NZ621345B2 - Methods of treatment of retinal degeneration diseases - Google Patents

Abstract

Discloses use of a mesenchymal stem cell (MSC) or a cell population comprising a hematopoietic stem cell (HSC) and a progenitor cell, wherein the Wnt/?-catenin signalling pathway of said cells is activated, in the manufacture of a medicament for the treatment of a retinal degeneration disease by direct implantation of said cells into the eye of a subject in need of treatment. Also discloses a cell composition, wherein at least 50% of the cells of said cell composition are hematopoietic stem cells (HSCs) and progenitor cells and wherein the Wnt/?-catenin signalling pathway of said cells is activated. ect implantation of said cells into the eye of a subject in need of treatment. Also discloses a cell composition, wherein at least 50% of the cells of said cell composition are hematopoietic stem cells (HSCs) and progenitor cells and wherein the Wnt/?-catenin signalling pathway of said cells is activated.

Description

METHODS OF TREATMENT OF RETINAL DEGENERATION DISEASES FIELD OF THE INVENTION This invention s to the field of cell-based or regenerative therapy for ophthalmic diseases. In particular, the invention provides s of treatment of retinal degeneration diseases by administering cells. said cells having properties of stem cells or progenitor cells, to the retina and reprogramming of retinal cells, such as retinal neurons or retinal glial cells, mediated by cell fusion of said. cells with said. retinal cells, said reprogramming being mediated. by tion of the Wnt/B-catenin signalling pathway.

BACKGROUND OF THE INVENTION The retina is a specialized light-sensitive tissue at the back of the eye that contains photoreceptor cells (rods and cones) and. s connected. to a neural network for the processing of visual information. The rods function in conditions of low illumination whereas cones are responsible for color vision and. all visual tasks that require high tion (e.g., reading). The rods are mostly located. away from the center of the eye in the retinal periphery. The highest concentration of cones is found at the center of the retina, the macula, which is necessary for visual acuity. For support of its metabolic ons, the retina is dependent on cells of the adjacent retinal pigment lium (RPE).

Retinal degeneration is the deterioration of the retina caused by the progressive and eventual death of the retinal or retinal pigment ephitelium (RPE) cells. There are several reasons for retinal degeneration, ing artery or vein occlusion, diabetic retinopathy, retrolental fib'roplasia/retinopathy of prematurity, or disease (usually hereditary). These may present in many different ways such as impaired Vision. night blindness, retinal detachment, light ivity, tunnel vision, and loss of peripheral vision to total loss of vision. Retinal degeneration is found in many different forms of retinal diseases including retinitis tosa, age-related r degeneration (AMD), diabetic retinopathy, cataracts, and glaucoma. tis pigmentosa (RP) is the most common retinal degeneration with a prevalence of approximately I in 3,000 to l in 5,000 individuals, affecting imately 1.5 million people worldwide. RP is a heterogeneous family of ted retinal disorders characterized by progressive degeneration of the photoreceptors with subsequent degeneration of RPE. It is the most common inherited retinal degeneration and is characterized by t deposits predominantly in the peripheral retina and by a relative sparing of the central . The typical manifestations are present between adolescence and early adulthood and. lead to devastating visual loss with a high probability. In most of the cases of RP, there is primary degeneration of photoreceptor rods, with ary degeneration of cones. RP is a long-lasting disease that usually evolves over several decades, initially presented as night blindness, and, later in life as viSual impairment in l conditions. Currently, there is no therapy that stops the evolution of retinal ration or restores Vision. There are few treatment options such as light avoidance and/or the use of low-Vision aids to slow down the progression of RP. Some practitioners also er vitamin A as a possible treatment option to slow down the progression of RP.

Effective treatment for retinal degeneration has been widely investigated. The field. of stem ased therapy holds great potential for the treatment of retinal degenerative diseases as many s in animal models suggest that stem cells have the capacity to regenerate lost photoreceptors and retinal neurons and e Vision. To date, these cells include retinal progenitor cells, embryonic stem cells, bone marrow- derived. stem cells, and induced pluripotent stem cells.

Retinal progenitor cells (RPCs) are derived from fetal or neonatal retinas, and se an immature cell population that is responsible for generation of all retinal cells during nic development. RPCs can proliferate and generate new neurons and specialized retinal support cells in Vitro, and can also migrate into all retinal layers and develop morphological characteristics of various retinal cell types in viva (MacLaren et (1]., 2006, Nature 444:203-7). These results support the hypothesis that RPCs lants are a potential treatment for retinal degenerative diseases.

Embryonic stem cells (ESCs) are derived from the inner cell mass of blastocyst- stage embryos, with self-renewal lities as well as the ability to differentiate into all adult cell types, including photoreceptor progenitors, photoreceptor, or RPE in mice and humans (Lamba ct al., 2006, PNAS USA "103:12769-74; Osakada et (11., 2008, Nat Bioteclmol 26215—224). Lamba er al. showed that transplantation of retinal cells derived from human ESCs into the subretinal space of adult Crx("r') mice promoted the differentiation of hESCs-derived retinal cells into functional photoreceptors, and the ure improved light responses in these animals a 6t (11., 2009, Cell Stem Cell 4:73-9). Although ESCs are promising in retinal replacement therapies, there remain ethical and immune rejection issues to be considered, and ESCs have also been associated. with teratoma ion.

The bone marrow harbors at least two distinct stem cell populations: mesenchymal stem cells (MSCs) and hematopoietic stem cells (HSCs). MSCs can be induced into cells expressing photoreceptor e-specific markers in vitro using activin A, taurine, and. epidermal growth factor (Kicic et (11., 2003, J Neurosci 2317742- 9). In on, an in vivo animal model demonstrated that MSC injected into the subretinal space can slow down retinal cell degeneration and integrate into the retina and differentiate into photoreceptors in Royal College of Surgeons (RCS) rats (Kicic et al._, 2003, J Neurosci 23 :7742-9; Inoue er al., 2007. Exp Eye Res 85:234-41).

Otani er a]. have ed that intravitreally ed, lineage-negative (Lin') hematopoietic stem cells (HSCs) can rescue l degeneration in rdj and NIH) mice (Otani et (11., 2004, J Clin Invest 1'142755-7; US 2008/03'1772'1; US 20'10/0303768).

However, the transplanted retinas were formed of nearly only cones, and the electroretinogram responses were severely abnormal and. comparable to untreated. animals. There was a limitation in that intravitreally injected. Lin" HSCs were effectively incorporated into the retina only during an early, postnatal developmental stage but not in adult mice, only targeting activated astrocytes that are observed in neonatal mice or in an injury induced model in the adult (Otani er LIL, 2002, Nat Med 821004-10; Otani er (1]., 2004, J Clin Invest 'I 14:755-7; Sasahara et (11., 2004, Am J Pathol I72:'1693-703).

Induced pluripotent stem cells (iPS) derived from adult tissues are pluripotent ESC-like cells reprogrammed in vitro from terminally differentiated. somatic cell by retroviral transduction of four transcription factors: Oct3/4, 80x2, Klf4 and e-Myc. It has been reported that human iPS have a similar potential of ESCs to mimic normal retinogenesis (Meyer er al._. 2009, PNAS USA 106216698-703). However, major issues include reducing the risk l ations and oncogene sion for tion of iPS. These limitation may be me using alternative methods to obtain iPS such as activation of signalling pathways, including the Wnt/B—catenin, MAPK/ERK, TGF-D and Pl3K/AKT ssignalling pathways (; Sanges & Cosma, 2010, Int J Dev Biol 54:1575-87).

Therefore, there is the need to provide an ive method for treating retinal degenerative diseases.

SUMMARY OF THE INVENTION Inventors have now found that retinal regeneration can be achieved by implanting cells, said. cells having properties of stem cells or progenitor cells, into the retina of a t which fuse with retinal cells, such as retinal neurons, e,g., rods, etc., or l glial cells, e.g., Miiller cells, to form hybrid cells which reactivate neuronal precursor markers, proliferate, dc-d'ifferentiate and finally differentiate into terminally entiated retinal neurons of st, e.g., photoreceptor cells, ganglion cells, etc., which can regenerate the damaged retinal tissue. The tion of the Wnt/B-catenin signalling pathway is essential to induce de-differentiation of said. hybrid cells and. final re-differentiation in the retinal neurons of interest. In an embodiment, activation of the Wnt/B-catenin signalling pathway is, at least lly, ed. by the ted. cells (which have been treated with a Wnt/B-catenin signalling pathway tor, or with an inhibitor of a Wnt/B-catenin signalling pathway rcpressor, and/or overexpress a Wnt/B- catenin signalling pathway activator), whereas in another embodiment, activation of the WntlB-c-atenin signalling pathway is only provided as a result of administering a Wnt/B- catenin signalling pathway activator, or an inhibitor of a Wnt/B-catenin signalling pathway repressor, to the subject to be treated or as a consequence of a retinal damage or injury, as occurs in, for example, retinal degeneration diseases (e.g., Retinitis Pi gmentosa). The newborn retinal neurons fully regenerate the retina in the transplanted mammalian, with some rescue of functional vision. Histological analysis shows that said rated retinas are indistinguishable from retinas of wild-type mammalians two months after transplantation. These data show that cell fusion-mediated. regeneration is a very efficient process in mammalian retina, and that it can be red by tion of Wnt/B-catenin signalling pathway in the transplanted cells, and that in vivo reprogramming of terminally differentiated retinal s is a possible mechanism of tissue regeneration. Consequently, these teachings can be d to treat diseases wherein retina is degenerated.

BRIEF DESCRIPTION OF THE DRAWINGS Figure l. Cell fusion controls. (a) Schematic representation of the experiment plan. o cell fusion between HSPCsRHme with l s of LoxP-STOP- LoxP-YFP mice (R26Y) leads to excision of a floxed stop codon in the retinal neurons, and in turn, to expression of YFP. The ing hybrids express both RFP and. YFP. (b) Representative fluorescence raphs of R26YW s 24 h after inal transplantation of BIO-treated 'm'm’. YFP positive cells represent hybrids d from cell fusion of HSPCs with R26Y’d1 retinal cells. (c) RT-PCR analysis of the target gene Axi'n2 shows B-catenin signalling activation in BIO-treated HSPCs. (d-e) Representative fluorescence micrographs of 1310 wild-type R26Y retinas 24 h after subretinal transplantation of BIO-treated HSPCsCRERFP. No YEP-positive cells (green) were detected. Nuclei were counterstained with DAPI in (e). Dotted. lines show the final part of the retinal tissue. OS: outer segment; ONL: outer nuclear layer; INL: inner nuclear layer.

Figure 2-. Transplanted HSPCs fuse and induce de-d'ifferentiation of rdl'mousc retinal cells upon Wnt/B-catenin signalling pathway activation. (a-d.) Representative fluorescence micrographs of R26Y'Wmouse retinas 24h afier subretinal transplantation of HSPCscml‘lRF'). Double-positive RFPIYFP (red/green) hybrids following cell fusion of HSPCs (red) with rd] retinal cells were detected in the ONL, and a few in the INL.

Thcse YFP-positive hybrids (YFP, green) are also positive for markers to rod (rhodops'in; red in b) and Muller (glutamine synthetase; red in c) cells, but not to cones (d). (e-g) Quantification of apoptotic photoreceptors (e) and apoptotic (f) and proliferating (g) hybrids 24h after transplantation of O-treated. (No BIO) and BIO-treated (BIO) HSPCSCRH in p10 R26Yrdl eyes. Numbers were calculated. as the percentage of TUNEL positive photoreceptors with respect to total photoreceptor nuclei (e) or as the tage of Annexin V (i) or Ki67 (g) positive cells with t to the total numbers of YFP positive hybrid. cells. (h) Real-time PCR of genes (as indicated.) expressed in the HSPCs and retinal and hybrid cells (as indicated). 0N L: outer nuclear layer; IN L: inner nuclear layer.

Figure 3. Proliferation and cell-death analysis of de-differentiated hybrids.

Representative immunofluorescence staining of Annexin V (a, b) and Ki67 (c, d) on retinal sections of R26Y’d’ mice analysed 24 h after lantation at p10 with BIO— treated l’lSPCscp‘E (BIO; a, c) or non-treated HSPCSCRE (No BIO; _b, d). YFP fluorescence (green) localises hybrids obtained after fusion. Nuclei were 'counterstained with DAPI (blue). Yellow arrows indicate apoptotic (b) or proliferating hybrids (c-d).

Figure 4. Immunofluorescence analysis of expression of precursor markers in de-difi‘erentiated hybrids. Representative immunofluorescence staining of Nestin (a, (1, red), Noggin (b, e, red) and Otx2 (c, f, red) in retinal sections from R26Y’d’ mice 24 h after transplantation at p10 of BIO-treated I-ISPCsCRE (BIO; a-c) or ted cells (No BIO; d-t). YFP s ) obtained after fusion were positive for these markers only following BIO-treatment (a-c, yellow arrows).

Figure 5. Histological analysis time course of retinal regeneration in rd! mice. (a-h) Representative H&E staining (a, b, (3-11) and TUNEL staining (c, d; red) of l sections of R26Ynil mice transplanted at p10 with untreated (a, c, e, g) or BIO-treated (b, d, f, h) HSPCsm/CRE and analysed 5 (p15; ad), 10 (p20; e, f) and 15 days (p25; g, h) after transplantation. (i—p) Representative H&E staining of wild-type (i, j) and rd! mice (k-p) without transplantation (i, j, o, p) or transplanted at p10 (k-n) with ted (m, n) or BIO-treated (k-l) HSPCS (m-n), all analysed at p60. Magnification: 20x a-h, j, 1, n, p; 5X i, k, m, o. ONL: outer nuclear layer.

Figure 6. Histological analysis time course of transplanted R26Y"”eyes. (a) entative H&E staining and TUNEL staining of retinal sections of R26Yrdl mice transplanted at p10 with untreated. or BIO-treated HSPCSRWCRE and analysed 5 (p15), (p20) and 15 days (p25) after lantation.(b) Representative immuno staining of retinas of R26Y'd' mice transplanted with no Bio-treated HSPCSRFP’CRE ' ONL: outer nuclear layer; INL: inner nuclear layer.

Figure 7. Analysis of hybrid entiation at p60. (a-f) Representative immunofluorescence staining of retinal sections of R26Y““ mice t RECTIFIED SHEET (RULE 91) ' lSA/EP transplantation (e) and transplanted at p10 with BIO-treated. HSPCs (a-d, f) and analysed at p60. (a-d) YFP-positive hybrids (green) are positive for rhodopsin (a, red) but not for cone opsin (b, red), glutamine synthetase (c, red), and CD31 (d, red). Bottom images: merges of red and green, with nuclei also counterstained with DAPI (blue). (ef ) Rhodopsin (red), Pde6b (magenta) and counterstained nuclei with DAPI (blue). (g) Western blotting of Pde6b protein expression in the retina of wild-type (wt) and R26Yrdl mice either untreated ('rd'l NT) or transplanted with BIO-treated HSPCs ('rdl BIO), all analysed at p60. Total protein lysatcs were normalized with an anti-B-actin antibody. ON L: outer nuclear layer; IN L: inner nuclear layer; GCL: ganglion cell layer.

Figure 8. YFP positive hybrids express PDE6B. (a) Representative fluoreseence staining ofrhodopsin (red) in retinal section from R26Y mice 2 months after transplantation at p10 of ted HSPCsCRF' cells. Neither YFP hybrids (green) nor rhodopsin (red) positive photoreceptors were detected. Nuclei were counterstained. with DAPI. (b) Representative retinal sections of RZOYF‘“ mice lanted at p10 with BIO-treated RE and analysed at p60. YFP positive hybrids (green) are positive to both rhodopsin (red) and Pde6b (magenta). Nuclei in merged images were counterstained with DAPI . ONL: outer nuclear layer; IN L: inner nuclear layer; GCL: ganglion cell layer.

Figure 9. Damage-dependent cell fusion iii-viva. (A) Schematic representation of cell fusion experimental plan. ln-vivo cell fusion between red —labelled SPCscm with retinal s of L-oxP-STOP-LoxP-YFP mice (R26Y) leads to excision of a floxed stop codon in the l neurons, and in turn, to expression of YFP. The resulting hybrids express YFP and are also labelled in red. (B, C) Confocal photomicrographs of R26Y NMDA—damaged (B) or healthy s (C) of mice transplanted with Fm‘l’e. The mice were ced 24 h after tissue damage. Deiible-positive RFP (red) and YFP (green) hybrids derived from cell fusion are detected in the presence of NMDA damage (B, NMDA), but not in the maged eye (C, No NMDA). Nuclei were counterstained with DAPI (blue). onI: outer nuclear layer; in]: inner nuclear layer; gcl: ganglion cell layer. Scale bar: 50 um. (D) Quantification of hybrids formed 24 h after cell lantation, as percentages of YFP-positive cells on the total red HSPCscruiRFP localised in the optical fields. Sections of NMDA-damaged and non- damaged (No NMDA) eyes were analysed. Data are means is.e.'m.; n = 90 (three different retinal fields of 10 different retinal serial sections, for each eye. Three different eyes were analysed). ***P <0.00‘l. (E-G): I'mmunohistochemical analysis of the l fusion cell partners. YFP hybrids also positive for ganglion (E, Thyl.l, red), ne (F . sintaxin, red) or negative for Muller (G, GS, red) cell s are detected 12 h after transplantation of HSPCsUe in NMDA-damaged eyes. Yellow arrows indicate cells positive to both YFP and marker staining. Scale bar: 10 um.

Figure 10. Analysis of cell fusion events. (A) H&E staining (left) and, schematic representation of the retinal tissue. (B) TUNEL staining (green) on sections of R26Y mice eyes sacrificed 48h after NMDA injection. (C) NMDA treatment in R26Y mice does not activate YFP expression (green) in retinal neurons. (D) Cell transplantation was performed at least in 3 different eyes for each experiment. Then, a total of ten serial sections from each of the eyes were examined in three different regions for each n.

The number ofirnmunoreactive marker positive. of YFP-positive or GFP- positive cells within three areas (40X optical fields) of the retina was counted in dual sections.

The ratio between the latter numbers and the total number of red-labelled. (DiD) cells or RFP positive cells in the same fields resulted. in the percentage of positive cells. The 40X fields (red rectangles) were chosen in areas including the gel and the inl of the retinal . (E) Flow cytometry analysis of tetraploid. cells with a 4C content of DNA was performed. on total cells isolated. from NMDA-damaged. RZnY retinas transplanted with BIO-HSPCu'e. The presence of tetraploid. cells in a GZ/M phase of the cell cycle was detected when gating on the RFP positive cells ds) (right graph) while were not in control unfused RFP HSPCsCrc (left graph). (F) Statistical analysis of the retinal fusion rs. Numbers ent the percentage of YFP hybrids also positive either for a ganglion, amacrine or Mfiller retinal cell markers detected 12 h after transplantation of HSPCscre in NMDA-damaged R26Y eyes.

Figure II. is of ESC and RSPC fusion events. (A) Representative samples of Cscre and. DiD-RSPCsUe injected either into mice eyes pre-treated for 24 h with NMDA to induce cellular damage, or in healthy eyes (No NMDA). In R26Y eyes 24 h after cells injection (DiD cells, red), YFP sion (YFP, green) is detected in the NMDA—damaged eyes (NMDA), but not in the non-damaged eye (No NMDA). Nuclei were counterstained with DAPI (blue). Scale bar: 20 um. (B) fication of YFP-positive cells as percentage relative to the total number of transplanted DiD- ESCscm and DiD-RSPCsCr0 localized in the optical fields. Sections of NMDA-damaged and non-damaged eyes were analysed in mice sacrificed 24h after transplantation. Data are means :ts.e.m.; n=30 (three different areas of '10 different retinal serial sections for each eye). P value <0.001 (***). (C) NMDA (intravitreal) and BrdU peritoneal) were injected in R26Y mice; one day later, unlabelled ESCs were ed vitreal) and. finally BrdU ng was performed. on eye sections of mice sacrificed after further 24 h. Total BrdU positive cells (red. arrows) were counted. in the gel in a 40X field. YFP positive hybrids were never positive to BrdU staining (green arrows). Data are means is.e.m.; n=30.

Figure 12-. Analysis of reprogramming of retinal s after fusion. (A) lmmunofluorescence staining using an anti B-catenin antibody (red) was med on sections from eyes treated either with NMDA. with both NMDA and DKK'] or untreated as control. The expression and nuclear accumulation of B-catenin in retinal cells detected. in NMDA-damaged eyes (red. ) is reduced after treatment with DKKl. Scale bar: 20_um. (B) Schematic representation of iii—viva reprogramming experimental plan. Red—labelled SPCs either non-treated ol), or treated for 24 h with BIO were injected in NMDA-damaged. or undamaged eyes of Nanog-GFP-Puro recipient mice. The sion of GFP in reprogrammed hybrids was analysed one day after injection. (C) NMDA treatment does not activate GFP expression (green) in Nanog-GFP retinal neurons. (D-F) BIO treatment of HSPCs activates B-catenin signalling as shown by RT-PCR of the target gene Axin2 (D) or by nuclear location of B-cate'nin in untreated (E) or BIO-treated (F) cells. (G) Transplantation of BIO-treated HSPCsRFP (red) in healthy Nanog-GFP eyes does not induce vation ofthe Nanog-GFP transgene (green). Nuclei were counterstained. with DAPI.

Figure 13. Activation of the Wnt/B-catenin signalling pathway enhances neuron reprogramming after cellfusion in-vivr). (A) Schematic representation of in-vivo reprogramming experimental plan. Nestin-CRE mice received. intravitreal injection of both NMDA and DKKl, NMDA alone, or PBS as l, one day before HSPCsR26Y injection. Before transplantation, HSPCsR26Y were pre-treated or not with Wnt3a or BIO and labelled with DiD red dye. Samples were analysed 24 h after cell transplantation.

Only as a consequence of cell fusion and reprogramming can the Cre. re-expressed in adult mice due to the tion of the Nestin promoter. induce expression of YFP in hybrids that retain the red membranes. (B) Only in the presence of NMDA Without DKKl do transplanted red HSPCstoY start to express YFP (green arrows). Yellow arrows indicate double-positive red. and green cells. Wnt3a pre-treatment of red ’Y before transplantation ses the amounts of -positive red-”green s. Scale bar: 50 um (C—D) Statistic-a1 analysis of the s of double red/green (DiD!YFP)—positive hybrids detected in Nestin-CRE (C) or Nanog GFP (D) retinas treated. with NMDA, NMDA+DKK1, or untreated (No NMDA), 24 h after transplantation of untreated HSPCs or of Wnt3a- or BIO-treated HSPCs. Percentages were ated as the number of YFP-positive cells with respect to the total number of red HSPCs detected in the optical fields. Data are means is.e.m._; n=90. ***P <0.00’l.

(E) Confocal photomicrographs 24h after transplantation of undamaged (No NMDA) Nanog-GFP retinas and of NMDA Nanog-GFP retinas transplanted with HSPCs pre- treated. with Wnt3a (NMDA + Wnt3 a).

Figure 14. Activation of the Wnt/B-catenin signalling pathway enhances neuron reprogramming after cell fusion in vivo. (A) Representative samples where DiD-ESCs were injected. 24h after PBS injection (No NMDA) or NMDA injection in Nanog-GFP- puro mice. Twenty-four hours after ESC injection, Nanog-GFP expression (green) is detected in ESC-neuron s (red and. green) in NMDA-damaged. (NMDA) but not in non-treated eyes (No NMDA). P-re-treatment with DKK'] (NMDA+DKK'I) reduces the number of GFP-positive hybrids. BIO and Wnt3a pre-treatment of ESCs augmented the number of sitive reprogrammed neurons (red/green) with respect to the non- treated ESCs (No BIO). Nuclei were counterstained with DAPI (blue). Scale bar: 20 um. (B) Hybrids isolated. from NMDA-damaged Nanog-GFP eyes transplanted with BIO-treated (BIO) or untreated (No BIO) ESCs where cultured. in vitro under puromyein selection. A mean of 23 sitive clones where detected after one month of cell culturing. Clones are also positive to the alkaline phosphatase staining.

(C) Transplanted RSPCs (red) do not reprogram NMDA-damaged. retinal neurons in presence or not of BIO ent. Nuclei were counterstained With DAPI (blue). (D) Statistical analysis of the percentage of YFP- hybrids after injection of either untreated or BIO-treated HSPCs‘I‘lI“ (white bars). ESCsC” (gray bars) or RSPCsCI“ (black bars), in R26Y eyes eated (NMDA) or not (No NMDA) with NMDA.

