg, 0.99 mmol) in dioxane (5 ml) was treated with a solution of sodium hydroxide pellets (119mg, 2.98 mmol) in water (2 ml). The solution was stirred at 80°C for 1 h. The reaction mixture was acidified to pH3 with aq. 1N HCI soln. and extracted with EtOAc. The combined organic phases were dried over MgSO4 and concentrated to afford the title compound after flash chromatography on silica gel (heptane/ EtOAc 100:0 to 0:100 then EtOAc/MeOH 90:10 to 80:20) as a solid (370mg, 79% yield).

UPLC RtMG =1.79 min; ESIMS: 372 [(M+H-100)+] 1H NMR (400 MHz, CDCI3): 5 8.22-8.48 (m, 2H), 6.82 (d, 1H), 6.33 (m,1H), 6.21 (d, 1H), .76 (m, 1H), 4.27-4.41 (m, 2H), 4.15-4.27 (m, 3H), 3.62-3.77 (m, 2H), 3.31-3.58 (m, 5H), 1.85-2.19 (m, 2H), 1.34-1.56 (m, 9H) c)(S)[4-(5-tert-Butoxycarbonylaminomethoxy-pyridiny|)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinecarboxy|ic acid tert-butyl ester l’ N O O “DMD Et N, t—BuOH, 100°C é 6 40 /O / —> /o / NK/O K/o A solution of 5-[6-((S)—1-tert-butoxycarbonyl-pyrrolidinyloxy)—2,3-dihydro—benzo[1,4]oxazin- 4-yl]—2-methoxy-nicotinic acid (370 mg, 0.78 mmol) and Et3N (0.28 ml, 1.96 mmol) in tBuOH (5 ml) was d with DPPA (CAS registry 263869) (0.17 ml, 0.78 mmol) and stirred at 100°C for 6 h. DCM and sat. aq. NaHCOs soln. were added,the organic layer was separated by elution through a separating phase cartridge and concentrated to afford the title compound after flash chromatography on silica gel (heptane/ EtOAc 100:0 to 50:50) as a pink gum (114 mg, 24%).

UPLC RtM2=1.36 min; ESIMS: 486 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 8.42 (br s, 1H), 7.75 (d, 1H), 7.02 (s, 1H), 6.78 (d, 1H), 6.15- 6.41 (m, 1H), 4.71 (br s, 1H), 4.23-4.39 (m, 2H), 4.09-4.22 (m, 3H), .75 (m, 2H), 3.31- 3.58 (m, 4H), .26 (m, 2H), .60 (m, 18H). d) 2-Methoxy[6-((S)-pyrrolidinyloxy)-2,3-dihydro-benzo[1,4]oxazinyl]-pyridin ylamine A m “0H 0 NH O 03< TFA,DCM,rt,1h NH2 /0 —> /O / /| I N\ N\ N N A solution of (S)[4-(5-tert-butoxycarbonylaminomethoxy-pyridinyl)-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]—pyrrolidinecarboxylic acid tert-butyl ester (130 mg, 0.24 mmol) in DCM (2 ml) was treated with TFA (CAS registry 761) and stirred at rt for 1 h. The reaction mixture was concentrated to afford the title compound after elution from a 2 g lsolute SCX—2 cartridge (eluent MeOH, then 2M NH3/MeOH) as a yellow gum (88 mg, quant. crude).

UPLC RtM2=1.25 min; ESIMS: 343 +]. e) {(S)[4-(5-Aminomethoxy-pyridinyl)-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]- pyrrolidinyl}-(1-methyl-1H-imidazolyl)-methanone NAN/ HEM—I /\ NH2 0 N/ N/ HBTU, EtSN, DMA, HENfi NH O 2 O /O — rt, 1 h + O —> /O / I I K/0 $0 A solution of 1-methyl-1H-imidazole—4-carboxylic acid (CAS registry 417161) (36.0 mg, 0.26 mmol) and Et3N (0.11 ml, 0.78 mmol) in DMF (1 ml) was treated with HBTU (CAS registry 94790-37) (107 mg, 0.28 mmol). After stirring at rt for 20 min, the reaction e was cooled down to 5°C and a solution of 2-methoxy[6-((S)—pyrrolidinyloxy)—2,3- dihydro-benzo[1,4]oxazinyl]-pyridinylamine (88 mg, 0.26 mmol) in DMF (3 ml) was added. The reaction mixture was stirred at rt for 1 h, concentrated and the residue was taken up in DCM (10 ml), washed with a sat. aq. NaHC03 soln. (5 ml), the organic layer was ted by n through a separating phase dge and concentrated. The residue was d by flash chromatography on silica gel (heptane/ EtOAc 100:0 to 0:100), the combined fractions were concentrated, dissolved in tBuOH/HZO and lyophilized to afford the title compound as a colourless solid (21 mg, 37% yield).

UPLC Rth =0.85 min; ESIMS: 451 [(M+H)+]. 1H NMR (400 MHz, CD30D): 5 7.64 (s, 1H), 7.62 (s, 1H), 7.65 m, 1H), 6.93 (m, 1H), 6.70 (m, 1H), 6.20-6.34 (m, 1H), 6.15 (m, 1H), 4.81 (m, 1H), 4.19-4.31 (m, 2H), 3.90-4.05 (m, 4H), 3.55-3.83 (m, 8H), 2.04-2.28 (m, 2H).

Example U: N-(2-Methoxy{6-[(S)(1-methyl-1H-imidazolecarbonyl)-pyrrolidin -2,3-dihydro-benzo[1,4]oxaziny|}-pyridinyl)-methanesulfonamide ¢\ / HE «EN ,? W ,, N N O pyEidine, MsCI, O¢S\ o 50 C,18h / HEN$ N O 0 /O / /O / I _> N\ I N N‘ b0 V’ A solution of {(S)[4-(5-Aminomethoxy-pyridinyl)-3,4-dihydro-2H-benzo[1 ,4]- oxazinyloxy]—pyrrolidinyl}-(1-methyl-1H-imidazolyl)-methanone (22.9 mg, 0.05 mmol) in pyridine (1ml) was treated with methanesulfonyl chloride (CAS registry 1240) (0.08 ml, 0.97 mmol) and stirred at 50°C for 18 h. The reaction e was diluted with DCM and H20, the organic layer was separated by elution through a separating phase cartridge and concentrated. The residue was purifed by flash tography on silica gel (heptane/ EtOAc 100:0 to 0:100 then EtOAc/MeOH 90:10 to 80:20), the combined fractions were trated, dissolved in tBuOH/HZO and lyophilized to afford the title compound as a colourless solid (14 mg, 49%).

UPLC RtM2=1.39 min; ESIMS: 529 [(M+H)+]. 1H NMR (400 MHz, CD30D): 5 7.87 (d, 1H), 7.41-7.76 (m, 3H), 6.73 (m, 1H), 6.02-6.44 (m, 2H), 4.14-4.39 (m, 2H), 3.87-4.12 (m, 5H), 3.55-3.84 (m, 8H), 2.85-3.08 (m, 3H), 1.75-2.40 (m, 2H).

Example V: (1 ,1-Dioxo-hexahydro-1lambda*6*-thiopyrany|)-{(S)[4-(6-methoxy methyl-pyridiny|)methyl-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]-pyrrolidin yl}-methanone NaOMe 30% in MeOH GET é GETCul 33% 130°0 5h DCM rt 18h 0 —» TE Ho: CAI/[(0% BH3THF H 0 18“ rt [N PPh3, DEAD, 70°C, 18h _, ’C/NJ( Jro d o O/ O/ NaOtBu,dioxane, N \ DCM N \ 100°C,18h '/ 6h rt '/ [RuPhos]Pd, 2. EDC HOBt NEt3, RuPhos DCM 18h rt N 0», / 0'0 00%N4 E: E C” 0 6 f N \ ” I o / s=o a) 6-Methoxymethyl-4H-benzo[1,4]oxazinone A solution of 6-bromomethyl-4H-benzo[1,4]oxazinone (CAS ry 11547402) (1000 mg, 4.13 mmol) and GUI (79 mg, 0.41 mmol) in NaOMe 30% in MeOH (8.1 ml) was stirred at 130°C for 5 h. The orange/brown mixture was cooled to rt, diluted with EtOAc and washed with a sat. aq. NaHCOs soln. The combined organic layers were dried over MgSO4, and concentrated to afford an orange solid. Trituration with cyclohexane afforded the title compound as a pink solid (647 mg, 70% yield).

HPLC Rtm1=0.73 min. 1H NMR (400 MHz, DMSO-ds):510.21 (s, 1H), 6.76 (d, 1H), 6.53 (d, 1H), 4.42 (s, 2H), 3.71 (s, 3H), 2.05 (s, 3H). b) 6-Hydroxymethyl-4H-benzo[1,4]oxazinone A suspension of 6-methoxymethyl-4H-benzo[1,4]oxazinone (647 mg, 3.35 mmol) in DCM (30 ml) was treated under argon at rt with BBr3 (3.16 mi, 33.5 mmol) and stirred for 18 h at rt. The reaction mixture was quenched by dropwise addition of MeOH at 0°C until obtention of a clear solution. After removal of the solvents, the residue was poured onto ice/ sat. aq. NaHCOs soln. and extracted with EtOAc. The organic layer was dried over MgSO4 and concentrated to afford the title compound as a brown solid (647 mg, crude), which was used in the next step without further purification.

HPLC RtM1=0.49 min. 1H NMR (400 MHz, DMSO-ds):610.11 (s, 1H), 6.43 (d, 1H), 5.98 (d, 1H), 4.57 (s, 2H), 1.89 (s, 3H). c) 5-Methyl-3,4-dihydro-2H-benzo[1,4]oxazinol A solution of 6-hydroxymethyl-4H-benzo[1,4]oxazinone (647 mg, 3.61 mmol) in THF (20 ml) was treated under argon at 0°C with BH3*THF (1M in THF, 10.83 mi, 10.83 mmol) and stirred for 18 h at rt. MeOH was added and the solution was stirred at rt for 1 h, concentrated to afford a residue which was dissolved in THF (20 ml), treated with F (1M in THF, 10.83 ml, 10.83 mmol) and stirred at rt for 18 h. MeOH was added, the solution was stirred at rt for 4 h, concentrated to dryness to afford the title compound as a brown solid (600 mg, , which was used in the next step without further purification.

HPLC Rtm1=0.49 min; ESIMS: 166 [(M+H)+]. d) (S)(5-Methyl-3,4-dihydro-2H-benzo[1,4]oxazinyloxy)-pyrrolidinecarboxylic acid tert-butyl ester A solution of triphenylphosphine (1.33 g, 5.09 mmol) in THF (10 ml) was treated with DEAD (0.8 ml, 5.09 mmol) followed by (R)—3-hydroxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry 1274234) (1 g, 5.45 mmol) and 5-methyl-3,4-dihydro-2H-benzo[1,4]oxazin- 6-ol (600 mg, 3.63 mmol). The resulting red/brown solution was d at 70°C for 18 h. The brown mixture was cooled down, diluted with EtOAc and washed with sat. aq. NaHCOs soln.

The ed organic layers were dried over MgSO4, filtered and trated to afford a brown oil. The crude product was three times ed by flash chromatography on silica gel (cyclohexane/ EtOAc 90:10 to 40:60) to afford the title compound as a colourless oil (130 mg, 11% yield) HPLC RtM1=1.09 min; ESIMS: 335 [(M+H)+]. 1H NMR (400 MHz, a): 6 6.44 (d, 1H), 6.22-6.04 (m, 1H), 5.24 (br s, 1H), 4.75 (br s, 1H), 4.07-3.93 (m, 2H), 3.45-3.33 (m, 3H), 3.28 (d, 7H), 2.00 (d, 2H), 1.83 (d, 3H), 1.46-1.32 (m, 9H).

WO 93849 e) (S)[4-(6-Methoxymethyl-pyridiny|)methy|-3,4-dihydro-2H-benzo[1,4]oxazin- 6-yloxy]-pyrrolidinecarboxylic acid utyl ester A solution of (S)(5-methyl-3,4-dihydro-2H-benzo[1 ,4]oxazinyloxy)-pyrrolidine carboxylic acid tert-butyl ester (120 mg, 0.36 mmol), 5-bromomethoxymethylpyridine (CAS registry 7602072) (145 mg, 0.72 mmol), NaOtBu (103 mg, 1.08 mmol), RuPhos (CAS registry 7876188) (8 mg, 0.02 mmol) and[RuPhos]palladacycle (CAS registry 7876188) (15 mg, 0.02 mmol) in dioxane (2 ml) was stirred at 100°C for 18 h. The orange/brown mixture was cooled with EtOAc and washed with water. The , diluted ed organic layers were dried over MgSO4, filtered and concentrated to afford a brown oil. The crude product was three times purified by flash chromatography on silica gel (cyclohexane/ EtOAc 95:05 to 60:40) to afford the title compound as a yellow oil (97 mg, 60% yield) HPLC Rtm1=1.37 min; ESIMS: 456 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 7.40 (d, 1H), 7.28-7.07 (m, 1H), 6.74 (s, 2H), 4.84 (br s, 1H), 3.96 (br s, 2H), 3.80 (s, 2H), 3.57 (br s, 2H), 3.44-3.19 (m, 10H), 2.08 (s, 3H), 2.05-1.92 (m, 2H), 1.60 (d, 3H), 1.34 (d, 9H). f) (1,1 -Dioxo-hexahydro-1 lambda*6*-thiopyrany|)-{(S)[4-(6-methoxymethyl- pyridinyl)methyl-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]-pyrrolidiny|}- methanone A on of (S)[4-(6-methoxymethyl-pyridinyl)—5-methyl-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinecarboxy|ic acid tert—butyl ester (97 mg, 0.21 mmol) in DCM (3 ml) was treated under argon at rt with TFA (0.16 ml, 2.13 mmol) and stirred for 6 h.

The reaction mixture was quenched with sat. aq. NaHCOs soln. and the organic solution was separated through a phase separating cartridge affording a yellow solution. 1,1-Dioxo- hexahydro-1|ambda*6*—thiopyrancarboxylic acid (CAS registry 640963) (49 mg, 0.28 mmol), Et3N (0.09 ml, 0.64 mmol), EDC (62 mg, 0.32 mmol), HOBT (49 mg, 0.32 mmol) were added to the yellow solution and stirred at rt for 18 h. The reaction mixture was quenched with sat. aq. NaHCOs soln. and the organic layer was separated by passing through a phase separating dge, then trated and purified by prep. RP-HPLC (column SunFire C18 OBD 5 mm 30x100mm, Solvent A: H20 (0.1% TFA) Solvent B: CH3CN (0.1% TFA) afforded the title nd as white solid (76 mg, 70% yield) HPLC RtM1=0.98 min; ESIMS: 516 [(M+H)+]. 1H NMR (400 MHz, s, 375K): 5 7.44 (br s, 1H), 7.18 (br s, 1H), 6.75 (s, 2H), 4.88 (br s, 1 H), 4.02 (t, 2H), 3.86 (s, 3H), 3.81-3.33 (m, 6H), 3.24-3.06 (m, 4H), 2.83 (br s, 1H), 1.66 (s, 3H). Rotamers.

Example W: {(S)[4-(6-Methanesulfonylmethyl-pyridinyl)methy|-3,4-dihydro- 2H-benzo[1,4]oxazinyloxy]-pyrro|idiny|}-(tetrahydro-pyrany|)-methanone O=g=0 Cscog, BINAP \ N BH3.THF Pd(OAc)2 THF, n rt Toluene, 100°C 2 days 2 days OT:81) N Br E:1]—*b E I] | | O=S=O o=s=o NaOtBu \N \N Dioxane, 100°C, 0.5h / Pd/C, H2, AcOH / Phos)Pd, RuPhos MeOH/THF, rt, 65h —> —> c d EIZM'IIB/2 0II (I) || 0 0(R) O=S=O H2804. NaNo2 \N \N H20, rt, 3d | HOUN:,_/< / l/ 3 too , tofij "ow O=S=O CHZCIZ, rt, 18h \ N g Eififog a) 6-Bromomethyl-3,4-dihydro-2H-benzo[1,4]oxazine A solution of 6-bromomethyI-4H-benzo[1,4]oxazinone (CAS registry 11547402) (425 mg, 1.56 mmol) in THF (9 ml) was treated under argon at 0°C with BH3*THF (1M in THF, 4.7 ml, 4.69 mmol) and stirred for 18 h at rt. BH3.THF 1M (2 ml) was added and stirring was continued for another 24 h. The reaction e was concentrated and purified by flash chromatography on silica gel ( cyclohexane/ EtOAc 100:0 to 80:20) to afford the title compound as an orange solid (324 mg, 86% yield) HPLC .04 min; ESIMS: 228, 230 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 6.68 (d, 1H), 6.48 (d, 1H), 5.54 (br s, 1H), 4.04 (t, 2H), 3.36- 3.26 (m, 2H), 2.11(s, 3H). b) 6-Bromo(6-methanesulfonylmethyI-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazine A solution of 6-bromomethyl-3,4-dihydro—2H-benzo[1,4]oxazine (324 mg, 1.42 mmol), Intermediate |A1 (391 mg, 1.56 mmol), Cs2C03 (1018 mg, 3.13 mmol), BINAP (CAS registry 87-8) (44 mg, 0.07 mmol), Pd(OAc)2 (CAS registry 33753) (32 mg, 0.14 mmol) in toluene (13 ml) was stirred at 100°C for 18 h. Catalyst and ligand were reloaded and stirring was continued for another 24 h at 100°c. The reaction e was cooled to rt, diluted with EtOAc and washed with water. Concentration of the organic layer and purification by flash chromatography on silica gel (cyclohexane/ EtOAc 97:03 to 40:60) afforded the title compound as an orange solid (345 mg, 58% yield).

