NZ621325B2 - Cyclopropaneamine compound - Google Patents

Cyclopropaneamine compound Download PDF

Info

Publication number
NZ621325B2
NZ621325B2 NZ621325A NZ62132512A NZ621325B2 NZ 621325 B2 NZ621325 B2 NZ 621325B2 NZ 621325 A NZ621325 A NZ 621325A NZ 62132512 A NZ62132512 A NZ 62132512A NZ 621325 B2 NZ621325 B2 NZ 621325B2
Authority
NZ
New Zealand
Prior art keywords
group
phenyl
trans
cyclopropyl
amino
Prior art date
Application number
NZ621325A
Other versions
NZ621325A (en
Inventor
Douglas Robert Cary
Ryujiro Hara
Shinichi Imamura
Shigeo Kajii
Satoru Matsuda
Daisuke Tomita
Naoki Tomita
Ken Tsuchida
Original Assignee
Takeda Pharmaceutical Company Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Pharmaceutical Company Limited filed Critical Takeda Pharmaceutical Company Limited
Priority claimed from PCT/JP2012/070267 external-priority patent/WO2013022047A1/en
Publication of NZ621325A publication Critical patent/NZ621325A/en
Publication of NZ621325B2 publication Critical patent/NZ621325B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A61K31/36—Compounds containing methylenedioxyphenyl groups, e.g. sesamin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A61K31/366—Lactones having six-membered rings, e.g. delta-lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/38—Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381—Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/402—1-aryl substituted, e.g. piretanide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/4035—Isoindoles, e.g. phthalimide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/421—1,3-Oxazoles, e.g. pemoline, trimethadione
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/426—1,3-Thiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/428—Thiazoles condensed with carbocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/429—Thiazoles condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/433—Thidiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4406—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 3, e.g. zimeldine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4409—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 4, e.g. isoniazid, iproniazid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4453—Non condensed piperidines, e.g. piperocaine only substituted in position 1, e.g. propipocaine, diperodon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4468—Non condensed piperidines, e.g. piperocaine having a nitrogen directly attached in position 4, e.g. clebopride, fentanyl
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/451—Non condensed piperidines, e.g. piperocaine having a carbocyclic group directly attached to the heterocyclic ring, e.g. glutethimide, meperidine, loperamide, phencyclidine, piminodine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C07C233/64—Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings
    • C07C233/77—Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups
    • C07C233/80—Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by a carbon atom of a six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/42—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/44—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring
    • C07C235/56—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C237/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups
    • C07C237/28—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton
    • C07C237/40—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton having the nitrogen atom of the carboxamide group bound to a carbon atom of a six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C237/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups
    • C07C237/28—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton
    • C07C237/42—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton having nitrogen atoms of amino groups bound to the carbon skeleton of the acid part, further acylated
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2601/00—Systems containing only non-condensed rings
    • C07C2601/02—Systems containing only non-condensed rings with a three-membered ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2601/00—Systems containing only non-condensed rings
    • C07C2601/18—Systems containing only non-condensed rings with a ring being at least seven-membered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2602/00—Systems containing two condensed rings
    • C07C2602/02—Systems containing two condensed rings the rings having only two atoms in common
    • C07C2602/04—One of the condensed rings being a six-membered aromatic ring
    • C07C2602/08—One of the condensed rings being a six-membered aromatic ring the other ring being five-membered, e.g. indane
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C271/00—Derivatives of carbamic acids, i.e. compounds containing any of the groups, the nitrogen atom not being part of nitro or nitroso groups
    • C07C271/06—Esters of carbamic acids
    • C07C271/08—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms
    • C07C271/10—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C271/20—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms to carbon atoms of hydrocarbon radicals substituted by nitrogen atoms not being part of nitro or nitroso groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C271/00—Derivatives of carbamic acids, i.e. compounds containing any of the groups, the nitrogen atom not being part of nitro or nitroso groups
    • C07C271/06—Esters of carbamic acids
    • C07C271/08—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms
    • C07C271/10—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C271/22—Esters of carbamic acids having oxygen atoms of carbamate groups bound to acyclic carbon atoms with the nitrogen atoms of the carbamate groups bound to hydrogen atoms or to acyclic carbon atoms to carbon atoms of hydrocarbon radicals substituted by carboxyl groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/06—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with radicals, containing only hydrogen and carbon atoms, attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/30—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D207/32—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D207/33—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms with substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D207/337—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/08—Indoles; Hydrogenated indoles with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to carbon atoms of the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/30—Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
    • C07D209/42—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/44—Iso-indoles; Hydrogenated iso-indoles
    • C07D209/46—Iso-indoles; Hydrogenated iso-indoles with an oxygen atom in position 1
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/44—Iso-indoles; Hydrogenated iso-indoles
    • C07D209/48—Iso-indoles; Hydrogenated iso-indoles with oxygen atoms in positions 1 and 3, e.g. phthalimide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/40—Oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/56—Nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/56—Nitrogen atoms
    • C07D211/58—Nitrogen atoms attached in position 4
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/68—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member
    • C07D211/72—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D211/74—Oxygen atoms
    • C07D211/76—Oxygen atoms attached in position 2 or 6
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/92—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with a hetero atom directly attached to the ring nitrogen atom
    • C07D211/98—Nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/24—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D213/36—Radicals substituted by singly-bound nitrogen atoms
    • C07D213/38—Radicals substituted by singly-bound nitrogen atoms having only hydrogen or hydrocarbon radicals attached to the substituent nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/24—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D213/54—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/56—Amides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D223/00—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom
    • C07D223/14—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D223/16—Benzazepines; Hydrogenated benzazepines
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D231/18—One oxygen or sulfur atom
    • C07D231/20—One oxygen atom attached in position 3 or 5
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D231/18—One oxygen or sulfur atom
    • C07D231/20—One oxygen atom attached in position 3 or 5
    • C07D231/22—One oxygen atom attached in position 3 or 5 with aryl radicals attached to ring nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D231/18—One oxygen or sulfur atom
    • C07D231/20—One oxygen atom attached in position 3 or 5
    • C07D231/22—One oxygen atom attached in position 3 or 5 with aryl radicals attached to ring nitrogen atoms
    • C07D231/26—1-Phenyl-3-methyl-5- pyrazolones, unsubstituted or substituted on the phenyl ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/54—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings condensed with carbocyclic rings or ring systems
    • C07D231/56—Benzopyrazoles; Hydrogenated benzopyrazoles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
    • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
    • C07D233/56—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, attached to ring carbon atoms
    • C07D233/61—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, attached to ring carbon atoms with hydrocarbon radicals, substituted by nitrogen atoms not forming part of a nitro radical, attached to ring nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
    • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
    • C07D233/64—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with substituted hydrocarbon radicals attached to ring carbon atoms, e.g. histidine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/32—One oxygen, sulfur or nitrogen atom
    • C07D239/34—One oxygen atom
    • C07D239/36—One oxygen atom as doubly bound oxygen atom or as unsubstituted hydroxy radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D261/00—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings
    • C07D261/02—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings
    • C07D261/06—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members
    • C07D261/08—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D261/00—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings
    • C07D261/02—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings
    • C07D261/06—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members
    • C07D261/10—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/30—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D263/32—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/30—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D263/34—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D277/28—Radicals substituted by nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D277/30—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62—Benzothiazoles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D285/00—Heterocyclic compounds containing rings having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by groups C07D275/00 - C07D283/00
    • C07D285/01—Five-membered rings
    • C07D285/02—Thiadiazoles; Hydrogenated thiadiazoles
    • C07D285/04—Thiadiazoles; Hydrogenated thiadiazoles not condensed with other rings
    • C07D285/06—1,2,3-Thiadiazoles; Hydrogenated 1,2,3-thiadiazoles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
    • C07D295/12—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by singly or doubly bound nitrogen atoms
    • C07D295/135—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by singly or doubly bound nitrogen atoms with the ring nitrogen atoms and the substituent nitrogen atoms separated by carbocyclic rings or by carbon chains interrupted by carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
    • C07D295/14—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
    • C07D295/14—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D295/155—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with the ring nitrogen atoms and the carbon atoms with three bonds to hetero atoms separated by carbocyclic rings or by carbon chains interrupted by carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D309/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings
    • C07D309/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
    • C07D309/08—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D309/14—Nitrogen atoms not forming part of a nitro radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D317/00—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms
    • C07D317/08—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3
    • C07D317/44—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3 ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D317/46—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3 ortho- or peri-condensed with carbocyclic rings or ring systems condensed with one six-membered ring
    • C07D317/48—Methylenedioxybenzenes or hydrogenated methylenedioxybenzenes, unsubstituted on the hetero ring
    • C07D317/50—Methylenedioxybenzenes or hydrogenated methylenedioxybenzenes, unsubstituted on the hetero ring with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to atoms of the carbocyclic ring
    • C07D317/58—Radicals substituted by nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/06—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to the ring carbon atoms
    • C07D333/14—Radicals substituted by singly bound hetero atoms other than halogen
    • C07D333/20—Radicals substituted by singly bound hetero atoms other than halogen by nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D335/00—Heterocyclic compounds containing six-membered rings having one sulfur atom as the only ring hetero atom
    • C07D335/02—Heterocyclic compounds containing six-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04—Ortho-condensed systems

Abstract

Disclosed are N-(4-{trans-2-[amino]cyclopropyl}-phenyl)benzamide analogues and derivatives as represented by the general formula (I), wherein A is a cyclic ring containing moiety as defined herein; R is a hydrogen atom or an alkyl group; or A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo groups; Q1 is a hydrogen atom or an alkyl group; Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom or an alkyl group optionally substituted by one cycloalkyl group; Z1, Z2 and Z3 are each a hydrogen atom; Y1, Y2 and Y3 are each independently: (1) a hydrogen atom, (2) an alkyl group optionally having 1 to 3 substituents, (3) a cycloalkyl group, (4) a phenyl group optionally having 1 to 3 substituents, (5) a pyridyl group optionally having 1 to 3 alkoxy groups, (6) a naphthyl group, (7) a biphenylyl group, (8) a thienyl group, (9) an imidazolyl group, (10) a thiazolyl group, (11) an imidazopyridyl group, (12) an imidazothiazolyl group, (13) a thienopyridyl group, or (14) a 1,8-naphthyridinyl group; or Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, a cycloalkane ring, a pyrrolidine ring, a piperidine ring, a tetrahydropyran ring, a 2,3-dihydroindene ring, a fluorene ring, a 8-azabicyclo[3.2.1]octane ring, or a tetrahydrothiopyran ring, each of which optionally has 1 to 3 substituents; or X and Y1 are optionally bonded to each other to form a pyrrolidine ring, together with the adjacent nitrogen atom and carbon atom; and wherein the remaining substituents are as defined herein; or a salt thereof. Also disclosed are the compounds N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl-4-carboxamide, N-(4-{trans-2-[(1-methylpiperidin-4-yl)amino]cyclopropyl}phenyl)-3-(trifluoromethyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1H-pyrazole-4-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}-2-methylphenyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-3-(trifluoromethoxy)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-cyclohexanecarboxamide, N-(4-{trans-2-[(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)amino]cyclopropyl}phenyl)-3-(trifluoromethyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1,3-dimethyl-1H-pyrazole-5-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1,5-dimethyl-1H-pyrazole-3-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1-methyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1-methyl-5-(trifluoromethyl)-1H-pyrazole-4-carboxamide, and N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1-methyl-1H-pyrazole-4-carboxamide. Also disclosed is a medicament comprising the compound as defined above or a salt thereof, which is a prophylactic or therapeutic agent for cancer, and/or an LSD1 inhibitor, and/or a prophylactic or therapeutic agent for schizophrenia, Alzheimer’s disease, Parkinson’s disease or Huntington’s chorea. droisoindole ring having 1 or 2 oxo groups; Q1 is a hydrogen atom or an alkyl group; Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom or an alkyl group optionally substituted by one cycloalkyl group; Z1, Z2 and Z3 are each a hydrogen atom; Y1, Y2 and Y3 are each independently: (1) a hydrogen atom, (2) an alkyl group optionally having 1 to 3 substituents, (3) a cycloalkyl group, (4) a phenyl group optionally having 1 to 3 substituents, (5) a pyridyl group optionally having 1 to 3 alkoxy groups, (6) a naphthyl group, (7) a biphenylyl group, (8) a thienyl group, (9) an imidazolyl group, (10) a thiazolyl group, (11) an imidazopyridyl group, (12) an imidazothiazolyl group, (13) a thienopyridyl group, or (14) a 1,8-naphthyridinyl group; or Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, a cycloalkane ring, a pyrrolidine ring, a piperidine ring, a tetrahydropyran ring, a 2,3-dihydroindene ring, a fluorene ring, a 8-azabicyclo[3.2.1]octane ring, or a tetrahydrothiopyran ring, each of which optionally has 1 to 3 substituents; or X and Y1 are optionally bonded to each other to form a pyrrolidine ring, together with the adjacent nitrogen atom and carbon atom; and wherein the remaining substituents are as defined herein; or a salt thereof. Also disclosed are the compounds N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl-4-carboxamide, N-(4-{trans-2-[(1-methylpiperidin-4-yl)amino]cyclopropyl}phenyl)-3-(trifluoromethyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1H-pyrazole-4-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}-2-methylphenyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-3-(trifluoromethoxy)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-cyclohexanecarboxamide, N-(4-{trans-2-[(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)amino]cyclopropyl}phenyl)-3-(trifluoromethyl)benzamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1,3-dimethyl-1H-pyrazole-5-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1,5-dimethyl-1H-pyrazole-3-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1-methyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxamide, N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1-methyl-5-(trifluoromethyl)-1H-pyrazole-4-carboxamide, and N-(4-{trans-2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1-methyl-1H-pyrazole-4-carboxamide. Also disclosed is a medicament comprising the compound as defined above or a salt thereof, which is a prophylactic or therapeutic agent for cancer, and/or an LSD1 inhibitor, and/or a prophylactic or therapeutic agent for schizophrenia, Alzheimer’s disease, Parkinson’s disease or Huntington’s chorea.