Figure 15. Characterisation of the reprogrammed s. (A) RT-PCR analysis of the expression of different genes in RFP positive hybrids sorted by FACS 24 h after transplantation of BIO (black bars) or non-BlO-trcatcd (grey bars) MRFP in R26Y NMDA—damaged eyes. (B) Confocal photomierographs of NMDA-damaged R26Y retinas transplanted with BIO-treated HSPCsCIO and d 24 h later with anti- Oct4, anti-Nanog, anti-Nestin, anti cKit or anti Tuj-l antibodies. YFP positive hybrids (green) were also positive to Oct4, Nanog and Nestin (red, arrows) sion, however they were not positive to c-Kit or Tuj-l , arrows). Scale bar: 50 p.111. (C-D) Species-specific gene expression was evaluated. by RT-PCR using mouse (C) or human (D) c oligos in hybrids FACS-sorted 24h after transplantation of BIO—treated and DiD labelled human CD34+ HSPCs in NMDA—damaged eyes of Nanog-GFP mice. (E- J) amaged R26‘i’ eyes were intravitreally injected with BIO treated (BIO) or untreated (N0 BIO) HSPCsCfe and analyzed 24h later. To evaluate eration (E—G and I) and cell death (F, H and J) of YFP positive hybrids (green), sections were stained either with anti-Ki67 (G and. 1, red.) or anti-Annexin V (H and. J) antibodies. The amount of positive hybrids was evaluated as the percentage of Ki67 (E) or Annexin V (F) positive cells ve to the total number ofYFP hybrids. Data are means is.e.m.; n=30.

P value <0.001 (***). Yellow arrows in G and. J indicated Ki67 positive or Annexin V positive hybrids respectively. Scale bar: 50 um. (K—L) The expression of markers for ESCs (Oct4, Nanog), mesoderm (Gata4), e'ndoderm (Handl), neuroectoderm (Nestin, Noggin and Otx2), HSPCs (c-Kit and Seal) or ally differentiated neurons (Tuj-l) were evaluated in YFP hybrids formed after BIO-treated (K) or non-treated (L) HSPCsCrc injected into NMDA-damaged eyes of R26Y mice and sacrificed 24 (white bars), 48 (grey bars) and 72 h (black bars) after cell transplantation. Data are means is.e.m.; n=30.

Figure 16. Proliferation and. gene expression in the hybrids. (A-B) RT-PCR analysis of untransplanted NMDA-damaged. R26Y retinas (A) or of untreated, (No BIO, grey bars) or BIO-treated (BIO, black bars) HSPCs cells. (C) Confocal photomierographs of NMDA-damaged. Nanog-GFP retinas transplanted with DiD- labelled and BIO-treated human CD34+ HSPCs (red). YFP positive s (green/red cells, yellow ) were detected. (D-E) Ki67 (D) and Annexin V (E) staining were med on YFP-positive reprogrammed hybrids obtained after injection of BIO- treated or untreated ESCs in NMDA-damaged R26Y eyes. Positive hybrids were evaluated as the percentage of positive cells ve to the total number of YF P hybrids.

Data are means is.e.n1.; n=30. P value <0.001 (***). (F) The expression of markers for mesoderm (Gata4), endoderm (Handl). neuroectoderm (Nestin, Noggin and Otx2), terminally differentiated neurons (Tuj-l) or ESCs (Oct4, Nanog) were evaluated in YFP hybrids formed after BIO-treated HSPCsC”e injection into NMDA-damaged eyes of R26Y mice sacrificed 24 (white bars), 48 (grey bars) and 72h (black bars) after cell transplantation. Data are means ofn=30.

Figure [7. NMDA-damagcd retinas can be regenerated after fusion of transplanted HSPCs. (A) H&E staining g increase 'in thickness of the inner nuclear layer (inl, ts) and regeneration ofthe ganglion cell layer (gel, arrowheads) in NMDA-damaged retina one month after BlO-HSPCscre transplantation. Arrows indicated. ganglion cell loss in the NMDA—damaged retinas. Scale bars: 50 mm. (B-C) Quantification of ganglion nuclei in the gcl (B) and nuclear rows in the inl (C) as d in vertical retinal sections of damaged (NMDA) or undamaged retinas transplanted with BIO-treated (BIO) or untreated. HSPCs. Data are means is.e.m. (n = 30). ***P < 0.001. (D) Neurons in the gel were counted along nasoremporal (left) and dorsoventral (right) axes and. graphed cells per millimeter d. A total of 80 different images ing the whole retina were counted for each sample. Data are means is.e.m. from 3 retinas. *P < 001. ON: optic nerve. (E) Total cells in the gel excluding endothelial cells were counted along nasotcmporal (left) and dorsoventral (right) axes and graphed as y maps. Dark red corresponds to a cell density of ,000 cellsfmmz, as indicated in the color bar.

Figure 18. Long-term differentiation potential of the hybrids obtained after cell fusion-mediated reprogramming. (A) mental strategy to identify YFP- hybrids one month afier BIO-treated or ted HSPCsCre in NMDA-damaged R26Y retinas.

(B) YFP+ neurons were detected in NMDA-injured R26Y retinal flat mounts one month after BIO—HSPCsOre transplantation. Nuclei were counterstained with DAPI (blue).

Scale bars: 50 pm. A higher magnification of the YFP+ neurons is shown in the right panel. (C) YFP+ differentiated hybrids ) expressed either the ganglion cell marker SMI-32 (left, red) or the amacrine cell marker Chat (right, red). (D) YFP+ axons (green) were detected in optic nerves from eyes transplanted with BlO-HSPCsC", but not with untreated- HSPCsm. A higher ication of the YFP+ positive axons (green) in the optic nerve is shown in the right panel.

Figure 19. Analysis of bone marrow replacement efficiency and analysis of hybrid proliferation and. apoptosis after endogenous BM mobilization and cell fusion.(A) entative chromocytometric analysis of mice one month after bone marrow replacement. (B-C) Ki67 (B) and Annexin V (C) staining were med on YEP-positive reprogrammed hybrids obtained 24h afier injection of B10 in NMDA- REP-"Cm damaged R26Y eyes from mice that received BM replacement.

Figure 20. Endogenous BM-derived cells ted in damaged eyes can fuse with retinal neurons. (A) Experimental scheme. R26Y mice ed BMRFN3m transplantation via tail vein injection after sub-lethal irradiation. After BM reconstitution (1 month), right eyes received an intravitreal injection of NMDA, left eyes were not injected; the mice were analyzed. 24 h later. Only in case of cell fusion of ted-BM cells (red) and neurons, YFP/RFP double positive hybrids are detected.

(B-F) Double ve YFP/RFP hybrids were detected in NMDA-damaged (B-C.

NMDA) but not in healthy (D-E, No NMDA) eyes. (F) The percentage of YFPJRFP double positive hybrids with respect to the total number of detected. RFP cells was ated. (G—K) Immunohystochemical analysis of the retinal cell-fusion partners.

YFP hybrids ) are also positive for Seal (G) and c-Kit (H) HSPCs markers and for ganglion (I, Thyl.ln red), amacrine (J, syntaxin, red) and Muller (K, GS, red) retinal ‘25 cell markers 24 h after NMDA damage. Yellow arrows indicate double positive cells.

Scale bar: 50 pm.

Figure 2|. Endogenous BM cell fusion-mediated reprogramming of retinal neurons is induced by BIO. (A) Experimental scheme. Nestin-Cre mice received BMR26Y transplantation via tail vein injection after thal irradiation. Afier BM reconstitution (1 month), right eyes received an intravitreal injection of BIO+NMDA, while the contralateral eyes were injected with NMDA alone. Only in case of cell fusion-mediated reprogramming of hybrids between reeruited-BMCsRA“ and neurons, -med'iated Cre expression leads to expression of the YFP. (B-C) Only after BIO injection (C), YFP positive reprogrammed hybrids (green) after fusion of recruited BM- cells and damaged neurons were detected. In contrast no YFP hybrids (B) were seen in NMDA-damaged eyes without BIO. (D-E) Percentages of proliferating (Ki67 positive, D) or dying (AnnexinV positive, E) hybrids were evaluated. as the number of YFP double positive cells with the t to the total amount of YFP cells. Data are means is.e.m.; n=30. (F-I) Confocal ic-rographs of IO treated. retinas show expression of Oc-t4 (red in F—G) and Nanog (red in H-I) proteins in YFP-reprogrammed s (green, see merge in G and. I). Percentages of Oct4 and Nanog positive hybrids (E) were evaluated as the number of YFP double positive cells with the respect to the total amount of YFP cells. Data are means is.e;m._; n=30.

Figure 2-2. Macrophage/monocyte analysis after HSPCs transplantation. (A) Representative confocal image of flat-mounted NMDA-damaged retinas 1 month after transplantation of untreated HSPCs. Only few YFP+ cells (green) were detected. Scale bars: 50 um. (B) Optic nerve harvested. 24 h after transplantation of HSPCsUe in NMDA-damaged R26Y eyes. Scale bars: 200 um (C-F) FACS analysis as percentages of RFP+/YFP+ hybrids also positive for CD45 (C-E) and M acI (D-F) ng 24 h (C, D) and 2 weeks (E, F) after lantation of HSPCsCWRFP in NMDA-damagcd R26Y eyes.

ED DESCRIPTION OF THE INVENTION Retinal ration can be achieved by implanting some types of cells into the retina of a subject, said cells having properties of stem cells or progenitor cells such as hematopoietic stem cells, progenitor cells and/or mesenchymal stem cells. These cells fuse with retina] cells such as retinal neurons, e.g., rods, ganglion cells, amaerine cells, and the like, or with retinal glial cells, e. g., Miiller cells, to form hybrid cells which in turn de—differentiate and finally differentiate in retinal neurons of interest, e.g., photoreceptor cells and/or ganglion cells, etc., wherein tion of Wnt-‘B-eatenin signalling pathway in the implanted. cells or in the hybrid cells is essential to induce de- differentiation of said hybrid cells and. final re—differentiation in the retinal neurons of interest. In an embodiment, activation of the Wnt/B-cateni-n signalling pathway is, at least lly, provided by the ted cells (which have been treated with a Wnt/B- n signalling pathway activator, or with an inhibitor of a Wnt/B-catenin ling pathway sor, and/or press a Wnt/B-catcnin signalling y activator), whereas in r embodiment, activation of the Wnt/B—catenin signalling y is only provided as a result of administering a W'nt’B-catenin signalling pathway activator, 'J‘I or with an inhibitor of a W'nL’B-catenin signalling y repressor, to the subject to be treated or as a consequence of a retinal damage or inj ury, as occurs in, for example, retinal degeneration diseases.

Use of cells havinoI properties of stem cells or progenitor cells for treatment of retinal degeneration diseases bv reproolramming= mediated by activation of the Wnt/ -catenin athwa ~' of retinal cells fused to said cells ent A In an aspect, the invention relates to a cell, said cell having its Wnt/B-catenin signalling pathway activated and being selected from the group consisting of a hematopoietic stem cell, a progenitor cell, and a mesenchymal stem cell, for use in the treatment of a retinal degeneration disease. In other words, according to this aspect, the invention provides a cell selected from the group consisting of a hematopoietic stem cell (HSC), a itor cell, and, a hymal stem cell (MSC), wherein the Wnt/B- catenin signalling pathway of said cell is activated, for use in the treatment of a retinal degeneration disease.

Thus, the invention provides a cell selected from the group consisting of a poietic stem cell, a progenitor cell, and a mesenchymal stem cell, wherein said cell is treated with a Wnt/B-catenin signalling pathway activator, or with an inhibitor of a Wnt/B-catenin signalling pathway repressor, and/or it is a cell that overexpresses a Wnt/B-catenin signalling pathway activator for use in the ent of a retinal degeneration disease. As a result of said treatments, or cell manipulation to overexpress a Wnt/B-catenin signalling pathway activator, the cell has its Wnt/B-catenin signalling pathway activated and can be used in the treatment of a retinal degeneration disease. To that end the cell so treated or manipulated is implanted in the eye of a subject in need of treatment of a retinal degeneration disease.

In other words, this aspect of the ion relates to the use of a cell, said cell having its Wnt/B-catenin signalling y activated and being selected From the group consisting of a hematopoietic stem cell, a progenitor cell, and a mesenchymal stem cell, in the cture of a pharmaceutical composition for the treatment of a retinal degeneration disease; or, alternatively, this aspect of the invention relates to the use of a cell selected from the group consisting of a hematopoietic stem cell, a progenitor cell, and a mesenchymal stem cell, wherein said cell is treated with a Wnt/B- catenin signalling y activator, or with an inhibitor of a Wnt’B-catenin signalling pathway repressor, r overexpresses a Wnt’B-c-atenin signalling pathway activator, in the manufacture of a pharmaceutical ition for the treatment of a retinal degeneration disease.

According to Treatment A, activation of the Wnt/B-catenin signalling pathway is, at least partially, ed by the implanted cells having their Wnt/B-catcnin signalling pathway ted and being selected from the group consisting of a hematopoietic stem cell, a itor cell, and a mesenchymal stem cell. . The subject to be treated may also have activated. the Wnt-‘B—catenin signalling pathway after retinal damage or injury.ln general, the Wnt/B-catenin signalling pathway is activated when the target genes are transcribed; by illustrative, activation of the Wnt/B-catenin signalling pathway may be confirmed. by tional techniques, for example, by analyzing the expression of the target genes, e.g., AxinZ, by means known by the skilled person in the art to analyze the expression of genes, such as, for example, RT-PCR (reverse transcription-p0lymcrase chain reaction), or by detection of B-catenin translocation in the nuclei of the cells by tional techniques, such as, for example, by immunostaining, or by detecting the phosphorylation of Dishevelled or the phosphorylation ofthe LRP tail, etc.

The manner in which the Wnt-‘B-eatenin signalling pathway is activated. can vary. By illustrative, activation of the Wnt/B-catenin ling pathway in a cell selected from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, and a mesenchymal stem cell (MSC) can be achieved by treating said cell with a Wnt/B-catenin signalling pathway activator, or with an inhibitor of a W’Iit’B-catcnin signalling pathway repressor, in such a way that said pathway is activated, or by manipulating the cell to overexpress a protein or peptide which is a Wnt/D-catenin ling pathway activator, as it will be discussed below. Alternatively, activation of the Wnt/B-catenin signalling pathway can be achieved as a consequence of a l damage or injury. as occurs in, for example. l degeneration diseases or by administering a Wnt/fi-catenin signalling pathway activator to the subject to be treated or an inhibitor of a Wnt/B-catenin signalling pathway repressor, in such a way that said y is activated, as it will be discussed. below.

The term “Hematopoietic stem cell” or “HSC”, in plural , as used herein refers to a multipotent stem cell that gives rise to all the blood cell types from the myeloid. (monoc-ytes and macrophages, neutrophils, basophils, eosinophils, ocytes. ryocytesfplatelets, dendritic cells), and lymphoid lineages (T-c-ells, B-cells, NK-cells). HSCs are a heterogeneous tion. Three classes of stem cells exist, distinguished by their ratio of lymphoid to myeloid progeny (L/M) in blood.

Myeloid-biased (My-bi) HSCs have low L/M ratio (>0, <3), whereas id-biased (Ly-bi) HSCs show a large ratio (>10). The third. category consists of the balanced.

(Bala) HSCs for which 3 S L/M : 10. As stem cells, HSCs are defined by their ability to replenish all blood cell types (multipotency) and their y to self-renew. In reference to phenotype, HSCs are identified by their small size, lack of lineage (lin) markers, low staining (side population) with vital dyes such as rhodamine ”123 (rhodamine DU LL, also called. mold) or Hoechst 33342, and presence of various antigenic markers on their e. In humans, the majority of HSCs are CD34+CD38-CD90+CD45RA-.

However, not all HSCs are covered by said combination that, nonetheless. has become popular. In fact. even in humans. there are HSCs that are D38-. In a preferred embodiment the HSC is a mammalian cell, ably a human cell.

In a particular embodiment the HSC is a long-term HSC (LT-HSC), i.e._. a hematopoietie stem cell which is capable of contributing to hematopoiesis for months or even a lifetime and it is characterized by CD34-, C'D38-, SC‘A-l+, Thyl.1+,/low_, C-kit+, lin-_. CD135-_. Slamfl/CD150+.

In another particular embodiment the HSC is a short—term HSC (ST—HSC), i.e., a HSC which has a reconstitution ability that is limited to several weeks and it is CD34+_.

CD38+, SCA-H, Thy’l.l+/low, C-kit+, lin-, CD'135-_. Slamfl/CD'150+_. Mac-l (CD1 lb)low.

The term “M” as used herein refers to a cluster of differentiation present on certain cells within the human body. It is a cell surface rotein and Functions as a cell-cell adhesion . It may also mediate the attachment of stem cells to bone marrow extracellular matrix or directly to stromal cells. Cells expressing CD34 (CD34+ cell) are ly found in the umbilical cord and bone marrow as poietic cells, a subset of mesenchymal stem cells, endothelial progenitor cells, endothelial cells of blood vessels but not lymphatic-s. The complete protein sequence for human CD34 has the UniProt accession number P28906 (July 26, 2012).

The term “CD38” as used herein refers to a cluster of differentiation 38, also known as cyclic- ADP ribose hydrolase is a glycoprotein found on the surface of many immune cells (white blood cells), including CD4+, CD8+, B and natural killer cells.

CD38 also functions in cell adhesion, signal transduction and calcium signalling. CD38 is a type II transmembrane protein that functions as a signalling molecule and mediates the adhesion between lymphocytes and endothelial cells. It also ons enzymatic-ally in the formation and hydrolyzation of the second messenger cyclic ADP ribose. In the hematopoietic system, CD38 is most highly expressed. on plasma cells. The complete n sequence for human CD38 has the t accession number P28907 (July 26, 2012).

The term “CD90” or Thy-l as used herein refers to Cluster of Differentiation 90, a 25—37 kDa heavily N—glycosylated, g1ycophosphatidylinositol (GPI) anchored. conserved cell surface protein with a single V-like immunoglobulin domain (The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel B-strands arranged in two B-sheets with a Greek key topology), originally discovered as a thymocyte antigen. The complete n sequence for human CD90 has the UniProt ion number P04216 (July 26, 2012).

The term “m” as used. herein refers to family consisting of multiple members that are all products of a single complex gene. This gene contains 34 exons and three exons of the primary transcripts are alternatively d to generate up to eight different mature mRNAs and after translation eight different n products. These three exons generate the RA, RB and RC isoforms. Various isoforms of CD45 exist: CD4SRA, CD45RB, CD45RC, CD45RAB, CD45RAC, CD4SRBC, CD45R0, (.‘D45R (ABC). The complete proteinsequence for human CD45 has the UniProt accession number P08575 (July 26, 2012).

The term “SCA-l” refers to ataxin l which Function is unknown. The complete protein sequence for human SCA-l has the UniProt accession number P54253 (July 26, 2012).

The term “c-kit” refers to a Mast/stem cell growth factor or (SCFR), also known as proto-oncogene c-Kit or tyrosine-protein kinasc Kit or CD117, is a protein that in humans is encoded. by the KIT gene. CD117 is a receptor tyrosine kinase type III, which binds to stem cell factor, also known as "steel factor" or "c—kit ligand". The complete protein sequence for human c-kit has the UniProt accession number P10721 (July 26, 2012).

The term “CD135”, as used herein refers to r of differentiation antigen 135 (CD135) also known as ke tyrosine kinasc 3 (FLT-3) or receptor-type tyrosine-protein kinase.CD135 is a cytokine or expressed on the surface of hematopoietic progenitor cells. The complete protein sequence for human CD135 has the UniProt accession number P36888 (July 26, 2012).

The term I”, as used herein refers to signalling lymphocytic activation molecule is a protein that in humans is encoded by the SLAMFl gene. SLAMFI has also ly has been designated CD150 (cluster of differentiation 150). The te n sequence for human SLAMFI has the UniProt accession number Q13291 (July 26,2012).

The term “Mac-1 tCDllb)”, as used. herein refers to a Integrin alpha M (ITGAM) is one protein subunit that forms the heterod'imeric integrin alpha-M beta-2 (niMB2) molecule, also known as macrophage-'1 antigen ) or complement. ‘25 receptor 3 (CR3). ITGAM is also known as CR3A, and cluster of differentiation molecule [18 (CDl'l B). The complete protein sequence for human Mac-l has the UniProt accession number P11215 (July 26, 2012).

The term “li_n” refers to lineage s, a standard cocktail of antibodies designed. to remove mature hematopoietic cells from a sample. Those antibodies are targeted to CD2, CD3, CD4, CD5, CD8, NK1.1, B220, TER-119, and. Gr-l in mice and, CD3 (T lymphocytes), CD14 (Monocytes), CD16 (NK cells, granulocytes), CD19 (B lymphocytes), CD20 (B lymphocytes), and CD56 (NK cells) in humans.

A “progenitor cel ” refers to a cell that is derived from a stem cell by differentiation and is capable of further differentiation to more mature cell types.

Progenitor cells typically have more restricted proliferation capacity as compared to stem cells. In a particular embodiment, the itor cell is a hematopoietic progenitor cell derived from a HSC by entiation during the progression from HSCs to differentiated functional cells. The hematopoietic progenitor cell is characterized. by the markers D38-CD90-CD45RA—. In a preferred embodiment the progenitor cell is a ian cell, preferably a human cell.

In a particular ment the progenitor cell is an Early Multipotent Progenitor (Early MPP) terized by CD34+, SCA-l+, Thyl.I-, C-kit+, lin-, , Slamfl/CD']50-, Mac-l (CD1 I b)l0W_. CD4low.

In another particular embodiment the progenitor cell is a Late Multipotent Progenitor (Late MPP) defined by CD34+, SCA-I+, Thyl .l-, C-kit+_. lin-, CD135high, Slamfl.-’CD150-, Mae-l (CD11b)low, .

In another particular embodiment the progenitor cell is a Lineage-restricted Progenitor (LRP) cell characterized by CD150-CD48+CD244+.

In another particular embodiment the progenitor cell is a Common Myeloid Progenitor (CM P), i.c., a colony forming unit that generates myeloid cells characterized by CD34+CD38+1L3Ral°wCD4SRA3 In another particular embodiment the progenitor cell is a Granu.locyte-.Vlaerophage Progenitor (0MP), the precursor for monoblasts and. 'myeloblasts characterized by CD34+CD38+I L3Ra-C D45Ra-.

In another ular embodiment, the progenitor cell is a Megakaryocyte- E'ryth‘roid Progenitor (M EP) characterized by CD34+C D38+I L3 RA+ CD45 RA-.

The term ” as used herein refers to cluster of differentiation 4. It is a glycoprotein found on the surface of immune cells such as T helper cells, monoeytes, hages, and dendritic cells. CD4 is a eptor that assists the T cell receptor (TCR) with an antigen—presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR by recruiting an enzyme, known as the tyrosine kinasc lck, which is essential for activating many molecules involved in the signalling cascade of an activated T cell. CD4 also interacts directly with MHC class II molecules on the surface of the antigen-presenting cell using its extracellular domain.

The complete protein sequence for human CD4 has the UniProt accession number P01730 (July 26, 2012).

The term “M” as used herein refers to CD244 molecule, natural killer cell receptor 234. This gene encodes a cell surface receptor sed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. The complete protein sequence for human CD244 has the UniProt accession number Q9BZW8 (July 26, 2012).

The term “IL3RA” as used. herein refers to Interleukin 3 receptor, alpha (low affinity) ), also known as CD123 (Cluster of Differentiation 123), is a type I transmembrane protein of 41.3 Kda and IL-3RA has been shown to interact With Interleukin 3. The te n sequence for human IL3RA has the UniProt accession number P26951 (July 26, 2012).

The term “Mesenchymal stem cell” or “MSC”, in plural “MSCs”, as used. herein, refers to a multipotent stromal cell that can differentiate into a variety of cell types, including: osteoblasts (bone cells), ehondrocytes (cartilage cells), and. adipocytes (fat cells). Markers expressed by mesenchymal stem cells include CD105 (8H2), CD73 (SH3/4), CD44, CD90 (Thy-l}, CD71 and Stro-l as well as the adhesion molecules CD106, CD166, and. CD29. Among negative markers for MSCs (not expressed) are poietic markers CD45, CD34, CD14, and the costimulatory molecules CD80, CD86 and CD40 as well as the on molecule CD31 .

