NZ617944B2 - Methods and compositions for modulating gene expression using components that self assemble in cells and produce rnai activity - Google Patents

Abstract

Disclosed is an in vitro screening method for selecting an antisense strand binding site on a ribonucleic acid target of interest, said method comprising; (i) identifying a site on said target that is available for antisense strand binding using an antisense oligonucleotide; (ii) obtaining a set of a first and a second oligonucleotide with sequences capable of forming a duplex or a set of a first and a second oligonucleotide that are not complementary to each other but which are capable of forming a duplex with a third strand where in at least one strand is complementary to the site identified as available for binding in (i); (iii) modifying said oligonucleotide strands to increase their stability and activity; (iv) contacting a cell expressing said target with said first oligonucleotide strand or said two non-complementary strands and providing a suitable amount of time for said strand(s) to enter said cell; (v) contacting said cell with said second or said second and third oligonucleotide strands not complementary to each other but complementary to a strand in (iv) and; (vi) determining the expression of the target sequence as compared to the expression of the target sequence without step (iii). of a first and a second oligonucleotide with sequences capable of forming a duplex or a set of a first and a second oligonucleotide that are not complementary to each other but which are capable of forming a duplex with a third strand where in at least one strand is complementary to the site identified as available for binding in (i); (iii) modifying said oligonucleotide strands to increase their stability and activity; (iv) contacting a cell expressing said target with said first oligonucleotide strand or said two non-complementary strands and providing a suitable amount of time for said strand(s) to enter said cell; (v) contacting said cell with said second or said second and third oligonucleotide strands not complementary to each other but complementary to a strand in (iv) and; (vi) determining the expression of the target sequence as compared to the expression of the target sequence without step (iii).

Description

METHODS AND COMPOSITIONS FOR MODULATING GENE EXPRESSION USING COMPONENTS THAT SELF ASSEMBLE IN CELLS AND PRODUCE RNAi ACTIVITY This application claims priority to US Provisional Application Nos:61/477,283, 61/477,291 each filed April 20, 2011 and 61/477,875 filed April 21, 2011 respectively, the sure of all of the ing applications being incorporated herein by nce as though set forth in full.

FIELD OF THE INVENTION This invention relates to the fields of medicine, drug development and modulation of gene expression. More specifically, the invention provides compositions and methods of use thereof that facilitate the modulation of gene expression using novel oligonucleotide based drugs that produce an inhibitory RNA (RNAi) ism of .

BACKGROUND OF THE INVENTION Numerous publications and patent nts, including both published applications and issued patents, are cited throughout the specification in order to be the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.

RNA interference (RNAi) refers to molecules and isms whereby n double stranded RNA (dsRNA) structures (RNAi rs) cause sequence specific gene inhibition. Two main categories of RNAi have been distinguished: small inhibitory RNA (siRNA) and microRNA (miRNA). In the case of naturally occurring siRNA the original source of the dsRNA is exogenous to the cell or it is derived from transposable elements within the cell. Cells may then process the dsRNA to produce siRNA that can specifically suppress the activity of the source of the dsRNA. The exogenous sources include certain viruses where the siRNA generated provides a defense mechanism against such rs.

In contrast, naturally occurring miRNA is produced from precursor molecules that are generated from independent genes or from very short intron sequences found in some protein encoding genes. Unlike siRNA molecules, miRNA molecules broadly inhibit le different genes rather than being narrowly focused on a particular gene. Thus, naturally ing siRNA characteristically performs more narrowly d inhibitory actions than does miRNA.

These differences are reflected, in part, in the "targeting codes" that are associated with these two classes of RNAi. The targeting code can be briefly defined as the subset of the antisense strand sequence that is primarily or fully responsible for recognizing the target sequence by complementary base pairing. (Ambros et al., RNA, e a more ed description of how naturally ing siRNA and miRNA can be experimentally guished and annotated 9: 277-279, 2003.) The general mechanisms that underlie the implementation of siRNA and miRNA- dependent activity are substantially overlapping, but the particulars of how siRNA and miRNA function to suppress gene expression are substantially different. At the heart of the general isms able to both of these types of RNAi is the RNA-induced silencing complex (RISC). The double stranded siRNA or miRNA is loaded into RISC. Next the sense strand is discarded and the antisense strand is used to direct RISC to its target(s).

In the case of siRNA typically and for a subset of , the RISC complex includes an enzyme called argonaute-2 (AGO-2) that cleaves a specific mRNA target. Other enzymes recognize the bifurcated mRNA as abnormal and further degrade it. mRNA cleavage by AGO-2 requires a high degree of sequence complementarity between the guide strand and its target particularly with t to the nucleosides adjacent to the AGO-2 cleavage side that are located a positions 10 and 11 counting from the 5'-end of the guide strand along with several of the nucleosides on either side of positions 10 and 11. The nucleoside sequence found at this location (central region) is the targeting code in this context. Typically a perfect complementarity between the targeting code nucleosides and the corresponding target sides is required for AGO-2 based cleavage. Additional nucleosides out side of this targeting code can also affect the efficiency of the target recognition and functional inhibition by RISC but some mismatches can be tolerated in these flanking areas.

Genome wide identification of miRNA targets and computational predictions estimate that each mammalian miRNA on average inhibits the expression of ds of different mRNAs. Thus, miRNA can be involved in coordinating patterns of gene expression. The ability of particular miRNAs to produce a particular cellular phenotype, however, can be based on the modulation of the expression of as few genes as one. Most mammalian genes appear to be post-transcriptionally regulated by miRNAs. Abnormalities in the expression of particular miRNAs have pathogenic roles in a wide range of medical disorders.

The targeting code most ly used by miRNA resides in a so called "seed sequence" that is made up of nucleosides 2-8(or 2-7) counting in from the 5'-end of the guide or antisense strand. This sequence is the major determinant of target recognition and is sufficient to trigger translational silencing. Target sequences are found in the 3’-untranslated region (3’UTR) of the mRNA targets. Infrequently, mentarity between nucleosides down-stream of the seed sequence and the target contribute to target recognition particularly when the seed ce has a weak match with the target. These are called 3'-supplementary or 3'-compensatory sites. r category of miRNA es a target code involving "centered sites" that consist of 11 or 12 consecutive nucleosides that begin at on 4 or 5 downstream from the '-end of the guide or antisense strand. To date no 3'-supplementary or 3'-compensatory sites have been uncovered that support target recognition by the targeting code.

MiRNA, other than the few with a siRNA-like tory mechanism, can suppress the translation of specific sets of mRNA by interfering with the translation machinery without affecting mRNA levels and/or by causing the mRNA to be degraded by promoting the ions necessary to te the naturally occurring 3' mRNA decay pathway.

In addition to the common targeting of the 3'UTR of mRNA, some miRNAs have been found to target the 5'-UTR or to the coding region of some mRNAs. In some of these cases the miRNA/RISC complex inhibits the translation of the target mRNA and in others translation is promoted. Further, there are instances of certain miRNAs forming complexes with ribonucleoproteins and thus interfering with their RNA binding functions in a RISC- independent manner. Finally, there are also documented instances in which miRNAs can affect transcription of particular genes by binding to DNA.

Over the last dozen years, RNAi related mechanisms involving siRNA and miRNA have been substantially elucidated and found to occur widely in both plants and animals including in all human cell types. In turn, these advances have been applied to the design and use of RNAi based drugs for use as therapeutic candidates and as a tool for various research and drug pment purposes. Tuschl’s group first reported the administration of synthetic siRNA to cells more than 10 years ago (Elbashir et al., Nature 411: 8, 2001).

Conventional siRNA therapeutics has very recently reached the stage where significant RNAi activity can be achieved in the livers of primates as well as man. The best of these results to date are based on the use of second-generation lipid nanoparticles (LNPs) that envelop the siRNA and e its ry to hepatic cells. These data come from interim s from a phase I trial of a siRNA directed to PCSK9.