Description

DESCRIPTION Title of the Invention: CYCLOPROPANEAMINE COMPOUND Technical Field The present invention relates to a cyclopropanamine compound having a lysine specific demethylase l imes abbreviated as LSDl in the present specification) tory action and useful as a medicament such as a prophylactic or therapeutic agent for cancer, schizophrenia, Alzheimer’s e, Parkinson’s disease and gton’s chorea, and the like.
(Background of the Invention) LSDl is a demethylation enzyme of histone, catalyzes a demethylation reaction of a monomethylated product and a dimethylated product of the 4th lysine residue of histone H3 (H3K4mel/2), and forms formaldehyde as a by—product. In addition, LSDl forms a complex with flavin adenine dinucleotide (FAD) which is a kind of coenzyme, and FAD promotes oxidation of lysine residue by enzymes as a redox mediator. (patent document 1) discloses a compound of the ing formula or a pharmaceutically acceptable salt thereof as an LSDl tor:
[0004] H H 1R7 R1 H R3 R5 FORMULAl wherein Rl—RS are H, halo and the like; R6 is H or alkyl; R7 is H, alkyl or cycloalkyl; R8 is -L~heterocyclyl or —L—aryl wherein L is —(CHfln—(CHfln—, —(CHflnNH(CHfln—, —(CHfinO(CHfln— or —(CHflnS(CHfln—, and n is 0, l, 2 or 3. (patent document 2) ses a nd of the following formula or a pharmaceutically acceptable salt thereof as an LSDl inhibitor: FORMULA I wherein Rl—RS are H, halo and the like; R6 is H or alkyl; R7 is H, alkyl or cycloalkyl; R8 is -C(=O)NRny or —C(=O)Rz wherein Rx and Ry are each independently H, alkyl and the like, and R2 is H, alkoxy and the like. (patent document 3) ses a compound of the following formula or a pharmaceutically able salt thereof as an LSDl inhibitor: (A’)x-(A)-(B)-(Z)—(L)-(D) wherein (A’) is aryl, koxy, heterocyclyl and the like; (A) is heteroaryl or aryl; X is 0, l, 2 or 3; (B) is a cyclopropyl ring; (Z) is ~NH—; (L) is —CH2CH2— and the like; (D) is —N(—Rl)—R2, ~O—R3 or -S—R3 wherein R1 and R2 are each independently H, alkyl and the like; and R3 is H, alkyl and the like. (patent document 4) discloses a compound of the following formula or a pharmaceutically acceptable salt thereof as an LSDl inhibitor: (A' B )-(Z)-(L)-C(=0)NHz wherein (A’) is aryl, arylalkoxy, arylalkyl, heterocyclyl and the like; (A) is heteroaryl or aryl; X is O, l, 2 or 3; (B) is a cyclopropyl ring; (Z) is —NH—; (L) is —(CHflmCR1R2— wherein m is O, l, 2, 3, 4, 5 or 6; and R1 and R2 are each independently H or Cl~6 alkyl.
USZOlO/0324147 (patent document 5) ses a compound of the following formula or a salt thereof as an LSDl inhibitor: RE R4 RC X“ R9 R5
[0017] wherein X is a bond, 0, S or NH; and RA, RB, RC, RD and RE are each independently H, C1—7 alkyl and the like.
WO 43582 (patent document 6) discloses a compound of the following formula or a pharmaceutically acceptable salt thereof as an LSDl inhibitor: wherein R} is H, an alkyl group optionally having a substituent attached thereto and the like; R2 is an alkylene group optionally having a substituent attached thereto; R3 is an alkyl group optionally having a substituent ed thereto, a phenyl group optionally having a substituent attached thereto and the like; R4 is an alkyl group optionally having a substituent attached thereto, a phenyl group optionally having a tuent attached o and the like; and X is 0, NHL NHCO, CONH, S or CH2.
J. Am. Chem. Soc. 2010, 132, 6827—6833 (non—patent document 1) discloses compounds of the following formulas as an LSD 1/2 inhibitor: a run (Me) The Journal of Neuroscience, October 17, 2007, : 11254—11262 (non—patent document 2) discloses that a decrease in histone H3K4 methylation and a decrease in Gadl mRNA expression are observed in the brain of phrenia patients.
Document List patent documents patent document 1: W02010/084l60 patent nt 2: WOZOlO/O43721 patent document 3: WOZOll/03594l patent document 4: /0422l7 patent document 5: U82010/0324l47 patent document 6: WOZOlO/l43582 non-patent documents non—patent document 1: J. Am. Chem. Soc. 2010, 132, 6827—6833 non-patent document 2: The Journal of Neuroscience, October 17, 2007, 27(42):11254-11262 y of the ion Problems to be Solved by the Invention An object of the present invention is to provide a cyclopropanamine compound having a superior LSD1 inhibitory action and high LSD1 selectivity, and useful as a medicament such as a prophylactic or eutic agent for cancer, schizophrenia, Alzheimer’s disease, Parkinson’s e and Huntington’s chorea, or a cyclopropanamine compound that at least provides a useful alternative.
Means of Solving the Problems The present inventors have conducted intensive s in an attempt to solve the aforementioned problems and found that a compound represented by the following formula (I) has a superior LSD1 inhibitory action and high LSD1 selectivity, which resulted in the completion of the present invention.
Accordingly, the present invention relates to the following.
A compound represented by the formula
[0030] wherein A is a hydrocarbon group optionally having tuent(s), or a heterocyclic group optionally having substituent(s); R is a hydrogen atom, a hydrocarbon group optionally having substituent(s), or a heterocyclic group optionally having substituent(s); or A and R are optionally bonded to each other to form a ring optionally having substituent(s); Q1, Q2, Q3 and Q4 are each independently a hydrogen atom or a substituent; Q1 and Q2, and Q3 and Q4, are each optionally bonded to each other to form a ring optionally having tuent(s); X is a hydrogen atom, an acyclic hydrocarbon group optionally having tuent(s), or a saturated cyclic group optionally having substituent(s); Y4, Y2 and Y3 are each independently a hydrogen atom, a hydrocarbon group optionally having substituent(s), or a heterocyclic group optionally having substituent(s); X and Y1, and Y1 and Y2, are each optionally bonded to each other to form a ring optionally having substituent(s); and 21, 22 and Z3 are each independently a hydrogen atom or a substituent, or a salt thereof (hereinafter sometimes to be iated as compound (1)).
The compound of [1], wherein A is (l) a C}e lkyl group optionally having substituent(s), (2) a C644 aryl group optionally having substituent(s), (3) a C644 aryl Cyfi alkyl group optionally having substituent(s), (4) a C644 aryl Cbfi alkyl C644 aryl group optionally having substituent(s), (5) a 4— to ll-membered heterocyclic group containing, as a ring-constituting atom besides carbon atom, l to 3 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having tuent(s), or (6) a Cw-“ cyclic hydrocarbon group optionally having substituent(s); R is a hydrogen atom or a C36 alkyl group optionally having substituent(s); or A and R are optionally bonded to each other to form a 4* to 10— membered heterocycle optionally having substituent(s), or a salt thereof. [2A] The compound of [l] or [2], wherein A is (l) a C644 aryl group optionally having 1 to 3 substituents selected from (a) a halogen atom, (b) a CLfi alkyl group optionally having 1 to 5 halogen atoms, (C) C6fl4 aryloxy group, (d) C6fl4 aryl CL6 alkyloxy group, (e) C614 aryl—carbonylamino group, (f) a C5¢4 aryl Cbg alkylamino group, (g) a 4- to 7-membered heterocyclic group containing, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having an oxo group and optionally having 1 or 2 CL6 alkyl groups, and (h) a Crs alkyl group optionally having a ered cyclic group containing, as a ring—constituting atom besides carbon atom, 2 or 3 nitrogen atoms, (2) a C6¢4 aryl Cbfi alkyl group optionally having a C644 aryl Cbfi alkyloxy—carbonylamino group, (3) a C644 aryl CL5 alkyl C644 aryl group, (4) a C38 cycloalkyl group, (5) a ered heterocyclic group containing, as a ring— constituting atom besides carbon atom, l to 3 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 to 3 tuents selected from 1 or 2 Che alkyl groups optionally having 1 to 5 halogen atoms and a phenyl group, (6) a Cm_m cyclic hydrocarbon group, or (7) a 9— to ll—membered heterocyclic group containing, as a ring—constituting atom besides carbon atom, l to 3 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 to 3 tuents selected from a Crfi alkyl—carbonyl group, a furyl group and a thienyl group; R is a hydrogen atom or a Cbfi alkyl group optionally having substituent{s); or A and R are ally bonded to each other to form a 4— to 10— membered heterocycle having 1 or 2 oxo groups, or a salt thereof. [2B] The compound of [l], [2] or [2A], wherein A is a phenyl—Cbfi alkyl group, a C36 cycloalkyl group, a tetrahydronaphthyl group, a phenyl group, a biphenylyl group, a furyl group, a thienyl group, an oxazolyl group, an isoxazolyl group, a thiazolyl group, a pyrazolyl group, an lyl group, a benzofuryl group, a benzimidazolyl group, a benzothiazolyl group, an indolyl group, or a tetrahydrobenzazepinyl group, each of which optionally has substituent(s); R is a hydrogen atom or a Cbfi alkyl group; or A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo , or a salt thereof. [2C] The compound of [l], [2], [2A] or [2B], wherein A is a thDYl—C}6 alkyl group, a C36 cycloalkyl group, a tetrahydronaphthyl group, a phenyl group, a biphenylyl group, a furyl group, a thienyl group, an oxazolyl group, an isoxazolyl group, a thiazolyl group, a pyrazolyl group, an indazolyl group, a benzofuryl group, a benzimidazolyl group, a hiazolyl group, an indolyl group, or a tetrahydrobenzazepinyl group, each of which optionally has 1 to 3 substituents selected from (1) a halogen atom, (2) a Cyfi alkyl group optionally having 1 to 3 substituents selected from a n atom, a phenyl group, an imidazolyl group and a triazolyl group, (3) a Cbfi alkoxy group optionally having 1 to 3 substituents selected from a halogen atom and a phenyl group, (4) a Cbfi alkyl—carbonyl group, (5) a di-CL6 mino group, (6) a Cpfi alkylsulfonyl group, (7) a sulfamoyl group, (8) a Cyfi alkylsulfonylamino group, (9) an oxo group, (10) a C}fi cycloalkyl group, (11) a phenyl group optionally having 1 to 3 substituents selected from a n atom and a Cbfi alkyl group, (12) a phenoxy group, (13) a phenylcarbonylamino group, (14) a benzyloxycarbonylamino group, (15) a benzoyl group, (16) a benzylamino group, (17) a pyrazolyl group, (18) a opyrazolyl group optionally having 1 to 3 substituents selected from a Cbfi alkyl group and an oxo group, (19) an oxazolyl group, (20) a lyl group having 1 or 2 Cbfi alkyl groups, (21) a tetrazolyl group, (22) a pyrrolyl group, (23) a piperazinyl group having 1 to 3 Cyfi alkyl groups, (24) an imidazolyl group, (25) a pyridyl group, (26) a pyrimidinyl group, (27) a piperidyl group optionally having one oxo group, (28) a thienyl group, (29) a furyl group, and (30) a thiadiazolyl group; R is a hydrogen atom or a Cbfi alkyl group; or A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo groups, or a salt thereof. [2D] The compound of [1], [2], [2A], [2B] or [2C], wherein A is a phenyl—Cyfi alkyl group, a phenyl group, a biphenylyl group or a pyrazolyl group, each of which optionally has 1 to 3 substituents selected from (1) a halogen atom, (2) a Cyfi alkyl group optionally having 1 to 3 substituents ed from.a n atom and a phenyl group, (3) a phenylcarbonylamino group, (4) a benzyloxycarbonylamino group, and (5) a dyl group optionally having one oxo group; R is a hydrogen atom; or A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo groups,‘ or a salt thereof. [2E] The compound of [l], [2], [2A], [2B], [2C] or [2D], wherein R is a hydrogen atom or a Cyfi alkyl group, or a salt thereof.
The compound of [1], [2], [2A], [2B], [2C], [2D] or [2E], wherein Q1 is a hydrogen atom or a Cbfi alkyl group, and Q2, Q3 and Q4 are each a hydrogen atom, or a salt thereof. [3A] The compound of [l], [2], [2A], [2B], [2C], [2D], [2E] or , wherein 2O 01, Q2, Q3 and Q4 are each a hydrogen atom, or a salt thereof.
The compound of [l], [2], [2A], [2B], [2C], [2D], [2E], [3] or [3A], wherein X is a hydrogen atom or an optionally substituted Cyfi alkyl group; Y1, Y2 and Y3 are each ndently (l) a hydrogen atom, (2) a C190 alkyl group optionally having substituent(s), (3) a C33 cycloalkyl group optionally having substituent(s), (4) a C644 aryl group optionally having substituent(s), (5) a C544 aryl Cys alkyl group optionally having tuent(s), (6) a 5— to ered monocyclic aromatic heterocyclic group containing, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having substituent(s), or (7) a ic or tricyclic aromatic heterocyclic group containing, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having tuent(s); X and Y1 are optionally bonded to each other to form, together with the adjacent nitrogen atom and carbon atom, a 5— to 7—membered monocyclic nitrogen—containing nOnaromatic heterocycle containing, as a ring-constituting atom besides carbon atom, one nitrogen atom, and optionally further ning one hetero atom selected from a en atom, a sulfur atom and an oxygen atom, and optionally having substituent(s); Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, (l) a 5- to 7-membered monocyclic nonaromatic heterocycle containing, as a ring—constituting atom besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having substituent(s), (2) a 7— to lO—membered bridged heterocycle containing, as a onstituting atom besides carbon atom, one or two hetero atoms ed from a en atom, a sulfur atom and an oxygen atom, and optionally having substituent(s), or a salt thereof. [4A] The compound of [l], [2], [2A], [2B], [2C], [2D], [2E], , [3A] or [4], wherein X is'a hydrogen atom or an optionally substituted Cyfi alkyl group; Y1, Y2 and Y3 are each independently (l) a hydrogen atom, (2) a C140 alkyl group optionally having 1 to 3 substituents selected from (a) an amino group, (b) a Cbfi alkoxy group, (c) a C644 aryloxy group, and (d) a C644 aryl Cbs alkyloxy group, (3) a C38 cycloalkyl group, (4) a C644 aryl group optionally having 1 to 3 substituents selected from (a) a halogen atom, (b) a CLfi alkoxy group, (c) a Chg alkylenedioxy group, and (d) a di—Cyfi alkylamino group, (5) a C644 aryl Cyfi alkyl group, (6) a 5— to 7—membered monocyclic aromatic heterocyclic group containing, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a en atom, a sulfur atom and an oxygen atom, and optionally having tuent(s), or (7) a bicyclic or tricyclic aromatic heterocyclic group containing, as a ring-constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having tuent(s); X and Y1 are optionally bonded to each other to form, together with the adjacent nitrogen atom and carbon atom, an optionally substituted 5— to 7-membered monocyclic nitrogen— containing nonaromatic heterocycle containing, as a ring— constituting atom s carbon atom, one nitrogen atom and optionally further containing one hetero atom ed from a nitrogen atom, a sulfur atom and an oxygen atom; and Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, (l) a C}3 cycloalkane ring ally having substituent(s), (2) a 2,3—dihydroindene ring, (3) a fluorene ring, (4) a 5- to ?—membered monocyclic nonaromatic heterocycle containing, as a ring—constituting atom besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 to 3 substituents ed from (a) a Cbfi alkyl group optionally having substituent(s), (b) a C644 aryl Chg alkyl group, (c) a C}6 alkenyloxy-carbonyl group, (d) a C}g cycloalkyl group, and ( e) a C6fl4 aryl group, or (5) a 7— to lO—membered bridged heterocycle containing, as a ring—constituting atom besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having substituent(s), or a salt thereof. [4B] The nd of [1], [2], [2A], [2B], [2C], [2D], [2E], [3], [3A], [4] or [4A], wherein X is a hydrogen atom or a Cbfi alkyl group optionally substituted by one C}6 cycloalkyl group; Y1, Y2 and Y3 are each independently (l) a hydrogen atom, (2) a CLQO alkyl group optionally having 1 to 3 substituents ed from an amino group, a Cyfi alkoxy group, a phenyl group, a phenyloxy group and a benzyloxy group, (3) a C}3 cycloalkyl group, (4) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom, a C36 alkoxy group, a Cp3 alkylenedioxy group and a di-CLfi alkylamino group, (5) a l group optionally having 1 to 3 CLfi alkoxy groups, (6) a naphthyl group, (7) a biphenylyl group, (8) a l group, (9) an imidazolyl group, (10) a thiazolyl group, (11) a piperidyl group optionally having 1 to 3 Cyfi alkyl groups, (12) an imidazopyridyl group, (13) an imidazothiazolyl group, (14) a thienopyridyl group, or (15) a 1,8-naphthyridinyl group; Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, a C}8 cycloalkane ring, a pyrrolidine ring, a dine ring, a tetrahydropyran ring, a 2,3—dihydroindene ring, a fluorene ring, a 8—azabicyclo[3.2.l]octane ring, or a tetrahydrothiopyran ring, each of which optionally has 1 to 3 substituents selected from (1) a n atom, (2) a Cbfi alkyl group optionally having 1 to 3 substituents selected from a halogen atom and a phenyl group, (3) a C36 cycloalkyl group, (4) an oxo group, (5) a phenyl group, (6) a C}6 loxy—carbonyl group, and (7) a Cbfi alkyl—carbonyl group; and X and Y1 are optionally bonded to each other to form a pyrrolidine ring together with the adjacent nitrogen atom and carbon atom, or a salt thereof.
The compound of [l], [2], [2A], [2B], [2C], [2D], [2E], [3], [3A], [4], [4A] or [43], wherein Z1, Z2 and Z3 are each a hydrogen atom, or a salt thereof.
The compound of [l], [2], [2A], [28], [2C], [2D], [2E], [3], [3A], [4], [4A], [4B] or [5], wherein A is a phenyl—CL6 alkyl group, a C36 cycloalkyl group, a ydronaphthyl group, a phenyl group, a biphenylyl group, a furyl group, a thienyl group, an oxazolyl group, an isoxazolyl group, a thiazolyl group, a pyrazolyl group, an indazolyl group, a benzofuryl group, a benzimidazolyl group, a benzothiazolyl group, an indolyl group, or a tetrahydrobenzazepinyl group, each of which ally has 1 to 3 substituents selected from (1) a halogen atom, (2) a Obs alkyl group optionally having 1 to 3 substituents selected from a halogen atom, a phenyl group, an olyl group and a lyl group, (3) a Cyfi alkoxy group optionally having 1 to 3 substituents selected from a halogen atom and a phenyl group, (4) a Cbfi alkyl—carbonyl group, (5) a di‘C}fi alkylamino group, (6) a Chg alkylsulfonyl group, (7) a sulfamoyl group, (8) a Cyfi alkylsulfonylamino group, (9) an oxo group, (10) a C}6 cycloalkyl group, (11) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom and a Cpfi alkyl group, (12) a phenoxy group, (13) a phenylcarbonylamino group, (14) a benzyloxycarbonylamino group, (15) a benzoyl group, (16) a benzylamino group, (17) a pyrazolyl group, (18) a dihydropyrazolyl group ally having 1 to 3 tuents selected from a Crfi alkyl group and an oxo group, (19) an oxazolyl group, ( 20) a thiazolyl group having 1 or 2 Cbfi alkyl groups, ( 21) a tetrazolyl group, (22) a pyrrolyl group, (23) a piperazinyl group having 1 to 3 Cyfi alkyl groups, (24) an imidazolyl group, (25) a pyridyl group, (26) a pyrimidinyl group, (27) a piperidyl group optionally having one oxo group, (28) a thienyl group, (29) a furyl group, and (30) a thiadiazolyl group; R is a hydrogen atom or a Cbfi alkyl group; or A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo groups; Q1 is a hydrogen atom or a Cbfi alkyl group; Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom or a Cbfi alkyl group optionally substituted by one C}6 lkyl group; Y1, Y2 and Y3 are each independently (1) a hydrogen atom, (2) a CLQO alkyl group optionally having 1 to 3 substituents ed from an amino group, a C16 alkoxy group, a phenyl group, a phenyloxy group and a benzyloxy group, (3) a Cyg cycloalkyl group, (4) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom, a Chg alkoxy group, a 0&3 alkylenedioxy group and a di—CL6 alkylamino group, (5) a pyridyl group optionally having 1 to 3 CL6 alkoxy groups, (6) a naphthyl group, (7) a biphenylyl group, (8) a thienyl group, (9) an imidazolyl group, (10) a thiazolyl group, (11) a piperidyl group optionally having 1 to 3 Cyfi alkyl groups, (12) an opyridyl group, (13) an othiazolyl group, (14) a thienopyridyl group, or (15) a 1,8—naphthyridinyl group; Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, a C38 cycloalkane ring, a pyrrolidine ring, a piperidine ring, a tetrahydropyran ring, a 2,3—dihydroindene ring, a fluorene ring, a 8—azabicyclo[3.2.1]octane ring, or a tetrahydrothiopyran ring, each of which optionally has 1 to 3 substituents selected from (1) a halogen atom, (2) a CLfi alkyl group optionally having 1 to 3 tuents selected from a halogen atom and a phenyl group, (3) a C$5 cycloalkyl group, (4) an oxo group, (5) a phenyl group, (6) a Czfi alkenyloxy—carbonyl group, and (7) a Cyfi alkyl—carbonyl group; X and Y1 are optionally bonded to each other to form a pyrrolidine ring, together with the adjacent nitrogen atom and carbon atom; and ZR 22 and Z3 are each a hydrogen atom, or a salt thereof.
[0044] [6A] The compound of [l], [2], [2A], [2B], [2C], [2D], [2E], , [3A], [4], [4A], [4B], [5] or [6], wherein A is a phenyl—Cbe alkyl group, a phenyl group, a biphenylyl group, or a pyrazolyl group, each of which optionally has 1 to 3 substituents selected from (1) a halogen atom, (2) a Cyfi alkyl group ally having 1 to 3 substituents ed from a halogen atom and a phenyl group, (3) a phenylcarbonylamino group, (4) a benzyloxycarbonylamino group, and (5) a piperidyl group optionally having one oxo group; R is a hydrogen atom; or A and R are optionally bonded to each other to form a oisoindole ring having 1 or 2 0x0 groups; Q1 is a hydrogen atom or a Cbg alkyl group; Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom; Y1, Y2 andY3 are each independently (l) a hydrogen atom, (2) a C140 alkyl group, (3) a C}fi cycloalkyl group, or (4) a phenyl group optionally having 1 to 3 Chg alkoxy groups; Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, piperidine ring optionally having 1 to 3 Cyfi alkyl ; X and Y1 are optionally bonded to each other to form a pyrrolidine ring together with the adjacent nitrogen atom and carbon atom; and Z1, 22 and Z3 are each a hydrogen atom, or a salt thereof. [7] The compound of [l], [2], [2A], [2B], [2C], [2D], [2B], [3], [3A], [4], [4A], [4B], [5], [6] or [6A], wherein A is a phenyl group optionally having 1 to 3 Cyfi alkyl groups substituted by l to 3 halogen atoms, a ylyl group, or a pyrazolyl group; R is a hydrogen atom; or A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo groups; Q1 is a hydrogen atom or a Cyfi alkyl group; QZ, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom; Y1, Y2 and Y3 are each independently a hydrogen atom or a C38 cycloalkyl group; Yl and Y2 are optionally bonded to each other to form, er with the adjacent carbon atom, a piperidine ring optionally having 1 to 3 CL£ alkyl groups; 21, Z2 and Z3 are each a hydrogen atom, or a salt thereof. [7A] N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— carboxamide, N—(4-{trans—2~[(l—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide, N—(4—{(1R,ZS)—2—[(l—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)~3—(trifluoromethyl)benzamide, (lS,2R)—2—[(l—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide or N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—1H— pyrazolecarboxamide, or a salt thereof. [8] N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— carboxamide or a salt thereof. [8A] The compound of [8], wherein N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— carboxamide is N—(4—{(lR,28)—2- [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— carboxamide, or N—(4-{(lS,2R)—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4~ carboxamide, or a salt f. [9] N—(4—{trans—2—[(l-methylpiperidin yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide or a salt thereof. [9A] The compound of [9], wherein N-(4—{trans—2—[(1— methylpiperidin~4—yl)amino]cyclopropyl}phenyl)—3— (trifluoromethyl)benzamide is N—(4—{(lR,28)—2~[(l—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide, or N—(4—{(lS,2R)*2—[(l—methylpiperidin—4— no]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide, or a salt thereof.
N—(4—{trans—2- opropylmethyl)amino]cyclopropyl}phenyl)—lH—pyrazole—4— carboxamide or a salt thereof.
A medicament containing the compound of [l] or a salt thereof.
[12] The medicament of [11], which is a prophylactic or therapeutic agent for cancer.
The medicament of [11], which is an LSDl inhibitor.
The medicament of [11], which is a prophylactic or therapeutic agent for schizophrenia, Alzheimer's disease, Parkinson’s disease or Huntington’s chorea.
A method for the prophylaxis or treatment of schizophrenia, Alzheimer’s disease, Parkinson’s disease or Huntington’s chorea, sing administering an effective amount of the compound of or a salt thereof to a mammal. [15A] A method for the prophylaxis or treatment of cancer, comprising administering an effective amount of the compound of or a salt thereof to a mammal.
Use of the compound of [l] or a salt thereof for the production of a prophylactic or eutic agent for schizophrenia, Alzheimer’s e, Parkinson’s disease or Huntington’s chorea. [16A] Use of the compound of [1] or a salt thereof for the production of a prophylactic or therapeutic agent for cancer.
[0060] The compound of [1] or a salt thereof for use in the prophylaxis or treatment of schizophrenia, mer’s disease, Parkinson’s disease or Huntington’s chorea. [17A] The compound of [1] or a salt thereof for use in the prophylaxis or treatment of .
A method of inhibiting LSD1, comprising stering an effective amount of the compound of [1] or a salt thereof to a mammal. [18A] A lactic or therapeutic agent for schizophrenia, Alzheimer’s disease, Parkinson’s disease or Huntington’s chorea, comprising the compound of [l] or a salt thereof.
[0064] [18B] A lactic or therapeutic agent for cancer, comprising the compound of [l] or a salt thereof. [18C] Use of the compound of [l] or a salt thereof for the production of an LSDl inhibitor.
The definition of each symbol used in the present specification is described in detail in the following.
Examples of the “substituent” for Q1, Q2, Q3, Q4, Z1, 22 or Z3 include a halogen atom, a cyano group, a nitro group, a hydrocarbon group optionally having tuent(s), a heterocyclic group optionally having tuent(s), an acyl group optionally having substituent(s), an amino group optionally having substituent(s), a oyl group optionally having substituent(s), a sulfamoyl group optionally having substituent(s), a hydroxy group optionally having a substituent, a sulfanyl (SH) group optionally having a tuent and the like.
Examples of the “halogen atom” e fluorine, chlorine, bromine and iodine.
Examples of the “hydrocarbon group” in the “hydrocarbon group optionally having substituent(s)” for A, R, Y1, Y2 or Y3, and in the “hydrocarbon group optionally having substituent(s)” exemplified as the substituent for Q1, Q2, Q3, Q4, 21, Z2 or Z3 include (1) a Crag alkyl group (e.g., methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec—butyl, tert—butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl), preferably, a C34 alkyl group (e.g., methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec—butyl, tert-butyl, pentyl, hexyl), (2) a C26 alkenyl group (e.g., vinyl, allyl, isopropenyl, 2— butenyl), (3) a C26 alkynyl group (e.g., l, propargyl, 2-butynyl), (4) a C;3 cycloalkyl group (e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl), (5) a Cyfi cycloalkenyl group (e.g., ropenyl, cyclobutenyl, entenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl), (6) a Cg44 aryl group (e.g., phenyl, l—naphthyl, 2-naphthyl, 2— anthryl, biphenylyl), (7) a C544 aryl Cyfi alkyl group (e.g., benzyl, phenethyl, diphenylmethyl, triphenylmethyl, l—naphthylmethyl, 2- ylmethyl, 2,2—diphenylethyl, 3—phenylpropyl, 4— phenylbutyl, ylpentyl), (8) a C6¢4 aryl Cyfi alkyl C544 aryl group (e.g., benzylphenyl, phenethylphenyl), and (9) a Cm-“ cyclic hydrocarbon group (e.g., tetrahydronaphthyl).
Examples of the substituent of the aforementioned “hydrocarbon group optionally having tuent(s)” include substituents selected from the following substituent group A and the like.
[ Substituent group A] (l ) a halogen atom (e.g., fluorine, chlorine, bromine, iodine), (2) a nitro group, (3) a cyano group, (4) a hydroxy group, (5) an optionally halogenated CLfi alkoxy group, (6) an optionally halogenated C14 alkylthio group, (7) a C544 aryloxy group (e.g., phenoxy, naphthoxy), (8) a C6q4 aryl Cyfi xy group (e.g., benzyloxy), (9) a 5— to 7—membered heterocyclyloxy group, (10) an amino group, '35 (11) a mono— or di—Cbfi alkylamino group (e.g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, dimethylamino, diethylamino, dipropylamino, dibutylamino, N— ethyl—N—methylamino), (12) a 4— to 7—membered (preferably, 5— to 7-membered) cyclic group optionally having substituent(s), (13) a formyl group, (14) a y group, (15) a carbamoyl group, (16) a thiocarbamoyl group, (17 V an ally halogenated CL6 alkyl—carbonyl group, (18) a Cpfi alkoxy—carbonyl group, (19) a C644 aryl—carbonyl group (e.g., benzoyl, l—naphthoyl, 2— naphthoyl), (20) a heterocyclylcarbonyl group optionally having substituent(s), (21) a C644 aryloxy—carbonyl group (e.g., oxycarbonyl, 1— naphthyloxycarbonyl, 2—naphthyloxycarbonyl), (22) a C644 aryl Cps alkyloxy—carbonyl group (e.g., benzyloxycarbonyl, phenethyloxycarbonyl), (23) a mono— or di"C}6 alkyl—carbamoyl group (e.g., methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, N—ethyl—N—methylcarbamoyl), (24) a carbamoyl—Cyfi alkyl—carbamoyl group (e.g., carbamoylmethylcarbamoyl, carbamoylethylcarbamoyl), (25) a C544 aryl—carbamoyl group (e.g., phenylcarbamoyl), (26) a heterocyclylcarbamoyl group optionally having substituent(s), (27) an optionally halogenated CLfi alkylsulfonyl group, (28) a C644 arylsulfonyl group (e.g., phenylsulfonyl, l— naphthylsulfonyl, thylsulfonyl), (29) a formylamino group, (30) an optionally halogenated Cbfi alkyl-carbonylamino group, (31) a C644 aryl Cpfi alkylamino group (e.g., benzylamino), (32) a C6¢4 aryl—carbonylamino group (e.g., phenylcarbonylamino, naphthylcarbonylamino), (33) a CLfi alkoxy—carbonylamino group (e.g., methoxycarbonylamino, carbonylamino, propoxycarbonylamino, butoxycarbonylamino, tert-butoxycarbonylamino), (34) a C544 aryl Che alkyloxyfcarbonylamino group (e.g., benzyloxycarbonylamino), (35) a CLfi alkylsulfonylamino group (e.g., methylsulfonylamino, ethylsulfonylamino), (36) a Cyfi alkyl—carbonyloxy group (e.g., acetoxy, propanoyloxy), (37) a Cqu aryl—carbonyloxy group (e.g., benzoyloxy, l— naphthoyloxy, 2—naphthoyloxy), (38) a Cbfi alkoxy—carbonyloxy group (e.g., methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy), (39) a mono— or di—Ctfi alkyl—carbamoyloxy group (e.g., nethylcarbamoyloxy, ethylcarbamoyloxy, dimethylcarbamoyloxy, diethylcarbamoyloxy), (40) a C544 aryl—carbamoyloxy group (e.g., phenylcarbamoyloxy, naphthylcarbamoyloxy), (41) a 5— or 6-membered heterocyclylcarbonyloxy group (e.g., noyloxy), (42) a sulfamoyl group, (43) an oxo group, (44) a C36 cycloalkyl group, and (45) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom and a Cyfi alkyl group.
The number of the substituents is, for example, 1 to 5, preferably 1 to 3. When the number of the substituents is two or more, the respective tuents may be the same or different.
[0070] When the “hydrocarbon group” of the aforementioned “hydrocarbon group optionally having substituent(s)” is a Cys cycloalkyl group, a C33 lkenyl group, a C644 aryl group, a C644 aryl Cyfi alkyl group or a Cqu aryl Cbfi alkyl C644 aryl group, examples of the substituent of the “hydrocarbon group optionally having substituent(s)” include a substituent selected from (1) the aforementioned substituent group A, (2) a Cbg alkylenedioxy group (e.g., methylenedioxy, ethylenedioxy), (3) a Cbfi alkyl group optionally having 1 to 5 halogen atoms, (4) a Cyfi alkyl group optionally having a 5-membered cyclic group (e.g., imidazolyl, triazolyl) containing 2 or 3 nitrogen atoms as a ring—constituting atom s carbon atom, and the like.
The number of the substituents is, for example, 1 to 5, preferably 1 to 3. When the number of the substituents is two or more, the respective substituents may be the same or different.
Examples of the aforementioned “optionally halogenated CLfi alkoxy group” include a Cyfi alkoxy group (e.g., methoxy, ethoxy, propoxy, , pentyloxy) optionally having 1 to 5, preferably 1 to 3, halogen atoms (e.g., fluorine, chlorine, bromine, iodine) and the like. Specific examples include y, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2— trifluoroethoxy, y, isopropoxy, butoxy, 4,4,4— orobutoxy, isobutoxy, sec—butoxy, oxy, hexyloxy and the like.
Examples of the aforementioned “optionally halogenated CLfi alkylthio group” include a Cyfi alkylthio group (e.g., methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio, utylthio) optionally having 1 to 5, preferably 1 to 3, halogen atoms (e.g., fluorine, chlorine, bromine, iodine) and the like. Specific es include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like.
Examples of the “4— to 7—membered heterocyclic group” of the aforementioned “4— to 7—membered cyclic group optionally having substituent(s)” e a 4— to 7—membered (preferably, 5— to 7—membered) heterocyclic group ning, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom and the like. Preferable examples of the 4— to 7— ed heterocyclic group include a 4— to 7-membered (preferably, 5- to 7—membered) nonaromatic cyclic group such as pyrrolidinyl (e.g., l-, 2— or 3—pyrrolidinyl); imidazolidinyl (e.g., 1—, 2—, 4— or 5—imidazolidinyl); imidazolinyl (e.g., 2— or 4—imidazolinyl); pyrazolidinyl (e.g., 2—, 3— or 4—pyrazolidinyl); piperidinyl (e.g., 1—, 2—, 3— or 4— piperidinyl); piperazinyl (e.g., l— or 2—piperazinyl); tetrahydropyranyl; morpholinyl; thiomorpholinyl; dihydropyrazolyl and the like; and a 5— to 7—membered aromatic heterocyclic group such as thienyl (e.g., 2— or 3—thienyl); furyl (e.g., 2- or 3—furyl); pyrrolyl (e.g., 1—, 2— or 3—pyrrolyl); imidazolyl (e.g., 1—, 2— or 4- olyl); thiazolyl (e.g., 2—, 4— or 5—thiazolyl); oxazolyl (e.g., 2—, 4— or 5—oxazolyl); isothiazolyl (e.g., 3— isothiazolyl); isoxazolyl (e.g., 3-isoxazolyl); pyridyl (e.g., 2—, 3- or 4—pyridyl); pyrazolyl (e.g., 1—, 3-~ or 4—pyrazolyl); pyrazinyl (e.g., 2—pyrazinyl); pyrimidinyl (e.g., 2—, 4— or 5— pyrimidinyl); pyridazinyl (e.g., 3— or 4—pyridazinyl); oxadiazolyl (e.g., 1,2,4—oxadiazol—5-yl; 1,2,4—oxadiazolyl); thiadiazolyl (e.g., 1,2,4—thiadiazol—5—yl; 1,2,4-thiadiazol—3— yl); triazolyl (e.g., l,2,3—triazol—l—yl; triazol—4—yl; 1,2,4—triazol—l—yl; triazol—3—yl); tetrazolyl (e.g., l— or 5-tetrazolyl); pyranyl (e.g., 2—, 3- or 4—pyranyl) and the like.
Examples of the aforementioned “optionally halogenated Cyfi alkyl—carbonyl group” include a Cbfi alkyl—carbonyl group (e.g., acetyl, propanoyl, butanoyl, pentanoyl, hexanoyl) optionally having 1 to 5, preferably 1 to 3, n atoms (e.g., fluorine, chlorine, bromine, iodine) and the like.
Specific examples include acetyl, monochloroacetyl, trifluoroacetyl, trichloroacetyl, propanoyl, butanoyl, pentanoyl, hexanoyl and the like.
Examples of the aforementioned “CLfi —carbonyl group” include methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert—butoxycarbonyl and the like.
Examples of the “heterocyclylcarbonyl group” of the aforementioned “heterocyclylcarbonyl group ally having substituent(s)” e nicotinoyl, isonicotinoyl, thenoyl (e.g., 2—thenoyl, 3—thenoyl), furoyl (e.g., 2-furoyl, 3—furoyl), morpholinocarbonyl, piperidinocarbonyl, pyrrolidin—l—ylcarbonyl, lcarbonyl and the like.
Examples of the “heterocyclylcarbamoyl group” of the aforementioned ocyclylcarbamoyl group optionally having substituent(s)” include morpholinocarbamoyl, piperidinocarbamoyl, pyridylcarbamoyl (e.g., 2—pyridylcarbamoyl, 3—pyridylcarbamoyl, 4—pyridylcarbamoyl), thienylcarbamoyl (e.g., nylcarbamoyl, 3—thienylcarbamoyl), indolylcarbamoyl and the like.
Examples of the aforementioned “optionally halogenated CLfi ulfonyl group” include a Cbfi alkylsulfonyl group (e.g., methylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl, butylsulfonyl, sec—butylsulfonyl, tert- butylsulfonyl) optionally having 1 to 5, preferably 1 to 3, halogen atoms (e.g., fluorine, chlorine, bromine, iodine) and the like. Specific examples e methylsulfonyl, difluoromethylsulfonyl, trifluoromethylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl, ulfonyl, 4,4,4— trifluorobutylsulfonyl, pentylsulfonyl, hexylsulfonyl and the like. es of the aforementioned “optionally halogenated Cpfi alkyl—carbonylamino group” include a C35 alkyl— carbonylamino group (e.g., acetylamino, propanoylamino, butanoylamino) optionally having 1 to 5, preferably 1 to 3, halogen atoms (e.g., fluorine, chlorine, bromine, ) and the like. Specific examples include acetylamino, trifluoroacetylamino, propanoylamino, butanoylamino and the like.
Examples of the substituent of the aforementioned “5— to 7—membered heterocyclic group optionally having substituent(s)” “heterocyclylcarbonyl group optionally having substituent(s)” and “heterocyclylcarbamoyl group optionally having substituent(s)” include a substituent selected from the following substituent group B and the like.
[Substituent group B] (l) a halogen atom (e.g., fluorine, chlorine, bromine, ), (2) a Cra alkylenedioxy group (e.g., methylenedioxy, ethylenedioxy), a nitro group, a cyano group, an oxo group, an optionally halogenated Cyfi alkyl group, a carbamoyl—Cyg alkyl group (e.g., oylmethyl), an optionally halogenated C}6 lkyl group, a C644 aryl group (e.g., phenyl, naphthyl), (10) a C6fi4 aryl Cbfi alkyl group (e.g., benzyl, phenethyl), (ll) an optionally halogenated CLfi alkoxy group, (12) an ally halogenated Cbfi alkylthio group, (13) a hydroxy group, (14) an amino group, (15) a mono— or di—Cbfi alkylamino group (e.g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, ylamino, diethylamino, dipropylamino, dibutylamino, N— ethyl—N-methylamino), (16) a formyl group, (17) a carboxy group, (18) a carbamoyl group, (19) a thiocarbamoyl group, (20) an optionally halogenated Cbfi alkyl—carbonyl group, (21) a CLfi alkoxy—carbonyl group, (22) a C}5 loxy—carbonyl group (e.g., allyloxycarbonyl), (23) a C544 aryl—carbonyl group (e.g., benzoyl, 1-naphthoy1, 2— naphthoyl), (24) a mono— or di~C36 alkyl—carbamoyl group (e.g., carbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, N—ethyl—N—methylcarbamoyl), (25) a mono— or di—Cefl4 aryl Cbfi alkyl~carbamoy1 group (e.g., benzylcarbamoyl), (26) an optionally nated Cys ulfonyl group, (27) a C644 arylsulfonyl group (e.g., phenylsulfonyl), (28) a sulfamoyl group, (29) a mono— or di-Cbs sulfamoyl group (e.g., methylsulfamoyl, ethylsulfamoyl, dimethylsulfamoyl, diethylsulfamoyl, N—ethyl—N—methylsulfamoyl), (30) a formylamino group, (31) an optionally halogenated CL6 alkyl—carbonylamino group, (32) a CLfi alkoxy—carbonylamino group (e.g., methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino, butoxycarbonylamino), (33) a Cyfi alkylsulfonylamino group (e.g., methylsulfonylamino, ethylsulfonylamino), (34) a Cyfi alkyl—carbonyloxy group (e.g., acetoxy, propanoyloxy), (35) a Cbfi alkoxy—carbonyloxy group (e.g., methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy), (36) a 5— or 6—membered aromatic heterocyclic group (e.g., tetrazolyl, thiazolyl, oxazolyl, furyl, thienyl, pyrazolyl, pyrrolyl, imidazolyl, pyridyl, pyrimidinyl, thiadiazolyl) optionally having 1 to 3 CLfi alkyl groups, (37) a dihydropyrazolyl group optionally having 1 to 3 tuents selected from a Cbfi alkyl group and an oxo group, (38) a piperazinyl group having 1 to 3 Cbg alkyl groups, (39) a dyl group optionally having one oxo group, (40) a Cbfi alkyl group optionally having 1 to 3 substituents selected from a halogen atom, a phenyl group, an imidazolyl group and a triazolyl group, (41) a Cyfi alkoxy group optionally having 1 to 3 substituents selected from a halogen atom and a phenyl group, (42) a Cbfi alkylsulfonylamino group, (43) a phenyl group optionally having 1 to 3 tuents selected from a halogen atom and a Cyfi alkyl group, (44) a phenoxy group, (45) a phenylcarbonylamino group, (46) a oxycarbonylamino group, and (47) a benzylamino group.
The number of the tuents is, for example, 1 to 3.
When the number of the substituents is two or more, the respective substituents may be the same or different.
Examples of the aforementioned “optionally halogenated CL4 alkyl group” include a CLfi alkyl group (e.g., methyl, ethyl, propyl, isopropyl, butyl, yl, sec—butyl, tert—butyl, , hexyl) optionally having 1 to 5, preferably 1 to 3, halogen atoms (e.g., fluorine, chlorine, bromine, iodine).
Specific examples include methyl, chloromethyl, difluoromethyl, oromethyl, trifluoromethyl, ethyl, oethyl, 2,2,2- trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl, 4,4,4—trifluorobutyl, isobutyl, sec—butyl, tert—butyl, pentyl, isopentyl, neopentyl, 5,5,5—trifluoropentyl, hexyl, 6,6,6—trifluorohexyl and the like.
Examples of the aforementioned “optionally halogenated C}6 cycloalkyl group” e a C}6 lkyl group (e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl) optionally having 1 to 5, preferably 1 to 3, halogen atoms (e.g., fluorine, ne, bromine, iodine) and the like. ic examples include cyclopropyl, utyl, cyclopentyl, cyclohexyl, 4,4— dichlorocyclohexyl, 2,2,3,3—tetrafluorocyclopentyl, 4— chlorocyclohexyl and the like.
[0083] Examples of each of the aforementioned nally halogenated Cbfi alkoxy group”, “optionally halogenated Chg alkylthio group”, “optionally halogenated Cbfi carbonyl group”, “Cyfi alkoxy-carbonyl group”, “optionally halogenated C14 alkylsulfonyl group” and “optionally halogenated Cbfi alkyl— carbonylamino group” include those exemplified as the “substituent” of the aforementioned “hydrocarbon group ally having substituent(s)”.
Examples of the “heterocyclic group” of the “heterocyclic group optionally having substituent(s)” for A, R, Y1, Y2 or Y3, and the “heterocyclic group optionally having substituent(s)” exemplified as the substituent for Q1, Q2, Q3, Q4, Z1, Z2 or Z3 include (i) an aromatic heterocyclic group, (ii) a nonaromatic heterocyclic group and (iii) a 7— to lO—membered bridged heterocyclic group, each of which contains, as a ring— constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom.
Here, examples of the “aromatic heterocyclic group” include a 4— to l4—membered (preferably 4— to lO—membered) aromatic heterocyclic group ning, as a ring-constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and the like. '35 Preferable examples of the “aromatic heterocyclic group” include a monocyclic aromatic heterocyclic group such as thienyl, furyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, 1,2,4—oxadiazolyl, oxadiazolyl, 1,2,4—thiadiazolyl, 1,3,4—thiadiazolyl, triazolyl, tetrazolyl, furazanyl, pyranyl and the like; a fused polycyclic (preferably ic or tricyclic) ic heterocyclic group such as benzothiophenyl, benzofuranyl, benzimidazolyl, benzoxazolyl, benzothiazolyl, benzisothiazolyl, naphtho[2,3—thhiophenyl, phenoxathiinyl, indolyl, isoindolyl, lH—indazolyl, purinyl, 4H—quinolizinyl, isoquinolyl, quinolyl, azinyl, naphthyridinyl (e.g., 1,8—naphthyridinyl), quinoxalinyl, quinazolinyl, cinnolinyl, carbazolyl, B— carbolinyl, phenanthridinyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalimido, imidazopyridyl, imidazothiazolyl, thienopyridyl etc., and the like.
Examples of the omatic heterocyclic group” include a 4— to l4-membered rably 4— to lO-membered) nonaromatic a) heterocyclic group ning, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms ed from a nitrogen atom, a sulfur atom and an oxygen atom and the like.
Preferable examples of the “nonaromatic heterocyclic group” include a clic nonaromatic heterocyclic group such as azetidinyl, tetrahydrothiophenyl, tetrahydrofuranyl, pyrrolinyl, pyrrolidinyl, imidazolinyl, imidazolidinyl, oxazolinyl, oxazolidinyl, pyrazolinyl, pyrazolidinyl, thiazolinyl, thiazolidinyl, tetrahydrothiazolyl, tetrahydroisothiazolyl, tetrahydrooxazolyl, tetrahydroisoxazolyl, piperidinyl, piperazinyl, tetrahydropyridinyl, dihydropyridinyl, ydropyrimidinyl, tetrahydropyridazinyl, ydropyranyl, azepanyl, morpholinyl, thiomorpholinyl, diazepanyl, azepinyl, azocanyl, diazocanyl and the like; a fused polycyclic (preferably bicyclic or tricyclic) nonaromatic heterocyclic group such as dihydrobenzofuranyl, dihydrobenzimidazolyl, obenzoxazolyl, dihydrobenzothiazolyl, dihydrobenzisothiazolyl, dihydronaphtho[2,3—b]thiophenyl, ydroisoquinolyl, tetrahydroquinolyl, indolinyl, isoindolinyl, ydrothieno[2,3—c]pyridinyl, tetrahydrobenzazepinyl, tetrahydroquinoxalinyl, tetrahydrophenanthridinyl, hexahydrophenothiazinyl, hexahydrophenoxazinyl, tetrahydrophthalazinyl, tetrahydronaphthyridinyl, tetrahydroquinazolinyl, tetrahydrocinnolinyl, tetrahydrocarbazolyl, tetrahydro—B—carbolinyl, tetrahydroacridinyl, tetrahydrophenazinyl, tetrahydrothioxanthenyl, octahydroisoquinolyl and the like.
Preferable examples of the “7— to lO—membered bridged heterocyclic group” include quinuclidinyl, 7— azabicyclo[2.2.l]heptanyl and the like.
Examples of the substituent of the “heterocyclic group optionally having substituent(s)” include substituents selected from the aforementioned substituent group B and the like.
The number of the tuents is, for example, 1 to 3.
When the number of the substituents is two or more, the tive substituents may be the same or different.
Examples of the acyl group of the “acyl group optionally having substituent(s)” exemplified as the substituent for QR Q2, Q3, Q4, 21, 22 or Z3 include , —CO—OR1A, ~302R1A, —SOR1A, —PO(ORM)(OR”U wherein R1A and Ruiare each independently a hydrogen atom, a hydrocarbon group or a cyclic group, and the like.
Examples of the “hydrocarbon group” for R1A or Rfliinclude the “hydrocarbon groups” exemplified for the “hydrocarbon group optionally having substituent(s)” exemplified as the substituent for 01, 02, Q3, Q4, Zl, Z2 or Z3. The hydrocarbon group is preferably a Cyfi alkyl group, a Cgfi alkenyl group, a C33 cycloalkyl group, a C3% cycloalkenyl group, a C544 aryl group, a C644 aryl Cbfi alkyl group and the like.
Examples of the “heterocyclic group” for Rm'or R2A include the “heterocyclic groups” exemplified for the “heterocyclic group optionally having substituent(s)” exemplified as the substituent for Q1, Q2, Q3, Q4, Z1, Z2 or Z3.
The cyclic group is preferably lyl, oxazolyl, isothiazolyl, isoxazolyl, pyrazolyl, pyridyl, nyl, benzoxazolyl, benzothiazolyl, quinolyl, isoquinolyl, pyrrolidinyl, piperidinyl, piperazinyl and the like.
The acyl group optionally has 1 to 3 substituents at substitutable on(s). Examples of such substituent include an optionally halogenated Cbfi alkyl group (e.g., methyl, ethyl); an optionally halogenated Cyfi alkoxy group (e.g., methoxy, ethoxy); a halogen atom (e.g., fluorine, chlorine, bromine, iodine); a nitro group; a hydroxy group; an amino group (e.g., methylamino, ylamino) optionally mono— or di—substituted by a Cbfi alkyl group (e.g., , ethyl); a Crfi alkoxy—carbonylamino group (e.g., tert—butoxycarbonylamino) and the like.
Preferable examples of the acyl group include a formyl group, a carboxyl group, a CL£ alkyl—carbonyl group (e.g., acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, yl), a Cgfi alkenyl—carbonyl group (e.g., crotonoyl), a ng cycloalkyl—carbonyl group (e.g., cyclobutanecarbonyl, cyclopentanecarbonyl, cyclohexanecarbonyl, eptanecarbonyl), a C}8 cycloalkenyl—carbonyl group (e.g., 2-cyclohexenecarbonyl), a C544 aryl—carbonyl group (e.g., benzoyl, l—naphthoyl, 2—naphthoyl), a C544 aryl Cyfi alkyl— carbonyl group (e.g., benzylcarbonyl, phenethylcarbonyl), an aromatic heterocyclylcarbonyl group (e.g., nicotinoyl, isonicotinoyl), a nonaromatic heterocyclylcarbonyl group (e.g., pyrrolidinylcarbonyl, piperidinylcarbonyl), a CLfi alkoxy— carbonyl group (e.g., methoxycarbonyl, carbonyl, propoxycarbonyl, butoxycarbonyl, tert-butoxycarbonyl), a Ca14 aryloxy—carbonyl group (e.g., phenyloxycarbonyl, naphthyloxycarbonyl), a C644 aryl C14 alkyloxy—carbonyl group (e.g., benzyloxycarbonyl, phenethyloxycarbonyl), a Cks alkylsulfinyl group (e.g., methylsulfinyl, ethylsulfinyl), a Cbfi alkylsulfonyl group (e.g., methylsulfonyl, ethylsulfonyl), a C644 arylsulfonyl group (e.g., phenylsulfonyl), a phosphono group, a mono— or di‘CLfi alkylphosphono group (e.g., dimethylphosphono, diethylphosphono, diisopropylphosphono, dibutylphosphono) and the like.
Examples of the “amino group optionally having substituent(s)”, moyl group optionally having substituent(s)” and “sulfamoyl group optionally having tuent(s)” exemplified as the substituent for Q1, Q2, Qa Q4, Z1, Z2 or Z3 e an amino group, a carbamoyl group and a sulfamoyl group, each of which optionally has 1 or 2 substituents selected from (1) the “hydrocarbon group optionally having substituent(s)”, “acyl group optionally having substituent(s)” and “heterocyclic group optionally having substituent(s)”, each exemplified as the substituent for Q1, Q2, Q3, Q4, 21, 22 or Z3; and (2) a carbamoyl group optionally having 1 or 2 substituents selected from a Cyfi alkyl group (e.g., methyl, ethyl), a Cyg cycloalkyl group (e.g., ropyl, cyclohexyl), a C644 aryl group (e.g., phenyl) and a C644 aryl Cyfi alkyl group (e.g., benzyl). When the en atom constituting the amino group, carbamoyl group and sulfamoyl group is substituted by two substituents, the substituents may form, together with the nt nitrogen atom, a nitrogen—containing heterocycle.
Examples of the “nitrogen—containing heterocycle” e a 5— ‘35 to 7—membered nitrogen—containing heterocycle containing one nitrogen atom as a ring—constituting atom besides carbon atom, and optionally r containing 1 or 2 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom.
Preferable examples of the nitrogen-containing heterocycle include idine, imidazolidine, pyrazolidine, piperidine, piperazine, morpholine, thiomorpholine and the like.
The “amino group optionally having substituent(s)”, “carbamoyl group optionally having tuent(s)” and “sulfamoyl group ally having substituent(s)” are preferably an amino group, a carbamoyl group and a sulfamoyl group, respectively, each of which optionally has “1 or 2 substituents selected from a Cbfi alkyl group, a Czfi alkenyl group, a C}@ cycloalkyl group, a C644 aryl group, a C6fl4 aryl CLfi alkyl group, a Chg alkyl—carbonyl group, a C644 aryl— carbonyl group, a C644 aryl Cbfi alkyl—carbonyl group, an aromatic heterocyclylcarbonyl group, a matic heterocyclylcarbonyl group, a Cyfi alkoxy—carbonyl group, an aromatic heterocyclic group, a carbamoyl group, a mono— or di— Clfi alkyl—carbamoyl group and a mono— or di—ngg aryl Cyfi alkyl—carbamoyl group, each of which optionally has 1 to 3 substituents selected from a halogen atom (e.g., fluorine, chlorine, bromine, iodine), an optionally halogenated Clm alkoxy group, a hydroxy group, a nitro group, an amino group and a oyl group”.
Preferable examples of the amino group optionally having substituent(s) include an amino group, a mono— or di—Cks alkylamino group (e.g., methylamino, dimethylamino, mino, diethylamino, propylamino, dibutylamino), a mono— or di—Cks alkenylamino group (e.g., diallylamino), a mono- or di‘C}8 cycloalkylamino group (e.g., cyclopropylamino, exylamino), a mono— or di—C644 arylamino group (e.g., phenylamino), a mono— or di—C644 aryl Ckfi alkylamino group (e.g., benzylamino, dibenzylamino), a mono— or di—(optionally halogenated Chg alkyl)—carbonylamino group (e.g., acetylamino, propionylamino), a mono— or di—C544 aryl—carbonylamino group (e.g., benzoylamino), a mono- or 4 aryl Cyfi alkyl—carbonylamino group (e.g., benzylcarbonylamino), a mono— or di—aromatic heterocyclylcarbonylamino group (e.g., nicotinoylamino, isonicotinoylamino), a mono“ or di—nonaromatic cyclylcarbonylamino group (e.g., dinylcarbonylamino), a mono— or di”CLfi alkoxy- carbonylamino group (e.g., tert—butoxycarbonylamino), an aromatic heterocyclylamino group (e.g., pyridylamino), a carbamoylamino group, a (mono— or di—Cbfi carbamoyl)amino group (e.g., methylcarbamoylamino), a (mono- or di—ngA aryl Cp carbamoyl)amino group (e.g., benzylcarbamoylamino) and the like.
[0097] Preferable examples of the carbamoyl group optionally having substituent(s) include a carbamoyl group, a mono— or di— Cye alkyl—carbamoyl group (e.g., carbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, N—ethyl—N— methylcarbamoyl), a mono— or di—Czfi alkenyl—carbamoyl group (e.g., diallylcarbamoyl), a mono— or di—C33 cycloalkyl— carbamoyl group (e.g., cyclopropylcarbamoyl, cyclohexylcarbamoyl), a mono— or di—C644 aryl—carbamoyl group (e.g., phenylcarbamoyl), a mono~ or di—C6fi4 aryl Cbfi alkyl— carbamoyl group (e.g., benzylcarbamoyl, phenethylcarbamoyl), a mono— or di—Cbfi alkyl—carbonyl—carbamoyl group (e.g., acetylcarbamoyl, propionylcarbamoyl), a mono— or 4 aryl— carbonyl—carbamoyl group (e.g., benzoylcarbamoyl), an aromatic heterocyclylcarbamoyl group (e.g., pyridylcarbamoyl), and a nitrogen—containing heterocyclylcarbonyl group (e.g., morpholinocarbonyl).
Preferable examples of the sulfamoyl group optionally having substituent(s) include a sulfamoyl group, a mono— or di— C14 alkyl—sulfamoyl group (e.g., methylsulfamoyl, ethylsulfamoyl, dimethylsulfamoyl, diethylsulfamoyl, N—ethyl—N— methylsulfamoyl), a mono— or di—Czfi alkenyl—sulfamoyl group (e.g., diallylsulfamoyl), a mono— or di—C3fl cycloalkyl— sulfamoyl group (e.g., cyclopropylsulfamoyl, exylsulfamoyl), a mono- or di—Cefl4 aryl—sulfamoyl group (e.g., phenylsulfamoyl), a mono— or di_C6fl4 aryl CL6 alkyl— sulfamoyl group (e.g., benzylsulfamoyl, phenethylsulfamoyl), a mono— or di—Cbg alkyl—carbonyl—sulfamoyl group (e.g., acetylsulfamoyl, propionylsulfamoyl), a mono— or di—C6d4 aryl— yl—sulfamoyl group (e.g., benzoylsulfamoyl), an aromatic heterocyclylsulfamoyl group (e.g., pyridylsulfamoyl) and the like.
Examples of the “hydroxy group optionally having a substituent” and “sulfanyl group optionally having a substituent” exemplified as the substituent for Q1, Q2, Q3, Q3 21, 22 or Z3 include a hydroxy group and a sulfanyl group, each optionally having a substituent selected from the “hydrocarbon group optionally having substituent(s)”, “acyl group optionally having substituent(s)” and “heterocyclic group optionally having substituent(s)” each exemplified as the substituent for Q1, Q2, Q3, Q4, Z1, Zz or Z3. xy group optionally having substituent(s)” and “sulfanyl group optionally having tuent(s)” preferably a hydroxy group and a sulfanyl group, each optionally having the “substituent selected from a CLfi alkyl group, a C26 alkenyl group, a C}B cycloalkyl group, a quA aryl group, a Cfiflq aryl Cyfi alkyl group, a Cyfi alkyl-carbonyl group, a C6fl4 aryl—carbonyl group and an aromatic heterocyclic group, each of which optionally has 1 to 3 tuents ed from a halogen atom (e.g., fluorine, chlorine, bromine, iodine), an optionally halogenated Cyg alkoxy group, a y group, a nitro group, an amino group and a carbamoyl group”.
[0101] Preferable examples of the hydroxy group optionally having substituent(s) include a hydroxy group, a Cyfi alkoxy group (e.g., methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec—butoxy, tert—butoxy, pentyloxy, isopentyloxy, neopentyloxy, xy), a C%5 alkenyloxy group (e.g., allyloxy, 2-butenyloxy, 2—pentenyloxy, 3—hexenyloxy), a C38 cycloalkyloxy group (e.g., cyclohexyloxy), a C6&4 y group (e.g., phenoxy, naphthyloxy), a C6fl4 aryl Cbfi alkyloxy group (e.g., benzyloxy, hyloxy), a Cyfi alkyl—carbonyloxy group (e.g., acetyloxy, propionyloxy, butyryloxy, isobutyryloxy, pivaloyloxy), a C6¢4 aryl—carbonyloxy group (e.g., benzoyloxy), an aromatic heterocyclyloxy group (e.g., pyridyloxy) and the like.
Preferable examples of the sulfanyl group optionally having substituent(s) include a sulfanyl group, a Cyfi alkylthio group (e.g., methylthio, ethylthio, thio, isopropylthio, butylthio, isobutylthio, sec-butylthio, tert-butylthio, pentylthio, isopentylthio, neopentylthio, hexylthio), a Cpg alkenylthio group (e.g., allylthio, 2-butenylthio, 2- pentenylthio, 3-hexenylthio), a C38 lkylthio group (e.g., exylthio), a C6¢4 arylthio group (e.g., phenylthio, naphthylthio), a C5¢4 aryl Cbfi hio group (e.g., benzylthio, hylthio), a Cyfi alkyl—carbonylthio group (e.g., acetylthio, propionylthio, butyrylthio, isobutyrylthio, pivaloylthio), a C644 arbonylthio group (e.g., benzoylthio), an aromatic cyclylthio group (e.g., pyridylthio) and the like.