The term “m” as used herein refers to endoglin, a type I membrane glycoprotein located on cell surfaces and is part of the TGF beta receptor complex. The complete protein sequence for human CDIOS has the UniProt accession number Pl 7813 (July 26, 2012).

The term “CD73” as used herein refers to 5'-nu.cleotid.ase ), also known as ecto-5'-nu.cleotidase or CD73 (Cluster of entiation 73), is an enzyme that in humans is encoded by the NTSE gene. The complete protein sequence for human CD73 has the Uni Prot accession number P21589 (July 26, 2012).

The term “M” refers to antigen is a cell-surface glycoprotcin involved in ell ctions, cell adhesion and ion. The complete protein sequence for human CD44 has the UniProt accession number P16070 (July 26, 2012).

The term “CD71”, as used herein refers to Transferrin receptor protein 1 (Tle) also known as (Cluster of Differentiation 71) (CD71) is a n that is required for iron delivery from transferrin to cells. The complete protein sequence for human CD71 has the Uni Prot accession number P02786 (July 26, 2012).

The term “W” as used herein refers to a cell surface protein expressed by bone marrow stromal cells and erythroid precursors.

The term “CD106” refers to a Vascular cell adhesion protein 1 also known as vascular cell adhesion molecule 1 (VCAM-l) or cluster of differentiation 106 (CD106) is a protein that in humans is encoded by the VCAM] gene and functions as a cell adhesion molecule. The complete protein ce for human CD106 has the UniProt accession number P19320 (July 26, 2012).

The term “CD166” as used herein, refers to a 100-105 kD typel transme‘mbrane rotein that is a member of the i-mmunoglobulin superfamily of proteins. The complete protein sequence for human CD166 has the UniProt accession number 0 (July 26, 2012).

The term “M” as used. herein refers to a integrin beta-1 is an integrin unit associated. with very late antigen receptors. The complete n sequence for human CD29 has the UniProt accession number P05556 (July 26, 2012).

The term “CD14”, as used. herein refers to cluster of differentiation 14 which is a component of the innate immune system. The complete protein sequence for human CD14 has the UniProt accession number P08571 (July 26, 2012).

The term “M” as used herein Cluster of Differentiation 80 (also CD80 and. 87-1) is a n found on ted B cells and 'monocytes that provides a costi'mulatory signal necessary for T cell activation and survival. The complete protein ‘25 sequence for human (TDSO has the UniProt accession number P3368 '1 (July 26, 2012).

The term “CD86” as used herein refers to r of Differentiation 86 (also known as CD86 and B7-2) is a protein sed on antigen—presenting cells that provides costimulatory signals necessary for T cell activation and al. The complete protein sequence for human CD86 has the UniProt accession number P42081 (July 26,2012).

The term “CD40” as used herein refers to a costi'mulatory protein found on antigen presenting cells and is required for their activation. The te protein sequence for human (.‘D40 has the UniProt accession number P25942 (July 26, 2012).

The term “w”, as used herein, refers to a Platelet endothelial cell on molecule (PECAM-l) also known as cluster of differentiation 3'] (CD31) is a protein that plays a key role in removing aged neutrophils from the body. The complete protein sequence for human CD31 has the UniProt accession number P16284 (July 26, 2012).

The presence/absence of a marker in a cell can be determined, for e, by means of flow cytometry using conventional methods and apparatuses. For instance, a BD LSR 11 Flow Cytometer (BD Biosciences Corp, Franklin Lakes, NJ, US) with commercially available antibodies and following protocols known in the art may be employed. Thus, cells emitting a signal for a specific cell surface marker more intense than the background noise can be selected. The background signal is defined as the signal intensity given by a non-specific antibody of the same isotype as the specific dy used to detect each surface marker in the conventional FACS analysis. In order for a marker to be ered positive, the observed c signal must be 20%, preferably, %, 40%, 50%, 60%, 70%, 80%, 90%, 500%, [000%, 5000%, '10000% or above more intense than the background signal using conventional methods and apparatuses (cg. by using a FACSCalibur flow cytomctcr (BD Bioscicnccs Corp, Franklin Lakes, NJ , US') and commercially ble antibodies). Otherwise the cell is considered negative for said marker.

In a particular embodiment, the cell for use in the treatment of a retinal degeneration disease according to Treatment A, said cell having its Wnt/B-catenin signalling pathway ted, is a HSC. In another ular embodiment, said cell is a LT-HSC or a ST-HSC.

In another particular ment, the cell for use in the treatment of a retinal degeneration disease according to Treatment A, said. cell having its Wnt/B-catenin signalling pathway activated, is a progenitor cell. In another particular embodiment, said itor cell is an Early .VIPP, a Late MPP, a LRP, a (IMP, a GMP or a MEP.

In another particular embodiment, the cell for use in the ent of a retinal degeneration disease according to Treatment A. said cell having its Wnt/B-catenin signalling pathway activated, is a MSC.

The cells for use in the treatment of a retinal degeneration disease according to the invention may be g part of a tion of said cells which use in the treatment of a retinal degeneration disease tutes an additional aspect of the present invention.

Thus. in other aspect. the invention further relates to a cell population comprising a plurality of cells, said, cells having their Wnt/B-catenin signalling pathway activated and. being ed from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, a mesenchymal stem cell (MSC) and. any combination thereof, for use in the treatment of a l degeneration e. Thus, according to this aspect, the invention provides a cell population comprising a ity of cells, said cells being selected from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, a mcse'nchymal stem cell (MSC), and any combination thereof, wherein the W'nt/B- cate'nin signalling pathway of said cells is activated, for use in the treatment of a retinal degeneration disease.

In other words, the invention relates to a cell population comprising a ity of cells, said cells being selected. from the group consisting of a HSC, a progenitor cell, a MSC and any combination thereof, wherein said cell are treated with a Wnt/B-catenin signalling pathway activator, or with an inhibitor of a W'nt/B-catenin signalling pathway 'reprcssor, and/or said cells ovcrcxpress a Wnt/B-catcnin signalling pathway activator, for use in the treatment of a retinal degeneration disease. As a result of said treatments, or cell lation to overexpress a protein or peptide which is a catenin signalling pathway activator, the cells of the cell population have their Wnt/B-catenin signalling pathway activated and can be used in the treatment of a retinal degeneration e. To that end the cell population is implanted in the eye of a subject in need of treatment of a retinal degeneration disease.

Alternatively drafted. this aspect of the invention relates to the use of a cell tion comprising a plurality of cells, said. cells having their Wnt/B-catenin signalling pathway activated and. being ed, from the group consisting of HSCs, progenitor cells, MSCs and any ation thereof, in the manufacture of a pharmaceutical composition for the treatment of a retinal degeneration disease; or. alternatively, to the use of a cell population comprising a plurality of cells, said cells being selected. from the group consisting of a HSC, a progenitor cell, a MSC and. any combination thereof, wherein said cells are treated with a Wnt/B-catenin signalling pathway activator, or with an inhibitor of a Wnt/B-catenin signalling pathway repressor, and/or overexpress a Wnt/B-catenin signalling pathway activator, in such a way that said Wnt/B-catenin signalling pathway is activated, in the manufacture of a pharmaceutical composition for the treatment of a retinal degeneration disease.

The particulars of said. HSCs, progenitor cells, and MSCs have been previously mentioned. The particulars of the above mentioned treatments aimed to activate the Wnt’B-catenin signalling y will be discussed below.

In a particular embodiment, the cell population for use in the treatment of a retinal ration e according to Treatment A comprises a ity, i.e., more than two, of HSCs, said cells having their Wnt/B-catenin signalling pathway activated.

In a particular embodiment, said HSCs are selected from L-T-HSC, ST-HSC and combinations thereof.

In another ular embodiment, the cell population for use in the treatment of a retinal ration disease according to Treatment A comprises a plurality of progenitor cells, said cells having their Wnt/B-catenin signalling pathway activated. In a particular embodiment, said progenitor cells are selected from Early MPP, a Late MPP, a LRP, a CMP, a GMP, MEP and combinations thereof.

In another particular embodiment, the cell population for use in the ent of a retinal degeneration disease according to Treatment A comprises a plurality of MSCs, said cells having their Wnt/B—cate'nin signalling pathway ted.

In a ular embodiment, the cell tion for use in the treatment of a retinal degeneration disease according to Treatment A comprises at least one HSC and at least one progenitor cell, said cells having their W'nt/B-catenin signalling pathway activated. In a particular embodiment, said. HSC cell is a LT-HSC or a ST-HSC; in another particular embodiment, said progenitor cell is an Early MPP, a Late MPP, a LRP, a CMP, a GMP or a MEP.

In r partiCular embodiment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment A ses at least one HSC and at least one MSC, said cells having their Wnt/B-catenin signalling pathway activated. In a particular embodiment, said HSC cell is a LT-HSC or a ST-HSC.

In r particular embodiment, the cell population for use in the treatment of a retinal degeneration e according to Treatment A comprises at least one progenitor cell and at least one MSC, said cells having their Wnt/fi-catenin signalling pathway activated. In a particular embodiment, said progenitor cell is an Early MPP, a Late MPP, a LRP, a CMP, a GMP or a MEP.

In another partiCular embodiment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment A comprises at least one HSC, at least one progenitor cell and. at least one MSC, said cells having their WnU’B-eatenin signalling y activated. In a ular embodiment, said HSC cell is a LT-HSC or a ST—HSC; in another particular embodiment, said progenitor cell is an Early MPP, a Late MPP, a LRP, a CMP, a GMP or a MEP.

In a particular ment, a cell population comprising HSCs, precursor cells and MSCs, obtainable from bone marrow, is identified sometimes herein as “HSPC”, i.e._, as “hematopoietic stem and. progenitor cells”. Said cell population HSPC may include HSC, progenitor cells and M80; in different ratios or proportions. Said. HSPC cell population can be obtained, for example, from bone marrow, or, alternatively, by mixing HSCs, progenitor cells and MSCs, in the d ratios or proportions, in order to obtain a HSPC cell population. The skilled person in the art will understand that said cell population may be enriched in any type of specific cells by tional means, for example, by separating a specific type of cells by any suitable technique based. on the use of binding pairs for the ponding surface markers. Thus, in a particular embodiment. the HSPC cell population may be enriched in HSCs, or in progenitor cells, or in MSCs. In order that said cell population identified as HSPC is suitable for use in the treatment of a retinal degeneration disease according to Treatment A, it is necessary that the cells of said. cell population have their Wnt/B-catenin ling pathway activated.

For use within the teachings of the present invention, the cell having its Wnt/B- catenin signalling pathway activated. and being selected. from the group consisting of a hematopoietic stem cell, a progenitor cell, and a mesenchymal stem cell, for use in the treatment of a retinal degeneration disease according to the ion, or the cell population for use in the treatment of a retinal ration disease according to the invention, may be from the same t, i.e., autologous, in order to minimize the risk of eventual rejections or red side reactions; heless, the invention also contemplates the use of allogeneic cells, i.e., cells from other subject of the same s as that of the recipient subject in which case the use of ic or local i'mmunosuppressive agents may be recommended, although the retina has low immune response, and, therefore, compatible cells from a ent human subject could be used provided that said cells are selected from HSCs, progenitor cells, and MSCs and, subjected to a treatment or manipulation to have their Wnt/B-catenin signalling pathway activated as mentioned. above.

The expression E-catenin signalling pathway” refers to a network of proteins that play a variety of important roles in embryonic development, cell differentiation, and cell ty generation. Unless ise indicated, it refers to the cal Wnt pathway and includes a series of events that occur when W'nt proteins bind to cell-surface receptors of the Frizzled family, causing the receptors to activate Dishevelled family proteins and. ultimately resulting in a change in the amount of B- catenin that reaches the nucleus. Dishevelled (DSH) is a key component of a membrane-associated Wnt receptor complex, which, when activated. by Wnt binding, inhibits a second complex of proteins that includes axin, glycogen synthase kinase 3 (GSK-3), and the protein adenomatous polyposis coli (APC). The axin/GSK-3/APC complex ly promotes the proteolytic degradation of the B-catenin intracellular signalling molecule. Afier this. B—catenin destruction x is inhibited, a pool of cytoplasmic B-catenin stabilizes, and some B-cateni'n, is able to enter the nucleus and interact with TCF/LEF family transcription factors to promote specific gene expression.

Several protein kinases and protein phosphatases have been associated with the ability of the cell surface Wnt—activated Wnt receptor complex to bind axin and emble the axin/GSK3 complex. Phosphorylation of the cytoplasmic domain of LRP by CKl and GSK3 can regulate axin binding to LRP. The protein kinase ty of GSK3 appears to be important for both the formation of the membrane—associated Wnt/FRZ/LRP/DSI-L/Axin complex and the function of the Axin/APC/GSKS/B—catenin complex. Phosphorylation of B-catenin by GSK3 leads to the ction of B—catenin.

A “W‘nt/ -catenin si nallin oathwa activator”, as used herein, refers to a molecule capable of activating the Wnt’B-catenin signalling pathway. In general, the Wut’fi-catenin signalling pathway is activated when the target genes are transcribed; by illustrative, tion of the Wnt/B-catenin signalling pathway may be confirmed by analyzing the expression of the target genes, e.g., Axi'n2, by RT-PCR. or by detection of B-catenin translocation in the nuclei of the cells by, e.g., immunostaining, or by ing the phosphorylation of Dishevelled or the phosphorylation of the LRP tail, etc.

Wnt/B-catenin signalling pathway activators may act on membrane receptors of Wnt signalling proteins and on the proteins that comprise the ling cascade. Illustrative, non-limiting examples of Wnt/B-catenin ling pathway activators include peptides or proteins as well as chemical nds other than peptides or proteins (i.e., non- peptide drugs”, such as : - peptides or proteins, for e, Wnt protein isoforms such as Wntl, Wnt2, Wnt2b/l3, Wnt3, , W'nt4, Wnt5a, W'ntSb, Wnt6, W'nt7a, W'nt7b, W'nt8a, Wnt8b, W'nt9a, Wnt9b, Wntha, Wnthb, W'nt'll or W'ntl6; B—cateni-n; a spondin, such as a R-spondi-n, etc.; or fimctional variants thereof, e.g., peptides or proteins that have an amino acid sequence that is at least 40%, typically at least 50%, advantageously at least 60%, preferably at least 70%, more preferably at least 80%, still more preferably at least 90% identical to the amino acid sequences of the previously mentioned peptides or proteins and that maintain the y to te the Wnt/B-cateni'n signalling pathway; or - non-peptide compounds, for example, 2-(4-acetylphenylazo')-”-(3,3-dimethyl- 3,4-dihydro—2H—isoquinolinylidene)-aeetamide (IQl), (25’)—2-[2—(indan yloxy)( l l e'nylyl)methyl)-9H—purinylamino]phenyl-propan- l — ol (081 l 2), deoxychol ic acid (DCA), 2-amino[3 ,4- lenedioxy)benzylamin0](3-methoxyphenyl')pyrimidine, or an (hetero)arylpyrimidine disclosed by Gilbert et al., in Bioorganic & Medicinal Chemistry Letters, Volume 20, Issue 1, 1 January 2010, 366-370.

Examples of Wm protein isoforms, which belong to the Wnt secreted proteins family and. act as activators of the Wnt/B-eatenin signalling pathway, include the following or orthologues thereof (S wiss—prot nces): Homo .sapiens: Wntl: P04628; Wnt2: P09544; Wnt2b/l3: 093097; Wnt3: PS6703; W'nt3a: P56704; W'nt4: P56705; W'ntSa: P4122]; Wnt5b: 7; Wnt6: Q9Y6F9; W'nt7a: 000755; W-nt7b: P56706; Wnt8a: Q9H1J5; W-nt9a: 014904; W'nt9b: 014905; W'nt10a: Q9GZT5; Wnt10b: 000744; Wntll: 096014; Wnt'l 6: ; Mus musculus: W'ntl: P04426; Wnt2: P215521; Wnt2b/‘l3: 0702832; W'nt3: P'l7553; Wnt3a: P27467; W'nt4: P22724; W'nt5a: P22725; Wnt5b: P22726; W'nt6: 1; W'nt8a: Q64527; Wnt9a: ; Wnt9b: 0354682; Wntha: P70701; Wnthb: P486l4; Wntll: P48615; Wntl6: Q9QYSl.l; as well as a functional isoform, variant or fragment thereof, i.e._, an isoforrn, t or fragment thereof having the ability to activate the Wnth-catenin signalling pathway.

Examples of B-catenin include the following or orthologues thereof (Swiss-prot references): Homo sapiens: P35222; M’us museums: Q02248; as well as a functional isofonn, variant or fragment thereof, i.e._, an m, variant or fragment thereof having the ability to activate the Wnt’B-catcnin signalling pathway.

The R-Spondi'ns (RSpo) are 4 secreted agonists of the canonical W‘ntJB-catenin signalling pathway. Also known as cysteine-rich and single thrombospondin domain containing proteins (Cristins), R-Spondins share around 40% amino acid identity (Lowther, W. et a]. .]. Virol. 79210093; Kim, K.-A. ct a]. (2006) Cell Cycle 5:23).

All the R-Spondi'ns contain two nt cysteine-rich fu'rin-likc domains followed by a thrombospondin (TSP-l) motif and a region rich in basic residues. Only the furin-likc domains are needed for B-catcnin stabilization (Kim, K.-A. et al. (2006) Cell Cycle 5:23; Kazanskaya, O. et al. (2004) Dev. Cell 7:525). Injection of recombinant R- Spondin l in mice causes activation of B—catenin and proliferation of intestinal crypt epithelial cells, and. rates experimental colitis (Kim, K.—A. et al. ) Science 30921256; Zhao, J. et al. (2007) Gastroenterology 132:1331). din 1 (RSPOl) appears to regulate W‘nt/B-cateni'n by competing with the Wnt nist DKK-l for binding to the Wnt co-receptor, Kremen. This ition s internalization of DKK-‘l/LRP-6/Kremcn complexes (Binnerts, M.E. et al. (2007) Proc. Natl. Acad. Sci.

USA 104:147007). Illustrative, mitative, examples of R-Spondins which act as activators of the Wnt/B-catenin signalling pathway, include the following or orthologues thereof (Swiss-prot references): Homo sapi‘ens: R-spond'in-l: Q2MKA7; R-spondin-Z: Q6UXX9; R-spondin-3: ; R-spondin-4: QZIOMS, or a filnctional isoform, variant or fragment thereof, i.e., an isoform, variant or fragment thereof having the ability to activate the Wntffi-catenin signalling pathway, for example, an isoform, variant or fragment thereof that maintain their onal domains.

Illustrative, non-limitative, examples of said. o_)arylpyrimidines include the compounds of formula V) below.

In a particular ment, the (hetero)arylpyrimidine is an (hetero)aryl- pyrimidine agonist of the catenin signalling pathway of formula (I), (ll), (III) or (IV) [Table 1].

Table l Illustrative examples of (hetero)arylpyrimidines agonists of the W'nt/B-catenin signalling y Compound Formula Definitions of formula (I) R is N—(3-1H—imidazol H y] )propane), N -(2-pyridi n g/ Mel/Neg: yl)ethane)_. N-(2-pyridinyl)ethanc), JV N 3,5-dimethyl-1H—pyrazol—l- yl)propyl), N-(Z-(lH-mdol-‘J- / yl)cthane), or N-(S)(l H-‘indol .\ yl)propanol amine (II) R1 is CHg-l dazole, 4-pyridine, H 3-(1H—indole), 3—(2—methyl-1H—indol- /NVNN/A‘Rl 5-01), or 4-(1H—imidazole); and ké Ni R2 is 4-(pyridinyl), 4-(pyrid'in R2 yl), 4-(3-n1trophenyl), 2- (benzo[b]th1ophene) or 2-(naphthyl) R is H, ethyl, methylenecyclohexyl, H 2-fluoro(trifluoromethyl)benzyl or _ N“V_ Nk propynyl; and l NH 3 , N Nag R“ is 2—(benzo[b]thiophene) or 2- T/ R30 (naphthyl) (IV) H R is 3,5-difluorobenzyl, propynyl, 2-acetamide or anitrile; and R2 is 2-(benzo[b]thiophene) or 2- (naphthyl) An “inhibitor of a Wnt/B-cate'nin ling pathway repressor”, as used , refers to a molecule capable of activating the Wnt/B-eatenin signalling pathway by inhibiting or blocking a Wnt/B-catenin ling pathway repressor, i.e., a compound which represses, blocks or silences the activation of the Wnt/B-catenin signalling pathway. rative, non-limitative, examples of Wnt/B-catenin signalling pathway repressors include glycogen synthase kinase 3 (GSK-3), secreted. frizzledV-related protein 1 (SFRPI), and. the like.

Illustrative, non-li-mitative, examples of inhibitors of SFRP'] include 5- lsulfonyl)-N -(4—'pipcridinyl)-2 -(trif1uoromcthyl')bcnzcnesulfonamide (WAY- 316606).

- Illustrative, 'non—l'imitative, examples of inhibitors of GSK-3 include:lithium salts (Cg.n lithium chloride), 6-bromoindirub'in-3 -0Xi'me (BIG), 6- bromoindi'rub'in-3lJacetoxi‘me (BlO—acetoxi'me), 6-{_2—[4-(2,4-dichloro-phe'nyl)- 5-(4-methyl—1H—imidazol-Z-yl)—pyrimidin-2 -ylamino]-ethyl-amino '} -nieotino- nitrile 9021), N—[(4-methoxyphenyl)methyl]-N'-(5-nitrothiazolyl)urea (AR-A01 44 18), 3-(2,4-dichlorophenyl)(1-methyl-lH—indolyl)-1H—pyrrole— 2,5-dione (SB-216763), 5-benzylaminooxo-2,3-dihydro-1,2,4-thiadiazole (TDZD-ZO), 3-[(3-ehlorohydroxyphenyl)amino](2-nitro-phenyl)-1H- pyrrole—2,5-dione 5286), etc, or functional analogs or derivatives thereof, i.e., compounds which contain functional groups which render the compound of st when administered to a subject.

Further examples of GSK-3 inhibitors are known to those skilled in the art.

Examples are described in, for example, WO 99/65897 and W0 03/074072 and references cited therein. For e, various GSK-3 inhibitor compounds are disclosed in US 2005(0054663, US 200230156087, WO 02/20495 and W0 99.65897 (pyrimidine and pyridine based compounds); US 200350008866. US 200l/0044436 and W001/44246 (bicyclic based compounds); US 2001;003:4051 (pyrazine based, compounds); and W0 98.?36528 (purine based compounds). Further GSK-3 inhibitor compounds include those disclosed. in WO 02/22598 (quinolinone based compOunds), US 2004/0077707 le based compounds); US 2004/0138273 (carbocyclic compounds); US 2005/0004152 (thiazole compounds); and US 20040034037 oaryl compounds). Further GSK-3 inhibitor compounds include 'macrocyclic 'maleimide selective GS K-3 [3 inhibitors developed by n & Johnson and described in, for example, Kuo et a1. (2003) J Med Chem 46(‘l9):402l-3l, a particular example being 10,11_.13,14,16,17,19,2022,23-Decahydro-9_.4:24,29-dimetho-1H id.o (2,3- n:3',2'-t) pyrrolo (3,4-q)-(1,4,7,10,13,22) tetraoxadiazacyclotetracosine-l,3 (2H)-dione.

Further, substituted aminopyrimidine derivatives CHIR 98014 (6-pyridinediamine, N6- [2-[[4-(2,4-dichlorophenyl)( l azol- l -yl)pyrimidinyl]amino]cthyl]nitro-) and CHIR 99021 [4-(2,4-dichloro-phenyl)(4-methyl-l H-imidazolyl)- pyrimidin-Z-ylarnino]-ethylamino}-nicotinonitrilc) inhibit human GSK-3 potently.

Also, a number of other GSK-3 inhibitors which may be useful in the present invention are commercially available from Calb'ioche'm(l§), for example: 5-methyl-l H-pyrazol -phenquuinazolinyl)ami'ne_. 4-benzylmethyl-l.2,4-thiadiazolidi'ne-3,5-dione (TDZD8), 2—thio(3-iodobenzyl)( l -p.yridyl)—[l ,3,4]—oxadiazolc, 3-hyd'roxy- propyl)-lH-pyrrol0[2,3-b]pyridin—3-yl]pyrazinyl-pyrrole-2,5-dionc, etc. Included within the scope of the invention are the functional analogs or derivatives of the above mentioned compounds.