MiRNA is comparatively a fundamentally more complex area of RNAi than siRNA and consequently attempts to acquire miRNA-based drug candidates for therapeutic as well as use as a tool for various research and drug development purposes have lagged behind siRNA. Potential miRNA eutics include miRNA inhibitors and miRNA . Most advanced is the use of antisense oligonucleotides (oligos) with a steric hindrance mechanism to inhibit the function of certain miRNAs. One example is a mixed LNA/DNA nucleoside phosphorothioate oligo that inhibits miR-122 and which has completed phase II testing with promising results. Mir-122 is highly expressed by liver and is required for HCV tion and increases the level of total cholesterol in plasma.

Least advanced is the delivery of miRNA mimics to tissues in vivo for therapeutic or research or drug development purposes. In part this is because the field is still in the early stages of elucidating the functions and identities of therapeutically relevant miRNAs. A relatively small number of miRNAs, however, have a substantial body of literature support for having key roles in certain medical conditions. A number of these miRNAs function as ncogenes for particular types of cancer where they are pathologically under expressed.

Importantly replacement of the deficient miRNA often has a substantial anti-cancer activity, for example, miR-34 and let-7 family s.

It is well recognized in the art that the single most important barrier to the development of siRNA and miRNA mimics as drugs is the very poor uptake of these compounds by tissues in the body (Aliabadi et al., Biomaterials 33: 2546, 2012; Kanasty et al., Mol Ther published online ahead of print Jan 17, 2012). It is widely held that for general use complex carriers are needed that will envelop the siRNA or miRNA mimic and promote their delivery in to tissues in a bioavailable . To date the success of this approach is essentially limited to the delivery of such compounds to liver.

In st, steric hindrance antisense oligos being used to inhibit miRNAs are being successfully delivered tissues without the need for a r. Further, clinically important endpoints are being achieved. Such , however, e high doses and perhaps most importantly very high affinity for their target miRNA (Elmen et al., Nature 452: 896, 2008; Lanford et al., Science 327: 198, 2010). Thus, miRNAs with relatively high G/C content should be most susceptible to this form of inhibition. It may not be le to effectively target the majority or miRNAs using this approach and ng antisense oligo chemistries because of the high affinity ement.

The miRNA sequences and nomenclature used herein are taken from the miRBase (www.mirbase.org) which has been described in Griffiths-Jones et al., Nucleic Acids Research 34: D140-D144, 2006. In brief, s that immediately follow the designation miR-, for example, miR-29, designate particular . This designation is applied to the corresponding miRNAs across various species. Letters, for example in miR-34a and miR- 34b, distinguish particular miRNAs differing in only one or two positions in the mature miRNA (antisense strand). Numbers following a second dash, for example in miR1 and miR2, distinguish distinct loci that give rise to identical mature miRNAs. These miRNAs can have different sense strands. Multiple miRNAs family members that differ in only one or two side positions from some other member(s) for the family in the mature miRNA and which also come from distinct hairpin loci have both letters and additional s following the s, for example, miR-29b-1 and b-2 with the other family members being miR-29a and miR-29c. Finally, in some instances two different mature miRNA sequences are excised from the same hairpin precursor where one comes from the 5' arm and the other from the 3' arm. These are designated -5p and -3p respectively, for example, miR5p and miR3p.

SUMMARY OF THE ION In accordance with the t invention, methods and compositions that provide RNAi activity in tissues in vivo are disclosed. The compositions of the present invention can be delivered to subjects as single strand oligos in a e or physiological buffer, with out the requirement for a carrier or prodrug design while ultimately being capable of suppressing the intended target(s) in a wide variety of tissue types. Surprisingly, the present inventor has designed individual oligo strands with features that allow them survive administration, become bioavailable in a wide variety of tissues where they combine with a partner strand(s) to form duplexes that result in the efficient loading of the intended antisense oligo into RISC and produce robust intended silencing activity with minimized rget effects.

The types of compositions of the present invention fall into three basic groups to include those that: (1) inhibit the expression of dual genes or small numbers of genes by an AGO-2 based cleavage mechanism; (2) t the expression of particular miRNAs; and (3)provide miRNA-like functions through partially mimicking the actions of particular endogenous miRNAs of generating miRNA-like nds with novel seed ces. All three of these types of nds are broadly defined as sequential RNAi (seqRNAi).They are individually distinguished by the terms seqsiRNA, R and seqMiR respectively.

Single stranded compounds with these three types of activity, NA, ss-IMiR and ss-MiR respectively, are also provided.

Exemplary seqsiRNA, R, seqMiR and ss-MiRcompounds are based on the agents shown in Figures 8, 10, 12, 14, 16, 20-23 and 26-67; Figures 68-81;Figures2, 9, 11, 13, 15, 17, 86-97; and Figures 2, 18 and 19 respectively. An exemplary method entails contacting a cell expressing the gene target, miRNA target or with a miRNA deficit with an effective amount of an appropriate seqRNAi nd, the seqRNAi being effective to inhibit expression of the target or to augment miRNA activity. SeqRNAi can include, without tion, a single stranded or double stranded oligoribonucleotide or chimeric oligo with the properties ed for herein.

In a particularly preferred embodiment, a two-step stration method is disclosed.

An exemplary method entails administration of a first oligo strand to a subject, waiting for a suitable time period, followed by administration of a second oligo strand to said subject, said first strand and said second strand forming an intracellular duplex in cells in vivo that is effective to achieve one of the following: (1) catalyze degradation of target gene mRNA or small number of mRNAs or inhibit translation of said mRNA(s); (2) catalyze degradation of a particular miRNA or small number of miRNAs; or (3) provide for miRNA activity.The oligo strands can be administered in a vehicle without a carrier or prodrug design, but a carrier may be used for special purposes such as the targeting of a particular tissue type to the exclusion of others.

In one aspect there is provided an in vitro screening method for selecting an antisense strand binding site on a ribonucleic acid target of interest, said method comprising; (i) identifying a site on said target that is ble for antisense strand binding using an antisense oligonucleotide; (ii) obtaining a set of a first and a second oligonucleotide with sequences e of forming a duplex or a set of a first and a second oligonucleotide that are not complementary to each other but which are capable of forming a duplex with a third strand where in at least one strand is complementary to the site identified as available for binding in (i); (iii) modifying said oligonucleotide strands to increase their stability and activity; (iv) contacting a cell expressing said target with said first oligonucleotide strand or said two non-complementary strands and providing a suitable amount of time for said strand(s) to enter said cell; (v) contacting said cell with said second or said second and third oligonucleotide strands not complementary to each other but complementary to a strand in (iv) and; (vi) ining the expression of the target sequence as compared to the sion of the target sequence without step (iii).

It is to be noted that, throughout the description and claims of this specification, the word 'comprise' and variations of the word, such as 'comprising' and 'comprises', is not intended to exclude other variants or additional components, integers or steps. Modifications and improvements to the invention will be readily apparent to those skilled in the art. Such modifications and improvements are ed to be within the scope of this invention.

Any reference to or sion of any document, act or item of knowledge in this specification is ed solely for the purpose of providing a context for the present invention. It is not ted or represented that any of these matters or any combination thereof formed at the priority date part of the common l knowledge, or was known to be relevant to an attempt to solve any problem with which this specification is concerned.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: phosphate Linkage.

Figure 2: Boranophosphate Monomer with Native Ribose.

DETAILED DESCRIPTION OF THE INVENTION A. Overview of Prior Art It is currently assumed in the art that the broad application of siRNA-based compounds and miRNA mimics as drugs will require the development of carriers that do not currently exist and that likely will involve different designs for different cell types. The existing carriers have primarily shown limited but meaningful success in obtaining siRNA activity at significant levels in the liver including in ts. It is generally believed that the carriers that will be needed to establish conventional siRNA and miRNA mimics as drug platforms will be of a complex structure and will envelop siRNA or miRNA duplexes. A possible tissue exception to the carrier requirement could be the proximal tubule cells of the kidney.

Carriers are ed to be needed for multiple reasons based on what happens when naked siRNA is ed into subjects including: (1) poor uptake by cells; (2) ction by nucleases; and (3) rapid clearance of intact duplexes from the body. Further, the carriers being developed for general drug use have a variety of associated problems including, but not limited to, toxicity, difficulties in ation, short shelf half-life and large size (siRNA/carrier or miRNA/carrier xes are >100nm in size while capillary pores are estimated to range from 5-60nm). In addition, the published studies involving many carriers have common deficiencies making it difficult to draw firm conclusions; for example, it is uncommon to see proper dose response curves ularly ones that include comparing the test siRNA/carrier against an siRNA-control/carrier.