HPLC RtM1=1.13 min; ESIMS: 397,399 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 7.99 (br. s, 1H), 7.37 (d, 1H), 7.24 (br. s, 1H), 6.83 (d, 1H), 4.13 (t, 2H), 3.97-3.86 (m, 2H), 3.30 (s, 3H), 2.52 (s, 3H), 1.93 (s, 3H). c) Benzyl-[4-(6-methanesulfonylmethyl-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinyl]-amine A solution of 6-bromo(6-methanesulfonylmethyl-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazine (324 mg, 0.82 mmol), benzylamine (350 mg, 3.26 mmol), NaOtBu (157 mg, 1.63 mmol), RuPhos (CAS registry 7876188) (30 mg, 0.06mmol) and [BrettPhos]palladacycle (CAS registry 11481489) (52 mg, 0.06 mmol) in dioxane (16 ml) was stirred at 80°C for 0.5 h. Filtration, concentration of the filtrate and cation by flash chromatography on silica gel (cyclohexane/ EtOAc 88:12 to 35:65) afforded the title compound as a yellow oil (228 mg, 66% yield).

HPLC Rtm1=1.13 min; ESIMS: 424 +]. 1H NMR (400 MHz, DMSO-da): 6 7.94 (br s, 1H), 7.40-7.33 (m, 2H), 7.30 (t, 2H), 7.19 (t, 2H), 6.58 (d, 1H), 6.30 (d, 1H), 5.25 (t, 1H), 4.30 (d, 2H), .97 (m, 2H), 3.90 (d, 2H), 3.29 (s, 3H), 2.51 (br s, 3H), 1.76 (s, 3H). d) 4-(6-Methanesulfonylmethyl-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinylamine A solution of benzyl-[4-(6-methanesulfonylmethyl-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinyl]-amine (228 mg, 0.53 mmol), acetic acid (0.21 ml, 3.70 mmol), Pd/C in MeOH/THF (2.5/2.5 ml) was hydrogenated with H2 at rt for 65 h. Filtration and concentration of the filtrate afforded the title compound as a green oil (200 mg, crude, including remaining AcOH).

HPLC RtM1=0.64 min; ESIMS: 334 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 7.96 (br s, 1H), 7.17 (br s, 1H), 6.62-6.54 (d, 1H), 6.54- 6.45(d, 1H), 4.48 (br s, 2H), 4.01 (t, 2H), 3.88 (br s, 2H), 3.28 (s, 3H), 1.88 (d, 3H), 1.63 (s, 3H). e) ethanesulfonylmethyl-pyridiny|)methyl-3,4-dihydro-2H- benzo[1,4]oxazinol A solution of 4-(6-methanesulfonylmethyl-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinylamine (200 mg, 0.60 mmol) in water (3.5 ml) and H2804 (0.32 ml) was added dropwise to a solution of sodium nitrite (49.7 mg, 0.72 mmol) in water (10 ml) at 0°C.

The mixture was stirred at rt for 3 d. The reaction mixture was filtered and the filtrate was quenched with sat. aq. NaHCOs soln. and extracted with EtOAc. The organic layer was dried over MgSO4, ed and concentrated to afford a brown oil. Purification by flash chromatography on silica gel (DCM / MeOH 88:12 to 80:20) ed the title nd as a brown oil (50 mg, 25% yield).

HPLC RtM1=0.78 min; ESIMS: 335 [(M+H)+]. f) (1,1 -Dioxo-hexahydro-1 lambda*6*-thiopyrany|)-{(S)[4-(6-methoxymethyl- pyridinyl)methyl-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]-pyrrolidiny|}- methanone A solution of triphenylphosphine (55 mg, 0.21 mmol) in THF (2.5 ml) was treated with DEAD (0.03 ml, 0.21 mmol), followed by (R)—3-hydroxy-pyrrolidine—1-carboxylic acid tert-butyl ester (CAS registry 4) (33 mg, 0.18 mmol) and 4-(6-methanesulfonylmethyl-pyridin- 3-yl)methyl-3,4-dihydro-2H-benzo[1,4]oxazinol (50 mg, 0.15 mmol). The resulting red/brown solution was stirred at 70°C for 18 h. The reaction mixture was cooled down to rt, d with EtOAc and washed with sat. aq. NaHCOs soln.. The organic layer was dried over MgSO4. concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 90:10 to 40:60) to afford the title compound as an orange solid (44 mg, 58% yield) HPLC .16 min; ESIMS: 504 [(M+H)+]. g) {(S)[4-(6-Methanesulfonylmethyl-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidiny|}-(tetrahydro-pyranyl)-methanone A solution of (1 ,1-dioxo-hexahydro-1 lambda*6*—thiopyranyl)-{(S)[4-(6-methoxy methyl-pyridinyl)methyl-3,4-dihydro-2H-benzo[1,4]oxazinyloxy]-pyrrolidiny|}- methanone (44 mg, 0.09 mmol) in DCM (4 ml) was treated under argon at rt with TFA (0.07 ml, 0.17 mmol) and stirred for 18 h. The reaction mixture was ed with sat. aq.

NaHCOs soln. and the organic solution was separated h a phase separating cartridge, concentrated and purified by flash chromatography on silica gel (DCM / MeOH 100:0 to 90:10).The obtained product was dissolved in DCM (4 ml) and Et3N was added. ydro- pyrancarbonyl chloride (CAS registry 32-0) (15 mg, 0.10 mmol) was added to the reaction mixture at 0°C and the resulting orange solution was stirred at rt for 4 h. The reaction mixture was quenched with sat. aq. NaHCOs soln. and the organic layer was separated by elution through a phase separating cartridge, concentrated and purified by SFC (column NH2 (250 x 30mm (l x w), 60A, 5pm, Princeton, nt of methanol in supercritical C02) to afford the title compound as a yellow oil (15 mg, 32% yield) HPLC Rtm1=0.88 min; ESIMS: 516 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds, 375K): 5 7.98 (br s, 1 H), 7.19 (br s, 1 H), 6.92 - 6.85 (m, 1 H), 6.85 - 6.77 (m, 1 H), 4.95 (br s, 1 H), 4.12 (t, 2 H), 3.92 (t, 2 H), 3.88 (br s, 2 H), 3.61 (br s, 3 H), 3.38 (td, 2 H), 3.27 (s, 3 H), 2.68 (d, 1 H), 2.56 (s, 3 H), 2.17 (br s, 2 H), 1.73 (s, 3 H), 1.58 (br s, 4 H). Rotamers.

Example X: {(S)[4-(5-Difluoromethylmethoxy-pyridinyl)methyl-3,4-dihydro- 2H-benzo[1,4]oxazinyloxy]-pyrrolidinyl}-(1,1-dioxo-hexahydro-1|ambda*6*- thiopyranyl)-methanone BH3.THF NaO‘Bu NI \ THF, 0°C then rt Dioxane, 100°C, 3 days / 2 days (BrettPhos)Pd, RuPhos 0 N Br N Br N Br T —* —* a E o o b o O/ O F HO(R) O a)3,(CH34‘BuXPhos N \ F l/ N4 NI \ KOH,Dioxane/HZO 0% / 100 0, 18h N OH N 0,,” o E d E CM J<o 0 O 1,TFA , rt, 18h / 2, EDC, HoBt, Et3N N \ F , rt, 18h l a) 6-Bromomethyl-3,4-dihydro-2H-benzo[1,4]oxazine A solution of 6-bromomethyl-4H-benzo[1,4]oxazinone (CAS registry 11547402) (2.8 g, 11.56 mmol) in THF (50 ml) was treated under argon with BH3*THF (1M in THF, 34.7 ml, 34.70 mmol) and heated under reflux for 2 h. MeOH was added and the solution was stirred at rt for 1 h, concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 100:0 to 80:20) to afford the title compound as an orange solid (1.8 g, 68% yield).

HPLC RtM1=1.04 min; ESIMS: 228, 230 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 6.68 (d, 1H), 6.48 (d, 1H), 5.54 (br s, 1H), 4.04 (t, 2H), 3.36- 3.26 (m, 2H), 2.11 (s, 3H). b) 6-Bromo(5-difluoromethylmethoxy-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazine A solution of 6-bromomethyl-3,4-dihydro-2H-benzo[1,4]oxazine (500 mg, 2.19 mmol), Intermediate |A6 (574 mg, 2.41 mmol), NaOtBu (421 mg, 4.38 mmol), BrettPhos (CAS registry 10706633) (59 mg, 0.11 mmol) and [BrettPhos]palladacycle (CAS ry 11481489) (88 mg, 0.11 mmol) in dioxane (11 ml) was stirred at 100°C for 18 h. Catalyst and ligand were reloaded and stirring was continued at 100°C for 48 h. The reaction mixture was cooled down to rt, diluted with EtOAc and washed with sat. aq. NaHCOs soln. The organic layer was dried over MgSO4, concentrated to afford a brown oil. Purification by flash chromatography on silica gel ( cyclohexane/ EtOAc 100:0 to 80:20) ed the title compound as a brown oil (150 mg, 18% yield).

HPLC Rtm1=1.34 min; ESIMS: 385, 387 [(M+H)+]. c) 4-(5-Difluoromethylmethoxy-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinol A mixture of 6-bromo(5-difluoromethylmethoxy-pyridinyl)—5-methyl-3,4-dihydro-2H- benzo[1,4]oxazine (150 mg, 0.39 mmol), KOH (65 mg, 1.17 mmol) in water (0.33 ml), tetramethyl-t-butyl-XPhos (CAS registry 8573566) (18.72 mg, 0.04 mmol) and Pd2(dba)3 (17.83 mg, 0.02 mmol) in dioxane (2 ml) was degassed with nitrogen and heated at 100°C for 18 h. Filtration, concentration and purification by flash chromatography on silica gel hexane/ EtOAc 100:0 to 70:30) afforded the title compound as an orange oil (65 mg, 52% yield).

HPLC Rtm1=1.01 min; ESIMS: 323 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 8.83 (s, 1H), 7.89 (d, 1H), 7.36 (d, 1H), 7.00 (t, 1H), 6.61 (d, 1H), 6.55 (d, 1H), 3.93 (t, 2H), 3.88 (s, 3H), 3.65 (t, 2H), 1.60 (s, 3H). d) (S)[4-(5-Difluoromethylmethoxy-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinecarboxylic acid tert-butyl ester A solution of nylphosphine (74 mg, 0.28 mmol) in THF (2 ml) was treated with DEAD (0.04 ml, 0.28 mmol) followed by (R)—3-hydroxy-pyrrolidinecarboxylic acid tert-butyl ester (CAS ry 1274234) (45 mg, 0.24 mmol) and 4-(5-difluoromethylmethoxy-pyridin- -methyl-3,4-dihydro-2H-benzo[1,4]oxazinol (65 mg, 0.20 mmol). The resulting red/brown solution was stirred at 70°C for 18 h, cooled down to rt, diluted with EtOAc and washed with sat. aq. NaHCOs soln. The c layer was dried over MgSO4, trated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 100:0 to 70:30) to afford the title compound as a yellow solid (51 mg, 42% yield).

HPLC RtM1=1.36 min; ESIMS: 492 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 5 7.92-7.75 (m, 1H), 7.46-7.33 (m, 1H), 7.19-6.84 (t, 1H), 6.77 (s, 2H), 4.86 (br s, 1H), 3.98 (br s, 2H), 3.88 (s, 3H), 3.73-3.55 (m, 2H), 3.46-3.33 (m, 2H), .95 (m, 2H), 1.65-1.55 (m, 3H), 1.34 (br s, 9H). Rotamers. e) {(S)[4-(5-Difluoromethylmethoxy-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidiny|}-(1,1-dioxo-hexahydro-1|ambda*6*-thiopyran- 4-y|)-methanone A solution of (S)[4-(5-difluoromethylmethoxy-pyridinyl)methyl-3,4-dihydro-2H- benzo[1,4]oxazinyloxy]-pyrrolidinecarboxy|ic acid tert-butyl ester (51 mg, 0.10 mmol) in DCM (3 ml) was treated under argon at rt with TFA (0.08 ml, 1.10 mmol) and stirred for 18 h.

The reaction mixture was quenched with sat. aq. NaHCOs soln. and the organic on was ted through a phase separating affording a yellow solution. 1,1-Dioxo-hexahydro- 1|ambda*6*—thiopyrancarboxylic acid (CAS registry 640963) (25 mg, 0.14 mmol), Et3N (0.05 ml, 0.33 mmol), EDC (31 mg, 0.16 mmol) and HOBT (25 mg, 0.16 mmol) were added and the reaction mixture was stirred at rt for 3 h. The reaction mixture was ed with sat. aq. NaHCOs soln. The organic layer was separated by elution through a phase separating cartridge, the crude product was purified over SFC (column Reprosil NH2 (250 x 30mm (l x w), 60A, 5pm, Princeton, gradient of methanol in supercritical C02) to afford the title nd as a yellow oil (19 mg, 30% yield) HPLC Rtm1=1.00 min; ESIMS: 552 [(M+H)+]. 1H NMR (400 MHz, DMSO-da 375K): 5 7.85 (br s, 1 H), 7.43 (br s, 1H), 6.96 (t, 1H), 6.80 (s, 2H), 5.11-4.71 (m, 1H), 4.04 (t, 2 H), 3.94 (s, 3H), 3.70 (d, 2 H), 3.63 (br s, 2 H), 3.52 (br s, 2 H), .04 (m, 4H), 2.92-2.73 (m, 1H), 2.16 (br s, 2 H), 2.06 (br s, 4H), 1.67 (s, 3 H), Rotamers. e Y: 2-Methoxy{6-[(S)(tetrahydro-pyrancarbonyl)-pyrrolidinylamino]- hydro-benzo[1,4]oxazinyl}-nicotinonitrile N Br / EU N O O \ | \ N Pd(0)[(t-Bu)3P]21 NaOtBu / :N NIS, TFA, TFAA l toluene / N Br 90°C,18h 110°C, 18 h | E U H N“, NJL /# O/ l I O N 2-dicyclohexylphosphinobi- TFA, CH2C|2, phenyl, NaOtBu,Pd2(dba)3, rt, 2 h toluene,110°C,1h E:UNCNo4o7< //N CIJKO //N EtN CH2C|2, [:©H"~CNH——’0.0 H. [231)“CJb a) methoxy-nicotinonitrile A mixture of 2-methoxy-nicotinonitrile (CAS registry 72544) (10 g, 74.6 mmol) and N- iodosuccinimide (CAS registry 5161) (25.2 g, 112 mmol) was treated with trifluoroacetic acid (CAS registry 761) (68.9 ml, 895 mmol) and trifluoroacetic anhydride (CAS registry 4070) (31.6 ml, 224 mmol) and the reaction mixture was heated at 90°C for 18 h then cooled to rt and poured onto ice. The e was slowly basified using 30% aq. NaOH soln., diluted with water and extracted with EtOAc. The organic layer was successively washed with 20% aq. sodium thiosulfate soln., and sat. aq. NaHCOs soln., dried over NaZSO4, filtered WO 93849 and trated. The title compound was obtained after flash chromatography on silica gel (cyclohexane/ EtOAc, 100:0 to 20:80) as a solid (12.2 g, 63% yield) UPLC Rtm14=1.30 min; ESIMS: 261 [(M+H)+]. 1H NMR (400 MHz, : 5 8.54 (d, 1H), 8.11 (d, 1H), 4.06 (s, 3H). b) romo-2,3-dihydro-benzo[1,4]oxazinyl)methoxy-nicotinonitrile A mixture of 6-bromo-3,4-dihydro-2H-benzo[1,4]oxazine (CAS registry 1056554) (5.0 g, 23.36 mmol), 5-iodomethoxy-nicotinonitrile (12.2 g, 46.7 mmol) and NaOtBu (2.69 g, 28.0 mmol) in toluene (50 ml) was degassed with argon for 10 min, then bis(tri-tert- butylphosphine)-pa||adium(0) (0.36 g, 0.70 mmol) was added. The reaction mixture stirred at 110°C for 18 h under argon. After cooling to rt, the on mixture was filtered through celite, rinsed with EtOAc and the filtrates were washed with sat. aq. NaHC03 soln.. The organic layer was dried over NaZSO4, filtered, concentrated and purified by flash chromatography on silica gel (cyclohexane / EtOAc, 100:0 to 50:50) to yield the title compound (4.2 g, 52% yield).