For a review of compounds capable of activating the Wnt/B-catenin signalling y see Chen et al, Am J Physiol Gastrointest Liver Physiol. 2010, Barker et al._, Nat Rev Drug Discov. 2006 and Meijer et al, Trends Pharmacol Sci. 2004.

In a particular embodiment, the compound used for treating a cell selected from the group ting of a HSC, a progenitor cell, a MSC and any combination thereof, in such a way that the Wilt-’B—catenin signalling pathway thereof is activated. is selected from the group consisting of a Wnt isoform, [3-catenin, a R-spond‘in, or functional variants or fragments thereof, IO], 08]], DCA, 2-a'm'ino[3,4-(‘methylenedioxy)- amino](3-mcthoxyphcnyl)pyrimidine, an (hetero)arylpyrimidine such as, for example, an (hetero)arylpyrimidine of formula (I); (II), (III) or (IV) [Table l], a GSK-3 inhibitor, a SFRPI inhibitor, and any combinations thereof. In a ular embodiment, said Wnt protein m is selected from the group consisting of Wntl, Wnt2, Wnt2bf13, Wnt3, Wnt3a, Wnt4, WntSa, WntSb, Wnté, Wnt7a, Wnt7b, Wnt8a, WntSb, Wnt9a, Wnt9b, Wntha, Wnthb, Wntll, Wntl6, and combinations thereof, or functional ts or fragments f. In another particular embodiment, said. Wntlfi- catenin signalling pathway activator is B-catenin or a functional variant or nt thereof. In another particular ment, said W'nt’B-caten'in signalling pathway activator is a R-spond-in such as R-spondin-l, R-spondi'n-Z, R-spond-in-3, R-spond-in—4, or a functional isoform, variant or fragment thereof.

In another particular embodiment, the SFRPl inhibitor is WAY-316606. In another particular embodiment, the GSK-3 inhibitor is selected from the group consisting of a lithium salt, preferably, lithium chloride, BIO, BIO-acetoxime, CHIR99021, AR-A0l44l8. SB-216763, TDZD-20, 83415286, and any combination thereof.

In a preferred ment, the Wnt-“B-catenin signalling y activator is selected from the group consisting of Wnt3a, B-catenin, R—spondin-l, and. a combination thereof. In r preferred ment, the inhibitor of the Wnt B-caten-in signalling pathway repressor is selected from the group consisting of BIO, CHIR9902'], and a combination thereof.

In a particular embodiment, the cell for use in the treatment of a retinal degeneration disease according to the invention, alone or in a cell population comprising a plurality of said cells, the cell being selected. from the group consisting of a HSC, a progenitor cell and a MSC, is a cell d. with a Wnt/B-catenin signalling y activator in such a way that said pathway is activated. According to this embodiment, a cell, or a plurality of cells, selected from the group consisting of a HSC, a progenitor cell and a MSC, is contacted, cg, cultured or incubated, with a Wnt/B- catenin signalling pathway activator. The amount of said Wnt/[B-catenin signalling pathway activator may vary within a range, nevertheless, preferably, the Wnt/D-catenin signalling pathway activator will be added in a suitable amount, i.e., in an amount which allows to obtain a specific amount of B-catenin accumulated in the nucleus of the cells. By illustrative, in a particular embodiment, a range of about "100 to about ml of Wnt3a may be used to treat said cells under suitable specific culture conditions. The amount of Wnt’B—catenin signalling pathway activator which allows to obtain a specific amount of B-catenin accumulated in the cells and translocated in the s of the cells with which cell fusion-mediated. ramming is observed can be determined by the skilled. person in the art by conventional assays, for example, by contacting the cell with a Wnt-‘B-catenin pathway activator, at different concentrations and during different periods of time before transplantation of the so treated cells into an animal and then analyzing if cell fusion-mediated reprogramming occurs, for example, by detecting and/or determining the expression of undifferentiated cells markers, e.g._.

Nanog, Oct4, Nestin, Otx2, Noggin, SSEA-l, etc. In a particular embodiment, the cells are treated with Wnt3a as Wnt/B-catenin pathway activator, in a suitable amount of about 100-300 ngjul for 24 h before lantation of the treated cells.

In another particular embodiment, the cell, alone or in cell population comprising a ity of said cells, for use in the ent of a retinal degeneration disease according to the invention, selected from the group consisting of a HSC, a progenitor cell and a MSC, is a cell treated with an inhibitor of a Wnth-catcnin signalling pathway sor in such a way that said pathway is activated. According to this embodiment, a cell ed from the group consisting of a HSC, a progenitor cell and a MSC. is contacted. c.g._. cultured or incubated, with an inhibitor of a WntlB- catenin ling y repressor. The amount of said inhibitor of a WnUB-catenin signalling pathway sor may vary within a range; nevertheless, preferably, the inhibitor of a Wnt/B-catenin signalling pathway repressor will be added in a suitable amount, i.e.. in an amount which allows to obtain a specific amount of B-catenin accumulated in the nucleus of the cells. By illustrative, in a particular embodiment, a range of about 1 to about 3 uM of B10 may be used to treat said cells in a specific culture condition (see below). The amount of inhibitor of Wnt’B-catenin pathway sor which allows to obtain a specific amount of B-catenin accumulated in the cells and translocated in the nucleus of the cells with which cell fusion-mediated reprogramming is ed can be determined by the skilled. person in the art by means of an assay as that mentioned in e 1. Briefly, said assay ses contacting the cell with an inhibitor of a Wnt/[3-catenin pathway 'rep'ressor, at different concentrations and during different periods of time before transplantation of the so treated cells into an animal and then analyzing if cell fusion-mediated reprogramming occurs, for example. by detecting andfor determining the expression of undifferentiated cells markers, c.g., Nanog, Oct4, Nestin, Otx2, Noggin, SSEA-l, etc. In a particular embodiment, the cells are treated with BIO as an inhibitor of a catenin pathway repressor (GSK-3), in a suitable amount of about 1-3 uM for 24 h before transplantation of the treated cells.

In another particular embodiment, the cell for use in the ent of a retinal degeneration disease according to the invention, selected. from the group consisting of a HSC, a progenitor cell and a MSC, which may be present in a cell tion as mentioned above, is a cell that overexpresses a -catenin pathway activator.

As used , a “cell that overexpresses a Wnt/B-catenin signalling pathway activator” is a cell, such as a cell selected from the group consisting of a HSC, a progenitor cell and a MSC, that has been genetically manipulated to overexpress a catenin signalling pathway activator, wherein said catenin signalling pathway activator is a peptide or protein. In a particular embodiment, said Wnt/B- catcnin ling pathway activator is a Wnt protein isoform such as Wntl, WntZ, Wnt2bf13, Wnt3, Wnt3a, Wnt4, WntSa, WntSb, Wnt6, Wnt7a, WntSa, Wnt8b, Wnt9a, Wnt9b, Wntha, Wnthb, Wntl 1, Wntlé, or a functional variant or fragment thereof. In another particular embodiment, said Wnt/B-catenin signalling pathway activator is [3- catcnin or a onal Variant or fragment thereof. In another particular embodiment, said Wnt/B-catenin signalling pathway activator is a R-spondin such as R-spondin-l, R- spondin-Z. R-spondin-3, R-spondin-4. or a functional isoform, t or fragment thereof. In an ment, the polynucleotide comprising the nucleotide ce encoding the Wnt/B-catenin signalling pathway activator is comprised. in an expression cassette, and said polynucleotide is operatively bound to (i.e., under the control of) an sion control sequence of said. polynucleotide comprising the nucleotide sequence encoding the Wnt/B-catenin signalling pathway activator. Expression control sequences are sequences that control and regulate transcription and, where appropriate, translation of a protein, and include promoter sequences, ces encoding transcriptional regulators, me binding sequences (RBS) and-’01“ transcription terminator sequences. In aparticular embodiment, said expression control sequence is functional in cukaryotic cells, such as mammalian cells, preferably human cells, for example, the human cytomegalovirus (hCMV) promoter, the combination of the cytomegalovirus (CM V) early enhancer element and chicken beta-actin promoter (CAG), the cukaryotic translation initiation factor (elF) promoter, etc.

AdvantageOusly, said. sion cassette further ses a marker or gene encoding a motive or for a phenotype allowing the selection of the host cell transformed. with said expression cassette. Illustrative examples of said markers that could be present in the expression cassette of the invention include antibiotic-resistant genes, toxic compound-resistant genes, fluorescent marker-expressing genes, and generally all those genes that allow selecting the genetically transformed cells. The gene construct can be inserted in a suitable vector. The choice of the vector will depend on the host cell where it will subsequently be introduced. By way of illustration, the vector in which the polynucleotide comprising the nucleotide sequence encoding the Wnt/B-catenin signalling pathway activator is introduced can be a plasmid or a vector which, when uced in a host cell, either becomes integrated or not in the genome of said. cell.

Said vector can be obtained by conventional methods known by persons skilled in the art [Sambrook and Russell, “Molecular Cloning, A Laboratory Manual”, 3rd ed., Cold Spring Harbor Laboratory Press, N.Y., 2001 Vol 1-3]. In a ular embodiment, said inant vector is a vector that is useful for transforming animal cells, preferably mammalian cells. Said vector can be used to transform, transfect or infect cells such as cells selected from the group consisting of HSCs, progenitor cells and MSCs.

Transformed, ectcd or infected cells can be obtained by conventional methods known by persons skilled in the art [Sambrok and Russell. (2001), cited supra].

The cells for use in the treatment of a retinal degeneration e according to the invention, selected from the group ting of a HSC, a progenitor cell and a MSC, preferably isolated cells, may be used to initiate, or seed, cell cultures. The specific cells may be isolated. in view of their s as it has been previously mentioned. Isolated cells may be transferred to sterile tissue culture vessels, either uncoated or coated with extracellular matrix or ligands such as n, collagen (native, denatured or crosslinked), gelatin, fibroncctin, and other ellular matrix ns. The cells for use in the treatment of a retinal degeneration disease according to the invention may be cultured in any suitable culture medium (depending on the nature of the cells) capable of ning growth of said cells such as, for example, DMEM (high or low glucose), advanced DMEM, CDB 20'], Eagle s basal medium, Hamls F10 medium (F10), Hamls F-‘lZ medium (F12), lscove's modified Dulbecco's - l7 medium, DMEM/FIZ, RPMI 1640, etc. If necessary, the culture medium may be supplemented with one or more components including, for example, fetal bovine serum (FBS); equine serum (ES); human serum (HS); beta-mercaptoethanol (BME or 2-ME), preferably about 0.001% (Viv); one or more growth factors, for example, platelet- derived. growth factor (PDGF), epidermal growth factor (EGF), fibroblast growth factor (FGF), ar endothelial growth factor (VEGF), n-like growth factor-1 (IGF-l), leukocyte inhibitory factor (LIF), stem cell factor (SCF) and e'rythropoictin; cytokines as interleukin-3 (IL—3), interleukin-6 (IL-6), FMS-like ne kinase 3 (Flt3); amino acids, including L-valine; and one or more antibiotic and/or antimycotic agents to l microbial contamination, such as, for example, penicillin G. streptomycin sulfate, amphotericin B, gentamicin, and. nystatin, either alone or in combination. The cells may be seeded in Culture vessels at a density to allow cell growth.

Methods for the selection of the most riate culture medium, medium preparation, and cell culture techniques are well known in the art and are described in a variety of sources, including Doyle et al., (eds), 1995, Cell & Tissue Culture: Laboratory Procedures, John Wiley &Sons, Chichester; and H0 and Wang (eds), 1991, Animal Cell Biorcactors, Buttewvorth-Heincmann, .

As it is shown in Example 1, the cells, or the cell population, for use in the treatment of a retinal degeneration disease according to the invention, transplanted into the sub'retinal space of rd] mice at postnatal day '10 (pl 0) fuse with rods and Muller cells, thus forming hybrids which de—differentiate and. finally re-differentiate in retinal neurons, for example photoreceptor cells such as rods, etc, ganglion cells, etc. In this case, the activation of Wnt/[El-catenin signalling pathway in the transplanted cells appears to be ial to induce de—differentiation of newly formed hybrids that finally 're-differentiatc in newborn retinal neurons. Further, the newborn photoreceptor cells fully regenerate the retina in the lanted mice, with rescue of functional Vision.

These data demonstrate that cell fusion-mediated regeneration is a very efficient s in mammalian , and that it can be triggered by activation of Wnt/D-catenin signalling pathway. Retinitis tosa (RP) is a very severe disease for which no treatment is currently available. However, retinal regeneration through transplantation of the cells or cell population for use in the treatment of a l degeneration disease according to the invention constitutes an approach for the rescue of vision in subjects ed by RP or even by a variety of retinal degeneration diseases.

The cells or cell tion for use in the treatment of a retinal degeneration disease according to the invention can be used as a cell therapy for treating a l degeneration disease since, once transplanted. into a target location in the eye, said. cells fuse with retinal cells, such as retinal neurons andfor retinal glial cells, thus providing hybrid cells which entiate into one or more phenotypes. ing to the invention, the ent of the retinal degeneration disease occurs by reprogramming of retinal cells mediated by cell fusion of said cell with said retinal cells, e.g., retinal neurons and’or retinal glial cells. Reprogram'ming, in general, can be ed to the passage of a cell from the differentiated state (or differentiated cell — i.e., a cell specialized for a c function, such as a heart, liver, etc, that cannot generate other types of cells) to an undifferentiated state (or undifferentiated stem cell - i.e., a cell not specialized for a specific Function that retains the ial to give rise to specialized cells), both at level of embryonic state or progenitor state; but also reprogramming can be referred to the passage from one differentiated. state to another differentiated state (for example, a fibroblast that becomes a neuron withOut going back to a precursor/embryonic state, or a retinal neuron that becomes r retinal neuron without going back to a precursor/embryonic state). In this description, “reprogramming” refers only to the de-differentiation of a somatic cell which is followed by differentiation of the hybrid cells previously formed as a result of the cell fusion between a cell (e.g., a HSC, a progenitor cell or a MSC) and a somatic cell (e.g., a retinal neuron or a retinal glial cell).

As used , the expression “cell fusion” relates to cell-cell fusion that occurs spontaneOusly or mediated by exogenous agents. Cell-cell fusion regulates many developmental processes as well as cell fate and cell differentiation. Somatic cells can fuse spontaneously with stem cells, and the resulting hybrid clones have a stem cell-like phenotype. The stem cell features of stem cells are dominant over the somatic cell traits and allow the reprogramming of the somatic cell nucleus. Thus, cell-cell fusion is a way to force the fate of a cell, and in the case of fusion with cells. such as HSCs, progenitor cells or MSCs. this mechanism induces cellular reprogramming, that is, dedifferentiation of somatic cells. The ors have shown that fusion-mediated reprogramming of a c cell is greatly enhanced by time-dependent activation of the Wnt/B-catenin signalling pathway. After Wnt binding to its receptors or inhibition of GSK—3, as a component of the destruction complex, B-catenin is stabilized and translocates into the nucleus, where it activates several target genes.

As used herein, the term “retinal neuron” refers to the neurons which form part ofthe retina. The retina is a light-sensitive tissue lining the inner surface of the eye. It is a layered. structure with several layers of neurons interconnected by synapses. The only s that are directly sensitive to light are the photoreceptor cells. These are mainly of two types: rods and cones. Rods function mainly in dim light and provide black-and- white Vision. while cones t daytime Vision and the perception of colour. A third, much rarer type of photoreceptor, the photosensitive ganglion cell, is important for reflexive ses to bright daylight. Neural signals from the rods and cones undergo processing by other neurons ofthe retina. The output takes the form of action potentials in retinal ganglion cells whose axons form the optic nerve. The retinal neurons further include horizontal cells, bipolar cells, amacrine cells, interplexiform cells, ganglion cells, among others. In addition to said cells there are glial cells in the retina such as Muller cells (Muller glia), which are the main glial cell of the retina and. act as supporting cells. astrocytes and microglial cells (Webvision — The Organization of the Retina and Visual System, Part I], Chapter entitled “Glial cells of the Retina”, by Helga Kolb. dated July 3'] , 2012).

In a particular embodiment, the retinal cells comprise retinal neurons such as rods and the like and retinal glial cells such as Miiller cells, etc., which fuse with the cells or cell population for use in the treatment of a retinal degeneration disease ing to the invention, e.g., BIO-treated HSPCs (Example 1). In another particular embodiment, the retinal s comprise ganglion cells and/or amacrine cells which fuse with the transplanted HSPCs (Example 2). In another particular ment it is contemplated the fusion of cells selected from the group ting of HSCs, progenitor cells, MSCs and any ation thereof. including the the cells for use in the treatment of a retinal degeneration disease according to the invention, or a population thereof, e.g., HS PCs, with endogenous proliferating cells (e.g., RSPCs).

The final retinal s which may ed after reprogramming of the fused retinal neurons may vary, for example, photoreceptor cells, ganglion cells, interneu'rons, 'J‘I etc. In a particular embodiment, fused retinal neurons (e.g., rods) and retinal glial cells (e.g., Muller cells) are rammed to mainly rods (Example 1), whereas in another particular embodiment fused. retinal neurons (e.g., ganglion cells and/or amacrine cells) are reprogrammed to ganglion cells and interneurons (Example 2).

Although the inventors wish not to be bound. by any theory, it is believed. that the reprogrammed retinal neurons may be of the same type (or different) as that of the retinal neuron fused to the cell or cell population for use in the treatment of a retinal degeneration disease according to the invention. e.g., a rod may be reprogrammed to a rod or to another type of retinal neuron such as, e.g., a ganglion cell, an amacrine cell, etc; a ganglion cell may be reprogrammed to a ganglion cell or to another type of retinal neuron such as, e.g., a rod, an amacrine cell, etc; an amacrine cell may be reprogrammed to an ne cell or to another type of retinal neuron such as, e.g., a rod, a ganglion cell, etc. Further, a retinal glial cell, such as a Muller cell, after fusion with a cell or cell population for use in the treatment of a retinal ration e according to the ion, may be reprogrammed to a retinal neuron such as a rod, or to another type of retinal neuron such as, e.g., a ganglion cell, an amacrine cell, etc.

Indeed, e I shows fusion of HSPCs with rods and the differentiation of the hybrid cells only into rods.

In a particular embodiment, the treatment of said retinal ration disease comprises reprogramming of l cells, such as retinal neurons (e.g., rods, ganglion cells, ne cells, etc.) and/0r retinal glial cells (e. g._, Muller cells, etc.) mediated by cell fusion of said cell or cell population for use in the treatment of a retinal ration disease according to the invention with said retinal cells and differentiation of the resulting hybrid cells to retinal neurons such as photoreceptor cells (e.g., rods. etc.), ganglion cells, amacrine cells, etc. In another ular embodiment, the treatment of said retinal degeneration disease comprises reprogramming of retinal neurons mediated by cell fusion of said cell or cell population for use in the treatment of a retinal degeneration disease according to the invention with said retinal neurons and differentiation of the resulting hybrid cells to the same or different type of retinal neurons for e photoreceptor cells, such as rods, etc., ganglion cells, amacrine cells, etc.

In a particular embodiment, the retinal cells se retinal neurons (e.g., rods, 'J‘I ganglion cells, amacrine cells, etc.). In r particular embodiment, the retinal cells comprise retinal glial cells (e.g., Muller cells, etc.). In another particular ment, the retinal cells comprise retinal neurons (e.g., rods, ganglion cells, ne cells, etc.) and retinal glial cells (e.g., Muller cells, etc.).

A “retinal degeneration e”, as defined herein, is a disease associated with deterioration of the retina caused. by the progressive and eventual death of the cells of the retinal tissue. The term al degeneration disease” also includes indirect causes of retinal degeneration, i.e._. retinal degenerative conditions derived from other primary pathologies, such as cts, diabetes, glaucoma, etc. In a particular embodiment, said retinal degeneration disease is selected from the group comprising retinitis pignentosa, age-related. macular degeneration, Stargardt disease, cone-rod dystrophy, ital nary night blindness, Leber congenital amaurosis, Best's vitelliform macular dystrophy, anterior ischemic optic neuropathy, choroideremia, age-related macular degeneration, acular phy, Bictti lline corneoretinal dystrophy, UsherLs syndrome, etc., as well as retinal degenerative conditions derived. from other primary pathologies, such as cataracts, diabetes, glaucoma, etc. In a particular embodiment, said retinal degeneration disease derives from cataracts, diabetes or glaucoma. In another particular embodiment, said retinal degeneration disease is age- related macular degeneration that is presented in two forms: “31'” that results from atrophy t0 the retinal pigment epithelial layer below the , which causes vision loss through loss of photoreceptors (rods and cones) in the central part of the eye; and “w_et” that causes vision loss due to abnormal blood. vessel growth (choroidal neovascularization) in the choriocapillaris, through BruchlE membrane, tely leading to blood. and protein leakage below the macula, eventually causing irreversible damage to the photoreceptors and rapid vision loss. In a more ular embodiment, said retinal degeneration disease is RP, a heterogeneous family of inherited retinal disorders characterized by progressive degeneration of the eceptors With subsequent degeneration of RPE, which is characterized by pigment deposits predominantly in the peripheral retina and by a relative sparing of the central retina. In most of the cases of RP, there is primary degeneration of photoreceptor rods, with secondary degeneration of cones.

In the context of the present invention, r.treatment of retinal degeneration 'J‘I M” means the administration of the cells for use in the treatment of a l degeneration disease according to the ion, or a population of said. cells, or a pharmaceutical composition sing said cells or a ceutical composition comprising cells other than the cells for use in the treatment of a l degeneration disease according to the invention (see Treatment B below) to prevent or treat the onset of symptoms, complications or biochemical indications of a retinal degeneration disease, to alleviate its ms or to stop or inhibit its development and progression such as, for example, the onset of blindness. The treatment can be a prophylactic treatment to delay the onset of the disease or to prevent the manifestation of its clinical or subelinical symptoms or a therapeutic treatment to ate or alleviate the symptoms after the manifestation ofthe disease.

Survival of transplanted cells in a living t may be ined. h the use of a y of scanning techniques, e.g._. computerized axial tomography (CAT or CT) scan, magnetic resonance imaging (MRI) or positron emission tomography (PET) scans. Alternatively, determination of transplant survival may also be done post mortem by removing the tissue and examining it visually or thrOugh a microscope. Examining restoration of the ocular function that was damaged or diseased can assess functional integration of transplanted cells into ocular tissue of a subject. For example, effectiveness in the treatment of retinal degeneration diseases may be determined by improvement of Visual acuity and evaluation for abnormalities and grading of stereoscopic color fundus photographs (Age—Related Eye Disease Study Research Group, NE15 NIH, AREDS Report No. 8, 2001, Arch. Ophthalmol. 119: 1417-1436).

For the administration to a t, the cells or cell population for use in the treatment of a retinal degeneration disease ing to the ion may be formulated in a pharmaceutical composition, preparation or formulation, using pha-rmaceutically acceptable carriers, which particulars Will be discussed below under section entitled “Pharmaceutical composition”.

Treatment B In another aspect, the invention relates to a cell selected from the group consisting ofa hematopoietic stem cell, a progenitor cell, and a mescnchymal stem cell, for use in the treatment of a retinal degeneration disease, by reprogramming of retinal cells, such as retinal neurons and/or retinal glial cells, mediated by cell fusion of said cell with said. retinal cells, said reprogramming being mediated by activation of the catenin signalling pathway. In other words, according to this , the invention provides a cell selected from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, and a mesenchymal stem cell (MSC), for use in the ent of a retinal degeneration disease, by ramming, mediated by the Wnth-catenin signalling pathway, or" a retinal cell, such as a l neuron and/or a retinal glial cell, by Fusion of said cell with said retinal cell upon contact of said cell with said retinal cell in the eye of a subject.

Alternatively, in other words, this aspect of the invention relates to the use of a cell selected. from the grOup consisting of a hematopoietic stem cell, a progenitor cell, a mcscnchymal stem cell, in the manufacture of a pharmaceutical ition for the treatment of a retinal degeneration disease, by reprogramming of retinal cells, such as retinal neurons and/or retinal glial cells, mediated. by cell fusion of said cell with said retinal cells, said. reprogramming being mediated by activation of the Wnt/B-catenin signalling y.