Examples of the “hydrocarbon group” of the “acyclic hydrocarbon group optionally having substituent(s)” for X include (1) a Cyfi alkyl group (e.g., methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec—butyl, tert—butyl, pentyl, hexyl), (2) a C36 alkenyl group (e.g., vinyl, allyl, isopropenyl, 2— butenyl), (3) a Czfi l group (e.g., ethynyl, propargyl, 2—butynyl) and the like.
Examples of the substituent of the ic hydrocarbon group optionally having substituent(s)” for X include the substituents selected from the aforementioned substituent group A and the like.
The number of the substituents is, for example, 1 to 5, preferably 1 to 3. When the number of the substituents is two or more, the respective substituents may be the same or different.
Examples of the “saturated cyclic group” of the “saturated cyclic group optionally having substituent(s)” for X include (1) a C}g cycloalkyl group (e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, ctyl), (2) a 4— to l4—membered (preferably 4— to 8—membered, more preferably 5- or 6—membered) saturated heterocyclic group (e.g., azetidinyl, tetrahydrothiophenyl, tetrahydrofuranyl, pyrrolidinyl, imidazolidinyl, oxazolidinyl, pyrazolidinyl, thiazolidinyl, idinyl, azolidinyl, isoxazolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, azepanyl, anyl, oxazepanyl, thiazepanyl, azocanyl, diazocanyl) containing, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and the like.
Examples of the substituent of the “saturated cyclic group ally having tuent(s)” for X include the substituents selected from the aforementioned substituent group B and the like.
The number of the substituents is, for example, 1 to 3.
When the number of the substituents is two or more, the respective substituents may be the same or different.
[0105] Examples of the “ring” of the “ring ally having substituent(s)” optionally formed by A and R, bonded to each other, together with the adjacent carbonyl and nitrogen atom include a 5— to ered monocyclic nitrogen-containing nonaromatic cycle (e.g., 2-oxopyrrolidine, 2— oxopiperidine, 2—oxopiperazine, 3—oxomorpholine, 3— oxothiomorpholine), and a 4— to bered heterocycle (e.g., dihydroisoindole), each containing one nitrogen atom as a ring— constituting atom besides carbon atom, and optionally further containing one hetero atom selected from a nitrogen atom, a sulfur atom and an oxygen atom, and having 1 or 2 oxo groups, and the like.
Examples of the substituent of the “ring optionally having substituent(s)" optionally formed by A and R bonded to each other include the substituents selected from the aforementioned substituent group B and the like.
The number of the substituents is, for e, 1 to 3.
When the number of the substituents is two or more, the respective tuents may be the same or different.
[0106] es of the “ring” of the “ring optionally having substituent(s)” ally formed by Q1 and Q2, and Q3 and Q3 each bonded to each other, together with the adjacent carbon atoms include a 5— or 6—membered aromatic ring or nonaromatic ring each optionally containing, as a onstituting atom besides carbon atom, l to 3 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom and the like.
Examples of the “aromatic ring” include benzene, thiophene, furan, pyrrole, pyrazole, imidazole, thiazole, oxazole, isothiazole, isoxazole, oxadiazole, thiadiazole, triazole, pyridine, pyrazine, pyrimidine, pyridazine, pyran and the like.
Examples of the “nonaromatic ring” include cyclopentene, cyclohexene, exadiene, dihydrothiophene, dihydrofuran, pyrroline, pyrazoline, imidazoline, thiazoline, oxazoline, isothiazoline, isoxazoline, tetrahydropyridine, dihydropyridine, tetrahydropyrazine, dihydropyrazine, tetrahydropyrimidine, dihydropyrimidine, ydropyridazine, dihydropyridazine, dihydropyran and the like. es of the substituent of the “ring optionally having substituent(s)” optionally formed by Q1 and Q2, and Q3 and Q4, each bonded to each other, include the substituents selected from the aforementioned substituent group B and the like.
The number of the tuents is, for example, 1 to 3.
When the number of the substituents is two or more, the respective substituents may be the same or different.
Examples of the “ring” of the “ring optionally having substituent(s)” optionally formed by X and Y1, bonded to each other, er with the adjacent nitrogen atom and carbon atom include a 5— to 7—membered nitrogen—containing nonaromatic heterocycle containing one nitrogen atom as a ring—constituting atom besides carbon atom, and optionally further containing one hetero atom selected from a en atom, a sulfur atom and an oxygen atom and the like. Examples of the “nitrogen-containing nonaromatic ring” include pyrrolidine, pyrroline, pyrazoline, imidazoline, thiazolidine, oxazolidine, azolidine, isoxazolidine, thiazoline, oxazoline, isothiazoline, isoxazoline, piperidine, piperazine, morpholine, thiomorpholine, azepane, diazepane, oxazepane, thiazepane and the like.
Examples of the tuent of the “ring optionally having substituent(s)” optionally formed by X and Y1 bonded to each other include the substituents selected from the aforementioned substituent group B and the like.
The number of the substituents is, for example, 1 to 3.
When the number of the substituents is two or more, the tive substituents may be the same or different.
Examples of the “ring” of the “ring optionally having substituent(s)” optionally formed by Y1 and Y2, bonded to each other, together with the adjacent carbon atom include (1) a C38 cycloalkane ring (e.g., cyclopropane, cyclobutane, entane, cyclohexane, cycloheptane, cyclooctane), (2) a 2,3—dihydroindene ring, (3) a ne ring, (4) a 4— to l4—membered (preferably 4— to lO—membered) nonaromatic heterocycle containing, as a ring-constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom and the like.
Preferable examples of the “nonaromatic heterocycle” include a monocyclic nonaromatic heterocycle such as azetidine, tetrahydrothiophene, tetrahydrofuran, pyrroline, pyrrolidine, imidazoline, imidazolidine, oxazoline, idine, pyrazoline, lidine, thiazoline, thiazolidine, ydrothiazoline, tetrahydroisothiazoline, tetrahydrooxazoline, tetrahydroisoxazoline, piperidine, piperazine, tetrahydropyridine, dihydropyridine, ydropyrimidine, tetrahydropyridazine, tetrahydropyran, azepane, morpholine, thiomorpholine, diazepane, azepine, azocane, diazocane, tetrahydrothiopyran and the like; a fused polycyclic (preferably bicyclic or tricyclic) nonaromatic heterocycle such as dihydrobenzofuran, dihydrobenzimidazole, dihydrobenzoxazole, dihydrobenzothiazole, obenzisothiazole, onaphtho[2,3—b]thiophene, tetrahydroisoquinoline, ydroquinoline, indoline, isoindoline, tetrahydrothieno[2,3—c]pyridine, tetrahydrobenzazepine, tetrahydroquinoxaline, tetrahydrophenanthridine, hexahydrophenothiazine, hexahydrophenoxazine, tetrahydrophthalazine, tetrahydronaphthyridine, tetrahydroquinazoline, tetrahydrocinnoline, tetrahydrocarbazole, tetrahydro—B— carboline, tetrahydroacridine, tetrahydrophenazine, tetrahydrothioxanthene, octahydroisoquinoline, 8— azabicyclo[3.2.l]octane and the like.
Examples of the substituent of the “ring optionally‘ having substituent(s)” optionally formed by Y1 and Y2 bonded to each other include the substituents selected from the aforementioned substituent group B and the like.
The number of the substituents is, for example, 1 to 3.
When the number of the substituents is two or more, the respective substituents may be the same or different.
Preferably, Q1 is a en atom or a Cyfi alkyl group, and Q2, Q3 and Q4 are each a en atom.
Q1, Q2, Q3 and Q4 are each more preferably a hydrogen atom.
Z1, Z2 and Z3 are each preferably a en atom.
A is preferably a hydrocarbon group optionally having substituent(s), more preferably, (1) a C644 aryl group (e.g., phenyl, biphenylyl) optionally having 1 to 3 tuents selected from (a) a n atom, (b) a Chg alkyl group optionally having 1 to 5 halogen atoms, C5¢4 aryloxy group, C6¢4 aryl Chg alkyloxy group, C644 aryl—carbonylamino group, a C6fl4 aryl Cbfi alkylamino group, and a 5— to 7-membered nonaromatic heterocyclic group (e.g., piperidyl) containing, as a ring—constituting atom besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having an oxo group, (2) a C644 aryl Cyfi alkyl group optionally having a C5fl4 aryl CLfi alkyloxy—carbonylamino group, or (3) a C644 aryl Cyfi alkyl C514 aryl group.
R is preferably a hydrogen atom or a Cyfi alkyl group, more preferably, a hydrogen atom.
X is preferably a hydrogen atom or a Cpfi alkyl group ally tuted by one Cyfi cycloalkyl group, more preferably, a hydrogen atom or a Chg alkyl group, further preferably, a hydrogen atom.
Preferably, Y1, Y2 and Y3 are each independently (l) a hydrogen atom, (2) a CLQO alkyl group optionally having 1 to 3 substituents selected from an amino group, a Cbg alkoxy group, a phenyl group, a phenyloxy group and a benzyloxy group, (3) a C}g cycloalkyl group, (4) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom, a Cyfi alkoxy group, a Cy3 alkylenedioxy group and a di—C}fi alkylamino group, (5) a pyridyl group optionally having 1 to 3 CLfi alkoxy groups, (6) a naphthyl group, (7) a ylyl group, (8) a thienyl group, (9) an imidazolyl group, (10) a thiazolyl group, (11) a piperidyl group optionally having 1 to 3 CLfi alkyl groups, (12) an imidazopyridyl group, (13) an imidazothiazolyl group, (14) a thienopyridyl group, or (15) an 1,8-naphthyridinyl group.
In another preferable ment, Y1, Y2 and Y3 are each independently (1) a hydrogen atom, (2) a C140 alkyl group optionally having 1 to 3 substituents selected from (a) an amino group, (b) a C35 alkoxy group, (c) a C544 aryloxy group, and (d) a C644 aryl Cyg xy group, (3) a C33 cycloalkyl group, (4) a C644 aryl group (e.g., phenyl, naphthyl, biphenylyl) ally having 1 to 3 substituents selected from (a) a halogen atom, (b) a CLfi alkoxy group, and (c) a Cre alkylenedioxy group, (5) a C544 aryl Cyfi alkyl group, or (6) a 5— to 7—membered monocyclic aromatic heterocyclic group (e.g., pyridyl, thienyl) containing, as a ring—constituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 to 3 CLfi alkoxy groups.
[0116] An embodiment wherein X and Y1 are bonded to each other to form, together with the adjacent nitrogen atom and carbon atom, a 5— to 7—membered monocyclic en—containing matic cycle (e.g., pyrrolidine) containing one nitrogen atom as a ring—constituting atom besides carbon atom, and optionally further containing one hetero atom selected from a nitrogen atom, a sulfur atom and an oxygen atom is also preferable.
When X and Y1 are bonded to each other to form, together with the adjacent nitrogen atom and carbon atom, a ring optionally having tuent(s), Y2 and Y3 are each preferably a hydrogen atom.
An embodiment wherein Y1 and Y2 are bonded to each other to form, together with the adjacent carbon atom, a C33 cycloalkane ring, a pyrrolidine ring, a piperidine ring, a tetrahydropyran ring, a 2,3-dihydroindene ring, a fluorene ring, a 8—azabicyclo[3.2.l]octane ring, or a tetrahydrothiopyran ring, each of which optionally has 1 to 3 substituents selected from (1) a halogen atom, (2) a Chg alkyl group optionally having 1 to 3 substituents selected from a halogen atom.and a phenyl group, (3) a C3£ cycloalkyl group, (4) an OXO group, (5) a phenyl group, (6) a C}fi alkenyloxy—carbonyl group, and (7) a CL5 alkyl—carbonyl group, is also able.
[0119] An embodiment wherein Y1 and Y2 are bonded to each other to form, together with the adjacent carbon atom, (l) C}3 lkane (e.g., eptane, cyclooctane), (2) 2,3—dihydroindene, (3) fluorene, or (4) a 5— to 7—membered monocyclic nonaromatic heterocycle (e.g., piperidine) containing, as a ring—constituting atom.besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 to 3 substituents selected from (a) a CL6 alkyl group, (b) a C644 aryl Cbg alkyl group, and (c) a C}6 alkenyloxy—carbonyl group, is also preferable.
[0120] When Y1 and Y2 are optionally bonded to each other to form, er with the adjacent carbon atom, a ring optionally having substituent(s), X and Y3 are each preferably a hydrogen atom.
[0121] In the formula (I), the configuration of a substituent represented by the formula
[0123] and a substituent represented by the formula —N(X)—C(Y1)(Y2)(Y% on a cyclopropane ring is ably a trans form rather than a cis form. ic preferable examples of compound (I) include the following compound.
[Compound A] Compound (I) wherein A is (l) a C644 aryl group (e.g., phenyl, biphenylyl) optionally having 1 to 3 substituents selected from a n atom, a CLfi alkyl group optionally having 1 to 5 halogen atoms, C644 aryloxy group, C644 aryl Cbfi alkyloxy group, C6fi4 aryl—carbonylamino group, a C544 aryl Cyfi mino group, and ((3) a 5* to 7—membered nonaromatic heterocyclic group (e.g., piperidinyl) containing, as a ring—constituting atom besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having an oxo group, (2) a C644 aryl Chg alkyl group optionally having a C644 aryl C14 alkyloxy~carbonylamino group, or (3) a C544 aryl CL5 alkyl C644 aryl group; R is a hydrogen atom; Q1, Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom or a Cbfi alkyl group; Y1, Y2 and Y3 are each independently (l) a hydrogen atom, (2) a CLQO alkyl group optionally having 1 to 3 tuents selected from ( a) an amino group, ( G ) a Cbfi alkoxy group, (c) a C6¢4 aryloxy group, and (d) a C6¢4 aryl Che xy group, (3) a C33 cycloalkyl group, (4) a C644 aryl group (e.g., phenyl, naphthyl, biphenylyl) optionally having 1 to 3 substituents selected from (a) a halogen atom, (b) a Cbfi alkoxy group, and (c) a Cpg alkylenedioxy group, (5) a C9fl4 aryl CL6 alkyl group, or (6) a 5— to 7—membered monocyclic aromatic heterocyclic group (e.g., pyridyl, thienyl) containing, as a onstituting atom besides carbon atom, l to 4 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 to 3 CLfi alkoxy groups; X and Y1 are optionally bonded to each other to form, together with the adjacent nitrogen atom and carbon atom, a 5— to 7— membered monocyclic nitrogen—containing nonaromatic cycle (e.g., pyrrolidine) containing one nitrogen atom as a ring~ constituting atom besides carbon atom, and optionally further containing one hetero atom selected from a nitrogen atom, a sulfur atom and an oXygen atom; Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, (l) C}g cycloalkane (e.g., eptane, cyclooctane), (2) 2,3—dihydroindene, (3) fluorene, or (4) a 5— to ered monocyclic nonaromatic heterocycle (e.g., piperidine) containing, as a ring—constituting atom besides carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom, and optionally having 1 .to 3 tuents selected from (a) a Che alkyl group, (b) a C6¢4 aryl CLfi alkyl group, and (c) a C26 alkenyloxyecarbonyl group; and 21, Z2 and Z3 are each a hydrogen atom.
The salt of compound (I) is preferably a pharmacologically able salt. Examples of such salt include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, and salts with basic or acidic amino acids.
Preferable examples of salts with inorganic bases e alkali metal salts such as sodium salts, potassium salts and the like; alkali earth metal salts such as calcium salts, magnesium salts and the like; aluminum salts; and ammonium salts.
Preferable examples of salts with organic bases include salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N,N—dibenzylethylenediamine and the like.
Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
Preferable examples of salts with organic acids include salts with formic acid, acetic acid, oroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p—toluenesulfonic acid and the like.
Preferable examples of salts with basic amino acids include salts with arginine, lysine, ornithine and the like.
Preferable es of salts with acidic amino acids include salts with aspartic acid, glutamic acid and the like.
The salt of compound (I) is preferably a salt with an inorganic acid (preferably, hydrochloric acid) or an organic acid (preferably, trifluoroacetic acid).
Compound (I) may also be used as a prodrug. A prodrug of compound (I) means a compound which is ted to compound (I) due to a reaction due to an enzyme, gastric acid, etc. under the physiological condition in the living body, that is, a compound which is converted to compound (I) with oxidation, H7 ion, hydrolysis, and the like according to an enzyme; a compound which is converted to compound (I) by hydrolysis etc. due to c acid, and the like; A prodrug for nd (I) may be a compound obtained by Subjecting an amino group in compound (I) to an acylation, alkylation or phosphorylation (e.g., a compound obtained by subjecting an amino group in nd (I) to an eicosanoylation, alanylation, pentylaminocarbonylation, (5—methyl—2—oxo—l,3-dioxolen—4— yl)methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation and tert— tion, etc.); a compound ed by subjecting a hydroxy group in compound (I) to an acylation, alkylation, orylation or boration (e.g., a compound obtained by subjecting a hydroxy group in compound (I) to an acetylation, palmitoylation, propanoylation, pivaloylation, succinylation, fumarylation, alanylation and dimethylaminomethylcarbonylation); a compound obtained by subjecting a carboxyl group in compound (I) to an esterification or ion (e.g., a compound obtained by subjecting a carboxyl group in compound (I) to an ethyl esterification, phenyl esterification, carboxymethyl esterification, dimethylaminomethyl esterification, pivaloyloxymethyl esterification, ethoxycarbonyloxyethyl esterification, phthalidyl esterification, (5-methyl—2—oxo—l,3— dioxolen—4~yl)methyl esterification, cyclohexyloxycarbonylethyl as esterification and methylamidation) and the like. Any of these compounds can be produced from compound (I) by a method known per se.
The prodrug of compound (I) may be a compound that ts to compound (I) under logical conditions as described in Development of Pharmaceutical Products, vol. 7, Molecular Design, 163—198, Hirokawa Shoten (1990).
Compound (I) may be labeled with an isotope (e.g., %L 3H, 14C, 358, 1251, 11C, 18F) arui the Ilike.
Compound (I) labeled with or substituted by an isotope can be used, for example, as a tracer used for Positron Emissicn Tomography (PET) (PET tracer), and is useful in the field of medical diagnosis and the like.
Compound (I) may be an anhydrate or a hydrate. Compound (I) may be a e or a non-solvate. Furthermore, compound (I) may be a deuterated compound.
Compound (I) may be a l, and both a single crystal and crystal mixtures are encompassed in compound (I). Crystals can be produced by crystallization ing to crystallization methods known per se.
In addition, compound (I) may be a pharmaceutically acceptable cocrystal or cocrystal salt. Here, the tal or cocrystal salt means a crystalline substance consisting of two or more particular substances which are solids at room temperature, each having different al properties (e.g., structure, melting point, heat of melting, hygroscopicity, and stability). The cocrystal and cocrystal salt can be produced by cocrystallization method known per se.
When compound (I) includes isomers such as optical isomers, stereoisomers, regioisomers, rotational isomers, rical isomers, and the like, one of the isomers and mixture are also encompassed in nd (I).
Compound (I) or a prodrug thereof (hereinafter sometimes to be simply abbreviated as the compound of the present ion) has low toxicity (e.g., acute toxicity, chronic toxicity, genetic toxicity, reproductive toxicity, cardiotoxicity, carcinogenicity), and can be used as it is or in the form of a pharmaceutical composition (in the present specification, sometimes to be abbreviated as “medicament of the present ion”) after mixing with a cologically acceptable r etc. to mammals (e.g., human, mouse, rat, rabbit, dog, cat, bovine, horse, swine, monkey) as an agent for the prophylaxis or ent of various diseases mentioned below.
As a pharmaceutical acceptable carrier here, common organic or nic carrier substances are used as ation raw als. Carriers are added as vehicles, lubricants, binders and disintegrants in the solid formulations; and as solvents, solubilizing agents, suspending agents, ization agents, buffering agents, soothing agents etc. in the liquid formulations. If desired, formulation additives such as preservatives, antioxidants, colorants, sweeteners, etc. can be used.
Preferable examples of the vehicles are as s: lactose, sucrose, D—mannitol, D—sorbitol, starch, a—starch, dextrin, crystalline cellulose, low—substituted hydroxypropyl cellulose, sodium carboxymethylcellulose, gum Arabic, pullulan, light anhydrous silicic acid, synthetic aluminum silicate, and magnesium metasilicic aluminate.
Preferable examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica, and the like.
Preferable examples of the s are as follows: @— starch, sucrose, gelatin, gum Arabic, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, crystalline cellulose, sucrose, D—mannitol, trehalose, dextrin, pullulan, hydroxypropylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone. able examples of the disintegrants are as follows: lactose, sucrose, , carboxymethylcellulose, calcium carboxymethylcellulose, croscarmellose sodium, sodium carboxymethyl , light anhydrous silicic acid, and low— substituted hydroxypropylcellulose.
[0134] Preferable examples of the solvents are as follows: water for injection, physiological saline, Linger on, alcohol, propylene glycol, polyethylene glycol, sesame oil, corn oil, olive oil, and cottonseed oil.
[0135] Preferable examples of the solubilizing agents are as follows: polyethylene glycol, propylene glycol, D—mannitol, trehalose, benzyl benzoate, ethanol, tris—aminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, sodium late, and sodium acetate.
Preferable examples of the suspending agent include surfactants such as stearyl anolamine, sodium lauryl sulfate, aminopropionic acid, in, benzalkonium chloride, onium chloride, glycerin monostearate and the like; hydrophilic polymers such as polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose sodium, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose and the like; rbates, and polyoxyethylene hydrogenated castor oil.
Preferable examples of the isotonization agents include sodium chloride, glycerin, D—mannitol, D-sorbitol, and glucose.
Preferable examples of the buffering agent include buffer solutions such as phosphates, acetates, carbonates, and citrates.
Preferable examples of the soothing agent include benzyl alcohol.
Preferable examples of the preservative include p— hydroxybenzoates, chlorobutanol, benzyl alcohol, phenethyl alcohol, oacetic acid, and sorbic acid.
[0141] Preferable examples of antioxidants include sulfites and ascorbates.
Preferable examples of the colorants include water soluble edible tar dyes (e.g., edible dyes such as Food Red No. 2 and No. 3, Food Yellow No. 4 and No. 5, Food Blue No. l and 2, etc.); water insoluble lake dyes (e.g., aluminum salts of the entioned water soluble edible tar dyes), and natural dyes (e.g., B—carotene, chlorophyll, ferric oxide red).
[0143] Preferable examples of the sweeteners include sodium saccharin, dipotassium glycyrrhizinate, aspartame and stevia.
Examples of the dosage form of the medicament of the present invention include oral ations such as tablet (including sublingual tablet, orally disintegrating tablet), capsule ding soft capsule, apsule), granule, powder, troche, syrup, emulsion, suspension and the like; and parenteral agents such as injection (e.g., subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal ion, drip infusion), external preparation (e.g., dermal preparation, nt), suppository (e.g., rectal suppository, l suppository), pellet, nasal preparation, pulmonary ation (inhalant), eye drop and the like, which can be respectively safely administered orally or parenterally.
These preparations may be a release control preparation (e.g., sustained—release microcapsule) such as an immediate— release preparation, a ned—release preparation and the like.
The medicament of the present invention can be manufactured by the common methods in the field of formulation technology, for example, methods listed in the Japanese Pharmacopoeia, and the like.
The t of the compound of the t invention in the medicament of the present invention varies based on the dosage forms, dosages of the compound of the present invention, and the like. For e, it is approximately about 0.1 to 100 wt%.
The nd of the present invention has a superior LSD1 inhibitory action and can be used as a prophylactic or therapeutic agent for various diseases in mammals (e.g., human, mouse, rat, rabbit, dog, cat, bovine, horse, swine, monkey).
Moreover, since the compound of the present invention shows low monoamine e A (MAOeA) and monoamine oxidase B (MAO—B) inhibitory activity and high LSD1 selectivity, it causes fewer side effects.
In addition, the compound of the present invention is expected to show, after transfer into the brain, ssion of a se in histone H3K4 methylation and suppression of decrease in Gadl mRNA expression, which are derived from the inhibition of LSD1. As a result, it is also useful as a medicament based on superior actions of nerve activation, enhancement of neural plasticity, promotion of neurogenesis, and promotion of BDNF production.
[0150] The compound of the present invention can be used as a prophylactic or therapeutic agent for cancer. es of the cancer include breast cancer, prostate cancer, pancreatic cancer, gastric cancer, lung cancer, colon cancer, rectal , esophagus cancer, duodenal cancer, tongue cancer, pharyngeal cancer, brain tumor, neurinoma, non—small cell lung cancer, small cell lung , liver , kidney cancer, bile duct cancer, e body cancer, cervical cancer, ovarian cancer, urinary bladder cancer, skin cancer, hemangioma, malignant lymphoma, malignant melanoma, thyroid cancer, bone tumor, vascular fibroma, retinoblastoma, penile cancer, pediatric solid cancer, Kaposi's sarcoma, ’s sarcoma derived from AIDS, maxillary tumor, fibrous histiocytoma, leiomyosarcoma, rhabdomyosarcoma, and leukemia. Among these, the compound can be preferably used for prostate cancer, leukemia, and malignant lymphoma.
It is known that the level of H3K4me2, which is a substrate of LSDl, and memory improvement are correlated (Nature 2007, Vol. 447, page 175), and the compound of the present invention having a or LSDl inhibitory action can also be used as a prophylactic or therapeutic agent for neurodegenerative diseases.
The nd of the present invention can be used as a prophylactic or therapeutic agent for central nervous system diseases. It is useful as a lactic or therapeutic agent for diseases such as (1) psychiatric diseases [e.g., depression, major sion, bipolar depression, dysthymic disorder, emotional disorder (seasonal affective disorder and the like), recurrent depression, postpartum depression, stress er, depression symptom, mania, anxiety, generalized anxiety disorder, anxiety syndrome, panic er, phobia, social phobia, social anxiety disorder, obsessive er, post—traumatic stress syndrome, raumatic stress disorder, Tourette syndrome, autism, fragile X syndrome, Rett syndrome, adjustment disorder, bipolar disorder, neurosis, schizophrenia, chronic fatigue syndrome, anxiety neurosis, compulsive neurosis, panic disorder, epilepsy, y symptom, anxious mental state, emotional ality, cyclothymia, nervous erethism, faint, addiction, low sex drive, attention deficit hyperactivity disorder (ADHD), psychotic major depression, refractory major depression, treatment— resistant depression], (2) neurodegenerative diseases [e.g., Alzheimer’s disease, mer—type senile ia, son’s disease, Huntington’s chorea, multi—infarct dementia, frontotemporal dementia, frontotemporal dementia with sonism, progressive supranuclear palsy, Pick’s syndrome, Niemann—Pick syndrome, corticobasal degeneration, Down’s disease, ar dementia, postencephalitic sonism, dementia with Lewy body, HIV dementia, amyotrophic lateral sclerosis (ALS), motor neurogenesis disease (MND), Creutzfeldt—Jakob disease or prion disease, cerebral palsy, progressive supranuclear palsy, multiple sclerosis], (3) age—related cognition and memory disorders [e.g., age— related memory disorders, senile dementia] (4) sleep disorders [e.g., intrinsic sleep disorders (e.g., psychophysiological insomnia and the like), extrinsic sleep disorder, circadian rhythm disorders (e.g., time zone change syndrome (jet lag), shift work sleep disorder, lar sleep— wake pattern, delayed sleep phase syndrome, advanced sleep phase syndrome, non—24—hour sleep~wake and the like), parasomnia, sleep disorders ated with internal medical or psychiatric er (e.g., chronic obstructive pulmonary disease, Alzheimer’s disease, Parkinson’s disease, cerebrovascular dementia, schizophrenia, depression, anxiety neurosis), stress insomnia, insomnia, iac neurosis, sleep apnea syndrome], (5) respiratory depression caused by anesthetics, traumatic disease, or neurodegenerative disease and the like, (6) tic brain injury, al apoplexy, neurotic anorexia, eating disorder, anorexia nervosa, rexia, other eating disorder, alcohol dependence, alcohol abuse, lic amnesia, alcohol paranoia, alcohol preference, l withdrawal, alcoholic ty, alcohol intoxication, alcoholic jealousy, alcoholic mania, alcohol—dependent psychiatric disorder, alcoholic insanity, pharmacophilia, pharmacophobia, pharmacomania, drug withdrawal, migraine, stress headache, catatonic headache, diabetic athy, obesity, diabetes, muscular spasm, Meniere's e, autonomic ataxia, alopecia, glaucoma, hearing loss, hypertension, cardiac disease, tachycardia, congestive cardiac failure, entilation, bronchial asthma, apnea, sudden infant death syndrome, inflammatory disease, allergic disease, impotence, climacteric disorder, infertility, cancer, immunodeficiency syndrome caused by HIV infection, immunodeficiency syndrome caused by stress, cerebrospinal meningitis, acromegaly, incontinence, metabolic syndrome, osteoporosis, peptic ulcer, irritable bowel syndrome, inflammatory bowel disease, ulcerative colitis, Crohn’s e, stress gastrointestinal disorder, stress vomiting, stress ulcer, diarrhea, constipation, postoperative ileus, and the like.
The compound of the present invention is particularly useful as a prophylactic or eutic agent for diseases such as phrenia, Alzheimer’s e, Parkinson’s disease, Huntington’s chorea and the like.
Since the compound of the present invention has a superior LSDl inhibitory activity and action, it is expected to show a superior treatment effect for the above—mentioned diseases.
The dosage of the compound of the present invention varies depending on the administration subjects, administration routes, target diseases, symptoms, and the like. For example, for oral administration to adult patients with , generally a single dose is about 0.01 to 100 mg/kg body weight, preferably 0.1 to 50 mg/kg body weight, further preferably 0.5 to 20 mg/kg body weight, and this dosage is preferably administered 1 to 3 times daily.
The compound of the t invention can be used in combination with a medicament such as chemotherapeutic agent, immunotherapeutic agent, medicament inhibiting actions of cell growth factor and receptor thereof (hereinafter to be abbreviated as a concomitant drug).
By combining the compound of the present invention and a itant drug, a superior effect such as (1) the dose can be reduced as compared to single stration of the compound of the present invention or a concomitant drug, (2) the drug to be combined with the compound of the present invention can be selected according to the ion of ts (mild case, severe case and the like), (3) the period of treatment can be set longer by selecting a concomitant drug having different action and mechanism from the compound of the present invention, (4) a sustained treatment effect can be designed by selecting a concomitant drug having different action and mechanism from the nd of the present invention, (5) a istic effect can be afforded by a combined use of the compound of the t invention and a concomitant drug, and the like, can be achieved.
[0157] Hereinafter the compound of the present invention and a concomitant drug used in combination are referred to as the “combination agent of the present invention”.
When using the combination agent of the present invention, the administration time of the compound of the present invention and the concomitant drug is not restricted, and the compound of the present invention or a pharmaceutical composition thereof and the concomitant drug or a pharmaceutical composition thereof can be administered to an administration subject simultaneously, or may be administered at different times. The dosage of the concomitant drug may be determined ing to the dose clinically used, and can be appropriately selected depending on an administration subject, administration route, e, combination and the like.
The administration mode of the combination agent of the present invention is not particularly restricted, and it is sufficient that the nd of the present invention and the concomitant drug are combined in administration. Examples of such administration mode include the following methods: (1) administration of a single preparation obtained by simultaneously processing the compound of the present invention and the concomitant drug, (2) aneous administration of two kinds of preparations of the compound of the present invention and the concomitant drug, which have been separately produced, by the same administration route, (3) administration of two kinds of preparations of the compound of the present invention and the itant drug, which have been tely produced, by the same administration route in a staggered manner,.(4) simultaneous administration of two kinds of ations of the compound of the present invention and the conComitant drug, which have been separately produced, by different administration routes, (5) administration of two kinds of preparations of the compound of the present invention and the concomitant drug, which have been tely produced, by different administration routes in a staggered manner (e.g., administration in the order of the compound of the t invention and the concomitant drug, or in the reverse order) and the like.
The dose of the itant drug can be riately determined based on the dose employed in clinical situations.
The mixing ratio of the compound of the present invention and a concomitant drug on can be appropriately determined depending the administration subject, administration route, target disease, symptom, combination and the like.
For example, the content of the compound of the present invention in the ation agent of the present invention differs depending on the form of a ation, and usually from about 0.01 to about 100 wt%, preferably from about 0.1 to 0.5 to about 20 about 50 wt%, further preferably from about wt%, based on the preparation.
The content of the itant drug in the combination of the t ion differs depending on the form of agent a preparation, and usually from about 0.01 to about wt%, preferably from about 0.1 to about 50 wt%, further preferably from about 0.5 to about 20 wt%, based on the ation.
The content of additives such as a carrier and the like in the combination agent of the present invention differs depending on the form of a preparation, and usually from about 1 to about 99.99 wt%, preferably from about 10 to about 90 wt%, based on the preparation.
When the compound of the present invention and a concomitant drug are separately formulated into preparations, the contents thereof are similar to the above.
Examples of the chemotherapeutic agent include alkylating agents (e.g., nitrogen mustard, en deN—oxide hydrochloride, chlorambutyl, hosphamide, ifosfamide, thiotepa, carboquone, improsulfan tosylate, busulfan, nimustine hloride, mitobronitol, lan, dacarbazine, ranimustine, estramustine phosphate sodium, triethylenemelamine, carmustine, lomustine, streptozocin, pipobroman, etoglucid, carboplatin, cisplatin, miboplatin, nedaplatin, oxaliplatin, altretamine, ambamustine, dibrospidium hydrochloride, fotemustine, prednimustine, pumitepa, ribomustin, temozolomide, treosulphan, trophosphamide, zinostatin stimalamer, adozelesin, cystemustine, bizelesin), metabolic antagonists (e.g., mercaptopurine, 6—mercaptopurine riboside, thioinosine, methotrexate, pemetrexed, enocitabine, cytarabine, cytarabine ocfosfate, ancitabine hydrochloride, S—FU drug (e.g., fluorouracil, tegafur, UFT, doxifluridine, carmofur, gallocitabine, emitefur, capecitabine), aminopterine, nelzarabine, leucovorin calcium, tabloid, butocine, folinate calcium, levofolinate calcium, cladribine, emitefur, abine, gemcitabine, ycarbamide, pentostatin, piritrexim, idoxuridine, mitoguazone, thiazophrine, stine, bendamustine), antitumor otics (e.g., actinomycin D, actinomycin C, mitomycin C, chromomycin A3, bleomycin hydrochloride, bleomycin sulfate, peplomycin sulfate, daunorubicin hydrochloride, bicin hydrochloride, aclarubicin hydrochloride, pirarubicin hydrochloride, icin hydrochloride, neocarzinostatin, mithramycin, sarcomycin, carzinophilin, ne, zorubicin hydrochloride, mitoxantrone hydrochloride, idarubicin hydrochloride) and plant—derived antitumor agents (e.g., etoposide, etoposide phosphate, vinblastine sulfate, vincristine e, vindesine sulfate, teniposide, paclitaxel, docetaxel, vinorelbine).
Examples of the immunotherapeutic agent include picibanil, krestin, schizophyllan, lentinan, ubenimex, interferon, interleukin, macrophage colony ating factor, granulocyte ‘ colony stimulating factor, opoietin, lymphotoxin, BCG vaccine, corynebacterium parvum, levamisole, polysaccharide K, procodazole and TLA4 antibody.
Examples of the “medicament inhibiting actions of cell growth factor and receptor thereof” include anti—VEGF antibody (e.g., Bevacizumab), anti-HERZ dy (e.g., Trastuzumab, Pertuzumab), anti—EGFR antibody (e.g., Cetuximab, Panitumumab, mab, Nimotuzumab), anti—VEGFR antibody, anti—HGF antibody, Imatinib mesylate, Erlotinib, Gefitinib, Sorafenib, Sunitinib, Dasatinib, Lapatinib, Vatalanib, 4—(4~fluoro—2~methyl—lH—indol— y)—6—methoxy—7—[3—(l—pyrrolidinyl)propoxy]quinazoline 17l), Lestaurtinib, Pazopanib, inib, Tandutinib, 3— (4—bromo—2,6-difluorobenzyloxy)—5—[3—[4—(l— pyrrolidinyl)butyl]ureido]isothiazole—4—carboxamide (GP—547632), Axitinib, N—(3,3—dimethyl—2,3—dihydro-lH—indol—6-yl)—2— (pyridin—4—ylmethylamino)pyridine—3—carboxamide (ANS—706), Nilotinib, 6—{4—(4—ethylpiperazin—l—ylmethyl)phenyl]~N—[l(R)— phenylethyl]—7H—pyrrolo[2,3~d]pyrimidin—4—amine (AEE-788), anib, olimus, Everolimus, Enzastaurin, N—[4—[4—(4— methylpiperazin—l—yl)—6~(3'methyl-lH—pyrazol—5— ylamino)pyrimidin—Z—ylsulfanyl]phenyl]cyclopropanecarboxamide (VX—680), 2—[N—[3—[4~[5—[N—(3—fluorophenyl)carbamoylmethyl]~1H~ pyrazol—3—ylamino]quinazolin—7—yloxy]propyl]—N—ethylamino]ethyl phosphate (AZD—llBZ), 4—[9~chloro—7—(2,6—difluorophenyl)—5H— primido[5,4—d][2Jbenzazepin—2—ylamino]benzoic acid 054), N—[2—methoxy—5—[(E)—2—(2,4,6— trimethoxyphenyl)vinylsulfonylmethyl]phenyl]glycine sodium salt (ON—l9lONa), 4-[8—cyclopentyl—7(R)—ethyl—5—methyl—6—oxo- 5,6,7,8—tetrahydropteridin—2—ylamino]~3—methoxy—N—(l— methylpiperidin~4—yl)benzamide (BI—2536), 5—(4ebromo—2— chlorophenylamino)—4~fluoro—l~methyl—lH—benzimidazole—6— carbohydroxamic acid 2~hydroxyethyl ester (AZD—6244), N— [2(R),3—dihydroxypropoxy]—3,4—difluoro—2~(2—fluoro—4— iodophenylamino)benzamide (PD—0325901) and everolimus (RADOOl).
Examples of the concomitant drug for the l nervous system diseases include the following. benzodiazepine (chlordiazepoxide, diazepam, potassium clorazepate, lorazepam, clonazepam, alprazolam etc.), L—type calcium channel inhibitor (pregabalin etc.), tricyclic or yclic antidepressant (imipramine hydrochloride, amitriptyline hydrochloride, desipramine hydrochloride, clomipramine hydrochloride etc.), selective serotonin reuptake inhibitor (fluvoxamine maleate, fluoxetine hydrochloride, citalopram hydrobromide, sertraline hloride, paroxetine hydrochloride, escitalopram oxalate etc.), serotonin— noradrenaline reuptake inhibitor (venlafaxine hydrochloride, duloxetine hydrochloride, desvenlafaxine hydrochloride etc.), noradrenaline reuptake inhibitor (reboxetine mesylate etc.), mirtazapine, one hydrochloride, nefazodone hloride, bupropion hloride, setiptiline maleate, 5—HTm_agonist, (buspirone hydrochloride, tandospirone citrate, osemozotan hydrocloride etc.), 5-HT3 nist (cyamemazine etc.), non— cardioselective B blocker (propranolol hydrochloride, oxprenolol hydrochloride etc.), ine H1 nist (hydroxyzine hydrochloride etc.), therapeutic drug for schizophrenia (chlorpromazine, haloperidol, sulpiride, clozapine, trifluoperazine hydrochloride, fluphenazine hydrochloride, olanzapine, quetiapine fumarate, risperidone, aripiprazole etc.), CRF antagonist, other antianxiety drug (meprobamate etc.), tachykinin antagonist (MK-869, saredutant etc.), medicament that acts on metabotropic glutamate receptor, CCK antagonist, B3 adrenaline antagonist gron hydrochloride etc.), GAT~1 inhibitor (tiagabine hydrochloride etc.), N~type m l inhibitor, carbonic anhydrase II inhibitor, NMDA glycine site agonist, NMDA antagonist (memantine etc.), peripheral benzodiazepine receptor agonist, vasopressin antagonist, vasopressin Vlb antagonist, vasopressin Vla antagoniSt, odiesterase inhibitor, opioid antagonist, opioid agonist, e, nicotinic acid receptor agonist, d hormone (T3, T4), TSH, TRH, MAO inhibitor (phenelzine sulfate, tranylcypromine sulfate, moclobemide etc.), 5—HT2A antagonist, 5—HTE inverse agonist, COMT inhibitor (entacapone etc.), therapeutic drug for bipolar disorder (lithium carbonate, sodium valproate, lamotrigine, riluzole, felbamate etc.), cannabinoid CB1 antagonist (rimonabant etc.), FAAH inhibitor, sodium channel inhibitor, anti—ADHD drug (methylphenidate hydrochloride, methamphetamine hydrochloride etc.), therapeutic drug for alcoholism, therapeutic drug for autisma, therapeutic drug for chronic fatigue me, therapeutic drug for spasm, therapeutic drug for fibromyalgia syndrome, eutic drug for headache, therapeutic drug for insomnia (etizolam, zopiclone, triazolam, zolpidem, ramelteon, indiplon etc.), therapeutic drug for ng smoking, therapeutic drug for myasthenia gravis, therapeutic drug for cerebral infarction, therapeutic drug for mania, therapeutic drug for hypersomnia, therapeutic drug for pain, therapeutic drug for dysthymia, therapeutic drug for autonomic ataxia, therapeutic drug for male and female sexual dysfunction, therapeutic drug for migraine, therapeutic drug for pathological r, therapeutic drug for ss legs syndrome, therapeutic drug for substance addiction, therapeutic drug for alcohol—related syndrome, therapeutic drug for irritable bowel syndrome, therapeutic drug for Alzheimer’s e (donepezil, galanthamine, memantine etc.), therapeutic drug for Parkinson’s disease, therapeutic drug for ALS ole etc., neurotrophic factor etc.), eutic drug for lipid ality such as cholesterol—lowering drug (statin series (pravastatin sodium, atrovastatin, simvastatin, rosuvastatin etc.), fibrate (clofibrate etc.), squalene synthetase inhibitor), therapeutic drug for abnormal behavior or suppressant of dromomania due to dementia (sedatives, antianxiety drug etc.), apoptosis inhibitor, antiobesity drug, therapeutic drug for diabetes, therapeutic drug for hypertension, therapeutic drug for nsion, therapeutic drug for rheumatism (DMARD), anti— cancer agent, therapeutic drug for parathyroid (PTH), calcium or antagonist, sex hormone or a derivative thereof (progesterone, estradiol, estradiol benzoate etc.), neuronal differentiation promoter, nerve regeneration er, non— steroidal anti—inflammatory drug (meloxicam, tenoxicam, indomethacin, ibuprofen, celecoxib, rofecoxib, aspirin, indomethacin etc.), steroid (dexamethasone, cortisone acetate etc.), anti—cytokine drug (TNF inhibitor, MAP kinase inhibitor etc.), antibody medicament, nucleic acid or nucleic acid derivative, aptamer drug, and the like.
The above—mentioned concomitant drug may be used in a combination of two or more kinds at an appropriate ratio.
When the compound of the present invention is used in combination with a concomitant drug, the respective dosages can be d within a safe range in consideration of the opposite effects of the respective drugs. As a result, the opposite effect caused by these agents can be prevented safely.
The nd of the present invention can also be used in combination with a non-medication therapy. Specific examples of the non—medication therapy e (1) operation; (2) hypertensive chemical therapy using angiotensin II and the like; (3) gene therapy; (4) hermic therapy; (5) cryotherapy; (6) laser ablation method; (7) radiation therapy; and (8) immunotherapy.
The production method of compound (I) of the present invention is explained in the following.
Compound (I) of the present invention can be produced, for example, ing to the method shown in the following reaction scheme or a method ous o and the like.
The compounds in the schemes may form.a salt, and examples of such salt include those similar to the aforementioned salts of compound (I).
While the compounds obtained in each step can be directly used for the next reaction in the form of a reaction mixture or as a crude product, they can be isolated and purified from a on mixture according to a tionally known method such as concentration, extraction, recrystallization, distillation, chromatography and the like.
In addition, the compound obtained in each step may be used after optical resolution by a known means such as chiral column chromatography, optical fractional crystallization, diastereomer derivatization and the like.
The outline of each reaction scheme is shown below, wherein each symbol in the compounds is as defined above.
[Production method 1] Compound (I) can be produced by the following production method or a method analogous o. _ R Q1 HZN Q2 R‘J Hg! ACOJ :12 , 2‘ (VII) (1x) ATM (22: Q4 E's” Step 1-5 4 N,Boc: Step 1-6 OQ4 I Step 1—4 03 3 N,Boc (Rifi) O H Step l—ll (x=H ) Y1 wherein each symbol is as defined above, and J is a halogen atom (e.g., F, Cl, Br, I), p—toluenesulfonyloxy (OTs), methanesulfonyloxy (OMS) or OH.
[0168] [Step 1—1] In this Step, compound (II) is d with ethyl diazoacetate in the presence of a metal catalyst to produce compound (III).
The starting material compound (II) may be a commercially .available product, or can be produced by a method known per [for example, the method described in Synlett 2002, 1137; Journal of Organic Chemistry 2003, 68, 6354; Bioorganic and Medicinal Chemistry 2008, 16, 5452 and the like] or a method analogous thereto.
This on is generally performed in an inert solvent.
The amount of ethyl diazoacetate to be used is generally 1 - 10 molar equivalents relative to compound (II).
Examples of the inert solvent include chloroform, dichloromethane, chloroethane, carbon tetrachloride, tetrahydrofuran, diethyl ether, 1,2—dimethoxyethane, 1,4— dioxane, toluene, benzene, chlorobenzene, cyclohexane, N,N— is dimethylformamide, N,N~dimethylacetamide, acetonitrile and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
Examples of the metal st include copper(I) chloride, copper(II) acetonate, copper(II) trifluoromethanesulfonate, copper(II) e, palladium(II) acetate, palladium(II) de, dirhodium(II) tetraacetate, and the like. Two or more kinds of these metal catalysts may be used in an appropriate ratio.
The amount of the metal catalyst to be used is generally 0.01 — 1 molar equivalent, preferably 0.1 — 0.5 molar equivalent, relative to compound (II).
The on temperature is generally about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[0169] [Step 1—2] In this Step, nd (IV) is produced by subjecting compound (III) to hydrolysis.
This reaction is generally performed in the ce of base, in water or a water—containing solvent.
Examples of the base include sodium ethoxide, sodium ide, sodium hydroxide, lithium hydroxide, potassium hydroxide, barium hydroxide, sodium hydroperoxide and the like.
The amount of the base to be used is lly 1 — 1000 molar equivalents relative to compound (III).
Examples of the t to be used as the water— containing solvent e tetrahydrofuran, methanol, ethanol, isopropanol, l,4—dioxane, N,N—dimethylformamide, N,N— dimethylacetamide, itrile, dimethyl sulfoxide, e and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The reaction temperature is generally about 0 — 100°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[0170] [Step 1~3] In this Step, compound (IV) is d with diphenylphosphoryl azide and tert—butyl alcohol to produce compound (V).
This reaction is generally performed in the presence of a base in an inert solvent or an excess amount of tert~butyl alcohol.
Examples of the base include triethylamine, ropylethylamine, l,8—diazabicyclo[5.4.0]undec—7—ene, potassium carbonate, cesium carbonate, potassium tert—butoxide and the like. Among these, triethylamine and diisopropylethylamine are preferable.
The amount of the base to be used is lly 1 - 10 molar equivalents relative to compound (IV).
Examples of the inert solvent include toluene, benzene, xylene, tetrahydrofuran, 1,4—dioxane, N,N—dimethylformamide, N,N—dimethylacetamide, acetonitrile and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The reaction temperature is generally about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 1—4] In this Step, compound (V) is ted to a reduction reaction to e compound (VI).
This reaction is generally performed in the presence of a metal reagent in a water—containing solvent.
Examples of the metal reagent include iron, zinc, nickel, tin, tin(II) chloride and the like.
The amount of the metal reagent to be used is generally 1 - 1000 molar equivalents relative to compound (V).
The ss of this reaction can be accelerated by adding an additive such as calcium chloride, ammonium chloride, sodium e, acetic acid, hydrochloric acid, ine and the like to the reaction “ The amount of such additive to be used is generally not less than 1 molar equivalent relative to compound (V).
Examples of the solvent to be used as a water-containing solvent include methanol, ethanol, isopropanol, tetrahydrofuran, 1,4—dioxane, N,N—dimethylformamide, N,N—dimethylacetamide, acetonitrile and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The reaction temperature is lly about 0 ~ 100°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 1—5] In this Step, compound (VI) is reacted with compound (VII) under basic conditions to produce compound (VIII) (R¢H).
Compound (VII) may be a commercially available product, or can be produced by a method known per se [for example, the method described in “Advanced Organic Chemistry, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. ) and the like] or a method analogous thereto.
The amount of compound (VII) to be used is generally O.l — lO molar equivalents ve to compound (VI).
This reaction is generally med in the presence of a base in an inert solvent.
Examples of the base e triethylamine, diisopropylethylamine, l,8—diazabicyclo[5.4.0]undec—7—ene, potassium carbonate, sodium carbonate, cesium carbonate, potassium tert-butoxide, sodium hydroxide and the like. Among these, triethylamine, diisopropylethylamine and potassium carbonate are preferable.
The amount of such base to be used is generally not less than 1 molar equivalent relative to compound (VI).
Examples of the inert solvent include tetrahydrofuran, 1,4—dioxane, N,N~dimethylformamide, N,N~dimethylacetamide, acetonitrile, dimethyl sulfoxide, acetone, methylene chloride and the like. Two or more kinds of these solvents may be used in an riate ratio.
The reaction temperature is generally about 0 — 150°C.
While the reaction time is not ularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 1—6] In this Step, compound (VIII) is d with compound (IX) to produce compound (X).
Compound (IX) may be a commercially available t, or can be produced by a method known per se [for example, the method described in “Advanced Organic Chemistry, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by d C. Larock) and the like] or a method analogous thereto.
The amount of compound (IX) to be used is generally O.l — lO molar equivalents relative to compound (VIII).
This reaction is generally performed in the presence of a base in an inert t.
Examples of the base include triethylamine, diisopropylethylamine, pyridine, N,N—dimethylaniline, 1,8— diazabicyclo[5.4.0]undec-7—ene, potassium carbonate, sodium carbonate, cesium carbonate, potassium tert—butoxide, sodium ide and the like. Among these, triethylamine and diisopropylethylamine are preferable.
The amount of the base to be used is generally not less than 1 molar equivalent relative to compound (VIII).
Examples of the inert t include tetrahydrofuran, diethyl ether, 1,2—dimethoxyethane, 1,4—dioxane, toluene, benzene, , N,N—dimethylformamide, N,N—dimethylacetamide, acetonitrile, ethyl acetate, methylene chloride and the like can be mentioned. Two or more kinds of these solvents may be used in an appropriate ratio.
When a carboxylic acid is used as compound (IX), the on can be accelerated by adding a condensing agent in the reaction system.
Examples of the condensing agent include l—ethyl—l—(3— ylaminopropyl)carbodiimide hydrochloride, 1,3— dicyclohexylcarbodiimide, diethyl hosphate, ylphosphoryl azide, l,l’—carbonyldiimidazole, benzotriazol—l—yloxytripyrrolidinophosphonium hexafluorophosphate, O—(benzotriazol~l—yl)—N,N,N’,N’~ tetramethyluronium hexafluorophosphate, O—(7—azabenzotriazol~l— yl)—N,N,N’,N’ftetramethyluronium hexafluorophosphate and the like.
The amount of the condensing agent to be used is generally 1 — lO molar lents relative to compound (VIII).
In this reaction, a suitable condensation accelerator (e.g., l—hydroxybenzotriazole, N~hydroxysuccinimide, N,N- dimethyl—4—aminopyridine etc.) can be used as necessary.
The amount of the condensation accelerator to be used is generally 0.1 — lO molar equivalents relative to compound (VIII).
The reaction temperature is generally about 0 — 150°C.
While the reaction time is not ularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 1—7] In this Step, compound (VI) is reacted with compound (IX) to produce compound (X) (R=H).
This on can be carried out in the same manner as in the aforementioned Step 1—6.
[Step 1—8] In this Step, compound (X) is subjected to a reaction for removal of a tert—butoxycarbonyl group to produce compound (XI).
This reaction is lly performed in the presence of an acid in an inert solvent or an excess amount of an acid.
Examples of the acid include trifluoroacetic acid, hydrochloric acid, romic acid, sulfuric acid, hydrofluoric acid and the like. Among these, hydrochloric acid and trifluoroacetic acid are preferable.
The amount of the acid to be used is generally 1 ~ 1000 molar equivalents relative to compound (X).
Examples of the inert solvent include methanol, ethanol, isopropanol, water, methylene de, toluene, benzene, xylene, ydrofuran, 1,4—dioxane, N,N—dimethylformamide, N,N—dimethylacetamide, acetonitrile and the like. Two or more kinds of these ts may be used in an riate ratio.
The reaction ature is generally about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 1—9].
In this Step, compound (X1) is reacted with compound (XII) under basic conditions to produce compound (XIII) (XiH).
Compound (XII) may be a commercially available product, or can be produced by a method known per se [for example, the method described in “Advanced Organic Chemistry, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous thereto.
The amount of compound (XII) to be used is generally 0.1 — 10 molar equivalents relative to compound (XI).
This reaction is generally performed in the ce of a base in an inert solvent.
Examples of the base e ylamine, diisopropylethylamine, l,8—diazabicyclo[5.4.0]undec—7—ene, potassium carbonate, sodium carbonate, cesium carbonate, potassium.tert—butoxide, sodium ide and the like. Among these, triethylamine, diisopropylethylamine and potassium carbonate are preferable.
The amount of the base to be used is lly not less than 1 molar equivalent ve to compound (XI).
Examples of the inert solvent include tetrahydrofuran, 1,4—dioxane, N,N—dimethy1formamide, N,N~dimethylacetamide, acetonitrile, dimethyl sulfoxide, acetone, methylene chloride and the like. Two or more kinds of these ts may be used in an appropriate ratio.
The reaction temperature is generally about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 ~ 72 hr.