UPLC Rtm14=1.55 min; ESIMS: 348 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 8.31 (d, 1H), 7.80 (d, 1H), 6.89 (dd, 1H), 6.78 (d, 1H), 6.67 (d, 1H), 4.30-4.35 (m, 2H), 4.10 (s, 3H), 3.61-3.66 (m, 2H). c) (S)[4-(5-Cyanomethoxy-pyridiny|)-3,4-dihydro-2H-benzo[1,4]oxazin ylamino]-pyrrolidinecarboxylic acid tert-butyl ester A e of 5-(6-bromo-2,3-dihydro-benzo[1,4]oxazinyl)methoxy-nicotinonitrile (300 mg, 0.87 mmol), (S)amino-pyrrolidinecarboxylic acid tert-butyl ester (CAS registry ) (0.26 ml, 1.47 mmol), 2-(dicyclohexylphosphino)biphenyl (CAS registry 2479403) (18.2 mg, 0.05 mmol) and NaOtBu (100 mg, 1.04 mmol) in toluene (10 ml) was degassed with argon for 10 min, then Pd2(dba)3 (23.8 mg, 0.03 mmol) was added. The reaction mixture was stirred at 110°C for 1 h under argon. After cooling to rt, the reaction mixture was filtered through celite, rinsed with EtOAc and the filtrates were concentrated.

The title compound was obtained after flash tography on silica gel (cyclohexane/ EtOAc, 100:0 to 70:30) as a yellow foam (150 mg, 37% yield).

UPLC RtM11= 2.73 min; ESIMS: 452 [(M+H)+]. 1H NMR (400 MHz, CD30D): 6 8.36 (d, 1H), 8.04 (d, 1H), 6.68 (s, 1H), 6.19 (dd, 1H), 6.03 (s, 1H), 4.19-4.24 (m, 2H), 4.06 (s, 3H), 3.81-3.89 (m, 1H), 3.62-3.68 (m, 2H), 3.48-3.56 (m, 1H), 3.35-3.48 (m, 2H), 3.08-3.18 (m, 1H), 2.05-2.18 (m, 1H), 1.75-1.87 (m, 1H), 1.46 (s, 9H). d) 2-Methoxy[6-((S)-pyrrolidinylamino)-2,3-dihydro-benzo[1,4]oxazinyl]- nicotinonitrile A solution of (S)[4-(5-cyanomethoxy-pyridinyl)-3,4-dihydro-2H-benzo[1,4]oxazin ylamino]-pyrrolidinecarboxylic acid tert-butyl ester (144 mg, 0.32 mmol) in CH2C|2 (4 ml) was treated with TFA (0.49 ml, 6.38 mmol). The reaction mixture was stirred at rt for 2 h, quenched with sat. aq. NaHCOs soln. and extracted with DCM. The organic layer was dried over NaZSO4, filtered and concentrated under reduced pressure to afford the title product as a yellow foam (120 mg, 100% yield).

UPLC Rtwm = 2.06 min; ESIMS: 352 +]. 1H NMR (400 MHz, CD30D): 6 8.36 (d, 1H), 8.04 (d, 1H), 6.69 (d, 1H), 6.17 (dd, 1H), 6.00 (d, 1H), 4.19-4.26 (m, 2H), 4.06 (s, 3H), 3.80-3.90 (m, 1H), 3.62-3.69 (m, 2H), 3.10-3.20 (m, 2H), 2.98-3.09 (m, 1H), 2.82-2.90 (m, 1H), 2.06-2.18 (m, 1H), 1.70-1.81 (m, 1H). e) 2-Methoxy{6-[(S)(tetrahydro-pyrancarbonyl)-pyrrolidinylamino]-2,3- dihydro-benzo[1,4]oxazinyl}-nicotinonitrile At 0°C, a solution of 2-methoxy[6-((S)-pyrro|idinylamino)—2,3-dihydro-benzo[1,4]oxazin- 4-yl]-nicotinonitrile (27 mg, 0.08 mmol) in CH2C|2 (1 ml) was treated with Et3N (0.02 ml, 0.12 mmol) and tetrahydro-pyrancarbonyl chloride (CAS registry 401910) (11 ul, 0.09 mmol).The reaction e was stirred at 0°C for 1 h, then ed with sat. aq. NaHCOs soln. and extracted with DCM. The organic layer was dried over NaZSO4, filtered and concentrated and the title compound was obtained after prep. RP-HPLC (column Sunfire 8 OBD 30x100 mm, 5 pm; solvent A: H20+0.1 Vol.-% TFA; solvent B: CH3CN +0.1 Vol.-% TFA, gradient 5—60% B in 20 min) and filtration over Agilent s MP SPE cartridgeas a yellow solid (9 mg, 25% yield).

UPLC Rt M2: 1.19 min; ESIMS: 464 [(M+H)+]. 1H NMR (400 MHz, CD30D): 6 8.36 (d, 1H), 8.05 (m, 1H), 6.69 (dd, 1H), 6.15-6.23 (m, 1H), .97-6.07 (m, 1H), 4.15-4.29 (m, 2H), 4.06 (s, 3H), 3.82-4.03 (m, 3H), 3.35-3.80 (m, 8H), .84 (m, 1H), .28 (m, 1H), 1.49-2.03 (m, 5H).

Coupling conditions A) ld aminations or hydroxylations Condi- _ Typical Typical Pd source LIgand Base Solvents tIon #_ temperatur reactlon_ used e tIme CA1 a)3 Rac-BINAP-m 60100°C CA2 0120203 B 0 CA3 0120203mm CA4 0120203 tetramethyl- CA5 Pd2(dba)3 l- dioxane 100° 18-72 h XPhos IHZO CA6 Pd2(dba)3 XPhos aw80-110°c CA7 m—m CA8 m—m cA9 Pd2(dba)3 — umXPhos 125°C (mw) CA10 Pd(OAc)2 Rac-BINAP m 60-100 c PdtRuphoslm“—U mm—-—m WM—--—U Pd2<dba>a B) Amide bond formation conditions Condi- Coupling Solvents used tIon#_ reagents temperature reactIon tIme_ _ CB1 HBTU DMF or DMA CB3 HATU CH2C|2 CB4 HOBT, EDC CH2C|2 CBS“—CH CB7 HBTU CH2CI2 C) Side chain introduction ions CC1) Using mesylate At rt, a dry solution of pyridinol intermediate (1 eq.) and mesylate intermediate (1.1 - 2 eq.) in DMF (0.17 M) was treated with NaH in mineral oil (2 - 3 eq.) and the reaction mixture was stirred at 20-80°C for 4 to 72 h.

CC2) Using te At rt, a dry solution arylol intermediate (1 eq.) and te intermediate (1.1 - 2 eq.) in DMF (0.17M) was treated with NaH in mineral oil (2 - 3 eq.) and the reaction mixture was stirred at 50-80°C for 4 to 72 h.

CC3) Using mesylate At rt, a dry solution of arylol intermediate (1 eq.) and mesylate intermediate (2.5 eq.) in DMF (0.06M) was treated with K2003 (4 eq.) and the reaction mixture was stirred at 85°ZC to 100°C for 4 to 50 h.

CC4) Using Mitsunobu At rt, DEAD (1.4 eq.), (R)—3-Hydroxy-pyrrolidinecarboxylic acid tert—butyl ester (1.5 eq.) and aryIol intermediate (1 eq.) were added to a solution of triphenylphosphine (1.4 eq.) in THF (0.30M) . The red/brown solution was stirred at 70 °C for 18 h.

D) Conditions for chiral tion chromatography Column UV Detection -250x30 mm, 5pmE Chiralpak lC n-Heptane/DMME/lPA/DEA 230 nm :50:30:0.05 D2 Chiralpak IC ACN 100% 230 nm 250x30 mm, 5pm D3 cel ODH EtOH/MeOH 60:40 D4 Chiralpak IC DMME/IPA/MeOH/DEA D5 Chiralpak lC ACN 100% 250x30 mm, 5pm pak lC MeOH 100% 250x30 mm, 5pm D7 Chiralpak lC n-Heptane/DMME/EtOH/DEA 240 nm 250X46 mm, 5”" 40:50:10:0.05 CD8 Chiralcel OD-H, COZ/IPA 70:30 (isocratic 215 nm 2012/057554 _4-6 x250 mm —— CD9 Chiralpak AD-H, Heptane/EtOH 60:40 Chiralpak IC DMME/IPA/MeOH/DEA 230 nm 250X46 mm’ 5m 70:25:5:0.05, 250x20 mm, 5 m CD12 Chiralpak IC EtOH/MeOH 50:50 210 nm 765x37.5 cm, 20 Preparation of Intermediates IA) Aromatic bromides Intermediate # IA) ic Autonom name Comment on synthesus Bromides Structure -Bromo 1 step from CAS methanesuIfonyImethyl- 12892701 pyridine -Bromofluoro 1 step from CAS methanesulfonyl- 12890077 pyridine -Bromo 1 step from CAS esulfonyI 21 11228 trifluoromethyI-pyridine -Bromodifluoromethyl- 2 steps from CAS 2-methanesulfonyl- 8521814 pyridine -Bromo—3-fluoromethyl-2— 2 steps from CAS methanesulfonyI-pyridine 7421000 -Bromo—3-difluoromethyl- CAS12541237 2—methoxy-pyridine -Bromo—3-fluoromethyl-2— 1 step from CAS y—pyridine 3514104 -Bromo—2- CAS 12143376 romethoxymethyl- pyridine -Bromo—2-methoxy CAS 7602072 methyl-pyridine -Br0mo—3-fluoro—2— CAS 124432—70-8 methoxy—pyridine -Bromo—3-chloro—2— CAS 848366-28—9 methoxy—pyridine -Bromo—2—methoxy- CAS 9412948 nicotinonitrile -Bromo—pyridine—3- CAS 896160-99—9 sulfonic acid dimethylamide 4-(5-Bromo—pyridine—3- CAS 8896761 sulfonyl)—morpholine -Bromo—2-methylnitro— CAS 9114344 pyridine -Bromo—2—methyI-pyridine CAS 34305 -Bromo—nicotinonitrile CAS 355905 -bromo- CAS 6 trifluoromethylpyridine -Bromo—2—ethoxy CAS 6102793 methyl-pyridine -bromo—2— CAS 85-0 methoxypyridine -bromo—2—methoxy CAS 12143770 trifluoromethylpyridine -Bromo—2—methoxy- CAS 1224334 nic acid me thyl ester 2—amino—5-bromo—3- CAS 794561 trifluoromethylpyridine 1-(5-Bromo—2—methoxypyridinesulfonyI ) -piperazine -Bromo—2- CAS 10007878 methoxymethyI-pyridine -bromo—2— CAS 436799-32—5 trifluromethylpyridine -Bromo—3-methyI-pyridin- CAS 34305 2—ylamine -Bromo—pyridine—2— CAS 974837 carbonitrile -Bromo—2,3-dimethoxy- CAS 52605-98—8 pyridine 3-Bromo—5-(propane—2— sulfonyl)—pyridine romo—2-methyl- CAS 3647368 benzenesulfonyl)- piperidine 4-(5-Bromo—2—methoxy- CAS 325809-68—5 benzenesulfonyl)- morpholine 4-(5-Bromo—pyridine—3- CAS 8896761 sulfonyl)—morpholine romo—2—methoxy- CAS 3258090 benzenesulfonyl)—4- methyl-piperazine romo—pyridine—3- CAS 1007212-08—9 sulfonyl)—4-methyl- piperazine -Bromo—2,N-dimethoxy- CAS 12478915 N-methyl- benzenesulfonamide -Bromo—pyridine—3- CAS 12482823 sulfonic acid methoxy- methyl-amide 3-Bromo—5-methoxy- CAS 50720-12 2 pyridine 3-Bromo—5-chIoro-pyridine CAS 73583-39—8 -Bromo—2- CAS 98626 95-0 methanesulfonyI-pyridine -Bromo—pyridine—3- CAS 896160-99 9 sulfonic acid ylamide -Bromo—pyridinylamine CAS135358 -Bromo—pyridine—3- CAS 1065074-78—3 sulfonic acid ethylamide -Bromo—2-ethanesuIfinyl- pyridine o—2- methanesulfonyI methoxy—pyridine -Bromo—3-methoxy- CAS 42409-58—5 pyridinylamine N-(5-Bromo—2-methoxy- CAS 1083327-58—5 pyridinyl)— methanesulfonamide -Bromo—3-ethyI CAS 8—92-7 methoxy—pyridine -Bromo—2-chloro—3- CAS 286947-03 3 methoxy—pyridine -Bromo—2-chloro—3- CAS 29241 60-9 methyl-pyridine (5-Bromo—2- methanesulfonyI-pyridin y|)-methy|—amine (5-Bromo—2- methanesulfonyI-pyridin y|)-dimethy|—amine -Bromo—3-chloro—2- 1335052-54 4 methanesulfonyl- pyridine o—quinoline CAS 5332-24 1 3-Bromo CAS 445491-71 4 methanesulfonyI-pyridine -Bromo—2-methyl- CAS 156001 -51 -3 benzonitrile 4-Bromo—1-methoxy-2— CAS 15140 trifluoromethyI-benzene -Bromo—2-ethanesulfonyl- CAS 2235567 pyridine 4-Bromo—2— CAS 90531-99—0 methanesulfonyI methoxy-benzene -Bromo—2-methoxy-N,N- CAS 8712698 benzenesulfonamide 4-Bromo—2—methyI-pyridine CA8222821 4-Bromo—2-methoxy- CAS 100367-39—3 pyridine 4-Bromo-2—trifluoromethyl- CAS 8875836 pyridine o—pyridine-2— CAS 621502 carbonitrile -Bromo-2,N-dimethoxy- benzenesulfonamide 4-Bromo-1,2-dimethoxy- CAS 28591 benzene -Bromomethyl-pyridin- CAS 9143589 3-ylamine (5-Bromo—2-methyl- CAS 12805921 pyridinyl)—dimethyl- amine 2-(Benzyloxy)—5-bromo CA8 1289270330 methylpyridine -Bromo GAS 35141043943 (dimethoxymethyl)—2- methoxypyridine Intermediate IA1: omethanesulfonylmethyl-pyridine A solution of 5-bromo—2-methylsulfanylmethyl-pyridine (9.04 g, 41.4 mmol) in DCM (83 ml) was treated at 0°C with mCPBA (21.46 g, 124 mmol). After stirring for 18 h at rt, the reaction mixture was added to 2N aq. NaOH so|n. and was extracted with DCM. The organic layer was dried over NaZSO4, concentrated and the title nd was obtained after trituration with exane to afford a white solid (9.25 g, 89% yield).

UPLC Rtm1=0.81 min; MS (ESI, m/z): 250.1 [(M+H+] 1H NMR (400 MHz, DMSO-ds): 6 8.68 (d, 1H), 8.30 (d, 1H), 3.37 (s, 3H), 2.58 (s, 3H).

Intermediate IA2: 5-bromofluoroZ-methanesulfonyl-pyridine WO 93849 A solution of 5-bromofluoromethylsulfanyl-pyridine (222 mg, 1.0 mmol) in DCM (5 ml) was treated at 0 °C with mCPBA (518 mg, 3.0 mmol). After stirring for 1.5 h at rt the reaction e was added to 2N aq. NaOH soln. and was extracted with DCM. The organic layer was dried over NaZSO4, concentrated and the title compound was obtained as a white solid (241 mg, 95% yield) which was used without further purification.

UPLC .63 min; 1H NMR (400 MHz, s): 6 8.75 (d, 1H), 8.60 (d, 1H), 3.40 (s, 3H).

Intermediate IA3: 5-Bromomethanesulfonyltrifluoromethyl-pyridine A solution of 5-bromomethylsulfanyltrifluoromethyl-pyridine (1.40 g, 1.16 mmol) in DCM (30 ml) was treated at 0°C with mCPBA (2.67 g, 15.48 mmol). After stirring for 18 h at rt the reaction mixture was added to a 4N aq. NaOH soln. and was extracted with DCM. The c layer was dried over NaZSO4, filtered, trated and the title compound was obtained after flash chromatography on silica gel (hexane/ EtOAc, 100:0 to 70:30) as a white solid (940 mg, 60% yield).

UPLC RtM1=0.87 min; MS (ESI, m/z): 323.0 [(M+NH4)+]. 1H NMR (400 MHz, CDCI3): 6 9.45 (d, 1H), 8.76 (d, 1H), 3.57 (s, 3H).

Intermediate IA4: 5-Bromodifluoromethylmethanesulfonyl-pyridine a) 2,5-Dibromodifluoromethyl-pyridine A solution of Et3N trifluoride (1.80 ml, 11.3 mmol) in DCM (40ml) was treated at 0 °C with Xtalfluor—E (2.67 g, 15.5 mmol) and bromo-pyridinecarbaldehyde (1.0 g, 3.77 mmol).