The particulars of the cell ed from the group consisting of a poietic stem cell, a itor cell, a 'mesenchymal stem cell, and the retinal degeneration disease to be treated have been previously discussed in connection with above Treatment A, whose ulars are hereby incorporated.

In a particular embodiment, the retinal cells comprise retinal neurons (e. g., rods, ganglion cells, amacrine cells, etc). In another particular embodiment, the retinal cells comprise retinal glial cells (e.g., Muller cells, etc.). In another particular embodiment, the retinal cells comprise retinal neurons (e.g., rods, ganglion cells, amacrine cells, etc.) and retinal glial cells (c.g., Muller cells, etc.).

In st to above Treatment A, in Treatment B it is not necessary that the cell (HSC, progenitor cell or MSC) to be implanted has its Wnt-‘B-e-atenin signalling pathway activated at the time of the cell is implanted into the eye because said pathway may be endogenously activated or by administration of a Wnt/B-catenin signalling pathway activator or an inhibitor of a Wnt/B-catenin signalling pathway repressor, as it will be discussed below. Thus, according to Treatment B, it is not necessary that the cell (HSC, itor cell or MSC) is d, prior to its implantation into the eye, with a Wnt/B-catenin signalling pathway activator or with an inhibitor of a Wnt/B-catenin signalling pathway repressor or that overexpresses a Wnt/B-catenin signalling pathway tor, but what is necessary is that retinal regeneration occurs by reprogramming of retinal cells, such as retinal neurons and/or l glial cells, mediated by cell fusion of said cell with said. retinal cells, said ramming being mediated. by activation of the Wnt/B-catenin signalling pathway. In this case, the activation of the W'nt/B-catenin signalling pathway may be endogenous, i.e., it can be achieved by the subject to which the cells are to be administered (implanted or transplanted) as a consequence of a damage, lesion or injury in the retina (what may occur in retinal degeneration diseases) or by administration of a Wnt/B-catenin signalling pathway activator or an inhibitor of a Wnt/B-catenin ling pathway repressor. Several assays performed. by the inventors have shown that after endogenous activation of the Wnt/B-catenin signalling pathway reprogramming of the hybrid cells formed after damage is observed (Example 2). On the other hand, recruitment of endogenous bone marrow cells (BMC s) after damage in the eye and. ectopic tion of atenin ling y is sufficient to observe reprogramming of the hybrid cells (Example 2). Therefore, in a particular embodiment, the cell for use in the treatment of a retinal degeneration disease according to Treatment B (i.e., by reprogramming of retinal cells, such as retinal neurons and/or l glial cells, mediated by cell Fusion of said cell with said retinal cells, said reprogramming being ed by activation of the Wnt/B-catenin pathway) is a BMC (c-kit+, sea-1+) recruited from the bone marrow (BM) into the eye and. the eye is treated. with a catenin signalling y activator in order to obtain regeneration of the retinal tissue.

The effects of the activation of the Wnt/B-catenin signalling pathway, as well as illustrative, non-limitative, examples of Wnt/B-catenin ling pathway activators and inhibitors of Wnt/B-catenin signalling pathway repressors have been discussed in connection with above Treatment A, whose particulars are hereby incorporated.

Example 2 shows that upon activation of -catenin signalling pathway, mouse retinal neurons can be transiently rammed in viva back to a precursor stage after spontaneous fusion with transplanted cells (e.g., HSPCs, or ESCs). Newly formed hybrid cells reactivate neuronal precursor markers (e.g., HSPCs and ESCs ramme retinal neurons back to Nanog and Nestin expression). Further, said hybrid cells can proliferate, differentiate along a neuro-ectodermal lineage (in the case of hybrid. cells formed by HSPCs and retinal s), and finally into terminally differentiated l neurons (e.g., photoreceptor cells), which can regenerate the damaged retinal tissue; alternatively, hybrid cells formed. by ESCs and retinal neurons can also proliferate and differentiate, in addition to the neuroectodermal lineage, in endoderm and ectoderm es what may result in formation of a teratoma. Following retinal damage and induction of catenin signalling pathway in the eye, usion-mediated reprogramming also occurs after endogenous mobilisation of bone marrow cells in the eyes. These data show that in-vivo reprogramming of terminally differentiated. retinal neurons is a possible mechanism of tissue regeneration.

In a particular embodiment, the cell for use in the treatment of a retinal degeneration disease according to Treatment B, is a HSC. In another ular embodiment, said cell is a LT-H SC or a ST-H SC.

In another particular embodiment, the cell for use in the treatment of a retinal ration disease according to Treatment B, is a itor cell. In another particular embodiment, said progenitor cell is an Early MPP, a Late MPP, a LRP, a (3MP, a GM? or a MEP.

In r particular ment, the cell for use in the treatment of a retinal degeneration disease according to Treatment B, is a MSC.

The cells for use in the treatment of a retinal degeneration disease according to Treatment B may be forming part of a population of said cells which use in the treatment of a retinal degeneration disease constitutes an additional aspect of the present invention.

Thus. the invention further s to a cell population comprising a plurality of cells, said cells being selected from the group consisting of a hematopoietic stem cell (H SC), a progenitor cell, a mescnchymal stem cell (MSC) and any combination thereof, for use in the treatment of a retinal degeneration disease according to Treatment B.

In other words, the invention relates to a cell population sing a plurality of cells, said cells being selected from the group ting of a HSC, a progenitor cell, a MSC and any combination thereof, for use in the treatment of a retinal degeneration disease, by ramming of retinal cells, such as retinal neurons and/or retinal glial cells, mediated by cell fusion of said cell with said l cells, said reprogramming being mediated by activation of the Wnt/B-catenin ling pathway. To that end. the cell population is ted. in the eye of a subject in need of treatment of a retinal ration disease. Thus, according to this aspect, the invention es a cell population comprising a plurality of cells, said cells being selected. from the group consisting of a HSC, a progenitor cell, a MSC and. any combination thereof, for use in the treatment of a retinal degeneration disease, by reprogramming, mediated by the Wnt/B-catenin signalling pathway, of a retinal ccll, such as a retinal neuron and/or a retinal glial cell, by fusion of said cell With said retinal cell upon t of said cell with said retinal cell in the eye of a subject.

Alternatively drafted. this aspect of the invention relates to the use of a cell population comprising a plurality of cells, said cells being ed. from the group consisting of HSCs, progenitor cells, MSCs and any combination thereof, in the manufacture of a pharmaceutical composition for the treatment of a retinal degeneration disease, by reprogramming of retinal cells, such as retinal neurons andfor retinal glial cells, mediated by cell fusion of said cells with said retinal cells, said reprogramming being mediated by activation of the WntIB-catenin signalling pathway. or, atively, to the use of a cell population sing a plurality of cells, said cells being selected from the group consisting of a HSC, a progenitor cell, a MSC and any combination thereof, in the manufacture of a pharmaceutical composition for the treatment of a retinal degeneration disease, by ramming of retinal cells, such as retinal neurons and/0r retinal glial cells, mediated by cell fusion of said. cells with said. retinal cells, said reprogramming being mediated by activation ofthe Wnt/B-catenin signalling pathway.

The particulars of said. HSCs, progenitor cells, and. MSCs have been previously mentioned.

In a particular embodiment, the retinal cells comprise retinal neurons (c.g., rods, ganglion cells, amacrine cells, etc.). In another particular embodiment, the retinal cells comprise retinal glial cells (e.g., Muller cells, etc.). In another particular embodiment, the retinal cells se l neurons (e.g._. rods, on cells. amacri'nc cells, etc.) and retinal glial cells (e.g., Miiller cells. etc.).

In a particular ment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment B comprises a plurality, ire, more than two, of HSCs. In a particular ment, said HSCs are selected from LT-HSC, ST-HSC and combinations thereof.

In another particular embodiment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment B comprises a plurality of progenitor cells. In a particular embodiment, said progenitor cells are selected from Early MPP, a Late MPP, a LRP, a CMP, a GMP, MEP and combinations thereof.

In another particular embodiment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment B comprises a ity of MSCs.

In a particular ment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment B comprises at least one HSC and. at least one progenitor cell. In a particular embodiment, said. HSC cell is a LT-HSC or a ST-HSC; in another particular embodiment, said progenitor cell is an Early MPP, a Late MPP, a LRP, a CMP, a GMP or a MEP.

In another particular embodiment, the cell tion for use in the treatment of a retinal degeneration discasc according to Treatment B comprises at least one HSC and at least one MSC. In a particular embodiment, said HSC cell is a LT-HSC or a ST—HSC.

In another ular embodiment, the cell population for use in the treatment of a retinal degeneration disease ing to Treatment B ses at least one progenitor cell and at least one MSC. In a particular embodiment, said progenitor cell is an Early MPP, a Late MPP, a LRP. a CMP, a GMP or a MEP.

In another particular embodiment, the cell population for use in the treatment of a retinal degeneration disease according to Treatment B comprises at least one HSC, at least one itor cell and at least one MSC. In a particular embodiment, said HSC cell is a LT-HSC or a ST-HSC; in another particular embodiment, said. progenitor cell is an Early MPP, a Late MPP, a LRP. a CMP, a GMP or a MEP.

In a particular embodiment, a cell population for use in the treatment of a retinal degeneration disease according to Treatment B is the cell composition identified as , Le, a cell population compn'sing HSCs, progenitor cells and MSCs; said. cell population can be obtained, for example, from bone , or, alternatively, by mixing HSCs, progenitor cells and MSCs, in the desired ratios or proportions. in order to obtain a HSPC cell population. Thus, said cell population HSPC may include HSC, progenitor cells and MSCs in different ratios or tions. The skilled person in the art will understand that said cell population may be enriched in any type of specific cells by conventional means, for example, by ting a specific type of cells by any suitable technique based on the use of binding pairs for the corresponding surface markers. Thus, in a particular embodiment, the HSPC cell population may be enriched in HSCs, or in progenitor cells, or even in MSCs.

Compositions In another aspect, the invention relates to a cell composition, after referred to as “cell composition of the invention”, wherein at least 50% of the cells of said cell composition are selected from the group consisting of hematopoietic stem cells (HSCs), progenitor cells, mesenchymal stem cells (MSCs) and any combination thereof and wherein said cells have their Wnt/B-catenin signalling pathway activated, or n the Wnt/B-catenin ling pathway of said cells is activated, or, wherein said cells have been treated with a Wnt’B-catenin signalling pathway tor, or with an inhibitor of a Wnt/B-c-atcnin signalling pathway repressor, andfor wherein said cclls overcxprcss a WntlB-c-atenin signalling pathway activator.

In a particular embodiment, the cell composition of the invention is a ition n at least 60%, preferably 70%, more preferably 80%, still more preferably 90%, yet more preferably 95%, and even more preferably 100% of the cells are HSCs, progenitor cells, and/or MSCs, in any ratio, having their W‘nt/B-catenin signalling pathway activated. (as a , for example, of having been treated with a Wnt/B-catenin ling pathway activator, or with an inhibitor of a Wnt/B-catenin signalling y repressor, or by manipulation to overexpress a Wnt/B-catenin signalling pathway activator). The cell composition of the invention further comprises a medium; said medium must be compatible with the cells contained in said composition; illustrative, non-limitative examples of media which can be present in the cell composition of the invention include isotonic solutions optionally supplemented with serum; cell culture media or, alternatively, a solid, semisolid, gelatinous or viscous support medium.

Pharmaceutical compositions 'J‘I The cells and cell population for use in the treatment of a retinal degeneration disease according to Treatments A and B of the present invention may be administered in a pharmaceutical composition, ation, or formulation, by using pharmaceutically able carriers.

Thus, in an aspect, the invention relates to a pharmaceutical composition, hereinafter referred. to as “phannaceutical composition of the ion”, selected. from the group consisting of: l) a pharmaceutical composition comprising at least a cell selected from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, a mesenchymal stem cell (MSC), and any combination thereof, wherein the Wnt/B-catenin signalling pathway of said, cells is ted, and a pharmaceutically acceptable r, and. 2) a pharmaceutical composition comprising at least a cell selected from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, a mcscnchyrnal stem cell (MSC), and any combination thereof, in ation with a Wnt/B-catenin signalling y activator or an inhibitor of a B-catenin signalling pathway repressor, and a pharmaceutically acceptable carrier.

In order that the HSCs, progenitor cells, and/or MSCs have their Wnt/B-cate'nin signalling pathway activated [pharmaceutical composition of the invention 1)], said HSCs, progenitor cells and/0r MSCs are d with a Wnt/B-catenin signalling pathway activator, or with an inhibitor of a Wnt/B-catenin signalling pathway repressor, and/or are manipulated. in order to press a Wnt/B-catenin signalling pathway activator.

The pharmaceutical composition of the invention can be used in the treatment of a retinal degeneration disease.

As used herein, the term “an” includes vehicles, media or ents, whereby the cells for use in the treatment of a retinal degeneration e according to Treatments A or B of the invention can be administered. Obviously, said carrier must be ible with said cells. rative, non-limiting examples of suitable pharmaceutically acceptable carriers include any logically compatible carrier, for example, isotonic solutions (e.g., 0.9% NaCl e saline solution, phosphate buffered saline (PBS) solution, Ringer-lactate solution, etc.) optionally supplemented with serum, preferably with autologous serum; cell e media (e.g., DMEM, etc); etc.

The pharmaceutical composition of the ion may comprise auxiliary components as would be familiar to medicinal chemists or biologists, for example, an antioxidant agent suitable for ocular administration (e.g., EDTA, sodium sulfite, sodium sulfite, mercaptopropionyl glycine, N-acetyl cysteine, beta- mercaptoethylamine, glutathione and similar species, ascorbic acid and its salts or sulfite or sodium 'metabisulfite, etc.)_, a buffering agent to maintain the pH at a suitable pH to minimize irritation of the eye (e.g., for direct intravitreal or i'ntraocular injection, the pharmaceutical compositions should. be at pH 7.2 to 7.5, alternatively at pH 7.3-7.4), a ty agent le for administration to the eye (e..g., sodium chloride to make compositions approximately isotonic with 0.9% saline solution), a viscosity enhancing agent (e.g., hyd'roxyethylcellulose, hydroxypropylccllulose, methylcellulose, polyvinylpyrrolidone, etc.), etc. In some embodiments, the pharmaceutical composition of the invention may n a preservative (c.g., benzalkonium chloride, benzcthonium de, chlorobutanol, phenylmercuric acetate or nitrate, thimerosal, methyl or propylp8arabens, etc.) Said pharmaceutically acceptable substances which can be used in the ceutical composition of the invention are generally known by the persons skilled in the art and are normally used in the preparation of cell compositions.

Examples of suitable pharmaceutical carriers are described, for example, in “Remington's Pharmaceutical Sciences”, of E.W. Martin.

The cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the ion may be administered. alone (e.g., as substantially homogeneous populations) or as mixtures with other cells, for example, neurons, neural stem cells, l stem cells, ocular progenitor cells, retinal or corneal epithelial stem cells and/or other multipote'nt or pluripotent stem cells. Where the cells for use in the treatment of a l degeneration disease according to Treatments A or B of the invention are administered with other cells, they may be administered simultaneously or sequentially with the other cells (either before or after the other cells). The cells of different types may be mixed with the cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the invention immediately or shortly prior to administration, or they may be co-cultured together for a period of time prior to administration.

The cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the invention may be administered. with at least one pharmaceutical agent, such as, for e, growth factors, trophic factors, conditioned medium, or other active agents, such as anti-inflammatory agents, anti apoptotic agents, antioxidants, neurotrophic factors or neuroregenerative or neuroprotective drugs as known in the art, either together in a single pharmaceutical composition, or in separate pharmaceutical compositions, simultaneously or sequentially with the other agents (either before or after administration of the other agents); it is expected that the use of said agents increases the efficiency of the cell regeneration or decreases cell degeneration.

Examples of said other agents or components that may be administered with the cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the invention include, but are not d to: ('1) other neuroprotective or neurobcncficial drugs; (2) selected, extracellular matrix components, such as one or more types of collagen known in the art, r growth factors, platelet-rich , and drugs (alternatively, the cells may be genetically engineered to express and produce growth factors); (3) anti- tic agents (c.g., erythropoietin (EPO), EPO 'mimctibody, thrombopoietin, n-like growth factor (IGF)-I, lGF—ll, hepatocytc growth , caspasc inhibitors); (4) anti- inflammatory compounds (c.g., p38 MAP kinase inhibitors, TOP—beta inhibitors, statins, IL-6 and IL—1 inhibitors, last, Tranilast, Remicade, Sirolimus, and eroidal anti-inflammatory drugs (NSAIDS) such as, for example, tepoxalin, tolmetin, and. en; (5) immunosuppressive or immunomodulatory agents, such as calcineurin inhibitors, mTOR inhibitors, antiproliferatives, osteroids and s antibodies; (6) antioxidants such as ol, Vitamins C and E, coenzyme Q- '10, glutathionc, L-cysteine, N- acetylcysteine, etc.; and (7) local anesthetics, to name a few.

The pharmaceutical composition of the invention may be typically formulated as liquid or fluid compositions, semisolids (e.g., gels or hydrogels), foams, or porous solids (e.g., polymeric matrices, composites, calcium phosphate derivatives, and the like, as appropriate for ophthalmic tissue ering) or particles for cell encapsulation 'J‘I from natural or tic origin to allow a better administration of the cells or a higher survival and. on. In a particular embodiment, the cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the invention may be administered in semi-solid or solid devices suitable for surgical tation; or may be administered with a liquid. carrier (e.g., to be injected. into the ent subject). Thus, said cells may be surgically implanted, injected. or otherwise administered. ly or indirectly to the site of ocular damage or distress. When cells are administered in semi- solid or solid devices, surgical implantation into a precise location in the body is typically a suitable means of administration. Liquid or fluid pharmaceutical compositions, r, may be administered to a more general location in the eye (e.g., intra-ocularly).

The pharmaceutical composition of the invention may be delivered. to the eye of a subject in need thereof (patient) in one or more of several delivery modes known in the art. In an embodiment the pharmaceutical composition is implanted or red to the retina or surrounding area, via periodic intraocular or intravitrea injection, or under the retina. In addition ideally cells will be delivered only one time at the early onset of the disease, however ifthere will be a ion of the phenotype it might be possible additional deliveries during the life of the subject. As it will be understood by a person skilled in the art, mes the direct administration of the pharmaceutical composition of the invention to the site wishing to benefit can be advantageous. Therefore, the direct administration of the pharmaceutical composition of the invention to the desired. organ or tissue can be achieved. by direct administration (e.g., through injection, etc.) by means of inserting a suitable device, e.g., a suitable cannula, or by other means ned. in this description or known in the technique.

Pharmaceutical compositions for injection may be designed for single-use stration and do not contain preservatives. able solutions may have isotonicity equivalent to 0.9% sodium chloride solution (osmolality of 290-300 'milliosmoles). This may be attained by on of sodium chloride or excipients such as buffering agents and antioxidants, as listed above.

The administration of the pharmaceutical composition of the invention to the subject will be carried out by conventional means, for e, said pharmaceutical 'J‘I composition can be administered to said subject through intravitreal route by using suitable devices such as syringes, as, etc. In all cases, the pharmaceutical composition of the ion will be administered using equipment, apparatuses and, devices suitable for administering cell compositions known by the person skilled in the art.

Dosage forms and regimes for administering the cells for use in the treatment of a retinal degeneration disease according to ents A or B of the invention or any of the other pharmaceutical compositions described herein are developed in accordance with good medical practice, taking into account the condition of the subject, e.g., nature and extent of the retinal degenerative condition, age, sex, body weight and general medical condition, and other factors known to medical practitioners. Thus, the effective amount of a pharmaceutical composition to be administered to a t will be determined by these considerations as known in the art.

Nevertheless, in general, the pharmaceutical composition of the invention (or any of the other pharmaceutical compositions described. ) will contain a eutically effective amount of the cells for use in the ent of a retinal degeneration disease according to Treatments A or B of the invention, preferably a substantially 'nous population of said cells to provide the desired therapeutic effect. In the sense used in this description, the term “therapeutically effective amount” relates to the amount of cells for use in the treatment ofa retinal degeneration disease according to ents A or B of the invention which is capable of producing the desired therapeutic effect (e.g., regenerate total or lly the retina and/or rescue of functional vision, and. the like) and. will generally be determined by, among other factors, the teristics of said cells themselves and. the desired. therapeutic effect.

Generally, the therapeutically effective amount of said cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the ion that must be administered will depend on, among other factors, the characteristics of the subject himself, the seriousness of the disease, the dosage form, etc. For this purpose, the dose mentioned in this invention must only be taken into account as a guideline for the person d in the art, who must adjust this dose depending on the aforementioned factors. In a particular embodiment, the pharmaceutical composition of the invention is administered in a dose containing between about 104 and about 1010 cells for use in the ent of a retinal degeneration e according to Treatments A or B of the invention per eye, preferably between about 106 and. 108 cells per eye. The dose of said, cells can be repeated. depending on the status and evolution of the t in temporal intervals of days, weeks or months that must be established by the specialist in each case.

In some occasions, it may be desirable or appropriate to pharmacologically immunosupprcss a subject prior to initiating cell therapy. This may be accomplished through the use of systemic or local im-munosuppressive agents, or it may be accomplished by ring the cells in an encapsulated device. These and other means for reducing or ating an immune response to the transplanted. cells are known in the art. As an alternative, the cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the invention may be genetically modified. to reduce their immunogenicity.

Kits In another aspect, the invention relates to a kit, hereinafter referred. to as “kit of the invention”, ed from the group consisting of: l) a kit comprising at least a cell selected from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell. a chymal stem cell (MSC), and any combination thereof. wherein the Wnt/B- eatenin signalling y of said. cells is activated, and. instructions for use of the kit components, and. 2) a kit comprising at least a cell selected. from the group consisting of a hematopoietic stem cell (HSC), a progenitor cell, a mesenchymal stem cell (M SC). and any combination thereof, in combination with a Wnt/B-catenin signalling pathway activator or an inhibitor of a Wnt/B-catenin ling pathway repressor, and instructions for use of the kit components.

In order that the HSCs, progenitor cells, and/or MSCs have their Wnt/B-catenin signalling pathway activated [kit of the invention 1)], said HSCs, progenitor cells and/or MSCs are treated with a Wnt/B-catenin signalling pathway activator, or with an inhibitor of a Wnt’B-catenin signalling pathway sor, and/or are manipulated in 'J‘I order to press a Wn tJB-catenin signalling pathway activator.

The kit of the invention can be used in the treatment of a retinal degeneration disease.

The particulars of the cells for use in the treatment of a retinal degeneration disease according to Treatments A or B of the invention, pharmaceutical composition of the invention, and retinal ration disease to be treated. have been previously mentioned and are incorporated herein. ing to another aspect of the invention, a method is provided. for ng a subject having a retinal degeneration disease (i.e._, a patient), which comprises administering to said. subject in need. of treatment a cell or a cell population for use in the treatment of a retinal degeneration disease according to the invention, a pharmaceutical composition of the invention, in an amount effective to treat the retinal degeneration disease, wherein said treatment of the retinal degeneration disease occurs by reprogramming of retinal cells, such as retinal neurons and/or retinal glial cells, mediated by cell fusion of said cells with said retinal cells, said reprogramming being 'm d by activation of the Wn t/B-catenin pathway.

The particulars of the cells for use in the ent of a retinal degeneration disease according to the invention, pharmaceutical itions of the invention, retinal degeneration diseases to be d and effective amount to treat said diseases have been previously mentioned and are incorporated herein.

In a particular embodiment, the retinal cells comprise retinal neurons (e. g., rods, ganglion cells, amacrine cells, etc.). In another particular embodiment, the retinal cells comprise retinal glial cells (e.g., Muller cells, etc.). In r particular ment, the retina] cells comprise retinal neurons (e.g., rods. ganglion cells, amacrine cells, etc.) and retinal glial cells (e.g., Muller cells, ctc.).

In a particular embodiment, the method for treating a subject having a retinal degeneration disease comprises the administration of a pharmaceutical composition of the invention 1), i.e., a pharmaceutical composition comprising at least a cell ed from the group consisting of a HSC, a progenitor cell, a MSC, and any ation thereof, wherein said cells have their Wnt/B-catenin signalling pathway activated, and a pharmaceutically acceptable carrier, in an amount effective to treat the retinal degeneration disease, wherein said ent of the retinal ration disease occurs by reprogramming of l cells, such as retinal neurons and/or l glial cells, mediated. by cell fusion of said cells with said retinal cells, said reprogramming being mediated. by activation of the catenin pathway.

