NZ623726B2 - Blood coagulation factor ? and ?a derivatives, conjugates and complexes comprising the same, and use thereof - Google Patents

Abstract

Disclosed is a derivative of Fac? or its active form Fac?a, comprising the amino acid sequence of SEQ ID NO. 4 from Fac? and a peptide linker linked at the C-terminus thereof, wherein the C-terminal amino acid residue of the peptide linker is a cysteine, wherein the sequence is defined in the complete specification. Also disclosed is the use of said compound for the preparation of a medicament for preventing or treating haemophilia or for promoting blood coagulation. te specification. Also disclosed is the use of said compound for the preparation of a medicament for preventing or treating haemophilia or for promoting blood coagulation.

Description

ption Title of Invention: BLOOD COAGULATION FACTOR VII AND VIIA DERIVATIVES, CONJUGATES AND COMPLEXES SING THE SAME, AND USE THEREOF Technical Field The present invention relates to a blood coagulation factor VII derivative, a blood co— agulation factor VIIa derivative, FacVII and FacVIIa conjugates each prepared by linking a polymer capable of extending the blood half—life to the derivative, FacVII and VIIa complexes each prepared by linking a carrier to the conjugate, genes encoding the FacVII and FacVIIa derivatives, expression vectors comprising the genes, trans— formants introduced with the expression vectors, a method for preparing the FacVII and FacVIIa derivatives using the transformants, a method for preparing the FacVIIa ate and complex, a FacVIIa complex prepared by the method, a ceutical composition for preventing or treating hemophilia comprising the derivative, conjugate, or complex as an active ingredient, and a pharmaceutical composition for promoting blood coagulation sing the derivative, conjugate, or complex as an active ingredient. Further, the present invention s to a method for preventing or ng hemophilia or for promoting blood coagulation, comprising administering to a t a therapeutically effective amount of the composition.

Background Art At t, there are an estimated 140 thousand people with hemophilia worldwide, showing an annual increase of 20%. Genetically, hemophilia occurs in one out of every ten thousand, but diagnosis or treatment is made only for approximately 25% of all patients. Based on etiology, hemophilia is largely divided into two types: one is ilia A that is caused by a lack of blood coagulation factor VII (Factor VII, FacVII) and accounts for 80% of the total hemophilia patients, and the other is hemophilia B that is caused by a lack of blood coagulation factor XI (Factor XI) and accounts for 20% of the total hemophilia patients. For the treatment of hemophilia, external administration of blood coagulation factors is given, but this treatment method is problematic in that 10—15% of all hemophilia A patients develop antibodies against the blood coagulation factor, and 1—3% of all ilia B patients develop dies against the blood coagulation .

On the other hand, FacVII, which is a cause of hemophilia A accounting for more than a half of the hemophilia ts, is an enzyme that is mainly produced in the liver and composed of 406 amino acids, and includes gamma—carboxylation of glutamic acid at position 10, N—glycosylation of asparagines at positions 145 and 322, and O— glycosylation of serines at positions 52 and 60. Further, FacVII has two EGF—like domains and one serine protease domain, and single—chain FacVII is activated through cleavage n arginine at position 152 and isoleucine at position 153 to generate two—chain FacVIIa consisting of a light chain and a heavy chain. Since activated FacVIIa acts through auxiliary blood clotting mechanism, unlike other blood co— agulation factors, antibodies are not produced even though ion of high—dose FacVIIa. Therefore, it can be used for the treatment of ilia A patients as well as patients having antibodies against FacVII due to the conventional therapies, and is known as a means of addressing the above described problems.

However, antibodies against FacVIIa are not produced, but there is another problem of ing high—dose, nt stration because of a short blood half—life.

Because of the short half—life, FacVIIa should be administered 2—3 times a day for the treatment of hemophilia, and this frequent administration also becomes a serious obstacle to the prevention of ilia. In order to solve the problem of short blood half—life, studies have ted the known microencapsulation, liposome encap— sulation, and a y of chemical modifications, but successful outcomes have not been reported yet. In particular, chemical modifications have been ted such that the lysine residue or N—terminus on the surface of FacVIIa is chemically modified, or a carrier capable of extending blood half—life such as polyethylene glycol, albumin, transferrin, and immunoglobulin fragment is linked thereto, or a cysteine residue is inserted into a region not directly affecting the activity of FacVIIa to promote binding with other carrier. However, chemical cation of the lysine residue or N—terminus on the surface of FacVIIa reduces the ability of FacVIIa to bind with the membrane of et. When it is linked to other carrier, the carrier interferes with enzymatic ac— tivities. Insertion of cysteine residue induces formation of non—specific disulfide bond, consequently g to a reduction in enzymatic activities. As such, many studies have been made to develop derivatives having an ed blood half—life without reducing the activity of FacVIIa, but no successful results have been reported yet. rVIIa—FP (CSL Behring) prepared by fusion of albumin to the C—terminus of FacVIIa is in the pre—clinical phase, and its blood half—life in rats was increased to 6.7 times higher than that of the native FacVIIa. r, it still has a very short half—life of 4.38 hrs, and thus is not suitable for the ent and prevention of hemophilia.

PEGLip—FVIIa (Omri) prepared by using a pegylated liposome formulation is also in the pre—clinical phase, but its blood half—life was only 2 times higher than that of the native FacVIIa.

Two ts, MAXY—VII /Maxygen) prepared by Gla domain mutation and lycosylation of FacVIIa to have a prolonged blood half—life and NN7128 (Novo/Neose) prepared by 40K PEG glycosylation to have a prolonged blood half—life are under clinical studies, but their blood half-life was only 5 times higher than that of the native FacⅦa. Thus, they are not suitable for the effective treatment and prevention of hemophilia.

Disclosure of ion Technical Problem Based on this background, the present inventors have made many efforts to develop derivatives having improved blood half-life while ing the maximum activities of FacⅦ and FacⅦa. As a , they found that a derivative prepared by fusion of a part of the SOD1 (Superoxide Dismutase 1) sequence to the C-terminus of FacⅦ is easily able to bind with a carrier capable of extending the blood half-life such as polyethylene , albumin, transferrin, and immunoglobulin fragment without reducing the activity of FacⅦ or FacⅦa, and in particular, an immunoglobulin Fc region, a ptidyl polymer, and a FacⅦ or Fac Ⅶa derivative are site-specifically linked via a covalent bond to minimize the activity reduction and to remarkably increase the blood half-life of the ate, thereby completing the present invention.

Solution to Problem Described herein is a derivative of FacⅦ or its active form FacⅦa which has an amino acid sequence of blood coagulation factor Ⅶ (Factor Ⅶ, FacⅦ) or its active form, blood ation factor Ⅶa (Factor Ⅶa, FacⅦa) and a peptide linker at the C-terminus.

Described herein is a polynucleotide encoding the derivative of FacⅦ or its active form FacⅦa.

Further described herein is an expression vector comprising the polynucleotide.

Still another object of the present invention is to provide a transformant introduced with the expression vector.

Still further described herein is a method for preparing the derivative of FacⅦ or its active form FacⅦa using the transformant.

Described herein is a conjugate of FacⅦ or its active form FacⅦa, which is prepared by linking a polymer capable of extending the blood half-life to the peptide linker of the tive.

Described herein is a complex of FacⅦ or its active form FacⅦa, which is prepared by linking a carrier capable of extending the blood half-life to one end of the ate.

Described herein is a method for preparing the FacⅦa complex comprising the step of activating the FacⅦ complex.

Described herein is a FacⅦa complex prepared by the above method.

Still further described herein is a pharmaceutical composition for the prevention or treatment of hemophilia, comprising the derivative, conjugate, or complex as an active ingredient.

Further described herein is a pharmaceutical composition for blood coagulation, sing the derivative, conjugate, or complex as an active ient.

Described herein is a method for preventing or treating ilia, comprising the step of administering to a subject a therapeutically effective amount of the pharmaceutical composition for the prevention or treatment of hemophilia.

Described herein is a method for promoting blood coagulation, comprising the step of stering to a subject a eutically effective amount of the pharmaceutical composition for blood coagulation. [21A] According to the invention there is also provided a tive of FacⅦ or its active form FacⅦa, comprising an amino acid sequence of SEQ ID NO. 4 of FacⅦ and a peptide linker linked at the inus thereof, n the inal amino acid residue of the peptide linker is a cysteine. [21B] According to the invention there is also provided use of the FacⅦ derivative or the Fac Ⅶa derivative, the FacⅦ conjugate or the FacⅦa conjugate, the FacⅦ complex or the FacⅦ a complex, the FacⅦa conjugate, or the FacⅦa complex according to the invention, for preparation of a medicament for preventing or treating hemophilia. [21C] According to the invention there is also provided use of the FacⅦ derivative or the Fac Ⅶa derivative , the FacⅦ conjugate or the FacⅦa conjugate, the FacⅦ complex or the FacⅦ a complex, the FacⅦa conjugate, or the FacⅦa complex according to the invention, for preparation of a medicament for promoting blood coagulation. ageous Effects of Invention The FacⅦ or FacⅦa derivative of the present invention is able to bind with a carrier capable of improving the blood half-life while maintaining the activity of FacⅦ or FacⅦa, and they can be widely used in the development of effective prophylactic or therapeutic agent for hemophilia.

Brief Description of Drawings is a photograph g the result of Western blot analysis of FacⅦ- ATKAVC expressed in 293F cell line; is a photograph showing the result of n blot analysis of a control group and FacⅦ-GGGGSC expressed in 293F cell line; is a photograph showing the result of Western blot analysis showing the molecular weight difference of FacⅦ-ATKAVC and FacⅦ-SOD1 1-149 expressed in 293F cell line; is a photograph showing the result of electrophoresis of the purified FacⅦ- is a photograph g the result of electrophoresis of a FacⅦ-ATKAVCPEG conjugate; is a photograph showing the result of electrophoresis of a FacⅦa-ATKAVCPEG-Fc conjugate; is a photograph showing the result of Western blot analysis of the FacVIIa—ATKAVC—PEG—Fc conjugate; and is a graph of tration—dependent absorbance showing in vitro activities of FacVII and —ATKAVC.

Best Mode for Carrying out the Invention In one aspect to achieve the above objects, the present invention provides a derivative of FacVII or its active form FacVIIa which has an amino acid sequence (SEQ ID NO. 4) of blood coagulation factor VII (Factor VII, FacVII) and a peptide linker at its C—terminus.