After stirring for 19 h at rt the reaction mixture was diluted with TBME and washed with sat. aq. NaHCOs soln. The organic layer was dried over NaZSO4, concentrated to leave a yellow oil (950 mg, 88% yield) which was used without further purification.

UPLC Rtm1=1.05 min; 1H NMR (400 MHz, DMSO-ds): 6 8.57 (d, 1H), 8.48 (d, 1H), 7.14 (t, 1H), 3.35 (s, 3H). b) 5-Bromodifluoromethylmethanesulfony|-pyridine A solution of 2,5-dibromodifluoromethyl-pyridine (1400 mg, 1.16 mmol) in DMF (10ml) was treated at 0°C with sodium methanethiolate (348 mg, 4.97 mmol). After stirring for 1,5 h at rt, the reaction was cooled at 0°C and mCPBA (2857 mg, 16.56 mmol) was added to the reaction mixture. After stirring for 1 h at rt the reaction mixture was added to a 4N aq. NaOH soln. and was extracted with TBME. The organic layer was dried over Na2804, filtered, concentrated and the title compound was ed after flash chromatography on silica gel (hexane / EtOAc, 100/0 to 80/20) as a white solid (498 mg, 53% yield).

UPLC RtM1=0.86 min; 1H NMR (400 MHz, CDCI3): 6 8.67 (d, 1H), 8.45 (d, 1H), 7.37 (t, 1H), 3.37 (s, 3H).

Intermediate IA5: 5-Bromofluoromethylmethanesulfonyl-pyridine a) ochlorofluoromethyl-pyridine A solution of Et3N trifluoride (1.76 ml, 10.79 mmol) in DCM (20 ml) was treated at 0°C with Xtalfluor—E (1.65 g, 7.19 mmol) and (5-bromochloro-pyridinyl)—methanol (0.80 g, 3.60 mmol). After stirring for 18 h at rt the reaction mixture was diluted with TBME and washed with sat. aq. NaHCOs soln. The organic layer was dried over NaZSO4, concentrated and the title compound was obtained after flash chromatography on silica gel (hexane/ EtOAc, 100/0 to 90/10) as a colourless oil (286 mg, 35% .

UPLC Rtm1=0.98 min; 1H NMR (400 MHz, CDCI3): 5 8.53 (d, 1H), 8.45 (d, 1H), 5.52 (d, 1H) b) 5-Bromofluoromethylmethanesulfonyl-pyridine A solution of 2,5-dibromodifluoromethyl-pyridine (1.4 g, 1.16 mmol) in DMF (10 ml) was treated at 0°C with sodium methanethiolate (348 mg, 4.97 mmol). After stirring at rt for 1.5 h, the reaction was cooled down to 0°C and mCPBA (2857 mg, 16.56 mmol) was uced to the reaction mixture. After stirring for 1 h at rt the reaction mixture was added to an 4N aq.

NaOH soln. and was extracted with TBME. The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was obtained after flash chromatography on silica gel (hexane/ EtOAc, 100/0 to 80/20) as a white solid (498 mg, 53%yield) UPLC Rtm1=0.86 min; 1H NMR (400 MHz, CDCI3): 5 8.67 (d, 1H), 8.45 (d, 1H), 7.37 (t, 1H), 3.37 (s, 3H).

Intermediate IA7: 5-Bromofluoromethylmethoxy-pyridine A solution of (5-bromomethoxy-pyridinyl)—methanol (343 mg, 1.57 mmol) in DCM (7 ml) was treated at 0°C with deoxofluor (1.5 ml, 3.46 mmol) and EtOH (27.6 ul, 0.47 mmol). The on mixture was stirred at rt, quenched with sat. aq. NaHCOs soln. and was extracted with DCM. The organic layer was dried over NaZSO4, concentrated to afford the title compound after flash chromatography on silica gel e/EtOAc 80:20) as a yellow oil (80 mg, 23%yield).

UPLC RtM1=1.07 min; 1H NMR (400 MHz, a): 5 8.32 (t, 1H), 8.00 (t, 1H), 5.37 (d, 2H), 3.89 (s, 3H). ediate IA24: 1-(5-Bromomethoxy-pyridinesulfonyI)methyl-piperazine a)(5-Bromomethanesulfonyl-pyridinyI)-methyI-amine | N 93' [N] I ] o=s=o I}! N O=S=O \ H | _, CI N / | Br TEA, DCM N / 0°C then rt, 18h Br A solution of 5-bromochloro-pyridinesulfonyl chloride (CAS registry 08) ( 580 mg, 1.99 mmol) and Et3N (0.55 ml, 3.99 mmol) in DCM (20 ml) at 0°C was treated with 1-methyl-piperazine (0.33 ml, 2.99 mmol), the resulting mixture was stirred at 0°C for 20 min and at rt for 18 h. The mixture was diluted with DCM (30 ml) and washed with sat.aq.

NaHCOs soln. The organic layer was dried over MgSO4, concentrated and ed by flash chromatography on silica gel (DCM / MeOH 100:0 to 90:10) to afford the title compound as an orange solid (420 mg, 59% yield).

HPLC RtM2=1.49 min; ESIMS: 356 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 8.62 (d, 1H), 8.50 (d, 1H), 3.57-3.29 (t, 4H), 2.50 (t, 4H), 2.33(s, 3H). b)1-(5-Bromomethoxy-pyridinesulfonyl)methyl-piperazine {:1 {*1 NaOMe N o=s=o THF, rt, 18h Ozézo \ /O I \ N / N / Br Br A solution of 1-(5-bromochloro-pyridinesulfonyl)methyl-piperazine (420 mg, 1.18 mmol) in THF (10 ml) was treated portionwise with sodium methoxide (192 mg, 3.55 mmol).

The resulting mixture was stirred at rt for 18 h. The mixture was quenched by addition of water and ted with EtOAc. The ed organic layers were washed with sat. aq.

NaHCOs soln. and dried over MgSO4, concentrated and ed by flash chromatography on silica gel (DCM / MeOH 100:0 to 90:10) to afford the title compound (358 mg, 85% yield).

HPLC RtM2 =1.47 min; ESIMS: 350, 352 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 8.36 (d, 1H), 8.28 (d, 1H), 4.05 (s, 3H), 3.35 (br s, 4 H), 2.49 (br s, 4 H), 2.33 (s, 3H).

Intermediate IA30: 3-Bromo(propanesulfonyl)-pyridine 1. Sodium propanethiolate NMP, 80C, 2°C Br 03 ,’O N \ 2. m-CPBA, DCM S I rt, 18h / NI \ Y A solution of 3,5-dibromo-pyridine (CAS registry 6253) (495 mg, 2.09 mmol) in NMP (5 ml) was treated with sodium propanethiolate (CAS registry 206076) (205 mg, 2.09 mmol), the resulting mixture was stirred at 80°C for 2 h. The mixture was cooled down and diluted with EtOAc, washed with water (2x), then brine. The organic layer was dried over MgSO4 and concentrated. The obtained e was dissolved in DCM (10 ml), treated with mCPBA (1083 mg, 6.27 mmol) and stirred at rt for 18 h.10% aq. sodium e soln. was added and the e was stirred at rt for 1 h. The phases were separated and the organic layer was washed with sat. aq. NaHCOs soln., dried over MgSO4, concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 100:0 to 00:100) to afford the title nd (364 mg, 59% yield).

HPLC RtM2 =0.77 min; ESIMS: 264, 266 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 8.98 (dd, 2H), 8.33 (t, 1H),3.34-3.17 (m, 1H), 1.37 (d, 6H).

Intermediate IA44: 5-Bromoethanesulfinyl-pyridine a)5-Bromoethylsulfanyl-pyridine sodium ethanethiolate Br |N\ DMSO,rt,18h W s N /Br I A mixture of 2,5-dibromo-pyridine (CAS registry 5887291) (1.15 g, 4.85 mmol) and sodium ethanthiolate (CAS registry 8118 )(2.04 g, 24.27 mmol) in DMSO (15 ml) was stirred at rt for 18 h. Water was added and the mixture was extracted with DCM. The organic layer was dried by passing it through a phase separating cartridge, was trated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 100:0 to 70:30) to afford the title compound as an orange oil (1.09 g, 92% yield).

HPLC RtM2=1.25 min; ESIMS: 218, 220 [(M+H)+]. b) 5-Bromoethanesulfinyl-pyridine fl mCPBA 2eq, DCM, RT, 3 mIn S N N \ | ——> I A solution of 5-Bromoethylsulfanyl-pyridine (1.09 g, 4.49 mmol) in DCM (15 ml) was treated with mCPBA (1.55 g, 8.98 mmol). The resulting on was stirred at rt for 15 min.

The mixture was quenched by addition of aq. 2M NaOH soln., and extracted with DCM. The combined organic layers were dried over MgSO4 and concentrated. The compound was ed by prep. RP-HPLC (column SunFire C18 OBD, gradient 5-60% ACN in 15 min) to afford the title compound as a less oil (490 mg, 45% yield).

HPLC RtM2 =0.65 min; ESIMS: 234, 236 +]. 1H NMR (400 MHz, DMSO-ds): 5 8.85 (d, 1H), 8.37 (dd, 1H), 7.80 (d, 1H), 3.33 (s, 2H), 3.27- 3.10 (m, 1H), 2.94-2.72 (m, 1 H), 1.01 (t, 3 H).

Intermediate IA45: omethanesulfonylmethoxypyridine a)5-Bromomethoxymethylsulfanyl-pyridine Br 8/ Sodium thiolate 0 O N \ \ DMSO, RT, 0.5h N \ \ | | / _> / Br Br A mixture of 2,5-dibromomethoxy-pyridine (CAS registry 11421918) (550 mg, 2.06 mmol) and sodium methanethiolate (CAS registry 51888 )(722 mg, 10.30 mmol) in DMSO (1.5 ml) was stirred at rt for 0.5 h. Water was added and the mixture was extracted with DCM. The organic layer was dried by passing it through a phase separating cartridge and was concentrated to afford the title compound as a less oil (1.50 g, 93% yield, crude). 1H NMR (400 MHz, DMSO-ds): 5 8.19 (d, 1H), 7.53 (d, 1H), 3.89 (s, 3H), 3.32 (s, 3H). b) 5-Bromomethanesulfonylmethoxypyridine s/ ,o \ ’_ m-CPBA 4eq, 8—0 N \ \ DCM, RT, 18h O | N \ \ / _, | A solution of 5-bromo—3-methoxymethylsulfanyl-pyridine (1.50 g, 2.24 mmol) in DCM (10 ml) was treated with mCPBA (1.55 g, 8.97 mmol). The resulting mixture was stirred at rt for 18 h .The mixture was quenched by addition of aq. 2M NaOH soln., and extracted with DCM.

The organic layer was dried by passing through a phase separating cartridge and concentrated to afford the title compound (400 mg, 33% yield as crude).

HPLC RtMZ =0.75 min; ESIMS: 268[(M+H)+]. 1H NMR (400 MHz, DMSO-da): 5 8.41 (d, 1H), 8.17 (s, 1H), 4.01 (s, 3H), 3.30 (s, 3H).

Intermediate IA51: (5-Bromomethanesulfonyl-pyridiny|)-methy|-amine a) moch|oro-pyridiny|)-methy|-amine BuLi(1.6M,1eq) NH2 Mel \NH Cl THF, DC to rt / CI | 18h / N \ | Br Br A solution of 5-bromochloro-pyridinylamine (CAS registry 1) (565 mg, 2.72 mmol) in THF (4 ml) at 0°C was d with BuLi 1.6M in hexane (0.17 ml, 0.17 mmol), the resulting mixture was stirred at 0°C for 0.5 h, then methyl iodide (0.17 ml, 2.72 mmol) was slowly added. The reaction mixture was allowed to warm to rt and was stirred for 18 h. The /brown mixture was poured into sat. aq. NaHCOs soln., and ted with EtOAc. The organic layer was dried over MgSO4, concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 95:5 to 60:40) to afford the title compound as an orange solid (354 mg, 59% yield).

HPLC Rtm1=0.94 min; ESIMS: 221, 223, 225 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 7.65 (d, 1H), 7.14 (d, 1H), 6.11 (d, 1H), 2.74 (d, 3H). b) (5-Bromomethanesulfonyl-pyridiny|)-methy|-amine (3| 1. NaSMe, DMF, 0C then rt for 2d, I O=é=0 then 60C for 4 days H NI \ 2. mCPBA, DCM, /N \N rt 1 8h / , | Br Br A solution of (5-bromochloro-pyridinyl)-methyl-amine (354 mg, 1.60 mmol) in DMF (2.6 ml) was treated with sodium methanethiolate (168 mg, 2.40 mmol) at 0°C. The resulting solution was stirred at rt for 2 d and heated at 60°C for 4 d. The mixture was quenched at 0°C by addition of aq. 2M NaOH soln., and extracted with DCM. The combined organic layers were dried over MgSO4 and concentrated to afford an orange oil which was dissolved in DCM (5 ml) and treated at 0°C with mCPBA (CAS registry 9374) (827 mg, 4.79 mmol) and stirred for 18 h at rt. The mixture was quenched at 0°C by addition of aq. NaOH 2M soln. andextracted with DCM. Combined organics were dried over MgSO4, concentrated and purified by flash chromatography on silica gel hexane/ EtOAc 92:8 to 32:68) to afford the title compound as an orange solid (174 mg, 41% yield).

HPLC RtM1=0.78 min; ESIMS: 265, 267 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 7.95 (d, 1H), 7.50 (d, 1H), 6.70-6.59 (m, 1H), 3.26 (s, 3H), 2.82 (d, 3H).

Intermediate IA52: (5-Bromomethanesulfonyl-pyridiny|)-dimethy|-amine a) (5-Bromoch|oro-pyridinyl)-methyl-amine BuLi (1.6M, 1eq) NH Mel 2 \NH THF, 0c to rt Cl / CI 18h / N —> | \ N\ Br Br A solution of ochloro-pyridinylamine (CAS registry 5887291) (1 g, 4.82 mmol) in THF (7 ml) at 0°C was treated with BuLi 1.6M in hexane (6 ml, 9.64 mmol), the ing mixture was stirred at 0°C for 0.5 h, then methyl iodide (0.60 ml, 9.64 mmol) was slowly added. The on mixture was allowed to warm at rt and was stirred for 18 h. The orange/brown mixture was poured onto sat. aq. NaHCOs soln., and extracted with EtOAc, the organic layer was dried over MgSO4, concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 95:05 to 70:30) to afford the title compound as an orange solid (182 mg, 17% yield).

HPLC RtM1=0.94 min; ESIMS: 221, 223[(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 5 7.65 (d, 1H), 7.14 (d, 1H), 6.11 (d, 1H), 2.74 (d, 3H). b) mochloro-pyridinyl)-dimethyl-amine \NH NaH, (1.2eq) Mel (1.2 eq) Ill Cl N \ \ / DMF, rt, 1h I | / N \ _, A solution of (5-bromochloro-pyridinyl)-methyl-amine (182 mg, 0.82 mmol) in DMF (4 ml) was treated with NaH (23 mg, 0.99 mmol) at rt, and the e was stirred at rt for 0.5 h, methyl iodide (0.06 ml, 0.99 mmol) was added and the resulting mixture was stirred at rt for 1 h. The mixture was diluted with TBME and washed with a sat. aq. NaHC03 soln., the organic layer was dried over MgSO4 and concentrated to afford the title compound as an orange oil (174 mg, 90% yield). It was used without further purification.

HPLC RtM1=1.03 min; ESIMS: 235, 237 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 5 8.10 (d, 1H), 7.70 (d, 1H), 2.78 (s, 6H). c) (5-Bromomethanesulfonyl-pyridinyl)-methyl-amine Cl | ill 1. NaSMe, DMF, 80C, 18h l 023:0 NI \ \ 2. m-CPBA, DCM, rt, 18h /N \N / _, | A solution of mochloro-pyridiny|)-dimethyl-amine (174 mg, 0.74 mmol) in DMF (5 ml) was treated with sodium methanethiolate (104 mg, 1.48 mmol) at rt, the resulting solution was stirred at 80°C for 18 h. At 0°C, the e was quenched by addition of aq. 2M NaOH soln. then extracted with TBME. The combined organic layers were dried over MgSO4 and concentrated to afford an orange oil which was dissolved in DCM (5 ml), treated at 0°C with mCPBA (CAS registry 9374) (382 mg, 2.21 mmol) and stirred for 18 h at rt. At 0°C, the mixture was quenched by addition of aq. 2M NaOH soln., then extracted with DCM. The combined organic layers were dried over MgSO4, concentrated and purified by flash chromatography on silica gel (cyclohexane / EtOAc 88:12 to 00:100) to afford the title compound as an orange solid (50 mg, 24% yield).