In order that the HSCs, progenitor cells, and/or MSCs have their Wnt/B-catenin ling pathway activated [kit of the invention 1)], said HSCs, progenitor cells and/or MSCs are treated with a Wnt/B-catenin signalling y activator, or with an inhibitor of a Wnt/B-catenin signalling pathway repressor, and/or are manipulated in order to overexpress a Wnt/B-catenin signalling y activator.

In r aspect, the invention es a method for treating a subject having a retinal degeneration disease (Le, a patient), which ses administering to said t in need of treatment a cell selected from the group consisting of HSCs, itor cells and MSCs, or a cell population comprising a plurality of cells, said cells being selected. from the grow consisting of HSCs, progenitor cells, MSCs, and any combination thereof, or a pharmaceutical composition comprising said cell or cell population, in an amount effective to treat the retinal degeneration disease, wherein said treatment of the retinal degeneration disease occurs by reprogramming of retinal cells, such as retinal neurons and/or retinal glial cells, mediated by cell fusion of said cells with said. retinal cells, said reprogramming being mediated. by activation of the Wnt/B- catenin pathway.

In a particular embodiment, the above method. for treating a subject having a retinal degeneration disease comprises the administration of a pharmaceutical composition composition comprising at least a cell selected from the group consisting of a HSC, a progenitor cell, a MSC, and any combination thereof, together with, optionally, a Wnt/B-catenin signalling pathway activator, or an inhibitor of a Wnt’B- catenin signalling pathway repressor, and a phatmac-eutically acceptable carrier, in made from cells other than the cells of the invention, in an amount ive to treat the retinal degeneration disease, wherein said treatment of the retinal degeneration disease occurs by reprogramming of retinal cells, such as retinal neurons and/or retinal glial cells, ed by cell fusion of said cells with said retinal cells, said reprogramming being mediated by activation of the Wnt/[3-catenin y.

The t ion is r illustrated, but not limited, by, the following examples.

EXAMPLE 1 Haematopoietic stem cell fusi0n trioIgers retinal revIeneration in a mouse model of Retinitis Pigmentosa I. Methods Cell preparation Lineage-negative HSPCs were isolated. from total bone marrow of P mice (mice stably expressing CRE and red fluorescent protein [RFP]; provided by Jackson Laboratories) using Lineage Cell Depletion kits (Miltenyi Biotech). They were treated either with l iLM BIO or PBS and with 1 uM tamoxifen for 24 h before transplantation.

Animals R26Yrdl mice (mice ng the R26Lox-Stop-Lox-YFP transgene and homozygous for the ra’I mutation) [S'rinivas er (11., BMC Dev Bin! 1, 4 (2001)].

Transplantation A range of 105-106 cells were transplanted. in mice previously anesthetized with an intraperitoneal injection of ketamine: metomidine (80 mg/kg: 1.0 mg/kg, 1.10.), the eye lid opened carefully, a small incision made below the ora serrata and I up to 5 pl of a solution containing cell suspension in PBS was injected into the vitreus or in the subretinal space. The capillary was maintained in the eye for about 3 seconds to avoid reflux.

Hflrid FACS sorting For gene expression analysis, 24 h after cell transplantation mouse retinal tissues were isolated and disaggregated in tryps'in, by mechanical ation. A FACS cell sorter was used to isolate the red and green ve hybrid cells. Total RNA was extracted using RNA Isolation Micro kits (Qiagen), according to the manufacturer protocol. The RNA was reverse-transcribed with SuperScript III (Invitrogen) and. qRT- PCR reactions using Platinum SYBR green qPCix—UDG (Invitrogen) were run in an ABI Prism 7000 real-time PCR machine. All experiments were performed in triplicate, and differences in cDNA input were compensated for by normalisation to expression of GAPDH. The primers used in the R analysis are shown in Table 2.

Tablez Mouse 8 ecific rimers for RT-PCR Gum] SuperArray ence Corporation [Catalog No. 5 l A-200] Rhodopsin FW GTAGATGACCGGGTTATAGATGGA RV GCAGAGAAGGAAGTCACCCGC RDS Fw CGGGACTGGTTCGAGATTC RV ATCCACGTTGCTCTTGCTGC Cm Fw ATCCGCAGAGCGTCCACT RV CCCATACTCAAGTGCCCCTA Rx Fw GTTCGGGTCCAGGTATGGTT Rv GCGAGGAGGGGAGAATCCTG Chxi0 Fw ATCCGCAGAGCGTCCACT RV CGGTCACTGGAGGAAACATC Nes‘tin Fw TGGAAGTGGCTACA RV TCAGCTTGGGGTCAGG Noggin Fw CTTGGATGGCTTACACACCA RV TGTGGTCACAGACCTTCTGC 0H2 Fw AGTCGCCACCTCTACT RV CCGCATTGGACGTTAGAAAAG [Fw: Forward; RV: Reverse] TUNEL assa Apoptotic nuclei were detected by TdT-mediated dUTP terminal nick-end labeling kit , fluorescein; Roche Diagnostics, Monza, Italy) according to the producerl s protocols.

H&E ng Briefly, tissue sections were stained with Histo'Pert‘eetTM H&E Staining MN“.

(Manufacturer: BBC Biochemical) according to the produceris ols.

Samples treatment Tissues were fixed by immersion in 4% paraformaldehyde overnight, and then embedded in OCT compound (T-issue-Tek). Horizontal serial ns of lO-mm ess were processed for analysis. For fluoresceine immunostaining, the primary antibodies used were: anti-Nestin (1:300, Abeam), anti-Otx2 (1:200, Abcam), anti- Noggin (1:200, Abcam), anti-Thy1.1 (1:100, Abcam), yntaxin (1:50, Sigma), antiglutamine synthetase (Sigma, 1:100) anti-An‘nexin V (1:200, Abcam) and anti-Ki67 (Sigma, 1.100). The ary antibodies used were: anti-mouse IgG and anti-rabbit lgG antibodies conjugated with Alexa Fluor 488, Alexa Fluor 546 or Alexa Fluor 633 (1 :1000; Molecular Probes, Invitrogen).

Statistical analysis The numbers of immunereactive or YFP-positive cells Within three different retinal areas (40X field) were counted in individual sections. A total of 10 serial sections were examined. for each eye, from at least three different mice. For statistical is, the data were expressed as means iSEM, as pooled from at least three independent experiments, each carried out in duplicate. 2. Results Retinitis Pigmentosa is a devastating blindness disorder that arises from different mutations in more than 100 known genes [Wright et al. Nat Rev Genet 11, 4, doi:11rg2717 [pii]10.1038.-’in'g2717 (2010)]. Rd! mice carry a neous recessive mutation in the P0563 gene that encodes the [3 subunit of cyclic GMP-specific 3|,5I4 cyclic phosphodiesterase. This loss of Function mutation results in accumulation of cyclic GMP and Ca2 in the rods, which in turn leads to photoreceptor cell death [Doona-n er” (1!. Invest Ophthalmol Vis Sci 46, 3530-3538, doi:46/10/3530 [pii]'10.l'I67.’iovs.05-0248 (2005)]. Rd] mice are homozygous for this on, and they represent a severe model for fast progression of this degenerative disease.

HSPCs are multipotent cells that can give rise to all types of blood cells. In addition, they have been proposed to retain some plasticity with some degree of regenerative potential for ent tissues, including for the CNS [Alvarez-Dolado, M.

Front Biosci 12, 1-12 (2007)].

Activation of the Wnt/B-cate'nin pathway has been shown to promote proliferation and dedifferentiation of Miiller glia (Miiller cells) in different mouse models of retinal degeneration, suggesting a possible contribution of this pathway in the modulation of CNS plasticity da, F. e: a]. J Neurosci 27, 4210-4219 (2007)].

Indeed, ors recently reported that periodic activation of the Wnt/B-catenin pathway via Wnt3a or via the GSK-3 inhibitor BIO in nic stem cells (ESCs) strongly enhances the reprogramming of neural precursor cells after cell fusion [Lluis et a]. Cell Stem Cell 3. 493-507 (2008)]. Inventors, ore, asked whether fusion of HSPCs with retinal neurons along with a transient activation of the Wnt/B-catenin pathway in transplanted HSPCs might be a mechanism for retinal regeneration and onal Vision rescue in rdI mice.

CREIRFP Thus. inventors transplanted Lin' HSPCs (isolated from donor mice stably expressing CRE and red fluorescent n [RFP]) tinally in the eyes of postnatal day '10 (p10) R26Yrdl mice (carrying the R26Lox-Stop-Lox-YFP transgene and homozygous for the rd! mutation) and sacrificed. the mice 24 h later. It was expected. to e RFP and. yellow cent prorein (YPP) double-positive hybrid. cells in case of cell fusion (Fig. 1a). Indeed, it was observed a very high number of hybrids (RFP/YFP-positive) in the outer nuclear layer (ONL) of the retina, and. some in the inner nuclear layer (IN L) (Fig. 2a).

Inventors have previously shown that the GSK-3 inhibitor BIO does not increase the fusion efficiency of ESCs with neural progenitor cells in vitro [L-luis et a1. (2008) cited. supra]. Similarly, here it was observed able levels of hybrids in the ONL when inventors transplanted HSPCs‘IfiRE’MP pro-treated with BIO for 24 h (henceforth referred to as BlO-HSPCs), to activate the Wnt’B-catenin pathway (Fig. lb and l c).

This ruled out a role for BIO in modulating fusion efficiency in vivo. In contrast, it was not ed any fusion event after subretinal transplantations in control ype R26Y mice at pl 0 (Fig. l d and l e), showing that the genetic cell damage triggers fusion between retinal neurons and HSPCs.

RH rdI (not REP positive) were then transplanted subretinally in R26Y mice to fy the retinal cell fusion partners. These HSPCs fused. specifically with rods in the ONL (rhodopsianPF double-positive cells) (Fig. 2b) and. with Milller cells (glutamine synthetase/YFP double-positive cells) (Fig. 2c). However, fusion between these HS PCs and cones was never observed (Fig. 2d).

Neurodegeneration in rd] mice is already apparent at pl 0 as the photoreceptors (first rods, and later, as a consequence. cones) undergo apoptosis and degeneration; by p20 these are already almost completely gone. Interestingly, the number of apoptotic photoreceptors decreased substantially after BIO-HSPCs transplantation, which suggested that rod-cell death was delayed or stopped already at 24 h after transplantation (Fig. 20). Furthermore, in the YFP-positive hybrids that derived from fusion of the BlO-HSPCsCRE’m with retinal neurons (i.e., the BIO-hybrids), there were low levels of apoptosis (20%, of total YEP-positive cells) and a high eration rate (16%). In contrast, in the hybrids formed between O-treated HSPCSCRH’RH) and l neurons (i.e., 'no-BIO-hybrids), there were high levels of cell death (75%) and a low proliferation rate (2%) (Fig. 2f, 2g and Fig. 3).

To characterise the YFP/RFP hybrids, they were FACS sorted from the transplanted s and analysed for expression of l sor neuronal and retinal markers, by qRT-PCR analysis (Fig. 2h). The neuronal precursors Nestin, Noggin and. Otx2 were clearly activated in the BIO-hybrids, with low activation of the Crx, Rx and (7th photoreceptor precursor markers. Moreover, rhodopsin and. pheripherin (rds), which are expressed in terminally differentiated photoreceptors, and GATA-I, an HSPC marker, were strongly down-regulated in the BIO-hybrids. In contrast, in the 'no-BIO-hybrids, there was no reactivation of precursor cell markers or silencing ofli-neage genes (Fig. 2h).

The protein expression was then analysed in sections. Here, the BIO-hybrids had activated sion of Nestin, Noggin and Otx2; in st, in the no-BIO-hybrids, there was almost no activation of these markers (Fig. 4). These data thus show the induction of a dedifferentiation process in the newly generated BIO-hybrids.

In conclusion, BIO-hybrids derived from fusion of the BIO-treated HSPCs with retinal neurons do not enter into apoptosis, but instead undergo cell proliferation and erentiation reac-tivating different retinal precursor al markers. In st, the hybrids d from non-BIO-treated HSPCS do not erate, and nor do they dedifferentiate; instead, they undergo apoptosis.

Next, to investigate whether these BIO-hybrids can regenerate retinal tissue, inventors performed a time-course experiment. BlO-HSPCsRFPiCRE and no-BIO- HSPCsRFECRE were transplanted subretinally at pl 0 in different groups of R26Yrdl mice, and TUNEL and H&E staining were performed on retinal sections after 5 (p15), 10 (p20) and 15 (p25) days, and after 2 months (p60). Although the photoreceptors were still clearly present at p15 in l sections from eyes transplanted with both BIO- HSPCs and no-BIO-HSPCs, as shown by the normal structure of the ONL (Fig. 5a, 5b and 6a), the viabilities of the retinal neurons were very different. At p15, there was read apoptosis in the photoreceptor layer in sections from the eyes transplanted with no-BlO-HSPCs (Fig. 5c and 6a); in contrast, cell death was almost absent at p15 in the ONL of retinas transplanted. with BIO-HSPCs (Fig. 5d and 6a). Remarkably, at the subsequent time points (p20 and p25), the photoreceptor layer in BIO-HSPC- transplanted eyes maintained its normal structure (Fig. 5f. 5h and 6a), while rods and cones nuclei were absent in the ON L- of no-BIO-HSPC-transplanted eyes. In their place, few aberrant nuclear layers of cells were seen, which expressed pigmentu'm and which were positive to the retinal pigment epithelium marker, Rpe65 and to the RFP only (Fig. 5e, 5f, 5g, 6a and. 6b).

Finally, at 2 months after transplantation, the retinas of the BIO-HSPCs- transplanted rd! mice were still indistinguishable from the wild—type retinas along the entire tissue (Fig. 5i, Sj, 5k and 5]), with '10 rows of photoreceptor nuclei and normal outer and inner segment ures. On the other hand, the histology of no-BlO-HSPCs— transplanted s was comparable to those of the non-transplanted rd] eyes, with fully degenerated photoreceptor layers (Fig. 5111, 511, 50 and 5p).

Thus. it can be concluded that the lanted BIO-HSPCs fully preserved the photoreceptor layer in the rd] mouse s at least up to two months after their transplantation. This would t either a block in the degeneration mechanism or activation of a regeneration s. In contrast, transplantation of no-BIO-HSPCs did not rescue the rd] mouse ype, even if the transplanted cells retained a moderate potential to transdifferentiate into retinal ted epithelium cells.

To investigate differentiation of the hybrids in the long term, R26Y'd' mice were transplanted at p10 with BIO-HSPCsCRF‘ or no-BIO—HSPCsCRF‘ and analysed again two months after the transplantation. Here, there was a full layer of YFP-positive cells in the BIO-HSPC-transplanted rd! mouse retinas (Fig. 7a). lmmunofluoreseenee staining showed that YFP hybrids were differentiated into rods, but not into cones, as they were positive to staining for rhodopsin (Fig. 7a) but not for cone ops-in (Fig. 7b). Furthermore no YFP hybrid cells that were also positive for the Muller cell marker glutamine synthetase or for the endothelial cell marker CD31 were found, thus excluding differentiation of the hybrids into Miiller cells or into retinal vessels (Fig. 7c and. 7d). In contrast, with the no-BIO-HSPC-transplanted cells, almost no YFP-positive hybrids were found two months after their transplantation because the hybrids did not e for this length of time (Fig. 8a). Thus, it can be concluded that the BIO-hybrids differentiate cally in rods, and as a consequence the cones are able to survive. All in all, the expression of YFP in all of the rods clearly indicates that newborn hybrids replace the rd} mutated photoreceptors, y regenerating the retinal tissue.

To further assess hybrid differentiation in rods and to determine whether this fusion-mediated regeneration process can rescue the rd] mouse on, the expression of PDEfiB, which is not sed in rd] mice. was analysed. Remarkably YFP/rhodopsin double-positive rods were also positive for PDE6B expression, as also confirmed. by Western blotting of total extracts from transplanted. retina (Fig. 7g). These results te that the BIO—hybrids can generate wild-type rods, and. thereby can regenerate the retina (Fig. 7e, 7f and 8b); since rd] rods cannot express wild-type PDE6B, the mutation was complemented by the HSPC genome in the hybrids, Next, to determine Whether regenerated rods were also electrophysiologically functional, inventors performed electroretinogram tests on rd! mice 1 month after transplantation of BIO-HSPCs or no-BlO-HSPCs. Of note, both A and B waves under scotopic and ic conditions were recorded in 4 mice out of 8 transplanted with BIO-HSPCs. with a A amplitude in the order of 150 uV on average (not shown) ting that the regenerated rods underwent cell-membrane hyperpolarisation in response to a light stimulus, and that they could transmit the electric signals to the intemeurons, as indicated by the B-wave response. Retinal regeneration under histological analysis confirmed the functional rescue (not shown). Moreover, the viSual acuity of a group of treated. rd] mice between 2.0 and 2.5 months of age were analysed. with the ter test. In the BIO-HSPCs-transplanted rdj mice, the number of head tracking movements, which es the automatic response of the animals when detecting a moving target [Abdeljalil et (1!. Vision Res 45, 1439-1446, doi:80042- 6989(05)00005-2 [pi-i]lO.l0'l6.’j.visrcs.2004.l2.015 (2005)] was significantly higher than that measured in the non-transplanted and no-BIO-HSPCs-transplanted rd] mice (not shown). This demonstrated. a visual response after stimulus in the PCs- transplanted rdl mice. 3. Discussion Some attempts have been undertaken to improve the function of retinal degeneration using bone-marrow-derivcd stem cells (BMSCs). It has been reported that Lin" HSPCs injected intravitreally in rd] mouse eyes can prevent retinal vascular degeneration, a secondary e ype, which then delayed retinal cone degeneration. However, the transplanted retinas were formed of nearly only cones, and the electroretinogram responses were severely abnormal and comparable to untreated animals [Otani et ai. J Clin Invest 114, 765-774, .l 172/.ICI2'1686 (2004)].

Additional investigations relating to the mechanisms of improved retinal function after BMSC transplantation have been based. on the role of BMSCs in promoting an increase in enesis, or a decrease in inflammation, or even anti—apoptotic effects, which might delay retinal degeneration and therefore be beneficial due to slowed progression of the disease. In addition, ifferentiation of transplanted BMSCs in l- pigmented lium, which can sustain photoreceptor survival, has been shown in acute eye injury mouse models [Siqucira er a1. Arq Bras Oflalmol 73, 9, doi:SOOO4—27492010000500019 [pii] (2010)]. All of these approaches, however, have remained far from therapeutically efficient as they have not been seen to significantly improve the regeneration of retinal tissue.

In addition, systemically lanted BMSCs have been reported to fuse with resident cells in different tissues, such as heart, skeletal muscle, liver and brain a et (1!. Nature 4l6, 542-545 (2002); Alvarez-Dolado et al. Nature 425, 968-973 (2003); Piquer—Gil 63‘ a]. J Cereb Blood Flow fi/Ierab 29, 480-485 (2009)]. However, these fusion events are seen to be very rare, which naturally promotes some skepticism as to their physiological relevance [Wurrnser & Gage. Nature 416, 485—487 (2002)]. Here, ors have clearly demonstrated that if Wntr’B-catenin signalling pathway is not activated, the hybrids undergo apoptosis and therefore cannot be detected. at late stages.

The majority of these transplanted HSPCs do not fuse, and instead die; however, a few can transd-ifferentiate into retinal—pigmented epithelium cells, which are of mesenchymal origin. This transdifferentiation can provide some slowing down of the degeneration, but it cannot resc ue the phenotype.

In contrast, the activation of the Wnt/B-catenin signalling pathway induces the HSPC genome in the hybrids to activate the PDE6B gene; in this ion the hybrids themselves were instructed to differentiate into rods, passing through a transient de- differentiatcd state. l\'o heterokaryons could be detected, although it cannot formally discarded. that there were some present. However, the rated eceptors eo- sed PDE6B and YFP, which ted that the genomes of the retinal neurons and of the transplanted HSPCs were mixed in the same cells. It remains to be ined whether reduction mitosis or a multipolar mitosis mechanism as previously reported during liver regeneration can reduce the ploidy of the regenerated photoreceptors, or if double genome copies are tolerated in the newborn rods, which finally preserve cone degeneration. Indeed, tetraploid neurons have been identified in mouse and. human brain [Wurmser & Gage Cited. supra].

Several gene therapy attempts have been undertaken to treat individual Retinitis Pigmentosa mutations; however, a mutation-independent cell—therapy approach could be much more efficient and practical then creating dual gene therapies to treat each single gene mutation. These data e real hope for the treatment of patients with Retinitis tosa as well as further l degeneration diseases.

EXAMPLE 2 o Tri oers Neur0n Re r0 rammino in the Mouse Retina This Example was med to e if somatic cell reprogramming can be induced in s in mammalian. The results obtained show that upon activation of the Wnt/B-catenin signalling pathway, mouse retinal s can be transiently reprogrammed in viva back to a precursor stage after spontaneous fusion with transplanted haematopoietic stem and progenitor cells (HSPCs). Moreover, it has been shown that retinal damage is essential for cell-hybrid formation in viva. Newly formed hybrids reactivate neuronal precursor markers, 0614 and. Nanog; furthermore, they can proliferate. The hybrids soon commit to differentiation along a neuroeetodermal e, and. finally into ally differentiated neurons, which can regenerate the damaged retinal tissue. ing retinal damage and ion of Wnt/B-catenin signalling pathway in the eye, cell-fusion—mediated reprogramming also occurs after endogenous mobilisation of bone marrow cells in the eyes. These data. show that in-vivn reprogramming of terminally differentiated retinal neurons is a possible mechanism of tissue regeneration. 1. Experimental Procedures Animal care and treamzems All of the procedures on mice were performed. in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and with our institutional guidelines for animal research. All of the animals were maintained under a 'l 2 li light/dark cycle, with access to food and water ad libitum.

Retinal damage and BrdU treatment Mice at the age of 3 months were anaesthetised by injection of ketamine: metomidine (80 mg/kg: 1.0 mg/kg, intraperitoneal (i.p.)). To induce retinal damage, the s were treated. intravitreally with 2 ul of 20 mM N-methyl-D-aspartate (NMDA) (total 40 nmol; Sigma) for 24 h [Timmers er at, Mo] Vis 7, 131-137 (2001)]. Control eyes received 2 l1] PBS. For the BrdU incorporation assays, the mice received intraperitoneal (i.p.) BrdU administration of 50 mg/kg body weight.

Stem cellpreparation and transplantation Retinal stem and progenitor cells (RS PCs) were isolated from the ciliary margin of adult Cre mice as usly described [Sanges et al., Proc Natl Acad Sci U S A I03, 17366-17371 (2006)]. Lineage negative HSPCs (Lin' HSPCs) were ed from the total BM of Cre, Cre-RFP or R26Y mice using Lineage Cell Depletion kits nyi Biotech). Human CD34+ HSPCS were purchased from StemCell Technologies. Cells were pre—treated with 1 uM tamoxifen for 24 h to induce nuclear translocation of Cre recombinase, and. labelled with Vybrant DiD (5 lul/ml) (Invitrogen) before transplantation, where necessary.

To obtain ESQ-sac, 5 X106 ESCs were electroporated with the Cre-recombi'nase- ca-n'yi‘ng vector (CAGG-Cre), using ES nucleofector kits (Amaxa).

The stem cells (SCs) were left non-treated or were pretreated with 100 ‘ng/ml Wnt3a or 1 ILLM BIO, for 24 h, and. finally 5 x105 cells were injected. intravitreally into the eyes of the anaesthetised. mice. The mice were sacrificed by cervical dislocation, and their eyeballs were enucleated. for histological analyses.

Hybrid isolation fbr gene sion and tetraploz’a’y analysis Twenty-four hours after cell transplantation, the retinal tissue was isolated. from treated, mice and disaggregated in n by mechanical trituration.

To analyze the tetraploid content of hybrids, cells were pelleted, washed twice with [X PBS and fixed for 2 h in ice with 70% ethanol. After fixation, cells were washed twice with ’lx PBS and incubated with 25 rig/ml propidium iodide and 25 .ug/ml RNAse A -Aldrich) for 30 minutes at room temperature. Samples were analyzed by flow cytometry in a FACSCanto n Dickinson). Doublet discrimination was performed, by gating on width versus pulse-area of the PI channel. Samples were analyzed. with FlowJo software (Tree Star, Inc).