[Step 1—10] In this Step, compound (XIII) is reacted with compound (XIV) under basic conditions to produce nd (I).
Compound (XIV) may be a commercially available product, or can be produced by a method known per se [for example, the method bed in “Advanced Organic Chemistry, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous thereto.
The amount of compound (XIV) to be used is generally 0.1 ~ 10 molar equivalents relative to compound (XIII).
This reaction is generally performed in the presence of a base in an inert solvent.
Examples of the base include triethylamine, diisopropylethylamine, l,8-diazabicyclo[5.4.0]undec—7—ene, potassium carbonate, sodium carbonate, cesium ate, potassium tert—butoxide, sodium hydroxide and the like. Among these, triethylamine, diisopropylethylamine and potassium carbonate are preferable.
The amount of the base to be used is generally not less than 1 molar equivalent relative to nd (XIII).
Examples of the inert solvent include tetrahydrofuran, 1,4—dioxane, N,N~dimethylformamide, N,N—dimethylacetamide, acetonitrile, dimethyl sulfoxide, acetone, methylene chloride and the like. Two or more kinds of these solvents may be used in an riate ratio.
The reaction temperature is generally about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 ~ 100 hr, preferably 0.5 ~ 72 hr.
Compound (I) can also be produced by one step from compound (XI) without via compound (XIII).
[0178] [Step 1—11] In this Step, compound (XI) is d with nd (XIV) under basic conditions to produce compound (I) (X=H).
This reaction can be carried out in the same manner as in the aforementioned Step l~lO.
[Step 1—12] In this Step, compound (XI) is reacted with compound (XV) in the presence of a ng agent to produce compound (Ia).
Compound (Ia) is compound (I) n Y1=H. Compound (Ia) is encompassed in compound (I).
Compound (XV) may be a commercially ble product, or can be produced by a method known per se [for example, the method described in “Advanced Organic Chemistry, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous thereto.
The amount of compound (XV) to be used is generally 0.1 — molar equivalents relative to compound (XI).
This on is generally performed in the ce of a reducing agent in an inert solvent.
Examples of the reducing agent include sodium triacetoxyborohydride, sodium cyanoborohydride, sodium borohydride, 2—picoline borane complex and the like.
The amount of the reducing agent to be used is generally 1 — 10 molar equivalents relative to compound (XI).
Examples of the inert t include tetrahydrofuran, methanol, ethanol, isopropanol, 1,4—dioxane, N,N— dimethylformamide, N,Nedimethylacetamide, acetonitrile, methylene chloride, acetic acid, water and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The reaction temperature is generally about 0 - 150°C.
While the reaction time is not particularly limited, it is generally 0.1 - 100 hr, preferably 0.5 ~ 72 hr.
Compound (X1) is reacted in advance with compound (XV) in the presence of a dehydrating agent (titanium(IV) isopropoxide, sodium hydrogen carbonate, sodium sulfate, magnesium sulfate, molecular sieve etc.) to produce enamine, which is reacted with a ng agent to produce the object compound (Ia).
[Step 1—13] In this Step, nd (XIII) is reacted with compound (XV) in the presence of a reducing agent to produce compound (Ia).
This on can be carried out in the same manner as in the entioned Step 1-12. nd (Ia) can also be produced by one step from compound (XI) without via compound (XIII).
[0181] [Production method 2] Compound (XI) can also be produced by the following production method or a method analogous o.
/ Step 2—3 (R=H) \ Q1 3%23 R Q1 R Q1 1 R Q1 _ z HN Q2 RJ . ACOJ 1 Q2 I 2 \ ”N N 02 I (v11) (IX) A \ (XIX) ATN 0222 / l Q4 L1 0 / Step 2—1 Q4 [1 Step 2—2 0 / 4 1 Step 2—4 Ql. Z3 Q L w m¢m @ 03 m z1 (XVI) (XVII) ) (XX) ‘ Q‘ *3 0‘ F5 0‘ A N Q2 A N m A N m T Z1 1: Z1 Z1 8tep 2-7 1'" Step 2_5 04 SteP 2—6 Q4 Q 000a COOH Q3 Q3 03 fifioc Z:3 Z2 23 22 Z3 22 am) awn amm 1 Q A E Q2 . T 21 Step 2—8 004 (XI) wherein each symbol is as defined above, J is a halogen atom (e.g., F, Cl, Br, I), OTs, OMS or OH, and L1 and L2 are each independently H) Cl, Br, I, trifluoromethanesulfonyloxy (OTf), 9—BBN u) B(OH)2, BEgK, B(—OCMe2CMeZO~)) or a group.
[Step 2—1] In this Step, compound (XVI) is reacted with compound (VII) under basic conditions to produce nd (XVII) (RiH).
This reaction can be carried out in the same manner as in the aforementioned Step 1—5.
[Step 2—2] In this Step, compound (XVII) is reacted with compound (IX) to produce compound (XVIII).
This reaction can be carried out in the same manner as in the aforementioned Step 1—6.
[Step 2—3] In this Step, compound (XVI) is d with compound (IX) to e compound (XVIII) (R=H).
This reaction can be carried out in the same manner as in the aforementioned Step 1—6.
[Step 2—4] In this Step, compound (XVIII) is coupled with vinyl compound (XIX) in the presence of a metal catalyst to produce compound (XX).
Vinyl compound (XIX) may be a commercially available' product, or can be produced by a method known per se [for e, the method described in Synlett 2002, 1137; Journal of Organic Chemistry 2003, 68, 6354; Bioorganic and Medicinal i5 Chemistry 2008, 16, 5452 and the like] or a method analogous thereto.
This reaction is generally performed in an inert solvent.
This reaction is performed under microwave irradiation where necessary.
The amount of compound (XIX) to be used is generally 0.1 — 10 molar equivalents relative to compound ). es of the inert solvent include water, methanol, ethanol, chloroform, dichloromethane, 1,2—dichloroethane, carbon tetrachloride, tetrahydrofuran, l ether, 1,2— dimethoxyethane, oxane, toluene, xylene, benzene, chlorobenzene, N,N—dimethylformamide, N,N—dimethylacetamide, 1— methylpiperidone, acetonitrile, dimethyl sulfoxide and the like.
Two or more kinds of these solvents may be used in an appropriately ratio.
Examples of the metal catalyst include palladium(II) acetate, ium(II) chloride, tris(dibenzylideneacetone)dipalladium(0), bis(acetylacetonato)palladium(II), nickel(II) chloride, copper(I) chloride, copper(I) acetate and the like. Two or nmre kinds of these metal catalysts may be used in appropriately ratio.
The amount of the metal catalyst to be used is generally 0.001 — 1 molar equivalent, preferably 0.01 — 0.5 molar equivalent, relative to compound ).
The reaction can be accelerated by adding an appropriate ligand to the metal catalyst.
Examples of the ligand include triphenylphosphine, tri(o— tolyl)phosphine, tri(tert—butyl)phosphine, 1,1’— phenylphosphino)ferrocene, 2,2’—bis(diphenylphosphino)— l,1’—binaphthyl and the like. A complex of the ligand with the aforementioned metal catalyst may be prepared in advance and used, or a commercially available complex already prepared may also be used.
The amount of the ligand to be used is generally 0.001 ~ 2 molar equivalents, preferably 0.01 — 1 molar equivalent, relative to compound (XVIII).
The reaction temperature is generally about 0 — 200°C.
While the reaction time is not particularly limited, it is generally 0.01 — 100 hr, preferably 0.1 — 72 hr.
[0188] [Step 2~5] In this Step, compound (XX) is d with ethyl diazoacetate in the ce of a metal catalyst to produce compound.(XXI).
This reaction can be carried out in the same manner as in the aforementioned Step 1—1.
[Step 2—6] In this Step, nd (XXI) is subjected to hydrolysis to produce compound (XXII).
This reaction can be carried out in the same manner as in the entioned Step 1—2.
[Step 2—7] In this Step, compound (XXII) is reacted with diphenylphosphoryl azide and utyl alcohol to produce compound (XXIII).
This reaction can be carried out in the same manner as in the aforementioned Step 1—3.
[0191] [Step 2—8] In this Step, compound (XXIII) is ted to a reaction for removal of a tert—butoxycarbonyl group to produce compound (XI).
This reaction can be d out in the same manner as in the aforementioned Step 1—8.
[Production method 3] Compound (Ic) which is compound (I) wherein X is a group represented by wherein Y4 and Y5 are each independently a hydrogen atom, a m) hydrocarbon group optionally having substituent(s), or a cyclic group optionally having substituent(s), and Y4 and Y5 are optionally bonded to each other to form a ring optionally having substituent(s), can be produced by the following production method or a method analogous thereto. Compound (Ib) is compound (I) wherein X=H.
Compounds (Ib) and (Ic) are encompassed in compound (I). 4 2 R Q1 0=<Y 6 Q1 l O=<Y 1 ATN Q12 5 A N Q2 Y; i]? Q 1 \n/ 1 A N 2 Y Q2 (XV) Z H (XV) O kY2 0 Y2 T 1 a4 ———> Z 3 o4 X 3 0 N Y N Y 04 Q3 r tep 3—2 Step 3~1 Q3 3 2 3 Z2 \7‘Y“ NHZ Z Z Z Q3 Y (Y2=Y4l Y3=Y5) 23 22 (lb) (10) (X1) wherein each symbol is as defined above, and J is a halogen atom (e.g., F, Cl, Br, I), OTs, OMS or OH.
[Step 3~l] In this Step, compound (Ib) is reacted with compound (XV) in the ce of a reducing agent to produce compound (Ic).
Compound (XV) may be a commercially available product, or can be ed by a method known per se [for e, the method described in “Advanced Organic try, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous thereto.
This reaction can be carried out in the same manner as in the aforementioned Step 1—12.
[Step 3—2] In this Step, compound (XI) is reacted with nd (XV) in the presence of a reducing agent to produce compound (Ic).
Compound (XV) may be a commercially available product, can be produced by a method known per se [for e, the method described in “Advanced Organic Chemistry, 4th Ed.” (by Jerry March), “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous 'thereto.
This reaction can be carried out in the same manner as in the aforementioned Step 1—12.
[Production method 4] Compound (Ib) which is compound (I) wherein X=H can also be produced by the following production method or a method analogous thereto. Compound (Id) is compound (I) wherein R=H, X=H. Compounds (Ib) and (Id) are assed in compound (I).
Q1 w H m A N 02 A N Q2 Rd A N Q2 Q4 Q4 4 03 a Y Step 4—1 Q3 ’3 Y3 Q Step 4-2 filXYs 23 z2 z3 22 5°C QB (R ¢ H) 23 22 Boo am WNW «no Step 4—3 1 R Q‘ Aer Q2 a W 4 W 3 wk§3 Z3 22H wherein each symbol is as defined above, and J is a halogen atom (e.g., F, Cl, Br, I), OTs, OMs or OH.
[0202] [Step 4—1] In this Step, compound (Id) is reacted with di—tert—butyl dicarbonate under basic conditions to produce compound (XXIV).
The amount of the t—butyl dicarbonate to be used is generally 0.1 — 10 molar equivalents relative to compound (Id).
This reaction is generally performed in the presence of a base in an inert solvent.
Examples of the base include triethylamine, diisopropylethylamine, 1,8—diazabicyclo[5.4.0]undec—7~ene, i5 potassium ate, sodium carbonate, cesium carbonate, potassium tert~butoxide, sodium hydroxide and the like. Among these, triethylamine, diisopropylethylamine and sodium hydroxide are preferable.
The amount of the base to be used is generally not less than 1 molar equivalent relative to compound (Id).
Examples of the inert solvent include tetrahydrofuran, oxane, N,N~dimethylformamide, methylacetamide, acetonitrile, dimethyl sulfoxide, acetone, methylene de, water and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The on temperature is generally about 0 — 100°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 4-2] In this Step, compound (XXIV) is reacted with compound (VII) under basic conditions to produce compound (XXV) (RiH).
This reaction can be carried out in the same manner as in the aforementioned Step l~5.
[0204] [Step 4—3] In this Step, nd (XXV) is ted to a reaction for removal of a tert—butoxyCarbonyl group to produce compound (Th).
This reaction can be carried out in the same manner as in the aforementioned Step l~8.
[Production method 5] Compound (Ie) which is compound (I) wherein R=H, X=H, §fl=H can also be produced by the following production method or a method analogous thereto. Compound (Ie) is encompassed in nd (I).
TTDC Q1 True ()1 =<Y2 Trot: Q‘ 31:?q? HN 02 HN Q2 =<Y3 ”N 02 Z1 Z1 Z1 Z1 NJ30cSte Q: 04 0‘ p 5—l 03 Step 5—2 Q I“:Ste 5--3 03 2H2 p (4X; (XXVII)Z z3 z2H - (XXVIII) Tmc Q1 Q1 HN Q2 HzN Q12 H ACOJ [\ ATN 02 21 H Z H (14Y2_._____,Q4 / XY: ____E__)__.[X Z1 Step 5—4 2Y2 Q3 3Step 55 Q: ’3 Y Step 5—6 N Y3 23 ZzBocY 23 735°C Q3 23 2280:: (XXI (XXX) (XXXI) A H Q2 T 21 H oQ4 Y2 Step 5-7 N Y3 23 22 (59)
[0207] wherein each symbol is as defined above, J is a halogen atom (e.g., F, Cl, Br, I), OTs, OMs or OH, and Troc is 2,2,2— trichloroethoxycarbonyl.
[Step 5—1] In this Step, compound (VI) is reacted with 2,2,2— trichloroethyl chloroformate under basic conditions to produce compound (XXVI).
The amount of the 2,2,2—trichloroethyl chloroformate to be used is generally O.l — lO molar equivalents ve to compound (VI).
This reaction is generally performed in the presence of a base in an inert solvent; Examples of the base include triethylamine, ropylethylamine, l,8—diazabicyclo[5.4.0]undec—7—ene, potassium carbonate, sodium carbonate, cesium carbonate, potassium tert—butoxide, sodium hydroxide and the like. Among these, triethylamine, diisopropylethylamine and potassium carbonate are preferable.
The amount of the base to be used is lly not less than 1 molar equivalent relative to compound (VI).
Examples of the inert solvent include tetrahydrofuran, l,4—dioxane, N,N~dimethylformamide, N,N—dimethylacetamide, acetonitrile, dimethyl sulfoxide, e, methylene de and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The reaction temperature is generally about 0 — 150°C.
While the reaction time is not particularly d, it is generally 0.1 — 100 hr, preferably 0.5 ~ 72 hr.
[0209] [Step 5—2] In this Step, nd (XXVI) is subjected to a reaction for removal of a tert—butoxycarbonyl group to produce compound (XXVII).
This reaction can be carried out in the same manner as in the aforementioned Step 1—8.
[Step 5—3] In this Step, compound ) is reacted with nd (XV) in the presence of a reducing agent to produce compound (XXVIII).
This reaction can be carried out in the same manner as in the aforementioned Step 1—12.
[Step 5—4] In this Step, compound (XXVIII) is d with di—tert— butyl onate under basic conditions to produce compound (XXIX) .
This reaction can be carried out in the same manner as in the aforementioned Step 4—1.
[Step 5—5] In this Step, compound (XXIX) is subjected to a reaction for removal of a 2,2,2—trichloroethoxycarbonyl group to produce compound (XXX).
This reaction is generally performed in the presence of an acid and a metal t in a polar solvent.
Examples of the acid include acetic acid, citric acid, trifluoroacetic acid, hydrochloric acid, hydrobromic acid and the like. Among these, acetic acid is preferable.
The amount of the acid to be used is generally 1 — 1000 molar equivalents relative to compound (XXIX).
Examples of the metal reagent include zinc, iron, tin, cadmium and the like. Among these, zinc is preferable.
The amount of the metal reagent to be used is generally 1 ~ 1000 molar equivalents ve to compound (XXIX).
Examples of the polar solvent include water, methanol, ethanol, isopropanol, tetrahydrofuran, 1,4—dioxane, N,N— dimethylformamide, N,N—dimethylacetamide, acetonitrile, yl sulfoxide, acetic acid, trifluoroacetic acid and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
The reaction temperature is lly about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 — 72 hr.
[Step 5—6] In this Step, compound (XXX) is reacted with compound (IX) to produce compound (XXXI).
This reaction can be carried out in the same manner as in the aforementioned Step 1~6.
[Step 5—7] In this Step, compound (XXXI) is subjected to a reaction for l of a utoxycarbonyl group to produce compound (Ie).
This reaction can be carried out in the same manner as in the aforementioned Step 1—8.
[Production method 6] Compound (If) which is compound (I) wherein A—CON(R)— is a group represented by
[0217] wherein R1 and R2 are each independently an optionally fused hydrocarbon group optionally having tuent(s), E is a methylene group optionally having substituent(s) or a carbonyl group, and m and n are each independently an integer of 0 to 3, and Y4=H can also be produced by the following production method or a method analogous o. Compound (If) is assed in compound (I).
R1 m ,J1 E 1 i R1 E"! R1 Q1 R2 )n m R2 ’v.’ Q1 R2 E Q1 HzN (22 0 J2 ( R Q: ,3 Q2 Z‘I H 2 n (XXXH) 21 H n 21 H Q4 Y3 °Q4 Y: —"'—"' ’ OQ‘ XYZ Q: N Y Step 6-1 03 g Y6 Step 6—2 03 y Y3 23 Z23” 23 2280:: Z: ZzBoc (XXXHD (XXXIV) R1 E'OH 1 Step 6—5 Wm 1 R1 R2 R2 Q H m n o N 02 Step R2 s Q‘ (XXXV) n Z1 H Y2 6’4 N 0.2 054 " 3 Z1 H 03 I? Y O Q4 XY2 ZS 2280:: N Y3 (XXXVI) 23 22 wherein each symbol is as defined above, andJl and J2 are each ndently a halogen atom (e.g., F, Cl, Br, I), OTs, OMs or [Step 6~1] In this Step, compound (XXX) is reacted with compound (XXXII) to produce compound (XXXIII).
Compound (XXXII) may be a commercially available product, or can be produced by a method known per se [for example, the method described in “Advanced Organic try, 4th Ed.” (by Jerry , “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous thereto.
This reaction can be carried out in the same manner as in the aforementioned Step 1—6.
[0221] [Step 6—2] In this Step, compound (XXXIII) is cyclized to produce compound (XXXIV).
This reaction is generally performed in the ce of a base in an inert solvent.
Examples of the base include triethylamine, diisopropylethylamine, azabicyclo[5.4.0]undec—7—ene, potassium carbonate, sodium carbonate, cesium carbonate, potassium.tert—butoxide, sodium hydroxide and the like. Among these, triethylamine, diisopropylethylamine, and potassium carbonate are preferable.
The amount of the base to be used is generally not less than 1 molar equivalent relative to compound (XXXIII).
Examples of the inert solvent include tetrahydrofuran, l,4—dioxane, N,N—dimethylformamide, N,N-dimethylacetamide, acetonitrile, dimethyl sulfoxide, acetone, methylene chloride and the like. Two or more kinds of these solvents may be used in an appropriate ratio.
When carboxylic acid (E=CO, J1=OH) is used as compound (XXXIII), the reaction can be accelerated by adding a condensing agent to the reaction .
Examples of the condensing agent e l—ethyl-l—(B— dimethylaminopropyl)carbodiimide hydrochloride, 1,3— dicyclohexylcarbodiimide, diethyl cyanophosphate, diphenylphosphoryl azide, l,l’—carbonyldiimidazole, benzotriazol—l—yloxytripyrrolidinophosphonium hexafluorophosphate, zotriazol~l—yl)—N,N,N’,N’— tetramethyluronium hexafluorophosphate, O—(7—azabenzotriazol—l~ N,N',N’~tetramethyluronium hexafluorophosphate and the like.
The amount of the condensing agent to be used is generally 1 — lO molar equivalents ve to compound (XXXIII).
In this reaction, a suitable condensation accelerator (e.g., l—hydroxybenzotriazole, N—hydroxysuccinimide, N,N— dimethyl—4—aminopyridine etc.) can be used as necessary.
The amount of the condensation accelerator to be used is generally 0.1 — lO molar equivalents relative to compound The on temperature is generally about 0 — 150°C.
While the reaction time is not particularly limited, it is generally 0.1 ~ 100 hr, preferably 0.5 — 72 hr.
Compound ) can also be produced by one step from compound (XXX) without via compound (XXXIII).
[Step 6-3] In this Step, compound (XXX) is reacted with compound (XXXV) to produce compound (XXXVI).
Compound (XXXV) may be a commercially available product, or can be produced by a method known per se [for example, the method bed in “Advanced Organic Chemistry, 4th Ed.” (by Jerry , “Comprehensive Organic Transformations, 2nd Ed.” (by Richard C. Larock) and the like] or a method analogous thereto.
This on can be carried out in the same manner as in the entioned Step 1—5.
[Step 6~4] In this Step, compound (XXXVI) is cyclized to produce compound (XXXIV).
This reaction is generally performed in the presence of an acid or sing agent in an inert solvent.
Examples of the acid include hydrochloric acid, hydrobromic acid, acetic acid, p~toluenesulfonic acid, sulfuric acid, pyrophosphoric acid and the like. Among these, hydrochloric acid and p—toluenesulfonic acid are preferable.
The amount of the acid to be used is generally 0.01 - lO molar equivalents relative to compound (XXXVI).
Examples of the inert solvent include tetrahydrofuran, l,4—dioxane, N,N~dimethylformamide, N,N—dimethylacetamide, acetonitrile, dimethyl sulfoxide, acetone, methylene chloride and the like. Two or more kinds of these solvents may be used in an appropriate ratio. es of the condensing agent e acetic anhydride, trifluoroacetic anhydride, p—toluenesulfonyl chloride, Mitsunobu reagent (mixture of dialkyl azodicarboxylate and trialkylphosphine or triarylphosphine), l~ethyl—l—(3— dimethylaminopropyl)carbodiimide hydrochloride, 1,3— dicyclohexylcarbodiimide, l cyanophosphate, diphenylphosphoryl azide, arbonyldiimidazole, benzotriazol—l—yloxytripyrrolidinophosphonium uorophosphate, O—(benzotriazol—l—yl)~N,N,N’,N’- tetramethyluronium hexafluorophosphate, O~(7—azabenzotriazol-l— yl)—N,N,N’,N’—tetramethyluronium hexafluorophosphate and the like.
The amount of the condensing agent to be used is lly 1 ~ 10 molar equivalents relative to compound (XXXVI).
In this reaction, a suitable condensation accelerator (e.g., lehydroxybenzotriazole, N-hydroxysuccinimide, N,N— dimethyl—4—aminopyridine etc.) can be used as necessary.
The amount of the condensation accelerator to be used is generally 0.1 ~ 10 molar equivalents relative to compound The reaction temperature is generally about 0 — 200°C.
While the reaction time is not particularly limited, it is generally 0.1 — 100 hr, preferably 0.5 - 72 hr. nd (XXXIV) can also be produced by one step from compound (XXX) without via compound (XXXVI).
[Step 6—5] In this Step, compound (XXXIV) is subjected to a reaction for removal of a tert—butoxycarbonyl group to produce compound (If).
This reaction can be carried out in the same manner as in the aforementioned Step 1—8.
[0225] It is also possible to produce a compound encompassed in the t invention by further ng substituent' introduction or functional group conversion to compound (I) according to a means known per se. Substituent introduction and functional group conversion are performed according to known conventional methods such as conversion to carboxy group by ester hydrolysis, conversion to carbamoyl group by amidation of carboxy group, conversion to hydroxymethyl group by reduction of carboxy group, conversion to alcohol compound by reduction or alkylation of carbonyl group, reductive amination of carbonyl group, oximation of carbonyl group, acylation, ureation, sulfonylation or alkylation of amino group, amination of ted halogen with amine, sion to amino group by reduction of nitro group, and acylation, carbamation, sulfonylation or tion of hydroxy group. When a reactive substituent causing an unintended reaction during substituent introduction and functional group conversion is present, a protecting group may be introduced in e into the reactive substituent as necessary according to a means known per se, the object reaction is performed and the protecting group is removed according to a means known per se, whereby compounds encompassed in the present invention can be produced.
In each of the above—mentioned reactions, when the ng compounds have an amino group, a yl group, a hydroxy group or a carbonyl group as a substituent, such groups may be protected with the protecting groups generally used in peptide Chemistry, etc. In such case, if necessary, such ting groups can be removed after the reactions to obtain the ive compounds.
Examples of the amino~protecting group include formyl, and Crs alkylcarbonyl (e.g., acetyl, ethylcarbonyl etc.), carbonyl, Cbfi ~carbonyl (e.g., methoxycarbonyl, ethoxycarbonyl, tert~butoxycarbonyl etc.), phenyloxycarbonyl, C740 aralkyl—carbonyl (e.g., benzylcarbonyl etc.), trityl, phthaloyl, N,N—dimethylaminomethylene and the like, each of which optionally has substituent(s). es of the substituent of the “amino—protecting group” include a halogen atom (e.g., fluorine, chlorine, bromine, iodine), Cyfi alkyl— carbonyl (e.g., methylcarbonyl, ethylcarbonyl, butylcarbonyl etc.), a nitro group and the like, wherein the number of the substituents is l to several (e.g., 3).
Examples of the carboxyl—protecting group include a Che alkyl group, a C711 aralkyl group (e.g., benzyl), a phenyl group, a trityl group, a substituted silyl group (e.g., trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert— butyldimethylsilyl, utyldiethylsilyl), a C}fi alkenyl group (e.g., l—allyl) and the like. These groups are ally substituted by l to 3 halogen atoms, a C14 alkoxy group, a nitro group etc.
Examples of the hydroxy—protecting group include a Chg alkyl group, a phenyl group, a trityl group, a C140 aralkyl group (e.g., benzyl), a formyl group, a CL£ alkyl—carbonyl group, a benzoyl group, a C140 l—carbonyl group (e.g., benzylcarbonyl), a 2—tetrahydropyranyl group, a 2— tetrahydrofuranyl group, a substituted silyl group (e.g., trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert— butyldimethylsilyl, tert—butyldiethylsilyl), a Czfi alkenyl group (e.g., l—allyl) and the like. These groups are optionally tuted by l to 3 halogen atoms, a CLfi alkyl group, a Cyfi alkoxy group, a nitro group etc.
[0230] Examples of the carbonyl~protecting group include cyclic acetal (e.g., 1,3—dioxane), non—cyclic acetal (e.g., di—Cbg alkyl acetal) and the like.
Removal of the mentioned protecting group can be performed according to a known method, for e, the method described in Protective Groups in Organic Synthesis, John Wiley and Sons (1980) and the like. For e, a method using acid, base, ultraviolet rays, hydrazine, phenylhydrazine, sodium N— methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate, trialkylsilyl halide (e.g., trimethylsilyl iodide, trimethylsilyl bromide) and the like, a reduction method and the like can be used.
Examples
[0232] The t invention is explained in detail in the following by ing to Examples, mental Examples and Formulation Examples. However, the es do not limit the present invention and the present invention can be modified within the scope of the present invention.
The “room temperature” in the following Examples is generally about 10°C to about 35°C. The ratio for a mixed solvent is, unless otherwise specified, a volume mixing ratio and % means wt% unless otherwise specified.
In silica gel column chromatography, the indication of NH means use of aminopropylsilane—bonded silica gel. In HPLC (high performance liquid chromatography), the indication of C18 neans use of octadecyl—bonded silica gel. The ratio of elution solvents is, unless otherwise specified, a volume mixing ratio. 1H NMR (proton nuclear magnetic resonance spectrum) was measured by Fourier—transform NMR. For the analysis, ACD/SpecManager (trade name) and the like were used. Very mild peaks showing protons of hydroxyl group, amino group and the like are not described.
MS (mass spectrum) was measured by LC/MS d chromatography mass spectrometer). As the ionization method, ESI (ElectroSpray Ionization) method or APCI (Atmospheric Pressure Chemical Ionization) method was used as API (Atmospheric re Ionization), and the ement was performed in a positive mode (API+) or negative mode (API—).
The data tes measured values (found). Generally, a molecular ion peak is observed, but an ion peak added with a solvent such as itrile (CH3CN) and the like or sodium ion (Na+) is sometimes observed. When a compound having a tert— butoxycarbonyl group (—Boc) is used, a peak free of a tert— butoxycarbonyl group or tert—butyl group may be observed as a fragment ion. In addition, when a compound having a hydroxyl group (—OH) is used, a peak free of H20 may be observed as a fragment ion. In the case of a salt, generally, a molecular ion peak of a free form or a fragment ion peak is observed.
[0237] In the following Examples, the following abbreviations are used.
.TFA: trifluoroacetic acid, DMSO: dimethyl sulfoxide, DMF: N,N—dimethylformamide, THE: tetrahydrofuran.
[0238] Example 1 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}benzamide ¢§\.
L i, , Q. ,- - m». ...«*' w.”- 3 ~ / tn“ r. a \.
[0240] A) utyl (trans—2—{4e [(phenylcarbonyl)amino]phenyl}cyclopropyl)carbamate To a solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyl]carbamate (150 mg) described in a nt (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (6 mL) were added l chloride (84 uL) and triethylamine (101 uL). The mixture was stirred at room temperature ght and water was added. The e was extracted with ethyl acetate, and the extract was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel title column chromatography (hexane/ethyl acetate) to give the compound (212 mg). in NMR (400 MHz, s) 5 1.07 (2H, brs), 1.38 (9H, s), 1.88 7.24 (1H, brs), 2.56—2.65 (1H, m), 7.07 (2H, d, J = 8.6 Hz), (1H, brs), 7.48-7.62 (3H, m), 7.66 (2H, d, J = 7.6 Hz), 7.94 (2H, d, J = 7.6 Hz), 10.18 (1H, s).
B) N—[4—(trans—2—aminocyclopropyl)phenyl]benzamide hydrochloride tert—Butyl (trans—2—{4— [(phenylcarbonyl)amino]phenyl}cyclopropyl)carbamate (212 mg) acetate on (2 was dissolved in 4N hydrochloric acid/ethyl mL), and the mixture was stirred at room.temperature for 2 hr and the solvent was evaporated under reduced pressure to give the title compound (148 mg). 1H NMR (400 MHz, DMSO—de) 5 1.13~1.25 (1H, m), .44 (1H, m), 2.24—2.35 (1H, m), 2.79 (1H, brs), 7.14 (2H, d, J = 8.1 Hz), .65 (3H, m), 7.72 (2H, d, J = 7.8 Hz), 7.95 (2H, d, J = 7.3 Hz), 8.38 (3H, brs), 10.25 (1H, s).
[0242] C) N—{4—[trans—Z—(benzylamino)cyclopropyl]phenyl}benzamide To a solution of trans-2— yclopropyl)pheny1]benzamide hydrochloride (70 mg) in Vmethanol (2 mL) were added benzaldehyde (25 uL) and sodium hydrogen carbonate (30.5 mg). The reaction mixture was stirred at 70°C for 1 hr, and ice~cooled to 0°C and sodium borohydride (13.8 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over, The solvent was anhydrous sodium sulfate. evaporated under reduced pressure. The residue was recrystallized (hexane/ethyl acetate) to give the title compound (49.1 mg).
MS (API+): [M+H]+ 343.3. 1H NMR (400 MHZ, CDC13) 6 0.96 (1H, brs), 1.11 (1H, brs), 1.92 J = 7.8 (1H, brs), 2.37 (1H, brs), 3.89 (2H, brs), 7.00 (2H, d, Hz), 7.21—7.36 (4H, m), 7.45-7.60 (5H, m), 7.73 (1H, brs), 7.82—7.91 (2H, m).
Example 2 N~{4—[trans~2-(octylamino)cyclopropyl]phenyl}benzamide 453:», \wx’g 0 kv’*figh§,3¢m\jfxxflk By a method similar to Example 1, Step C, the title compound (59.4 mg) was obtained from N—[4—(trans—2— aminocyclopropyl)phenyl]benzamide hydrochloride (100 mg) and octylaldehyde (44.4 mg). 1H NMR (400 MHz, DMSO—ds) 5 0.81—0.97 (5H, m), 1.24 (10H, brs), 1.39 (2H, brs), 1.70—1.79 (1H, m), 2.12—2.31 (2H, m), 2.54—2.62 (2H, m), 7.02 (2H, s), 7.48—7.55 (2H, m), 7.55—7.59 (1H, m), 7.60—7.66 (2H, m), 7.93 (2H, d, J = 7.3 Hz), 10.15 (1H, s).
Example 3 N—{4~[trans~2—(benzylamino)cyclopropyl]phenyl}~3-bromobenzamide
[0247] 27.94%; . ka Q ; Eff/4* ,»an, .34» a?“ fig?“N ”7"". i.;::’:‘-;.‘:% H l u Hfixv A) tert—butyl [trans—2—(4—{[(3— bromophenyl)carbonyl]amino}pheny1)cycloprdpy11carbamate To a solution of tert-butyl [trans-2—(4- aminophenyl)cyclopropy11carbamate (300 mg) bed in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (12 mL) were added 3—bromobenzoyl chloride (191 uL) and triethylamine (202 uL). The mixture was stirred at room temperature overnight and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title nd (407 mg). 1H NMR (400 MHZ, CDCl3) 5 1.15 (2H, t, J = 5.6 Hz), 1.46 (9H, s), 2.04 (1H, s), 2.70 (1H, brs), 4.86 (1H, brs), 7.15 (2H, d, J = 7.6 Hz), 7.36 (1H, t, J = 7.9 Hz), 7.52 (2H, d, J = 7.6 Hz), 7.67 (1H, d, J = 8.1 Hz), 7.71—7.81 (2H, m), 8.00 (1H, s).
B) N*[4—(trans~2-aminocyclopropyl)phenyl]—3—bromobenzamide hydrochloride tert—Butyl [trans—2—(4—{[(3— bromophenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate (407 mg) was dissolved in 4N hydrochloric acid/ethyl acetate solution (2 mL), and the e was stirred at room temperature for 2 hr. The solvent was evaporated under reduced pressure to give the title nd (320 mg). 1H NMR (400 MHz, DMSO—ds) 5 1.15—1.24 (1H, m), 1.32—1.40 (1H, m), 2.29 (1H, brs), 2.76—2.84 (1H, m), 7.15 (2H, d, J = 8.1 Hz), 7.50 (1H, t, J = 7.9 Hz), 7.70 (2H, d, J = 8.1 Hz), 7.80 (1H, d, J = 7.8 Hz), 7.95 (1H, d, J = 8.1 Hz), 8.13 (1H, s), 8.33 (3H, brs), 10.35 (1H, s).
C) trans-2—(benzylamino)cyclopropyl]phenyl}—3— enzamide To a solution of N—[4—(trans—Z—aminocyclopropyl)phenyl]- 3-bromobenzamide hydrochloride (80 mg) in methanol (2 mL) were added benzaldehyde (22 uL) and sodium hydrogen carbonate (27.4 mg). The mixture was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (12.4 mg) was added. The mixture was d for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with ted brine and dried over ous sodium sulfate. The solvent was evaporated under reduced pressure. The e was purified by silica gel column chromatography (hexane/ethyl acetate) and recrystallized (hexane/ethyl acetate) to give the title compound (21.0 mg).
Ms (API+): [M+H]+ 421.2. 1H NMR (400 MHz, CDCl3) 5 0.96 (1H, dt, J = 6.9, 5.6 Hz), 1.11 (1H, dt, J = 9.1, 4.9 Hz), 1.88—1.95 (2H, m), 2.33—2.40 (1H, m), 3.89 (2H, d, J = 2.4 Hz), 6.98 (2H, d, J = 8.6 Hz), .38 (6H, m), 7.48 (2H, d, J = 8.6 Hz), 7.66 (1H, ddd, J = 7.9, 1.9, 1.0 Hz), 7.77 (2H, d, J = 6.4 Hz), 7.98 (1H, t, J = 1.7 Hz).
Example 4 3—bromo—N—{4~[trans—2—(octylamino)cycloproplephenyl}benzamide
[0252] _. 3E are:Ag”« .N*"%“* 13.4. ”\3‘ Rigyhmwflxgwf‘“» a. J r’fi‘w”, To a solution of trans—2~aminocyclopropyl)phenyl]— 3—bromobenzamide hydrochloride (80 mg) in methanol (2 mL) were added octylaldehyde (34 mL) and sodium hydrogen carbonate (27.4 mg). The reaction mixture was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (12.4 mg) was added.
The mixture was stirred for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl acetate) and recrystallized (hexane/ethyl acetate) to give the title compound (48.3 mg).
MS (API+): [M+H]+ 443.3. 1H NMR (400 MHz, DMSO—de) 5 0.80~0.96 (5H, m), 1.24 (10H, 8) I 1.38 (2H, d, J = 7.1 Hz), 1.70—1.80 (1H, m), 2.13—2.22 (1H, m), 2.22-2.30 (1H, m), 2.57 (2H, t, J = 6.8 Hz), 7.02 (2H, d, J = 8.6 Hz), 7.49 (1H, t, J = 7.9 Hz), 7.61 (2H, d, J = 8.6 Hz), 7.79 (1H, d, J = 8.1 Hz), 7.94 (1H, d, J = 8.1 Hz), 8.08—8.15 (1H, m), 10.25 (1H, s).
Example 5 3—bromo—N—(4—{trans-2—[(1-methylpiperidin—4— yl)amino]cyclopropyl}phenyl)benzamide
[0255] amwmu!- > 3r. W \é-r’ To a solution of N—[4—(trans—2~aminocyclopropyl)phenyl]— 3—bromobenzamide hydrochloride (80 mg) in methanol (2 mL) were added 1-methylpiperidinone (24.6 mg) and sodium hydrogen carbonate (27.4 mg). The mixture was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (12.4 mg) was added. The mixture was stirred for 1 hr and water was added.
The mixture was ted with ethyl e, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was ated under reduced pressure.
The residue was purified by silica gel column chromatography (ethyl acetate) and tallized (ethyl acetate) to give the title compound (10.0 mg).
MS (2491+): [M+H]+ 428.3. 1H NMR (400 MHz, DMSO—de) 5 0.89-0.96 (2H, m), 1.20—1.35 (2H, m), 1.68—1.79 (3H, m), 1.86 (2H, t, J = 10.5 Hz), 2.11 (3H, s), 2.14—2.21 (1H, m), 2.47 (2H, brs), 2.62—2.70 (2H, m), 7.01 (2H, d, J = 8.6 Hz), 7.50 (1H, t, J = 7.9 Hz), 7.61 (2H, d, J = 8.6 Hz), 7.79 (1H, d, J = 7.1 Hz), 7.94 (1H, d, J = 8.1 Hz), 8.12 (1H, 3), 10.25 (1H, s).
Example 6 3—bromo—N—(4-{trans—2—[(3,4— dimethoxybenzyl)amino]cyclopropyl}phenyl)benzamide BF,” ' E,» a ‘- O I ' ., .- f " V‘‘ -" ' a, V i “QW‘EMé To a solution of N—[4—(trans—2—aminocyclopropyl)phenyl]— 3—bromobenzamide hydrochloride (80 mg) in methanol (2 mL) were added 3,4—dimethoxybenzaldehyde (36.2 mg) and sodium hydrogen carbonate (27.4 mg). The mixture was stirred at 70°C for 1 hr, and oled to 0°C and sodium borohydride (12.4 mg) was added. The mixture was stirred for 1 hr and water was added.
The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over ous sodium sulfate. The t was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (ethyl acetate) and recrystallized (ethyl acetate) to give the title compound (44.2 mg).
MS (API+): [M+H]+ 481.3. 1H NMR (400 MHz, DMSO—ds) 5 0.86—1.06 (2H, m), 1.80 (1H, brs), 2.15 (1H, brs), 2.79 (1H, brs), 3.62-3.75 (8H, m), 6.74—6.91 (3H, m), 6.97 (2H, d, J = 8.3 Hz), 7.49 (1H, t, J = 7.8 Hz), 7.60 (2H, d, J = 8.1 Hz), 7.79 (1H, d, J = 7.8 Hz), 7.94 (1H, d, J = 7.3 Hz), 8.12 (1H, s), 10.25 (1H, s).
[0260] N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— methylbenzamide A) tert—butyl —2-(4—{[(3— methylphenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate To a on of tert-butyl [trans—2—(4- henyl)cyclopropyl]carbamate (100 mg) described in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (4 mL) were added 3—methylbenzoyl chloride (62.3 mg) and triethylamine (56 uL). The mixture was stirred at room temperature for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (141 mg). 1H NMR (400 MHz, CDCl3) 5 .20 (2H, m), 1.46 (9H, s), 2.05 (1H, s), 2.43 (3H, s), 2.71 (1H, brs), 4.85 (1H, brs), 7.15 (2H, d, J = 7.8 Hz), .39 (2H, m), 7.54 (2H, d, J = 8.1 Hz), 7.64 (1H, d, J 4.4 Hz), 7.68 (1H, s), 7.76 (1H, brs).
[0263] B) N—[4—(trans—2—aminocyclopropyl)phenyl]~3-methylbenzamide hydrochloride tert-Butyl [trans-2—(4—{[(3~ methylphenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate (141 mg) was dissolved in 4N hydrochloric acid/ethyl acetate solution (2 mL). The mixture was stirred at room temperature for 2 hr and the solvent was evaporated under reduced pressure to give the title compound (51.6 mg). 1H NMR (400 MHz, DMSO—de) 5 1.15-1.24 (1H, m), 1.35 (1H, brs), 2.28 (1H, brs), 2.40 (3H, s), 2.79 (1H, d, J = 3.7 Hz), 7.14 (2H, d, J = 8.6 Hz), 7.38—7.43 (2H, m), 7.66—7.78 (4H, m), 8.33 (3H, brs), 10.19 (1H, s).
C) N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl} methylbenzamide To a solution of N—[4—(trans—2-aminocyclopropyl)phenyl]— ylbenzamide hydrochloride (113 mg) in methanol (3 mL) were added benzaldehyde (38 uL) and sodium hydrogen carbonate (47.0 mg). The mixture was stirred at 70°C for 1 hr, and ice— cooled to 0°C and sodium borohydride (21.2 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was ted with ethyl e, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate.
The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) and recrystallized (hexane/ethyl acetate) to give the title compound (85.6 mg).
MS (API+): [M+H]+ 357.1. lH NMR (400 MHz, DMSO—de) 5 0.87—0.94 (1H, m), 0.94—1.02 (1H, m), 1.76—1.85 (1H, m), .21 (1H, m), 2.39 (3H, s), 2.81— 2.92 (1H, m), 3.76 (2H, s), 6.95 (2H, d, J = 8.6 Hz), 7.18—7.25 (1H, m), 7.26—7.34 (4H, m), .43 (2H, m), 7.60 (2H, d, J = 8.6 Hz), 7.69—7.77 (2H, m), 10.10 (1H, s).
Example 8 N—{4—[trans-2—(benzylamino)cyclopropyl]phenyl}—3~ (trifluoromethyl)benzamide [Rf1‘\fQN S ‘[h: :fipka‘?Nffix,‘Hfigj k...
A) tert—butyl {trans—2—[4—({[3— (trifluoromethyl)phenyl]carbonyl}amino)phenyl]cyclopropyl}— carbamate To a solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyl]carbamate (100 mg) bed in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (4 mL) were added 3—(trifluoromethyl)benzoyl de (126 mg) and triethylamine (84 uL). The mixture was stirred at room temperature for 30 min and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was crystallized (hexane/ethyl e) to give the title compound (161 mg). 1H NMR (400 MHz, CDClg) 5 1.17 (2H, brs), 1.46 (9H, s), 2.00— 2.11 (1H, m), 2.66—2.76 (1H, m), 4.78—4.94 (1H, m), 7.17 (2H, d, J = 7.3 Hz), 7.54 (2H, d, J = 7.6 Hz), 7.64 (1H, s), 7.79 (2H, d, J = 14.4 Hz), 8.03—8.09 (1H, m), 8.12 (1H, s).
B) N—[4—(trans—Z-aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride tert—Butyl {trans—2—[4—({[3— (trifluoromethyl)phenyl]carbonyl}amino)phenyl]cyclopropyl}— carbamate (161 mg) was dissolved in 4N hydrochloric thyl acetate solution (2 mL), and the mixture was stirred at room temperature for 2 hr. The solvent was evaporated under reduced pressure to give the title compound (130 mg). 1H NMR (400 MHz, s) 5 1.16—1.26 (1H, m), 1.36 (1H, d, J I! 3.9 Hz), 2.29 (1H, brs), 2.80 (1H, brs), 7.17 (2H, d, J = 8.1 Hz), 7.71 (2H, d, J = 8.3 Hz), 7.79 (1H, t, J = 7.2 Hz), 7.97 (1H, d, J = 7.6 Hz), 8.21-8.38 (5H, m), 10.48 (1H, s).
[0269] C) N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— (trifluoromethyl)benzamide To a solution of N-[4-(trans—2—aminocyclopropyl)phenyl]— 3—(trifluoromethyl)benzamide hydrochloride (107 mg) in ol (2 mL) were added benzaldehyde (30 uL) and sodium hydrogen carbonate (37.8 mg). The mixture was stirred at 70°C for 1 hr, and oled to 0°C and sodium borohydride (17.0 mg) was added. The mixture was d for 1 hr and water was added.
The mixture was extracted with ethyl acetate, and the t was washed with saturated brine and dried over ous sodium sulfate. The solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl acetate) and recrystallized (hexane/ethyl acetate) to give the title compound (66.0 mg).
MS ): [M+H]+ 411.3. 1H NMR (400 MHz, DMSO—ds) 5 0.93 (1H, d, J = 6.1 Hz), 0.96—1.03 (1H, m), 1.81 (1H, brs), 2.20 (1H, d, J = 3.4 Hz), 3.77 (2H, s), 6.98 (2H, d, J = 8.6 Hz), 7.18~7.25 (1H, m), 7.26—7.34 (4H, m), 7.61 (2H, d, J = 8.3 Hz), 7.75—7.82 (1H, m), 7.96 (1H, d, J = 7.6 Hz), 8.22—8.29 (2H, m), 10.37 (1H, s).
Example 9 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3—tert- butylbenzamide
[0271] A) tert-butyl [trans—2—(4—{[(3—tert-butylphenyl)carbonyl]— amino}phenyl)cyclopropyl]carbamate By a method similar to Example 28, Step A, the title compound (100 mg) was obtained from tert—butyl [trans-2—(4- aminophenyl)cyclopropyl]carbamate (100 mg) and 3-tert— butylbenzoic acid (86 mg). 1H NMR (400 MHz, CDC13) 5 1.08—1.20 (2H, m), 1.35 (9H, s), 1.46 (9H, s), 2.05 (1H, br. s), 2.71 (1H, brs), 4.86 (1H, brs), 7.15 (2H, d, J = 7.8 Hz), 7.36—7.46 (1H, m), 7.50-7.65 (4H, m), 7.72' (1H, s), 7.92 (1H, s).
B) N—[4—(trans—Z—aminocyclopropyl)phenyl]—3—tert—butylbenzamide hydrochloride By a method similar to Example 1, Step B, the title compound (64.3 mg) was obtained from tert—butyl [trans—2—(4— {[(3—tert—butylphenyl)carbonyl]amino}phenyl)cyclopropyl]— carbamate (99 mg). 1H NMR (400 MHz, DMSO—ds) 5 1.16~1.24 (1H, m), 1.32—1.40 (10H, m), 2.29 (1H, ddd, J = 9.9, 6.5, 3.4 Hz), 2.79 (1H, dt, J = 7.6, 4.1 Hz), 7.15 (2H, d, J = 8.6 Hz), 7.42—7.48 (1H, m), 7.60—7.65 (1H, m), 7.70 (2H, d, J = 8.6 Hz), 7.76 (1H, d, J = 7.8 Hz), 7.92 (1H, t, J = 1.8 Hz), 8.34 (3H, brs), 10.21 (1H, s).
C) N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3—tert— enzamide By a method similar to Example 1, Step C, the title compound (15.0 mg) was obtained from N—[4-(trans—2— yclopropyl)phenyl]—3—tert-butylbenzamide hydrochloride (62.6 mg). 1H NMR (400 MHz, CDCl3) 5 0.97 (1H, dt, J = 7.0, 5.5 Hz), 1.07— 1.15 (1H, m), 1.36 (9H, s), 1.92 (2H, ddd, J = 9.2, 5.9, 3.2 Hz), 2.37 (1H, ddd, J = 7.2, 4.1, 3.2 Hz), 3.85—3.94 (2H, m), 6.96—7.01 (2H, m), 7.22—7.35 (4H, m), 7.37—7.43 (1H, m), 7.51 (2H, d, J = 8.3 Hz), 7.55—7.63 (2H, m), 7.75 (1H, brs), 7.92 (1H, t, J = 1.7 Hz). e 10 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— phenoxybenzamide A) tert—butyl [trans—2—(4—{[(3— phenoxyphenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate By a method similar to Example 28, Step A, the title compound (93.8 mg) was obtained from tert—butyl [trans—2—(4- aminophenyl)cyclopropyl]carbamate (100 mg) and 3—phenoxybenzoic acid (104 mg). 1H NMR (400 MHz, CDC13) 5 1.10~1.19 (2H, m), 1.46 (9H, s), 2.04 (1H, brs), 2.70 (1H, brs), 4.85 (1H, brs), 7.02—7.07 (2H, m), 7.11—7.20 (4H, m), 7.34—7.40 (2H, m), 7.44 (1H, t, J = 7.9 Hz), 7.48—7.54 (3H, m), 7.56 (1H, d, J = 7.8 Hz), 7.71 (1H, s).
B) N-[4—(trans-2—aminocyclopropyl)phenyl]—3—phenoxybenzamide hydrochloride By a method similar to Example 1, Step B, the title compound (51.9 mg) was obtained from tert—butyl [trans—2—(4— {[(3—phenoxyphenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate (92 mg). 1H NMR (400 MHz, DMSO~d6) 5 1.15—1.23 (1H, m), .40 (1H, m), 2.29 (1H, ddd, J = 10.1, 6.4, 3.5 Hz), 2.79 (1H, brs), 7.07 (2H, dd, J = 8.6, 1.0 Hz), 7.14 (2H, d, J = 8.8 Hz), 7.16—7.26 (2H, m), 7.40—7.47 (2H, m), .59 (2H, m), 7.69 (2H, d, J ll 8.6 Hz), 7.75 (1H, d, J = 8.1 Hz), 8.38 (3H, brs), 10.27 (1H, s).
C) N—{4—[trans—2—(benzylamino)cyclopropyl]pheny1}—3— ybenzamide By a method similar to Example 1, Step C, the title compound (8.3 mg) was ed from N—[4—(trans—2- aminocyclopropyl)phenyl]—3—phenoxybenzamide hydrochloride (27.1 mg). 1H NMR (400 MHz, DMSO—dg) 6 0.87—0.94 (1H, m), 0.98 (1H, dt, J = 9.2, 4.5 Hz), 1.75-1.83 (1H, m), 2.14—2.21 (1H, m), 2.86 (1H, brs), 3.76 (2H, s), 6.94 (2H, d, J = 8.6 Hz), 7.04—7.09 (2H, m), 7.16-7.24 (3H, m), 7.25—7.33 (4H, m), 7.40—7.47 (2H, m), 7.50— 7.61 (4H, m), 7.73 (1H, d, J = 8.1 Hz), 10.16 (1H, s). e 11 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— (benzyloxy)benzamide hloride A) tert-butyl {trans—2—[4—({[3— (benzyloxy)phenyl]carbonyl}amino)phenyl]cyclopropyl}carbamate By a method similar to Example 28, Step A, the title compound (164 mg) was obtained from tert—butyl [trans-2—(4— aminophenyl)cyclopropyl]carbamate (100 mg) and 3— (benzyloxy)benzoic acid (110 mg). 1H NMR (400 MHz, DMSO—ds) 5 .13 (2H, m), 1.38 (9H, s), .92 (1H, m), 2.59 (1H, brs), 5.19 (2H, s), 7.07 (2H, d, J = 8.6 Hz), 7.20—7.27 (2H, m), 7.32—7.38 (1H, m), 7.38—7.45 (3H, m), 7.45—7.51 (2H, m), 7.54 (1H, d, J = 7.6 Hz), 7.58 (1H, d, J = 1.7 Hz), 7.65 (2H, d, J = 8.6 Hz), 10.14 (1H, s).
[0283] B) N—[4—(trans—2—aminocyclopropyl)phenyl]—3—- (benzyloxy)benzamide hydrochloride By a method similar to Example 1, Step B, the title compound (115 mg) was obtained from tert-butyl {trans—2-[4— ({[3—(benzyloxy)phenyl]carbonyl}amino)phenyl]cyclopropyl}— carbamate (164 mg). 1H NMR (400 MHz, DMSO‘dg) 5 1.19 (1H, d, J = 6.8 Hz), 1.30-1.38 (1H, m), 2.28 (1H, brs), 2.76—2.83 (1H, m), 5.19 (2H, s), 7.14 (2H, d, J = 8.6 Hz), 7.24 (1H, dd, J = 7.9, 2.1 Hz), 7.36 (1H, d, J = 7.1 Hz), 7.38—7.51 (5H, m), 7.54 (1H, d, J = 7.8 Hz), 7.58 (1H, d, J = 2.0 Hz), 7.71 (2H, d, J = 8.6 Hz), 8.30 (3H, brs), 10.21 (1H, s).
C) N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— (benzyloxy)benzamide hydrochloride By a method similar to Example 1, Step C, 4N hydrochloric acid/ethyl e solution was added to N—{4~[trans—2~ lamino)cyclopropyl]phenyl}—3—(benzyloxy)benzamide obtained from N—[4—(trans—2-aminocyclopropyl)phenyl]—3— (benzyloxy)benzamide hydrochloride (109 mg) and benzaldehyde (29.3 uL), and the resulting solid was collected by filtration to give the title compound (96.1 mg). 1H NMR (400 MHz, DMSO—ds) 5 1.22—1.34 (1H, m), 1.46 (1H, brs), 2.41 (1H, brs), 2.89 (1H, brs), 4.29 (2H, brs), 5.19 (2H, s), 7.11 (2H, d, J = 8.6 Hz), 7.24 (1H, dd, J = 8.3, 2.0 Hz), 7.30— 7.63 (13H, m), 7.70 (2H, d, J = 8.3 Hz), 9.44 (2H, br. 3), .20 (1H, s).
Example 12 N—(4~{trans~2—[(pyridin—3-ylmethyl)amino]cyclopropyl}phenyl)— benzamide bis(trifluoroacetate) To a solution of N—[4—(trans—2— aminocyclopropyl)phenyl]benzamide hydrochloride (23 mg) and 3— necarboxyaldehyde (17 mg) in methanol (0.5 mL) were added acetic acid (0.1 mL) and a solution of 2—picoline borane (23 mg) in methanol (0.4 mL). The reaction mixture was stirred at 60°C overnight, and the solvent was evaporated by an air blowing apparatus. The residue was purified by HPLC (C18, mobile phase: water/acetonitrile (with 0.1% TFA)) to give the title compound (2.8 mg).
MS (API+): [M+H]+ 344.2.
The nds produced by the method described in the above—mentioned Example 12 or a method ous thereto are shown in the following Tables. In the Tables, MS shows measured values.
[ Table 1—1] N—(4-{trans—2— [(thiophen-Z- ylmethyl)amino]— cyclopropyl}- phenyl)benzamide N—(4—{trans—2— enyl— propyl)amino]— cyclopropyl}~ )benzamide N—(4—{trans—2— [(2—fluoro— benzyl)amino]— CF3COOH 361.2 cyclopropyl}— phenyl)benzamide N—(4—{trans—2— [(biphenyl-4— ylmethyl)amino]- QYR CF3COOH 419 . 3 cyclopropyl}- phenyl)benzamide N—(4—{trans—2— [(2,2—dimethyl— propyl)amino]— CF3COOH 323.3 cyclopropyl}— phenyl)benzamide N—(4—{trans-2— [(naphthalen-Z— ylmethyl)amino]— ropyl}- phenyl)benzamide N—(4-{trans—2— [(l—phenyl— amino]- cyclopropyl}— phenyl)benzamide N—{4—[trans—2- (2,3-dihydro-1H- inden-l- ylamino)cyclo— CF3COOH 369.3 propyl]phenyl}— benzamide [Table 1—2] IUPAC name No. -MS N—{4—[trans—2— (9H-fluoren—9—yl 21 amino)cyclo— é? o CF3COOH 417.3 prepyllphenyl}— benzamide N-{4—[trans—2— (dodecylamino)— ropy1]— CF3COOH 421.4 phenyl}benzamide trans—2— (cycloheptyl— amino)cyclo— H 349.3 prepyllphenyl}— benzamide N—{4—[trans-2— (cyclooctyl— amino)cyclo— CF3COOH 363.3 prepyllphenyl}- benzamide trans—2— [(l—benzyl— piperidin—4— yl)amino]cyclo— 2CF3COOH 426.3 prOpyl}phenyl)— benzamide N—[4—(trans—2— {[2—(benzyloxy)— ethyl]amino}— CF3COOH 387.3 cyclopropy1)— phenlebenzamide N—{4—[trans-2— (dimethylamino)— CF3COOH cycloprople— 281.1 phenyl}benzamide Example 28 3—benzyl—N—{4—[trans-2— (benzylamino)cyclopropyljphenyl}benzamide
[0292] [asF"ng/L‘Qz’j‘ Kj¢§ +.__,22"“ - f1». lv ' ‘3 wf gmW Wfl A) tert—butyl [trans—2—(4—{[(3- benzylphenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate To a solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyljcarbamate (100 mg) described in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (4 mL) were added 3—benzylbenzoic acid (103 mg) described in a document (J. Org. Chem. 2001, 66, 2874.), N-ethyl-N'—(3— ylaminopropyl)carbodiimide hloride (93 mg), 1— hydroxybenzotriazole (65.3 mg) and triethylamine (140 uL). The mixture was stirred at room temperature ght and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The e was recrystallized (hexane/ethyl acetate) to give the title compound (126 mg). 1H NMR (400 MHz, CDC13) 5 1.13 (2H, t, J = 6.6 Hz), 1.45 (9H, s), 1.97-2.03 (1H, m), 2.68 (1H, brs), 4.03 (2H, s), 4.89 (1H, brs), 7.11 (2H, d, J = 8.6 Hz), 7.15—7.24 (3H, m), 7.25—7.32 (2H, m), 7.35 (2H, s), 7.51 (2H, d, J = 8.3 Hz), 7.65—7.69 (1H, m), 7.71 (1H, s), 7.88 (1H, brs).
B) N-[4-(trans-Z—aminocyclopropyl)phenyl]-3—benzylbenzamide hydrochloride utyl [trans—2—(4—{[(3— benzylphenyl)carbonyl]amino}phenyl)cyclopropyl]carbamate (125 mg) was dissolved in 4N hydrochloric thyl acetate solution (2 mL), and the mixture was stirred at room temperature overnight. The solvent was evaporated under reduced pressure to give the title compound (54.7 mg).
MS (API+): [M+H]+ 343.1.
C) 3—benzyl—N—{4—[trans—2— (benzylamino)cyclopropyl]pheny1}benzamide To a on of N—[4—(trans—Z—aminocyclopropyl)phenyl]— 3-benzylbenzamide hloride (69.6 mg) in ol (1.5 mL) were added dehyde (19 uL) and sodium hydrogen carbonate (23.2 mg). The mixture was stirred at 70°C for 1 hr, and ice— cooled to 0°C and sodium borohydride (10.4 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate.
The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) and crystallized (hexane/ethyl acetate) to give the title compound (29.7 mg).
MS (API+): [M+H]+ 433.3. 1H NMR (400 MHz, e) 6 0.88—0.94 (1H, m), 0.98 (1H, dt, J = 9.0, 4.5 Hz), 1.75—1.83 (1H, m), 2.14—2.20 (1H, m), 2.86 (1H, brs), 3.76 (2H, s), 4.03 (2H, s), 6.95 (2H, d, J = 8.6 Hz), 7.16—7.24 (2H, m), 7.24-7.33 (8H, m), 7.43 (2H, d, J = 4.6 Hz), 7.58 (2H, d, J = 8.3 Hz), 7.76 (1H, t, J = 4.0 Hz), 7.80 (1H, s), 10.11 (1H, s).
Example 29 3—(benzylamino)-N—{4—[trans—2— (benzylamino)cyclopropyl]phenyl}benzamide A) methyl 3—[benzyl(tert—butoxycarbonyl)amino]benzoate To a solution of methyl 3-(tert— butoxycarbonylamino)benzoate (1.08 g) described in a document (Bioorg. Med. Chem. 2010, 18, 3175.) in DMF (40 mL) was added sodium hydride (258 mg). The reaction mixture was stirred at room temperature for 15 min, and benzyl bromide (613 uL) was added. The mixture was stirred for 1 hr and water was added.
The mixture was extracted with ethyl e, and the extract was washed with ted brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (125 mg). 1H NMR (400 MHz, CDCl3) 5 1.42 (9H, s), 3.89 (3H, s), 4.86 (2H, s), 7.19—7.34 (7H, m), 7.80—7.85 (1H, m), 7.88 (1H, s).
B) 3—[benzyl(tert-butoxycarbonyl)aminOJbenzoic acid By a method similar to Example 33, Step A, the title compound (121 mg) was obtained from methyl 3—[benzyl(tert— butoxycarbonyl)aminOJbenzoate (125 mg). 1H NMR (400 MHz, CDCl3) 51.46 (9H, s), 4.90 (2H, s), .27 (3H, m), 7.30—7.43 (4H, m), 7.91 (1H, dd, J = 8.7, 1.6 Hz), 7.96 (1H, s).
[0300] C) tert—butyl benzyl{3—[(4—{trans—2-[(tert— butoxycarbonyl)amino]cyclopropyl}phenyl)carbamoyl]phenyl}— carbamate By a method similar to e 28, Step A, the title compound (81.6 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropyl]carbamate (110 mg) and 3*[benzyl(tert— butoxycarbonyl)amino]benzoic acid (121 mg). 1H NMR (400 MHZ, CDCl3) 5 1.08—1.18 (2H, m), 1.41—1.48 (18H, m), 1.86—1.97 (1H, m), .76 (1H, m), 4.85 (2H, s ), 6.52—6.65 (1H, m), 6.89—6.99 (1H, m), 7.11 (2H, d, J = 8.6 HZ), 7.18-7.40 (4H, m), 7.44—7.55 (2H, m), 7.64 (2H, s), 7.75—7. 83 (1H, m), 7.87-8.00 (1H, m).
D) N—[4—(trans—Z—aminocyclopropyl)phenyl]~3- (benzylamino)benzamide dihydrochloride By a method similar to Example 1, Step B, the title compound (35.7 mg) was obtained from utyl benzyl{3—[(4— {trans—2-[(tert—butoxycarbonyl)amino]cyclopropy1}— )carbamolephenyl}carbamate (82 mg). 1H NMR (400 MHz, DMSO—d6) 5 1.18 (1H, d, J = 7.8 Hz), 1.36 (1H, t, J = 4.3 Hz), 2.24—2 34 (1H, m), 2.78 (1H, dd, J = 8.2, 4.0 Hz), 4.34 (2H, 5), 6.79 (1H, d, J = 8.1 Hz), 7.07—7.27 (6H, m), 7 29—7.41 (4H, m), 7.68 (2H, d, J = 8.6 Hz), 8.41 (3H, d, J = 4.4 Hz), 10.07 (1H, s). [0302) E) 3—(benzy1amino)—N—{4—[trans—2— (benzylamino)cyclopropyl]pheny1}benzamide By a method similar to Example 1, Step C, the title compound (5.0 mg) was obtained from trans—2— aminocyclopropyl)phenyl]—3—(benzylamino)benzamide hydrochloride (40 mg). 1H NMR (400 MHZ, DMSO—ds) 5 1.22—1.31 (1H, m), 1.45-1.53 (1H, m), 2.41—2.48 (1H, m), 2.85-2.93 (1H, m), 4.27-4. 32 (2H, m), 4.34 (2H, 8), 6.76— 6.81 (1H, m), 7.09 (4H, s), 7. 16—7.26 (2H, m), 7.33 (2H, s), 7.36-7.40 (2H, m), 7.40-7.45 (3H, m), 7.50~ 7.58 (2H, m), 7.67 (2H, d, J = 8.6 Hz), 9.53—9.67 (2H, m), .03—10.10 (1H, m).
Example 30 N—{4—[trans—2-(pyrrolidin-l—yl)cyclopropyl]phenyl}benzamide hydrochloride [0305} To a mixture of N—[4—(trans-2— yclopropyl)phenyl]benzamide hydrochloride (100 mg), triethylamine (0.l45 mL), and N,N-dimethylformamide (2.0 mL) was added l,4—dibromobutane (0.050 mL), and the mixture was stirred at 60°C for 2 hr. To the reaction mixture was added saturated aqueous sodium hydrogen carbonate solution, and the mixture was extracted twice with ethyl acetate. The organic layers were combined, washed with saturated brine, dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column tography (ethyl acetate/methanol), and the fractions containing the object product were collected and concentrated.
The residue was dissolved in methanol (5.0 mL), 10% hydrochloric acid methanol solution (1.0 mL) was added, and the e was concentrated under reduced pressure to give the title compound (9.8 mg).
Ms (API+): [M+H]+ 307.3. 1H NMR (300 MHz, CDyDD) 6 .48 (1H, m), 1.63 (1H, ddd, J = .7, 6.7, 4.3 Hz), 2.00-2.14 (2H, m), 2.14—2.32 (2H, m), 2.64 (lH, ddd, J = 10.4, 6.7, 3.5 Hz), 3.05—3.20 (1H, m), 3.26~3.4l (2H, m), 3.64—3.88 (2H, m), .23 (2H, m), 7.49—7.59 (3H, n0, 7.62—7.70 (2H, m), 7.88—7.95 (2H, m). e 31 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— [(phenylcarbonyl)amino]benzamide
[0307] A) tert—butyl (trans—2—{4—[({3— [(phenylcarbonyl)amino]phenyl}carbony1)amino]phenyl}— cyclopropyl)carbamate To a solution of tert—butyl [trans—2—(4— henyl)cyclopropy1]carbamate (124 mg) described in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (4 mL) were added 3-[(phanylcarbonyl)amino]benzoic acid (100 mg), N—ethyl-N’-(3—dimethy1aminopropyl)carbodiimide hydrochloride (95 mg), 1—hydroxybenzotriazole (67.2 mg) and triethylamine (69 uL). The mixture was stirred at room ature overnight and water was added. Ethyl acetate was added to the mixture, and the resulting solid was collected by filtration to give the title compound (188 mg). 1H NMR (400 MHz, DMSO—ds) 5 1.00—1.13 (2H, m), 1.39 (9H, s), 1.83—1.92 (1H, m), 2.60 (1H, brs), 7.08 (2H, d, J = 8.6 Hz), 7.24 (1H, brs), 7.47—7.71 (7H, m), 7.98—8.05 (3H, m), 8.30 (1H, 3), 10.22 (1H, s), 10.45 (1H, s).