HPLC RtM1=0.83 min; ESIMS: 279, 281 [(M+H)+]. 1H NMR (400 MHz, DMSO-ds): 6 8.25 (d, 1H), 7.90 (d, 1H), 3.29 (s, 3H), 2.91 (s, 6H). ediate IA65: 5-Bromo-2,N-dimethoxy-benzenesulfonamide I 0‘ O=S=O O-methylhydroxylamine l}l o TEA, THF, rt, 18h o=s=o ——> /0 r A solution of 5-bromomethoxy-benzenesulfonyl chloride (CAS registry 05-8) (218 mg, 0.76 mmol) and Et3N (0.55 ml, 3.99 mmol) in DCM (20 ml) at 0°C was stirred for 15 min and treated with O-methylhydroxylamine (36 mg, 0.76 mmol), the resulting mixture was stirred at rt for 18 h. The mixture was partitioned n EtOAc and water. The organic layer was washed with . NaHCOs soln., dried over MgSO4 concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 100:0 to 0:100) to afford the title compound (189 mg, 84% yield). 1H NMR (400 MHz, CDCI3): 6 8.10 (d, 1 H), 7.78 (s, 1 H), 7.72 (dd, 1 H), 6.97 (d, 1 H), 4.01 (s, 3 H), 3.81 (s, 3 H).

IB) Carboxylic acids or acid des Intermediate IB) Carboxylic Autonom name # acids or acid chlorides Structure Tetrahyd ro-fu ran (DD/MOH carboxylic acid (pure enantiomer1 enantiomer) Tetrahyd ro-fu ran ylic acid (pure enantiomer) -tert— butoxycarbonylamino— 1-methyI-1H- imidazole—4-carboxylic acid 2012/057554 Example IB1IIB2: trahydro-furancarboxylic acid I (R)-Tetrahydro-furan carboxylic acid a) Tetrahydro-furancarboxylic acid benzyl ester 0 BnBr, K2CO3 DMF, 100°0, 18h OH 00b A solution of tetrahydro-furancarboxylic acid (CAS registry 893648) (4.00 g, 34.40 mmol) in DMF (20 ml) was treated with K2C03 (9.52 g, 68.9 mmol) and benzyl bromide (CAS registry 1000) (8.18 mi, 68.9 mmol) at 100°C for 18 h. The mixture was cooled down to rt, diluted with EtOAc, washed with water and brine. Combined organic layers were dried over MgSO4, concentrated and purified by flash chromatography on silica gel (cyclohexane/ EtOAc 92:8 to 34:66) to afford the title compound as colourless oil (6.93 g, 98% yield) HPLC RtM2 =0.94 min; ESIMS: 207 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 7.50-7.26 (m, 5H), 5.17 (m, 2H), 4.05-3.75 (m, 4H), 3.29- 3.05(m, 1H), 2.36-2.09 (m, 2H). b) Enantiomer separation of tetrahydro-furancarboxylic acid benzyl ester ONO chiral tion 09/140 —> + 09/40 (rac.) >99% ee >99% ee peak 1 peak 2 Method information: Column: Chiralpak AD-PREP Solvent: E/ETOH/MEOH 95/2.5/2.5 Flow: 1.0 ml/min Long onde: 210 nm Engine: Agilent 1200 DAD Magellan Solution EtOH After tion of 6.347 g of racemic, 2 peaks were obtained: peak 1 at 9.086 min (2.43 g, ee>99%) and peak 2 at 10.584 min (2.19 g, ee>99%).

HPLC (peak 1 or 2) RtM2=0.92 min; ESIMS: 207 [(M+H)+]. 1H NMR (peak 1) (400 MHz, CDCI3): 5 7.48-7.29 (m, 5H), 5.23-5.07 (m, 2H), 4.05-3.77 (m, 4H), 3.23-3.10(m, 1H), 2.35-2.05 (m, 2H). 1H NMR (peak 2) (400 MHz, CDCI3): 5 7.51-7.31 (m, 5H), 5.23-5.09 (m, 2H), 4.07-3.77 (m, 4H), 3.24-3.07 (m, 1H), .05 (m, 2H). c) (S)-Tetrahydro-furancarboxylic acid I (R)-Tetrahydro-furancarboxylic acid 0 o Pd/C, H2 >99% ee EtOH, rt, 18h peak 1 |B1 O O 0310 Pd H2 @140- EtOH, rt, 18h >99% ee peak 2 A solution of an omerically pure tetrahydro-furancarboxylic acid benzyl ester (peak 1 or peak 2, 200 mg, 0.97 mmol), Pd/C (103 mg, 0.97 mmol) in EtOH (2 ml) was hydrogenated with H2 at rt for 18 h. Filtration of the reaction mixture and concentration of the filtrate afforded the title compound as colourless oil (125 mg (Peak 1), 111mg (Peak 2), crude). 1H NMR (both enantiomers) (400 MHz, DMSO-da): 5 12.40 (br s, 1H), 3.84-3.59 (m, 4H), 3.00 (m, 1H), 2.08-1.92(m, 1H).

Example IB3): 5-tert-Butoxycarbonylaminomethyl-1H-imidazolecarboxylic acid a) ert-Butoxycarbonyl)aminomethy|-1H-imidazoleca3rboxylic acid ethyl ester o/\ LiHMDS, BOC2o, THF N 19h, 5—0°C ->rt ->50°C 4N \ ' 2< A solution of 5-aminomethyl-1H-imidazolecarboxylic acid ethyl ester (CAS ry 541475) (82 mg, 0.49 mmol) in THF (4 ml) was treated at - 50°C with 1M LiHMDS in THF soln. (0.97 ml, 0.97 mmol) and the reaction mixture was stirred at - 50°C for 10 min, then a solution of Boc20 (237 mg, 1.07 mmol) in THF (1.5 ml) was added. The reaction mixture was allowed to warm slowly to rt, then to 50°C and to stir for 15 h at 50°C. The reaction e was cooled to rt, diluted with EtOAc and quenched with H20. The organic layer was dried over NaZSO4, filtered, concentrated and the title compound was obtained after after flash chromatography on silica gel (heptane / EtOAc, 85:15 to 0:100) as a white solid (140 mg, 78% .

UPLC .96 min; ESIMS: 370 [(M+H)+] 1H NMR (400 MHz, CDCI3, 298 K): 6 4.33 (q, 2H), 3.50 (s, 3H), 1.41 (s, 18H), 1.35 (t, 3H). b) 5-tert-Butoxycarbonylaminomethyl-1H-imidazolecarboxylic acid 0 o 00 OH 4 \ 1L0J< LiOH, THF/H20 i,“ \ | )0 N 18h,rt lo o A solution of 5-di(tert-butoxycarbonyl)aminomethyl-1H-imidazole—4-carboxylic acid ethyl ester (167 mg, 0.452 mmol) in THF (2.2 ml) and H20 (2.2 ml) was treated with LiOH (54.1 mg, 2.26 mmol) and the reaction mixture was stirred at rt for 18 h, then quenched with 1M aq. HCl soln. to reach pH 2 and extracted with EtOAc. The organic layer was dried over NaZSO4, filtered, concentrated to afford the title compound. (70 mg, 65% yield).

UPLC .47 min; ESIMS: 242 [(M+H)+] 1H NMR (400 MHz, s):612.42(br.s., 1H), 8.98 (br.s., 1H), 7.82 (s, 1H), 3.45 (s, 3H), 1.41 (s, 9H).

IC P rrolidinol derivatives or analo ues examo|e# s nthesis Methanesulfonic acid 2 steps from CAS 104706- (R) -(tetrahydro— 47-0 pyrancarbonyl)— pyrrolidinyl ester Methanesulfonic acid 2 steps from (S)-(tetrahydro-pyran- CAS 100243- 39-8 4-carbonyl)—pyrrolidin- 3-yl ester WO 93849 Methanesulfonic acid 2 steps from (S)propionyl- CAS 100243- pyrrolidinyl ester 39-8 2 steps from Methanesulfonic acid CAS 2799 (R)—1-propiony|— pyrrolidinyl ester Intermediate IC1: Methanesulfonic acid (R)(tetrahydro-pyrancarbonyl)-pyrrolidin- 3-yl ester a) ((R)Hydroxy-pyrrolidiny|)-(tetrahydro-pyranyl)-methanone 1) DMF cat, DCM, oxalyl de, 3°C, 1h J}. 2) Et3N, DCM, 3°C, 1h + HO Oxalyl chloride (0.20 ml, 3.84 mmol) was added to a solution of tetrahydro-pyrancarboxylic acid (CAS registry 53371) and DMF (0.012 ml, 0.15 mmol). The reaction mixture was stirred at 3°C for 1 h. Concentration of the on mixture under reduced pressure (170 mbar) at 40°C (water bath) afforded the acyl intermediate as a less oil. The intermediate was dissolved in DCM (2ml) and added to a solution of (R)—pyrrolidinol hydrochloride (CAS registry 1047060) (190 mg, 1.54 mmol) in DCM (3 ml), cooled down to 3°C, the formed white suspension was stirred at 3°C for 1 h. The reaction mixture was concentrated; EtOAc was added to the residue which was filtered off and washed with EtOAc. Concentration and purification of the filtrate by flash chromatography on silica gel (DCM /DCM: MeOH (9:1), 100:0 to 60:40 over 11 min) ed the title compound as white solid (250 mg, 82% yield).

ESIMS: 200 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 6 4.43 - 4.65 (m, 1H), 3.95-4.16 (m, 2H), 3.30-3.82 (m, 6H), 2.45-2.75 (m, 1H), 1.83-2.30 (m, 4H), 1.54-1.78 (m, 3H). b) Methanesulfonic acid (R)(tetrahydro-pyrancarbony|)-pyrro|idinyl ester HO —fi-O Et3N,CH2C|2, o 0 1h, 0°C 0 N N 0 o Under argon, esulfonyl chloride (CAS ry 1240) (3.52mi, 45.2 mmol) was added to a solution of ((R)—3-hydroxy-pyrrolidinyl)-(tetrahydro-pyranyl)-methanone (6 g, 22.6 mmol) and Et3N (6.30 ml, 45.2 mmol) in DCM (100 ml) at -10°C. The solution was stirred at 0°C for 1 h, diluted with H20 and DCM, the organic layer was washed twice with H20 and brine and dried over MgSO4. Concentration and trituration of the resulting oil with diethyl ether afforded the title compound as an off-white solid (5.3 g, 84%).

ESIMS: 278 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 5.22-5.44 (m, 1H), 3.96-4.13 (m, 2H), 3.85-3.96 (m, 1H), 3.56- 3.83 (m, 3H), 3.36-3.53 (m, 2H), 3.08 (d, 3H), 2.07-2.75 (m, 3H), 1.93 (m, 2H), 1.51-1.75 (m, 3H).

Intermediate IC2: Methanesulfonic acid (S)-(tetrahydro-pyrancarbony|)-pyrro|idin yl ester a) ((S)Hydroxy-pyrrolidiny|)-(tetrahydro-pyranyl)-methanone Et3N ,CHZCIZ, 3°C, 1h "— HO"-C/NH —> + $0 o Chm/O) A on of tetrahydro-pyrancarbonyl chloride (CAS registry 401910) (316 mg, 2.02 mmol) in DCM (2ml) was dropwise added (0°C <T <10°C) to a solution of rrolidino| (CAS registry 100243-39—8) (250 mg, 2.02 mmol) and Et3N (0.62 ml, 4.45 mmol) in DCM (5 ml). The reaction mixture was stirred at 3°C for 1 h. The volatiles were trated and EtOAc was added to the residue, remaining solid was filtered off and washed with EtOAc, concentration of the filtrate afforded the title compound as a white solid (390 mg, 97% yield).

ESIMS: 200 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 4.55 (d, 1H), 3.96-4.11 (m, 2H), 3.36-3.80 (m, 6H), .74 (m, 1H), 1.52-2.20 (m, 7H). 2012/057554 b) Methanesulfonic acid (S)(tetrahydro-pyrancarbonyl)-pyrrolidinyl ester HO. ‘fi‘O: ‘-. MsCl, Et3N,CHZC|2, O ’- OpN OfiN O 0 Under argon, methanesulfonyl chloride (CAS ry -0) (0.23 ml, 2.94 mmol) was added to a solution of -hydroxy-pyrrolidiny|)-(tetrahydro-pyranyl)-methanone (0.39 g, 1.96 mmol) and Et3N (0.55 ml, 3.91 mmol) in DCM (10 ml) at -10°C. The solution was stirred at 3°C for 1 h, diluted with H20 and DCM, the organic layer was washed twice with H20 and brine, then dried over MgSO4. Concentration and trituration of the resulting oil with diethyl ether afforded the title compound as white solid (0.45 g, 83% yield).

ESIMS: 278 [(M+H)+]. 1H NMR (400 MHz, CDCI3): 5 5.25-5.44 (m, 1H), 3.99-4.16 (m, 2H), 3.85-3.95 (m, 1H), 3.56- 3.83 (m, 3H), 3.37-3.54 (m, 2H), 3.08 (d, 3H), 2.09-2.78 (m, 3H), 1.93 (m, 2H), 1.51-1.76 (m, Intermediate IC3: Methanesulfonic acid (S)propiony|-pyrrolidinyl ester a) 1-((S)Hydroxy-pyrrolidiny|)-propanone DCM, Et3N, 50°C 9H 9H 1.5 h o 0' m 0 H No b Propionyl chloride (CAS registry 798) (4.78 mi, 54.8 mmol) was dropwise added over a period of 15 min to a solution of (S)-pyrrolidinol (CAS registry 1002438) (4.8 g, 55.9 mmol) and Et3N (8.74 mi, 63.1 mmol) at 5°C, the solution was allowed to warm to rt and was d for 1 h. H20 (10ml) and sat. aq. NaHCOs soln (10 ml) were added to the solution, the organic phase was washed with brine (10 ml) and a 0.25M aq. HCl soln (20 ml). The combined aqueous layers were concentrated and extracted with EtOAc (2x 100ml), the combined organic phases were dried over MgSO4 and concentrated to afford the title compound as a pale yellow oil (4.80 g, 54% . 1H NMR (400 MHz, CDCI3): 5 4.54 (d, 1H), 3.31-3.73 (m, 3H), 3.12 (m, 1H), 1.82-2.46 (m, 5H), 1.17 (t, 3H) b) Methanesulfonic acid (S)propiony|-pyrro|idinyl ester MSCI, Et3N O S‘ Ho,...(N,NJK/ CH2CI2, rt 48h O Under argon, methanesulfonyl chloride (CAS registry 1240) (1.36 ml, 17.46 mmol) was added over a period of 10 min to a solution of 1-((S)hydroxy-pyrrolidiny|)-propanone (2.5 g, 17.4 mmol) and Et3N (2.43 mi, 17.4 mmol) in DCM (50 ml) at 5°C. The solution was allowed to warm to rt and was stirred for 18 h, methanesulfonyl de (CAS registry 124- 63-0) (1.36 ml, 17.46 mmol) and Et3N (2.43 mi, 17.4 mmol) were then added to the reaction mixture which was stirred for 48 h at rt. DCM and H20 were added to the solution and the organic phase was separated through a phase separation dge, concentrated and the title compound was obtained after flash chromatography on silica gel (EtOAc / MeOH 100:0 to 95:5 over 40 min) as a colourless Oil (2.7 g, 66% yield). 1H NMR (400 MHz, : 5 5.19-5.42 (m, 1H), 3.48-3.99 (m, 4H), 3.06 (d, 3H). 2.04-2.54 (m, 4H), 1.16 (t, 3H).

Intermediate IC4: Methanesulfonic acid (R)propionyl-pyrrolidinyl ester a) 1-((R)Hydroxy-pyrrolidiny|)-propanone DCM,EtN,O°C OH 3 (5 1h °' —’ + é N ”10 h Propionyl chloride (CAS registry 8) (7.06 ml, 81 mmol) was added (0°C <T <10°C) over a period of 15 min to a sion of (R)—pyrro|idino| (CAS registry 27995) (10 g, 81 mmol) and Et3N (23.6 ml, 170 mmol) in DCM (150 ml) that was precooled at -10°C. The off-white sion was stirred at 0°C for 2 h, MeOH (9.82 ml, 243 mmol) was added and the mixture was allowed to stir at rt for 1 h. Concentration and dilution of the residue with EtZO (200 ml) afforded, after filtration and concentration of the filtrate, the title compound as a yellow oil (11.2 g, 95%).