As used herein, the term "blood coagulation factor VII (Factor VII, FacVII)" is, also called proconvertin, one of the factors involved in blood coagulation, and has a size of 48 kDa, and it is encoded by a gene having a size of 12.8 kb, and mainly produced in the liver, and one of vitamin K—dependent plasma proteins. It has been known that FacVII binds to blood coagulation factor III on the e of extravascular tissues such as serine protease precursor and smooth muscle cells, tumor tissues, or activated leukocytes, and thus activates blood coagulation factors IX and X, leading to initiation of the sic blood coagulation. In the present invention, FacVII may include a native FacVII, chemically modified FacVII tives that retain the normal activity of the native FacVII, and variants that have at least 80% amino acid sequence homology, preferably 85%, 90%, or 95% amino acid sequence homology, and more preferably 98% or 99% amino acid sequence homology with the native FacVII while they retain the normal activity of the native FacVII. r, the sequence homology is not limited thereto, as long as they exhibit the activity of the native FacVII.

As used herein, the term "blood coagulation factor VIIa (Factor VIIa, a)" means an active form of blood coagulation factor VII (Factor VII, FacVII), and single— chain FacVII is activated through ge between ne at position 152 and isoleucine at position 153 to generate ain FacVIIa consisting of a light chain and a heavy chain. Since activated FacVIIa acts through auxiliary blood clotting mechanism, unlike other blood coagulation factors, antibodies are not produced even though ion of ose FacVIIa. In the present invention, FacVIIa may include a native FacVIIa, chemically modified FacVIIa derivatives that retain the normal activity of the native FacVIIa, and variants that have at least 80% amino acid sequence homology, preferably 85%, 90%, or 95% amino acid sequence homology, and more preferably 98% or 99% amino acid sequence homology with the native FacVII while they retain the normal activity of the native FacVIIa. However, the sequence homology is not limited thereto, as long as they exhibit the activity of the native FacVII.

As used herein, the term r" basically refers to a means capable of linking two different fusion partners (e.g., biological polymers) using a hydrogen bond, an elec— trostatic interaction, a van der Waals force, a disulfide bond, a salt bridge, a hy— drophobic interaction, a covalent bond or the like. Preferably, it may have at least one cysteine involved in at least one disulfide bond under physiological conditions or other standard peptide conditions (e.g., peptide purification conditions, peptide storage conditions). It is possible to use the cysteine as a reactive group linking the fusion partner as well as the disulfide bond. In addition, the linker functions to provide a pre— ined space between carriers or functions as a hinge providing the fusion protein with flexibility or rigidity as well as it simply ons to link each fusion partner. In the present invention, the linker is, but not particularly limited to, a peptide linker that links the C—terminus of FacVII or a to link a carrier capable of extending the blood half—life, and ably a C—terminal cysteine residue of peptide linker. It may be preferably a partial sequence (SEQ ID NO. 30) of SODl (Superoxide dismutase l), more preferably, a partial sequence (SEQ ID NO. 31) ed from 1 to 149 of SODl ce, much more preferably from 1 to 90 of SODl sequence (SEQ ID NO. 32), even much more preferably from 1 to 25 of SODl sequence (SEQ ID NO. 33), and most ably from 1 to 6 of SODl sequence (SEQ ID NO. 5).

As used herein, the term "SODl (superoxide ase 1)" means an enzyme that catalyzes the portionation of the reactive oxygen, superoxide ion to oxygen and hydrogen de, and is known to represent an important antioxidant defense in all cells exposed to oxygen. In the present invention, the SODl is used as a peptide linker capable of linking FacVII with the carrier capable of extending the blood half—life.

SODl commonly found in the body is used as the linker, thereby reducing immuno— genicity to the linker. VLKG (valine—leucine—lysine—glycine) within the peptide linker SODl sequence may be replaced by a self—cleavage site sequence IPRI (isoleucine—proline—arginine—isoleucine) that is recognized and cleaved by FacVIIa derivative. Owing to this replacement of the self—cleavage sequence, a linker region un— necessary for the activation can be removed by FacVIIa derivative upon tion.

In the t ion, the self—cleavage site is a site containing a particular sequence, in which a polypeptide possesses the corresponding particular sequence in its own sequence and recognizes and cleaves it.

As used , the term "FacVII derivative" means a modified FacVII that is composed of the amino acid sequence prepared by linking the e linker to the C— terminus of FacVII. The FacVII tive of the present invention means the form prior to activation, and is changed to a FacVIIa derivative, when activated by a particular method. In the present invention, the FacVII derivative and FacVIIa derivative may have an equivalent g, except in a particular step, for example, a preparation process of a conjugate or the like. In the t invention, the FacVII derivative is, but not ularly limited to, a polypeptide (SEQ ID NO. 9) prepared by linking ATKAVC (SEQ ID NO. 5) from 1 to 6 of the SODl sequence to the C— terminus of FacVII derivative, a polypeptide (SEQ ID NO. 13) prepared by linking GGGGSC (SEQ ID NO. 10) to the C—terminus of FacVII derivative, a ptide (SEQ ID NO. 14) prepared by linking the amino acid sequence from 1 to 149 of the SODl ce to the C—terminus of FacVII derivative, a polypeptide (SEQ ID NO. 34) prepared by linking the amino acid sequence from 1 to 90 of the SODl sequence to the C—terminus of FacVII derivative, a ptide (SEQ ID NO. 35) prepared by linking the amino acid ce from 1 to 25 of the SODl sequence to the C—terminus of FacVII derivative, a polypeptide (SEQ ID NO. 20) prepared by linking the amino acid sequence from 1 to 149 of the mutated SODl sequence to the C—terminus of FacVII derivative, a polypeptide (SEQ ID NO. 27) prepared by linking the amino acid sequence from 1 to 90 of the mutated SODl sequence to the C—terminus of FacVII derivative, or a polypeptide (SEQ ID NO. 24) prepared by linking the amino acid sequence from 1 to 25 of the mutated SODl sequence to the C—terminus of FacVII derivative.

As used herein, the term "FacVIIa derivative" means an active form of the FacVII tive, which has an amino acid sequence cal to that of the FacVII derivative, but is activated by cleavage between the amino acids at positions 152 and 153. In the present invention, the FacVIIa tive is, but not particularly limited to, a polypeptide (SEQ ID NO. 9) prepared by linking ATKAVC (SEQ ID NO. 5) from 1 to 6 of the SODl sequence to the C—terminus of FacVIIa derivative, a ptide (SEQ ID NO. 13) prepared by linking GGGGSC (SEQ ID NO. 10) to the C—terminus of FacVIIa derivative, a ptide (SEQ ID NO. 14) prepared by linking the amino acid sequence from 1 to 149 of the SODl sequence to the C—terminus of FacVIIa derivative, a polypeptide (SEQ ID NO. 34) prepared by linking the amino acid sequence from 1 to 90 of the SODl ce to the C—terminus of FacVII derivative a polypeptide (SEQ ID NO. 35) prepared by linking the amino acid sequence from 1 to 25 of the SODl sequence to the C—terminus of FacVII derivative a polypeptide (SEQ ID NO. 20) prepared by linking the amino acid sequence from 1 to 149 of the d SODl sequence to the inus of FacVIIa derivative, a polypeptide (SEQ ID NO. 27) prepared by linking the amino acid sequence from 1 to 90 of the mutated SODl sequence to the C—terminus of FacVII derivative or a polypeptide (SEQ ID NO. 24) prepared by linking the amino acid sequence from 1 to 25 of the mutated SODl sequence to the C—terminus of FacVIIa derivative.

The present inventors investigated the characteristics for the activated FacVII, and they intended to develop a derivative having the improved blood ife without reducing the activity of FacVIIa. Non—activated FacVII is a single—chain FacVII by connecting light and heavy chains, and exposes only the N—terminus of light chain.

However, when it s FacVIIa, the active site of heavy chain is exposed by cleavage between arginine at position 152 and isoleucine at position 153, and the exposed isoleucine at position 153 becomes the N—terminus of heavy chain. The N— terminus of heavy and light chains plays an important role in FacVIIa activation, and thus conjugation at the inus may reduce the activity of FacVII, compared to the native FacVII.

For this reason, the present inventors provide a FacVII derivative prepared by using a fragment of the SODl peptide sequence as a linker, the e fragment containing cysteine that is not exposed urally to the outside and thus is not involved in the disulfide bond. In addition, a self—cleavage site sequence that can be recognized and cleaved by FacVIIa derivative is inserted in the peptide fragment linked as a linker, and thus a linker unnecessary for the activation can be d. The present invention provides a FacVII derivative that has a fragment containing free cysteine of the SODl peptide at the C—terminus. It was found that a dimeric form of the FacVII derivative is produced at the lowest level during incubation, and the FacVII derivative is able to easily form a ate with a carrier capable of extending the blood half—life, thereby making up for the disadvantages of the native FacVII and the derivatives prepared by simple insertion of cysteine into FacVIIa.

Therefore, a conjugate is prepared by linking to the C—terminus of the FacVII or a tive of the present invention a substance capable of remarkably improving the blood half—life, maintaining the blood coagulation function and re— markably increasing drug ance, thereby preparing a product having more excellent effects of improving blood ation and preventing or treating hemophilia than the known products.

In r aspect, the present invention es a polynucleotide encoding the FacVII derivative, an sion vector comprising the polynucleotide, a transformant that is introduced with the expression vector to express the FacVII derivative, and a method for ing the FacVII derivative using the transformant.

The polynucleotide encoding the FacVII derivative provided in the present invention is, but not ularly limited to, a polynucleotide that is prepared by linking the FacVII—encoding region to the peptide linker—encoding region, and preferably a polynucleotide (SEQ ID NO. 8) encoding a polypeptide (SEQ ID NO. 9) that is prepared by linking ATKAVC (SEQ ID NO. 5) from 1 to 6 of the SODl sequence to the C—terminus of FacVII derivative, a polynucleotide (SEQ ID NO. 12) encoding a polypeptide (SEQ ID NO. 13) that is prepared by linking GGGGSC (SEQ ID NO. 10) to the C—terminus of FacVII derivative, a polynucleotide (SEQ ID NO. 15) encoding a polypeptide (SEQ ID NO. 14) that is ed by linking 1 to 149 amino acids of the SODl sequence to the C—terminus of FacVII derivative, a polynucleotide (SEQ ID NO. 21) encoding a ptide (SEQ ID NO. 20) that is prepared by linking 1 to 149 amino acids of the mutated SODl sequence to the C—terminus of FacVII derivative, a polynucleotide (SEQ ID NO. 28) encoding a polypeptide (SEQ ID NO. 27) that is prepared by linking 1 to 90 amino acids of the mutated SODl sequence to the C— terminus of FacVII derivative, or a polynucleotide (SEQ ID NO. 25) encoding a polypeptide (SEQ ID NO. 24) that is prepared by linking 1 to 25 amino acids of the d SODl sequence to the C—terminus of FacVII derivative.