Hence, there is a pressing need for new ches that will result in broad RNAidependent activity in tissues in vivo. The basic concept behind the present invention is that properly ed complementary sense and nse strand drugs can be sequentially administered without a carrier or prodrug to a t and will combine to form duplexes capable of producing RNAi ty in a wide range of cell types. Thus, in a preferred embodiment the compounds of the invention can be administered in the absence of a carrier (which facilitates cellular uptake) but are rather delivered in a vehicle, or physiological buffer such as saline Thus, this invention provides the means to generate sense and antisense strands with sufficient intrinsic nuclease stability such that they can be individually administered in vivo in a sequential manner and induce the production of RNAi activity in numerous tissues.

This general approach has been termed seqRNAi.

In the field of miRNA mimics, there is also a pressing need for the rationale design of compounds which avoid suppressing ble mRNA types while ting the expression mRNA types where there is a cial or medical interest in doing so. This is an intrinsic m when the goal is to closely mimic particular endogenous miRNAs. Using miRNA- like compounds that are limited their range of mRNA target types (e.g., selected to better match ular commercial goals) can ameliorate this problem. The seqMiRs of the present invention can be designed to do this in particular through the use of novel seed sequences and by manipulating the affinity of the seed sequence for its mRNA targets.

Xu et al., (Biochem Biophys Res Comm 316: 680, 2004) studied the effects of the sequential administration of single strands by transfection of sense and nse strands making up a chemically unmodified conventional siRNA duplex on cells grown in culture.

They demonstrated the ability of such an approach to cause RNAi based silencing in cells under these conditions. The authors made the observation that single stranded siRNA (sssiRNA ) “has a remarkably lower efficacy of reconstituting RISC than duplex siRNA.” This led them to test the following : “cellular persistence (meaning short persistence) might not be the main reason of ss-siRNA having lower efficacy than duplex siRNA.” Instead the duplex structure itself might promote RISC loading. They tested this idea by sequentially administering the complementary s of a conventional siRNA directed to Renilla luciferase or of one targeting human CD46 into a cell line expressing the target gene. These investigators did not disclose the sequential administration of individual strands in vivo nor the concept of using sequential strand administration to improve uptake compared to the administration of a . primarily involves the use of short and/or non-canonical siRNA triggers and data is provided to show that ones shorter than the standard 21-mers have substantial activity. The filing also asserts that the two strands that make up conventional siRNA can be sequentially administered to cells and as a result the RNAi-based ing effect of the parent siRNA duplex will be replicated in cells. The rationale that the text provides for doing this is the following: “Because the interferon pathway is triggered by cells exposed to double-stranded nucleic acids previous RNAi/gene silencing approaches using such agents could not rule out the concomitant activation of this pathway.” Accordingly, the inventors claim to provide compositions and methods for ting gene silencing both in vitro and in vivo in the absence of an eron response.” The idea that sequential administration of the strands could remedy the in vivo siRNA uptake problem was not considered, nor were specific compounds for use in this embodiment of the invention.

The sequential administration of complementary sense and antisense strands to achieve RNAi-dependent activity t a specific mRNA target in cells is clearly guishable from the practice of sequentially or co-administering conventional siRNA es to cells in vitro or in vivo. As for drugs generally, there are multiple rationales for administering more than one conventional siRNA duplex to an animal or individual in either a sequential or in a aneous manner. These s include, for example, the desire to produce a more profound suppression of a given target at a given time, to extend the effect on a given target over time, to achieve a particular commercial purpose by inhibiting multiple targets in a sequential manner or simultaneously or to reduce the selection pressure for the production of mutations in the target gene that nullify the intended effect.

US 156529 ses the sequential administration of established types of RNAi. In this application, “The term "co-administration" refers to administering to a subject two or more agents, and in particular two or more iRNA agents. The agents can be contained in a single pharmaceutical composition and be administered at the same time, or the agents can be contained in separate formulation and administered serially to a subject. So long as the two agents can be detected in the subject at the same time, the two agents are said to be co- administered.” Thus, the ors have provided for the sequential administration of “iRNA agents” (abbreviation for "interfering RNA agent") a term that is not established in the art but clearly means an agent that induces ependent silencing activity. Indeed, the inventors defined iRNA agents as follows: “An iRNA agent as used herein, is an RNA agent, which can down-regulate the expression of a target gene, e.g. ENaC gene SCNN1A…. an iRNA agent may act by one or more of a number of isms, including post-transcriptional cleavage of a target mRNA sometimes referred to in the art as RNAi, or pre-transcriptional or pre-translational mechanisms.” Thus, the term iRNA agent must be an entity that can gulate the expression of a target gene and such agents may be co-administered in a sequential manner over time if the agents being so co-administered are present in the subject at the same time.

In connection with attempts to generate based or miRNA mimic drug development platforms, investigators are focused on developing complex carriers that envelop the duplex to deliver conventional siRNA or miRNA mimics to subjects. The ed nature of these compounds provides a degree of nuclease stability that in turn affects the ion of specific al modifications to the strands, if any, in order to promote the various desirable drug attributes of the compound. The duplex structure also has an important bearing on the intracellular distribution of the compound with respect to parameters such as relative distribution between the cytoplasm and nucleus and general stickiness of proteins on a charge/charge basis. Further, the carrier itself introduces additional nuclease resistance and has a major influence on determining the details of the route followed by the duplex in becoming bioavailable in cells in vivo. Thus, the ches that have been developed to promote the desirable drug attributes of conventional siRNA or miRNA mimics have been arrived at in the context of the these drugs being administered as a duplex by means of a complex carrier.

The problem of what chemical modifications to use and where to place them in strands is necessarily substantially greater for seqRNAi than for the strands that comprise conventional siRNA or miRNA mimics. Basic to the greater difficulty for seqRNAi are the following facts: (1) seqRNAi strands have a substantially greater need for nuclease ance than the strands that make up conventional siRNA es. As a result they are necessarily more heavily modified compared to conventional siRNA or miRNA ; and (2) essentially all the types of chemical modifications that are applicable for achieving single strand nuclease resistance are known to be capable of substantially inhibiting or eliminating the intended RNAi-dependent silencing activity. A number of these are compatible with conventional siRNA activity but they must be used sparingly and with suitable positioning in the strand. This has been possible because of the duplex structure and the nuclease tion provided by carriers. The lack of these factors in the use of i, therefore, presents a novel challenge.

The t invention provides the means to achieve this by providing sufficient intrinsic se resistance for each of the strands to e long enough to become bioavailable duplexes in cells in vivo while not unduly adversely affecting the silencing activity against the intended target. This es providing the means for the efficient removal of the sense strand form the seqRNAi-based duplex by RISC. le i- based duplex architectures are also enabled by the disclosure in the present application. The algorithms provided herein surprisingly allow these objectives to be achieved without undo experimentation and provide for the rationale design of compounds having seqRNAi activity against any mRNA or miRNA target as well as compounds with miRNA-like properties. The miRNA mimics of the present invention fall into two broad categories: (1) those that are based on the seed sequences of nous miRNA compounds; and (2) those that are based on novel seed sequences. So the term “miRNA mimics” in this context is used for compounds that e miRNA-like activity rather than necessarily suggesting an attempt to exactly mimic the activity of any given endogenous miRNA. The miRNA mimics of the present invention are designed to serve as drugs that provide a wide range of miRNA activities that can be tailored to meet a variety of useful cial or medical needs.

The seqRNAi designs of the present invention are configured for single strand in vivo administration in a vehicle without a carrier or prodrug design. This results in RNAi activity in many cell types. While this is frequently desirable, it is also ant to have the ability to direct the seqRNAi strands to some cell or tissue types to the exclusion of others by using carriers with cell targeting characteristics. SeqRNAi strands are much better suited for use with carriers than is conventional siRNA or conventional miRNA mimics because of their r size and intrinsic nuclease resistance. Hence, the carrier can be simply conjugated to the seqRNAi strand and it can be relatively small and uncomplicated since it does not need to envelop the strand. Such relatively simple carriers capable of targeting oligos to particular tissues are well known in the art.