ESIMS: 144 [(M+H)+]. 1H NMR (400 MHz, DMSO-da): 5 4.81-5.04 (m, 1H), 4.15-4.38 (m, 1H), 3.35-3.59 (m, 2H), .29 (m, 2H), 2.11-2.33 (m, 2H), 1.65-2.00 (m, 2H), 0.98 (td, 3H). b) Methanesulfonic acid (R)propiony|-pyrro|idiny| ester 0 MsCI, Et3N 0:8‘ HOKC/N/[K/ CHZCIZ, rt, 48h —> O‘CN/[K/ Under argon, methanesulfonyl chloride (CAS registry 1240) (0.16 ml, 2.09 mmol) was dropwise added over a period of 5 min to a solution of 1-((R)hydroxy-pyrrolidiny|)- one (300 mg, 2.09 mmol) and Et3N (0.29 ml, 2.09 mmol) in DCM (10ml) at 5°C, the on mixture was d to stir at rt for 18 h. Methanesulfonyl de (CAS registry 1240) (0.16 ml, 2.09 mmol) and Et3N (0.29 ml, 2.09 mmol) were then added to the reaction mixture which was stirred at rt for 48 h. DCM and H20 were added to the solution and the organic phase was separated through a phase separation dge and concentrated. The title compound was obtained after flash chromatography on silica gel (EtOAc / MeOH 100:0 to 95:5 over 25 min) as a colourless oil (420 mg, 86%). 1H NMR (400 MHz, CDCI3): 5 5.21-5.44 (m, 1H). 3.49-4.03 (m, 4H), 2.98-3.12 (m, 3H), 1.97- 2.54 (m, 4H), 1.18 (t, 3H).

ID DBO derivatives or analo ues ID) DBO derivative or Intermediate # Comment on analogue Autonom name synthesis Structure 2 steps from 3,3-Dideutero-3,4- CAS 53412 dihydro-2H- 7, see Example benzo[1,4]oxazinol Q steps a), b) Biological evaluation The activity of a compound according to the present invention can be assessed by the following in vitro & in vivo methods. ical assays 1 Determination of tic PI3K alpha and PI3K delta isoform inhibition 1.1 Test of lipid kinase activity The efficacy of the compounds of examples 1-117 as P|3 kinase inhibitors can be demonstrated as follows: The kinase reaction is performed in a final volume of 50 ul per well of a half area COSTAR, 96 well plate. The final concentrations of ATP and phosphatidyl inositol in the assay are 5 uM and 6 ug/mL, respectively. The reaction is started by the addition of P|3 kinase, e.g. PI3 kinase 8. p1108. The components of the assay are added per well as follows: . 10 ul test nd in 5% DMSO per well in columns 2-1. 0 Total activity is ined by addition 10 ul of 5% vol/vol DMSO in the first 4 wells of column 1 and the last 4 wells of column 12.

. The background is determined by addition of 10 uM control compound to the last 4 wells of column 1 and the first 4 wells of column 12. . 2 mL ‘Assay mix’ are prepared per plate: 1.912 mL of HEPES assay buffer 8.33 ul of 3 mM stock of ATP giving a final tration of 5 uM per well 1 ul of [33P]ATP on the activity date giving 0.05 uCi per well ul of 1 mg/mL Pl stock giving a final concentration of 6 ug/mL per well ul of 1 M stock MgC|2 giving a final concentration of 1 mM per well . 20 ul of the assay mix are added per well. 0 2 mL ‘Enzyme mix’ are prepared per plate (x* ul PI3 kinase p11OB in 2 mL of kinase buffer). The ‘Enzyme mix’ is kept on ice during addition to the assay plates. 0 20 ul e mix’ are added/well to start the reaction.

. The plate is then incubated at room temperature for 90 minutes.

The reaction is terminated by the addition of 50 ul WGA-SPA bead (wheat germ inin-coated Scintillation Proximity Assay beads) suspension per well.

The assay plate is sealed using TopSeal-S (heat seal for polystyrene microplates, PerkinElmer LAS [Deutschland] GmbH, Rodgau, Germany) and incubated at room temperature for at least 60 minutes.

The assay plate is then centrifuged at 1500 rpm for 2 minutes using the Jouan bench top centrifuge (Jouan lnc., Nantes, France).

The assay plate is counted using a Packard TopCount, each well being counted for seconds.

* The volume of enzyme is dependent on the enzymatic activity of the batch in use.

In a more preferred assay, the kinase reaction is med in a final volume of 10 ul per well of a low volume non-binding CORNING, 384 well black plate (Cat. No. #3676). The final concentrations of ATP and phosphatidyl inositol (Pl) in the assay are 1 uM and 10 ug/mL, tively. The reaction is started by the addition of ATP.

The components of the assay are added per well as follows: 50 hi test compounds in 90% DMSO per well, in columns 1-20, 8 concentrations (1/3 and 1/3.33 serial dilution step) in single.

Low control: 50 hi of 90% DMSO in half the wells of columns 23-24 (0.45% in final).

High control: 50 hi of reference compound (e.g. compound of Example 7 in WO 2006/122806) in the other half of columns 23-24 (2.5 uM in .

Standard: 50 hi of reference compound as just mentioned diluted as the test compounds in columns 21-22. 20 mL ‘buffer’ are prepared per assay : 200 pl of 1M TRIS HCI pH7.5 (10 mM in final) 60 ul of 1M MgC|2 (3 mM in final) 500 pl of 2M NaCl (50 mM in final) 100 pl of 10% CHAPS (0.05% in final) 200 pl of 100mM DTT (1mM in final) 18.94 mL of nanopure water mL ‘Pl’ are ed per assay : 200 pl of 1 mg/mL l-alpha-Phosphatidylinositol (Liver Bovine, Avanti Polar Lipids Cat. No. C MW=909.12) prepared in 3% OctylGlucoside (10 ug/mL in final) 9.8 mL of ‘buffer’ . 10 mL ‘ATP’ are prepared per assay : 6.7 ul of 3 mM stock of ATP giving a final concentration of 1 uM per well mL of ‘buffer’ - 2.5 mL of each P|3K construct are prepared per assay in ‘Pl’ with the ing final concentration : nM P|3K a|fa EMV B1075 nM beta EMV BV949 nM delta EMV BV1060 150 nM gamma EMV BV950 - 5 pl of 3K’ are added per well. - 5 pl ‘ATP’ are added per well to start the reaction.

. The plates are then incubated at room ature for 60 minutes (a|fa, beta, delta) or 120 minutes (gamma).

- The on is terminated by the addition of 10 ul Kinase-Glo (Promega Cat. No. #6714).

- The assay plates are read after 10 minutes in Synergy 2 reader k, Vermont USA) with an integration time of 100 milliseconds and sensitivity set to 191.

. Output : The High control is around 60000 counts and the Low control is 30000 or lower - This luminescence assay gives a useful Z’ ratio between 0.4 and 0.7 The Z’ value is a universal measurement of the robustness of an assay. A Z’ between 0.5 and 1.0 is considered an excellent assay.

For this assay, the P|3K constructs mentioned are prepared as follows: 1.2 Generation of gene constructs Two different constructs, BV 1052 and BV 1075, are used to generate the Pl3 Kinase on proteins for compound screening.

P|3Kd BV-1052 85 iSH2 -Gl linker— 110a D20aa -C-term His ta PCR products for the inter SH2 domain (iSH2) of the p85 subunit and for the p110-a subunit (with a deletion of the first 20 amino acids) are ted and fused by overlapping PCR.

The iSH2 PCR product is generated from first strand cDNA using initially primers ng130-p01 (5’-CGAGAATATGATAGATTATATGAAGAAT-3’) (SEQ ID NO: 1) and ng130-p02 (5’-TGGTTT-AATGCTGTTCATACGTTTGTCAAT-3’) (SEQ ID NO: 2).

Subsequently in a secondary PCR reaction, y (Invitrogen AG, Basel, Switzerland) recombination AttB1 sites and linker sequences are added at the 5’end and 3’end of the p85 iSH2 fragment tively, using primers ng130-p03 (5’- GGGACAAGTTTGTACAAAAAAGCAGGCTACGAAGGAGATATACATAT- GCGAGAATATGATAGATTATATGAAGAAT -3’) (SEQ ID NO: 3) and ng152-p04 (5’- TACCATAATTCCACCACCACCACCGGAAATTCCCCCTGGTTTAATGCTGTTCATACGTTTGTCAAT-3 ’) (SEQ ID NO: 4).

The p110-a fragment is also generated from first strand cDNA, initially using s p01 (5’- CTAGTGGAATGTTTACTACCAAATGG-3’) (SEQ ID NO: 5) and ng152-p02 (5’- GTTCAATG-CATGCTGTTTAATTGTGT -3’) (SEQ ID NO: 6).

In a uent PCR reaction, linker sequence and a Histidine tag are added at the ’end and 3’end of the p110-a fragment respectively, using primers gw152—p03 (5’-GGGGGAATTTCCGGTGGTGGTGGTGGAATTATGGTACTAGTGGAATGTTTACTACC-AAATGGA-3 ’) (SEQ ID NO: 7) and ng152-p06 (5’-AGCTCCGTGATGGTGATGGTGATGTGCTCCGTTCAATG- CATGCTGTTTAATTGTGT—3’) (SEQ ID NO: 8).

The p85-iSH2/p110-a fusion protein is assembled in a third PCR reaction by the overlapping linkers at the 3’end of the iSH2 nt and the 5’end of the p110-a fragment, using the above ned ng130-p03 primer and a primer containing an overlapping Histidine tag and the AttBZ recombination ces (5’- GGGACCACTTTGTACAAGAAAGCTGGGTTTAAGCTCCGTGATGGTGATGGTGAT- GTGCTCC-3’) (SEQ ID NO: 9).

This final product is recombined in a (Invitrogen) OR reaction into the donor vector pDONR201 to generate the ORF318 entry clone. This clone is ed by sequencing and used in a Gateway LR reaction to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector for generation of the baculovirus sion vector LR410.

PI3Kq BV-1075 85 iSH2 -12 XGI linker- 110a D20aa -C-term His ta The construct for Baculovirus BV—1075 is generated by a three-part ligation comprised of a p85 fragment and a p110-a fragment cloned into vector pBlueBac4.5. The p85 fragment is derived from plasmid p1661-2 digested with Nhe/Spe. The p110-a fragment 2012/057554 derived from LR410 (see above) as a Spel/Hindlll fragment. The cloning vector pBIueBac4.5 (Invitrogen) is digested with Nhe/Hindlll. This results in the construct PED 153.8 The p85 component (iSH2) is generated by PCR using ORF 318 (described above) as a template and one forward primer KAC1028 (5’- GCTAGCATGCGAGAATATGATAGATTATATGAAGAATATACC) (SEQ ID NO: 10) and two reverse primers, KAC1029 (5’- GCCTCCACCACCTCCGCCTGGTTTAATGCTGTTCATACGTTTGTC) (SEQ ID NO: 11) and KAC1039 (5’-TACTAGTCCGCCTCCACCACCTCCGCCTCCACCACCTCCGCC) (SEQ ID NO: 12).

The two reverse primers overlap and incorporate the 12x Gly linker and the inal ce of the p110a gene to the Spel site. The 12x Gly linker replaces the linker in the BV1052 uct. The PCR fragment is cloned into pCR2.1 TOPO (Invitrogen). Of the resulting clones, p1661-2 is determined to be correct. This plasmid is digested with Nhe and Spel and the resulting fragment is gel-isolated and purified for sub-cloning.

The p110-a g fragment is generated by enzymatic digest of clone LR410 (see above) with Spe I and Hindlll. The Spel site is in the coding region of the p110a gene.

The resulting fragment is olated and purified for sub-cloning.

The cloning vector, pBIueBac4.5 (Invitrogen) is prepared by enzymatic digestion with Nhe and Hindlll. The cut vector is purified with Qiagen (Quiagen N.V, Venlo, Netherlands) column and then dephosphorylated with Calf Intestine alkaline phosphatase (CIP) (New d BioLabs, Ipswich, MA). After completion of the CIP reaction the cut vector is again column ed to generate the final . A 3 part ligation is performed using Roche Rapid Iigase and the vendor specifications.

PI3K BV—949 85 iSH2 -GI Iinker— 110b full-len th -C-term His ta PCR products for the inter SH2 domain (iSH2) of the p85 subunit and for the full-length p110-b subunit are generated and fused by overlapping PCR.

The iSH2 PCR product is generated from first strand cDNA initially using primers ng130-p01 (5’-CGAGAATATGATAGATTATATGAAGAAT-3’) (SEQ ID NO: 1) and ng130-p02 GTTT-AATGCTGTTCATACGTTTGTCAAT-3’) (SEQ ID NO: 2).

Subsequently, in a secondary PCR reaction Gateway (Invitrogen) recombination AttB1 sites and linker sequences are added at the 5’end and 3’end of the p85 iSH2 fragment respectively, using primers ng130-p03 (5’- AGTTTGTACAAAAAAGCAGGCTACGAAGGAGATA- TACATATGCGAGAATATGATAGATTATATGAAGAAT -3’) (SEQ ID NO: 3) and ng130-p05 (5’-ACTGAAGCATCCTCCTCCTCCTCCTCCTGGTTTAAT- GCTGTTCATACGTTTGTC-3’) (SEQ ID NO: 13).

The p110-b fragment is also ted from first strand cDNA initially using primers p04 (5’- ATTAAACCAGGAGGAGGAGGAGGAGGATGCTTCAGTTTCATAATGCC-TCCTGCT - 3’) (SEQ ID NO: 4) which contains linker sequences and the 5’end of p110-b and ng130-p06 (5’-AGCTCCGTGATGGTGATGGTGATGTGCTCCAGATCTGTAGTCTTT- CCGAACTGTGTG -3’) (SEQ ID NO: 14) which contains sequences of the 3’end of p1 10-b fused to a Histidine tag.

The p85-iSH2/p1 10-b fusion protein is led by an pping PCR a reaction of the linkers at the 3’end of the iSH2 fragment and the 5’end of the p110-b fragment, using the above mentioned ng130-p03 primer and a primer containing an pping Histidine tag and the AttBZ recombination sequences (5’- GGGACCACTTTGTACAAGAAAGCTGGGTTT- AAGCTCCGTGATGGTGATGGTGATGTGCTCC-3’) (SEQ ID NO: 15).

This final product is recombined in a Gateway (Invitrogen) OR reaction into the donor vector pDONR201 to generate the ORF253 entry clone. This clone is verified by sequencing and used in a Gateway LR reaction to transfer the insert into the y adapted pBlueBac4.5 (Invitrogen) vector for tion of the baculovirus expression vector LR280.

PI3K6 BV—1060 85 iSH2 -G| Iinker— 110d full-Ien th -C-term His ta PCR products for the inter SH2 domain (iSH2) of the p85 subunit and for the full-length p110-d subunit are generated and fused by overlapping PCR.

The iSH2 PCR product is generated from first strand cDNA using initially primers ng130-p01 AGAATATGATAGATTATATGAAGAAT-3’) (SEQ ID NO: 1) and ng130-p02 (5’-TGGTTT-AATGCTGTTCATACGTTTGTCAAT-3’) (SEQ ID NO: 2).

Subsequently, in a secondary PCR reaction Gateway (Invitrogen) recombination AttB1 sites and linker sequences are added at the 5’end and 3’end of the p85 iSH2 fragment respectively, using primers ng130-p03 (5’- GGGACAAGTTTGTACAAAAAAGCAGGCTACGAAGGAGATATACAT- ATGCGAGAATATGATAGATTATATGAAGAAT -3’) (SEQ ID NO: 3) and ng154-p04 (5’- TCCTCCTCCTCCTCCTCCTGGTTTAATGCTGTTCATACGTTTGTC - 3’) (SEQ ID NO: 16).

The p110-a fragment is also generated from first strand cDNA using initially primers ng154-p01 (5’- CCTGGGGTGGACTGCCCCAT -3’) (SEQ ID NO: 17) and ng154-p02 (5’- CTACTG-CCTGTTGTCTTTGGACACGT -3’) (SEQ ID NO: 18).

In a subsequent PCR reaction linker sequences and a Histidine tag is added at the 5’end and 3’end of the p110-d fragment respectively, using primers gw154-p03 (5’- ATTAAACCAGGAGGAGGAGGAGGAGGACCCCCTGGGGTGGAC- ATGGA -3’) (SEQ ID NO: 19) and ng154-p06 CTCCGTGATGGTGAT- GGTGATGTGCT-CCCTGCCTGTTGTCTTTGGACACGTTGT -3’) (SEQ ID NO: 20).

The p85-iSH2/p110-d fusion protein is assembled in a third PCR reaction by the overlapping linkers at the 3’end of the iSH2 fragment and the 5’end of the p110-d fragment, using the above mentioned ng130-p03 primer and a primer containing an overlapping Histidine tag and the Gateway (Invitrogen) AttBZ recombination ces (5’-GGGACCACTTTGTA-CAAGAAAGCTGGGTTT- AAGCTCCGTGATGGTGATGGTGATGTGCTCC-3’) (SEQ ID NO: 21).

This final product is recombined in a Gateway (Invitrogen) OR reaction into the donor vector pDONR201 to generate the ORF319 entry clone. This clone is verified by cing and used in a y LR on to transfer the insert into the Gateway adapted pBIueBac4.5 (Invitrogen) vector for generation of the baculovirus sion vector LR415.

PI3K BV—950 110 D144aa -C-term His ta This construct is obtained from Roger Williams lab, MRC Laboratory of Molecular Biology, Cambridge, UK (November, 2003). Description of the construct in: Pacold M. E. et al. (2000) Cell 103, 931-943. 1.3 Protein expression and purification Methods to generate recombinant baculovirus and protein for PI3K isoforms: The Bac4.5 (for a, b, and d isoforms) or pVL1393 (for g) plasmids containing the different PI3 kinase genes are co-transfected with BaculoGold WT genomic DNA (BD ences, Franklin Lakes, NJ, USA) using methods recommended by the vendor.