The expression vector comprising the polynucleotide encoding the FacVII derivative provided in the present invention is, but not particularly d to, a vector capable of replicating and/or expressing the polynucleotide in eukaryotic or prokaryotic cells, including mammalian cells (e.g., human, monkey, rabbit, rat, hamster, mouse cells, etc.), plant cells, yeast cells, insect cells or bacterial cells (e.g., E. coli, etc.), and preferably a vector that is operably linked to a proper promoter to express the polynu— cleotide in a host cell and contains at least one selection marker. More preferably, it may be an expression vector ed by introduction of the polynucleotide into a phage, a plasmid, a cosmid, a mini—chromosome, a viral vector, or a retroviral vector.

Most preferably, it may be an expression vector pXOGC—FVII—ATKAVC including the FacVII derivative—encoding polynucleotide that is prepared by linking the polynu— de encoding ATKAVC (SEQ ID NO. 5) from 1 to 6 of the SODl sequence to the 3'—terminus of FacVII gene, an expression vector pXOGC—FVII—GGGGSC including the FacVII derivative—encoding polynucleotide that is prepared by linking the polynu— cleotide encoding GGGGSC (SEQ ID NO. 10) to the 3'—terminus of FacVII gene, an expression vector pXOGC—FVII—SODl 1— 149 including the FacVII tive—encoding polynucleotide that is ed by linking the polynucleotide encoding the amino acid ce (SEQ ID NO. 14) from 1 to 149 of the SODl sequence to the minus of FacVII gene, an expression vector pXOGC—FVII—SODl IPRI including the FacVII derivative—encoding polynucleotide (SEQ ID NO. 21) that is ed by linking the polynucleotide encoding 1 to 149 amino acids of the mutated SODl sequence to the 3'—terminus of FacVII gene, an sion vector pXOGC—FVII—SODl 1—90 IPRI including the FacVII tive—encoding polynucleotide (SEQ ID NO. 28) that is prepared by linking the polynucleotide encoding 1 to 90 amino acids of the mutated SODl sequence to the 3'—terminus of FacVII gene, or an expression vector pXOGC—FVII—SODl 1—25 IPRI including the FacVII derivative—encoding polynu— cleotide (SEQ ID NO. 25) that is ed by g the polynucleotide encoding l to amino acids of the mutated SODl sequence to the 3'—terminus of FacVII gene.

The transformant introduced with the expression vector provided in the present invention is, but not particularly limited to, bacterial cells such as E. coli, Streptomyces, and Salmonella typhimurium; yeast cells such as Pichia pastoris; insect cells such as Drosophila and Spodoptera Sf9 cells; animal cells such as CHO, COS, NSO, 293, and Bowes melanoma cells; or plant cells, which are transformed by in— troduction of the expression vector. It may be preferably a ormant ed by in— troduction of the expression vector into 293F or CHO cell line, and most preferably HMF709 prepared by introduction of the sion vector pXOGC—FVII—ATKAVC into CHO cell line.

The method for preparing the FacVII derivative provided in the present invention comprises the steps of (i) culturing the transformant so as to obtain a culture solution; and (ii) recovering the FacVII tive from the culture solution.

The method further comprises the step of activating the red FacVII derivative, thereby ing the FacVIIa derivative from the prepared FacVII derivative. The ac— tivation method is the same as described above.

The present inventors prepared an expression vector pXOGC—FVII—ATKAVC including the FacVII derivative—encoding polynucleotide that is prepared by linking the polynucleotide encoding ATKAVC (SEQ ID NO. 5) from 1 to 6 of the SODl sequence to the 3'—terminus of FacVII gene (Example 2—l), and the expression vector was introduced into 293F cell line (Example 3—1) or CHO cell line (Example 3—2) so as to obtain a transformant. Subsequently, the FacVII derivative was expressed from the transformant, and the expressed FacVII derivative was purified (Example 4, .

The sed FacVII tive was activated to prepare the FacVIIa derivative, followed by comparison of its activity with that of native FacVIIa (Example 6 and . As a result, the FacVIIa derivative prepared from the FacVII derivative of the t invention was found to show the ty equivalent to that of native FacVIIa.

Thus, a clone showing the highest expression level of FacVII derivative was selected from the transformants prepared by introduction of the sion vector pXOGC—FVII—ATKAVC into CHO cells, and was designated as "HMF709", and deposited at the Korean Collection for Type Culture, Korea Research Institute of Bioscience and Biotechnology (1 ll Gwahangno, g—gu, Daejeon, Korea) under accession number " KCTC l2022BP".

In still another aspect, the present ion provides a conjugate of FacVII or its active form FacVIIa which is prepared by g a polymer capable of extending the blood half—life to the peptide linker of the FacVII derivative.

The polymer of the present invention may be a polymer such as polyethylene glycol capable of extending the blood ife, and selected from protein carriers such as im— munoglobulin fragment, transferrin, antibody, and albumin.

The present invention provides a conjugate that is prepared by linking the FacVII derivative with the protein carrier using a non—peptidyl polymer as a linker in vitro without using a genetic recombination .

The non—peptidyl polymer of the present invention refers to a non—peptidyl polymer designed to resist to the ation by various exzymes or immune molecules in the blood or serum. The non—peptidyl polymer which is not d by the followed, may be selected from the group consisting of hylene glycol, polypropylene glycol, ne glycol—propylene glycol copolymers, polyoxyethylated polyols, polyvinyl alcohols, polysaccharides, dextrans, polyvinyl ethyl ethers, biodegradable polymers, lipid polymers, chitins, hyaluronic acids, and a combination thereof. And the non— peptidyl polymer can be linked to each other via any kind of covalent bond except peptide bond. Further, the derivatives thereof known in the art and tives easily prepared by any known technique in the art are also within the scope of the present invention. In the present ion, the non—peptidyl polymer may be linked to the peptide linker of the FacVII derivative or the FacVIIa derivative. The non—peptidyl polymer may be linked to the various binding sites of the peptide linker. Preferably, the non—peptidyl polymer may be linked to the C—terminus of peptide linker present at the FacVII tive or the a derivative.

The non—peptidyl polymer can se reactive group which may include, but is not limited to, a aldehyde, a propionaldehyde, a butyraldehyde, a maleimide or a suc— cinimide(succinimidyl propionate, succinimidyl ymethyl, hydroxy succinimidyl, or succinimidyl carbonate). In addition, the non—peptidyl polymer may have a single reactive group or double ve groups. If the non—peptidyl polymer comprises two or more reactive groups, it can be linked to the liker of FacVII derivative at one reactive group, and also linked to another carrier such as the antibodies, the immunoglobulin fragments, albumin, or transferrin at other reactive group. For example, when the non— peptidyl polymer has a reactive aldehyde group at one end and a maleimide, ortho pyridyl disulfide or thiol reactive group at the other end, non—specific reaction can be zed, and it is effective in the selective binding of the FacVII derivative or the FacVIIa derivative and carrier at both ends of the non—peptidyl polymer. A final product produced by reductive alkylation due to the aldehyde bond may be more stable than an amide bond. In addition, the aldehyde reactive group selectively reacts with the amino terminus of the carrier at a low pH, and may form a covalent bond with a lysine residue at a high pH, for example, pH 9.0.

In still another aspect, the present invention es a complex of FacVII or its active form FacVIIa which is prepared by g the derivative of FacVII or its active form FacVIIa with an immunoglobulin Fc region via the non—peptidyl polymer.

The FacVII complex that is linked to a carrier such as antibody, immunoglobulin fragment, albumin, and transferrin, in ular, the immunoglobulin PC via the non— peptidyl polymer may be prepared by the steps of (l) covalently linking a ptidyl polymer having an aldehyde or succinimide derivative reactive group at its one end to the amine group of immunoglobulin PC; (2) recovering a conjugate that comprises the immunoglobulin Fc region covalently linked with the non—peptidyl r at the amine group, from the reaction mixture of step (1); (3) covalently g the FacVII derivative to the other end of the non—peptidyl polymer having a maleimide, ortho pyridyl disulfide, or thiol ve group in the recovered conjugate so as to produce a FacVII complex having the immunoglobulin Fc region and the FacVII tive at each end of the non—peptidyl polymer; and (4) activating the FacVII conjugate ed in step (3) so as to produce a FacVIIa complex having FacVIIa and the im— munoglobulin Fc region linked via the non—peptidyl polymer.

Further, the FacVII complex may be prepared by the steps of (l) covalently g a non—peptidyl polymer having a maleimide, ortho pyridyl disulfide, or thiol reactive group at its one end to the C—terminal thiol group of FacVII derivative; (2) recovering a conjugate that includes the FacVII tive covalently linked with the non—peptidyl polymer, from the reaction e of step (1); (3) covalently g the im— munoglobulin Fc region to the other end of the non—peptidyl polymer having an aldehyde or succinimide derivative reactive group in the recovered conjugate so as to produce a FacVII complex having the immunoglobulin Fc region and the FacVII derivative at each end of the non—peptidyl polymer; and (4) activating the FacVII conjugate produced in step (3) so as to produce a FacVIIa complex having FacVIIa and the immunoglobulin Fc region linked via the non—peptidyl polymer.

Further, the FacVIIa complex may be prepared by the steps of (l) covalently linking a non—peptidyl polymer having a maleimide, ortho pyridyl disulfide, or thiol reactive group at its one end to the C—terminal thiol group of FacVIIa derivative; (2) recovering a conjugate that includes the FacVII derivative covalently linked with the non—peptidyl polymer, from the reaction e of step (1); and (3) ntly linking the im— munoglobulin Fc region to the other end of the non—peptidyl polymer having an aldehyde or succinimide tive reactive group in the recovered conjugate so as to produce a FacVIIa complex having the immunoglobulin Fc region and the FacVIIa derivative at each end of the non—peptidyl polymer.

On the other hand, the non—peptidyl polymer may e two or three reactive ends, and the two or three reactive ends may be the same as or different from each other. For example, it may have a maleimide group at one end and an aldehyde group, a propi— onaldehyde group, or a butyraldehyde group at the other end. When poly(ethylene ) having hydroxy reactive groups at both ends thereof is used as the non—peptidyl r, the hydroxy group may be activated to various reactive groups by known chemical reactions, or a poly(ethylene glycol) having a commercially available modified reactive group may be used so as to prepare the FacVII conjugate and complex of the present invention.

Therefore, the non—peptidyl polymer included in the FacVII conjugate and complex of the present invention may be preferably a non—peptidyl r having a methyl group at one end and a maleimide, ortho l disulfide or thiol reactive group at the other end, and more preferably a non—peptidyl polymer having a maleimide, ortho pyridyl disulfide or thiol reactive group at one end and an aldehyde or succinimide derivative reactive group at the other end, and most preferably a non—peptidyl polymer having a maleimide ve group and an aldehyde reactive group at both ends, re— spectively.

The FacVII derivative that is used in the preparation of the conjugate or complex using the FacVII derivative of the present ion may be an inactive form or an activated FacVIIa derivative. However, the use of FacVII is red in order to t degradation due to the ted FacVIIa during the conjugate preparation using the FacVIIa derivative.