[0309] B) N—[4—(trans-Z—aminocyclopropyl)phenyl]—3— [(phenylcarbonyl)amino]benzamide hydrochloride tert—Butyl (trans—2-{4—[({3— [(phenylcarbonyl)amino]phenyl}carbonyl)amino]phenyl}— cyclopropyl)carbamate (188 mg) was dissolved in 4N hydrochloric acid/ethyl e on (2 mL), and the mixture was stirred at room ature for 2 hr. The solvent was evaporated under reduced pressure to give the title compound (10? mg). 1H NMR (400 MHz, DMSO—de) 5 1.16—1.24 (1H, m), 1.31-1.40 (1H, m), 2.23—2.33 (1H, m), 2.77—2.84 (1H, m), 7.15 (2H, d, J = 8.6 Hz), 7.48—7.65 (4H, m), 7.65—7.75 (3H, m), 7.96—8.03 (3H, m), 8.21—8.37 (4H, m), 10.28 (1H, 3), 10.47 (1H, s).
C) N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3— [(phenylcarbonyl)amino]benzamide To a on of N—[4—(trans—2—aminocyclopropyl)phenyl]- 3—[(phenylcarbonyl)aminOJbenzamide hydrochloride (85.5 mg) in methanol (2 mL) were added benzaldehyde (21 uL) and sodium hydrogen carbonate (26.4 mg). The mixture was stirred at 70°C for 1 hr, and oled to 0°C and sodium borohydride (11.9 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was ted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The t was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) and crystallized (hexane/ethyl acetate) to give the title compound (6.2 mg).
MS (API+): [M+H]+ 462.2. 1H NMR (400 MHz, CDClg) 5 0.92—0.99 (1H, m), 1.10 (1H, dt, J = 9.2, 4.8 Hz), 1.91 (1H, ddd, J = 9.2, 5.9, 3.2 Hz), 2.33—2.39 (1H, m , 3.84—3.94 (2H, m), 6.98 (2H, d, J = 8.6 Hz), 7.22—7.35 (5H, m), 7.43—7.54 (5H, m), 7.54-7.60 (1H, m), 7.63 (1H, d, J ll 7.8 Hz), 7.82—7.91 (3H, m), 8.01 (1H, s), 8.07 (1H, s), 8.15 (1H, s).
.Example 32 N—{4—[trans—2-(benzylamino)cycloproplephenyl}—3—piperidin—1- ylbenzamide My E 322 X\T"L§;~2L sad—4A Nox,.
[0313] A) tert—butyl {trans-2—[4-({[3—(piperidin—1— yl)phenyl]carbonyl}amino)phenyl]cyclopropyl}carbamate To a solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyl]carbamate (105 mg) bed in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (3 mL) were added 3—(piperidin-l-yl)benzoic acid (105 mg) described in a document (J. Med. Chem. 1997, 40, 331.), N— ethyl—N’—(3—dimethylaminopropyl)carbodiimide hydrochloride (81 mg), 1-hydroxybenzotriazole (57.2 mg) and ylamine (59 uL).
The mixture was stirred at room temperature overnight and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The t was evaporated under reduced presSure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (142 mg). 1H NMR (400 MHz, DMSO—ds) 5 .11 (2H, m), 1.35—1.41 (9H, m), 1.51—1.60 (2H, m), 1.63 (4H, d, J = 4.9 Hz), 1.87 (1H, brs), 2.55-2.63 (1H, m), 3.18—3.24 (4H, m), 4.83 (1H, s), 7.06 (2H, d, J = 8.6 Hz), 7.09—7.15 (1H, m), 7.28-7.35 (2H, m), 7.42 (1H, s), 7.63 (2H, d, J = 8.6 Hz), 10.06 (1H, s).
B) N—{4—[trans-2~aminocyclopropyl]phenyl}~3—(piperidin—l— y1)benzamide dihydrochloride tert—Butyl {trans—2—[4—({[3—(piperidin—1— y1)phenyl]carbonyl}amino)phenyl]cyclopropyl}carbamate (142 mg) was dissolved in 4N hydrochloric acid/ethyl e solution (2 mL), and the mixture was stirred at room temperature for 3 hr.
The solvent was evaporated under reduced pressure to give the title compound (121 mg). 1H NMR (400 MHz, DMSO-dE) 5 1.14—1.27 (1H, m), 1.31—1.45 (1H, m), 1.63 (2H, brs), 1.81 (4H, brs), 2.25—2.36 (1H, m), 2.79 (1H, brs), .48 (4H, m), 7.15 (2H, d, J = 8.8 Hz), 7.26 (1H, s), 7.52 (2H, brs), 7.71 (2H, d, J = 8.6 Hz), 8.38—8.53 (3H, m), .31 (1H, brs).
[0315] C) N—{4—[trans—2-(benzylamino)cyclopropyl]phenyl}—3—(piperidin— 1—y1)benzamide To a solution of N—{4—[trans—Z—aminocyclopropyl]phenyl}— 3e(piperidin—l—yl)benzamide dihydrochloride (64.2 mg) in ol (2 mL) were added benzaldehyde (16 uL) and sodium hydrogen carbonate (19.8 mg). The reaction mixture was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium.borohydride (8.9 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was ted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (51.0 mg).
MS (API+): [M+H]+ 426.3. 1H NMR (400 MHz, CDC13) 5 0.92—0.99 (1H, m), 1.10 (1H, dt, J = 9.4, 4.7 Hz), 1.55—1.63 (2H, m), 1.71 (4H, quin, J = 5.6 Hz), 1.88—1.94 (1H, m), 2.36 (1H, dt, J = 7.2, 3.6 Hz), 3.19—3.25 (4H, m), 3.84-3.93 (2H, m), 6.97 (2H, d, J = 8.6 Hz), 7.07 (1H, dd, J = 8.2, 2.6 Hz), 7.17 (1H, d, J = 7.6 Hz), 7.22—7.35 (6H, m), 7.45 (1H, t, J = 2.0 Hz), 7.50 (2H, d, J = 8.6 Hz), 7.79 (1H, brs).
Example 33 N—{4—[trans—2—(benzylamino)cyclopropy1]pheny1}—3—(2— oxopiperidin—l-yl)benzamide er’\x\< H A A) 3—(2—oxopiperidin—1—yl)benzoic acid To a solution of methyl 3—(2—oxopiperidin—l—yl)benzoate (114 mg) described in a document (J. Med. Chem. 1997, 40, 331.) in THE (3.0 mL) — water (0.5 mL) was added lithium hydroxide monohydrate (61.5 mg). The mixture was stirred at room temperature ght, and 10% citric acid solution was added.
The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title nd (34.7 mg). 1H NMR (400 MHz, DMSO—d6) 6 1.67—1.98 (4H, m), 2.40 (2H, t, J = 6.5 Hz), 3.63 (2H, t, J = 5.5 Hz), 7.39—7.60 (2H, m), 7.73—7.90 (2H, m), 12.39 (1H, brs).
B) tert—butyl {trans—2—[4—({[3—(2—0xopiperidin—1— yl)phenyl]carbonyl}amino)phenyl]cyclopropyl}carbamate To a on of utyl [trans—2—(4e aminophenyl)cyclopropyl]carbamate (230 mg) described in a nt (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (7 mL) were added 3—(2—oxopiperidin—1—yl)benzoic acid (169 mg), N—ethyl-N’—(3—dimethylaminopropyl)carbodiimide hydrochloride (177 mg), 1—hydroxybenzotriazole (125 mg) and triethylamine (128 uL). The mixture was stirred at room temperature overnight and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column tography (hexane/ethyl acetate) to give the title compound (53.4 mg). 1H NMR (400 MHz, CDCl3) 5 1.09—1.18 (2H, m), 1.46 (9H, s), 1.81-1.91 (2H, m), 1.91~2.07 (3H, m), 2.58 (2H, t, J = 5.5 Hz), 2.69 (1H, brs), 3.65 (2H, brs), 4.90 (1H, brs), 7.11 (2H, d, J = 8.6 Hz), 7.32—7.38 (1H, m), 7.38—7.46 (1H, m), 7.53 (2H, d, J = 8.6 Hz), .75 (2H, m), 8.40 (1H, brs).
C) N—{4—[trans—2—aminocyclopropyl]phenyl}—3—(2—oxopiperidin—1— yl)benzamide hydrochloride A mixed on of tert-butyl {trans—2—[4-({[3—(2— oxopiperidin—l—yl)phenyl]carbonyl}amino)phenyl]cyclopropyl}- carbamate (53.4 mg) in 4N hydrochloric thyl acetate solution (2 mL) was d at room temperature for 2 hr. The solvent was evaporated under d pressure to give the title compound (38.5 mg). 1H NMR (400 MHz, CDgDD) 5 1.31—1.48 (2H, m), 1.96—2.08 (4H, m), 2.39 (1H, brs), 2.58 (2H, t, J = 6.2 Hz), 2.82—2.90 (1H, m), 3.76 (2H, t, J = 5.6 Hz), 7.21 (2H, d, J = 8.6 Hz), 7.49—7.55 (1H, m), 7.56—7.63 (1H, m), 7.67 (2H, d, J = 8.6 Hz), 7.81—7.92 (2H, m).
D) N~{4—[trans—2—(benzylamino)cyclopropyl]phenyl}—3—(2— oxopiperidin—l—yl)benzamide To a solution of trans—Z—aminocyclopropyl]phenyl}— 3~(2-oxopiperidin—l—yl)benzamide hydrochloride (27.1 mg) in methanol (l mL) were added benzaldehyde (7.14 uL) and sodium hydrogen carbonate (8.9 mg). The mixture was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (4.0 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium e. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (10.9 mg).
MS (API+): [M+H]+ 440.3. 1H NMR (400 MHz, CDCl3) 5 0.92—0.99 (1H, m), 1.10 (1H, dt, J = 9.2, 4.8 Hz), 1.88—2.01 (6H, m), 2.33—2.39 (1H, m), 2.58 (2H, t, J = 5.7 Hz), 3.61—3.69 (2H, m), 3.89 (2H, d, J = 1.7 Hz), 6.97 (2H, d, J = 8.6 Hz), 7.22—7.37 (6H, m), 7.39—7.45 (1H, m), 7.51 (2H, d, J = 8.6 Hz), 7.68—7.73 (2H, m), 8.35 (1H, brs).
Example 34 N—{4—[trans-2—(benzylamino)cyclopropyl]phenyl}—3—(2— phenylethyl)benzamide A) tert-butyl {trans—2-[4—({[3-(2- phenylethyl)phenyl]carbonyl}amino)phenyl]cyclopropyllcarbamate By a method similar to Example 28, Step A, the title compound (232 mg) was obtained from utyl [trans—2—(4— aminophenyl)cyclopropyl]carbamate (191 mg) and 3—(2— phenylethyl)benzoic acid (145 mg). 1H NMR (300 MHz, DMSO—ds) 5 0.98—1.13 (2H, m), 1.38 (9H, s), 1.82-1.93 (1H, m), 2.58 (1H, brs), 2.87—3.02 (4H, m), 7.06 (2H, d, J = 8.3 Hz), 7.14—7.32 (6H, m), 7.36 (2H, d, J = 8.3 Hz), 7.65 (2H, d, J = 8.7 Hz), 7.86 (2H, d, J = 8.3 Hz), 10.08 (1H, s).
B) N—[4—(trans—Z—aminocyclopropyl)phenyl]—3—(2— phenylethyl)benzamide hloride By a method similar to Example 1, Step B, the title compound (154 mg) was obtained from tert-butyl {trans—2—[4— ({[3-(2—phenylethy1)phenyl]carbonyl}amino)pheny1]cyclopropyl}— carbamate (232 mg). 1H NMR (300 MHz, DMSO—ds) 6 1.11—1.25 (1H, m), 1.30—1.41 (1H, m), 2.21—2.36 (1H, m), 2.73—2.83 (1H, m), 2.86—3.02 (4H, m), .40 (9H, m), 7.70 (2H, d, J = 8.7 Hz), 7.85 (2H, d, J = 8.3 Hz), 8.34 (3H, brs) 10.14 (1H, s).
C) N—{4-[trans(benzylamino)cyclopropyl]phenyl}—3—(2— phenylethyl)benzamide By a method r to Example 1, Step C, the title compound (85.4 mg) was obtained from N-[4—(trans-2— aminocyclopropyl)phenyl]~3—(2-phenylethyl)benzamide hydrochloride (100 mg). 1H NMR (300 MHz, DMSO—ds) 5 0.83—1.03 (2H, m), 1.80 (1H, ddd, J = 9.0, 5.8, 3.0 Hz), 2.18 (1H, dt, J = 6.7, 3.6 Hz), 2.83—3.03 (4H, m), 3.77 (2H, s), 6.94 (2H, d, J = 8.3 Hz), 7.13 — 7.40 (12H, m), 7.60 (2H, d, J = 8.7 Hz), 7.85 (2H, d, J = 8.3 Hz), .04 (1H, s).
Example 35 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}bipheny1-4~ carboxamide A) tert—butyl (trans—2—{4—[(biphenyl ylcarbonyl)aminOJphenyl)cyclopropyl)carbamate To a solution of tert—butyl [trans—2-(4— aminophenyl)cyclopropyl]carbamate (150 mg) bed in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile .20 (6 mL) were added yl—4—carboxylic acid (100 mg), N—ethyl— N’—(3—dimethylaminopropyl)carbodiimide hydrochloride (116 mg), 1—hydroxybenzotriazole (82 mg) and triethylamine (84 uL). The e was stirred at room temperature overnight and water was added. The e was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was recrystallized (methanol/ethyl acetate) to give the title compound (131 mg).
MS (API+): [M—tBu+2H]+ 373.2.
[0330] B) N—[4—(trans—Z—aminocyclopropyl)phenyl]biphenyl-4—carboxamide hydrochloride tert—Butyl (trans—2—{4-[(biphenyl—4— ylcarbonyl)amino]phenyl}cyclopropyl)carbamate (154 mg) was dissolved in 4N hydrochloric thyl acetate solution (2 mL), and the e was stirred at room temperature for 2 hr. The solvent was evaporated under reduced pressure to give the title compound (81.9 mg).
MS (API+): [MJFH]+ 329.2.
[0331] C) N—{4-[trans—Z—(benzylamino)cyclopropyl]phenyl}biphenyl—4— carboxamide To a solution of N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—4—carboxamide hydrochloride (82 mg) in methanol (2 mL) were added benzaldehyde (25 uL) and sodium hydrogen carbonate (31.5 mg). The reaction mixture was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (14.2 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was ated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl e) to give the title compound (6.4 mg).
Ms (API+): [M+H]+ 419.2. 1H NMR (400 MHz, DMSO‘de) 6 0.88 — 1.03 (2H, m), 1.81 (1H, s), 2.16 — 2.24 (1H, m), 3.77 (2H, s), 6.97 (2H, d, J = 8.6 Hz), 7.22 (1H, d, J = 6.9 Hz), 7.27 — 7.34 (4H, m), 7.44 (1H, d, J = 7.3 Hz), 7.48 — 7.55 (2H, m), 7.64 (2H, d, J= 8.6 Hz), 7.74 — 7.79 (2H, m), 7.83 (2H, d, J = 8.6 Hz), 8.04 (2H, d, J = 8.6 Hz), 10.19 (1H, s).
Example 36 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}biphenyl—3— carboxamide 347% rt ‘3‘, , [1”‘ \wf”#°/g‘2 .u fi?« i 55 i ‘1 ‘x55’ nee{(1 “w.
WQFHM/mk?x§§H J J A) tert—butyl (trans—2-{4—[(biphenyl—3— ylcarbonyl)amino]phenyl}cyclopropyl)carbamate To a solution of tert—butyl [trans—Z—(4— aminophenyl)cyclopropyl]carbamate (100 mg) described in a document (J. Am. Chem. Soc., 2010, 132, 6827.) in acetonitrile (4 mL) were added biphenyl—B—carbonyl chloride (131 mg) and triethylamine (61.1 mg). The mixture was stirred at room temperature ght and water was added. To the reaction mixture was added ethyl acetate, and the resulting solid was ted by filtration to give the title compound (154 mg).
MS (API+): [M—tBu+2H]+ 373.2.
[0335] B) trans—2—aminocyclopropyl)phenyl]biphenyl—B—carboxamide hloride tert—Butyl (trans-2—{4—[(biphenyl—3— ylcarbonyl)amino]phenyl}cyclopropyl)carbamate (154 mg) was dissolved in 4N hydrochloric acid/ethyl acetate solution (2 mL), and the mixture was stirred at room temperature for 2 hr. The solvent was evaporated under reduced pressure to give the title compound (130 mg).
MS (API+): [M+H]+ 329.2.
[0336] C) N—{4—[trans—Z-(benzylamino)cyclopropyl]phenyl}biphenyl—3— carboxamide To a solution of N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—3—carboxamide hydrochloride (130 mg) in methanol (4 mL) were added benzaldehyde (40 uL) and sodium hydrogen carbonate (49.9 mg). The e was stirred at 70°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (22.5 mg) was added. The mixture was stirred for 1 hr and water was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was recrystallized (hexane/ethyl acetate) to give the title compound (60.4 mg).
MS : [M+CH3CN+H]+ 460.4. 1H NMR (400 MHz, e) 6 0.85—1.06 (2H, m), 1.76—1.86 (1H, m), 2.16-2.23 (1H, m), 2.81—2.96 (1H, m), 3.77 (2H, s), 6.97 (2H, d, J = 8.6 Hz), 7.18~7.26 (1H, m), 7.26—7.35 (4H, m), 7.43 (1H, d, J: 7.3 Hz), 7.49—7.56 (2H, m), 7.63 (3H, d, J = 8.3 Hz), 7.77 (2H, d, J: 7.3 Hz), 7.90 (2H, dd, J = 18.3, 7.8 Hz), 8.20 (1H, 3), 10.24 (1H, s).
[0337] Example 37 N—{4—[trans—2—(benzylamino)cyclopropyl]phenyl}biphenyl—4— carboxamide oroacetate (.3: TF8 HAG To a solution of N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—4—carboxamide hydrochloride (26 mg) and benzaldehyde (10 mg) in methanol (1 mL) was added acetic acid (0.1 mL), and the mixture was stirred at 45°C for 1 hr and 2—picoline borane (17 mg) was added. The mixture was d at 60°C overnight, and the t was evaporated by an air blowing apparatus. The residue was purified by HPLC (C18, mobile phase: water/acetonitrile (with 0.1% TFA)) to give the title compound (3.3 mg).
MS (API+): [M+H]+ 419.3 The compounds produced by the method described in the above—mentioned Example 37 or a method ous thereto are shown in the following Tables. In the Tables, MS shows measured values.
[ Table 1—3] IUPAC name MS trans—2— [(Pyridin—3— ylmethyl)amino]— cyclopropyl}— phenyl)biphenyl—4— carboxamide lHHHHHHH! 420.3 N—(4—{trans—2— [(pyridin—4— ylmethyl)amino]~ 2CF3COOH 420.3 cyclopropyl}— phenyl)biphenyl—4— carboxamide N—(4—{trans~2— [(cyclopropyl— methyl)amino]— cyclopropyl}— phenyl)biphenyl—4— carboxamide IHHHHHHHI 383.3 N—(4—{trans—2-[(3~ ybenzyl)— amino]cyclo— CF3COOH 449.3 propyl}phenyl)— biphenyl—4— amide N—(4—{trans—2—[( benzodioxol~5~ ylmethyl)amino]— CF3COOH 463.3 cyclopropyl}— phenyl)biphenyl~4~ carboxamide N—(4—{trans—2—[(4~ methoxybenzyl)— amino]cyclo— biphenyl—4— carboxamide N—(4—{trans—2—[ (2— O aminoethyl)— amino]cyclo— O 2CF3COOH 372.3 propyl}phenyl)— biphenyl—4— carboxamide H N—{4—[trans—2— (cyclooctylamino )cyclo— O H N H 439.3 ]phenyl}— biphenyl—4~ carboxamide [Table 1—4] N— (4—{trans—2—[ (3, 4~ O dimethoxy— benzyl)amino]cyclo— CF3COOH propyl}phenyl)— biphenyl—4— carboxamide N—(4—{trans—2—[(1— ethyl)amino]— cyclopropyl}phenyl)— CF3COOH biphenyl—4— carboxamide N—(4—{trans~2~[(2— methoxy—l—methyl— ethyl)amino]cyclo~ propyl}phenyl)~ biphenyl—4— carboxamide N—(4—{trans—2—[(l— ethylpropyl)amino]- cyclopropyl}phenyl)— CF3COOH 399.3 biphenyl—4— carboxamide N—(4—{trans—2—[(1— methylpiperidin—4— yl)amino]cyclo— 2CF3COOH 426.4 propy1}phenyl>— biphenyl—4— carboxamide N—(4—{trans—2—[(l— benzylpiperidin~4~ yl)am1no]cyclo. H 2CF3COOH 502.4 propyl}phenyl)— biphenyl~4— amide N—{4—[trans—2—{[2— (benzyloxy)ethyl]— amino}cyclopropyl]— H 463.3 phenyl}biphenyl—4— amide N—(4-{trans—2—[( dichloro- H benzyl)amino]— CF3COOH 487.3 cyclopropyl}phenyl)— biphenyl—4— carboxamide [Table 1—5] N~ {4— [trans--2— {[ methoxypyridin—3—6 H yl)methyl]amin°}' 2CF3COOH 450. 3 cyclopropyl]— }biphenyl—4— carboxamide allyl 4—{[trans—2— {4—[(biphenyl—4—yl— carbonyl)amino]— phenyl}cyclo— H 496.4 propyl]amino}— piperidine—l— carboxylate N-(4—{trans—2—[(l— methyl—2— phenoxyethyl)— amino]cyclo— CF3COOH 463.3 propyl}phenyl)— biphenyl—4— carboxamide Example 57 N—{4—[trans-Z—(benzylamino)cyclopropyl]phenyl}de— [(benzyloxy)carbonyl]—L—phenylalaninamide hydrochloride .:>=
[0346] To a mixture of N—[4—(trans—Z-aminocyclopropyl)phenyl]- Nd-[(benzyloxy)carbonyl]—L-phenylalaninamide hydrochloride (100 mg) described in a document (J. Am. Chem. Soc. 2010, 132, 6827.), sodium hydrogen ate (27.0 mg), and methanol (2.00 mL) was added benzaldehyde (0.022 mL), and the mixture was d at 70°C for 1 hr. The reaction mixture was cooled in an ice bath, sodium.borohydride (12.2 mg) was added and the mixture was stirred at 0°C for 1.5 hr. The reaction mixture was diluted with ated THF (4.00 mL), and cooled in an ice bath, and sodium dride (8.12 mg) was added. The ice bath was removed, and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with methanol (2.00 mL) and dehydrated THF (2.00 mL), and cooled in an ice bath, sodium borohydride (8.12 mg) was added, and the mixture was stirred at 0°C for 3 hr. To the reaction mixture was added saturated aqueous sodium hydrogen carbonate, and the mixture was concentrated under reduced pressure. To the residue was added water, and the mixture was extracted twice with ethyl acetate. The organic layers were combined, washed with saturated brine, dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column tography (hexane/ethyl acetate), and the fractions containing the object product were combined and concentrated. The e was dissolved in methanol (5.00 mL), 10% hydrochloric acid methanol solution (1.00 mL) was added, and the mixture was concentrated under reduced pressure to give the title compound (82.3 mg).
Ms (API+): [M+H]+ 520.4. 1H NMR (300 MHz, CEhOD) 5 .41 (1H, m), 1.49 (1H, ddd, J = 10.5, 6.6, 4.4 Hz), 2.42 (1H, ddd, J = 10.2, 6.6, 3.5 Hz), 2.89—3.03 (2H, m), 3.03—3.19 (1H, m), 4.37 (2H, s), 4.48 (1H, t, J = 7.5 Hz), 4.97—5.12 (2H, m), 7.05 (2H, d, J = 8.5 Hz), 7.14— 7.35 (10H, m), 7.35-7.54 (7H, m). e 58 N—{4-[trans—2—(benzylamino)cyclopropyl]phenyl}—Nd— [(benzyloxy)carbonyl]-D—phenylalaninamide hydrochloride o .f HCI To a mixture of N—[4—(trans-2—aminocyclopropyl)phenyl]— Nd—[(benzyloxy)carbonyl]—D—phenylalaninamide hydrochloride (100 .5 mg) described in a document (J. Am. Chem. Soc. 2010, 132, 6827.), sodium hydrogen carbonate (27.0 mg), and methanol (4.00 mL) was added benzaldehyde (0.022 mL), and the mixture was stirred at 70°C for 1 hr. The reaction mixture was diluted with dehydrated THF (6.00 mL), and cooled in an ice bath.
Sodium borohydride (24.4 mg) was added and the mixture was stirred at 0°C for 2 hr. To the reaction mixture was added saturated aqueous sodium en carbonate, and the mixture was concentrated under reduced pressure. Water was added to the residue, and the e was extracted twice with ethyl acetate. The organic layers were combined, washed with saturated brine, dried over anhydrous magnesium sulfate and concentrated under d pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate), and the fractions containing the object product were combined and concentrated. The e was dissolved in methanol (5.00 mL), % hydrochloric acid methanol solution (1.00 mL) was added, 'and the mixture was concentrated under reduced re to give the title compound (84.6 mg).
MS : [M+H]+ 520.4. 1H NMR (300 MHz, CDyDD) 5 1.25—1.41 (1H, m), 1.42—1.55 (1H, m), 2.35—2.48 (1H, m), 2.88-3.03 (2H, m), 3.03—3.20 (1H, m), 4.37 (2H, s), 4.47 (1H, t, J = 7.4 Hz), 4.96—5.13 (2H, m), 7.05 (2H, d, J = 8.5 HZ), 7.15-7.36 (10H, m), 7.36-7.53 (7H, m).
In the following Examples, description of salts (e.g., HCl, 2HC1, TFA, 2TFA) in the structural formulas is omitted.
Example 59 N—(4—{trans—2— [(cyclopropylmethyl)amino}cyclopropyl}phenyl)biphenyl-4P carboxamide hydrochloride 2:1: N//\\K;7H A on of trans—2- aminocyclopropyl)phenyl]biphenyl—4—carboxamide hloride (2.2 g) in methanol (75 mL)/THF (75 mL) was ice—cooled, and ropanecarbaldehyde (549 mg) and sodium hydrogen carbonate (1.01 g) were added. The mixture was stirred at 60°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (456 mg) was added.
The mixture was stirred for 1 hr, and saturated aqueous sodium hydrogen carbonate solution was added. The mixture was ted with ethyl acetate, and the extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate, ethyl acetate/methanol). 10% Hydrochloric acid methanol solution was added and the solvent was evaporated under reduced pressure. The residue was tallized from methanol/diisopropyl ether to give the title compound (1.62 g).
MS (API+): [M+H]+ 383.1. 1H NMR (300 MHz, CDyDD)5 0.38—0.48 (2H, m), 0.69—0.78 (2H, m), 1.06—1.21 (1H, m), 1.35—1.55 (2H, m), 2.47 (1H, ddd, J = 10.1, 6.5, 3.5 Hz), 2.96—3.04 (1H, m), 3.09 (2H, dd, J = 7.5, 2.1 Hz), 7.21 (2H, d, J = 8.7 Hz), 7.36—7.44 (1H, m), 7.45—7.53 (2H, m), 7.65—7.73 (4H, m), 7.78 (2H, d, J = 8.5 Hz), 8.02 (2H, d, J = 8.7 Hz).
[0353] Example 60 N—(4—{trans—2— [bis(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— amide hydrochloride
[0354] Q; 5;»; 2'" V. w a. a: 1 [3 “i ' 7g. " . . N'Kgifr 5““? 59%...»1‘QKH .75.4; To a solution of N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—4—carboxamide hydrochloride (100 mg) in methanol (5.4 mL) were added acetic acid (0.6 mL), cyclopropanecarbaldehyde (0.023 mL) and 2—picoline—borane complex (44 mg). The mixture was stirred at room temperature for 21 hr, and DMF (4 mL) and 2—picoline—borane complex (29.3 mg) were added. The mixture was d at room temperature for 2 hr, and ropanecarbaldehyde (0.010 mL) was added.
The mixture was stirred at room temperature for 3 hr, and cyclopropanecarbaldehyde (0.008 mL) was added- The mixture was stirred at room temperature for 1 hr, water and ethyl acetate were added, and the mixture was concentrated under reduced pressure. To the e was added saturated aqueous sodium hydrogen carbonate solution, and the mixture was extracted twice with ethyl acetate. The extracts were combined, washed with saturated brine, and dried over anhydrous magnesium sulfate. The solvent was ated under reduced pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl acetate), and 10% hydrochloric acid methanol solution (1.0 mL) was added to the obtained t. The solvent was evaporated under reduced pressure to give the title compound (26.1 mg).
MS (API+): [M+H]+ 437.3. 1H NMR (300 MHz, CDyDD) 5 0.27—0.61 (4H, m), 0.61—0.96 (4H, m), 1.03—1.39 (2H, m), 1.52 (1H, brs), 1.77 (1H, brs), 2.71 (2H, s), .55 (4H, m), 7.20 (2H, d, J = 7.6 Hz), 7.34—7.55 (3H, m), 7.63-7.84 (6H, m), 8.03 (2H, d, J = 8.1 Hz).
[0356] Example 61 N—{4—[trans—2—(tetrahydro—2H—pyran—4— ylamino)cyclopropyl]phenyl}biphenyl—4—carboxamide hydrochloride as?“ By a method similar to Example 59, the title compound (39 mg) was ed from trans—2— aminocyclopropyl)phenyl]biphenyl—4—carboxamide hydrochloride (120 mg) and tetrahydro-4H—pyran-4—one (32.9 mg).
MS (API+): [M+H]+ 413.4. 1H NMR (300 MHz, CD30D)6 1.37—1.58 (2H, m), 1.64—1.83 (2H, m), 2.10 (2H, d, J = 11.6 Hz), 2.42-2.57 (1H, m), 2.93—3.05 (1H, m), 3.41—3.67 (3H, m), 4.04 (2H, d, J = 8.1 Hz), 7.21 (2H, d, J = 8.0 Hz), 7.34—7.55 (3H, m), 7.65—7.82 (6H, m), 8.01 (2H, d, J = 8.1 Hz).
Example 62 N-(4—{trans-2—[(l—acetylpiperidin-4— yl)amino]cyclopropyl}phenyl)bipheny1—4—carboxamide hydrochloride :3?" i. E €1.11.fo g H 3% ‘ a r” ‘ 972*" . i By a method r to Example 59, the title compound (31 mg) was obtained from N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—4-carboxamide hydrochloride (120 mg) and l—acetylpiperidin—4—one (46.4 mg).
MS (API+): [M+H]+ 454.3. 1H NMR z, CDjDD)5 .88 (5H, m), 2.03—2.43 (5H, m), 2.51—3.16 (3H, m), 3.50—3.87 (1H, m), .25 (1H, m), 4.49— 4.78 (1H, m), 7.19—7.53 (5H, m), 7.66-7.81 (6H, m), 8.03 (2H, d, J = 7.4 Hz).
Example 63 N—{4-[trans-2—{[l—(2,2,2—trifluoroethyl)piperidin—4— yl]amino}cyclopropyl]phenyl}biphenyl—4—carboxamide hydrochloride "v’fJ-NQ' r I? 1~§3/-iK‘W:/;?§Kg i | . "i232" \ m‘ ’“~’ ' -- ~ G v", F ..... 1/; 5.
[0364] By a method similar to Example 59, the title compound (23 mg) was obtained from N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—4—carboxamide hydrochloride (164 mg) and l-(2,2,2-trifluoroethyl)piperidin—4-one (91 mg).
MS (API+): [M+H]+ 494.3 1H NMR (300MHz, CDyDD)5 1.43—1.60 (2H, m), 1.82—1.98 (2H, m), 2.20-2.32 (2H, m), 2.45—2.57 (1H, m), 2.69—2.85 (3H, m), 2.98— 3.06 (1H, m), 3.36—3.75 (4H, m), 7.23 (2H, d, J = 8.6 Hz), 7.39—7.44 (1H, m), 7.47-7.53 (2H, m), .73 (4H, m), 7.79 (2H, d, J = 8.7 Hz), 8.01-8.06 (2H, m).
Example 64 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—N— methylbiphenyl—4—carboxamide hydrochloride
[0367] A) tert—butyl (trans—2—{4—[(biphenyl—4- ylcarbonyl)(methyl)amino]phenyl}cyclopropyl)(cyclopropylmethyl) carbamate To a solution of trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl-4— carboxamide hydrochloride (90 mg) and triethylamine (43.5 mg) in THF (2 mL) was added di—tert—butyl dicarbonate (60.9 mg) under ice—cooling. The mixture was stirred at room temperature ght and water was added. The mixture was ted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium e. The solvent was ated under reduced pressure. The residue was dissolved in DMF (2.5 mL), sodium hydride (12.9 mg) was added under ice— cooling, and the mixture was stirred for 1 hr. To the reaction mixture was added methyl iodide (52.9 mg) under ice—cooling, and the mixture was stirred at room temperature overnight, and poured into saturated aqueous sodium en carbonate solution. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl e) to give the title compound (105 mg).
MS (API+): [M—tBu+2H]+ 441.3.
B) N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— N—methylbiphenyl—4—carboxamide hloride To a solution of tert—butyl (trans-2—{4—[(biphenyl—4— ylcarbonyl)(methyl)amino]phenyl}cyclopropyl)(cyclopropylmethyl) carbamate (248 mg) in THF (5 mL) was added 10% hydrochloric acid methanol (20 mL) under ice—cooling, and the mixture was stirred at room temperature overnight. The solvent was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl.ether to give the title compound (62 mg).
MS (API+): [M+H]+ 397.3. 1H NMR (300 MHz, CDyDD) 5 0.19—0.29 (2H, m), 0.50—0.61 (2H, m), 0.87—1.02 (1H, m), 1.16—1.30 (1H, m), 1.31—1.43 (1H, m), 2.30 (1H, ddd, J = 10.2, 6.5, 3.7 Hz), 2.82 (1H, dt, J = 7.8, 4.0 Hz), 2.90 (2H, d, J = 7.5 Hz), 3.37 (3H, s), 6.97-7.08 (4H, m), 7.19—7.41 (7H, m), .48 (2H, m).
Example 65 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—3— (trifluoromethyl)benzamide hydrochloride
[0370] To a solution of N—[4—(trans—Z-aminocyclopropyl)phenyl]- 3—(trifluoromethyl)benzamide hloride (150 mg) in methanol (10 mL)/THF (10 mL) were added cyclopropanecarbaldehyde (38.3 mg) and sodium hydrogen carbonate (70.6 mg). The mixture was d at 60°C for 1 hr, and ice~cooled to 0°C and sodium borohydride (31.8 mg) was added. The mixture was stirred at room temperature for 2 hr, and ice—cooled to 0°C, and aqueous sodium hydrogen carbonate on was added. The mixture was extracted with ethyl acetate, and the extract was washed with water and saturated brine and dried over anhydrous sodium e. The solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (ethyl acetate/methanol). To the obtained product was added 10% hydrochloric acid methanol solution, and the solvent was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (79 mg).
MS (1091+): [M+H]+ 375.2. 1H NMR (300MHz, CD3OD)6 0.42 (2H, m), 0.68—0.78 (2H, m), 1.05— 1.18 (1H, m), 1.34—1.54 (2H, m), 2.46 (1H, ddd, J = 10.2, 6.5, 3.3 Hz), 2.98 (1H, m), 3.08 (2H, dd, J = 7.5, 2.1 Hz), 7.20 (2H, d, J = 8.5 Hz), 7.63—7.77 (3H, m), 7.89 (1H, d, J = 7.7 Hz), 8.13—8.28 (2H, m).
[0372] Example 66 N—(4—{trans—2—[(1H—imidazol—4— ylmethyl)amino]cyclopropyl}phenyl)biphenyl-4—carboxamide dihydrochloride
[0373] if”? z ,1 Her .‘rfh‘x .
H g; 3 H By a method r to Example 59, the title compound (78 mg) was obtained from N—[4—(trans—2— aminocyclopropyl)phenyl]biphenyl—4-carboxamide hydrochloride (150 mg) and 1H—imidazole—4—carbaldehyde (39.5 mg).
MS (API+): [M+H]+ 409.0. 1H NMR (300MHz, CD3OD)5 1.40—1.49 (1H, m), 1.60 (1H, ddd, J = .6, 6.7, 4.3 Hz), 2.51-2.61 (1H, m), 3.08 (1H, dq, J = 4.3, 3.2 Hz), 4.61 (2H, d, J = 2.1 Hz), 7.16 (2H, d, J = 8.5 Hz), .43 (1H, m), 7.44—7.52 (2H, m), 7.65—7.73 (4H, m), 7.75— 7.82 (3H, m), 8.01 (2H, d, J = 8.5 Hz), 9.02 (1H, d, J = 1.1 Hz). e 67 N—(4—{trans—2—[(2—fluorobenzyl)amino]cyclopropyl}phenyl)—3— (trifluoromethyl)benzamide hydrochloride
[0377] By a method similar to Example 65, the title compound (90 mg) was obtained from N—[4-(trans—Z—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (120 mg) and 2— fluorobenzaldehyde (54.3 mg).
MS (API+): [M+H]+ 429.0. 1H NMR (300MHz, CDfiDD)5 1.36—1.55 (2H, m), 2.36—2.48 (1H, m), 3.03 (1H, dt, J = 7.5, 3.8 Hz), 4.47 (2H, s), 7.15 (2H, d, J = 7.9 Hz), 7.20—7.34 (2H, m), 7.47-7.60 (2H, m), 7.63—7.80 (3H, m), 7.91 (1H, d, J = 7.9 Hz), 8.16—8.30 (2H, m).
[0378] Example 68 N—(4-{trans—2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—4— methylbenzamide hydrochloride A) 2,2,2—trichloroethy1 (4—{trans—2—[(tert— butoxycarbonyl)amino]cyclopropyl}phenyl)carbamate To a solution of tert—butyl [trans—2-(4— henyl)cyclopropy1]carbamate (16.8 g) described in a document (J. Am. Chem. Soc., 2010, 132, 6827.) and triethylamine (11.32 mL) in THF (338 mL) was added 2,2,2— trichloroethyl chloroformate (11.2 mL). The mixture was stirred at room temperature overnight, and poured into saturated aqueous ammonium chloride solution. The reaction e was ted with ethyl e, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate. The t was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (19.0 g). 1H NMR (300 MHz, CDCl3) 5 1.07—1.19 (2H, m), 1.45 (9H, s), 1.95—2.08 (1H, m), 2.68 (1H, brs), 4.81 (3H, brs), 6.84 (1H, brs), 7.11 (2H, d, J = 7.8 Hz), 7.31 (2H, d, J = 7.8 Hz).
[0381] B) 2,2,2—trichloroethyl [4—(trans—2— aminocyclopropyl)phenyl]carbamate hydrochloride Trichloroethyl (4—{trans—2—[(tert— butoxycarbony1)amino]cyclopropyl}phenyl)carbamate (19.0 g) was dissolved in 4N hydrochloric acid/cyclopentyl methyl ether solution (188 mL), and the mixture was stirred at room temperature for 3 hr. The solvent was evaporated under reduced pressure to give the title compound (16.2 g). 1H NMR (300 MHz, DMSO—ds) 5 1.09—1.22 (1H, m), 1.24-1.37 (1H, m), 2.16—2.30 (1H, m), 2.69—2.81 (1H, m), 4.93 (2H, s), 7.11 (2H, d, J = 8.3 Hz), 7.43 (2H, d, J = 8.3 Hz), 8.21 (3H, brs), .11 (1H, brs).
C) trichloroethyl (4—{trans—2—[(tert— butoxycarbonyl)(cyclopropylmethyl)amino]cyclopropyl}phenyl)— carbamate To a solution of 2,2,2—trichloroethyl ans—2— aminocyclopropy1)phenyl]carbamate hydrochloride (16.2 g) and sodium hydrogen carbonate (7.56 g) in THF (112 mL)/methanol (112 mL) was added cyclopropanecarbaldehyde (4.37 mL). The nfixture was stirred at 60°C for 2 hr, and ice—cooled to 0°C and sodium dride (3.4 g) was added. The mixture was stirred at room temperature for 1 hr, and di—tert—butyl dicarbonate (14.7 g) was added. The mixture was stirred at room temperature overnight, and poured into water. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate.
The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography e/ethyl acetate) to give the title compound (15.9 g). 1H NMR (300 MHz, DMSO-de) 5 0.05—0.15 (1H, m), 0.16—0.27 (1H, m), 0.32—0.51 (2H, m), 0.89—1.04 (1H, m), 1.12—1.25 (2H, m), 1.35 (9H, s), 2.00—2.08 (1H, m), 2.62—2.75 (1H, m), 2.99 (1H, dd, J = 14.2, 6.9 Hz), 3.17 (1H, dd, J = 14.2, 6.9 Hz), 4.93 (2H, s), 7.08 (2H, d, J = 8.7 Hz), 7.40 (2H, d, J = 8.1 Hz), 10.06 (1H, brs).
D) tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate To a solution of 2,2,2—trichloroethy1 (4—{trans—2—[(tert— butoxycarbonyl)(cyclopropylmethyl)amino]cyclopropy1}pheny1)- carbamate (15.9 g) in THE (166 mL) were added zinc powder (32.6 g) and acetic acid (5 mL). The on mixture was d at room temperature for 5 hr, 1N aqueous sodium ide solution (100 mL) and ethyl acetate (500 mL) were added, and the mixture was filtered through celite. The organic layer was separated from the mother liquor, washed successively with water and saturated brine, and dried over anhydrous magnesium e.
The solvent was evaporated under reduced re. The residue was purified by silica gel column chromatography (NH, hexane/ethyl acetate) to give the title compound (6.83 g). 1H NMR (300 MHz, DMSO—ds) 5 0.06—0.16 (1H, m), 0.16—0.26 (1H, m), 0.33—0.48 (2H, m), 0.89—1.12 (3H, m), 1.36 (9H, s), 1.85— 1.95 (1H, m), 2.53—2.60 (1H, m), 2.97 (1H, dd, J = 14.2, 6.8 Hz), 3.15 (1H, dd, J = 14.2, 6.8 Hz), 4.83 (2H, s), 6.46 (2H, d, J = 7.9 Hz), 6.80 (2H, d, J = 7.9 Hz). {0384] E) tert-butyl (cyclopropylmethyl)(trans—2—{4—[(4- methylbenzoyl)amino]phenyl}cyclopropyl)carbamate To a solution of utyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (75.0 mg) and triethylamine (41.5 uL) in THF (1.24 mL) was added 4— toluoyl chloride (39.4 uL). The mixture was stirred at room temperature overnight, and poured into saturated aqueous um chloride solution. The mixture was extracted with ethyl e, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure to give the title compound (104.3 mg). 1H NMR (300 MHZ, DMSO'dg) 5 0.06—0.16 (1H, m), 0.18-0.29 (1H, m), 0.34—0.51 (2H, m), 0.91—1.04 (1H, m), 1.11—1.25 (2H, m), 1.36 (9H, s), 2.01—2.11 (1H, m), 2.38 (3H, s), 2.67—2.76 (1H, m), 3.00 (1H, dd, J = 14.3, 7.0 Hz), 3.19 (1H, dd, J = 14.3, 7.1 Hz), 7.11 (2H, d, J = 8.1 Hz), 7.33 (2H, d, J = 7.7 Hz), 7.66 (2H, d, J = 8.2 Hz), 7.86 (2H, d, J = 7.7 Hz), 10.08 (1H, s).
F) N—(4—{trans—2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)- 4-methylbenzamide hloride tert—Butyl (cyclopropylmethyl)(trans—2—{4—[(4— methylbenzoyl)aminOJphenyl)cyclopropyl)carbamate (104.3 mg) was dissolved in 4N hydrochloric acid/cyclopentyl methyl ether solution (4 mL), and the mixture was stirred at room temperature overnight. The t was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (65.0 mg).
MS (API+): [M+H]+ 321.2. 1H NMR (300 MHz, DMSO—dg) 5 0.32—0.41 (2H, m), 0.52—0.63 (2H, m), .13 (1H, m), 1.21—1.32 (1H, m), 1.42-1.56 (1H, m), 2.38 (3H, s), 2.41—2.47 (1H, m), 2.84—3.04 (3H, m), 7.15 (2H, d, J = 7.6 Hz), 7.33 (2H, d, J = 7.6 Hz), 7.71 (2H, d, J = 7.9 Hz), 7.86 (2H, d, J = 7.9 Hz), 9.15 (2H, brs), 10.14 (1H, s).
Example 69 N—(4—{trans—2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)~4— (trifluoromethyl)benzamide hydrochloride By a method similar to Example 68, Steps E and F, the title compound (65.9 mg) was obtained from tert—butyl [trans—2— (4—aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (73.0 mg) and 4~(trifluoromethyl)benzoyl chloride (43.0 uL).
MS (API+): [M+H]+ 375.4. 1H NMR (300 MHz, DMSO“d5) 6 0.31—0.43 (2H, m), 0.50—0.64 (2H, n0, 1.01—1.15 (1H, m), .33 (1H, m), .60 (1H, m), 2.43—2.48 (1H, m), 2.83—3.03 (3H, m), 7.18 (2H, d, J = 8.2 Hz), 7.72 (2H, d, J = 8.2 Hz), 7.92 (2H, d, J = 8.2 Hz), 8.15 (2H, d, J = 8.2 Hz), 9.27 (2H, brs), 10.48 (1H, s).
Example 70 4—tert—butyl—N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)benzamide hydrochloride By a method r to Example 68, Steps E and F, the title compound (67.6 mg) was obtained from tert—butyl [trans—2— (4—aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (71.3 mg) and 4-tert—butylbenzoyl chloride (55.3 pL).
MS (API+): [M+H]+ 363.4. 1H NMR (300 MHZ, DMSO—ds) 5 .41 (2H, m), 0.53—0.65 (2H, m), 0.98—1.13 (1H, m), 1.21—1.29 (1H, m), 1.32 (9H, s), 1.41— 1.55 (1H, m), 2.39—2.48 (1H, m), 2.81—3.05 (3H, m), 7.15 (2H, d, J = 8.1 Hz), 7.54 (2H, d, J = 8.1 Hz), 7.71 (2H, d, J = 8.1 Hz), 7.88 (2H, d, J = 8.1 Hz), 9.16 (2H, brs), 10.16 (1H, s).
Example 71 4-(benzyloxy)—N—(4—{trans—2— opropylmethyl)amino]cyclopropyl}phenyl)benzamide hydrochloride 13:10 .35» "x 7}” "3%: :11. a ,2 :3? fingf‘de .
”Rx-“:3; C" [g \‘xj/r ‘\ _, 3 xix/7 N" N“ . .
By a method similar to Example 68, Steps E and F, the title compound (50.2 mg) was obtained from tert—butyl [trans—2— (4—aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (70.9 mg) and 4—(benzyloxy)benzoyl chloride (69.4 mg).
MS (API+): [M+H]+ 413.3. 1H NMR (300 MHz, DMSO—dg) 5 0.30—0.40 (2H, m), .63 (2H, m), 0.96-1.13 (1H, m), 1.21—1.32 (1H, m), 1.39—1.53 (1H, m), 2.42 (1H, m), 2.85-3.04 (3H, m), 5.21 (2H, s), 7.05—7.20 (4H, m), 7.30—7.51 (5H, m), 7.70 (2H, d, J = 7.8 Hz), 7.94 (2H, d, J = 8.2 Hz), 9.03 (2H, brs), 10.07 (1H, s).
Example 72 N—(4—{trans—2—[(1,3—thiazol-4— ylmethyl)amino]cyclopropyl}phenyl)(trifluoromethyl)benzamide dihydrochloride _§>q.
L I1 :1 , FWC ’J‘E‘Nt/“r Kr; " MHz/Tats} " ' E: E O_. ‘\éfi’k’\.‘.‘ “£773”; ,._ "7le \ “1;:I .\-., ‘WS.
[0397] By a method similar to Example 65, the title compound (40 mg) was ed from N—[4—(trans—Z—aminocyclopropyl)phenyl]*3— (trifluoromethyl)benzamide hloride (80 mg) and 1,3— thiazole—4—carbaldehyde (33 mg).
MS (API+): [M+H]+ 417.9. 1H NMR (300MHz, CD3OD)6 1.34—1.55 (2H, m), 2.40—2.50 (1H, m), 3.04 (1H, td, J = 4.3, 3.4 Hz), 4.58 (2H, s), 7.14 (2H, d, J = 8.5 Hz), 7.64—7.79 (4H, m), 7.90 (1H, d, J = 7.9 Hz), 8.16—8.29 (2H, m), 9.10 (1H, d, J = 1.9 Hz).
[0398] Example 73 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—2— fluoro—S—(trifluoromethyl)benzamide hydrochloride A) tert—butyl (cyclopropylmethyl)[trans(4—{[2—f1uoro—5— (trifluoromethyl)benzoyl]amino}pheny1)cyclopropyl]carbamate A solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (80.0 mg) and triethylamine (32.1 mg) in acetonitrile (3 mL) was ice— cooled, and 2—fluoro—5—(trifluoromethyl)benzoyl chloride (71.9 mg) was added. The mixture was stirred at room temperature for 2 hr, and poured into water under ice—cooling. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate.
The solvent was evaporated under reduced pressure. The e was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title nd (115 mg).
MS (2491+): [M—tBu+2H]+ 437.0. 1H NMR (300 MHz, CDC13) 5 .31 (2H, m), 0.37f0.54 (2H, m), 0.93—1.12 (1H, m), 1.22—1.30 (2H, m), 1.45 (9H, s), 2.07—2.16 (1H, m), 2.78—2.88 (1H, m), 2.90~3.13 (1H, m), .35 (1H, m), 7.16 (2H, d, J = 8.1 Hz), 7.28~7.38 (1H, m), 7.57 (2H, d, J = 8.0 Hz), 7.75—7.84 (1H, m), 8.38 (1H, d) J = 14.4 Hz), 8.49 (1H, d, J = 6.7 Hz).
B) N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}pheny1)— 2—fluoro—5—(trifluoromethyl)benzamide hloride A solution of tert—butyl (cyclopropylmethyl)[trans—2—(4— uoro(trifluoromethyl)benzoyl]amino}pheny1)— cyclopropy1]carbamate (110 mg) in THF (1 mL) was ice-cooled, and 4N hydrochloric acid/cyclopentyl methyl ether solution (15 mL) was added. The mixture was stirred at room temperature overnight and the solvent was evaporated under reduced pressure.
The residue was recrystallized from methanol/diisopropyl ether to give the title compound (72.0 mg).
MS (API+): [M+H]+ 393.0. 1H NMR (300 MHz, CDyDD) 5 0.38—0.48 (2H, m), .79 (2H, m), .18 (1H, m), 1.36—1.58 (2H, m), 2.49 (1H, ddd, J = 10.0, 6.5, 3.7 Hz), 2.96—3.04 (1H, m), 3.09 (2H, dd, J = 7.5, 2.1 Hz), 7.21 (2H, d, J = 8.7 Hz), 7.48 (1H, t, J = 9.2 Hz), 7.66 (2H, d, J = 8.7 Hz), 7.86—7.97 (1H, m), 8.04 (1H, dd, J = 6.2, 2.3 Hz).
Example 74 N-(4—{trans—2-[(1~benzylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide dihydrochloride “? H fl By a method similar to Example 65, the title compound (65 mg) was obtained from trans~2—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (80 mg) and l~ benzylpiperidin—4—one (55.2 mg).
MS (API+): [M+H]+ 494.2. 1H NMR (300MHz, CDjJD)5 1.42—1.63 (2H, m), 2.02—2.21 (2H, m), 2.39~2.59 (3H, m), 3.03 (1H, brs), 3.14—3.25 (2H, m), 3.56—3.74 (3H, m), 4.37 (2H, brs), 7.23 (2H, d, J = 8.2 Hz), 7.50—7.61 (5H, m), 7.66—7.80 (3H, m), 7.92 (1H, d, J = 7.7 Hz), 8.16—8.29 (2H, m).
Example 75 N—(4—{trans—2—[(l-phenylpiperidin—4— 3o yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide dihydrochloride By a method similar to Example 65, the title compound (45 mg) was obtained from N—[4—(trans—2—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (80 mg) and 1— phenylpiperidin—4—one (51.1 mg).
MS : [M+H]+ 480.1. 1H NMR (300MHz, CD30D)5 .69 (2H, m), 2.22-2.44 (2H, m), 2.46m2.66 (3H, m), 3.06—3.16 (1H, m), 3.59—3.97 (5H, m), 7.27 (2H, d, J = 8.3 Hz), .51 (1H, m), 7.53—7.61 (2H, m), 7.62-7.68 (2H, m), 7.69e7.79 (3H, m), 7.91 (1H, d, J = 7.8 Hz), 8.16—8.30 (2H, m).
Example 76 N—(4-{trans—2—[(1—methylpiperidin—4— yl)amino]cyclopropy1}phenyl)~3—(trifluoromethyl)benzamide dihydrochloride if“. ‘ i _M sac21.11}, J-N‘V Hik'i jg} El 1 H . kw \\.....(«\Np’éxwlg
[0410] To a solution of N—[4~(trans—Z—aminocyclopropyl)phenyl]~ 3—(trifluoromethyl)benzamide hydrochloride (80 mg) in ol (3 mL)/THF (3 mL) were added 1—methylpiperidin—4—one (33.0 mg) and sodium hydrogen carbonate (37.7 mg). The mixture was stirred at 60°C for 2 hr, and ice—cooled to 0°C and sodium borohydride (17.0 mg) was added. The mixture was stirred at room temperature for 2 hr, and ice—cooled to 0°C, and saturated aqueous sodium hydrogen carbonate solution was added. The mixture was ted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium e. The solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl acetate, ethyl acetate/methanol). 10% Hydrochloric acid ol solution was added and the solvent was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title nd (40 mg).
MS : [M+H]+ 418.0. 1H NMR (300MHz, CDjDD)5 1.42—1.65 (2H, m), 2.02—2.22 (2H, m), 2.34—2.63 (3H, m), 2.92 (3H, s), 3.01—3.27 (3H, m), .78 (3H, m), 7.24 (2H, d, J = 8.3 Hz), 7.67-7.79 (3H, m), 7.91 (1H, d, J = 7.5 Hz), 8.17—8.28 (2H, m).
Example 77 N—(4—{trans-2—[(2—phenylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide dihydrochloride ‘5?\ E..flfirJ IH\\_ f," — ”‘ R 51?. H w?l \ ”IA: ._ ’3‘: ' ffims A) tert—butyl 2—phenyl—4—{[trans—2~(4—{[3~ (trifluoromethyl)benzoyl]amino}phenyl)cyclopropyl]amino}— piperidine—l—carboxylate To a solution of N-[4—(trans—Z—aminocyclopropyl)phenyl]— 3—(trifluoromethyl)benzamide hydrochloride (60 mg) in ol (1.5 mL)/THF (1.5 mL) were added tert—butyl 4—oxo—2— phenylpiperidine—1-carboxylate (60.2 mg) and sodium hydrogen carbonate (28.3 mg). The mixture was stirred at 60°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (12.7 mg) was added. The mixture was stirred at room temperature for 2 hr, and ice—cooled to 0°C and ted aqueous sodium hydrogen carbonate solution was added. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate. The t was evaporated under reduced pressure. The residue was purified by silica gel column tography (ethyl acetate/methanol) to give the title compound (62 mg).
MS (API+): [M-Boc+H]+ 480.1.
B) N—(4—{trans—2—[(2—phenylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide ochloride tert—Butyl 2—phenyl—4—{[trans—2~(4—{[3— (trifluoromethyl)benzoyl]amino}phenyl)cyclopropyl]amino}— piperidine—l—carboxylate (62 mg) was dissolved in THE (0.5 mL), and the mixture was ice—cooled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (5.0 mL) was added, and the mixture was stirred at room temperature overnight. The solvent was evaporated under reduced pressure. The residue was tallized from methanol/diisopropyl ether to give the title compound (24 mg).
MS (API+): [M+H]+ 480.1. 1H NMR (300MHz, CD30D)5 1.43—1.55 (1H, m), 1.56—1.67 (1H, m), 2.05—2.21 (1H, m), 2.31 (1H, d, J = 12.1 Hz), 2.47~2.67 (3H, m), 3.07 (1H, d, J = 3.4 Hz), 3.35~3.40 (1H, m), 3.62—3.72 (1H, m), 3.83—3.98 (1H, m), 4.49 (1H, d, J = 12.6 Hz), 7.22 (2H, t, J = 9.8 Hz), 7.48—7.59 (5H, m), 7.64—7.78 (3H, m), 7.90 (1H, d, J = 8.1 Hz), .31 (2H, m).
Example 78 2’—chloro—N—(4—{trans-2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl-4— carboxamide hydrochloride [O4l6] A) tert—butyl [trans—2—(4—{[(2’—chlorobiphenyl—4— bonyl]amino}phenyl)cyclopropyl](cyclopropylmethy1)— carbamate By a method similar to Example 79, Step A, the title nd (115 mg) was obtained from tert—butyl [trans—2—(4— henyl)cyclopropyl](cyclopropylmethyl)carbamate (75.0 mg) and 2’—chlorobiphenyl—4—carboxylic acid (69.2 mg).
MS : [M—tBu+2H]+ 461.0.
B) 2'—chloro—N-(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4- carboxamide hydrochloride tert-Butyl [trans—2—(4-{[(2’-chlorobiphenyl—4— yl)carbonyl]amino}phenyl)cyclopropyl](cyclopropylmethy1)— carbamate (115 mg) was dissolved in THE (0.5 mL), and the mixture was ice—cooled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (5 mL) was added, and the mixture was stirred at room temperature overnight. The solvent was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (65.0 mg).
MS (API+): [M+H]+ 417.0. 1H NMR (300MHz, 5 0.38—0.52 (2H, m), 0.69—0.80 (2H, m), 1.14 (1H, tt, J = 7.8, 4.8 Hz), 1.40 (1H, m), 1.48—1.59 (1H, m), 2.50 (1H, ddd, J = 10.2, 6.6, 3.6 Hz), 3.00 (1H, m), 3.06-3.16 (2H, m), 7.21 (2H, d, J = 8.7 Hz), 7.34—7.47 (3H, m), 7.49—7.63 (3H, m), 7.70 (2H, d, J = 8.7 Hz), 8.00 (2H, d, J = 8.5 Hz).
[0419] Example 79 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—lH— pyrazole—4—carboxamide hydrochloride N‘ g “H' LA“ wa I’fCfix' 'g; élx I’Zx \f/~ “ VH‘g) a; “it:
[0421] A) tert—butyl propylmethyl)(trans—2—{4-[(lH-pyrazol—4- ylcarbonyl)amino]phenyl}cyclopropyl)carbamate A solution of tert-butyl [trans-2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (75 mg) in DMF (3 mL) was ice—cooled, and lH—pyrazole—4—carboxylic acid (33.4 mg), N—ethyl—N’—(3~dimethylaminopropyl)carbodiimide hloride (143 mg), l—hydroxybenzotriazole (49.4 mg) and diisopropylethylamine (80 mg) were added. The mixture was stirred at room ature overnight, and saturated aqueous sodium hydrogen carbonate solution was added under ice—cooling.
The mixture was extracted with ethyl acetate, and the extract was washed with water and ted brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl e) to give the title compound (72 mg).
MS (API+): [M—tBu+2H]+ 341.0.
B) N—(4—{trans~2~[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— lH—pyrazole—4—carboxamide hydrochloride tert—Butyl (cyclopropylmethyl)(trans—2—{4—[(lH—pyrazol—4— ylcarbonyl)amino]phenyl}cyclopropyl)carbamate (72 mg) was dissolved in THF (0.5 mL), and the mixture was ice—cooled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (4.5 mL) was added, and the mixture was stirred at room temperature overnight. The solvent was ated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (45 mg).
MS (API+): [M+H]+ 297.0. 1H NMR (300MHz, CD3OD)5 0.37—0.47 (2H, m), 0.68—0 76 (2H, m), 1.04—1.22 (1H, m), 1.33—1.43 (1H, m), 1.45—1.55 (1H, m), 2.48 (1H, ddd, J = 10.1, 6.5, 3.6 Hz), 2 1 (1H, m), 3.08 (2H, dd, J = 7.4, 1.6 Hz), 6.87 (1H, brs), 7.17 (2H, d, J = 8.3 Hz), 7.67 (2H, d, J = 8.5 Hz), 7.74 (1H, brs). e 80 N—(4—{trans—2~[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—4— [(phenylcarbonyl)amino]benzamide hydrochloride 2:]: A) tert—butyl [trans—2~(4-{[4—(benzoylamino)benzoyl]amino}— phenyl)cyclopropyl](cyclopropylmethyl)carbamate To a solution of tert—butyl [trans—2—(4- aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (90.9 mg), 4—benzamidobenzoic acid (87 mg) and oxybenzotriazole (60.9 mg) in DMF (1.5 mL) was added N—ethyl—N'—(3— dimethylaminopropyl)carbodiimide hydrochloride (86 mg). The reaction mixture was stirred at room temperature for 2 hr, and poured into 0.5N hydrochloric acid. The mixture was extracted with ethyl acetate, and the extract was washed sively with water, saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under d pressure. The residue was washed with ethyl acetate/diisopropyl ether to give the title compound (98.0 mg). 1H NMR (300 MHz, DMSO—da) 5 0.07-0.17 (1H, m), 0.18—0.29 (1H, m), 0.34-0.52 (2H, m), 0.91—1.02 (1H, m), 1.15—1.28 (2H, m), 1.37 (9H, s), 2.01—2.12 (1H, m], 2.67—2.76 (1H, m), 3.00 (1H, dd, J = 14.5, 7.0 Hz), 3.20 (1H, dd, J = 14.5, 6.9 Hz), 7.12 (2H, d, J = 8.7 Hz), 7.50—7.63 (3H, m), 7.67 (2H, d, J = 8.7 Hz), 7.91—8.01 (6H, m), 10.09 (1H, 5), 10.51 (1H, s).
B) 4—(benzoylamino)—N—(4—{trans—2—[(cyclopropylmethyl)amino]— cyclopropyl}phenyl)benzamide hydrochloride tert—Butyl [trans—2—(4—{[4— (benzoylamino)benzoyl]amino}phenyl)cyclopropyl]~ propylmethyl)carbamate (98.0 mg) was dissolved in 4N hydrochloric yclopentyl methyl ether solution (1 mL), and the mixture was stirred at room temperature for 2 hr. The solvent was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (44.6 mg).
MS (API+): [M+H]+ 426.4. 1H NMR (300 MHz, DMSO—de) 5 0.32—0.41 (2H, m], .64 (2H, m), 0.98—1.14 (1H, m), .33 (1H, m), 1.43—1.55 (1H, m), 2.39—2.47 (1H, m), 2.85~3.05 (3H, m), 7.16 (2H, d, J = 8.4 Hz), 7.51—7.66 (3H, m), 7.73 (2H, d, J = 8.3 Hz), 7.89—8.05 (6H, m), 9.13 (2H, brs), 10.15 (1H, 8), 10.53 (1H, s).
Example 81 N~(4—{trans-2—[(cyclopropylmethyl)amino]cyclopropyl}—2— methylphenyl)benzamide hydrochloride \KWQ x“~i\ \/ ‘N : ” H i?
[0429] A) N—(4—bromo—2—methylphenyl)benzamide To a solution of 4—bromo—2—methylaniline (3.55 g) in pyridine (95 mL) was added benzoyl chloride (2.66 mL). The mixture was stirred at room temperature for 1 hr and the solvent was evaporated under reduced pressure. To the residue was added 2N hydrochloric acid. The mixture was extracted with ethyl acetate, and the extract was washed successively with 1N hydrochloric acid, ted aqueous sodium hydrogen carbonate solution and ted brine, and dried over anhydrous magnesium e. The solvent was evaporated under reduced pressure. The residue was washed with diisopropyl ether to give the title compound (4.35 g). 1H NMR (300 MHz, DMSO—de) 5 2.24 (3H, s), 7.33 (1H, d, J = 8.5 Hz), 7.41 (1H, dd, J = 8.5, 2.5 Hz), 7.49—7.64 (4H, m), 7.94— 8.00 (2H, m), 9.90 (1H, brs).
[0430] B) ethyl trans—2—[4—(benzoylamino)—3— methylphenyl]cyclopropanecarboxylate To a solution of N—(4—bromo—2—methylpheny1)benzamide(4.35 g) and 4,4,5,5—tetramethyl—2-viny1—1,3,2-dioxaborolane (2.54 g) in THF (64.3 mL)/water (10.7 mL) were added 1,1’— bis(diphenylphosphino)ferrocene—palladium(II) dichloride— dichloromethane complex (0.367 g) and triethylamine (4.18 mL).
The reaction mixture was stirred at 60°C overnight, and poured into saturated aqueous ammonium chloride solution. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure. The residue was purified by silica gel column tography (hexane/ethyl acetate) to give a e (4.42 g) ning N—(2—methyl—4—vinylphenyl)benzamide. To a solution of the mixture (4.42 g) and copper(1) chloride (0.233 g) in toluene (36 mL)/THF (5 mL) was added dropwise a solution of ethyl cetate (9.79 mL) in toluene (25 mL) at 80°C over 1 hr or longer. The mixture was stirred at 80°C overnight, cooled to room temperature, and ed through celite. The mother liquor was concentrated under d pressure, and the residue was purified by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (1.29 g). 1H NMR (300 MHz, DMSO—de) 5 1.21 (3H, t, J = 6.7 Hz), 1.34-1.53 (2H, m), 1.87—2.01 (1H, m), 2.20 (3H, s), .46 (1H, m), 4.11 (2H, q, J 6.7 Hz), 7.01 (1H, d, J = 8.0 Hz), 7.09 (1H, s), 7.23 (1H, d, J = 8.0 Hz), 7.47r7.62 (3H, m), 7.97 (2H, d, J = 7.5 Hz), 9.83 (1H, s).
C) trans—2—[4—(benzoylamino)-3— methylphenyl]cyclopropanecarboxylic acid To a solution of ethyl trans—2—[4~(benzoylamino)~3— methylphenyl]cyclopropanecarboxylate (1.29 g) in ethanol (7.98 mL) was added 1N aqueous sodium hydroxide solution (7.98 mL).
The reaction e was d at 50°C for 6.5 hr, 1N hydrochloric acid (10 mL) was added under ice—cooling, and the mixture was stirred under ice—cooling for 1 hr. The precipitate was collected by filtration to give the title compound (576.9 mg). 1H NMR (300 MHz, e) 5 1.30—1.47 (2H, m), 1.74—1.85 (1H, m), 2.20 (3H, s), 2.31—2.44 (1H, m), 7.00 (1H, d, J = 8.3 Hz), 7.07 (1H, s), 7.19—7.27 (1H, m), 7.46—7.67 (3H, m), 7.97 (2H, d, J = 7.6 Hz), 9.82 (1H, 5), 12.30 (1H, brs).
D) tert—butyl_{trans—2—[4—(benzoylamino)—3— methylphenyl]cyclopropyl}carbamate To trans—2—[4—(benzoylamino)—3— methylphenyl]cyclopropanecarboxylic acid (576.0 mg) was added toluene (200 mL), and the solvent was evaporated under reduced pressure. The residue was suspended in toluene (10 mL), and triethylamine (0.326 mL), THF (2 mL) and diphenylphosphoryl azide (0.504 mL) were added. The on mixture was stirred at room temperature for 1 hr, and tert—butyl alcohol (1.83 mL) was added. The mixture was stirred at 80°C overnight, and poured into saturated aqueous ammonium chloride solution. The reaction mixture was extracted with ethyl e, and the extract was washed successively with saturated aqueous sodium hydrogen carbonate on and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure. The residue was ed by silica gel column chromatography (hexane/ethyl acetate) to give the title compound (125.8 mg). 1H NMR (300 MHz, DMSO—dg) 5 1.01—1.14 (2H, m), 1.39 (9H, s), 1.80—1.94 (1H, m), 2.19 (3H, s), 2.54-2.67 (1H, m), 6.92 (1H, dd, J = 8.1, 1.5 Hz), 6.99 (1H, d, J = 1.5 Hz), 7.19 (1H, d, J = 8.1 Hz), 7.22—7.28 (1H, m), 7.46—7.63 (3H, m), 7.97 (2H, d, J = 6.6 Hz), 9.81 (1H, s).
E) N—[4—(trans—2—aminocyclopropyl)~2—methylphenyl]benzamide hydrochloride tert—Butyl {trans—2—[4—(benzoylamino)—3— methylphenyl]cyclopropyl}carbamate (125.8 mg) was dissolved in 4N hydrochloric acid/cyclopentyl methyl ether on (1.5 mL), and the mixture was stirred at room ature for 2 hr. The solvent was evaporated under reduced pressure to give the title nd (95.9 mg). 1H NMR (300 MHZ, DMSO—dg) 5 1.16—1.29 (1H, m), 1.31—1.42 (1H, m), 2.21 (3H, s), 2.24—2.33 (1H, m), .86 (1H, m), 7.01 (1H, dd, J = 8.1, 1.9 Hz), 7.06 (1H, d, J = 1.9 Hz), 7.26 (1H, d, J i 8.1 Hz), 7.45—7.67 (3H, m), 7.97 (2H, d, J = 6.8 Hz), 8.32 (3H, brs), 9.85 (1H, s).
F) N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}-2— methylphenyl)benzamide hydrochloride To a solution of N-[4—(trans—Z—aminocyclopropyl)—2— methylphenlebenzamide hydrochloride (90.1 mg) and sodium hydrogen carbonate (50.0 mg) in THF (1.49 mL)/methanol (1.49 mL) was added cyclopropanecarbaldehyde (0.029 mL). The reaction mixture was stirred at 60°C for 1 hr, and ice—cooled to 0°C and sodium borohydride (22.51 mg) was added. The mixture was stirred at room temperature overnight, and poured into saturated aqueous sodium hydrogen carbonate solution. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous ium sulfate. The t was ated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate) and the solvent was evaporated under reduced pressure. The residue was dissolved in ethyl acetate (5 mL), and 4N hloric acid/ethyl acetate solution (0.5 mL) was addedd The solvent was evaporated under reduced pressure, and the residue was recrystallized from methanol/diisopropyl to give the title compound (55.9 mg).
Ms (API+): [M+H]+ 321.2. 1H NMR (300 MHz, DMSO—de) 5 0.33—0.41 (2H, m), 0.54—0.64 (2H, m), 1.00—1.14 (1H, m), 1.23—1.34 (1H, m), 1.47—1.57 (1H, m), 2.21 (3H, s), 2.42—2.48 (1H, m), 2.86—3.05 (3H, m), 7.02 (1H, d, J = 8.1 Hz), 7.08 (1H, s), 7.26 (1H, d, J = 8.1 Hz), 7.44—7.64 (3H, m), 7.97 (2H, d, J = 7.4 Hz), 9.24 (2H, brs), 9.85 (1H, s).
[0435] Example 82 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}—3— methylphenyl)benzamide hydrochloride By a method similar to Example 81, the title nd (50.1 mg) was obtained from 4—bromo—3—methylaniline (3.55 g).
Ms (API+): [M+H]+ 321.4. 1H NMR (300 MHz, DMSO—ds) 5 .43 (2H, m), 0.54—0.67 (2H, m), 0.98—1.27 (2H, m), .51 (1H, m), 2.39 (3H, s), 2.41— 2.46 (1H, m), 2.89—3.06 (3H, m), 6.99 (1H, d, J = 8.5 Hz), 7.46—7.66 (5H, m), 7.94 (2H, d, J = 7.4 Hz), 9.04 (2H, brs), .16 (1H, s).
Example 83 trans—2-[(cyclopropylmethyl)amino]cyclopropyl}phenyl)~3— (dimethylamino)benzamide bis(trifluoroacetate) .§§.¢ . 3 l g.
“NR” “9/ ages..
I E 1 “gigs; i; Pé 'Vgfi .H ~¢ To tert—butyl [trans—2-(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (30 mg) were added a solution of 3~(dimethylamino)benzoic acid (33 mg) in DMF (1 mL), O-(7—azabenzotriazol—1—yl)-N,N,N’,N’— tetramethyluronium hexafluorophosphate (76 mg), and N,N— diisopropylethylamine (26 mg), and the mixture was stirred at room temperature ght. To the reaction mixture were added water (1 mL) and ethyl acetate (3 mL) and the e was stirred. The organic layer was passed through a phase separation filter, and the solvent was evaporated from the separate liquid by an air blowing apparatus. To the residue was added trifluoroacetic acid (200 uL) and the mixture was stirred for 1 hr. The solvent was evaporated by an air blowing apparatus. The residue was purified by HPLC (column: YMC Triart C18, mobile phase: 0.1% trifluoroacetic acid— acetonitrile/O.1% aqueous trifluoroacetic acid solution) to give the title compound (12.6 mg).
MS (API+): [M+H]+ 350.1.
The compounds produced by the method bed in the above—mentioned e 83 or a method analogous thereto are shown in the ing Tables. In the Tables, MS shows measured values.