Select antisense seqRNAi strands can also be used as ss-siRNA or ss-miRNA. Certain modifications can promote this activity. Typically the activity will be less than that which can be achieved with the sequential administration of the complementary sense strand(s), but for some commercial applications the simplicity of a single administration out weighs the sed potency the sense strand can provide. This would e situations where a very rapid ssive effect is desired.

It follows that the greater level of chemical modification that is required for seqRNAi strands compared to the strands in conventional siRNA and conventional miRNA must be more highly orchestrated such that potentially competing ives are ized. The present invention surprisingly provides the means to broadly achieve substantial RNAidependent activity against s of choice in multiple cell/tissue types in subjects without undo mentation. The RNAi-dependent activity generated by seqRNAi sets or ss-RNAi based on i antisense designs can occur in either a siRNA-like or miRNA-like format.

B. Definitions The following definitions and terms are provided to facilitate an understanding of the invention. “2’-fluoro”refers to a nucleoside cation where the fluorine has the same stereochemical ation as the hydroxyl in ribose. In instances where the fluorine has the te orientation, the associated nucleoside will be referred to as FANA or 2’-deoxy- 2’fluoro-arabinonucleic acid. pplementary or 3'-compensatory sites” refers to sites in some miRNA antisense s down-stream of the seed sequence that are complementary to the target ce and contribute to target selection particularly when the seed sequence has a weak match with the target. 3’UTR is an abbreviation for the 3’ untranslated region of an mRNA. “5'-to-3' mRNA decay pathway” refers to a naturally occurring y for degrading mRNA that is initiated by the removal of the poly(A) tail by deadenylases. This is followed by removal of the 5'-cap and subsequent 5' to 3' degradation of the rest of the mRNA.

“Antisense oligos or s” are oligos that are complementary to sense oligos, premRNA , mRNA or to mature miRNA and which bind to such nucleic acids by means of complementary base pairing. The antisense oligo need not base pair with every nucleoside in the target. All that is ary is that there be sufficient binding to provide for a Tm of greater than or equal to 40 °C under physiologic salt conditions at submicromolar oligo concentrations unless otherwise stated .

“Algorithms” refers to sets of rules used to design oligo strands for use in the generation of seqRNAi sets or pairs.

“Antisense strand vehicle” is used to describe an antisense strand structure into which particular seed sequences can be inserted as a starting point for the design of ss-MiR compounds. These vehicles are designed and/or selected to minimize off target effects and to promote efficient RISC loading.

“Architecture” refers to one of the possible architectural configurations of the seqRNAi-based duplexes formed after a set of seqRNAi strands undergoes complementary base pairing or it refers to the group of such architectures. etry rule” refers to the naturally occurring mechanism whereby the likelihood of a particular strand in a siRNA, miRNA or seqRNAi-based duplex is selected by RISC as the antisense strand. It has been applied to the design of tional siRNA compounds and it can apply to seqRNAi compounds. In brief, the relative Tm of the 4 terminal duplexed nucleosides at one end of the duplex compared to the corresponding nucleosides at the other terminus of the duplex plays a key role in determining the relative degree to which each strand will on as the antisense strand in RISC. The strand with its 5’-end ed in the duplexed terminus with the lower interstrand Tm more likely will be loaded into RISC as the antisense strand. The Tm effect, however, is not evenly buted across the duplexed terminal nucleosides because the most terminal is the most important with the successive nucleosides being progressively less ant with the terminal 4 duplexed nucleosides being the most significant.

“Backbone” refers to the alternating linker/sugar or sugar substitute structure of oligos while the normal bases or their substitutes occur as appendages to the backbone.

“Bulge structures or bulge” refers to regions in a miRNA duplex or seqMiR-based duplex where multiple interior contiguous nucleosides in one strand fail to base pair with the partner strand in a manner that results in the ion of a bulge in the duplex composed of these nucleosides. Bulge structures include bulge loops that occur when the nucleosides that fail to base pair with the partner strand are only in one strand and or loops that occur when opposing nucleosides in both strands cannot base pair.

“Central region of the nse stand” is defined as nucleosides 9 and 10 from the 5’end along with the adjacent three nucleosideson each side of these including allthe intervening linkages. cally modified” is applied to oligos used as conventional antisense oligos, conventional siRNA, conventional miRNA or seqRNAi (seqsiRNA, seqMiRs, or seqIMiR) where the term refers to any chemical differences between what appears in such compounds and the corresponding standard natural components of native RNA and DNA (U, T, A, C and G bases, ribose or deoxyribose sugar and phosphodiester linkages). During manufacture chemical modifications of this type do not have to lly be made to native DNA or RNA components. Also ed in this term are any nucleoside substitutes that can be used as units in overhang precursors.

“Chimeric oligonucleotides” are ones that containribonucleosides as well as 2’- deoxyribonucleosides.

“Compounds” refers to compositions of matter that include conventional siRNA, conventional miRNA, as well as the sense, antisense strands that make up particular seqRNAi sets in addition to the seqRNAi-based duplexes they can form by complementary base pairing with each other.

“Conventional antisense oligos” are single stranded oligos that t the expression of the targeted gene by one of the ing isms: (1) Steric hindrance – e.g., the antisense oligo eres with some step in the sequence of events involved in gene expression and/or production of the encoded protein by directly interfering with one of these steps. Such steps can include transcription of the gene, splicing of the NA and translation of the mRNA; (2) Induction of enzymatic digestion of the RNA transcripts of the targeted gene by RNase H; (3) Induction of enzymatic digestion of the RNA ripts of the targeted gene by RNase L; (4) Induction of enzymatic digestion of the RNA transcripts of the targeted gene by RNase P: (5) Induction of enzymatic digestion of the RNA ripts of the targeted gene by double stranded RNase; and (6) Combined steric hindrance and induction of enzymatic digestion activity in the same antisense oligo.

"Conventional miRNA" are those compounds administered to cells in vitro or in vivo as an oligo duplex and the term excludes those unusual cases where it is delivered as single stranded miRNA (ss-miRNA) - i.e., where the antisense stand is administered without a sense strand and produces a substantial RNAi silencing effect. Administration of conventional miRNA nearly always es the use of a carrier (in vitro or in vivo) or other means such as hydrodynamic delivery (in vivo) to get the compound into cells in an active form.

"Conventional siRNA" are those compounds administered to cells in vitro or in vivo as an oligo duplex and the term excludes those unusual cases where it is delivered as single stranded siRNA (ss-siRNA) - i.e., where the antisense stand is administered without a sense strand and produces a ntial RNAi silencing effect. Administration of conventional siRNA nearly always requires the use of a carrier (in vitro or in vivo) or other means such as hydrodynamic delivery (in vivo) to get the compound into cells in an active form.

“Duplex vehicle” is used to describe a duplex comprised of a sense and an antisense strand into which particular seed sequences and their sense strand complement can be inserted as a starting point for the design of seqMiR compounds. These vehicles are designed and/or ed to minimize off target effects and to e efficient RISC loading and retention of the intended antisense .

“Exosomes” are endosome-derived vesicles that transport molecular species such as miRNA and siRNA from one cell to another. They have a particular composition that reflects the cells of origin and lly this directs the payload to particular cells. Once these secondary cells take up the siRNA or miRNA they exert their RNAi functions.

“FANA”refers to a nucleoside modification where the fluorine has the opposite stereochemical orientation as the hydroxyl in . It can also be referred to as 2’-deoxy- ro-arabinonucleic acid.

“Gene target” or “target gene” refers to either the DNA sequence of a gene or its RNA transcript ssed or unprocessed) that is targeted by an RNAi trigger for ssion of its expression.

“Guide strand” is used interchangeably with antisense strand in the context of dsRNA, miRNA or siRNA compounds.