As the carrier, the Fc regions may be obtained from native forms isolated from humans and other animals ing cows, goats, pigs, mice, rabbits, hamsters, rats and guinea pigs. In addition, the immunoglobulin Fc region may be an Fc region that is d from IgG, IgA, IgD, IgE and IgM, or that is made by combinations thereof or hybrids thereof. Preferably, it is derived from IgG or IgM, which are among the most abundant proteins in human blood, and most preferably from IgG, which is known to enhance the half—lives of ligand—binding proteins. globulin Fc may be obtained from a native immunoglobulin by isolating whole immunoglobulins from human or animal organisms and treating them with a specific proteolytic enzyme, and also may be obtained from transformed cells by recombination technique. Preferably, it is a re— combinant human globulin Fc region from E.coli. On the other hand, IgG is divided into IgGl, IgG2, IgG3 and IgG4 subclasses, and the present invention includes combinations and s thereof. Preferred are the IgG2 and IgG4 subclasses, and most preferred is the Fc region of IgG4 rarely having effector functions such as CDC (complement dependent cytotoxicity).

That is, as the drug r of the present invention, the most preferable im— munoglobulin Fc region is a human IgG4—derived non—glycosylated Fc region. The human—derived Fc region is more preferable than a non—human derived Fc region, which may act as an antigen in the human body and cause undesirable immune responses such as the production of a new antibody against the antigen.

The peptide linker which is used in the fusion n obtained by a conventional inframe fusion method has drawbacks in that it is easily in-vivo d by a pro— teolytic enzyme, and thus a ient effect of increasing the serum half—life of the active drug by a carrier cannot be obtained as expected. However, in the present invention, the polymer having resistance to the proteolytic enzyme can be used to maintain the serum half—life of the peptide being similar to that of the r.

Therefore, any non—peptidyl polymer can be used without limitation, as long as it is a polymer having the aforementioned on, that is, a polymer having ance to the in-vivo lytic enzyme. The non—peptidyl polymer has a molecular weight in the range of l to 100 kDa, and preferably of l to 40 kDa. The non—peptidyl polymer of the present invention, linked to the globulin Fc region, may be one polymer or a combination of different types of polymers.

In one embodiment of the present invention, in vitro activity of the FacVII conjugate was determined. The present invention is ed to minimize a reduction in the activity by site—specific conjugation of FacVII and the non—peptidyl polymer. Thus, the activities of FacVII—ATKAVC and FacVII—ATKAVC—40kDa PEG were determined using the native FacVII and FacVII—40 kDa PEG as a control group (Example7). As a result, it was found that in vitro ty of the N—terminal PEGylated FacVII—40 kDa PEG was imately 11%, compared to that of FacVII, and in vitro activity of the C—terminal PEGylated FacVII—ATKAVC—40 kDa PEG was approximately 29%, compared to that of FacVII—ATKAVC. That is, the C—terminal PEGylated FacVII—ATKAVC—40 kDa PEG maintains an activity approximately 2.5 times higher than EC50 of the N—terminal PEGylated FacVII—40 kDa PEG, indicating that the FacVII activity can be maintained at a higher level by site—specific conjugation using ATKAVC (Table 2).

In another embodiment, in vitro activity of the complex prepared by linking the non— peptidyl polymer and the immunoglobulin Fc region to the FacVII ate was de— termined le 8). As a result, it was found that in vitro activity of FacVIIa—ATKAVC—PEG—Fc was approximately 45%, compared to that of FacVIIa—ATKAVC (Table 3), indicating that the complex linked with the non—peptidyl polymer and the immunoglobulin Fc region has the carrier capable of improving the blood half—life while maintaining the FacVII activity, thereby being widely used in the development of more ive prophylactic or therapeutic agent for ilia.

In still another aspect, the t invention provides a method for preparing a FacVIIa conjugate comprising the step of activating the FacVII conjugate, and a FacVIIa conjugate ed by the method. In detail, the method for ing the FacVIIa conjugate may comprise the steps of (i) covalently g a non—peptidyl polymer capable of extending the blood half—life to the C—terminal thiol group of the FacVII derivative; (ii) recovering the FacVII conjugate that is composed of the non— peptidyl polymer linked to the FacVII derivative; and (iii) activating the recovered FacVII conjugate so as to produce a FacVIIa conjugate having the non—peptidyl r linked to the FacVIIa region.

In addition, the method comprises the steps of (i) covalently g the non—peptidyl r capable of ing the blood half—life to the C—terminal thiol group of the FacVIIa derivative; and (ii) recovering the FacVIIa conjugate that is composed of the non—peptidyl polymer linked to the FacVIIa derivative so as to produce a FacVIIa conjugate having the ptidyl polymer linked to the FacVIIa region.

The non—peptidyl polymer capable of extending the blood half—life used in the method is the same as bed above, and the method for activating FacVII or FacVII conjugate is, but not particularly limited to, an on—column activation (auto—activation) of activating the FacVII or FacVII conjugate by ing it to an anion exchange column or an in—solution activation of activating the FacVII or FacVII conjugate by reacting it in a solution phase. In particular, the on—column tion is also called solid—phase activation, and is performed by activation" after attachment of the FacVII or FacVII conjugate to the anion exchange column without additional components. In contrast, the in—solution activation is a method of inducing FacVII ac— tivation, considering various factors needed in FacVII activation, for example, calcium ion concentration, pH, temperature, and FacVII concentration.

The present ors demonstrated that the blood half—life of the conjugate prepared by linking the immunoglobulin fragment to the native FacVII via the non—peptidiyl linker was increased to approximately 200 times, compared to the native FacVII having no immunoglobulin fragment (Korean Patent Application No. 2010—0062860). It is well known that the increased half—life is not attributed to FacVII, but attributed to the non—peptidiyl linker and the immunoglobulin fragment. Therefore, the conjugate prepared by using the prepared FacVII derivative is also expected to have the increased half-life.

In still another aspect, the present invention provides a ceutical composition for the tion or treatment of ilia or a pharmaceutical composition for blood coagulation, comprising the derivative of FacVII or its active form FacVIIa, the conjugate of FacVII or its active form FacVIIa, the complex of FacVII or its active form FacVIIa, as an active ingredient.

In addition, the present invention provides a method for preventing or treating hemophilia or for promoting blood coagulation, comprising administering to a subject a therapeutically effective amount of the pharmaceutical composition.

As used herein, the term "prevention" means all of the s by which the oc— currence of hemophilia is restrained or retarded by rent administration of the composition of the t invention, and the term "treatment" means all of the actions by which the symptoms of diabetes have taken a turn for the better or been modified favorably by concurrent administration of the composition of the present invention.

In the present invention, the method for promoting blood coagulation is to promote the action of blood coagulation factor by preparation of tives, conjugates, or complexes having remarkably increased blood half—life from blood coagulation factor FacVII or its active form FacVIIa having a short half—life.

Further, the pharmaceutical composition of the present invention may include a phar— maceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological ty and properties of the ad— ministered compound. For oral administration, the pharmaceutically acceptable carrier may include a , a ant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a ding agent, a coloring agent, and a flavor. For in— jectable preparations, the pharmaceutically acceptable carrier may include a buffering agent, a preserving agent, an analgesic, a solubilizer, an isotonic agent, and a stabilizer.

For preparations for topical administration, the pharmaceutically acceptable carrier may e a base, an excipient, a ant, and a preserving agent. . The — ceutical composition of the present invention may be formulated into a variety of dosage forms in ation with the aforementioned pharmaceutically acceptable carriers. For example, for oral administration, the pharmaceutical composition may be formulated into tablets, troches, capsules, elixirs, suspensions, syrups or wafers. For in— jectable preparations, the pharmaceutical composition may be formulated into a unit dosage form, such as a multi—dose container or an ampule as a —dose dosage form. The ceutical composition may be also formulated into solutions, sus— pensions, tablets, pills, capsules and long—acting preparations.

On the other hand, examples of the carrier, the excipient, and the diluent suitable for the ceutical formulations include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia , alginate, gelatin, m phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oils. In addition, the pharmaceutical ations may further include fillers, anti—coagulating agents, lubricants, humectants, flavors, and an— tiseptics.

In still another aspect, the present invention provides a method for treating hemophilia, comprising stering to a subject having hemophilia a therapeutically effective amount of the ceutical ition for the prevention or treatment of ilia including the tive, conjugate, or complex as an active ingredient. In this regard, the pharmaceutical composition may be stered alone or in com— binations with other therapeutic agents simultaneously or sequentially.

As used herein, the term administration means introduction of a predetermined amount of a substance into a patient by a certain suitable method. The composition may be administered via any of the common routes, as long as it is able to reach a desired tissue. A variety of modes of administration are contemplated, including in— traperitoneal, intravenous, intramuscular, subcutaneous, ermal, oral, l, in— tranasal, intrapulmonary and intrarectal, but the present invention is not limited to these exemplified modes of stration. However, since peptides are digested upon oral administration, active ients of a composition for oral administration should be coated or formulated for tion against degradation in the stomach. Preferably, the multimer may be administered in an injectable form. In addition, the pharma— ceutical composition may be administered using a certain apparatus capable of transporting the active ingredients into a target cell.

Further, the pharmaceutical composition of the present invention can be determined by several related factors ing the types of diseases to be treated, administration routes, the patient's age, gender, weight and severity of the illness, as well as by the types of the drug used as an active component.

The pharmaceutical composition of the present invention shows excellent in—vivo duration of efficacy and titer, thereby remarkably reducing the number and frequency of administration thereof for preventing or treating ilia or for promoting blood coagulation.

Mode for the Invention Hereinafter, the t invention will be described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be d by these Examples.

Example 1: Preparation of FacV]I gene-containing expression vector First, human Factor VII gene containing a signal sequence was obtained using a Polymerase Chain Reaction(PCR) technique. For amplification of Factor VII (FacVII) gene, a human fetal liver cDNA library (TAKARA BIO USA) was used as a template, and forward and reverse primers of the following SEQ ID NOs. 1 and 2 were used to perform PCR (95°C 1 minute denaturation; 30 cycles (95°C 30 seconds, 60°C 30 seconds and 68°C 90 seconds); 68°C 5 minutes). At this time, for easy cloning, the recognition site for the restriction enzyme BamHI was inserted into the primer of SEQ ID NO. 1 and the recognition site for the restriction enzyme XhoI was ed into the primer of SEQ ID NO. 2. Subsequently, a nucleotide sequence (SEQ ID NOs. 3 and 4) of the PCR product of approximately 1.3 kb obtained by PCR was ed.