[Table 1—6] IUPAC name N-(4—{trans—2— I [(cyclopropylmethyl) N amino]cyclopropyl}— phenyl)—4— (dimethylamino)— benzamide IEHEHHHH|3SO.1 N—(4—{trans—2— [(cyclopropylmethyl) H amino]cyclopropyl}* \:7\ CF3COOH 361.1 phenyl)—5,6,7,8— o tetrahydronaphtha- —carboxamide N—(4—{trans~2— [(cyclopropylmethyl) amino]cyclopropyl}— phenyl)—4—(3—methyl— CF3COOH —oxo—4,5—dihydro— lH—pyrazol~1- yl)benzamide N—(4—{trans—2— [(cyclopropylmethyl) amino]cyclopropyl}— CF3COOH phenyl)—4— lsulfonyl)— benzamide N—(4—{trans~2— [(cyclopropylmethyl) cyclopropyl}— CF3COOH )—4— sulfamoylbenzamide 4—cyclohexyl—N—(4~ {trans—2~ [(cyclopropylmethyl) CF3COOH amino]cyclopropyl}— phenyl)benzamide N—(4—{trans—2— [(cyclopropylmethyl) amino]cyclopropyl}— CF3COOH phenyl)—l,3— benzothiazole—6— carboxamide N—(4—{trans—2— [(cyclopropylmethyl) amino]cyclopropyl}— CF3COOH phenyl)—3— (methylsulfonyl)- benzamide [Table 1——7] N— (4— {trans——2— [(cyclopropylmethyl)— amino]cyclopropyl}— 2CF3COOH 373.0 phenyl)—4—(1H— imidazol—l— yl)benzamide N—(4—{trans~2~ [(cyclopropylmethyl)~ amino]cyclopropyl}— CF3COOH 374.0 phenyl)—5—phenyl—l,2— oxazole—3—carboxamide ~(4—{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}— 2CF3COOH )—4—(1H— pyrazol—l— yl)benzamide N—(4—{trans—2~ opropylmethyl)~ cyclopropyl}- CFBCOOH 374 ' O phenyl)—4—(l,3— oxazol—S—yl)benzamide N—(4—{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}— OH phenyl)~4-(Pyridin—4— yl)benzamide W\[::L\:7\ N—(4—{trans—2~ [(cyclopropylmethyl)— amino]cyclopropyl}— phenyl)~2~(3~ thienyl)—1H— benzimidazole—6— carboxamide igilliilll N~(4~{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}— phenyl)—2—(2—furyl)— lH—benzimidazole—6— carboxamide ll!!%%i%i|4l3.l N—(4—{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}~ phenyl)—1H~indazole— —carboxamide IHHHEHHHH||347.O [Table 1—8] salt MS N—(4—{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}— CFBCOOH phenyl) —3~ (lH— tetrazol~l— yl)benzamide N—(4*{trans—2— [(cyclopropylmethyl)— cyclopropyl}~ CF3COOH phenyl) —3—— (2—methyl— 1,3~thiazol~4— yl)benzamide N—(4~{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}— phenyl)—4—(lH— tetrazol~5— yl)benzamide l||||||||CF3COOH N“(4—{trans_2~ [(cyclopropylmethyl)— amino]cyclopropyl}— H phenyl)—2—phenyl—l,3— e—4—carboxamide I N—(4—{trans—2— [(cyclopropylmethyl)— amino]cyclopropyl}— CF3COOH phenyl)~2—phenyl—l,3~ ‘ oxazole—S—carboxamide ' Example 105 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— 3,4—dimethylbenzamide hydrochloride r3 J/\\ H [g 'R Le" "\v” \ . l?V
[0447] By a method similar to Example 80, the title nd (54.7 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (94.0 mg) and 3,4—dimethy1benzoic acid (56.0 mg). .5 MS (API+): [M+H]+ 335.3. lH NMR (300 MHz, DMSO—ds) 5 0.25-0.44 (2H, m), 0.53—0.62 (2H, m), 0.98—1.13 (1H, m), 1.19—1.32 (1H, m), .52 (1H, m), 2.30 (6H, brs), 2.36—2.47 (1H, m), 2.83—2.99 (3H, m), 7.15 (2H, d, J = 7.9 Hz), 7.28 (1H, d, J = 8.0 Hz), .78 (4H, m), 9.00 (2H, brs), 10.10 (1H, s).
Example 106 N—(4—{trans~2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— 2,5—dimethylbenzamide hydrochloride
[0449] By a method similar to Example 80, the title compound (50.9 mg) was obtained from tert—butyl [trans—2—(4— aminopheny1)cyclopropyl](cyclopropylmethyl)carbamate (94.6 mg) and 2,5—dimethylbenzoic acid (56.4 mg).
MS (API+): [M+H]+ 335.3. 1H NMR (300 MHz, DMSO—dg) 6 0.33—0.41 (2H, m), 0.53—0.64 (2H, m), 1.00—1.12 (1H, m), 1.19—1.31 (1H, m), 1.42—1.55 (1H, m), 2.31 (6H, s), 2.39—2.47 (1H, m), 2.83—3.05 (3H, m), 7.09—7.27 (5H, m), 7.66 (2H, d, J = 7.9 Hz), 9.17 (2H, brs), 10.23 (1H, e 107 N—(4-{trans—2—[(imidazo[1,2—a]pyridin—6— ylmethyl)amino]cyclopropyl}phenyl)~3—(trifluoromethyl)benzamide dihydrochloride #HC' - x’ ~? \~ ““ Q S 0 ii. f’J-s' ‘\?” V‘s?!.°="V ,,g ”5-. \gflf May‘, I '§§x/Liflf By a method similar to Example 65, the title compound (33 mg) was obtained from N—[4—(trans-Z—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (80 mg) and imidazo[1,2-a]pyridine—6—carbaldehyde (42.6 mg).
MS (API+): [M+H]+ 451.0. 1H NMR (300 MHz,(lkOD)5 1.34—1.44 (1H, m), 1.56—1.69 (1H, m), 2.40—2.51 (1H, m), 3.03—3.11 (1H, m), 4.54—4.70 (2H, m), 7.02 (2H, d, J = 8.5 Hz), 7.58 (2H, d, J = 8.7 Hz), 7.70 (1H, t, J = 7.7 Hz), 7.83—7.89 (1H, m), 7.96~8.07 (2H, m), 8.13—8.25 (4H, m), 9.01—9.05 (1H, m).
[0454] Example 108 N-(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—4— uoromethoxy)benzamide hydrochloride 5sflxfixxipffi§§ fi' " 3% ] if ' x\\v¢‘}’ ”\N .14" ”‘x 'x,’.}::: <3 E405;? ’ \::;?“N'“ix“w§;2H 20 i ‘r By a method similar to Example 80, the title nd (55.7 mg) was obtained from tert—butyl [trans—2-(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (87.2 mg) and fluoromethoxy)benzoic acid (71.3 mg).
MS (API+): [M+H]+ 391.3. 1H NMR (300 MHz, g) 5 0.30—0.41 (2H, m), 0.51—0.65 (2H, m), 0.93-1.13 (1H, m), 1.19—1.36 (1H, m), 1.38—1.55 (1H, m), 2.33—2.46 (1H, m), 2.82—3.04 (3H, m), 7.17 (2H, d, J = 8.1 Hz), 7.53 (2H, d, J = 8.1 Hz), 7.70 (2H, d, J = 8.1 Hz), 8.07 (2H, d, J = 8.1 Hz), 8.90 (2H, brs), 10.33 (1H, s).
Example 109 N—(4—{trans-2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—3— (trifluoromethoxy)benzamide hydrochloride
[0458] {3; ~ \4???’?a\ , w ?\N/A“ ‘ H if' By a method similar to Example 80, the title compound (82.8 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropy1](cyclopropylmethyl)carbamate (88.4 mg) and 3—(trifluoromethoxy)benzoic acid (72.3 mg).
MS (API+): [M+H]+ 391.3. 1H NMR (300 MHz, s) 5 0.30—0.40 (2H, m), 0.52—0.63 (2H, m), 0.95—1.11 (1H, m), 1.21—1.32 (1H, m), 1.37—1.55 (1H, m), 2.31—2.46 (1H, m), 2.79—3.08 (3H, m), 7.18 (2H, d, J = 8.5 Hz), 7.56—7.76 (4H, m), 7.90 (1H, s), 8.01 (1H, d, J = 7.8 Hz), 8.96 (2H, brs), 10.37 (1H, s).
Example 110 N—[4—(trans—2—{[4— (dimethylamino)benzyl]amino}cyclopropy1)pheny11—3— uoromethyl)benzamide dihydrochloride By a method similar to Example 65, the title compound (30 mg) was obtained from N—[4—(trans—2—aminocyclopropyl)phenyl]~3— (trifluoromethyl)benzamide hydrochloride (80 mg) and 4— (dimethylamino)benzaldehyde (43.5 mg).
MS (API+): [M+H]+ 454.0. 1H NMR (300MHz, CDyDD)5 1.35-1.45 (1H, m), 1.47-1.58 (1H, m), .47'(1H, m), 2.91—3.03 (1H, m), 3.07—3.24 (6H, m), 4.40 (2H, d, J = 2.8 Hz), 7.09—7.16 (2H, m), 7.33 (2H, d, J = 8.5 Hz), 7.57 (2H, d, J = 8.7 Hz), 7.67 (2H, d, J = 8.5 Hz), 7.71— 7.77 (1H, m), 7.90 (1H, d, J = 7.9 Hz), 8.18—8.26 (2H, m).
Example 111 N—(4—{trans—2—[(l-cyclopropylpiperidin—4— yl)amino]cyclopropyl}phenyl)~3-(trifluoromethyl)benzamide dihydrochloride J‘\\-" 31‘.)xEl/r2;:- 1/5“” (II/“KN a 'Rygexx! xq”§§\,r‘’., ~
[0465] By a method r to Example 65, the title compound (50 mg) was obtained from trans—Z—aminocyclopropyl)phenyl]~3— (trifluoromethyl)benzamide hydrochloride (60 mg) and l— cyclopropylpiperidin—4~one (30.4 mg).
MS (API+): [M+H]+ 444.3. 1H NMR (300MHz, (333013)?) 0.89—1.00 (2H, m), 1.02—1.10 (2H, m), 1.46 (1H, q, J = 6.8 Hz), 1.52—1.62 (1H, m), 2.01—2.16 (2H, m), 2.35-2.47 (2H, m), 2.52 (lH, ddd, J = 10.0, 6.5, 3.5 Hz), 2.68- 2.82 (1H, m), 3.02 (1H, dt, J = 7.6, 3.8 Hz), 3.17-3.29 (2H, m), 3.62—3.81 (3H, m), 7.24 (2H, d, J = 8.3 Hz), 7.67—7.78 (3H, m), 7.90 (1H, d, J = 7.9 Hz), .27 (2H, m).
Example 112 N—[4—(trans—2—{[1—(l—methylethyl)piperidin—4— yl]amino}cyclopropyl)phenyl]—3—(trifluoromethyl)benzamide ochloride kffi» if g ( “I 3 "E on 9.03V «i - é II E w ~~ \¢{a\_ i . J Wk yak“,- J .N H By a method similar to Example 65, the title compound (51 mg) was obtained from N-[4—(trans—Z—aminocyclopropyl)phenyl]~3— (trifluoromethyl)benzamide hydrochloride (60 mg) and 1— isopropylpiperidin—4—one (30.9 mg).
MS (API+): [M+H]+ 446.1. 1H NMR (300MHz, CD3OD)5 1.36—1.52 (7H, m), 1.56—1.68 (1H, m), 2.09—2.29 (2H, m), 2.43—2.54 (2H, m), 2.55—2.64 (1H, m), 3.01— 3.09 (1H, m), 3.14—3.28 (2H, m), 3.50-3.81 (4H, m), 7.24 (2H, d, X? J = 8.7 Hz), 7.63—7.79 (3H, m), 7.90 (1H, d, J = 7.9 Hz), 8.16— 8.28 (2H, m).
Example 113 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)~4— (1H—pyrazol—3—yl)benzamide hydrochloride X33211 Hfigfiai ,1 “£7" E a §§¢x \gg/ ”Kr/Wit"3 C3 igxflLg , W" f} v g Y;: By a method similar to Example 79, the title compound (78 mg) was obtained from tert—butyl [trans—2-(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (100 mg) and pyrazolyl)benzoic acid (93 mg).
MS (API+): [M+H]+ 373.0. 1H NMR (300MHz, CIhOD)5 0.42 (2H, q, J = 4.8 Hz), 0.68—0.77 (2H, m), 1.05—1.19 (1H, m), 1.39 (1H, q, J 6.8 Hz), .55 (1H, m), 2.48 (1H, ddd, J = 10.3, 6.6, 3.7 Hz), 2.99 (1H, dt, J = 7.8, 4.1 Hz), 3.05—3.13 (2H, m), 6.91—6.96 (1H, m), 7.19 (2H, d, J = 8.7 Hz), 7.67 (2H, d, J = 8.7 Hz), 7.90—7.98 (3H, m), 8.02 (2H, d, J = 7.5 Hz).
Example 114 —(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—1H— indole—S—carboxamide oroacetate W/\! H \foq\,«\§,§\ fifikfi {3. Exfljx . if???,.xv To tert—butyl [trans-2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (30 mg) were added a solution of indole—S—carboxylic acid (32 mg) in DMF (1 mL), N—ethyl—N’—(3—dimethylaminopropyl)carbodiimide hydrochloride (28.8 mg) and 1—hydroxybenzotriazole (20 mg), and the mixture was stirred at room.temperature overnight. To the reaction solution were added water (1 mL) and ethyl e (3 mL) and the mixture was stirred. The organic layer was passed through a phase separation filter, and the solvent was evaporated from the separated liquid by an air blowing apparatus. To the residue was added trifluoroacetic acid (200 uL) and the mixture was stirred for 1 hr. The solvent was evaporated by an air g apparatus. The residue was purified by HPLC (column: YMC Triart C18, mobile phase: 0.1% trifluoroacetic acid—acetonitrile/O.l% aqueous trifluoroacetic acid solution) to give the title compound (18.1 mg).
MS : [M+H]+ 345.9.
[0475] The compounds produced by the method described in the above—mentioned Example 114 or a method analogous thereto are shown in the following Tables. In the Tables, MS shows measured values.
[Table l— 9] IUPAC name (4 {trans——2— [(cyclopropylmethyl) amino]cyclopropyl}— N phenyl)—lH—indole—6— o carboxaml'de \I::l\:7\fi/A\K7 N—(4—{trans—2— [ (cyclopropylmethyl) amino] cyclopropyl } — 0 O CF3COOH 425.1 phenyl)—4’— propylbiphenyl—4— o carboxamide W{:l\7\ /\V7 —(4—{trans—2— [(cyclopropylmethyl) amino]cyclopropyl}~ )—4—(1H— 2CF3COOH 372.0 yl)benzamide N—(4—{trans—2— [(cyclopropylmethyl) amino]cyclopropyl}— phenyl)—4’— methylbiphenyl—4— carboxamide N—(4—{trans—2— [(cyclopropylmethyl)S amino]cyclopropyl}— CF3COOH 390.9 phenyl)—4~(l,2,3— thiadiazol—4— zamide 4'—tert—butyl—N—(4— {trans—2~' [(cyclopropylmethyl) amino]cyclopropyl}— [‘D phenyl)biphenyl—4— carboxamide HHH||439.1 N—(4—{trans—2— [(cyclopropylmethyl) amino]cyclopropyl}— phenyl)—5—methyl—l~ phenyl—lH—pyrazole— 4—carboxamide Iiiiaafiglllaili —(4—{trans—2- [(cyclopropylmethyl) amino]cyclopropyl}— )—5»methyl—2— phenyl—l,3~oxazole~ 4—carboxamide IHHHHHEHI [Table 1—10] N—(4—{trans—2— [(cyclopropyl— )amino]cyclo— CF3COOH 372.9 propyl}phenyl)—5— phenyl—Z—furamide N—(4—{trans—2— [(cyclopropyl— )amino]cyclo— 2CF3COOH propyl}phenyl)—l— phenyl—lH—pyrazole— 4—carboxamide N—(4—{trans—2— [(Cyclopropyl— methyl)amino}cyclo— prOpyl}phenyl)-4— CF3COOH phenyl—1,3— thiazole—2~ carboxamide N~(4~{trans—2— [(cyclopropyl— methyl)amino]cyclo— 2CF3COOH propyl}phenyl)—5— phenyl—lH—pyrazole— 3—carboxamide N—(4—{tranS*2~ [(cyclopropyl— methyl)amino]cyclo— propyl}phenyl)—1H— carboxamide N—(4—{trans—2— [(cyclopropyl— methyl)amino]cyclo~ CF3COOH 346.9 propyl}phenyl)—1H— indazole—3— carboxamide N—(4—{trans—2— [(cyclopropyl— methyl)amino]cyclo- CF3COOH 346.9 }phenyl)—l— benzofuran—Z— carboxamide N—(4-{trans—2— [(cyclopropyl— methyl)amino]cyclo— . prepyl}phenyl)—4— 3CF3COOH 405.1 (4—methylpiperazin— l—yl)benzamide [Table 1-11] ficyclopropyl—(4 {trans~~2— methyl)amino]— cyclopropyl}~ phenyl)~3-(4— -methylpiperazin— enzamide N—(4—{trans—2— [(cyclopropyl— methyl)amino]— cyclopropyl}— phenyl)—4— (pyridin—3~ yl)benzamide N-(4—{trans—2— [(cyclopropyl— methyl)amino]— ropyl}— CF3COOH phenyl)~3-phenyl— 1,2—oxazole—5— carboxamide 2—acetyl—N~(4— {trans—2— opropyl— methyl)amino]— cyclopropyl}— CF3COOH phenyl)—2,3,4,5— tetrahydro—lH—Z— benzazepine—8- carboxamide Example 135 ~(4—{trans—2~[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—4— [(methylsulfonyl)amino]benzamide hydrochloride
[0481] By a method similar to Example 80, the title compound (81.1 mg) was ed from tert-butyl [trans—2—(4— heny1)cyclopropy1](cyclopropylmethyl)carbamate (96.9 mg) and 4—(methanesulfonamido)benzoic acid (83 mg).
MS (2491+): [M+H]+ 400.3. 1H NMR (300 MHz, s) 5 0.32—0.40 (2H, m), 0.53—0.62 (2H, m), 0.97—1.12 (1H, m), 1.21—1.33 (1H, m), 1.41—1.53 (1H, m), 2.36—2.46 (1H, m), 2.82—3.01 (3H, m), 3.09 (3H, s), 7.15 (2H, d, J = 8.7 Hz), 7.30 (2H, d, J = 8.9 Hz), 7.69 (2H, d, J = 8.7 Hz), 7.93 (2H, d, J = 8.9 Hz), 9.08 (2H, brs), 10.14 (2H, s).
Example 136 N—(4—{trans—2~[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—3— [(methylsulfonyl)amino]benzamide hloride . zk/§§ {a {/0 g ] Pg? ’J’S‘MS/A‘Nfilf’ \ {INN-‘yifffi‘t\,.
O gory” xx. a K ,3?
[0484] By a method similar to Example 80, the title compound (75.4 mg) was obtained from tert—butyl [trans-2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (95.3 mg) and 3-(methanesulfonamido)benzoic acid (81 mg).
MS (API+): [M+H]+ 400.3. 1H NMR (300 MHz, DMSO—de) 5 0.26—0.42 (2H, m), 0.51-0.65 (2H, m), 0.93—1.14 (1H, m), 1.18—1.33 (1H, m), 1.37—1.54 (1H, m), 2.32—2.47 (1H, m), 2.83—2.99 (3H, m), 3.04 (3H, s), 7.16 (2H, d, J = 8.5 Hz), 7.37—7.55 (2H, m), 7.63—7.76 (4H, m), 9.03 (2H, brs), 9.98 (1H, brs), 10.27 (1H, s).
Example 137 N—(4—{trans-2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl) thiophene—2—carboxamide hydrochloride
[0486] :4...- (5 ‘12 .1 m —. r“\ x 3‘ 'yak~ TI 1.“; D. ‘ncfiia \z xN/“x. X H “V By a method r to Example 80, the title compound (46.8 mg) was obtained from tert—butyl [tranS*2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (83.1 mg) and 4—phenylthiophene~2~carboxylic acid (67.3 mg).
MS (API+): [M+H]+ 389.2. 1H NMR (300 MHz, DMSO—dg) 5 0.27—0.44 (2H, m), 0.53—0.64 (2H, m), 0.95—1.15 (1H, m), 1.21—1.34 (1H, m), 1.40—1.54 (1H, m), 2.35—2.46 (1H, m), 2.84—3.01 (3H, m), 7.19 (2H, d, J = 8.5 Hz), 7.35 (1H, t, J = 7.4 Hz), 7.48 (2H, dd, J = 7.4, 7.3 Hz), 7.69 (2H, d, J = 8.5 Hz), 7.75 (2H, d, J = 7.3 Hz), 8.18 (1H, d, J = 1.4 Hz), 8.52 (1H, brs), 9.01 (1H, brs), 10.32 (1H, brs).
Example 138 N~(4*{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—4~ (pyrimidin—Z—yl)benzamide hydrochloride {1N7
[0490] By a method similar to e 80, the title compound (34.3 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (87.7 mg) and 4—(Pyrimidin-Z—yl)benzoic acid (69.7 mg).
MS (API+): [M+H]+ 385.1. 1H NMR (300 MHz, g) 5 .42 (2H, m), 0.53—0.66 (2H, m), 0.98—1.12 (1H, m), 1.24—1.35 (1H, m), 1.43—1.55 (1H, m), 2.39—2.46 (1H, m), 2.86—3.07 (3H, m), 7.19 (2H, d, J = 8.6 Hz), 7.53 (1H, t, J = 4.9 Hz), 7.75 (2H, d, J = 8.7 Hz), 8.11 (2H, d, J = 8.6 Hz), 8.53 (2H, d, J = 8.6 Hz), 8.97 (2H, d, J = 4.9 Hz), 9.06 (2H, brs), 10.37 (1H, s).
Example 139 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—3— (pyrimidin—Z—yl)benzamide hloride By a method similar to Example 80, the title compound (38.9 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (93.0 mg) and 3—(pyrimidin—Z—yl)benzoic acid (73.9 mg).
MS (API+): [M+H]+ 385.1. 1H NMR (300 MHZ, DMSO—dg) 5 0.32—0.42 (2H, m), 0.53—0.65 (2H, m), 0.98—1.11 (1H, m), 1.23—1.35 (1H, m), 1.41—1.55 (1H, m), 2.40—2.47 (1H, m), 2.87—3.08 (3H, m), 7.19 (2H, d, J = 8.6 Hz), 7.52 (1H, t, J = 4.9 Hz), 7.70 (1H, dd, J = 7.8, 7.6 Hz), 7.75 (2H, d, J = 8.6 Hz), 8.10 (1H, ddd, J = 7.6, 1.7, 1.5 Hz), 8.59 (1H, ddd, J = 7.8, 1.6, 1.5 Hz), 8.95 (1H, dd, J = 1.7, 1.6 Hz), 8.97 (2H, d, J = 4.9 Hz), 9.05 (2H, brs), 10.45 (1H, s).
Example 140 N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)benzamide hydrochloride E x;L a \'\’/-’/’t £\p{/N\I:A\QE % ’ '5‘ ,fipi\ " mm“ B W By a method r to Example 68, Steps E and F, the title compound (79.3 mg) was obtained from tert—butyl [trans—2~ (4—aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (91.8 mg) and benzoyl de (42.3 uL).
MS (API+): [M+H}+ 307.3. 1H NMR (300 MHz, DMSO—d6)5 0.22—0.38 (2H, m), 0.46—0.63 (2H, m), 0.90—1.11 (1H, m), 1.13—1.30 (1H, m), 1.31—1.49 (1H, m), 2.28— 2.46 (1H, m), .97 (3H, m), 7.15 (2H, d, J = 8.7 Hz), 7.47—7.63 (3H, m), 7.64—7.75 (2H, m), 7.90e7.98 (2H, m), 10.22 (1H, brs).
Example 141 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— cyclohexanecarboxamide hydrochloride ("*5- LBJ/1‘ _ I,§i.\[;vfl§§1E V {“1}?<47 . ’_ .
[0499] By a method similar to Example 73, the title compound (145 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropy1](cyclopropylmethyl)carbamate (170 mg) and cyclohexanecarbonyl chloride (99.0 mg).
MS (API+): [M+H]+ 313.1. 1H NMR (300MHz, CDyDD)5 0.41 (2H, q, J = 5.0 Hz), 0.65—0.76 (2H, m), 1.03—1.17 (1H, m), .60 (7H, m), 1.67—1.76 (1H, m), 1.78—1.90 (4H, m), 2.27—2.50 (2H, m), 2.94 (1H, dt, J = 7.8, 4.0 Hz), 3.06 (2H, dd, J = 7.5, 2.1 Hz), 7.11 (2H, d, J = 8.5 Hz), 7.50 (2H, d, J = 8.7 Hz).
Example 142 N-{4-[trans—2—{[2— (dimethylamino)benzyl]amino}cyclopropyl]phenyl}—3— (trifluoromethyl)benzamide hloride i J11 £7.AK KKK ; $3122. “‘5 J.x: , "3/ f2 R C} .. x5,...“
[0502] By a method similar to Example 65, the title nd (40 mg) was obtained from N—[4~(trans—2—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (100 mg) and 2— (dimethylamino)benzaldehyde (41.8 mg).
MS (API+): [M+H]+ 454.0. 1H NMR (300 MHz, DMSO—ds) 5 1.22—1.34 (1H, m), 1.56—1.71 (1H, m), 2.54—2.64 (1H, m), 2.82 (6H, s), 2.98—3.11 (1H, m), 4.52 (2H, brs), 7.13 (2H, d, J = 8.5 Hz), 7.24—7.38 (1H, m), 7.42— 7.57 (2H, m), 7.67—7.82 (4H, m), 7.97 (1H, d, J = 7.7 Hz), 8.22—8.33 (2H, m), 9.84 (2H, brs), 10.52 (1H, s).
Example 143 2—(4-{trans-2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—1H— isoindole~1,3(2H)—dione hydrochloride A) tert-butyl (cyclopropylmethyl){trans—2—[4—(1,3—dioxo—1,3— dihydro—ZH-isoindol—Z—yl)phenyl]cyclopropyl}carbamate To a on of tert-butyl —2—(4- aminopheny1)cyclopropy1](cyclopropylmethyl)carbamate (177.9 mg) and triethylamine (98 uL) in THF (2.94 mL) was added phthalic anhydride (105 mg). The mixture was stirred at room temperature overnight and the solvent was evaporated under reduced pressure. The residue was ved in acetic anhydride (3 mL), and the mixture was stirred at 80°C for 5 hr.
The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl e) to give the title compound (252.7 mg). 1H NMR (300 MHz, DMSO—ds) 5 0.07—0.18 (1H, m), 0.19—0.31 (1H, m), 0.33-0.56 (2H, m), 0.90—1.07 (1H, m), 1.25—1.34 (2H, m), 1.38 (9H, s), 2.10—2.24 (1H, m), 2.75-2.85 (1H, m), 3.01 (1H, dd, J = 14.4, 6.7 Hz), 3.22 (1H, dd, J = 14.4, 6.7 Hz), 7.22- 7.39 (4H, m), 7.85—7.99 (4H, m).
B) 2—(4-{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— 1H—isoindole—1,3(2H)—dione hydrochloride tert-Butyl (cyclopropylmethyl){trans—2—[4—(1,3—dioxo—1,3— dihydro—ZH—isoindol—Z—yl)phenyl]cyclopropyl}carbamate (252.7 mg) was dissolved in 4N hydrochloric acid/cyclopentyl methyl ether solution (3 mL), and the mixture was stirred at room temperature for 2 hr. The solvent was evaporated under reduced pressure. The residue was tallized from methanol/diisopropyl ether to give the title compound (176.2 mg).
MS (API+): [M+H]+ 333.2. 1H NMR (300 MHz, DMSO—ds) 6 .43 (2H, m), 0.55—0.64 (2H, m), 1.02—1.16 (1H, m), 1.31—1.43 (1H, m), .66 (1H, m), 2.54-2.63 (1H, m), 2.90—3.07 (3H, m), 7.21—7.50 (4H, m), 7.84— 8.03 (4H, m), 9.37 (2H, brs).
Example 144 2-(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)isoindolin—l-one hydrochloride fmmfi, ./~ 3 ...fa H‘JNKY’AQK if .2 E Q i3§5§X&N:;?‘ Ark “§' 7 B; Ky A) tert—butyl (cyclopropylmethyl){trans—2—[4—(l—oxo—1,3- dihydro—ZH—isoindoln2—yl)phenyl]cyclopropyl}carbamate To a solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (126.8 mg) and triethylamine (70.1 uL) in THE (2.1 mL) was added 2— omethyl)benzoyl chloride (95 mg). The mixture was stirred at room temperature overnight, and saturated aqueous ammonium chloride on was added. The mixture was extracted with ethyl acetate, and the extract was washed successively with saturated aqueous sodium hydrogen ate solution and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced re to give a mixture (260.5 mg) containing the title compound and tert~butyl [trans—2—(4—{[2- (chloromethyl)benzoyl]amino}phenyl)cycloprople- (cyclopropylmethyl)carbamate. To a solution of this mixture and tetrabutylammonium iodide (15.51 mg) in DMF (4.2 mL) was added sodium hydride (20.16 mg). The e was stirred at room temperature for 2 hr and poured into water. The mixture was extracted with ethyl acetate, and the extract was washed with saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography e/ethyl acetate) to giVe the title compound (123.7 mg). 1H NMR (300 MHz, DMSO—dg) 5 0.07—0.17 (1H, m), 0.18—0.28 (1H, m), 0.33—0.53 (2H, m), 0.90—1.08 (1H, m), 1.14-1.27 (2H, m), 1.37 (9H, s), 2.07 (1H, ddd, J = 9.4, 6.5, 3.2 Hz), 2.65—2.78 (1H, m), 3.00 (1H, dd, J = 14.4, 6.8 Hz), 3.20 (1H, dd, J = 14.4, 6.8 Hz), 5.49 (2H, s), 7.09 (2H, d, J = 8.5 Hz), 7.17 (2H, d, J = 8.5 Hz), 7.50—7.73 (4H, m).
B) 2—(4-{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)isoindolin—l—one hydrochloride tert—Butyl (cyclopropylmethyl){trans—2-[4—(1—oxo—1,3— dihydro—ZH—isoindol—2—yl)phenyl]cyclopropyl}carbamate (123.7 mg) was dissolved in 4N hydrochloric acid/cyclopentyl methyl ether solution (1.5 mL), and the mixture was stirred at room temperature for 4 hr. The solvent was evaporated under reduced pressure. The e was recrystallized from methanol/diisopropyl ether to give the title compound (76.4 mg).
MS (API+): [M+H]+ 319.3. 1H NMR (300 MHz, DMSO-ds) 5 0.32-0.42 (2H, m), 0.52—0.64 (2H, m), 0.99—1.17 (1H, m), 1.22—1.36 (1H, m), 1.45—1.63 (1H, m), 2.53—2.59 (1H, m), 2.82—3.06 (3H, m), 5.65 (2H, brs), 7.08—7.44 (4H, m), 7.46—7.84 (3H, m), .41 (1H, m), 9.33 (2H, brs).
Example 145 trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)~3— oylbenzamide hydrochloride A) tert—butyl (cyclopropylmethyl)(trans—2—{4—[(3— sulfamoylbenzoyl)amino]phenyl}cyclopropyl)carbamate By a method similar to Example 80, Step A, the title compound (125.0 mg) was obtained from tert—butyl (4— aminopheny1)cyclopropyl](cyclopropylmethyl)carbamate (76.0 mg) and 3—sulfamoylbenzoic acid (60.7 mg). 1H NMR (300 MHz, g) 5 0.07—0.16 (1H, m), 0.18-0.28 (1H, m), 0.33—0.51 (2H, m), 1.02 (1H, brs), 1.20-1.28 (2H, m), 1.37 (9H, s), 2.07 (1H, ddd, J = 9.6, 6.5, 3.1 Hz), 2.69—2.76 (1H, m), 3.00 (1H, dd, J = 14.4, 6.7 Hz), 3.20 (1H, dd, J = 14.4, 6.7 Hz), 7.14 (2H, d, J = 8.6 Hz), 7.47—7.51 (2H, m), 7.67 (2H, d, J = 8.6 Hz), 7.73 (1H, dd, J = 7.7, 7.6 Hz), 7.98—8.08 (1H, m), 8.10—8.22 (1H, m), 8.38 (1H, t, J = 1.6 Hz), 10.43 (1H, s).
B) N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropy1}phenyl)— 3—sulfamoylbenzamide hydrochloride tert-Butyl (cyclopropylmethyl)(trans—2—{4—[(3~ sulfamoylbenzoyl)amino]phenyl}cyclopropyl)carbamate (125.0 mg) was dissolved in 4N hydrochloric acid/ethyl acetate solution (1.25 mL), and the mixture was d at room temperature overnight. The solvent was evaporated under reduced pressure.
The residue was recrystallized from methanol/diisopropyl ether to give the title compound (69.5 mg).
MS (API+): [M+H]+ 386.3. 1H NMR (300 MHz, DMSO~d6) 5 0.28—0.40 (2H, m), 0.54—0.62 (2H, m), 0.95—1.11 (1H, m), 1.17—1.34 (1H, m), 1.35—1.52 (1H, m), .45 (1H, m), 2.86—3.02 (3H, m), 7.18 (2H, d, J = 8.5 Hz), 7.49 (2H, s), 7.67—7.79 (3H, m), 8.00—8.04 (1H, m), 8.14—8.19 (1H, m), 8.37 (1H, t, J = 1.7 Hz), 8.90 (2H, 5), 10.48 (1H, s).
Example 146 trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—3~ (1H—imidazol—1—y1methyl)benzamide hydrochloride By a method similar to Example 145, the title compound (21.0 mg) was obtained from tert-butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (76.6 mg) and 3—(1H—imidazol—1—ylmethyl)benzoic acid (61.5 mg).
MS (API+): [M+H]+ 387.4. 1H NMR (300 MHz,-DMSO—d6) 6 0.29—0.45 (2H, m), 0.53~0.62 (2H, m), 1.05—1.12 (1H, m), 1.2l~1.31 (1H, m), 1.47—1.60 (1H, m), 2.42—2.47 (1H, m), 2.85~3.00 (3H, m), 5.52 (2H, s), 7.17 (2H, d, J = 8.3 Hz), 7.52—7.65 (2H, m), 7.67—7.76 (3H, m), 7.81—7.88 (1H, m), 7.94—8.08 (2H, m), 9.22—9.45 (3H, m), 10.37 (1H, s). e 147 N-(4—{trans-2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)~3— (1H—1,2,4—triazol~1—ylmethyl)benzamide hydrochloride ,flfirhi g \- J .
N\lfix/é‘xi?‘l .
. E 1 _ . KY .. i(I -: 0- i \x’“.
./ N' H S7 By a method similar to Example 145, the title compound (15.3 mg) was obtained from tert—butyl —2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (76.6 mg) and 3—(1H—1,2,4—triazol—1—ylmethyl)benzoic acid (61.8 mg).
MS (API+): [M+H]+ 388.3. 1H NMR (300 MHz, DMSO—de) 5 o 33—o.4o (2H, m), 0.55—0.62 (2H, m), .12 (1H, m), 1.23—1.33 (1H, m), 1.42—1.54 (1H, m), 2.40—2.46 (1H, m), 2.87—3.03 (3H, m), 5.51 (2H, s), 7.17 (2H, d, J = 8.7 Hz), 7.45—7.58 (2H, m), 7.69 (2H, d, J = 8.7 Hz), 7.82— 7.94 (2H, m), 8.01 (1H, s), 8.72 (1H, s), 9.08 (2H, brs), 10.27 (1H, s).
Example 148 —(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)-3— (lH—imidazol-l—yl)benzamide hydrochloride <¢?/§ymEfwfiprW5 59 ‘\¢¢ :;?\§/I\fi;f,\ _H By a method similar to e 145, the title compound (48.2 mg) was obtained from utyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (77.3 mg) and 3— (1H—imidazol—1—yl)benzoic acid (48.1 mg).
MS (API+): [M+H]+ 373.3. 1H NMR (300 MHz, DMSO—ds) 6 0.38 (2H, m), 0.53-0.62 (2H, m), 1.08-1.15 (1H, m), 1.22—1.32 (1H, m), 1.50—1.60 (1H, m), 2.52— 2.58 (1H, m), 2.88—3.01 (3H, m), 7.19 (2H, d, J = 8.6 Hz), 7.76—7.85 (3H, m), 7.90 (1H, s), 8.03 (1H, dd, J = 8.1, 1.6 Hz), 8.12 (1H, d, J = 8.1 Hz), 8.48 (2H, d, J = 19.1 Hz), 9.42 (2H, brs), 9.81 (1H, brs), 10.68 (1H, 5).
Example 149 —(4—{trans—2—[(8—methyl—8—azabicyclo[3.2.1]oct—3— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide dihydrochloride ‘ é H ... R. 1 N . t: 1 N. J» S irac, By a method similar to Example 65, the title compound (50 mg) was ed from N-[4—(trans—Z—aminocyclopropyl)phenyl]~3— (trifluoromethyl)benzamide hloride (100 mg) and 8—methyl— 8—azabicyclo[3.2.1]octanone (50.7 mg).
MS (API+): [M+H]+ 444.1. 1H NMR (300MHz, CD3OD)5 1.44—1.61 (3H, m), 1.66-1.78 (3H, m), 2.21—2.26 (1H, m), 2.37—2.56 (3H, m), 2.68—2.76 (1H, m), 2.80— 2.86 (3H, m), 3.15—3.25 (1H, m), 3.80—4.30 (3H, m), 7.25 (2H, d, J = 7.9 Hz), 7.65—7.78 (3H, m), 7.90 (1H, d, J = 7.8 Hz), 8.18— 8.28 (2H, m).
[0527] e 150 N—methyl—N—(4—{trans~2*[(l—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3-(trifluoromethyl)benzamide dihydrochloride
[0528] By a method similar to Example 64, the title compound (3 mg) was obtained from N—(4—{trans—2~[(1—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)~3—(trifluoromethyl)benzamide hydrochloride (160 mg).
MS (API+): [M+H]+ 432.1. 1H NMR z, CD30D)5 1.18—1.43 (2H, m), 1.48—1.62 (1H, n0, 1.91—2.11 (2H, m), 2.31—2.58 (3H, m), 2.84—3.21 (5H, m), 3.46 (3H, s), 3.56—3.73 (3H, m), 7.05—7.19 (4H, m), 7.37—7.48 (1H, m), 7.51—7.63 (3H, m).
Example 151 N—(4—{trans[(1,1—dioxidotetrahydro—ZH-thiopyran-4— yl)amino]cyclopropyl)phenyl)—3—(trifluoromethyl)benzamide hydrochloride To a solution of N—[4—(trans—2-aminocyclopropyl)phenyl]— 3-(trifluoromethyl)benzamide hydrochloride (75 mg), tetrahydro— opyran—4—one 1,1—dioxide (37.4 mg) and acetic acid (0.2 mL) in methanol (2 mL) was added 2—picoline—borane complex (38.2 mg). The mixture was stirred at room temperature overnight, and saturated aqueous sodium hydrogen carbonate solution was added under ice—cooling. The e was extracted with ethyl acetate, and the extract was washed with water and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under d pressure.
The residue was purified by silica gel column chromatography (hexane/ethyl e, ethyl acetate/methanol) and 10% hydrochloric acid methanol solution was added. The solvent was evaporated under reduced pressure. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (32.0 mg).
MS (API+): [M+H]+ 453.1. 1H NMR (300MHz, CDyDD)5 1.39—1.61 (2H, m), 2.25 (2H, d, J = 12.8 Hz), 2.43—2.63 (3H, m), 3.03 (1H, dt, J = 7.7, 4.1 Hz), .25 (2H, m), 3.32—3.42 (2H, m), .76 (1H, m), 7.22 (2H, d, J = 8.5 Hz), 7.65—7.78 (3H, m), 7.89 (1H, d, J = 7.7 Hz), 8.15—8.26 (2H, m).
[0533] Example 152 N—(4—{(1R,28) or (18,2R)—2-[(1—methy1piperidin—4— yl)amino]cyclopropyl}phenyl)—3-(trifluoromethyl)benzamide dihydrochloride
[0534] trans—2—[(1-Methylpiperidin—4— yl)amino]cyclopropyl}phenyl)~3—(trifluoromethyl)benzamide ochloride (113 mg) was fractionated by HPLC (CHIRALCEL (registered trademark) OD (CA002), 50 mmID X 500 mmL, manufactured by Daicel Corporation, mobile phase: hexane/ethanol/diethy1amine = 900/100/O.5), a fraction containing the object product and having a shorter ion time was concentrated under reduced pressure, and the residue was ice—cooled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (3.0 mL) was added, and the mixture was trated under reduced pressure to give the title compound (43tmg). optical purity: 99.9% ee, ion time: 9.284 min (CHIRACEL (registered trademark) OD3 (NL022), 4.6 mmID x 250 mmL, manufactured by Daicel Corporation, mobile phase: hexane/ethanol/diethy1amine = 900/100/0.1) 1H NMR (300MHz, CDjDD)5 1.41—1.52 (1H, m), 1.54—1.64 (1H, m), 2.00—2.19 (2H, m), 2.38—2.63 (3H, m), 2.91 (3H, s), 2.99—3.06 (1H, m), 3.10—3.27 (2H,m), 3.59—3.75 (3H, m), 7.23 (2H, d, J = 8.5 Hz), 7.64—7.77 (3H, m), 7.90 (1H, d, J = 7.9 Hz), 8.17—8.27 (2H, m).
Example 153 N—(4—{(1S,2R) or (1R,28)—2-[(1—methylpiperidin—4— . y1)amino]cyclopropyl}phenyl)~3—(trifluoromethyl)benzamide dihydrochloride N—(4¥{trans—2—[(1—Methylpiperidin—4— yl)amino]cyclopropyl}phenyl)~3~(trifluoromethyl)benzamide dihydrochloride (113 mg) was fractionated by HPLC (CHIRALCEL (registered trademark) OD (CA002), 50 mmID x 500 mmL, manufactured by Daicel Corporation, mobile phase: hexane/ethanol/diethy1amine II 900/100/0.5), a fraction containing the object product and having a longer retention time was concentrated under reduced pressure, and the residue was ice—cooled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (3.0 mL) was added, and the e was concentrated under reduced pressure to give the title compound (46 mg). optical purity: 99.1% ee, retention time: 12.724 min (CHIRACEL (registered trademark) OD3 (NL022), 4.6 mmID x 250 mmL, manufactured by Daicel Corporation, mobile phase: hexane/ethanol/diethylamine = 900/100/0.1) 1H NMR z, CD3OD)5 1.43—1.52 (1H, m), 1.54—1.64 (1H, m), 1.98—2.19 (2H, m), 2.37-2.61 (3H, m), 2.91 (3H, s), 3.00—3.25 (3H, m), 3.59—3.76 (3H, m), 7.23 (2H, d, J = 8.7 Hz), 7.67—7.77 (3H, m), 7.90 (1H, d, J = 7.3 Hz), 8.16—8.27 (2H, m).
Example 154 trans—2—[(4,4— difluorocyclohexyl)amino]cyclopropyl}phenyl)—3~ uoromethyl)benzamide hydrochloride é a AAk‘x’ \. 4 g \ r’ikxu F F‘s?» ‘“ 11’ 0:1 ,ng’wf: o ’4’ 4 ' j ‘1 (’5\ l. V x. N By a method similar to Example 151, the title compound (45 mg) was ed from N—[4—(trans—2- aminocyclopropyl)phenyl]~3—(trifluoromethyl)benzamide hydrochloride (75 mg) and 4,4—dif1uorocyclohexanone (33.8 mg).
MS (2191+): [M+H]+ 439.0. in NMR (300MHz, CDyDD)5 1.39—1 55 (2H, m), 1.73 (2H, q, J = 12.2 H2), 1.83—2.08 (2H, m), 2.1142.32 (4H, m), 2.44 (1H, ddd, J = 10.1, 6.7, 3.6 Hz), 2.95—3.03 (1H, m), 3.40—3.55 (1H, m), 7.20 (2H, d, J = 8.7 Hz), 7.65—7.77 (3H, m), 7.89 (1H, d, J = 7.9 Hz), 8.15—8.27 (2H, m).
Example 155 N—{4-[trans{[(1-methylpiperidin—4— y1)methyl]amino}cyclopropyl]phenyl}—3— (trifluoromethyl)benzamide dihydrochloride
[0544] By a method similar to Example 65, the title compound (20 mg) was obtained from N—[4—(trans—Z—aminocyclopropyl)phenyl]~3— (trifluoromethyl)benzamide hydrochloride (80 mg) and 1— methylpiperidine—4~carbaldehyde (28.5 mg).
Ms (API+): [M+H]+ 432.1. 1H NMR (300MHz, CD3OD)5 1.35—1.46 (1H, m), 1.51-1.73 (3H, nu, .16 (3H, m), .61 (1H, m), 2.86—2.92 (3H, m), 2.97— 3.11 (3H, m), 3.20 (2H, d, J = 6.6 Hz), 3.52—3.63 (2H, m), 7.21 (2H, d, J = 8.7 Hz), .77 (3H, m), 7.89 (1H, d, J = 7.9 Hz), 8.15—8.29 (2H, m).
Example 156 N—(4—{trans-2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— methyl—1H—pyrazole—S—carboxamide dihydrochloride By a method similar to Example 145, the title compound (89.6 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (88.6 mg) and methyl—lH—pyrazole—5-carboxylic acid (49.3 mg).
Ms (API+): [M+H]+ 325.3. 1H NMR (300 MHZ, DMSO—ds) 5 0.32-0.40 (2H, m), 0.52—0.64 (2H, m), 0.98—1.14 (1H, m), 1.22—1.32 (1H, m), 1.42—1.55 (1H, m), 2.19 (3H, s), 2.40—2.47 (1H, m), 2.87—3.03 (3H, m), 3.99 (3H, s), 6.82 (1H, s), 7.16 (2H, d, J = 8.6 Hz), 7.65 (2H, d, J = 8.6 Hz), 9.18 (2H, brs), 10.11 (1H, s).
[0548] Example 157 N~(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— l,5—dimethyl-lH—pyrazole—3—carboxamide dihydrochloride /"333 ~HN‘ 1 H ‘ 4‘97"? tax-N \‘gT/{béz O K.:?/’$§“\T7\ I“ x ‘Ni’ v .
By a method similar to Example 145, the title compound (60.0 mg) was obtained from tert-butyl [trans—2—(4— aminophenyl)cyclopropy1](cyclopropylmethyl)carbamate (87.2 mg) and 1,5—dimethyl—1H—pyrazole—3—carboxy1ic acid (48.5 mg).
Ms (API+): [M+H]+ 325.3. 1H NMR (300 MHz, s) 5 0.31—0.41 (2H, m), 0.53—0.63 (2H, m), 0.98—1.11 (1H, m), 1.18—1.33 (1H, m), 1.41—1.52 (1H, m), 2.30 (3H, s), 2.37—2.47 (1H, m), 2.85—3.03 (3H, m), 3.83 (3H, s), 6.53 (1H, s), 7.12 (2H, d, J = 8.7 Hz), 7.74 (2H, d, J = 8.6 Hz), 9.11 (2H, brs), 9.89 (1H, s).
[0551] Example 158 N-(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—1— methyl—3;(trifluoromethyl)~1H—pyrazole—4—carboxamide hloride
[0552] {ERTE 'H ”Far“ Ff: 5: I :;l.. ’ ., \gx . M; \R “:5.- . f 3r W... "k H \S‘X By a method similar to Example 145, the title compound (40.8 mg) was obtained from tert~butyl [trans—2—(4— aminopheny1)cyclopropyl](cyclopropylmethyl)carbamate (87.1 mg) and 1—methy1-3—(trifluoromethyl)—1H—pyrazole~4~carboxylic acid (67.1 mg).
MS (API+): [M+H]+ 379.3. 1H NMR (300 MHz, DMSO—de) 5 0.29—0.39 (2H, m), .62 (2H, m), 0.95—1.11 (1H, m), 1.17—1.30 (1H, m), 1.35—1.52 (1H, m), 2.31-2.45 (1H, m), 2.81—3.01 (3H, m), 3.98 (3H, s), 7.14 (2H, d, J = 8.6 Hz), 7.60 (2H, d, J = 8.6 Hz), 8.53 (1H, s), 8.95 (2H, brs), 10.11 (1H, s).
Example 159 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—l— methyl—5-(trifluoromethyl)—1H—pyrazole—4—carboxamide hydrochloride By a method similar to Example 80, the title compound (56.1 mg) was obtained from tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (82.8 mg) and yl—S-(trifluoromethyl)~1H—pyrazole—4—carboxylic acid (63.8 mg).
MS (API+): [M+H]+ 379.3. 1H NMR (300 MHz, DMSO—ds) 5 0.29—0.40 (2H, m), 0.52—0.62 (2H, m), 0.95—1.11 (1H, m), 1.18—1.30 (1H, m), 1.39—1.52 (1H, m), 2.32—2.47 (1H, m), 2.82—3.02 (3H, m), 3.98 (3H, s), 7.14 (2H, d, J = 8.6 Hz), 7.61 (2H, d, J = 8.6 Hz), 8.54 (1H, s), 9.01 (2H, brs), 10.12 (1H, s).
Example 160 N—(4—{trans—2~[(imidazo[2,1~b][l,3]thiazol—6— ylmethyl)amino]cyclopropyl}phenyl)~3—(trifluoromethyl)benzamide ochloride
[0559] By a method similar to Example 65, the title compound (17 mg) was obtaihed from N—[4-(trans—2—aminocyclopropy1)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (75 mg) and imidazo[2,1—b][1,3]thiazole—6—carbaldehyde (41.6 mg).
MS : [M+H]+ 457.0. 1H NMR (300 MHz, CDyDD)5 1.35 (1H, q, J = 6.8 Hz), 1.53-1.65 (1H, m), 2.50 (1H, s), 3.00—3.11 (1H, m), 4.60—4.66 (2H, m), 7.01 (2H, d, J = 8.3 Hz), 7.51—7.69 (4H, m), 7.80 (1H, d, J 7.7 Hz), 8.00—8.26 (4H, m). e 161 N-(4—{trans-2—[(thieno[2,3—b]pyridin-2— ylmethy1)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide hydrochloride 28‘.
F543" 3"” 71/" Wfb" 33« ‘iK‘LJJL’ , fl kg 3.;{Mfi§V smurf By a method similar to Example 65, the title compound (10 mg) was obtained from N—[4~(trans—Z—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hydrochloride (75 mg) and thieno[2,3—b]pyridine~2—carbaldehyde (44.6 mg).
Ms (API+): [M+H]+ 468.0. 1H NMR (300 MHz, CDyDD)5 1.36—1.57 (2H, m), 2.41 (1H, ddd, J = .2, 6.5, 3.7 Hz), 3.01 (1H, dt, J = 7.6, 4.0 Hz), 4.73 (2H, s), 7.07 (2H, d, J = 8.7 Hz), 7.44—7.54 (2H, m), 7.61 (2H, d, J = 8.7 Hz), .79 (1H, m), 7.90 (1H, d, J = 7.9 Hz), 8.15— 8.30 (3H, m), 8.58 (1H, dd, J = 4.7, 1.5 Hz).
Example 162 N—(4-{trans—2-[(1,8—naphthyridin-2— ylmethyl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide hydrochloride 2%“; , é ‘ :1 H 548. , x 13* ’?~ FfiS‘ J ]T “E x? .9, §~.fi'¥}‘$ \I ' 5" By a method similar to Example 65, the title compound (16 mg) was obtained from N—[4—(trans—2—aminocyclopropyl)phenyl]—3— (trifluoromethyl)benzamide hloride (75 mg) and 1,8— naphthyridine—Z~carbaldehyde(43.2 mg).
Ms (API+): [M+H]+ 463.0. 1H NMR (300 MHz, CDyDD)5 1.42-1.53 (lH, m), .73 (lH, m), 2.59—2.70 (1H, m), 3.20—3.28 (lH, m), 4.95 (2H, s), 7.20 (2H, d, J = 8.7 Hz), 7.64—7.77 (3H, m), 7.83—7.97 (3H, m), .27 (2H, m), 8.69 (lH, d, J [I 8.5 Hz), 8.85 (1H, dd, J = 8.3, 1.7 Hz), 9.19—9.32 (lH, m).
Example 163 N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)—l— methyl—lH—pyrazole—4—carboxamide hydrochloride
[0568] A) tert-butyl (cyclopropylmethyl)[trans—2-(4—{[(l—methyl—lH— pyrazol—4—yl)carbonyl]amino}phenyl)cyclopropyl]carbamate To a solution of tert—butyl [trans—2—(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (85.8 mg) and l—methyl—lH-pyrazole—4—carboxylic acid (42.9 mg) in DMF (1.42 mL) was added N—ethyl—N'-(3- dimethylaminopropyl)carbodiimide hydrochloride (82 mg). The mixture was stirred at room temperature overnight, and poured into water. The mixture was extracted with ethyl acetate, and the extract was washed sively with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure to give the title compound (114.8 mg). 1H NMR (300 MHz, DMSO—de) 5 0.05—0.16 (1H, m), 0.16—0.28 (1H, m), 0.32—0.52 (2H, m), 0.89—1.05 (1H, m), 1.09—1.26 (2H, m), 1.36 (9H, s), 2.00—2.10 (1H, m), 2.65—2.72 (1H, m), 2.98 (1H, dd, J = 14.2, 6.9 Hz), 3.19 (1H, dd, J = 14.2, 6.9 Hz), 3.88 (3H, s), 7.10 (2H, d, J = 8.5 Hz), 7.59 (2H, d, J = 8.7 Hz), 7.99 (1H, s), 8.28 (1H, s), 9.74 (1H, s).
B) N—(4—{trans—2—[(cyclopropylmethyl)amino]cyclopropyl}phenyl)— yl~1H—pyrazole—4~carboxamide hydrochloride tert—Butyl propylmethyl)[trans—2—(4—{[(1-methyl—1H— l—4—yl)carbonyl]amino}phenyl)cyclopropyl]carbamate (114.8 mg) was dissolved in 4N hydrochloric acid/cyclopentyl methyl ether solution (1 mL), and the e was stirred at room temperature for 1.5 hr. The solvent was evaporated under reduced re. The residue was recrystallized from methanol/diisopropyl ether to give the title compound (51.1 mg).
MS (API+): [M+H]+ 311.3. 1H NMR (300 MHZ, DMSO—de) 6 0.32—0.41 (2H, m), 0.51—0.62 (2H, m), 1.01—1.15 (1H, m), 1.19—1.30 (1H, m), 1.47—1.58 (1H, m), 2.43—2.49 (1H, m), 2.80—3.01 (3H, m), 3.89 (3H, s), 7.13 (2H, d, J = 8.7 Hz), 7.66 (2H, d, J = 8.7 Hz), 8.02 (1H, s), 8.33 (1H, s), 9.41 (2H, brs), 9.86 (1H, s).
[0570] Example 164 1—tert-butyl—N—(4-{trans—2- [(cyclopropylmethyl)amino]cyclopropyl}phenyl)~1H—pyrazole—4— carboxamide hydrochloride
[0571] By a method similar to Example 163, the title compound (30.7 mg) was obtained from utyl [trans—2-(4— aminophenyl)cyclopropyl](cyclopropylmethyl)carbamate (76.5 mg) and 1—(tert—butyl)—1H~pyrazole~4~carboxylic acid (51.1 mg).
MS (API+): [M+H]+ 353.2. 1H NMR (300 MHz, DMSO—ds) 5 .42 (2H, m), 0.53—0.61 (2H, m), 0.99—1.13 (1H, m), 1.19—1.30 (1H, m), 1.42—1.51 (1H, m), 1.55 (9H, s), 2.36—2.47 (1H, m), 2.84—2.98 (3H, m), 7.14 (2H, d, J = 8.5 Hz), 7.64 (2H, d, J = 8.5 Hz), 8.01 (1H, s), 8.48 (1H, s), 9.09 (2H, brs), 9.79 (1H, s).
Example 165 N—(4—{(1R,ZS) or (18,2R)—2— [(cyclopropylmethyl)amino]cyclopropyl}pheny1)biphenyl—4— carboxamide hydrochloride
[0575] N—(4—{trans—2— [(Cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— carboxamide hydrochloride (273 mg) was onated by HPLC (CHIRALPAK (registered trademark) AD (JGOOl), 50 mmID x 500 mmL, manufactured by Daicel Corporation, mobile phase: ethanol), a fraction containing the object product and having a shorter retention time was concentrated under reduced pressure, and the residue was oled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (3.0 mL) was added, and the mixture was concentrated under reduced pressure to give the title compound (116 mg). optical purity: 99.7% ee, retention time: 13.684 min LPAK (registered trademark) AD (KF053), 4.6 mmID X 250 mmL, manufactured by Daicel ation, mobile phase: ethanol) 1H NMR (300 MHz, CDyDD)6 0.39—0.48 (2H, m), .78 (2H, m), 1.06—1.23 (1H, m), 1.31—1.55 (2H, m), 2.47 (1H, ddd, J = 10.3, 6.7, 3.6 Hz), 2.95—3.03 (1H, m), 3.06-3.13 (2H, m), 7.21 (2H, d, J = 9.8 Hz), 7.36—7.53 (3H, m), 7.66—7.73 (4H, m), 7.78 (2H, d, J = 8.1 Hz), 8.01 (2H, d, J = 9.0 Hz).
Example 166 N-(4-{(lS,2R) or (lR,28)—2— [(cyclopropylmethyl)amino]cyclopropy1}phenyl)biphenyl—4— carboxamide hydrochloride 2:1: :12AV N—(4—{trans—2— [(Cyclopropylmethyl)amino]cyclopropy1}phenyl)biphenyl—4— carboxamide hydrochloride (273 mg) was fractionated by HPLC (CHIRALPAK (registered trademark) AD (JGOOl), 50 mmID x 500 mmL, manufactured by Daicel Corporation, mobile phase: ethanol), a on containing the object product and having a longer retention time was concentrated under reduced pressure, and the residue was ice—cooled to 0°C. 4N Hydrochloric acid/cyclopentyl methyl ether solution (3.0 mL) was added, and the mixture was concentrated under reduced pressure to give the title compound (128 mg). optical purity: 99.1% ee, retention time: 16.256 min (CHIRALPAK (registered trademark) AD (KF053), 4.6 mmID x 250 mmL, manufactured by Daicel Corporation, mobile phase: ethanol) 1H NMR (300 MHz, CD5ND)5 0.38—0.48 (2H, m), 0.69—0.79 (2H, m), \]\]O\i—‘ .O4—l.21 (1H, m), 1.36—1.55 (2H, m), 2.47 (1H, ddd, J = 10.2, .6, 3.4 Hz), 2.95—3.02 (1H, m), 3.09 (2H, dd, J = 7.5, 2.3 Hz), .21 (2H, d, J = 8.7 Hz), 7.36—7.44 (1H, m), 7.44—7.53 (2H, m), .66—7.73 (4H, m), 7.78 (2H, d, J = 8.9 Hz), 8.02 (2H, d, J = 8.5 Hz).
Experimental Example 1 The c engineering method described below was performed according to the method described in a book (Maniatis et al., Molecular g, Cold Spring Harbor Laboratory, 1989) or the method described in the protocol attached to the reagent. (1) Construction of GST—tagged expression vector having TEV se cleavage sequence A gged expression vector having TEV Protease cleavage sequence was constructed by successive 2 times of PCR method. y, PCR was performed using pGEX6Pl (GE Healthcare) as a template, two primers GST-Sw—F: ’—AGAATCATTTAAATGGTGATCATGTAACCCATCCT~3’ [SEQ ID NO: 1] GST-Tv—Rl: ’-CGCCCTGAAAGTACAGGTTCTCATCCGATTTTGGAGGATGGTCG—3’ [SEQ ID NO: 2] and PrimeStar GXL DNA Polymerase (Takara Bio Inc.). Template DNA 0.5 uL, 5x Buffer lO uL, 2.5 mM dNTP solution 4 uL, 10 pM primer on each 1.5 uL, PrimeStar GXL DNA Polymerase 1 nL, and sterilized distilled water 31.5 uL were mixeda After a treatment at 98°C for l min, the PCR reaction was d with repeats of a treatment at 98°C for 10 seconds, at 65°C for 5 seconds, and at 72°C for 25 s, followed by a treatment at 72°C for l min. Then, PCR was performed using the obtained PCR product as a template, two primers GST—Sw—F: ’-AGAATCATTTAAATGGTGATCATGTAACCCATCCT—3’ [SEQ ID NO: I] GST-TV-RZ: ’~ATAATAGGATCCGCCCTGAAAGTACAGGTTCTC~3' [SEQ ID NO: 3] and PrimeStar GXL DNA Polymerase. Template DNA 0.5 uL, 5x Buffer 10 uL, 2.5 mM dNTP solution 4 uL, 10 uM primer solution each 1.5 pL, PrimeStar GXL DNA Polymerase 1 uL, and sterilized distilled water 31.5 uL were mixed. After a treatment at 98°C for 1 min, the PCR reaction was started with 25 repeats of a treatment at 98°C for 10 seconds, at 65°C for 5 s, and at 72°C for 25 s, followed by a treatment at 72°C for 1 min.
The ed PCR product was electrophoresed on agarose gel (1%), and an about 0.3 kbp DNA fragment containing a part of GST gene was recovered from the gel. The recovered DNA fragment was cleaved with restriction enzymes Swa I (New England Biolabs) and Bam HI (Takara Bio Inc.), and inserted into the Swa I/Bam HI site of l to prepare an expression vector pGEX7V1. (2) Cloning of human LSDl (AOFZ) gene Human LSDl gene was cloned by PCR method using brain cDNA Library (Takara Bio Inc.) as a template, two primers hLSDl-NheI—ko-F: '—TATTATGCTAGCGCCACCATGTTATCTGGGAAGAAGGCGGCAGC—3’ [SEQ ID NO: 4] hLSDl—St-NotI—R: ’—TATTATGCGGCCGCTCACATGCTTGGGGACTGCTGTGC—3’ [SEQ ID NO: 5] and Pyrobest DNA Polymerase a Bio Inc.). Template DNA 0.5 uL, 10x Buffer 5 uL, 2.5 mM dNTP solution 4 uL, lO uM primer solution each 2.5 uL, Pyrobest DNA Polymerase 0.5 uL, and sterilized distilled water 34 uL were mixed. After a treatment at 98°C for l min, the PCR reaction was started with repeats of a treatment at 98°C for 10 seconds, at 68°C for 5 seconds, and at 72°C for 2.5 min, followed by a treatment at 72°C for l min. The obtained PCR product was electrophoresed on agarose gel (1%), and an about 2.5 kbp DNA fragment containing human LSDI gene was recovered from the gel. The red DNA fragment was cleaved with restriction enzymes Nhe I and Not I (Takara Bio Inc.), and inserted into the Nhe I/Not I site of .l(+) rogen) to prepare an expression plasmid pcDNA3.l/hLSD1. (3) Construction of expression plasmid for human LSDl(l7l—852) in Escherichia coli A plasmid for sion of human LSDl(l7l—852) in Escherichia coli was produced by PCR method using pcDNA3.l/hLSDl as a template, two primers hLSDl—l7laa—Bng—F: ’—TATTATAGATCTCCATCGGGTGTGGAGGGCGCA—3’ [SEQ ID NO: 6] hLSDl—St-NotI-R: ’~TATTATGCGGCCGCTCACATGCTTGGGGACTGCTGTGC-3’ [SEQ ID NO: 5] and tar MAX DNA Polymerase (Takara Bio Inc.). Template DNA 1 uL, 2x Enzyme PreMix 25 uL, 10 uM primer solution each 1.5 uL, and sterilized distilled water 21 uL were mixed. After a treatment at 98°C for l min, the PCR reaction was started with 25 repeats of a treatment at 98°C for 10 seconds and at 68°C for 10 seconds, ed by a treatment at 72°C for l min.
The obtained PCR product was electrophoresed on agarose gel (1%), and an about 2 kbp DNA fragment containing human LSD1(171-852) gene was red from the gel. The recovered DNA fragment was cleaved with restriction enzymes Bgl II and Not I (Takara Bio Inc.), and inserted into the Bam HI/Not I site of pGEX7V1 to e expression plasmid pGEX7V1/GST— hLSD1(171—852). (4) Preparation of LSDl ichia coli C43(DE3) pLysS was transformed with the expression plasmid pGEX7V1/GST—hLSD1(171—852) prepared in (3).
The obtained inant Escherichia coli was inoculated in a TB medium (1.2% tryptone, 2.4% yeast extract, 0.4% glycerol, 0.5% glucose, 17 mM potassium dihydrogen phosphate and 72 mM dipotassium hydrogen phosphate) added with 100 mg/L ampicillin and 30 mg/L chloramphenicol, and cultured at 37°C. When the turbidity reached 600 Klett units, the culture temperature was changed to 16°C, IPTG having a final concentration of 0.5 mM was added to induce expression, and the cells were cultured further for 21 hr. The culture medium was centrifuged at 9,000 g for 10 min, and Escherichia coli pellets were recovered.
Escherichia coli pellets in 9 L of the culture medium were suspended in 1340 mL of an extraction buffer (PBS, 5%(V/V) Glycerol), and 6700 units of ase (Merck) were added.
Using Branson onic disintegrator, the suspension was disrupted by ultrasonication for 3 min, and centrifuged at 33,000 g for 20 min, and the supernatant was recovered. To the supernatant was added 5 M NaCl on to a final concentration of 0.15 M, and the mixture was d to two GSTrap 4B 5 mL columns (GE Healthcare) equilibrated in advance with PBS, 0.15 M NaCl, 5%(V/V) Glycerol (Buffer A), and the columns were each washed with 25 mL of Buffer A. GST— hLSD1(171—852) was eluted from each column with 20 mL of 0.1 M Tris (pH 8.0), 10 mM GSH, 0.15 M NaCl, ) Glycerol. The eluate (14 mL) containing GST—hLSD1(171—852) was applied to HiLoad 26/60 Superdex 200 pg column (GE Healthcare) equilibrated with Buffer A, and eluted with 300 mL of Buffer A.
The fraction containing GST—hLSDl(l7l—852) was concentrated to 9 mL with AmiconUltra 15 (Japan Millipore) having a molecular weight cutoff of 30K to give purified GST—hLSDl(17l-852). 1 mg of His—TEV protease was added relative to about 36 mg of GST— hLSD1(l71-852), and the e was treated with 50 mM Tris (pH 8.0), 0.5 mM EDTA, 1 mM DTT at 4°C for 16 hr to cleave the GST tag. The reaction mixture after the cleavage reaction was applied to GSTrap 4B 5 mL column (GE Healthcare) equilibrated in e with Buffer A, and a flow—through fraction ning hLSD1(l71-852) free of GST tag was recovered. It was concentrated to 9 mL with AmiconUltra 15 (Japan Millipore), and purified with HiLoad 26/60 Superdex 200 pg column (GE Healthcare) equilibrated with Buffer A again to give hLSD1(171— 852) purified product. The protein concentration of hLSD1(l7l— 852) was measured by BCA Protein Assay Kit (Thermo Fisher Scientific K.K.) using bovine serum albumin as the standard. (5) Measurement of LSDl inhibitory activity A test compound dissolved in 2.5% DMSO was added by 4 uL to 3 uL reaction solution (50 mM Tris—HCl (pH 8.0), 0.1% BSA, 1 mM DTT) containing 2.8 ng of LSDl, and the mixture was d at room temperature for 15 min. —histone H3 mono methylated K4 peptide solution RT(me— K)QTARKSTGGKAPRKQLAGGK(Biotin)~CONH2) (3.3 uM) was added by 3 pL to start the reaction. After reaction at room temperature for 20 min, 1 mM 2—PCPA solution (5 pL) was added to ate the reaction. A detection solution (800 mM potassium de, 0.1% BSA) containing europium—labeled antihistone H3 antibody (Wako Pure Chemical Industries, Ltd.) and Streptavidin—XL665 (Cisbio) was further added by 5 uL, and the mixture was left standing for 60 min. A time—resolved fluorescence (excitation 320 nm, emission 615 nm, 665 nm) was measured by Envision (PerkinElmer). The LSDl inhibitory rate (%) of the test compound was calculated by the following formula. inhibitory rate (%) = (l — (test compound count — blank) + (control — blank) x 100 The count of the LSDl enzyme reaction mixture under compound non—addition conditions is indicated as control, and the count under compound dition and LSDl enzyme non— addition conditions is indicated as blank. The results are shown in Table 2.
Experimental Example 2 (1) Measurement of MAO—A inhibitory activity The MAO—A inhibitory activity evaluation described below followed the protocol of MAO—Glo (registered trademark) Assay of Promega KK.
A test compound dissolved in 4% DMSO was added by 12.5 uL to 25 uL reaction solution (100 mM HEPES (pH 7.5), 5% glycerol) containing 400 ng of MAO—A enzyme (Sigma—Aldrich Co. LLC.), and the mixture was d at room ature for 10 min. MAO substrate (Promega KK) (160 uM) was added by 12.5 uL to start the on. After reaction at room ature for 60 min, Luciferine detection reagent (Promega KK) (50 uL) was added to terminate the on. After reaction at room temperature for min with stirring, the luminescence was measured by Envision (PerkinElmer). The MAO—A inhibitory rate (%) of the test compound was calculated by the following formula. inhibitory rate (%) = (l — (test nd count — blank) + ol — blank) x 100 The count of the MAO—A enzyme reaction mixture under compound non—addition conditions is indicated as control, and the count under compound non—addition and MAO—A enzyme non— addition conditions is indicated as blank. The results are shown in Table 2. (2) Measurement of MAO—B tory activity The MAO—B inhibitory activity evaluation described below followed the protocol of MAO—Glo (registered trademark) Assay of Promega KK.
A test compound dissolved in 4% DMSO was added by 12.5 uL to 25 uL reaction solution (100 mM HEPES (pH 7.5), 5% glycerol, 10% DMSO) containing 400 ng of MAO-B enzyme (Sigma—Aldrich Co.
LLC.), and the mixture was reacted at room temperature for 10 min. MAO ate (Promega KK) (16 uM) was added by 12.5 uL to start the reaction. After reaction at room temperature for 60 min, Luciferine detection reagent ga KK) (50 uL) was added to terminate the reaction. After on at room ature for 20 min with stirring, the luminescence was measured by Envision (PerkinElmer). The MAO-B inhibitory rate (%) of the test compound was calculated by the following inhibitory rate (%) = (l — (test compound count — blank) + (control — blank) x 100 The count of the MAO—B enzyme reaction mixture under compound non—addition conditions is indicated as control, and the count under compound non—addition and MAO-B enzyme non— addition conditions is indicated as blank. The results are shown in Table 2.
[Table 2—1 ] LSDl MAO-A MAO—B Ex. No.
ICw value (11M) ICW value (11M) ICW value (uM) 7 >10 8 >10 9 >10 11 > 10 12 . . >10 <0.1 4.7 >10 <0.1 >10 >10 18 <0.1 2.6 >10 19 <0.1 >10 3.2 <0.1 >10 >10 21 <0.1 >10 >10 22 0.41 3.6 2.6 <0.1 >10 >10 >10 26 9.2 >10 0.58 1.7 >10 [Table 2—2] 1501 MAO—A MAO-B Ex. No IC50 value (uM) IC50 value (1.1M) IC50 value (11M) <0.1 >10 >10 33 <0.1 >10 34 0.19 >10 >10 0.13 1.3 >10 <0.1 4.6 >10 <0.1 9.1 >10 <0.1 >10 >10 40 <0.1 — 0.11 5.8 5.1 <0.1 >10 >lO 0.11 3.3 4.7 .5 y!) /\ O ;_.\ V |_| O 9.3 Lb k0 >10 (J1 E—‘O >10 U‘IUIUWU'I >10 LON VH 0 .1}. HQ) U‘lb (DOW VV e1H o0 U‘I LO /\ O L: \l l—-‘ VV F‘H oo }_| KC >10 V }__\ O [Table 2—3] LSDl MAO—A MAO—B Ex. No.
ICw value (uM) ICW value (uM) ICW value (uM) 61 <11 3-3 63 <0.1 >10 >10 11-2 8.5 >10 65 9.6 66 >10 67 >10 <0.1 >10 <0.1 >10 >10 -~J-J HQ >10 >10 /\ 0 1—1 V 1-4 O >10 72 <0.1 3 1 >10 -J-J 1590 8.1 <0.1 >10 >10 >10 >10 <0.1 >10 >10 <0 1 9 9 >10 <0.1 >10 >10 <0.1 _l_ >10 >10 “ <0.1 >10 >10 84 >10 n 1.0 >10 >10 <0.1 >10 >10 >10 >10 n 0.1 >10 >10 “ <0.1 >10 >10 [Table 2—4] LSDl MAO—A MAO-B Ex. No.
ICw value (pM) ICw value (uM) ICw value (uM) 91 >10 P__—§3 .1 >10 94 .1 >10 95 .1 >10 96 .1 >10 >10 .1 >10 >10 98 .1 >10 >10 __7 99 .1 >10 >10 F 100 <0.1 ———1 fi >10 >10 101 <0.1 >10 >10 102 0.2 ——1 103 <0.1 >10 104 >10 105 <0.1 >10 >10 106 <0.1 >10 >10 107 <0.1 4.3 >10 108 <0.1 >10 >10 109 <0.1 >10 >10 *_T_ 110 <0.1 >10 >10 111 <0.1 >10 >10 112 <0.1 >10 >10 113 <0.1 5.7 >10 114 <0.1 J__ >10 >10 1 115 <0.1 >10 >10 . 116 1.8 >10 _4___ >10 <0.1 7.5 >10 1.6 >10 >10 [Table 2—5] _——_7 LSDl MAO—A MAO-B EX' NO' ICw value (uM) ICw value (PM) 10% value (PM) 121 <o.1 >10 >10 122 <o.1 >10 >10 123 <0.1 5.0 >10 124 >10 125 >10 126 >10 127 >10 128 >10 129 >10 J 130 >10 132 >10 *-;j 133 >10 134 <o.1 >10 >10 135 0.1 >10 >10 136 <O.l >10 >10 [Table 2—6] l‘ _r_ LSDl MAO—A MAO—B EX. No.
ICW value (uM) 1cm value (uM) ICw value (uM) 151 <O.1 >10 >10 152 <O.1 >10 >10 153 <O.1 >10 >10 154 l <O.1 >10 >10 155 <O.1 >10 >10 }—.___ 156 F—— <O.1 >10 >10 L. 157 0.1 >10 >10 158 <O.1 >10 >10 159 <O.1 >10 >10 160 <O.1 5.1 >10 I— —+ 161 <O.1 4.1 >10 162 l <O.1 2.1 >10 163 0.1 >10 >10 164 0.2 >10 >10 165 <O.1 >10 >10 166 <O.1 >10 i >10 _l__ _l As shown in Table 2, the compound of the present invention has a superior LSDl tory activity. In addition, the MAO—A inhibitory activity and MAO—B inhibitory activity of the compound of the present invention are low, and the compound of the present invention has a selective LSD1 inhibitory activity.
Experimental e 3 Tumor growth ssive effect test using HEL92.1.7 acute myeloid leukemia cell 6—Week—old SCID mice were subcutaneously transplanted with 5x106 cells/100 uL of HEL92.1.7 acute myeloid leukemia cells, and the mice were grouped ing to the body weight and tumor volume after 15 to 17 days. Vehicle (0.5% methylcellulose) or compound A, nd B or compound C was administered orally to mice (5 mice per group). The administration was once per day and'performed continuously during the dosing period. Setting the change in tumor volume of the vehicle—treated group as 100%, the change rate in tumor volume of the compound—treated group (T/C %) was calculated.
The tumor volume was determined by measuring the long diameter and short diameter of the tumor with a r caliper, and calculating by the following calculation formula: (long diameter)x(short diameter)x(short diameter)/2. The results are shown in Table 3.
Compound A: N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl—4— carboxamide hydrochloride Compound B: N—(4—{trans[(l—methylpiperidin—4— yl)amino]cyclopropyl}phenyl)—3—(trifluoromethyl)benzamide ochloride Compound C: N—(4—{trans—2— [(cyclopropylmethyl)amino]cyclopropyl}phenyl)~1H—pyrazole—4— carboxamide hydrochloride Table 3 T/C dose dosing period com oundp (%) (mg/kg) (days) A 12.54 30 mg/kg 14 B —8.08 30 mg/kg 7 C 46.42 30 mg/kg 14 As shown in Table 3, the compound of the present ion has a superior antitumor growth activity.
Formulation Example 1 A medicament containing the compound of the present invention as an active ingredient can be produced, for example, according to the following formulation. 1. capsule (1) compound obtained in Example 1 10 mg (2) lactose 90 mg (3) crystalline ose 70 mg (4) magnesium stearate 10 mg 1 e 180 mg The total amount of the above-mentioned (l), (2) and (3) and 5 mg of (4) are blended, and the e is granulated.
Thereto is added the remaining 5 mg of (4), and the whole is sealed in a gelatin capsule. 2. tablet (1) compound obtained in Example 1 10 mg (2) lactose 35 mg (3) cornstarch 150 mg (4) lline cellulose 30 mg (5) magnesium stearate 5 mg 1 tablet 230 mg The total amount of the above—mentioned (l), (2) and (3), mg of (4) and 2.5 mg of (5) are blended, and the mixture is granulated. Thereto are added the remaining 10 mg of (4) and 2.5 mg of (5), and the mixture is compression—molded to give a tablet.
Industrial Applicability The compound of the present invention has a superior LSDl inhibitory action, and is useful as a medicament such as a prophylactic or therapeutic agent for cancer, schizophrenia, Alzheimer’s disease, Parkinson’s e and gton’s chorea, and the like.
This application is based on patent application No. 2011— 174305 filed in Japan, the entire contents of which are incorporated by nce herein.