"Identity" as used herein and as known in the art, is the relationship between two or more oligo sequences, and is determined by comparing the sequences. Identity also means the degree of ce relatedness between oligo sequences, as ined by the match between strings of such sequences. Identity can be y calculated (see, e.g., Computation Molecular Biology, Lesk, A. M., eds., Oxford University Press, New York (1998), and Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993), both of which are incorporated by reference herein). While a number of methods to measure identity between two polynucleotide ces are available, the term is well known to skilled artisans (see, e.g., Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); and Sequence Analysis Primer, Gribskovm, M. and Devereux, J., eds., M. Stockton Press, New York (1991)). Methods commonly employed to determine identity between oligo sequences include, for example, those disclosed in Carillo, H., and Lipman, D., Siam J. Applied Math. (1988) 48:1073.

“Internal linkage sites” refers to e sites that are not at the 5’ or 3’-ends of an oligo strand. These sites are ially t to single strand endonuclease attack and to double strand endonuclease attack if they form a duplex with a partner strand. Such sites may also be simply referred to as linkage sites. iPS cell or iPSC are abbreviations for induced pluripotent stem cells. They are created (induced) from somatic cells by experimental manipulation. Such manipulation has typically involved the use of expression vectors to cause altered (increased or decreased) expression of certain genes in the somatic cells. “Pluripotent” refers to the fact that such stem cells can produce daughter cells committed to one of several possible differentiation programs.

“Linkage site” refers to a particular linkage site or type of linkage site within an oligo that is defined by the nature of the linkage and the identities of the contiguous 5’ and 3’ nucleosides or nucleoside substitutes. Linkage sites are designated by “X-Y” where X and Y each represent nucleosides with one of the normal bases (A, C, G, T or U) or nucleoside tutes and the dash indicates the linkage between them.

“Mismatch" refers to a nucleoside in an oligo that does not undergo complementary base pairing with a nucleoside in a second nucleic acid or with another nucleoside in the same oligo and where the effect is to antagonize interstrand or intrastrand duplex formation by setting up a repulsion of the opposing nucleoside base.

“MicroRNAs (miRNAs)” are a category of lly ing dsRNAs that typically trigger the post-transcriptional sion of protein encoding genes after one of the strands is loaded into RISC. This antisense strand can be ed to as mature miRNA. It directs RISC to specific mRNA targets as recognized by the seed region of the mature miRNA. Most commonly the seed sequence recognizes complete d sequences in the 3’UTR of mRNAs transcribed from multiple genes.

“MicroRNA mimics or miRNA mimics” are a category of manufactured compounds that when administered to cells utilize the cellular mechanisms involved in implementing the ty of naturally occurring miRNA in order to produce a modulation in the expression of a particular set of genes. MicroRNA mimics of the present invention can be designed to modulate some or all of the same genes modulated by a ular naturally occurring miRNA or be designed to modulate the expression of a set of genes by using a novel seed sequence.

The miRNA mimics of the present invention are referred to as seqMiRs or ss-MiRs depending on whether they involve one or two strands.

“Modulate”, ating” or “modulation” refer to changing the rate at which a particular process occurs, inhibiting a particular process, reversing a particular process, and/or preventing the initiation of a particular process. Accordingly, if the particular process is tumor growth or metastasis, the term “modulation” includes, without limitation, decreasing the rate at which tumor growth and/or metastasis occurs; inhibiting tumor growth and/or metastasis; reversing tumor growth and/or metastasis (including tumor shrinkage and/or eradication) and/or ting tumor growth and/or asis.

“Native RNA” is naturally occurring RNA (i.e., RNA with normal C, G, U and A bases, ribose sugar and odiester linkages).

“Nucleoside” is to be interpreted to include the nucleoside analogs provided for herein. Such analogs can be modified either in the sugar or the base or both. Further, in particular ments, the nucleotides or nucleosides within an oligo sequence may be abasic. In overhang precursors and overhangs in RNAi triggers, each nucleoside and its 5’ linkage can be ed to as a unit. oside substitute” refers to structures with radically different chemistries, such as the aromatic structures that may appear in the 3’-end overhang precursors or overhangs of seqRNAi-based siRNA duplexes, but which play at least one role typically undertaken by a nucleosides. It is to be understood that the scope of the rules that apply to 3’-end overhang precursors are broader than the rules that apply to structures that occur in the regions of the seqRNAi strand that would form a duplex with its partner strand(s). In overhang sors and overhangs each nucleoside tute and its 5’ linkage can be ed to as a unit.

“Oligo(s)” is an abbreviation for oligonucleotide(s).

“Overhang” in the t of conventional siRNA and conventional miRNA refers to any portion of the sense and/or nse strand that extends beyond the duplex formed by these strands and that is comprised of nucleoside or nucleoside substitute units.

“Overhang precursor” refers to that portion, if any, of a seqRNAi strand that would form an overhang when combine with a partner seqRNAi strand to form a seqRNAi-based duplex. The term also applies to ss-RNAi based on seqRNAi antisense designs where there are one or more units at the 3’-end of the strand that do not undergo complementary base pairing with the ed target and which would form an overhang if the strand were duplexed with a seqRNAi sense strand.

“Passenger strand’” is used interchangeably with “sense strand” in the context of dsRNA miRNA or siRNA compounds or their components. It forms a x with its partner guide or antisense strand to form one of these nds.

"Pharmaceutical composition" refers to an entity that comprises a pharmacologically effective amount of a single or double stranded oligo(s), optionally other ), and a pharmaceutically acceptable carrier.

"Pharmacologically effective amount," "therapeutically effective amount" or simply "effective " refers to that amount of an agent effective to e a commercially viable pharmacological, therapeutic, preventive or other commercial result.

"Pharmaceutically acceptable carrier" refers to a carrier or diluent for administration of a therapeutic agent. Pharmaceutically acceptable carriers for therapeutic use are well known in the pharmaceutical art, and are described, for e, in Remington's Pharmaceutical Sciences, AR Gennaro (editor), 18th edition, 1990, Mack Publishing or Remington: The Science and Practice of Pharmacy, University of the Sciences in Philadelphia (editor), 21st edition, 2005, Lippincott ms & Wilkins, which are hereby incorporated by reference herein.

“Prodrug” refers to a compound that is administered in a form that is inactive but becomes active in the body after oing chemical modifications typically through metabolic processes. In the context of RNAi-dependent compounds, prodrug designs have been proposed as a means of protecting such compounds from nucleases and/or ing their uptake by cells. As for prodrugs generally any RNAi-dependent prodrugs have to undergo modification in the body to produce a compound capable of RISC loading and processing to induce ing the intended target(s).The stration of RNAi-dependent compounds without 5’-end phosphorylation of the antisense strand is not considered to constitute the administration of a prodrug.

“RNAi” is an abbreviation for RNA-mediated interference or RNA interference. It refers to the system of cellular mechanisms that es RNAi triggers and uses them to implement silencing activity. Multiple types of RNAi activities are recognized with the two most prominent being siRNA and miRNA. Nearly always the RNAi rs associated with these activities are double stranded RNA oligos most commonly in the 20mer-size range.

A common feature of the RNAi mechanism is the loading of one of these double stranded molecules into RISC following by the sense or passenger strand being discarded and the antisense or guide strand being retained and used to direct RISC to the target(s) to be “RNAi-dependent” refers to the use of an RNAi based mechanism to e gene expression. Compounds using this ism include conventional siRNA, shRNA, dicer substrates, miRNA and the three types of seqRNAi (seqsiRNA, seqMiR and seqIMiR) as well as ss-siRNA, ss-IMiRs and ss-MiRs.

“RNAi trigger” refers to a double stranded RNA compound most commonly in the 20mer size range that loads into RISC and provides the targeting entity (guide or antisense ) used to direct RNAi activity.

“Seed sequence or seed region” comprises sides 2-8(or 2-7) counting in from the 5'-end of the de facto antisense strand of conventional siRNA, miRNA or nonconventional seqRNAi or ss-RNAi.

“Seed duplex” refers to the duplex formed between the seed sequence in a de facto antisense stand and its complement in an mRNA 3’UTR.

“Sense oligos or strands” are oligos that are complementary to antisense oligos or antisense strands of particular genes and which bind to such nucleic acids by means of complementary base pairing. When g to an nse oligo, the sense oligo need not base pair with every nucleoside in the antisense oligo. All that is necessary is that there be sufficient binding to provide for a Tm of greater than or equal to 40 °C under logic salt conditions at submicromolar oligo concentrations unless otherwise provided for herein.