VIIBHISS F: 5'—cccggatccatggtctcccaggccctcaggctcc—3' (SEQ ID NO. 1) VIIXhoIAS R: 5'—gggctcgagctagggaaatggggctcgcagg—3' (SEQ ID NO. 2) In order to express the obtained PCR product under the control of CMV promoter, it was cloned into an animal cell sion vector pXOGC. The pXOGC vector is an ex— pression vector ing one or more CCGCCC repeat sequence—removed DHFR promoter and a DHFR—encoding nucleotide sequence operably linked thereto (Korean Patent No. 880509). Specifically, the PCR product was digested with the restriction enzymes, BamHI and XhoI at 37°C for 2 hours, and applied to a PCR purification kit n, USA) so as to obtain the cleaved DNA fragment. The DNA fragment was mixed with the pXOGC vector treated with the restriction enzymes BamHI and XhoI, and cloned using T4 DNA ligase, thereby preparing an expression vector ing FacVII gene.

Example 2: Preparation of expression vector for sion of various re- combinant FacV]I derivatives The FacVII gene—containing expression vector (pXOGC—FVII) prepared in Example 1 was used to obtain a polynucleotide encoding a FacVII derivative which has a partial sequence of SODl (Superoxide Dismutase l, SEQ ID NO. 30) at the C—terminus of FacVII, and an expression vector capable of sing the tive was prepared.

Example 2-1: Preparation of recombinant FacV]I derivative-expressing vector, pXOGC-FVlI-ATKAVC A recombinant FacVII tive—expressing vector pXOGC—FVII—ATKAVC, which contains a polynucleotide further having a polynucleotide encoding the sequence from 1 to 6 of the SOD1 ce at the 3'—terminus of FacVII gene included in the ex— pression vector pXOGC—FVII prepared in e 1, was prepared. In detail, the ex— pression vector pXOGC—FVII was used as a te, and forward and reverse primers of the following SEQ ID NOs. 6 and 7 were used to perform PCR (95°C 1 minute de— tion; 30 cycles (95°C 60 seconds, 60°C 60 seconds and 68°C 90 seconds); 68°C minutes). At this time, for easy cloning, the recognition site for the restriction enzyme EcoRI was inserted into the primer of SEQ ID NO. 6 and the recognition site for the ction enzyme XhoI was inserted into the primer of SEQ ID NO. 7. Sub— sequently, a nucleotide sequence (SEQ ID NO. 8) of the PCR product of ap— proximately 1.4 kb obtained by PCR was examined.

FVIIEcoRISS F (SEQ ID NO. 6): '—ccggaattcatggccaacgcgttcctggaggagctgcggccgggc—3' FVII#1XhoIAS R (SEQ ID NO. 7): '—ccgctcgagtcagcacacggccttcgtcgcgggaaatggggctcgcaggaggactcctgggc—3' In order to express the ed PCR product under the control of CMV er, it was cloned into an animal cell expression vector pXOGC. Specifically, the PCR product was digested with the restriction enzymes, EcoRI and XhoI at 37°C for 2 hours, and applied to a PCR purification kit so as to obtain the cleaved DNA nt.

The DNA fragment was mixed with the pXOGC vector d with the restriction enzymes EcoRI and XhoI, and cloned using T4 DNA ligase, thereby preparing an ex— pression vector (pXOGC—FVII—ATKAVC) having a FacVII derivative—encoding polynucleotide, which contains a polynucleotide encoding the sequence ATKAVC (SEQ ID NO. 5) from 1 to 6 of the SOD1 sequence linked at the 3'—terminus of FacVII gene.

Example 2-2: Preparation of recombinant FacV]I derivative-expressing vector, pXOGC-FVll-GGGGSC A recombinant FacVII tive—expressing vector pXOGC—FVII—GGGGSC, which contains a polynucleotide further having a polynucleotide encoding 6 amino acids (GGGGSC, SEQ ID NO. 10) at the 3'—terminus of FacVII gene included in the ex— pression vector pXOGC—FVII prepared in Example 1, was prepared. To achieve this, PCR was med in the same manner as in Example 2—1, except using forward and reverse primers of SEQ ID NOs. 6 and 11, and a nucleotide sequence (SEQ ID NO. 12) of the PCR product of approximately 1.4 kb was examined. Subsequently, an ex— pression vector (pXOGC—FVII—GGGGSC), which contains the FacVII derivative— encoding polynucleotide having a polynucleotide encoding GGGGSC (SEQ ID NO. ) at the 3'—terminus of FacVII gene, was prepared in the same manner as in Example 2—1, except using the PCR product.

FVII#2XhoIAS R (SEQ ID NO. 11): '—ccgctcgagtcagcaggagccgccgccgccgggaaatggggctcgcaggaggactcctgggc—3' Example 2-3: Preparation of recombinant FacV]I derivative-expressing vector, pXOGC-FVll-SODI 1-149 A inant FacVII derivative—expressing vector pXOGC—FVII—SODl 1—149, which contains a polynucleotide (SEQ ID NO. 15) further having a polynucleotide encoding 1 to 149 amino acids of the SODl (Superoxide ase 1) sequence at the 3'—terminus of FacVII gene included in the expression vector pXOGC—FVII prepared in Example 1, was prepared.

In detail, the FacVII DNA ce (SEQ ID NO. 3) was used as a template, and a FacVII forward primer (SEQ ID NO. 16) and a FacVII reverse primer (SEQ ID NO. 17) were used to perform PCR (95°C 1 minute denaturation; 30 cycles (95°C 60 seconds, 60°C 60 seconds and 68°C 90 seconds); 68°C 5 minutes). At this time, for easy cloning, the recognition site for the restriction enzyme EcoRI was inserted into the primer of SEQ ID NO. 16 and a partial sequence of 5 '—terminus of SODl was contained in the primer of SEQ ID NO. 17. As a result, a first PCR fragment was obtained.

FVIIEcoRISS F: 5'—ccggaattcatggtctcccaggccctcaggctcc—3' (SEQ ID NO. 16) FVIISODIanS R: 5'—cggccttcgtcgcgggaaatggggctcgcaggag—3' (SEQ ID NO. 17) Next, SODl cDNA (RC200725, OriGene, USA) was used as a template, and an SODl forward primer (SEQ ID NO. 18) and an SODl reverse primer (SEQ ID NO. 19) were used to perform PCR (95°C 1 minute ration; 30 cycles (95°C 60 seconds, 60°C 60 seconds and 68°C 40 seconds); 68°C 5 s). At this time, for easy cloning, a partial sequence of 3'—terminus of FacVII was ned in the primer of SEQ ID NO. 18 and the recognition site for the ction enzyme XhoI was inserted into the primer of SEQ ID NO. 19. As a result, a second PCR fragment was obtained. [139 [140 FVIISODInfSS F: 5'—gagccccatttcccgcgacgaaggccgtgtgcgt—3' (SEQ ID NO. 18) [141 SODXhoIAS R: 5'—ccgctcgagtcaaattacaccacaagccaaacga—3' (SEQ ID NO. 19) [142 [1431_11_11_11_11_1 The first and second PCR fragments thus obtained were used as a template and a FacVII forward primer (SEQ ID NO. 16) and a SOD1 reverse primer (SEQ ID NO. 19) were used to perform second PCR. Finally, a third PCR fragment was obtained (95°C 1 minute denaturation; 30 cycles (95°C 60 seconds, 60°C 60 seconds and 68°C 120 seconds); 68°C 5 minutes).

In order to express the obtained third PCR product under the control of CMV promoter, it was cloned into an animal cell expression vector pXOGC. Specifically, the third PCR product was digested with the ction enzymes, EcoRI and XhoI at 37°C for 2 hours, and applied to a PCR purification kit so as to obtain the cleaved DNA fragment. The DNA nt was mixed with the pXOGC vector treated with the re— striction s EcoRI and XhoI, and cloned using T4 DNA ligase, thereby preparing an sion vector (pXOGC—FVII—SODl 1—149) having a FacVII derivative—encoding polynucleotide, which contains a polynucleotide ng the amino acids from 1 to 149 of the SOD1 sequence linked at the 3'—terminus of FacVII gene.

Example 2-4: ation of recombinant FacV]I derivative-expressing vector, pXOGC-FVll-SODI IPRI It was intended to insert a self—cleavage site of FacVII into the SOD1 gene included in the expression vector pXOGC—FVII—SODl 1— 149 ed in Example 2—3. To achieve this, prepared was a recombinant FacVII derivative—expressing vector pXOGC—FVII—SODl IPRI which contains a polynucleotide (SEQ ID NO. 21) encoding an amino acid ce (SEQ ID NO. 20) prepared by linking 1—149 amino acids of SOD1 mutated by replacement of 7 to 10 amino acids (VLKG) of SOD1 in 451—454 amino acids of FacVII—SODl 1—149 (SEQ ID NO. 14) with IPRI, to the C—terminus of FacVII.

In detail, the third PCR fragment obtained in Example 2—3 was used as a template and forward and reverse primers (SEQ ID NOs. 22 and 23) were used to perform PCR.

Finally, a fourth PCR fragment was obtained (95°C 30 seconds denaturation; 18 cycles (95°C 30 seconds, 55°C 60 seconds and 68°C 9 minutes); 68°C 9 minutes).

A nucleotide sequence (SEQ ID NO. 21) of the fourth PCR t of approximately 9 kb was examined.

VIISODlmutSS F: (SEQ ID NO. 22) '—cccgcgacgaaggccgtgtgcattccgaggatcgacggcccagtgcagggcatc—3' FVIISODlmutAS R: (SEQ ID NO. 23) '—gatgccctgcactgggccgtcgatcctcggaatgcacacggccttcgtcgcggg—3' Subsequently, the fourth PCR product was digested with the restriction enzyme DpnI at 37°C for 1 hour to cleave a non—mutated sequence, and cloned by transformation into E. coli so as to prepare an expression vector (pXOGC—FVII—SODl IPRI) which contains a polynucleotide encoding a FacVII derivative having 1—149 amino acids of the mutated SOD1 at the C—terminus of FacVII.

Example 2-5: Preparation of recombinant FacV]I derivative-expressing vector, pXOGC-FVll-SODI 1-25 IPRI Prepared was a inant FacVII derivative—expressing vector pXOGC—FVII—SODl 1—25 IPRI which contains a polynucleotide (SEQ ID NO. 25) encoding an amino acid sequence (SEQ ID NO. 24) ed by linking 1—25 amino acids of SOD1 mutated by replacement of 7 to 10 amino acids (VLKG) of SOD1 with IPRI to the C—terminus of FacVII.

In detail, the expression vector FVII—SODl IPRI prepared in e 2—4 was used as a template, and forward and reverse primers (SEQ ID NOs. 16 and 26) were used to perform PCR (95°C 1 minute denaturation; 30 cycles (95°C 60 seconds, 60°C 60 seconds and 68°C 90 seconds); 68°C 5 minutes). Finally, a fifth PCR fragment was ed.