Subsequently, the recombinant baculovirus obtained from the ection is plaque- purified on Sf9 insect cells to yield several isolates expressing recombinant protein.

Positive clones are selected by anti-HIS or anti-isoform antibody western. For PI3K alpha and delta isoforms, a secondary plaque-purification is performed on the first clonal virus stocks of PI3K. Amplification of all virus isolates is performed at low multiplicity of infection (moi) to generate high-titer, low passage stock for protein production. The baculoviruses are designated BV1052 (o) and BV1075 (d), BV949 (B), BV1060 (6) and BV950 (v).

Protein production es infection (passage 3 or lower) of suspended Tn5 (Trichoplusia hi) or o (Expression s, LLC, Woodland, CA, USA) cells in protein-free media at moi of 2-10 for 39-48 hours in 2 | glass Erlenmyer flasks (110 rpm) or wave-bioreactors (22-25 rpm). lnitially, 10 | working volume wave-bioreactors are seeded at a density of 3e5 cells/mL at half capacity (5L). The reactor is rocked at 15 rpm during the cell growth phase for 72 hours, supplemented with 5% oxygen mixed with air (0.2 l per minute). Immediately prior to infection, the eactor cultures are analyzed for density, viability and diluted to approximately 1.5e6 L. 100-500 mL of high titer, low passage virus is added following 2-4 hours of additional culture. Oxygen is increased to 35% for the 39-48 hour infection period and rocking platform rpm increased to 25. During infection, cells are monitored by Vicell viability analyzer (Beckman Coulter, lnc, Fullerton, CA, USA) bioprocess for viability, er and density. Nova lyzer (NOVA Biomedical Corp., Waltham, MA, USA) readings of various parameters and metabolites (pH, 02 saturation, glucose, etc.) are taken every 12-18 hours until harvest.

The wave-bioreactor cells are collected within 40 hours post ion. Cells are collected by centrifugation (4 degrees C at 1500 rpm), and subsequently maintained on ice during pooling of pellets for lysis and purification. Pellet pools are made with small amounts of cold, un-supplemented Grace’s media (w/o protease inhibitors).

P|3K alpha Purification ol For HTS (BV1052) P|3K alpha is purified in three chromatographic steps: immobilized metal affinity chromatography on a Ni Sepharose resin (GE Healthcare, belonging to General Electric Company, Fairfield, CT, USA), gel filtration utilizing a ex 200 26/60 column (GE Healthcare), and finally a cation exchange step on a SP-XL column (GE care). All buffers are chilled to 4°C and lysis is performed chilled on ice. Column fractionation is med rapidly at room temperature.

Typically frozen insect cells are lysed in a hypertonic lysis buffer and applied to a prepared IMAC column. The resin is washed with 3-5 column volumes of lysis buffer, followed by 3-5 column volumes wash buffer containing 45 mM imidazole, and the target protein is then eluted with a buffer ning 250 mM imidazole. Fractions are analyzed by Coomassie stained SDS-PAGE gels, and fractions containing target n are pooled and applied to a prepared GFC column. Fractions from the GFC column are analyzed by Coomassie stained SDS-PAGE gels, and fractions containing target protein are pooled. The pool from the GFC column is diluted into a low salt buffer and applied to a prepared SP-XL column. The column is washed with low salt buffer until a stable A280 baseline absorbance is achieved, and eluted using a 20 column volume gradient from 0 mM NaCl to 500 mM NaCl. Again, fractions from the SP-XL column are analyzed by Coomassie stained GE gels, and fractions containing the target protein are pooled. The final pool is dialyzed into a storage buffer containing 50% glycerol and stored at -20°C. The final pool is assayed for activity in a phosphoinosititol kinase assay.

P|3K beta Purification Protocol For HTS (BV949) P|3K beta is purified in two chromatographic steps: immobilized metal ty chromatography (IMAC) on a Ni ose resin (GE Healthcare) and gel filtration (GFC) utilizing a Superdex 200 26/60 column (GE Healthcare). All buffers are d to 4°C and lysis is performed chilled on ice. Column fractionation is performed rapidly at room temperature. lly frozen insect cells are lysed in a hypertonic lysis buffer and applied to a prepared IMAC column. The resin is washed with 3-5 column volumes of lysis buffer, followed by 3-5 column volumes wash buffer containing 45 mM ole, and the target protein is then eluted with a buffer containing 250 mM imidazole. Fractions are analyzed by sie stained SDS—PAGE gels, and fractions containing target n are pooled and d to a prepared GFC column. Fractions from the GFC column are analyzed by Coomassie stained SDS—PAGE gels, and fractions ning target protein are pooled. The final pool is dialyzed into a e buffer containing 50% ol and stored at -20°C. The final pool is assayed for activity in the phosphoinostitol kinase assay.

P|3K gamma cation Protocol For HTS (BV950) P|3K gamma is purified in two chromatographic steps: immobilized metal affinity chromatography (IMAC) on a Ni Sepharose resin (GE Healthcare) and gel filtration (GFC) utilizing a Superdex 200 26/60 column (GE Healthcare). All buffers are chilled to 4°C and lysis is performed chilled on ice. Column fractionation is performed rapidly at room temperature. Typically frozen insect cells are lysed in a hypertonic lysis buffer and applied to a prepared IMAC column. The resin is washed with 3-5 column volumes of lysis buffer, followed by 3-5 column volumes wash buffer containing 45 mM imidazole, and the target protein is then eluted with a buffer containing 250 mM imidazole.

Fractions are analyzed by Coomassie stained SDS—PAGE gels, and fractions containing target n are pooled and applied to a prepared GFC column. Fractions from the GFC column are analyzed by Coomassie stained SDS—PAGE gels, and fractions containing target protein are pooled. The final pool is dialyzed into a storage buffer WO 93849 containing 50% glycerol and stored at -20°C. The final pool is assayed for activity in the phosphoinostitol kinase assay.

P|3K delta Purification Protocol For HTS (BV1060) P|3K delta is purified in three chromatographic steps: immobilized metal ty chromatography on a Ni Sepharose resin (GE Healthcare), gel filtration ing a Superdex 200 26/60 column (GE Healthcare), and finally a anion exchange step on a Q- HP column (GE Healthcare). All buffers are chilled to 4°C and lysis is performed chilled on ice. Column fractionation is performed rapidly at room temperature. Typically frozen insect cells are lysed in a hypertonic lysis buffer and applied to a prepared IMAC column.

The resin is washed with 3-5 column volumes of lysis buffer, followed by 3-5 column volumes wash buffer containing 45 mM imidazole, and the target protein is then eluted with a buffer containing 250 mM imidazole. Fractions are analyzed by Coomassie stained SDS—PAGE gels, and fractions containing the target protein are pooled and applied to a prepared GFC column. Fractions from the GFC column are analyzed by Coomassie d SDS—PAGE gels, and fractions containing the target protein are pooled. The pool from the GFC column is d into a low salt buffer and applied to a prepared Q-HP column. The column is washed with low salt buffer until a stable A280 baseline absorbance is achieved, and eluted using a 20 column volume gradient from 0 mM NaCl to 500 mM NaCl. Again, fractions from the Q-HP column are ed by sie stained SDS—PAGE gels, and fractions containing the target protein are pooled. The final pool is dialyzed into a storage buffer containing 50% glycerol and stored at -20°C. The final pool is assayed for activity in the phosphoinostitol kinase assay.

|C50 is determined by a four parameter curve fitting routine that comes along with "excel fit". A four parameter logistic on is used to calculate |C50 values (IDBS XLfit) of the tage inhibition of each compound at 8 concentrations (usually 10, 3.0, 1.0, 0.3, 0.1, 0.030, 0.010 and 0.003 uM). atively, |C50 values are calculated using idbsXLfit model 204, which is a 4 parameter logistic model.

Yet alternatively, for an ATP depletion assay, compounds of the a I to be tested are dissolved in DMSO and directly distributed into a white 384-well plate at 0.5 ul per well. To start the reaction, 10 ul of 10 nM PI3 kinase and 5 ug/mL 1-alpha- phosphatidylinositol (Pl) are added into each well followed by 10 ul of 2 uM ATP. The reaction is performed until approx 50% of the ATP is depleted, and then stopped by the addition of 20 ul of Kinase-Glo solution (Promega Corp., Madison, WI, USA). The stopped reaction is incubated for 5 minutes and the remaining ATP is then detected via luminescence. |C50 values are then determined.

In one embodiment of the present invention, the P|3K inhibitor, wherein said inhibitor has an inhibitory action on the P|3K isoform delta, wherein the range of activity, expressed as |C50, in the enzymatic PI3K delta assay is from is n 1 nM and 500 nM.

In another embodiment of the present invention, the P|3K inhibitor, wherein said inhibitor has an tory action on the P|3K isoform delta, wherein the range of activity, expressed as |C50, in the enzymatic P|3K delta assay is from is between 1 nM and 100 nM.

In another embodiment of the present invention, the P|3K inhibitor, n said inhibitor has an inhibitory action on the P|3K isoform delta, n the range of activity, expressed as |C50, in the enzymatic P|3K delta assay is from is between 0.5nM and 10 nM.

In one embodiment of the t invention, the P|3K inhibitor, wherein said inhibitor has an inhibitory action on the P|3K isoform delta, n the range of activity, expressed as |C50, in the cellular P|3K delta assay is from is n 1 nM and 1000 nM.

In another embodiment of the present invention, the P|3K inhibitor, wherein said inhibitor has an inhibitory action on the P|3K isoform delta, wherein the range of activity, expressed as |C50, in the cellular P|3K delta assay is from is between 1 nM and 500 nM.

In another embodiment of the present invention, the P|3K inhibitor, n said inhibitor has an tory action on the PI3K isoform delta where the inhibitor shows a selectivity for the P|3K isoform delta over one or more of the other isoforms wherein this ivity is at least fold.

In another embodiment of the present invention, the P|3K inhibitor, wherein said inhibitor has an inhibitory action on the PI3K isoform delta where the inhibitor shows a selectivity for the P|3K isoform delta over one or more of the other isoforms n this selectivity is at least fold.

In another embodiment of the present invention, the P|3K tor, wherein said inhibitor has an inhibitory action on the PI3K isoform delta where the inhibitor shows a selectivity for the P|3K isoform delta over the different paralogs PI3K 0L and [3, wherein this selectivity is at least 10 fold.

In another embodiment of the present invention, the P|3K inhibitor, wherein said inhibitor has an inhibitory action on the P|3K isoform delta where the inhibitor shows a selectivity for the P|3K isoform delta over the ent paralogs P|3K 0L and [3, n this selectivity is at least 20 fold.

In another embodiment of the present invention, the P|3K tor, n said inhibitor has an inhibitory action on the P|3K isoform delta, wherein the range of activity, expressed as |C50, in the cellular P|3K delta assay is from is between 1 nM and 500 nM and wherein said inhibitor has an inhibitory action on the P|3K isoform delta where the inhibitor shows a selectivity for the P|3K isoform delta over the different paralogs P|3K 0L and [3, wherein this selectivity is at least 10 fold.

In another ment of the present invention, the P|3K inhibitor, wherein said inhibitor has an inhibitory action on the P|3K isoform delta, wherein the range of activity, sed as |C50, in the cellular P|3K delta assay is from is between 1 nM and 500 nM and wherein said inhibitor has an inhibitory action on the P|3K isoform delta where the inhibitor shows a selectivity for the P|3K isoform delta over the different paralogs P|3K 0L and [3, wherein this selectivity is at least 20 fold. 2. Cellular assays 2.1 Phosphoinositide-3 kinase (Pl3K)-mediated Akt 1/2 ($473) phosphorylation in Rat-1 cells Rat-1 cells stably overexpressing a myristoylated form of the catalytic subunit of human phosphoinositide—3 kinase (Pl3K) alpha, beta or delta were plated in 384-well plates at a density of 7500 (Pl3K alpha), 6200 (Pl3K beta), or 4000 (Pl3K delta) cells in 30u| complete growth medium (Dulbecco’s modified s medium (DMEM high glucose) mented with 10% (v/v) fetal bovine serum, 1% (v/v) MEM non essential amino acids, 10mM HEPES, 2mM L-glutamine, 10 ug/mL puromycin and 1% (v/v) Penicillin/Streptomycin) and were incubated at 37%C / 5%C02 / 95% humidity for 24h.

Compounds were diluted in 384-well compound plates to obtain 8-point serial dilutions for 40 test compounds in 90% DMSO, as well as 4 reference compounds plus 16 high controls and 16 low (inhibited) controls. Predilution plates were prepared by dispensing pipetting 250 nl of compound ons into 384-well opylen plates using a Hummingwell ter dispensor . Compounds were prediluted by the addition of 49.75 ul complete growth medium. 10u| of prediluted compound solution were transferred to the cell plate using a 384-well pipettor, resulting in a final DMSO concentration of 0.11%.

Cells were incubated for 1 h at 37%C / 5%C02 / 95% humidity. The supernatant was removed, the cells were lysed in 20u| of lysis buffer for AlphaScreen® SureFire® ion.

For detection of Ser473), the SureFire® p-Akt 1/2 (Ser473) Assay Kit nElmer, U.S.A) was used. 5u| of cell lysate was transferred to 384-well low volume Proxiplates for detection using a 384-well pipettor. Addition of AlphaScreen® SureFire® reagents was done according to the manufacturer’s protocol. First, 5u| of reaction buffer plus activation buffer mix containing AlphaScreen® acceptor beads was added, the plate was sealed, and incubated on a plate shaker for 2 hours at room ature. Second, 2u| of dilution buffer containing creen® donor beads was added, and the plate was incubated on plate shaker as above for a further 2 hours. The plate was read on an AlphaScreen® compatible plate reader, using standard AlphaScreen® settings. 2.2 Determination of murine B cell activation P|3K8 has been recognized to modulate B cell function when cells are stimulated through the B cell receptor (BCR) (Okkenhaug et al. Science 297:1031 (2002). For assessing the inhibitory property of compounds on B cell activation, the upregulation of activation markers CD86 and CD69 on murine B cells derived from mouse spleen antibody is measured after ation with anti-lgM. CD69 is a well known activation marker for B and T cells (Sancho et al. Trends lmmunol. 26:136 (2005). CD86 (also known as 87-2) is primarily expressed on antigen-presenting cells, including B cells .

Resting B cells express CD86 at low levels, but upregulate it following stimulation of e.g. the BCR or lL-4 receptor. CD86 on a B cell interacts with CD28 on T cells. This interaction is required for optimal T cell activation and for the generation of an optimal lgG1 response (Carreno et al. Annu Rev lmmunol. 20:29 (2002)).

Spleens from Balb/c mice are ted, splenocytes are isolated and washed twice with RPMI ning 10% foetal bovine serum (FBS), 10 mM HEPES, 100 Units/mL penicilline/streptomycine. RPMI supplemented in this way is subsequently referred to as medium. The cells are ed to 2.5 X 106 cells/mL in medium and 200 pl cell suspension (5 x106cells) are added to the appropriate wells of 96 well plates.

Then the cells are stimulated by adding 50 ul anti-lgM mAb in medium (final concentration: 30 ug/mL). After incubation for 24 hours at 37°C, the cells are stained with the following dy cocktails: anti-mouse CD86-FITC, anti-mouse CD69-PerCP- Cy5.5, ouse erCP for the assessment of B cells, and anti-mouse CD3- FlTC, anti-mouse CD69-PE for the assessment of T cells (2 ul of each antibody/well).

After one hour at room temperature (rt) in the dark the cells are transferred to 96 Deepwell plates. The cells are washed once with 1 mL PBS containing 2% FBS and after re-suspension in 200 pl the samples are analyzed on a FACS Calibur flow cytometer. Lymphocytes are gated in the FSC/SSC dot plot according to size and granularity and further analyzed for expression of CD19, CD3 and activation markers (CD86, CD69). Data are calculated from dot blots as percentage of cells positively stained for activation markers within the CD19+ or CD3+ population using BD CellQest Software.