“Sequential” in the context of the administration of a seqRNAi compound refers to a “two-step administration or method” where cells are treated with one strand of a complementary sense and antisense oligo pair and after cellular uptake of this strand, the cells are treated with the other strand in a manner that also provides for its uptake into the cells.

The two strands then form a onal RNAi trigger intracellularly to inhibit target gene expression in the cells ning the RNAi trigger.

“SeqIMiRs”are the subtype of seqRNAi nds that are designed to inhibit the expression and/or function of particular nous miRNAs.

“SeqMiRs” are the subtype of seqRNAi compounds that are designed to mimic miRNA function. Such mimics may be based on a particular endogenous miRNA seed sequence. When based on a particular endogenous miRNA seqMiRs are typically ed to only inhibit a subset of the specific mRNAs inhibited by the endogenous miRNA in on.

SeqMiRs can also be designed with a novel seed sequence and, therefore, not be based on any given endogenous miRNA.

“SeqRNAi”refers to a novel approach to siRNA and miRNA delivery where the individual sense and antisense strands making up the duplexes are sufficiently modified to have sufficient intrinsic nuclease resistance for in vivo sequential administration without a r or prodrug design and at the same time being able to produce an RNAi-dependent silencing effect on the intended target gene(s) in a wide range of cell/tissue types. There are three different types of i RNAs, seqMiRs, and seqIMiRs).

“SeqRNAi-based duplex” refers to the duplex formed when the strands in a seqRNAi set or pair combine with each other through mentary base pairing.

“SeqRNAi set” or “seqRNAi pair” refers to a group of two or three strands where the strands can combine to form a seqRNAi-based duplex on the basis of complementary base pairing.

“SeqsiRNA” is the e of seqRNAi that inhibits the expression of an individual gene or small number of genes by ing direct ge of the transcripts of the genes by RISC. The targeting code is primarily composed of the central region of the antisense strand.

Conventional siRNA compounds can be converted to seqsiRNA use or accessible sites in mRNA for oligo binding can be used as the starting point for designing NA nds.

“Silencing” refers to the inhibition of gene expression that occurs as a result of RNAi activity. It is ly expressed as the concentration of the RNAi trigger that produces a 50% tion in the expression of the intended target at the optimum time point.

“Ss-IMiR” refers to an antisense strand that is designed according to the rules provided herein and is administered to a subject without a carrier or prodrug design and without the administration of a complementary sense strand. The compound is capable of being loaded into RISC in a subjects cells and subsequently ing RISC to a specific miRNA for silencing.

“Ss-MiR” refers to a single stranded miRNA mimic composed of an antisense strand designed according to the rules provided herein that is capable of being stered to a subject t a carrier or prodrug design and without a complementary sense strand. It can be loaded into RISC in subject cells and subsequently directed to a set of targets for silencing of target gene expression, e.g., inhibition of a particular set of mRNAs containing the complementary binding sequences in the 3’UTR. The targeting code is primarily or exclusively ed by the seed ce.

“Ss-miRNA” refers to a single stranded miRNA mimic composed of an antisense or guide strand that is capable of being loaded into RISC and subsequently directed to a set of targets for silencing of target gene sion, e.g., inhibition of a particular set of mRNAs containing the complementary binding sequences in the 3’UTR. The targeting code is primarily if not exclusively provided by the seed sequence.

“Ss-RNAi” refers to ss-siRNA and/or to ss-miRNA and/or to ss-MiR and/or to ss-IMiR compounds.

“Ss-siRNA” refers to an antisense strand that is designed according to the rules provided herein and is administered to a subject without a carrier or prodrug design and without a complementary sense strand. Further, the compound is capable of being loaded into RISC in subjects cells and uently directing RISC to the transcript(s) of one or at most a small number of mRNA types for silencing of target gene expression. The targeting code is primarily or exclusively composed of the central region of the strand and it typically directs AGO-2 to an mRNA target(s) that is d by this enzyme.

“Stem cell” refers to a rare cell type in the body that exhibits a capacity for selfrenewal.

Specifically when a stem cell divides the resulting daughter cells are either ted to undergoing a particular differentiation program or they undergo self-renewal in which case they produce a replica of the parent stem cell. By undergoing enewal, stem cells function as the source material for the maintenance and/or expansion of a particular tissue or cell type. ct”refers to a mammal including man.

"Substantially identical," as used herein, means there is a very high degree of homology preferably >90% sequence identity between two nucleic acid sequences.

"Synthetic" means chemically manufactured by man.

“Targeting code” refers to a contiguous nucleoside sequence that is a subset of the guide or antisense strand sequence of a siRNA, miRNA or seqRNAi compound that is primarily or exclusively responsible for directing RISC to a specific target(s). Targeting codes typically can be distinguished on the basis of their particular positions within the guide or antisense strand relative to its 5'-end.

“Tm” or g temperature is the midpoint of the temperature range over which an oligo separates from a complementary nucleotide sequence. At this ature, 50% helical (hybridized) and 50% coiled (unhybridized) forms are present. Tm is measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization using techniques that are well known in the art. There are also formulas available for estimating Tm on the basis of nearest or considerations or in the case of very short duplexes in accordance with the relative G:C and U:A content. For the purposes of the present invention Tm measurements are based on physiological pH (about 7.4) and salt concentrations (about 150mM).

"Treatment" refers to the application or administration of a single or double stranded oligo(s) or another drug to a subject or patient, or application or administration of an oligo or other drug to an isolated tissue or cell line from a subject or patient, who has a medical condition, e.g., a e or er, a symptom of disease, or a predisposition toward a disease, with the purpose to inhibit the expression of one or more target genes for research and pment purposes or to cure, heal, ate, e, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of disease, or the predisposition toward disease.

Tissues or cells or cell lines grown in vitro may also be ed” by such compounds for these purposes.

“Unit” refers to the nucleoside or nucleoside substitutes that appear in overhang precursors and overhangs along with their 5’-end linkage. Nucleosides may appear in 5’-end or 3’-end overhangs but nucleoside substitutes can only appear in 3’-end overhang sors and overhangs.

“Unlocked c acids” (UNA) are a new class of oligos that contain sides with a modification to the ribose sugar such that the ring becomes c by virtue of lacking the bond between the 2' and 3' carbon atoms. The term can also be applied to individual nucleosides with this cation.

“Upstream” and “Downstream” respectively refer to moving along a nucleotide strand in a 3’ to 5’ direction or a 5’ to 3’ direction respectively.

“Vehicle” refers a substance of no therapeutic value that is used to convey an active medicine or compound for administration to a subject in need thereof.

C. The Embodiments In one embodiment, novel complementary sense and antisense oligo compounds are sequentially administered to a subject in a two-step sequential procedure whereby one strand is administered without a carrier or prodrug design and taken up by cells expressing the RNA target(s), ed by administration of the second complementary strand without a carrier or prodrug design which is taken up by the same cells resulting in the silencing of the function of specific RNA target(s) by an RNAi-dependent mechanism. Thus, the individual strands are taken up intact by a wide variety cell/tissue types in vivo in sufficient amounts in a bioavailable manner that allows them to generate commercially useful ependent silencing activity against the intended RNA target(s). The types of RNA targets in question include, for example, pre-mRNA, mRNA and miRNA although in principle any RNA type could be targeted.

In a d embodiment, s and algorithms are provided for modifying known conventional siRNA nds to render them suitable for use in the sequential two-step sequential administration method described above. In particular these methods and algorithms provide for the creation of complementary sense and nse strands that can be sequentially administered to ts without a carrier or prodrug design and where they exhibit the following properties: (1) exhibit sufficient intrinsic nuclease resistance to survive long enough to carry out their intended drug function; (2) are widely taken up by many cell/tissue types in a manner that renders them bioavailable; and (3) produce the intended RNAi-dependent silencing ty in cells/tissues that express the relevant RNA target(s).

This silencing ty is enhanced relative to the effects seen when the strands are administered without the partner strand or compared to the sequence identical conventional RNAi-dependent compound that has not been modified in accordance with the present invention and is delivered without a carrier.