For gene expression analysis, a BD FACSAria 11 g machine (Beeton Dickinson) was used to isolate the red and green positive hybrids cells. Total RNA was ted using RNA Isolation Micro kits (Qiagen), according to the manufacturer protocol. The eluted RNA was reverse-transcribed with cript III (Invitrogen') and qRT-PCR reactions using Platinum SYBR green qPCix—UDG (Invitrogen) were performed in an ABI Prism 7000 real -time PCR machine, according to the manufacturer endations. The species specific oligos used are listed in Table 3. All of the experiments were med in triplicate, and differences in cDNA input were ,compensatedl hormalising to the expression of GA PDH.

Table 3 Human and mouse specific primers for qRT-PCR Human specific primers for gRT-PCR Species/Gene Sequence 5’-3’ SEQ ID NO: h0cz4 Fw ACCGAGTGAGAGGC 17 Rv CACACTCGGACCACATCCTTC 18 hNanog Fw CCAACATCCTGAACCTCAGCTAC [9 RV GCCTTCTGCGTCACACCATT 20 hN 9.51m Fw CCAGAGGCTTCTC 2'] Rv CAGGGCTGGTGAGCTTGG 22 h0zx2 Fw ACCCCTCCGTGGGCTACCC 23 Rv CAGTGCCACCTCCTCAGGC 24 hNoggz'n Fw AGCACGAGCGCTTACTGAAG 25 RV AAGCTGCGGAGGAAGTTACA 26 hCD34 Fw GTTGTCAAGACTCATGAACCCA 2’7 RV ACTCGGTGCGTCTCT(ITAGG 28 Mouse specific primers for gRT-PCR Species/Gene Sequence 5’-3’ SEQ ID NO: m0cr4 Fw CGTGGAGACTTTGCAGCCTG 29 Rv GCTTGGCAAACTGTTCTAGCTCCT 30 mNanog Fw GCGCATTTTAGCACCCCACA 31 RV GTTCTAAGTCCTAGGTTTGC 32 mNes-tin Fw TGGAAGTGGCTACA ‘l 1 RV TCAGCTTGGGGTCAGG ‘l 2 'm00:2 Fw GAGCTCAGTCGCCACCTCTACT 15 RV CCGCATTGGACGTTAGAAAAG 16 mNoggin FW CTTGGATGGCTTACACACCA RV TGTGGTCACAGACCTTCTGC mCD34 FW CTGGTACTTCCAGGGATGCT RV TGGGTAGCTCTCTGCCTGAT 34 [Fw: Forward; Rv: e] Gatal primers were purchased at SuperArray Bioscience Corporation [Catalog number PPM24651A-200] Bone marrow (Bi-MO replacement BM transplantation was conducted as previously reported with minor modifications. The BM of 4- to 6-week-old R26Y or Nest'in-Cre recipient mice was reconstituted with BM cells from the tibias and femurs of RFP/CRE or R26Y transgenic mice respectively. BM cells (12th7 cells) were ed. intravenously into the recipients 3 hours after irradiation with y-rays (9 Gy). The eyes of the recipients were ted. with lead shields to prevent radiation-induced. damage (radiation retinopathy). Four weeks after transplantation, the eral blood of chimeric mice was extracted from the tail vein, and the reconstituted BM was assessed. , sectioning and immum)histochemisngv s were fixed by ion in 4% paraformaldehyde overnight, and then embedded in OCT nd (Tissue-Tek). Horizontal serial sections of 10 um thickness were processed for im'munohistochemistry, and Visualisation of Nanog-GFP and Rosa26-YFP fluorescence was performed by fluorescent microscopy.

For fluoresceine immunostaining, the primary dies used were: anti-Nanog (1:200, R&D), anti—Oct4 (1:100, AbCam), anti-Nestin (1:300, Abcam), anti-GATA4 (1:500, Abe-am), anti—Otx2 , Abe-am), anti—Noggin (1:200, , anti—Handl (1:400, Abcam), anti-Tuj-l (1:100, Abcarn), anti-Thy1.1 (1:100, Abcam), anti-syntaxin (1:50, Sigma), anti-glutamine synthetasc (Sigma, 'l:l00) anti-Anncxin \i , Abcam), anti-Ki67 (Sigma, 1.100) and anti-BrdU (1:300, Sigma). The secondary antibodies used were; anti-mouse IgG and anti-rabbit IgG antibodies conjugated with Alexa Fluor 488, Alexa Fluor 546 or Alexa Fluor 633 (1:1000; Molecular Probes, Invitrogen).

Percentages of GFP and YFP positive cells were evaluated counterstaining the tissue sections with DAPI (Vectashield, Vector tories, Burlingame, CA, USA), and they were photographed using either an Axioplan microscope (Zeiss) or a Leica laser confocal microscope system.

In-vitm culture ereprogrammed hjo’bricls BIO-treated or non-BIO-treated ESCs or HSPCs were ed into the eyes of NMDA-damaged. Nanog-GFP-puro mice. Twenty-four hours after transplantation, the retinal tissue was ed. and treated. with trypsin for 30 min at 37"C. The cells were then reSuspended. as single-cell sions in ES culture media using a fire bore hole Pasteur, and plated onto gelatine—coated dishes at a concentration of 3 ><105 cells/ 9.6 cm2. To select the reprogrammed clones, puromycin was added to the culture medium after 72 h. sitive clones were counted and photographed after one month of culture. The clones were alkaline phosphatase (AP) stained. after 1 month of Culture, as previously bed [Lluis et al, Cell Stem Cell 3, 493-507 (2008)]. ation mounted retinas and optic nerves, and counting Qfganglion cells Retinal flat mounts were prepared as previously described. Briefly, the eyes were hemiscctcd along the era scrrata, and the retinas were separated. from the pigment epithelium and. mounted with the ganglion cell side up, on Isopore 3mm (Millipore).

Retinas were then fixed in 4% paraformaldehyde for 20 min, washed with phosphate- buf‘l‘ered saline, and treated for immu'nostaini'ng as described above. Optic nerves were dissected from the eyes and mounted directly on the slices using Vectashield (Vector Laboratories, game, CA, USA).

Total cells in the ganglion cell layer were counted as described previously (Jakobs et at, (2005). J Cell Biol 171313-315) with minor modifications. Flat-mounted s were counterstained. with DAPI and. survey pictures were taken at 20X on a confocal microscope (Leiea SP5) focusing on the gel. Covering the whole retina required about 80 . Cell nuclei were counted using Fiji Software and graphed as cells/millimeter; A mensional density map of each image was obtained by a routine written in Matlab and pictures of the Whole-mount retina were assembled from individual pictures in Photoshop 9.

Statistical analysis The numbers of immunoreactivc or of Nanog-GFP- and -YFP-positive cells Within three different retinal areas (40>< field) were counted in individual sections. A total of ten serial sections were examined for each eye, from at least three different mice. For statistical analysis, the data were expressed, as means iSEM, as pooled. from at least three independent ments, each d. out in duplicate. The experiments were performed, using at least three different mice. Differences were ed. using the unpaired Student t-test. 2. Results NMDA-induced injury triggers fusion between retinal neurons and stem cells Although cell fusion-mediated somatic cell reprogramming can be induced in culture, it remained to be seen if terminally differentiated cells can be reprogrammed via cell fusion within tissues of adult vertebrates.

Thus. inventors first determined r SPCs could fuse with retinal neurons in viva. For this, inventors used transgenic mice carrying YFP flanked by loxP sites under the control of the ubiquitously expressed Rosa26 promoter as recipients (i.c. with a LoxP—STOP-LoxP-YFP [R26Y] allele) [Srinivas er al., BMC Dev Biol 1, 4 (2001)].

Different SPCs stably expressing Cre recombinasc and labelled in red were transplanted in the eyes of recipient mice by intra—Vitreal injection (5 >105 cells.’eye). Specifically, inventors used Lineage negative (Lin') HSPCs(-"miRl-'P isolated from CRE-RFP double transgenic donor mice, l ,l I-ldioctadecyl-3,3,3I_.B -tetramethylindodicarbocyanine dye (DiD)—labelled RSPCscre ed from the ciliary margin of Cre transgenic mouse eyes s et al., Proc Natl Acad Sci U S A 103, 17366-17371 (2006)], and. belled ESCsUe generated. by the inventors. Mice were sacrificed at ent times after SPCs injection. If cell fusion had occurred n the injected. SPCsore and LoxP—STOP- LoxP-YFP (R26Y) retinal neurons, it could be expected to detect YFP expression in l sections, due to excision of the STOP codon by Cre (Fig. 9A).

Firstly, inventors tested Whether retinal tissue damage caused by intravitreal injections of NMDA in R26Y mice could. induce cell fusion. NMDA caused. apoptosis of neurons in the in] and gel of the retina (Fig. 10A and 103). as shown previously [Osakada et 42]., J Neurosci 27. 4210-4219 (2007)]; however. NMDA did not enhance the stochastic expression of the YFP ene in these R26Y mice (Fig. 10C). Then. inventors induced NMDA damage in the right eye of R26Y mice and left the contralateral eye undamaged as control; 24 h later HSP(Ism’miP were transplanted into both eyes. Mice were finally sacrificed 24, 48 or 72 h after transplantation (Fig. 9A).

Already 24 h after transplantation, up to 70% of the injected HSPCsC'elRH) that were detected in the optical field had fused with retinal cells, thus giving rise to YFP- positive hybrids (Fig. 9B, 9D and 10D). Interestingly, the transplanted cells integrated into the retinal tissue and crossed, the gel, even ng the inl (Fig. 9B, NMDA). In contrast, there were no YFP-positive hybrids in the lateral, non-damaged, eyes; furthermore, transplanted HSPCsC’m’lRFP remained on the border of the gcl and were not integrated into the retinal tissue (Fig. 9C and 9D. No NMDA). Similar s were seen in retinal ns of mice sacrificed. 48 and 72 h after transplantation (Fig. 9D). The presence of tetraploid. cells was also analysed. by flow eytometry. Nuclei with 4C DNA content were clearly evident in the hybrids present in the retinas of R26Y mice lanted with HSPCsmlRW (Fig. 1 0(1).

These data demonstrated that the injury was necessary to induce migration of transplanted HSPCs into the retinal tissue and their fusion with retinal neurons.

The localization of the hybrids (YFP positive cells) in the retinal tissue ted that transplanted cells fused with ganglion cells (that localize their nuclei in the gel) and amacrine cells (that localize across the ml and the inner plaxiform layer (ipl)) (Fig. 10A); to note, those are the retinal cells specifically damaged after NMDA ent [Osakada er a]. (2007). cited supra]. Thus, to confirm which of the retinal cells fused. with the HSPCs, inventors analyzed the expression of different retinal cell markers in the YFP—positive hybrids 12 h after the transplantation of Lin‘ HSPCsUemW into NMDA-damaged R26Y eyes. YFP hybrids either ve to the ganglion-cell marker thy1.1 in the gel (Fig. 9B), or to the amacrine—cell marker syntaxin in the ipl (Fig. 9F). No co-localisation was seen with the Miller cell marker ine synthetase (Fig. 9G). 60% of the YFP-positive hybrids were thyl.l-positive, while 22% were syntaxin positive (Fig. 10F and lOF), indicating that the majority of the s were formed between ganglion cells and HSPCs, with some fusion with amacrine cells. In the remaining 18% of the sitive hybrids, the Fusion partners were unclear; indeed, there might also have been down-regulation of thy'l.l and/or syntaxin in the newly formed hybrids.

Next inventors performed similar experiments by injecting DiD-labelled ESCscrc and DiD-RSPCsCrc into undamaged and NMDA-damaged eyes of the R26Y mice. With both cell types, up to 70% of the injected cells detected in the optical field fused with retinal neurons (Fig. 11A, 11B, and 10D). Also these cells fuse with ganglion cells and amaerine cells as demonstrated by the localisation of the YFP signal in the gel and. ipl and by the eo-localisation of the YFP and. thy1.1 or syntaxin s (Fig. 11A, 11B and data not shown).

To further m that injected SPCs do indeed fuse with post-mitotic retinal neurons, the erative potential of retinal cells before the fusion event was ed.

Concurrently inventors injected thymidinc analogue Sl-lbromo-2 -deoxyuridine (BrdU) intraperitoneally and NMDA into the eyes of R26Y mice; then, after 24 h ESCsCre were injected and, finally, the mice were sacrificed 24 h after this transplantation. Not BrdU— positive cells (red arrows) were seen to be also ve for YFP (green arrows), thus excluding the fusion of ESCs with proliferating cells (Fig. l 1C). The BrdL'-positive cells found next to the gel (Fig. 11 C, red arrows) were probably lial cells that had been recruited to the retina following the damage [Davies et al., Moi Vi's‘ 12, 467-477].

Overall, these data demonstrate that HSPCs, ESCs and RSPCs can spontaneously fuse with retinal neurons in viva upon cell damage.

The Wnt/B-catenin signalling pathway triggers reprogramming of retinal neurons in viva Wnt/B-catenin signalling pathway is ted. after NMDA damage resulting in increased expression of B-catenin, which accumulates into the cells (see Fig. 12A and.

Osakada er al. (2007) cited supra). Thus, inventors tested whether endogenous Wnt/B- n pathway activation could. mediate reprogramming after cell fusion in viva.

For this, two different mouse models were used as recipient mice; Nestin-CRE (transgenic mice expressing Crc rccombinasc gene under the control of Nestin promoter in neural precursors) [Tronche et (11., Nat Genet 23, 99-103 ( I999); Okita et (11., Nature 448, 7 (2007)]and, Nanog—GFP-Puro mic-e (transgenic mice expressing GFP- puromycine genes under the control of the Nanog promoter in the embryo [Okita et al._.

Nature 448, 313-317 (2007)], which allowed us to investigate reprogramming at the neuronal precursor and the nic stages, respectively. DiD-labelled HS PCsRM and HSPCsRFP were injected into the eyes of the Nestin-CRE and Nanog-GFP-puro mice, tively. NMDA was injected intravitreally into one eye of a group of mice, while the contralateral eye remained. undamaged as l. lmportantly here, no expression of Nanog-OPP (Fig. 12C) or Nestin-Cre (data not shown) transgene was detected following NMDA ent in the ganglion and amacrine cell. After 24 h, HSPCs were injected into both the eated. and. NMDA-treated. eyes, and, the mice were sacrificed. after an additional 24 h. In the case of reprogramming of the retinal neurons. in these mouse models it could be expected to find double red/green positive cells (Fig. '1 3A and Fig. 128). No green-positive cells were seen after ion of HSPCs into the non- damaged eyes (Fig. BB, 13C, 13D and l3E, No NMDA). In contrast, about 30% and % of the total red. cells were also green when HSPCs were injected into the NMDA- damaged eyes of -CRE and. Nanog-GFP-puro mice, respectively (Fig. 13B, 13C, 13D and. 13E, NMDA; and. 10C), indicating that up to 30% of the hybrids were indeed reprogrammed. as they had reactivated Nanog and Nestin promoters in the neuron genome.

To assess the role of activation of the endogenous W'nt/B-eatcnin signalling pathway in the reprogramming of retinal neurons, in both of these mouse models, DKK'] was also ed immediately after NMDA injection; DKKI is an inhibitor of the atenin y [Osakada et al. (2007) cited supra, Fig. '1 2A]. HSPCs were transplanted after 24 h, and mice were sacrificed 24 h later. DKKI injections almost completely blocked the reprogramming of neuron—HSPC hybrids (Fig. 133, l3C and 13D, NMDA+DKK1‘), which demonstrated that endogenous and damage-dependent activation of the Wnt-‘B-catenin pathway triggers reprogramming of retinal neurons after their fusion with HSPCs.

Next. inventors aimed. to analyse whether reprogramming of retinal neurons was increased after transplantation of HSPCs in which the Wnt/[3-catenin signalling pathway had been previously activated by the GSK-3 inhibitor BIO or by Wnt3a treatment before injection (Fig. 'l2D, ‘12E and lZF). Surprisingly, 24 h after transplantation of BIO-pretreated or Wnt3a-pretreated. HSPCs in NMDA—damaged. eyes of the Nestin- CRE and Nanog-GFP mice. there was a striking increase in the number of reprogrammed (green-positive) s with t to those seen in NMDA-damaged eyes that received untreated-HSPCs (Fig. 138 and 13E; NMDA+BIO, NMDA+Wnt3a).

Similar results were also observed in mice sacrificed 48 h and 72 h after cell transplantation (data not shown). Of note, after injection of BIO-treated HSPCs into non-damaged eyes, both Nanog-GFP-puro (Fig. 12G) and. Nestin-CRE transgenes (data not shown) were not expressed, confirming that the tissue damage is necessary for spontaneous cell fusion-mediated. retinal neuron reprogramming.

To evaluate the efficiency of this iii—viva reprogramming, inventors counted the green-positive rammed. cells relative to the total population of red-HSPCs detected in the optical field (Fig. 10(3). In the d retinas, up to 65% of both the BIO-pretreated and the Wnt3a-pretreated HSPCs reprogrammed retinal neurons after fusion, leading to the formation of double-positive HSPC-ncuron hybrids in both of these mouse models (Fig. 13C and. 13D).

Given that it was surprising to observe reprogramming at the embryonic stage after fusion of HSPCs with ally differentiated neurons, it was investigated. activation of the Nanog-GFP transgene after transplantation of ESCs and RSPCs into NMDA-injured eyes.

As it could be expected, in the case of the ESC transplantation, reprogramming of the retinal neurons, which was also dependent on tion of the endogenous Wnt/B-catenin ling pathway, was also observed. GFP-positive cells were also strikingly increased when ESCs were pretreated with BIO or with Wnt3a before being transplanted (Fig. 14A). To confirm reprogramming 0f ESC-retinal neuron hybrids, inventors cultured GFP-positive hybrids FACS-sorted from NMDA-da‘maged retinas of Nanog-GFP-puro mice transplanted with BIO-treated or untreated ESCs.

Reprogrammed GFP positive colonies were grown in culture and they were also resistant to puromycine selection and. positive to the ne phosphatise (AP) staining (Fig. 143).

In contrast, no ramming events after ion of RSPCs into the NMDA- injured eyes of the GFP mice was observed, even in the case of BIO pre- treatment of transplanted RSPCs (Fig. . Interestingly, only a few YFP-positive cells were observed after lantation of BIO-treated RSPCMC‘Y, in NMDA-damaged eyes of Nestin-CRE mice (not shown).

Finally, it was also ruled out an effect of BIO in the enhancement of fusion events in viva. BIO pre-treatment did not enhance the fusion efficiency of the HSPCs, ESCs or RS PCs injected into the NMDA-damaged eyes of the R26Y 'mice (Fig. 14D).

In conclusion here, it has been shown that activation of the Wntffi-catenin signalling pathway triggers the reprogramming of retinal neurons back to an embryonic/neuronal precursor stage, and. that this occurs ing damage-dependent cell-cell fusion of HSPCs and ESCs, but not of RSPCs.

To better characterize the rammed hybrids, in addition to look at Nestin- CRE and Nanog-GFP tra'nsge'nes reactivation, the expression profile of precursor and embryonic genes in vivo was analyzed in the newly formed hybrids. Then it was injected eated or untreated HS PCsCMRFP in \IMDA-damaged CYCS 0f R26Y mice, and 24 h later the hybrid. cells from the retinas were sorted by FACS. Marker expression was analysed by real time PCR. In the BIO-hybrids (hybrids formed by the BIO-treated HSPCs) Oct4, Nanog, Nestin, Noggin and. Otx2 were up-regulated (Fig. 15A), indeed, no expression of these genes was detected in the non-transplanted NMDA-injured retinas, nor in the HSPCs, with the exception of Nanog in the HSPCs (Fig. 16A and 16B). In contrast, Gatal, which is a HSPC specific gene, was down-regulated. in the BIO-hybrids (Fig. 15A). None of the sors markers were re-expressed (or they were poorly expressed in the case of Nanog and Nest-in) in non-BlO-hybrids, where expression of Gatal was comparable to that observed in the HSPCs (Fig. 15A and Fig. 168). sion of Oct4, Nanog and Nestin proteins in the BIO-hybrids was also confirmed. by their merged immunostaining signals with the YEP-positive hybrids in sections (Fig. 15B). r, to clearly trate that the re-expression of embryonic and progenitor markers resulted from reprogramming of the neuron genome and not from the genome of the injected HSPCs, inter-species hybrids were analyzed. For this, inventors transplanted BIO-treated and belled CD34 human HSPCs into damaged eyes of Nanog-GFP mice. The reprogramming of the retinal s was confirmed. in sections after fusion of the human HSPCs (Fig. 16C). Interestingly Oct4, Nanog, Nestin, Noggin and Otx2 were all expressed (as analysed with mouse-specific oligonucleotides; see Table 3) from the reprogrammed mouse neuron genome in the sorted hybrids (Fig. 15C). In addition, in the human genome. expression of Oct4, Nestin, Otx2 and Noggin was activated, while CD34 was down-regulated (Fig. '1 5D). l, it can be concluded that HSPC-fusion-mcdiated reprogramming of retinal neurons controlled by Wnt/B-catenin signalling pathway can occur in viva.

Reprogrammed neurons can proliferate and differentiate in viva Next the proliferative potential of the reprogrammed neurons was investigated.

Thus, BIO-treated. and ted. HSPCsUe were injected. into the NMDA-damaged. eyes of a group of R26Y mice and retinal sections were analysed 24 h later.

Surprisingly. 8% of the YFP-positive reprogrammed hybrids (after injection of BIO-treated m) underwent proliferation (Fig. '15E and 156. Ki67/YFP double positive); these cells were not committed to an apoptotic fate, as only about 5% of the hybrids were positive for Annexin-V staining (Fig. 15F and. 15H). On the contrary, injection of O-treated HSPCsCRF‘ led to the formation of non-proliferative s (Fig. 15E and lSl; as negative to Ki67 staining) that underwent apoptosis, as up to 30% of the sitive hybrids were positive for Annexin-V staining (Fig. 15F and '15.], Anexin-V!YFP double positive). Similar results were obtained 72 h after transplantation of BIO-treated or non-BIO-treated ESCs (Fig. 16D and. 16E). Overall, these data show that hybrids formed between HSPCs or ESCs and retinal neurons embark into apoptosis. but if the Wnt/B-catenin pathway is activated in the transplanted SPCs. the neurons can be reprogrammed, survive and ter into the cell cycle.

Inventors then analysed the iii-vim entiation potential of the reprogrammed retinal neurons in the NMDA-damaged. retinas of the R26Y mice injected with BIO- treated. and non-BIO-treated. HSPCsCfe. The mice were sacrificed. 24, 48 and. 72 h afier lantation. The percentages of YFP-positive hybrids for each marker were determined from retinal sections (Fig. 10C). ably, 24 h after the injection of the eated HS PCs, reprogrammed neurons (as YFP positive) were y re- expressing Nestin, Noggin and OtXZ, and this expression was maintained at the subsequent time points analysed (48, 72 h). Conversely, the al terminal differentiation marker Tuj-l was progressively silenced. In addition Seal and c-kit were ly down-regulated in these hybrids. Oct4 and Nanog were also highly expressed at 24 and 48 h, although their expression was decreased by 72 h (Fig. l SB and 15K). In contrast, a low number of YFP positive hybrids obtained after fusion with non-BIO- treated HS PCs reactivated Nestin, Noggin and Otx2, and instead they maintained expression of Tuj-l, Sca-l and c-kit in the majority of the hybrids. Oct4 and Nanog were also expressed, gh only at 24 h and in very few hybrids at the later (48, 72 h) time points (Fig. 15L), GATA4, a mesoderrn , and Handl, an endoderm marker, were never expressed in the hybrids (Fig. 15K and. 15L). In conclusion, the BIO-hybrids were reprogrammed and tended to differentiate into the neuroectoderm e. In contrast, the non-BIO hybrids were poorly reprogrammed, and thus they did. not embark into neuroectoderm differentiation.