SOD1—25XhoIAS R: 5'—ccgctcgagtcaactttccttctgctcgaaattg—3'(SEQ ID NO. 26) Subsequently, the fifth PCR product was digested with the restriction enzymes EcoRI and XhoI at 37°C for 2 hour, and applied to a PCR purification kit so as to obtain the cleaved DNA fragment. The DNA fragment was mixed with the pXOGC vector treated with the ction enzymes EcoRI and XhoI, and cloned using T4 DNA ligase, thereby preparing an sion vector (pXOGC—FVII—SODl 1—25 IPRI) containing a polynucleotide encoding a FacVII tive having 1 to 25 amino acids of the mutated SOD1 sequence linked at the C—terminus of FacVII gene.

Example 2-6: ation of recombinant FacV]I derivative-expressing vector, pXOGC-FVll-SODI 1-90 IPRI Prepared was a recombinant FacVII derivative expression vector pXOGC—FVII—SODl 1—90 IPRI which contains a cleotide (SEQ ID NO. 28) encoding an amino acid sequence (SEQ ID NO. 27) prepared by linking 1—90 amino acids of SOD1 mutated by replacement of 7 to 10 amino acids (VLKG) of SOD1 with IPRI to the inus of FacVII.

In detail, the expression vector pXOGC—FVII—SODl IPRI prepared in Example 2—4 was used as a template, and forward and reverse primers (SEQ ID NOs. 16 and 29) were used to perform PCR (95°C 1 minute denaturation; 30 cycles (95°C 60 seconds, 60°C 60 seconds and 68°C 100 seconds); 68°C 5 s). Finally, a fifth PCR nt was obtained. [170 [1711—11—11_11_1 SOD1—90XhoIAS R: 5'—ccgctcgagtcagtcagcagtcacattgcccaag—3'(SEQ ID NO. 29) [172 [173 uently, the fifth PCR product was ed with the restriction enzymes EcoRI and XhoI at 37°C for 2 hour, and applied to a PCR purification kit so as to obtain the cleaved DNA fragment. The DNA fragment was mixed with the pXOGC vector treated with the restriction enzymes EcoRI and XhoI, and cloned using T4 DNA ligase, y preparing an expression vector (pXOGC—FVII—SODl 1—90 IPRI) containing a polynucleotide encoding a FacVII derivative having 1 to 90 amino acids of the mutated SOD1 sequence linked at the inus of FacVII gene.

Example 3: Expression of FacV]I derivatives A variety of FacVII derivatives were expressed using each expression vector prepared in Example 2.

Example 3-1: Expression of FacV]I derivatives in 293F cell line An expression vector having g at the C—terminus of FacVII ol), and ex— pression vectors (pXOGC—FVII—SODl 1—149, pXOGC—FVII—SODl 1—25 IPRI, pXOGC-FVII-SODl 1-90 IPRI, pXOGC—FVII—ATKAVC or pXOGC—FVII—GGGGSC), each expression vector having a polynucleotide prepared by fusion of SOD1 1—149 sequence, mutated SOD1 1—25 sequence, mutated SOD1 1—90 sequence, SOD1 1—6 sequence, or GGGGSC sequence at the C—terminus of FacVII, were introduced into FreestyleTM 293 F cell line (Invitrogen, cat. no. R79007) to prepare each transformant.

Different FacVII derivatives were expressed from each transformant.

To achieve this, the 293F cell line was ltured every other day while it cultured at 37°C and 8% C02 with shaking at a speed of 120 rpm or higher. When the number of cultured cells reached 10 x 105 n11 and the viability was 85% or more, each ex— pression vector prepared in Example 2 was introduced thereto so as to obtain trans— formants. In detail, 500 [11 of FreestyleTM max reagent, 500 [1g of each expression vector, and 10 ml of oTM SFM (Invitrogen, cat. no. 12309—050) were added to 500 ml of FreestyleTM 293 expression medium (Invitrogen, cat. no. 12338—018) having X 105 ml of cells, and mixed and left at room ature for 10 s for introduction of each expression vector into 293F cell line. Thereafter, 50 ug of vitamin K essential for FacVII activation was added thereto, and cultured at 37°C and 8% C02 with shaking at a speed of 120 rpm or higher for 3 days. After completion of the culture, the cells were centrifuged at 3000 rpm for 5 minutes to obtain the supernatants.

Each FacVII derivative included in the atant was collected and purified. Sub— sequently, Western blotting was performed using anti—FacVII antibody to detect each expressed FacVII derivative (FIGs. 1a to 1c). is a photograph showing the result of Western blot is of FacVII—ATKAVC expressed in 293F cell line, in which M is a size marker (Prestained protein ladder, fermentas), Lane 1 is the result of Western blot analysis of FacVII—ATKAVC under reducing conditions, and Lane 2 is the result of Western blot analysis of FacVII—ATKAVC under non—reducing conditions. As shown in , ap— proximately 20 to 30% of a dimeric form was detected under non—reducing conditions, and no dimeric form was detected under reducing conditions.

Further, is a photograph showing the result of n blot analysis of a control group and FacVII—GGGGSC expressed in 293F cell line, and is a photograph showing the result of Western blot analysis showing the molecular weight difference of FacVII—ATKAVC and FacVII—SODl 1—149 expressed in 293F cell line.

As shown in FIGs. 1b and 1c, it was found that a variety of FacVII derivatives can be normally produced in 293F cell line.

Example 3-2: Expression of Fachl derivative (pXOGC-FVll-ATKAVC) in CHO cell line The expression vector pXOGC—FVII—ATKAVC prepared in Example 2—1 was in— troduced into DG44/CHO cell line hfr—) that is ent in DHFR to show in— complete DNA synthesis (Urlaub et al., Somat. Cell. Mol. Genet., 12, 555—566, 1986) to obtain a transformant, and FacVII—ATKAVC derivative was expressed from the transformant.

In detail, the DG44/CHO cell line was cultured to reach 80 to 90% confluence, and the cells were washed with Opti—MEM (Gibco, cat. No. 34) three times.

On the other hand, a e of 3 ml of Opti—MEM and 5 ug of expression vector pXOGC—FVII—ATKAVC, and a e of 3 ml of Opti—MEM and 20ul of lipo— fectamine (Gibco, cat. no. 18324—012) were left at room temperature for 30 minutes, respectively. Subsequently, the mixtures were mixed, and added to the cultured DG44/CHO cell line. Then, the cells were cultured at 37°C and 5% C02 for ap— proximately 18 hours, resulting in introduction of the expression vector pXOGC—FVII—ATKAVC into HO cell line. Subsequently, the cultured cells were washed with 10% FBS—supplemented DMEM—F12 (Gibco, cat. no. 11330) three times, and then the medium was added thereto, followed by cultivation for 48 hours.

The cultured cells were detached by trypsin treatment, and they were inoculated into MEM—(x medium (WELGENE, cat. no. LM008—02)) containing 10% FBS and 1 mg/ml of G418 ro, cat. no. 61—234 —RG) without selection medium (HT supplement (Hypoxanthine—Thymidine)). Until the ormed cells survived to form colonies, the medium was replaced with the selection medium every 2 or 3 days. Thus, the transformed cells were selected from the separated cells. At this time, in order to increase the expression level of FacVII—ATKAVC derivative in the selected ormed cells, 10 nM MTX (Sigma, cat. no. M8407) was added to the selection medium to gradually se the tration, and 2 to 3 weeks later, the content of MTX was increased up to 30 nM. rmore, in order to reduce heterogeneity of the transformed cells, a ng dilution method was med to obtain single clones. In detail, the transformed cells were diluted to a ratio of 0.7 cell in each well of a 96—well plate, and cultured for 2 to 3 weeks to examine whether single clones were observed. When cluster formation of single clones were observed in wells, the single clones were erred to a 24—well plate, and cell growth rate of each clone and expression level of FacVII derivative were analyzed by ELISA so as to select a clone showing the highest sion level of FacVII derivative. It was designated as "HMF709", and deposited at the Korean Collection for Type Culture, Korea Research Institute of Bioscience and Biotechnology (111 gno, Yuseong—gu, Daejeon, Korea) on Sep. 23, 2011 under accession number "KCTCl2022BP".

Example 4: Purification of FacVfl-ATKAVC The transformant prepared in Example 3—2 was cultured to express FacVII—ATKAVC, and the culture solution was centrifuged at 3000 rpm for 5 minutes to obtain a supernatant.

The supernatant was filtered using a 0.2 um microfiltration ne, and 0.6 M ammonium sulfate was added thereto, and the mixture was applied to a butyl HP column. Elution was performed using a concentration gradient buffer solution (20 mM Tris—HCl pH 7.5) containing 0.6—0 M ammonium sulfate to obtain an active fraction containing FacVII—ATKAVC.

The buffer solution of the obtained active fraction was replaced with a 10 mM sodium phosphate buffer solution (pH 7.0), which was applied to a Heparin HP column and eluted using a 0—1.0 M NaCl tration gradient buffer solution (10 mM sodium ate, pH 7.0) so as to obtain an active fraction containing —ATKAVC.

The active fraction was concentrated, and applied to a Superdex75 column, and then eluted using 150 mM NaCl 20 mM Tris—HCl (pH 7.5) buffer solution so as to obtain an active fraction ning FacVII—ATKAVC. The buffer solution of the obtained active fraction was replaced with a 2 mM benzamidine 20 mM Cl (pH 7.5) buffer solution, which was applied to a Q FF . Then, washing (2 mM benzamidine 0.2 M NaCl 20 mM Tris—HCl (pH 8.0) buffer), re—equilibration (2 mM benzamidine 0.1 M NaCl 20 mM Tris—HCl (pH 8.0) buffer), and concentration—gradient elution (2 mM benzamidine 25 mM NaCl 35 mM CaClz, 20 mM Tris—HCl (pH 8.0) ) were performed to purify FacVII—ATKAVC.

The purity of the purified FacVII—ATKAVC was examined by SDS PAGE (. is a photograph showing the result of electrophoresis of the purified FacVII—ATKAVC, in which M is a size marker, Lane 1 is FacVIII under reducing conditions, Lane 2 is of FacVII—ATKAVC under reducing conditions, Lane 3 is FacVII under non—reducing conditions, and Lane 4 is FacVII—ATKAVC under non—reducing conditions.

Example 5: Preparation of conjugates of FacVH-ATKAVC and PEG FacVII—ATKAVC purified in Example 4 was ated with PEG having different molecular weights to prepare conjugates. e 5-1: Preparation of FacVH-ATKAVC-40 kDa PEG conjugate For PEGylation of the C—terminus of —ATKAVC with 40 kDa mPEG— maleimide (NOF, Japan), —ATKAVC (1 mg/ml) and 40 kDa mPEG—maleimide were mixed at a molar ratio of 1:20 in the presence of a 100 mM phosphate buffer solution (pH 5.5), and a reducing agent, 2 mM triarylphosphine was added thereto, and reacted at 25°C for 2 hours. As a result, mono—PEGylated FacVII—ATKAVC (FacVII—ATKAVC—40k PEG ate) was prepared (. is a photograph showing the result of electrophoresis of a conjugate of FacVII—ATKAVC and PEG, in which M is a size marker, Lane 1 is FacVII—ATKAVC—40 kDa PEG conjugate under non—reducing conditions, and Lane 2 is FacVII—ATKAVC—5 kDa PEG conjugate under non—reducing conditions.