In another ment, the methods and algorithms provided are applied to complementary sense and antisense strands that are not known tional siRNA compounds. These same methods and design algorithms are also le for the generation of novel compounds that inhibit ular miRNAs. This approach can be applied to generating tors of any RNA target(s) in subjects where RNAi is desirable. What is required is that the portion of the target be accessible to complementary base pairing by an antisense strand that along with a complementary sense strand, are suitable for being configured in accordance with guidance provided with the present invention. The means for determining those portions of the intended RNA target which are ible to complementary base g are well known in the art. Conventional antisense oligo which have activity against RNA target(s) provide direct evidence of the particular binding site(s) on an RNA target accessible to such complementary base pairing. It also follows that conventional antisense oligos can be reconfigured as compounds of the present invention. In a preferred version of this ment an antisense strand compound of the present invention is directed to a hotspot in gene target mRNA transcripts where the hotspot is defined in US 7,517,644.

In yet another embodiment, algorithms, methods and compositions of matter are ed for achieving miRNA mimic ty in cells/tissues in subjects using the sequential delivery method of suitably designed sense and antisense strands. In one version of this approach a particular endogenous miRNA is subjected to the methods and thms of the present invention. In a variant of this, the ing code sequence of the endogenous miRNA is adjusted to improve the silencing profile of the compound for a ular commercial purpose.

In a related embodiment, algorithms, methods and compositions of matter are provided for achieving miRNA-like activity in cells/tissues in subjects using the sequential delivery method where the sense and antisense strands are not based on a particular endogenous miRNA. Nevertheless, these compounds are also referred to herein as miRNA . The starting point for these compounds is a novel seed sequence selected to target the 3’-UTR of one or more mRNA types of commercial interest for silencing. This novel seed sequence along with its sense strand complement is inserted into the riate regions of a duplex that is capable of ently loading its antisense strand into RISC (duplex vehicle) and the resulting duplex is ted to cation in accordance with the present invention.

In yet r embodiment an algorithm is used to further modify the antisense strands of the present invention so that they can induce the intended RNAi-dependent activity in subjects in the e of a partner sense .

In a final embodiment, carriers are employed with individual strands in cases where it is desirable to restrict the cell and/or tissue types targeted in subjects in vivo as the same silencing effect in another cell/tissue type can produce an undesirable side effect. The rationale for and means to achieve this type of cell/tissue targeting is well understood in the art including its application to single strand oligo drugs (antisense or aptamers). In extensive review of carriers suitable for use with single strand oligos and for the targeting of particular cell/tissue types is provided in . Such relatively small and simple established carriers are to be contrasted with those in development for the delivery of conventional siRNA and tional miRNA.

D. Overview of ion Details 1. Comments on Terminology: The term “nucleoside” is to be interpreted to cover normal ribonucleosides and deoxyribonucleosides as well as the nucleoside analogs provided. It is to be understood that the stereochemical orientations of the compound referred to are t to the same assumptions as are found in the literature generally when short hand terminology is used, for example, when ribose is referred to it is to be understood as being D-ribose or when arabinonucleic acids (ANA) are referred to the are D-arabinonucleic acids.

“Nucleoside substitute” refers to ures with chemistries radically different from nucleosides, but which play at least one role undertaken by a nucleoside in other situations.

In addition, it is to be understood that the scope of the modifications that apply to 3’-end overhangs are broader than those applying to structures that occur in the s of the seqRNAi strand that will form a duplex with its partner (s).

Statements such as “unless otherwise specified” or “unless otherwise ed for” refer to other specified modifications described herein that provide for a different modification(s) under certain circumstances. In these and in other instances where two or more rules specifying different modifications for the same entity, the more narrowly applicable rule (applies to fewer seqRNAi strands) will dominate. For example, rules applicable to a particular architecture dominate architectural independent rules.

The terms “preferred” and “most preferred” are used to designate the optimal range of configurations for strands for the majority of possible seqRNAi sets. In some ces, due to factors such as those arising from sequence specific differences, the optimal variant for a particular specification will not be what is generally red or most preferred. In such instances the selected variant still will fall within the more general range of variants provided for herein. Any such decision related to the use of variants that are not otherwise preferred or most preferred will be primarily based on balancing the desired level of silencing potency for the intended target along with the d duration of this silencing vs. reductions in get effects. Off-target effects include minimizing the suppression of the expression of unintended targets and minimizing unintended modulation of innate immunity. These red s are commonly associated with conventional siRNA es and/or their component strands. They can be measured using methods well known in the art.

“Silencing activity” refers to a level of silencing activity which is substantially specific to the intended target while minimizing off target effects. Preferably the target is silenced at greater than 50%, 60% , or 70% in cases where seqsiRNA, and seqImiRs used. In cases where seqMiRs are utilized, suppression of expression of at least 25%, 35%, 45% or >50% of 1, 2, 3, 4 or 5 of the targeted sequences is preferred. In the case of therapeutic seqRNAi compounds, for example, the commercial purpose is iently suppressing the intended target to the point a therapeutic benefit is achieved. In the case of onal genomics, for example, this term refers to those levels of intended silencing activity required to suppress the target levels to the point that significant ic s can be measured that allow the biologic role(s) of the target to be better understood.

Rules that are itly stated to be d to seqRNAi strands (sense, antisense or both) apply to the corresponding , antisense or both) seqsiRNA, seqIMiRs and seqMiRs strands. Such rules are not to be assumed to apply to ss-RNAi strands unless otherwise . Some ss-RNAi strand modifications are differentiated on the basis of whether they are designed to produce type or miRNA-type activity.

Unless otherwise specified it is to be understood that for simplicity certain linkage atives to the natural phosphodiester that are described herein (chirally specific phosphorothioate, boranophosphate) can substitute for one or more phosphorothioate linkages described in ns that refer to phosphorothioates generically. Unless otherwise specified, however, the es uniquely specified for use in seqRNAi strands that will become 3’-end overhangs in the seqRNAi-based siRNA duplex will only be applied in the context of 3’-end overhang protection (phosphonoacetate, thiophosphonoacetate, amide, carbamate and urea).

When a linkage is not specified, it is assumed to be odiester. 2. Basic Design Considerations: It is well established in the art that the types of chemical modifications used in seqRNAi strands to achieve nuclease resistance and to provide other essential features also have the potential to adversely affect function. For example, they can reduce and even to eliminate the silencing activity seen in a corresponding unmodified siRNA or miRNA duplex. r, the proper use of modifications depends on factors such as the underlying sequence, which strand is being considered (sense or antisense) the frequency of use of a particular modification, the nature of the other chemical modifications being used, the overall placements of al modifications in the strand, the effects of such factors in one strand on the partner strand and the regional as well as overall interstrand thermodynamics generated when a duplex is formed. In addition to silencing activity these erations also have a major impact on other functional features of seqRNAi strands and seqRNAi-based duplexes such as the extent to which ial off-target effects are engendered or suppressed.

It follows that the greater level of chemical modification that is required for seqRNAi s compared to the strands in conventional siRNA and conventional miRNA must be more highly orchestrated such that potentially competing objectives are harmonized. This harmonization can be achieved though the use of the algorithms provided herein. seqRNAi sets are ucted by applying a series of algorithms in a logical order.

Some thms, such as the one dealing with nuclease resistance are always applied while the application of others depends on particular preferences. A general ple for prioritizing the rules in particular combinations of algorithms applied to the design of a particular seqRNAi set is that more restrictive rule te less restrictive rules. Rules can be more restrictive in the sense of providing fewer options for the cation of a ular structure and/or they can be more restrictive in application. In practice once the ces for a particular seqRNAi set is selected the appropriate series of algorithms directing design of the final seqRNAi s are most efficiently d in a logical order. For example the order for the application of particular algorithms could be the following: (1) providing for nuclease resistance other than resistance to double strand endoribonucleases; (2) providing for certain other essential/preferred architecture-independent rules; (3) providing for a selected stand alone architecture (canonical, blunt-ended, tric or small internal segmented); (4) optional application of forked t to any of these architectures except the small internally segmented; (5) provide for l and al interstrand thermodynamic optimization; (6) provide for double strand endoribonuclease protection if needed; and (7) possibly select other optional ectural independent rules.