Claims (17)

1. A nd represented by the formula 5 wherein A is a phenyl-C1-6 alkyl group, a C3-6 cycloalkyl group, a ydronaphthyl group, 10 a phenyl group, a biphenylyl group, a furyl group, a thienyl group, an oxazolyl group, 15 an isoxazolyl group, a thiazolyl group, a pyrazolyl group, an indazolyl group, a benzofuryl group, 20 a idazolyl group, a benzothiazolyl group, an indolyl group, or a tetrahydrobenzazepinyl group, each of which optionally has 1 to 3 substituents selected from 25 (1) a halogen atom, (2) a C1-6 alkyl group optionally having 1 to 3 substituents selected from a halogen atom, a phenyl group, an imidazolyl group and a triazolyl group, (3) a C1-6 alkoxy group optionally having 1 to 3 substituents 30 selected from a halogen atom and a phenyl group, (4) a C1-6 alkyl-carbonyl group, (5) a di-C1-6 alkylamino group, (6) a C1-6 alkylsulfonyl group, (7) a oyl group, (8) a C1-6 alkylsulfonylamino group, 5 (9) an oxo group, (10) a C3-6 cycloalkyl group, (11) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom and a C1-6 alkyl group, (12) a y group, 10 (13) a phenylcarbonylamino group, (14) a benzyloxycarbonylamino group, (15) a benzoyl group, (16) a benzylamino group, (17) a pyrazolyl group, 15 (18) a dihydropyrazolyl group optionally having 1 to 3 substituents selected from a C1-6 alkyl group and an oxo group, (19) an oxazolyl group, (20) a thiazolyl group having 1 or 2 C1-6 alkyl groups, (21) a tetrazolyl group, 20 (22) a pyrrolyl group, (23) a piperazinyl group having 1 to 3 C1-6 alkyl groups, (24) an imidazolyl group, (25) a pyridyl group, (26) a pyrimidinyl group, 25 (27) a piperidyl group optionally having one oxo group, (28) a thienyl group, (29) a furyl group, and (30) a thiadiazolyl group; R is a en atom or a C1-6 alkyl group; or 30 A and R are optionally bonded to each other to form a dihydroisoindole ring having 1 or 2 oxo groups; Q1 is a hydrogen atom or a C1-6 alkyl group; Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom or a C1-6 alkyl group optionally 35 tuted by one C3-6 cycloalkyl group; Y1, Y2 and Y3 are each independently (1) a hydrogen atom, (2) a C1-20 alkyl group optionally having 1 to 3 substituents selected from an amino group, a C1-6 alkoxy group, a phenyl 5 group, a phenyloxy group and a benzyloxy group, (3) a C3-8 cycloalkyl group, (4) a phenyl group optionally having 1 to 3 substituents selected from a halogen atom, a C1-6 alkoxy group, a C1-3 nedioxy group and a di-C1-6 alkylamino group, 10 (5) a pyridyl group optionally having 1 to 3 C1-6 alkoxy groups, (6) a naphthyl group, (7) a biphenylyl group, (8) a thienyl group, (9) an olyl group, 15 (10) a thiazolyl group, (11) an imidazopyridyl group, (12) an imidazothiazolyl group, (13) a thienopyridyl group, or (14) a 1,8-naphthyridinyl group; 20 Y1 and Y2 are optionally bonded to each other to form, together with the adjacent carbon atom, a C3-8 cycloalkane ring, a pyrrolidine ring, a piperidine ring, 25 a tetrahydropyran ring, a 2,3-dihydroindene ring, a fluorene ring, a icyclo[3.2.1]octane ring, or a tetrahydrothiopyran ring, each of which ally has 1 to 3 30 substituents selected from (1) a halogen atom, (2) a C1-6 alkyl group optionally having 1 to 3 substituents selected from a halogen atom and a phenyl group, (3) a C3-6 cycloalkyl group, 35 (4) an oxo group, (5) a phenyl group, (6) a C2-6 alkenyloxy-carbonyl group, and (7) a C1-6 carbonyl group; X and Y1 are optionally bonded to each other to form a 5 idine ring, together with the adjacent nitrogen atom and carbon atom; and Z1, Z2 and Z3 are each a hydrogen atom, or a salt thereof. 10
2. The compound according to claim 1, wherein A is a phenyl group optionally having 1 to 3 C1-6 alkyl groups tuted by 1 to 3 halogen atoms, a biphenylyl group, or 15 a pyrazolyl group; R is a hydrogen atom; or A and R are optionally bonded to each other to form a oisoindole ring having 1 or 2 oxo groups; Q1 is a hydrogen atom or a C1-6 alkyl group; 20 Q2, Q3 and Q4 are each a hydrogen atom; X is a hydrogen atom; Y1, Y2 and Y3 are each independently a hydrogen atom or a C3-8 cycloalkyl group; Y1 and Y2 are optionally bonded to each other to form, together 25 with the adjacent carbon atom, a piperidine ring optionally having 1 to 3 C1-6 alkyl groups; Z1, Z2 and Z3 are each a hydrogen atom, or a salt thereof.
3. N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)biphenyl carboxamide or a salt thereof. 35
4. N-(4-{trans[(1-methylpiperidin yl)amino]cyclopropyl}phenyl)(trifluoromethyl)benzamide or a salt thereof.
5. N-(4-{trans[(cyclopropylmethyl)amino]cyclopropyl}phenyl)- 5 azolecarboxamide or a salt thereof.
6. A compound selected from (1) N-(4-{trans[(cyclopropylmethyl)amino]cyclopropyl} phenyl)benzamide, 10 (2) N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl) (trifluoromethoxy)benzamide, (3) trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)benzamide, 15 (4) N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)- cyclohexanecarboxamide, (5) N-(4-{trans[(1,1-dioxidotetrahydro-2H-thiopyran yl)amino]cyclopropyl}phenyl)(trifluoromethyl)benzamide, 20 (6) N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1,3-dimethyl-1H- pyrazolecarboxamide, (7) N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)-1,5-dimethyl-1H- 25 pyrazolecarboxamide, (8) N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)methyl (trifluoromethyl)-1H-pyrazolecarboxamide, (9) N-(4-{trans 30 [(cyclopropylmethyl)amino]cyclopropyl}phenyl)methyl (trifluoromethyl)-1H-pyrazolecarboxamide, and (10) N-(4-{trans [(cyclopropylmethyl)amino]cyclopropyl}phenyl)methyl-1H- pyrazolecarboxamide, 35 or a salt thereof.
7. A ment comprising the compound according to any one of claims 1 to 6 or a salt thereof. 5
8. The medicament according to claim 7, which is a lactic or therapeutic agent for cancer.
9. The medicament according to claim 7, which is an LSD1 inhibitor.
10. The medicament according to claim 7, which is a prophylactic or therapeutic agent for schizophrenia, Alzheimer’s e, Parkinson’s disease or Huntington’s chorea. 15
11. Use of the compound according to any one of claims 1 to 6 or a salt thereof for the production of a prophylactic or therapeutic agent for schizophrenia, Alzheimer’s disease, Parkinson’s disease or Huntington’s chorea. 20
12. The compound according to any one of claims 1 to 6 or a salt thereof for use in the prophylaxis or treatment of schizophrenia, Alzheimer’s disease, Parkinson’s disease or Huntington’s chorea. 25
13. Use of the compound according to any one of claims 1 to 6 or a salt thereof for the production of a medicament for inhibiting LSD1.
14. Use of the compound according to any one of claims 1 to 6 30 or a salt f for the tion of a prophylactic or eutic agent for cancer.
15. The compound according to any one of claims 1 to 6 or a salt thereof for use in the prophylaxis or treatment of cancer.
16. A compound according to claim 1, substantially as herein described with reference to any one of the accompanying examples thereof. 5
17. Use according to claims 11 and 14, substantially as herein described with reference to any one of the accompanying es thereof. 923_1
NZ621325A 2011-08-09 2012-08-08 Cyclopropaneamine compound NZ621325B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2011174305 2011-08-09
JP2011-174305 2011-08-09
PCT/JP2012/070267 WO2013022047A1 (en) 2011-08-09 2012-08-08 Cyclopropaneamine compound