For assessing the inhibitory property of compounds, compounds are first dissolved and diluted in DMSO followed by a 1:50 dilution in medium. Splenocytes from Balb/c mice are isolated, re-suspended and ered to 96 well plates as described above (200 ul/well). The diluted compounds or t are added to the plates (25 pi) and incubated at 37°C for 1 hour. Then the cultures are stimulated with 25 ul anti-lgM mAb/well (final concentration 30 ug/mL) for 24 hours at 37°C and stained with anti-mouse CD86-FITC and ouse erCP (2 ul of each antibody/well). CD86 expression on CD19 positive B cells is quantified by flow cytometry as described above. 2.3 Determination of rat B cell activation P|3K8 has been recognized to modulate B cell on when cells are ated through the B cell receptor (BCR) (Okkenhaug et al. Science 297:1031 (2002). For ing the tory property of compounds on B cell activation, the upregulation of activation markers CD86 on rat B cells derived from whole blood is measured after stimulation with anti-lgM and recombinant lL-4. The CD86 molecule (also known as B7- 2) is primarily expressed on antigen-presenting cells, including B cells. Resting B cells express CD86 at low levels, but upregulate it following stimulation of e.g. the BCR or lL-4 receptor. CD86 on a B cell interacts with CD28 on T cells. This interaction is required for optimal T cell activation and for the generation of an optimal lgG1 response no et al. Annu Rev lmmunol. 20:29 (2002)). tion of rat blood Whole blood was collected from the nal aorta adult male Lewis rats (LEW/Haand) oby using a 10 ml syringe with hypodermic needle pre-coated with sodium heparin. Blood was transferred into 50 ml Falcon tubes and the anticoagulant concentration was adjusted to 100 U/ml.

Stimulation of rat B cells and treatment with specific inhibitor For assessment of the in vitro effects of suppressive drugs, nized blood was prediluted to 50% with medium. As medium served DMEM high e (Animed cat# 1- 26F01-l) supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, 2 mM L-glutamin, 50 mg/ml dextran 40 and 5% fetal calf serum (FCS, Fetaclone I, Gibco #10270-106). Then, 190 pl prediluted blood was spiked with 10 ul of luted test compound in 96 well U- bottomed microtiter plates (Nunc) resulting in a 3-fold serial dilution with a concentration range from 20 to 0.0003 uM. l wells were pretreated with DMSO to obtain a final concentration of 0.5% DMSO. Cultures were set up in duplicates, mixed well by agitation on a plate shaker (Heidolph ax 101; 30 sec, speed 900), pipetting up and down and agitated on the plate shaker again. Cultures were incubated at 37°C, 5% C02 for 1 hr. Then, ul of polyclonal goat anti-rat lgM Ab ec, cat# 302001) and 10 ul of diluted recombinant rlL-4 otools # 340085) were added to obtain final trations of 30 ug/ml and 5 ng/ml, respectively. Plates were mixed by agitation on a plate shaker as above and incubated for 24 hrs at 37°C, 5% C02. ination of B cell activation by flow cytometgy After incubation, 15 ul of a 25 mM EDTA solution was added per well and shaken for 15 min to detach adherent cells. For analysis of surface activation markers, samples were then stained with PE-Cy5-Iabeled anti-ratCD45RA (BD cat# 557015) to allow gating on B cells in FACS analysis. In addition, samples were stained with PE-Iabeled anti-rat CD86 (BD cat# 551396). All staining procedures were performed at rt for 30 min in the dark. After incubation, samples were transferred to 96-deep well V-bottomed microtiter plates (Corning # 396096) containing 2 ml/well of BD Lysing Solution (BD # 349202). After lysis of erythrocytes samples were washed with 2 ml of CeIIWASH (BD # 349524). Data was acquired on an LSRII or libur flow cytometer (BD Biosciences) using Cellquest Plus or DIVA (version 6.1.1) software, respectively. Lymphocytes were gated in the FSC/SSC dot blot according to size and granularity and further analyzed for expression of CD45RA and activation markers. Data were calculated from dot blots or rams as percentage of cells positively stained for activation markers within the CD45RA+ population.

Statistical evaluation The percentage inhibition of B cell activation after exposure to drug was calculated by the following formula: % Inhibition = 100 X ation Without drug —stimulation With drug stimulation Without drug — unstimulated ORIGIN 7 software (OriginLab Corporation, Northampton, MA) was used for non-linear regression curve fitting. The drug concentration resulting in 50% inhibition (IC50) was obtained by fitting the Hill on to inhibition data. 2.4 Determination of TLR9-induced lL-6 in mouse splenocytes ation of single cell suspension from mouse spleen s were dissected from C57BL/6 mice immediately following euthanasia. Excess fat was trimmed from the spleens prior to mashing the spleen through a 0.4 uM cell strainer using a plunger from a 5 ml syringe. A single cell suspension was prepared and the volume was adjusted to 15 ml in a 50 ml Falcon tube using cold PBS. Cells were centrifuged at 1500 rpm for 5 minutes at 4°C degrees prior to removal of supernatant and re-suspension in 5 ml of red blood cell lysis buffer per spleen and incubation for 5 minutes at room temperature. lce cold PBS (30 ml) was added to the cells prior to centrifugation at 1500 rpm for 5 s at 4°C. The supernatant was d and the cells were washed twice with 40 ml of murine splenocyte culture media (MSCM). MSCM consisted of RPMI supplemented with 100 units/ml Penicillin and 100 ug/ml Streptomycin, 1 x nonessential amino acids, 1 mM Sodium Pyruvate, 0.05 mM B-mercaptoethanol, and 10% heatinactivated Fetal Bovine Serum (FBS).

Cells were re-suspended in 10-20 ml of MSCM and counted using a Countess cell counter.

Approximately 60x106 splenocytes were obtained from a single C57BL/6 mouse spleen.

Stimulation of murine splenocytes and treatment with specific inhibitor cytes were plated at a final density of 2x105 cells/well in a volume of 100 pl in 96 well flat bottomed plates and incubated in a humidified 37°C incubator for 2-4 hours. ards, compounds to be tested were dispensed using an automated liquid handling machine using previously prepared compound stock plates. Stock plates consisted of compounds (in 90%/10% dH20) arrayed in 8-10 point using 2— or 3-fold dilutions. The liquid handling machine dispensed 1 ul of each dilution from the usly prepared compound source plate into the appropriate destination well in the 96-well plate. The final starting concentration of the compounds in the cell culture was 10 uM. The final concentration of DMSO in the cell cultures was 0.5%. Cells were incubated with compounds for 1 hour prior to addition of TLR ligand. Then, a 10x ECgO concentration of CpG1826 was added in a volume of 20 ul (for a final culture volume of 200 pl) whereupon es were incubated overnight in a humidified 37°C incubator.

Determination of Interleukin-6 by ELISA After overnight e, plates were centrifugated at 2000 rpm for 5 minutes at room temperature. Subsequently 150 pl of each e was transferred to l V—bottomed plates and lL-6 levels were measured using commercially available mouse lL-6 sandwich ELISA kit. Briefly, plates were coated overnight with the capture antibody prior to blocking for 1 hour with PBS/0.1% BSA. Samples and rds were added in a volume of 50 pi and the plate was incubated for 2 hours at room temperature. After removal of the standards/samples, the plate was washed using PBS/0.05% Tween prior to addition of 50 ul of the ylated detection antibody whereupon the plate was incubated for 2 hours at room temperature with agitation. Plates were washed again prior to addition of 50 ul streptavidin- adish peroxidase per well for 20 minutes. ing additional plate washes 50 ul TMB substrate was added to each well and plates were incubated for 20 minutes prior addition of ul/well stop solution. |L-6 levels were measured using a SpectraMax 190 Plate Reader (450 nm) and analyzed using SoftMax Pro and GraphPad Prism software. 2.5 ination of nduced lFNalpha in human peripheral blood mononuclear cells (PBMC) Preparation of PBMC from fresh human blood Human blood (ca. 75 ml) was collected in 10 S-Monovette tubes containing Heparin (S- Monovette 7.5 mL NH Heparin 16 IU/mL blood; Starstedt). LeucosepT'VI tubes (30 mL #227290; Greiner Bio-one) were ed by addition of 15 ml lymphocyte separation medium LSM1077T'VI per tube (#J15-004; PAA Laboratories) and centrifugation for 30 sec at 1000g. Some 25 ml blood was erred to LeucosepT'VI tubes following dilution with equal parts of PBS (without Ca2+/Mg2+; #14190-094). Samples were centrifuged at 800g for 20 min at 22 °C using an Eppendorf 5810R centrifuge without brake. The PBMC layer was lly d from plasma:separation medium interface and transferred into clean 50 ml tube. Cells were washed once by addition of PBS (up to 45 ml) and centrifuged (1400rpm, 10 min at 22 °C) with brake (set at speed 9) using an Eppendorf 5810R. ed cells were carefully ended in Media (RPMI 1640+GlutaMAX-l, 0.05 mM 2-mercaptoethanol, 10 mM HEPES and 5% v/v FCS) and samples . The medium components 2- mercaptoethanol (#31350-010; 50 mM), Hepes (#15630-056, 1M) and RPMI 1640 (1x) + GlutaMAX—l (#61870-010) were obtained from Gibco. FCS (#2-01F36-1) was obtained from Amimed. The PBMC were counted using a Countess® Automated cell counter (sample was pre-diluted 1:10 in Media, prior to the addition of equal volume (10 pl) of Trypan Blue). Cells were diluted to 4 x 106 cells/ml and seeded in 384-well plates (#353962; Becton Dickinson AG) to give a final volume of 25 ul (i.e. 1 x105 cells/well).

Stimulation of PBMC and treatment with specific inhibitor Compounds were luted in 100% v/v DMSO (#41640-100mL; Aldrich), followed by transfer in Media (to achieve a final DMSO concentration of 0.25%). Cells were treated with riate compound dilution (5 pl) or vehicle control (5 pl) and incubated for 30 min at 37 °C in a humidified incubator in air with 5% (v/v) C02. Cells were stimulated with 6 (0.3 uM; #tlrl-hodna; lnvivogen) or vehicle control (10 ul/well) and incubated for 20 h. Plates were briefly centrifuged (200 x g for 2 min at 22 °C) and supernatant samples (30 ul) removed for quantification of lFNq levels.

Quantification of lFNq using AlphaLisa technology For quantification of lFNalpha the human interferon AlphaLlSA Kit (#AL264F) from Elmer was used. An antibody mix containing anti-lFNq acceptor beads (5 ug/ml final) and biotinylated antibody anti-lFNq (0.5 nM final) is prepared fresh and dispensed (5 pl) into 384-well OptiplatesT'VI (#6007299; PerkinElmer). Dilution of known lFNq standards (human 31 0 lFNq B (2b)) were prepared and together with cell supernatants (5 ul) were added to plates above. Plates were y centrifuged (pulse at 200g), covered with adhesive sealing film, vortexed and incubated 1 h at room temperature in the dark. avidin-coated donor beads (20 ug/ml final) was prepared and added to each well (5 pl) in a dark lit area (light sensitive mix). Plates were incubated 30 min at room temperature (Pates must not be centrifuged or d). After incubation, the plates were read with an EnVisionT'VI multiplate reader equipped with the ALPHA option using the ment’s own “AlphaScreen standard settings” (e.g. total measurement time: 550 ms, Laser 680 nm tion time: 180 ms, mirror: D640 as, emission filter: M570w, center ngth 570 nm, bandwidth 100 nm, transmittance 75%). Data were collected for analysis and quantification of lFNq .

Data evaluation and analysis Data were analysed using Excel XL fit 4.0 (Microsoft) with XLfit add-in (lDBS; version 4.3.2).

Specific lFNq concentrations were ined following extrapolation to standard curves using human lFNq B (2b). lndividual |C50 values of compounds were ined by nonlinear regression after fitting of curves to the experimental data. 3 Determination of antibody production to sheep red blood cells (SRBC).

In brief, OFA rats were injected iv with sheep erythrocytes on d0 and treated orally on four consecutive days (d0 to d3) with the compounds under investigation. Spleen cell suspensions were prepared on d4 and lymphocytes were plated onto soft agar in presence of indicator cells (SRBC) and complement. Lysis of the indicator cells due to secretion of SRBC-specific antibody (predominantly of the lgM subclass) and presence of complement yielded plaques. The number of plaques per plate were d and expressed as number of plaques per spleen. zation: Groups of five female OFA rats were immunized on day 0 with 2x108/ml SRBC (obtained from Laboratory Animal Services LAS, Novartis Pharma AG) in a volume of 0.5ml per rat by iv injection.

Compound treatment: Animals were treated with compound suspended in 0.5% CMC, 0.5%Tween80 in for 4 consecutive days (days 0, 1, 2 and 3) starting on the day of immunization. Compound was administered orally twice daily with 12 hours alls between doses in an application volume of 5 ml/kg body weight.

Preparation of spleen cell suspensions: On day 4, animals were euthanized with COZ Spleens were removed, weighed, and deposited in plastic tubes containing 10 ml of cold (4 °C) Hank’s balanced salt on (HBSS; Gibco, pH 7.3, containing 1mg Phenolred/100ml) for each rat spleen. Spleens were homogenized with a glass potter, left on ice for 5 minutes and 1 ml supernatant 31 1 was transferred into a new tube. Cells were washed once in 4 ml HBSS then supernatants were discarded and pellets re-suspended in 1 ml of HBSS. Lymphocyte numbers per spleen were determined by automated cell counter and spleen cell suspensions were adjusted to a cell concentration of 30x106/ml.

Plague forming assay: Soft agar petri dishes were prepared with 0.7% agarose (SERVA) in HBSS.

In addition, one ml of 0.7% agarose was prepared in plastic tubes and kept at 48°C in a water bath. Some 50 pl of a 30x106/ml spleen cell sion and 50 pl of SRBC at 40 x 108/ml were added, mixed rapidly (Vortex) and poured onto the prepared agarose dishes. Petri dishes were slightly tilted to e even distribution of cell mixture on agarose layer. The dishes were left at room temperature for 15 minutes and were then incubated at 37°C for 60 minutes. Then, 1.4ml guinea pig complement n; 10%) was added and the incubation continued for another 60 minutes at 37 °C. SRBC- specific dies released by the plated-out B cells bound to the antigen (SRBC) in their vicinity. These n-antibody complexes ted complement and led to the lysis of the SRBC leaving a bright spot (plaque) within the red erythrocyte layer. Plaques were counted with a microscope.

The following formula for determination of inhibition of plaque formation was used: %lnhibition = V—100 with: V: mean number of plaques/spleen for vehicle group; C: mean number of plaques/spleen for compound d group References: N.K. Jerne & A.A. Nordin (1963) Plaque formation in agar by single antibody-producing cells. Science 140:405.

N.K. Jerne, A.A. Nordin & C. Henry (1963) The agar plaque technique for recognizing antibody-producing cells. In: "Cell Bound Antibodies", B. Amos & H. Koprowski, Eds., Wistar lnst. Press, Philadelphia pp.109—125.

Biological data Enzymatic Assay —A4 —— —A5 4.663 0.037 —A6 0.377 0.009 WO 93849 WO 93849 31 3 2012/057554 law-— < 0.003 0.103 0.003 0.011 0.012 0.025 0.033 0.057 0.022 0.0745 0.2265 0.0106667 0.007 0.007 0.013 0.01 < 0.003 0.0045 0.011 0.065 0.023 0.095 0.004 .017 0.011 0.037 0.041 0.068 0.032 0.035 0.011 0.025 0.039 0.005 0.003 0.0055 WO 93849 31 5 WO 93849 31 6 WO 93849 31 7 WO 93849 31 8 WO 93849 31 9 Cellular Assays Cell PI3K / RWB/ IC50 Example IC50 [umol l-1] CD86 [nmol l-1] A1 0.043 37 B1 0.154 29 C1 0.081 68 D1 0.147 84 E1 0.007 78 E3 0.018 14 F1 0.011 7 F3 0.050 F7 0.018 40 Q 0.145 37 The reference in this ication to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an ledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates. hout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

Claims (1)

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A compound of formula (I) Q R7 R5 R30 R5 R30 N Y R5 V N R5 O R5 (I) or a salt thereof, wherein Y is selected from O or NH; V is selected from CR5 or N; W is ed from CH2, or O; U is selected from N or CH; Q is ed from N or CR6; wherein U and Q are not both N; R1 is selected from phenyl, pyridyl, pyrimininyl, pyrazinyl, pyridazinyl, 1,2,3-triazinyl, 1,2,4- triazinyl, 1,3,5-triazinyl, -X-R4 wherein X is selected from C(O), S(O)2 or CH2 R4 is ed from C1-C8-alkyl, halo-C1-C8-alkyl, hydroxy-C1-C8-alkyl, C1-C8- alkoxy-C1-C8-alkyl, cyano-C1-C8-alkyl, N,N-di-C1-C4-alkyl-amino-C1-C8-alkyl, C1-C4- alkyl-sulfonyl-C1-C8-alkyl, phenyl, heterocyclyl, heterocyclyl-oxy, heterocyclyl-C1- C8-alkyl, C3-C12-cycloalkyl, -cycloalkyl-oxy, C3-C12-cycloalkyl-C1-C8-alkyl, heteroaryl, heteroaryl-oxy, heteroaryl-C1-C8-alkyl, hydroxy, C1-C8-alkoxy, amino, NC1-C8-alkyl-amino or N,N-di-C1-C8-alkyl-amino, wherein C1-C8-alkyl in N-C1-C8-alkyl-amino and in N,N-di-C1-C8-alkyl-amino may be unsubstituted or substituted by halogen, y or C1-C4-alkoxy, H:\rec\Interwoven\NRPortbl\DCC\REC\7672623_1.docx-