Similar differentiation analysis, performed after injection of BIO-treated ESCsCrc in the damaged R26Y retinas, showed a delay in the neuroectodermal differentiation potential of the ing hybrids (as Nestin, Noggin and Otx2 were expressed. more at 72 h afier ESC ion while Oct4 and Nanog where highly expressed from 24 to 72 h) and the positive expression of Gata4 and Handl. These s indicate that ESC- neuron hybrids are more pluripotent and can differentiate in the neuroeetodermal lineage but also in the mesoderm and endoderm lineages (Figure "l 6F).

Finally, ors investigated r the BIO-hybrids that were committed to a neural differentiation fate can terminally differentiate into retinal neurons and thus regenerate the damaged retina. For this, a group of NMDA-damaged eyes of R26Y mice were injected with eated or non-BlO-treated HSPCsCWRFP and sacrificed 2 weeks later. Remarkably, YFP/RFP neurons in the gel and in the in] were observed only after transplantation of BIO-treated HSPCs. These cells were positive to the markers for thy1.1 and syntaxin, clearly indicating that the hybrids differentiated into ganglion and. amacrine neurons. On the contrary, no D hybrids were detected. 2 weeks afier transplantation of untreated. HSPCs, as they undergo cell death at short time. Next, the histology of the transplanted retina was analyzed. Strikingly, it was ed that the number of nuclear rows in the gel and in the in] of the retinas transplanted With the BIO- treated HSPCs was increased substantially with respect to those with the non-BIO- treated HSPCs and to splanted retinas. Their numbers were comparable to those in the wild-type retina (Fig. 17A, 17B and. 17C). These data clearly indie-ate that reprogrammed HSPC-neuron hybrids can differentiate in retinal neurons and regenerate the damaged retina. Thus, it can be concluded that cell-fusion-mediatcd ramming can trigger retinal tissue regeneration Reprogrammed hybrids can regenerate the injured retina Having seen that the reprogrammed hybrids can proliferate and differentiate towards neuroectodermal lineage inventors aimed to evaluate long-term differentiation and their regenerative potential. Then, HSPCscre were pre-treated. with BIO to activate Wnt signalling and transplanted. into the NMDA-damaged. R26Y eyes. In parallel, untreated. re ’ere lanted. as control. The mice were sacrificed. 4 weeks later (Figure 18A).

Analysis of flat-mounted retinas transplanted with BlO-HSPCs showed a high number of YFP+ hybrids (Figure 183) that were positive for expression of ganglion (SMl-32) and. amacrine (Chat) neuron markers (Figure 18C). Inventors then also analysed the optical nerves 24h and one month after transplantation. ably, in one-month optical nerves we observed YFP+ axons, likely derived, fi’orn tions of the regenerated ganglion neurons (Figure 18D). In contrast, retinas transplanted. with untreated HSPCsCrc showed very few YFP+ hybrids (Figure 22A) and no YFP+ axons were found along the l nerves (Figure 18D, untr.HSPCs). Interestingly, no YFP+ axons were seen in the optical nerves 24 h after transplantation of BIO-HSPCs (Figure 22B), indicating that the newly generated ganglion neurons project their axons some time after transplantation, likely during the regeneration process (Figure 180).

NMDA treatment induces recruitment of macrophages in the eye (Sasahara et (11., Am J Pathol I72, 703 (2008)). Indeed, as expected, in retinas harvested 24 h after transplantation, a tage of the YFP+ hybrids were positive to tc/ macrophage CD45 and Macl s, which suggested phagocytosis of some transplanted relRH’ by endogenous macrophages carrying the R26Y allele or phagocytosis of some YFP+ hybrids themselves (Figures 22C and, 22D). Interestingly, this percentage was already drastically decreased. in retinas harvested 2 weeks after transplantation es 22B and 22F). This result y indicates that although some hybrids can be phagocytosed son after transplantation, a percentage of them can e and regenerate the retinas.

Next, inventors analysed the occurrence of cell nuclei regeneration in al sections. Interestingly, the number of neuronal nuclei in the ganglion cell layer (Figures WA and 173, gel), and the number of nuclear rows in the inner nuclear layer (Figures 1 7A and 17C, inl) of retinas transplanted with BIO-HS PCs was comparable to wild-type retinas and substantially increased with respect to nontransplanted retinas or retinas transplanted with untreated HSPCs es 17A, 17B and 17C). This clearly tes retinal regeneration. ors also investigated the r density of the ganglion neurons in the whole unted. retinas by counting the total number of ganglion nuclei in the whole retinas harvested one month after transplantation. Remarkably, there was a significant increase of nuclei number in BIO-HSPCsCl'e-transplanted. retinas, with respect to the non-transplanted retinas (Figure I7D). r, newly generated ganglion neurons were not uniformly distributed, as shown by the nuclear density maps, indicating no-n-homogenous retinal regeneration (Figure 171-3).

These data clearly demonstrate that if Wnt signalling is activated, partial ration of retinal cells after NMDA-damage can be achieved. after fusion of transplanted HSPCs.

Endogenous BMC fusion-mediated reprogramming of retinal s occurs in viva after damage It has been reported. that endogenous BMCs can be recruited. into the eye after NMDA damage [Sasahara et (11., Am J Pat/'20! 172-, [693-1703 (2008)]; however, their role remains unknown. Thus, ors investigated whether endogenous BVICs can also fuse and reprogrammc retinal neurons after NMDA damage. For this, BMCs from donor RFP-(IRE mice (transgenic mice expressing RFP and CRE, both under the control of the ubiquitously expressed B-actin promoter (Long er (1]., (2005). BMC hnol 5, 20; Srinivas et a1. (2001) cited supra» were tail-vein transplanted in sub- lethally irradiated. R26Y ent mice, thereby substituting their BM with BMCWRH).

The repopulation of the BM with cells of donor origin was analysed. according to the expression of RFP in blood cells and by haemocytometric analysis (Fig. 19A). One month after transplantation, NMDA was injected intra-Vitreally in one eye of each group of chimeric mice, and then 24 h later the mice were sacrificed e 20A).

Interestingly, it was found that after NMDA damage, 50% of the RFP-positive cells were also YFP positive. ting fusion of endogenous BMCs recruited in the eyes (Fig. 203. 20C and 20F, NMDA, and Fig. 10D). In contrast, no RFP/YFP-positive cells were found in sections of non-NMDA-injectcd eyes (Fig. 20D, 20E and 20F, No NMDA). These results, clearly demonstrate that cell Fusion occurs between the BMCs recruited into the eyes and the l neurons.

Inventors then analysed the identity of these hybrid. cells that were obtained after endogenOus cell . It was ed that 12 h after NMDA damage, the YFP- positive cells in the retinal sections were also positive for the Seal, Ckit, Thy1.l, Syntaxin, and GS cell markers, clearly indicating that HSPCs were recruited from the BM and fuse with ganglion, amacrine and. Miiller cells (Fig. 200, 20H, 201, 20.1 and 20K).

Next inventors investigated if reprogramming can occur after BMC tment and fusion with retinal neurons; to this aim. BMCstGY were transplanted into a group of sub-lethally irradiated Nestin-CRE mice to generate chimeric mice. The reactivation of Nestin-CRE transgene and the consequent YFP expression enabled. us to identify ramming events after BMC recruitment in the eye. One month later, NMDA and BIO were injected into only one eye of the chimeric mice, which were sacrificed 24 h later (Fig. 21A). YFP-positive cells were observed after injection of BIO in the gel and inl of NMDA damaged. eye, but not in the NMDA-damaged. (non-BIO injected) untreated. lateral eyes (Fig. 218 and 21C). This y indicates that the retinal neurons had fused with the recruited BMCs and were reprogrammed because of the reactivation of the Nesti'n promoter. About 8% of these YFP-positive s were ve for Ki67 expression, and only 1% were Annexin-V positive, which indicated that some of the hybrids were dividing and very few were apoptotic (Fig. 2'] D, 198 and 19C). Strikingly, 50% of these YFP-positive hybrids were also positive for Oct4 expression (Fig. 21E, 21F and 21(3), and 70% for Nanog (Fig. 21E, 21H and 211), confirming that reprogramming of the retinal neurons occ-urred also after mobilisation ofthe BMCs into the eyes.

In conclusion, endogenous activation of BMC-Fusion-mediated ramming ofrcti'nal neurons can occur in the eye if the Wnt/B-catenin pathway is activated. 3. Discussion Here it has been trated that the canonical Wnt’B-catenin signalling pathway mediates the reprogramming of retinal neurons in vivo. In addition, it has been shown that spontaneous cell fusion can occur in the mouse retina after injury and that a proportion of fusion hybrids proliferate if they are reprogrammed by Wnt activity.

Furthermore, it has also been shown that if not reprogrammed, the neuron-SPC hybrids o apoptosis. Surprisingly, the reprogrammed hybrids can regenerate the d. retinal tissue. Finally, it has been clearly showed that after activation of the Wnt/B- catenin signalling y in the eye, BM-derived cells that are recruited into the injured. retina can fuse and. reprogramme the l neurons upon activation of the Wnt/B-catenin signalling pathway. Overall, it can be concluded that cell-fusion- mediated reprogramming can be an nous mechanism ofdamage repair.

Adult SPCs show a high degree of plasticity and pluripotency, and they can contribute to a wide spectrum of differentiated cells. Transplanted BMCs can fuse and acquire the identity of liver cells, Purkinje neurons, kidney cells, epithelial cells, and. more. This plasticity has been ed to either transdifferentiation or cell-cell fusion mechanisms.

Up to now however, cell fusion events have been considered very rare, and therefore the cell identity of the rn” hybrids has never been clearly investigated.

Here, inventors have demonstrated that cell-cell fusion occurs and can be visualised. as a very relevant event y after transplantation of HSPCs into a damaged eye. This is true also after sation of c-kit/sca-l-positive cells from the BM into damaged retinas. In previous studies, the s of hybrids derived from BMC fusion have been largely underestimated; indeed, it has been found here that unless these newly formed hybrids are reprogrammed, they undergo cell death, and. therefore a long time after the transplantation they cannot be detected.

HSPCs fuse with high ncy with ganglion and amacrine neurons; the resulting “newborn” hybrids are novel cell entities, which if a Wnt-signalling stimulus is ed, can initially be transiently reprogrammed and can proliferate and then become terminally differentiated neurons. It is remarkable that it was found expression of Nanog and Oct4, and at the same time, expression of Nestin, Noggin and Otx2 precursor neuronal markers in these hybrids. The expression of Nanog and. Oct4 is a clear evidence of reprogramming back to the embryonic stage; however, this state is transient, at least in the case of fusion between HSPCs and retinal neurons. The hybrids very soon commit to neuroectoderma] lineage, and indeed, 72 h after transplantation, 0ct4 and Nanog were already down-regulated. Finally, in two weeks, the s become terminally differentiated neurons and regenerate the gel and the inl in the retinal tissue. Interestingly, it was also observed full functional regeneration of photoreceptors in a mouse model of Retinitis tosa (RP) after cell-fusion-mediated reprogramming of retinal neurons upon transplantation of Wnt-‘B-catenin y activated HSPCs (Example 1).

These observations led. to pate that Oct4 and. Nanog are not only stem cell genes that are expressed in embryos, but that they have a Functional role also in adult tissue during cell-fusion-mediated regeneration processes. Expression of these genes in adults is controversial [Shin et (11., Mo] Cells 29, 533-538 (2010); Kucia er (1]., J Physiol Pharmacol 57 Suppl 5, 5-18 (2006)]; however, it might well be that their expression has not been clearly appreciated. in some circumstances, probably due to its very transient nature.

ESCs also have great plasticity, and here inventors were able to fy dedifferentiation events in vivo; i.e., reprogrammed s expressing Nanog after the fusion of retinal neurons with ESC s. ESC-retinal-ncuron hybrids are probably more pluripotent than HSPC-derived hybrids. They can form clones in culture and express markers of three different lineages; in addition, they form teratoma in vivo (data not . In st, in vitro, ors were not able to isolate clones from HSPC- retinal neuron hybrids, clearly indicating their transient reprogramming and fast commitment to 'neuroectoderm lineage differentiation. Interestingly, reprogramming of retinal neurons up to the expression of Nanog was not observed. after fusion of RSPCs, indicating the lower degree of plasticity of these cells with t to HSPCs.

For a long time, it has been thOught that differentiation is a one-way-direetion mechanism; the possibility to induce somatic-cell reprogramming has completely ted this opinion. However, to date, neuron dedifferentiation has been considered as relatively difficult. Here, it has been demonstrated that neurons can indeed change their developmental stage in a living organism while resident in their own tissue. r, when they fuse with HSPCs, they keep the memory of their neuronal identity, as these “newborn” hybrids finally differentiate into neurons. This is not a trivial observation, as researchers normally force in vz'zro reprogrammed cells to propagate with a de-differentiatcd phenotype; indeed, even ESCs, in principle, do not exist in the embryo. Pluripotent cells, such as the reprogrammed cells, should rapidly undergo a change of fate in viva, which will depend on the different tissue signals, and they should commit to progress into a specific differentiation fate. A lineage identity memory that is not erased during the reprogramming process might be ial, to direct the correct differentiation path in viva. Interestingly, induced pluripotent SCs (iPSCs) have been shown to retain epigenetic memory of their somatic cells of origin [P010 67 al, Nat hnol 28, 848-855 (2010); Kim et at, Nature 467, 285-290 (2010)]. Here, in the model used herein, the transition from one cell fate to another is not direct, but passes through the transient re-expression of precursor genes; thereby passing h an intermediate, less-differentiated, developmental precursor.

Wnt signalling controls the regeneration of tissues in se to damage in lower otes [Lengfeld et at, Dev Biol 330, 186-199 (2009)]. Regeneration of the Zebra fish tail fin and. the Xenopus limbs requires activation of catenin signalling; likewise for tissue regeneration in planarians [De Robertis, Sci Signal 3, pe2'l (2010)]. Interestingly, in fish and postnatal chicken retina, down-regulation of Miillcr cell specific markers, such as glutamine synthetase and tion of progenitor markers, such as Pax6 and Chx10 have been associated. to a regenerative potential of these cells. However, exogenous activation of Wnt signalling is necessary to induce Miiller cell de-differcntiation in mouse retina. The W'nt signalling regenerative activity that is present in lower eukaryotes might therefore have been lost during evolution.

Although all of these studies highlight the important role of the catenin signalling pathway in the regeneration process, the biological mechanisms that form the basis of this ration were still largely unknown to date; here, it is shown that at least in mOuse retina, regeneration can occur through cell—fusion-mediated reprogramming. On the other hand, it was found, a not homogenous regeneration of the lanted retinas, indicating that other factors, such nerve growth s for example, might be used to enhance the process. Also, it cannot be excluded that in addition to generate new neurons and therefore to ide regenerate the retinal , a delayed. neuronal ration might have also been induced.

Moreover, this process can be induced upon recruitment of BMCs into the eye.

Interestingly, a few recruited B.Vle fuse with Muller cells after damage were ed.

Therefore, it might well be that the de-differentiation of Muller cells, reported previously [Osakada et al., (2007) cited supra] is due to fusion events with recruited BMCS.

This nous in viva reprogramming can be a ism of damage repair and, minor damages, like photo-damage or ical-damage, might be repaired through cell fusion-mediated reprogramming after recruitment of BMCs. It is also possible that Wnt-mediated reprogramming is a safeguard, mechanism after in viva cell fusion. The hybrids that are not reprogrammed undergo apoptosis-mediated cell death.

Instead, Wnt-mediated reprogrammed hybrids can survive and can proliferate.

However, although other attempts to fully regenerate damaged mouse retinas after ectopic activation of Wnt signalling in the eye have failed da et al., (2007) cited supra] here it has been demonstrated that in addition to the activation of Wnt signalling, cell-fusion-mediated reprogramming is also essential in the ration process. Thus, strategies to increase BMC recruitment to the eyes along with the tion of Wnt signalling might be therapeutically relevant to regenerate damaged. retinal tissue.

The assays show that expression of RFP and YFP transgenes derived from the genome of the two ent fusion partners were detected two weeks after cell fusion, which indicates the contribution of both genomes in the hybrids. Moreover, proliferation of the reprogrammed hybrids was observed, an indication that they were mononucleate cells or bonajflde synkarions. Stable heterokaryons have been seen with Purkinje cell fusion with BM-derived cells, and their numbers were greatly increased upon inflammation [Johansson et al., Nat Cell Biol l0, 575-583 ]. In addition, recently, heterokaryons have been also found. in ype retinas [Morillo et al., Proc Natl Acad Sci U S A 107, 109-114 ]. However, inventors never detected heterokaryons in the retina of the injected eyes, although its presence cannot be formally excluded.

On the other hand, it sh0u.ld be taken into account that ental consequences were seen when increased resistance to apoptosis was observed after fusion of cancer SCs with somatic cells, such as multidrug resistance of a developing tumour (L-u & Kang. Cancer Res 6.9, 539 (2009)]. Moreover, cell fusion, and thus polyploid cells, can also arise during pathological conditions, and often the genetic instability in these cells can lead to aneuploidy and the development of cancers. Thus, data provided by the present invention might also be important in the future to follow a different path; i.e., to study the fusion of cancer SCs with somatic cells during tumour development.

Reprogramming is a gradual and. slow process, with lineage specific genes silenced, while endogenous genes associated with pluripotency are induced. Overall, the s is very inefficient, because of the different genetic and epigenetic- barriers [Sanges & Cosma. Int J Dev Biol 54, 1575-1587 (2010)]. Indeed. pre-iPS (partially reprogrammed cells) ShOW incomplete epigenetic remodelling and. tent DNA hypermethylation, among other features. They can be ted into iPS cells through global inhibition of DNA methylation. Inventors recently showed that deletion of ch3, which is a repressor of B-caten-in target genes, relieves epigenome modifications during reprogramming, thereby tating iPS cell derivation in vitro [Lluis et al., (2011) in press]. This might also take place during in viva cell fusion: the epigenome of SPCs might be actively remodelled, and some reprogrammers transcribed, which might change the neuronal epigenome in the hybrids in trans.

In conclusion, it can be ed that cell-fusion-‘mediated ramming lled by Wnt signalling is a physiological in viva process, which can contribute to cell regeneration-”repair in normal tissues.

Claims (20)

1. Use of a mesenchymal stem cell (MSC) or a cell tion comprising a hematopoietic stem cell (HSC) and a itor cell, wherein the Wnt/β-catenin 5 signalling pathway of said cells is activated, in the manufacture of a medicament for the treatment of a retinal degeneration disease by direct implantation of said cells into the eye of a subject in need of treatment.

2. Use of a cell or cell population according to claim 1, wherein said cells are cells 10 treated with a Wnt/β-catenin signalling pathway tor, or with an inhibitor of a Wnt/β-catenin signalling pathway sor, and/or are cells that overexpress a Wnt/β-catenin signalling y activator.

3. Use of a cell or cell population according to claim 2, wherein said Wnt/β-catenin 15 pathway activator is ed from the group consisting of a Wnt m, βcatenin , a R-spondin, 2-(4-acetylphenylazo)(3,3-dimethyl-3,4-dihydro-2H- isoquinolinylidene)-acetamide (IQ1), (2S)[2-(indanyloxy)(1,1'- biphenylyl)methyl)-9H-purinylamino]phenyl-propanol (QS11), deoxycholic acid (DCA), 2-amino[3,4-(methylenedioxy)benzylamino](3- 20 methoxyphenyl)pyrimidine, an o)arylpyrimidine of formula (I), (II), (III) or (IV) shown in Table 1, and combinations thereof.

4. Use of a cell or cell population according to claim 2, wherein said inhibitor of a Wnt/β-catenin pathway repressor is ed from the group consisting of a 25 GSK-3 inhibitor, a SFRP1 inhibitor, and combinations f.

5. Use of a cell or cell population according to any one of claims 1 to 4, wherein said retinal degeneration disease is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, Stargardt disease, cone-rod 30 dystrophy, congenital stationary night blindness, Leber congenital amaurosis, Best's vitelliform macular dystrophy, anterior ischemic optic neuropathy, choroideremia, age-related macular degeneration, foveomacular dystrophy, 2363921v1 Bietti crystalline corneoretinal dystrophy, Usher’s syndrome, and a retinal degenerative condition derived from a primary pathology.

6. Use of a cell or cell tion according to claim 5, wherein said retinal 5 degeneration derives from cataracts, diabetes or glaucoma.

7. Use of a mesenchymal stem cell (MSC) or a cell tion comprising a hematopoietic stem cell (HSC) and a progenitor cell in the manufacture of a medicament for the treatment of a retinal degeneration disease by direct 10 implantation of said cells into the eye of a subject in need of treatment prior to ramming of a retinal cell by fusion of said cells with said retinal cell, said ramming being mediated by activation of the Wnt/β-catenin signalling pathway. 15

8. Use of a cell or a cell population according to claim 7, in combination with a Wnt/β-catenin signalling pathway activator, or with an inhibitor of a Wnt/βcatenin signalling pathway repressor.

9. Use of a cell or a cell population according to claim 8, wherein said Wnt/β- 20 catenin pathway activator is selected from the group consisting of a Wnt isoform, nin, a R-spondin, IQ1, QS11, DCA, 2-amino[3,4- (methylenedioxy)benzylamino](3-methoxyphenyl) pyrimidine, an (hetero)arylpyrimidine of formula (I), (II), (III) or (IV) shown in Table 1, and combinations thereof.

10. Use of a cell or a cell population according to claim 8, wherein said inhibitor of a Wnt/β-catenin pathway repressor is selected from the group consisting of a GSK-3 inhibitor, a SFRP1 inhibitor, and ations thereof. 30

11. Use of a cell or a cell population according to any one of claims 7 to 10, wherein said retinal degeneration disease is selected from the group ting of retinitis pigmentosa, age-related macular degeneration, Stargardt disease, cone-rod dystrophy, congenital nary night blindness, Leber ital amaurosis, 2363921v1 Best's vitelliform macular dystrophy, anterior ic optic neuropathy, choroideremia, age-related macular degeneration, acular phy, Bietti crystalline corneoretinal dystrophy, Usher’s syndrome, and a retinal degenerative condition derived from a y pathology.

12. Use of a cell or a cell population according to claim 11, wherein said retinal degeneration derives from cataracts, diabetes or glaucoma.

13. A cell composition, wherein at least 50% of the cells of said cell composition are 10 hematopoietic stem cells (HSCs) and progenitor cells and wherein the Wnt/βcatenin signalling pathway of said cells is activated.

14. A pharmaceutical composition selected from the group consisting of: 1) a pharmaceutical composition comprising at least a mesenchymal 15 stem cell (MSC) or a hematopoietic stem cell (HSC) and a progenitor cell, wherein the Wnt/β-catenin signalling pathway of said cell is activated, and a pharmaceutically acceptable carrier, and 2) a pharmaceutical ition comprising at least a mesenchymal stem cell (MSC) or a hematopoietic stem cell (HSC) and a itor 20 cell, in combination with a Wnt/β-catenin signalling pathway activator or an inhibitor of a Wnt/β-catenin signalling pathway repressor, and a pharmaceutically acceptable carrier.

15. Use of a ceutical composition according to claim 14 in the manufacture 25 of a ment for the treatment of a retinal degeneration disease by direct implantation of said ition into the eye of a subject in need of treatment.

16. Use of a pharmaceutical composition according to claim 15 wherein said ition is administered by intraocular, intravitreal or subretinal injection.

17. A kit selected from the group consisting of: 1) a kit comprising at least a mesenchymal stem cell (MSC) or a hematopoietic stem cell (HSC) and a itor cell wherein the 2363921v1 Wnt/β-catenin signalling pathway of said cell is activated, and instructions for use of the kit components, and 2) a kit sing at least a mesenchymal stem cell (MSC) or a hematopoietic stem cell (HSC) and a itor cell , in combination 5 with a Wnt/β-catenin ling pathway activator or an inhibitor of a catenin signalling pathway repressor, and ctions for use of the kit components.

18. Use of the kit according to claim 17, in the manufacture of a medicament for the 10 treatment of a retinal degeneration disease.

19. Use of the kit according to claim 18, wherein said retinal degeneration disease is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, Stargardt disease, cone-rod dystrophy, congenital stationary night 15 blindness, Leber congenital amaurosis, Best's vitelliform macular dystrophy, anterior ic optic neuropathy, choroideremia, age-related macular ration, foveomacular dystrophy, Bietti crystalline corneoretinal phy, Usher’s syndrome, and a retinal degenerative condition derived from a primary pathology.

20. Use of the kit according to claim 18, wherein said retinal degeneration derives from cataracts, diabetes or glaucoma. 2363921v1