Publications (2)

Publication Number Publication Date
NZ621325A NZ621325A (en) 2016-02-26
NZ621325B2 true NZ621325B2 (en) 2016-05-27

Family

ID=

Similar Documents

Publication Publication Date Title
US9682925B2 (en) Cyclopropaneamine compound
JP6325449B2 (en) Cyclopropanamine compounds and uses thereof
RU2705579C2 (en) Novel pyrazolo[3,4-d]pyrimidine compound or salt thereof
US9920047B2 (en) Cyclopropanamine compound and use thereof
CN109715613A (en) Heterocyclic compound
US20180215754A1 (en) 1-substituted 1,2,3,4-tetrahydro-1,7-naphthyridin-8-amine derivatives and their use as ep4 receptor antagonists
AU2016284654A1 (en) 2,3-dihydro-4h-1,3-benzoxazin-4-one derivatives as modulators of cholinergic muscarinic M1 receptor
WO2007055418A1 (en) Aza-substituted spiro derivative
JP2019514951A (en) Substituted 2,4-diamino-quinoline derivatives for use in the treatment of proliferative diseases
WO2019151269A1 (en) Heterocyclic compound
NZ621325B2 (en) Cyclopropaneamine compound
WO2020067457A1 (en) Condensed-cyclic compound
TW202220978A (en) Heterocyclic compound
JP2004256498A (en) Pyrrolocarbazole derivative