Example 5-2: Preparation of FacVfl-ATKAVC-S kDa PEG conjugate PEGylation of the C—terminus of FacVII—ATKAVC with aldehyde—5 kDa PEG— maleimide (NOF, Japan) was performed in the same manner as in Example 5—l, except using aldehyde—5 kDa PEG—maleimide instead of 40 kDa mPEG—maleimide so as to prepare PEGylated FacVII—ATKAVC (FacVII—ATKAVC—5 kDa PEG conjugate) (FIG.

Example 5-3: Preparation of FachIa-ATKAVC-PEG-Fc complex To link the aldehyde reactive group of maleimide—10 kDa PEG—aldehyde (NOF, Japan) to the inus of immunoglobulin Fc , the immunoglobulin Fc region and maleimide—10 kDa PEG—aldehyde were mixed at a molar ratio of 1:1 in the presence of 100 mM phosphate buffer solution (pH 6.0), and a reducing agent, 20 mM Na—CNBH3 was added under the condition of a protein concentration of 10 mg/ml. The mixture was reacted at low temperature ) for 2 hours. In order to obtain a mono— PEGylated immunoglobulin Fc region (maleimide—10 kDa PEG—Fc), cation exchange tography was performed using Source 15Q, and elution was performed in a 20 mM Tris buffer solution (pH 7.5) using a sodium chloride concentration gradient.

On the other hand, the C—terminus of FacVII—ATKAVC was reduced in a 10 mM Glycil—Glycine buffer on (pH 5.5) using a reducing agent, 0.5~2 mM triph— enylphosphine—3,3',3"—trisulfonic trisodium salt hydrate at room temperature for 2 hours.

The inus—reduced FacVII—ATKAVC and the mono—PEGylated im— munoglobulin Fc region (maleimide—10kDa PEG—Fc) were mixed at a molar ratio of 1:4~1:20, and reacted at room temperature for 2 hours in the presence of 50 mM Tris buffer solution (pH 7.5) at a total protein concentration of 1~2 mg/ml. First, cation exchange chromatography was performed using Source 15Q, and a FacVII—ATKAVC—lOk PEG—Fc complex was eluted in a 20 mM Tris buffer solution (pH 7.5 ) using a sodium chloride concentration nt.

For activation of FacVII in the FacVII—ATKAVC—PEG—Fc complex, solution reaction was performed in a 0.1 M Tris—HCl buffer solution (pH 8.0) at approximately 4 mg/ml based on FacVII at low temperature (4~8°C) for 18 hours.

Size exclusion chromatography was performed using Superdex200 and a 10 mM Glycil—Glycine buffer solution (pH 5.5) so as to purify final FacVIIa—ATKAVC—PEG—Fc.

The purity of the purified FacVIIa—ATKAVC—PEG—Fc was examined by SDS PAGE and n blotting (. is a photograph showing the result of elec— trophoresis of the purified FacVIIa—ATKAVC—PEG—Fc conjugate, in which M is a size marker, Lane 1 is FacVIIa—ATKAVC—PEG—Fc under ng conditions, and Lane 2 is a—ATKAVC—PEG—Fc under non—reducing conditions. is a photograph showing the result of Western blot analysis of the purified FacVIIa—ATKAVC—PEG—Fc, in which Lane 1 is FacVIIa—ATKAVC—PEG—Fc under reducing ions, and Lane 2 is FacVIIa—ATKAVC—PEG—Fc under non—reducing conditions.

Exam le 6: In vitro activit EC5 of Fachl and Fachl-ATKAVC In order to determine in vitro activities of FacVII and FacVII—ATKAVC, a commercial kit ogenix, COASET) was used to perform chromogenic assay.

The activity assay was performed in accordance with the European Pharmacopoeia "2.7.10. ASSAY OF HUMAN COAGULATION FACTOR VII".

The diluted FacVII and —ATKAVC are activated by thromboplastin and Ca2+ ions. FX is activated to FXa by the activated FacVIIa and FacVIIa—ATKAVC, and a ate 8—2765 (N—a—Cbo—D—Arg—Gly—Arg—pNA) is hydrolyzed and dissociated into a e and a chromophoric group pNA by the activated FXa. The ance of the iated pNA at 405 nm was monitored to determine the in vitro activities of FacVIIa and FacVIIa—ATKAVC.

Changes in absorbance according to the concentrations of FacVII and FacVII—ATKAVC were ed by regression analysis using a 4—parameter model of Softmax Pro 4.0 program, and the activities between two substances were compared using the ed EC50 values.

The test results (and Table 1) showed that the in vitro activity of FacVII—ATKAVC shows a titer equivalent to or higher than that of the native FacVII.

Table 1 [Table 1] E831} comparison between Fac‘fll and Fac‘flI-aTKa‘JC Lot. No. ECa.(neKmL) (Relative activity. 3} FacW E13161-PK8251 1.62 1 .6? (1003' {1003' Fac‘v’H-ATKWC E13UQU-PK1111 1 .35 1 . 16 (119) {143) As shown in Table 1 and FacVII and FacVII—ATKAVC were found to exhibit equivalent in vitro activities, indicating that the FacVII or FacVII derivative of the present invention has an activity equivalent to that of native form, and addition of a peptide linker to the C—terminus does not affect its activity.

Example 7: In vitro activity (EC 50 1 of Fachl-ATKAVC and FacVII-ATKAVC-40 kDa PEG In order to examine the activity according to site—specific conjugation, in vitro ac— es of FacVII—40 kDa PEG, FacVII—ATKAVC, and C—terminal PEGylated —ATKAVC—40 kDa PEG were determined. A commercial kit (Chromogenix, COASET) was used to perform chromogenic assay, and the method was performed in the same manner as in Example 6. Changes in absorbance according to the concen— trations of test samples were ed using a meter model of Softmax Pro 4.0 m, and the relative activities after PEGylation were examined using the obtained EC50 values.

The test results (Table 2) showed that the in vitro activity of N—terminal PEGylated FacVII—40 kDa PEG shows a titer of approximately 11%, compared to FacVII, and in vitro activity of C—terminal PEGylated FacVII—ATKAVC—40 kDa PEG shows a titer of approximately 29%, compared to FacVII—ATKAVC.

Table 2 [Table 2] EC... comparison between Fac‘flI-ETKEVC and FacW—flTKfiVC-flfl kDa PEG Lot . Ho. EC... (neImL) {P.e let ive activity. 3) 1?ch BlBlBU-PJBQBI 1 .38 (100} FacW-ilfll kDa PEG E13161-PK1291 12.1? r.11. 3} FaCW—flTKflVC 1313190P111251 1. T5 (1001 mm3.3”i H! —JI I. II The activity of the conjugate of PEG and FacVII derivative of the present invention showed a titer of approximately 29%, compared to FacVII derivative. In contrast, the activity of the conjugate of PEG and FacVII showed a titer of imately 11%, compared to FacVII. These results indicate that the C—terminal PEGylated FacVII—ATKAVC—40 kDa PEG maintains approximately 2.5 times higher ve ty, compared to EC50 of the N—terminal PEGylated FacVII—40 kDa PEG, and the activity of FacVII can be highly maintained by site—specific conjugation using ATKAVC.

Example 8: In vitro activity of FachIa-ATKAVC-PEG-Fc In Vitro activity of FacVIIa—ATKAVC—PEG—Fc was determined using a commercial kit (StaclotVIIa—rTF, Stago) and international standard NIBSC Factor VIIa (656 IU/ Vial, Code No. 07/228) as a standard material. This method is based on coagulation by ic reaction of rsTF (recombinant soluble tissue factor) and Factor VIIa. NIBSC Factor VIIa, FacVIIa—ATKAVC, and FacVIIa—ATKAVC—PEG—Fc were diluted with —deficient human plasma at a ratio of 1:1, and reacted with a mixture of rsTF and phospholipid for approximately 180 s. Thereafter, 25 mM CaClz was added thereto to measure the time of coagulation. As the amount of Factor VIIa increases, the coagulation time becomes shorter.

In order to calculate a specific actiVity (IU/mg) of FacVIIa—ATKAVC and FacVIIa—ATKAVC—PEG—Fc, potencies ) of FacVIIa—ATKAVC and a—ATKAVC—PEG—Fc relative to potency (IU/mL) of NIBSC Factor VIIa were first analyzed using PLA 2.0. Thereafter, the calculated potency (IU/mL) was diVided by the protein concentration (mg/mL) to calculate the specific actiVity.

The test results (Table 3) showed that in Vitro actiVity of FacVIIa—ATKAVC—PEG—Fc was imately 20632 IU/mg, indicating that it maintains approximately 45% actiVity, compared to FacVIIa—ATKAVC.

Table 3 [Table 3] In Vitro activitzaF of FacWa-flTKflVC-PEG-Fc I-i'crutencsF Specific activity (1111’le (IUng 613 Fac‘flla) activity, 33' Fac‘v’Ha-ETKEVC E13DQU-PLD111 WWI-1 . CI £15143 . B (1003‘ Fat: -LL11041 1993 . T 20532 . 2 Wa-flTKflVC-PEG-Fc {£14 . T} flifi’l' ’I‘RIZA’KT ()5: THE A'YIC)N\L RECOGNITION Q my: DEPOSIT 0F MIC:ROOKLAMSMS FOR THE PURPOSE ()F PATENT PE“. I .5 ZNA’L‘IONAL FORM RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant, to Ruie 7.1 T0 : LEE. Kwan Sun Harm Pharm. Co., Ltd. 893-3 Hageowi, Paitan-myun, Hwaseong~sf, Gyeonggi—do 4453958 Republic of Korea L 1mg ’HFICA’X‘ION 0;: THE; 0300mm w Iciemificativm reference given by the DEPOSI’1Y3RI } HMF709 E (CHO cell fine (dhfr-)) ‘1 The. microorganism §demréfied under I above was accompanied by: ‘ [ X E a scientific description E a @ropcmed taxonomic (Iesignation QMark with a crass where applicabie) This International Domsitary Authmty accepts the: microorganiam identificd under 3 above, ; which was; received by it on September 23, 2011. in. ..

N, RE 11M” OF REQUEE FOR COX ERBION The: micmorgauism idtmuned uncier I abm‘e was received by this; international 1)0;)03itmjv Authority on and a request m convert the mriginai t 1:0 a deposit mder the Budamst '13“me was received by it on , NEPOSI'I‘ARY AUTI EORITY Signatumm m“ personm having the power 3; : Name: Korean Callection for Type Cuttures t0 repremnt the lntematiana) tary Autimrity m“ authorized officinKS)? "\ fi Addrcasf Korea ch Institute of 9‘») (l Bioscience and Biotechnotagzy fifiRIBB) J ‘ WW“ m mfi£w2% \ 111 Gwahangm, Yuseang-«gu, Daemon 3083-806 BAE, Kyung Sookl Director Republic {3? Korea Date: September 29. 2011 ~ [ I’m‘m BEE/4 (KC‘TC Form {’71 sch: 9(ng

Claims (44)

1. A derivative of FacⅦ or its active form FacⅦa, sing the amino acid sequence of SEQ ID NO. 4 from FacⅦ and a e linker linked at the C-terminus thereof, wherein the C-terminal amino acid residue of the peptide linker is a cysteine.

2. The derivative according to claim 1, wherein the peptide linker is a partial sequence of SOD1 (Superoxide dismutase).

3. The derivative according to claim 2, wherein the partial ce of SOD1 is mutated by replacing of VLKG (valine-leucine-lysine-glycine) within the sequence with a self-cleavage site sequence IPRI (isoleucine-proline-arginine-isoleucine).

4. The derivative according to claim 1, wherein the derivative is composed of an amino acid sequence selected from the group consisting of SEQ ID NOs. 9, 13, 14, 20, 24, and 27.

5. A polynucleotide encoding the derivative of FacⅦ or its active form FacⅦa of any one of claims 1 and 3 to 4.

6. The polynucleotide ing to claim 5, wherein the polynucleotide is composed of a nucleotide sequence selected from the group consisting of SEQ ID NOs. 8, 12, 15, 21, 25 and 28.

7. An expression vector comprising the polynucleotide of claim 5.

8. The expression vector according to claim 7, wherein the vector is selected from the group consisting of pX0GC-FⅦ-ATKAVC, pX0GC-FⅦ-GGGGSC, pX0GC-FⅦ-SOD1 1- 149, FⅦ-SOD1 IPRI, pX0GC-FⅦ-SOD1 1-25 IPRI, and pX0GC-FⅦ-SOD1 1-90 IPRI.

9. An ed transformant comprising the expression vector of claim 8.

10. The ed transformant according to claim 9, wherein the transformant is identified by accession number KCTC12022BP.

11. A method for preparing a FacⅦ derivative, comprising the steps of: (i) culturing the transformant of claim 10 so as to obtain a e solution; and (ii) recovering the FacⅦ derivative from the culture solution.

12. The method according to claim 11, r comprising the step of activating the recovered FacⅦ derivative.

13. A conjugate of FacⅦ or its active form FacⅦa, wherein a non-peptidyl polymer capable of extending the blood half-life is linked to the peptide linker of the derivative of FacⅦ or its active form FacⅦa of any one of claims 1 and 3 to 4.

14. The conjugate according to claim 13, wherein the non-peptidyl polymer is linked to the C-terminus of the tive of FacⅦ or its active form FacⅦa.

15. The conjugate according to claim 13, wherein the non-peptidyl polymer has one or more reactive group(s) selected from the group consisting of an aldehyde group, a propionaldehyde group, a butyraldehyde group, a ide group, ortho pyridyl disulfide, thiol and succinimide derivatives.

16. The conjugate according to claim 13, wherein the succinimide derivative is succinimidyl nate, succinimidyl carboxymethyl, hydroxy succinimidyl or succinimidyl carbonate.

17. The conjugate according to claim 13, wherein the non-peptidyl polymer has two or three reactive ends.

18. The conjugate according to claim 13, wherein the non-peptidyl polymer has a maleimide reactive group or an aldehyde reactive group at both ends, respectively.

19. The conjugate according to claim 13, wherein the non-peptidyl r is selected from the group consisting of polyethylene glycol, polypropylene glycol, ethylene glycolpropylene glycol non-peptidyl copolymers, polyoxyethylated polyols, polyvinyl alcohols, ccharides, dextrans, polyvinyl ethyl ethers, biodegradable rs, lipid non-peptidyl polymers, chitins, hyaluronic acids, and a combination thereof.

20. A complex of FacⅦ or its active form FacⅦa that is composed of the FacⅦ or FacⅦa derivative of any one of claims 1 and 3 to 4 linked to an immunoglobulin Fc region via a non-peptidyl polymer.

21. The x according to claim 20, wherein the non-peptidiyl polymer is selected from the group consisting of polyethylene glycol, opylene glycol, ethylene glycolpropylene glycol copolymers, polyoxyethylated polyols, polyvinyl alcohols, polysaccharides, dextrans, polyvinyl ethyl ethers, biodegradable polymers, lipid polymers, chitins, hyaluronic acids, and a combination f.

22. The x according to claim 20, wherein the non-peptidyl polymer has one, two or three reactive end(s).

23. The x according to claim 20, n the non-peptidyl polymer has a ide reactive group or an aldehyde reactive group at both ends, respectively.

24. The complex according to claim 20, wherein the immunoglobulin Fc region is composed of one to four domains selected from the group consisting of CH1, CH2, CH3 and CH4 domains.

25. The complex according to claim 20, wherein the immunoglobulin Fc region further comprises a hinge region.

26. The complex according to claim 20, wherein the immunoglobulin Fc region is derived from IgG, IgA, IgD, IgE, or IgM.

27. The x according to claim 20, wherein the immunoglobulin Fc region is an IgG4 Fc region.

28. The complex according to claim 20, wherein the immunoglobulin Fc region is a human aglycosylated IgG4 Fc region.

29. A method for preparing a FacⅦa complex, comprising the steps of: (ⅰ) covalently linking a non -peptidyl polymer having a succinimide derivative or aldehyde reactive group at its one end to the amine group of immunoglobulin Fc at pH 5.0 ~ pH 9.0; (ⅱ) recovering a conjugate that includes the immunoglobulin Fc region covalently linked with the non-peptidyl r at the amine group, from the reaction e of step (1); (ⅲ) covalently linking the C -terminal thiol group of the FacⅦ derivative of any one of claims 1 and 3 to 4 to the other end of the non-peptidyl r in the recovered conjugate so as to produce a FacⅦ complex having the immunoglobulin Fc region and the FacⅦ derivative at each end of the non-peptidyl polymer; and (iv) activating the FacⅦ complex produced in step (ⅲ) so as to e a FacⅦa complex having FacⅦa and the immunoglobulin Fc region linked via the non-peptidyl polymer.

30. A method for preparing a FacⅦa complex, comprising the steps of: (ⅰ) covalently linking a non-peptidyl polymer having a imide derivative or aldehyde reactive group at its one end to the amine group of immunoglobulin Fc at pH 5.0 ~ pH 9.0; (ⅱ) recovering a conjugate that includes the globulin Fc region covalently linked with the non-peptidyl polymer at the amine group, from the reaction mixture of step (ⅰ); and (ⅲ) covalently linking the C nal thiol group of the FacⅦa derivative of any one of claims 1 and 3 to 4 to the other end of the non-peptidyl polymer in the recovered conjugate so as to produce a FacⅦa complex having the immunoglobulin Fc region and the FacⅦa derivative at each end of the non-peptidyl polymer.

31. A method for preparing a FacⅦa conjugate, comprising the steps of: (i) ntly linking a non -peptidyl polymer having a reactive group selected from the group consisting of an aldehyde group, a propionaldehyde group, a butyraldehyde group, a maleimide group, ortho pyridyl disulfide, thiol and succinimide derivatives to the C- terminal thiol group of the FacⅦ derivative of any one of claims 1 and 3 to 4; (ii) recovering the FacⅦ conjugate prepared by covalently linking the non-peptidyl polymer to the FacⅦ derivative; and (iii) activating the red Fac Ⅶ conjugate so as to produce a FacⅦa conjugate having the non-peptidyl polymer linked to the FacⅦa region.

32. A method for preparing a FacⅦa conjugate, comprising the steps of: (i) covalently linking a non -peptidyl polymer having a reactive group selected from the group consisting of an de group, a propionaldehyde group, a butyraldehyde group, a maleimide group, ortho pyridyl disulfide, thiol and succinimide derivatives to the C- terminal thiol group of the FacⅦa derivative of any one of claims 1 and 3 to 4; and (ii) ring the FacⅦa conjugate prepared by covalently g the non-peptidyl polymer to the FacⅦa derivative.

33. A FacⅦa complex that is composed of an immunoglobulin Fc region linked to the other end of the non-peptidyl r in the recovered FacⅦa ate of claim 31 or 32.

34. The method according to any one of claims 29 to 32, wherein activation of the FacⅦ derivative, FacⅦ conjugate, or FacⅦ complex is med by on-column activation or insolution activation.

35. The method according to any one of claims 29 to 32, wherein the non-peptidyl polymer is polyethylene glycol.

36. A FacⅦa x that is prepared by the method of any one of claims 29 or 32.

37. A complex of FacⅦ or its active form FacⅦa that is composed of the FacⅦ derivative or the FacⅦa derivative of any one of claims 1 and 3 to 4 linked with a carrier via a non-peptidyl polymer selected from the group consisting of polyethylene glycol, opylene glycol, ethylene glycol-propylene glycol copolymers, polyoxyethylated polyols, nyl alcohols, polysaccharides, ns, polyvinyl ethyl ethers, biodegradable polymers, lipid polymers, chitins, hyaluronic acids, and a combination thereof.

38. The complex according to claim 37 wherein one end of the non-peptidyl polymer constituting the FacⅦ te or FacⅦa conjugate is linked to a carrier selected from the group consisting of antibody, albumin, and transferrin.

39. The complex according to claim 37, wherein the r is selected from the group consisting of antibody, albumin, and transferrin.

40. The complex according to claim 37, wherein the non-peptidyl polymer has one, two or three reactive end(s).

41. The complex according to claim 37, wherein the non-peptidyl polymer has a maleimide reactive group or an aldehyde reactive group at both ends, tively.

42. A FacⅦa conjugate that is prepared by the method of claims 31 or 32.

43. Use of the FacⅦ derivative or the FacⅦa derivative of any one of claims 1 and 3 to 4, the FacⅦ ate or the FacⅦa conjugate of any one of claims 13 to 19, the FacⅦ complex or the FacⅦa complex of any one of claims 20 to 28, the FacⅦa conjugate of claim 42, or the FacⅦa complex of claim 37, for ation of a medicament for preventing or treating hemophilia.

44. Use of the FacⅦ derivative or the FacⅦa derivative of any one of claims 1 and 3 to 4, the FacⅦ conjugate or the FacⅦa conjugate of any one of claims 13 to 19, the FacⅦ complex or the FacⅦa complex of any one of claims 20 to 28, the FacⅦa conjugate of claim 42, or the FacⅦa x of claim 36, for preparation of a medicament for promoting blood coagulation.