Each of the possible seqRNAi-based duplex architectures has advantages and disadvantages over the others and a number of these attributes are presented in Table 1. For general purposes the asymmetric architectural design with only the 3’-end overhang is most preferred.

TABLE 1 SUMMARY OF seqRNAi-BASED DUPLEX ARCHITECTURES THAT CAN BE FORMED IN CELLS FOLLOWING SINGLE STRAND ADMINISTRATION TO SUBJECTS Duplex Architecture General Potential Advantages Potential Disadvantages Generated in Comments Cells Presence of overhangs adds versatility with respect to factors such as duration of silencing and/or increased Based on the 3’exonuclease protection as a architecture of function of various possible naturally occurring Sense strand overhang can help chemical modifications. In Canonical siRNA that includes e its being loaded into addition, cytoplasmic the presence of RISC as an antisense strand. duplexes with overhangs tend overhangs in both to be less immunostimulatory strands. than those with blunt-ends.

The presence of n types of overhangs may promote the export of siRNA duplexes out of the nucleus.

Potential to n duration Compared to the canonical of silencing affect other architecture this architecture factors being equal. This can tends to be more Lacks overhangs in be an age in some stimulatory when Blunt-ended both strands commercial applications such present in the cytoplasm. The as when ged silencing lack of overhangs may impede may result in undesirable side the transport of siRNA duplexes effects. out of the nucleus.

When the d antisense strand has a 3'-end overhang and the sense stand does not the probability the desired antisense strand will load into RISC for target recognition Characterized by can be increased. The antisense strand presence of a 3'-end overhang having 3' and/or 5'- also adds ility with Asymmetric end overhangs while respect to factors such as the sense strand does duration of silencing on the not have any basis of various overhang overhang(s). chemistries. In some instances the selection preference for the desired antisense strand may be further increased through the use of a 5'-end overhang in the antisense strand.

Increases the number of sites on the RNA target suitable for siRNA attacks. This occurs because the forked variant provides the means to promote RISC loading of the desired A variant of antisense strand in situations Canonical, Bluntwhere the terminal sequences ended and one type are otherwise poorly of Asymmetric compatible with the normal architecture (one loading preference mechanism without 5’-end that is the basis for the overhang) where the asymmetry rule. An advantage forked design of this t appears in involves the use of situations where the choice of Forked Variant mismatches in the a site(s) on the RNA target is 3'-end of the sense restricted to those that cannot strand with the meet the design preferences complimentary ated with the basic antisense strand. It is ectures. For example, it applied where the might be desirable to cleave conditions for the an mRNA target between a asymmetry rule are primary and a ary particularly translational start site so that a unfavorable. truncated protein is produced.

As another e, it might be desirable to cleave an abnormal mRNA while g the normal mRNA. In either of these situations the available target sites may not readily t the favorable thermodynamic asymmetry between the duplexed termini that is required for ent silencing by the standard architectures unless the forked variant is used.

Two sense strands eliminates possibility that the intended By having two short strands the sense strand will be loaded binding affinity of each of the Characterized by use into RISC as the antisense two strands for the of two sense strands strand and reduces or complementary strand is in combination with eliminates the importance of substantially reduced and may a single the asymmetry rule. Two be inadequate for efficient mentary antisense s eliminate duplex ion. This situation antisense strand. In Small Internally any le contribution of tends to limit the sites on the the case of seqMiRs Segmented the antisense strand forming a RNA target for antisense/RISC there can be two duplex with the 5’-end half of binding to ones that are antisense strands the sense strand from relatively G/C rich. This can at and a single sense buting to target least partially be compensated strand. recognition. This can simplify for by using affinity increasing the design of effective modifications such as LNA. seqMiRs.

Index 1 provides a key for the modifications that can be made to the strands that applies to some but not all of the figures. Index 2 illustrates some of the more sophisticated approaches to the design of seqMiR sets that do not apply to other seqRNAi types. To illustrate the l design process a conventional siRNA directed to mouse PTEN has been ed along with the microRNA let-7i. The former compound is used to illustrate the design of a seqsiRNA or seqIMiR set of molecules and the latter compound is used to illustrate the design of a seqMiR set of molecules. The unmodified strands of the selected es are shown in Indices 3 and 4. The al removal of bulge structures, mismatches and/or wobble base pairs is the first design step in the uction of a seqMiR set. In the case of let-7i there are no bulge structures but there are five wobble base pairs in the duplex and one mismatch. The removal of these is illustrated in Index 5 and the effect on the specific nuclease resistance and certain other essential/preferred cations is shown in Index 7.

Indices 6 to 19 illustrate different aspects of the design process based on the chosen examples. Indices 8 and 9 are particularly noteworthy in that they provide examples of strands exhibiting the minimal requirements to qualify as a seqRNAi set of molecules.

E. Algorithm: Generally Applicable Architectural Independent rules - Achieving Nuclease Resistance All the sense and antisense strands of the present invention (seqsiRNA, seqIMiR, seqMiR, ss-siRNA, ss-IMiR and ss-MiR) e certain chemical modifications that provide for nuclease protection while simultaneously being compatible with or supportive of other essential and optional cations required for additional desirable properties. The required nuclease protections for certain linkage sites in a seqRNAi or ss-RNAi strand are the following: 1) tion of certain internal linkage sites from single strand endonuclease attack; 2) Protection of es between the terminal two or more nucleosides or nucleoside substitutes at the 3’-end of the strand from 3’-end exonuclease attack depending on the size and nature of the 3’-end overhang precursor(s), if any; 3) tion of the linkage site at the 5’-end of the strand from 5’-end exonuclease attack; and 4) Protection of certain linkage sites in seqRNAi strands that will form a seqRNAi-based duplex from double strand endoribonuclease attack where the needed modifications, if any, t the strand(s) in the duplex.

The protection of particular al linkage sites can be relaxed, if necessary, for the central region of NA, seqIMiR, ss-siRNA and ss-IMiR as well as for the seed sequence of seqMiR and ss-MiR antisense strands ed to the rest of the antisense strand. These regions of the antisense strands ily, if not exclusively, represent the targeting codes and they can be more sensitive to the chemical modifications used to generate se resistance than the rest of the antisense or sense strand.

The internal linkage sites to be protected in order to establish nuclease ance are defined by the ribonucleosides that bracket a given linkage. Thus, the frequency and positioning of the protective chemical cations are affected by the underlying strand sequence. For general use the linkage sites (reading 5’ to 3’) to be protected from single strand endoribonucleases are those where: 1) A pyrimidine (U, C or T) containing ribonucleoside is followed by a purine (G or A) except C-G. 2) A linkage sites is defined by C-C and U-C. 3) A linkage sites is defined by C-G, A-C and A-U.

Hence, of the 16 possible linkage sites involving ribonucleosides with one or two of the 4 normally occurring bases in RNA (A, U, C and G) only half of them need to be protected to achieve the stipulated nuclease protection. In contrast the linkage sites that do not have to be protected from single strand endoribonucleases are A-A, U-U, G-G, G-C, G-U, G-A, A-G and C-U. T may replace U in a ribonucleoside in some applications bed herein and when it does the nuclease protection rules treat it as a uridine.

Approaches for protecting particular linkage sites from single strand bonucleases include the following: 1) The 5’ nucleoside member of the e has a sugar that is ed from the group consisting of 2’-fluoro, ethyl or xyribose unless otherwise specified. 2) When there are two or more contiguous nucleosides and one is preferably a 2’- 0-methyl and the uous nucleosides include C then it is preferred that the C the be 2’methyl unless otherwise specified. 3) When the 5’ nucleoside sugar is 2’-fluoro it is preferred that the intervening linkage with the 3’ nucleoside be phosphorothioate particularly when the 3’nucleoside is 2’-fluoro or ribose. 4) The intervening linkage can be phosphorothioate or phosphodiester when the ’ nucleoside has a 2’methyl or 2’-deoxyribose sugar with the orothioate possibly providing added protection.

) The phosphorothioate is preferred when the linkage site is defined in group 1 (U-G, U-A, C-A) or group 2 (C-C and U-C). In group 3 when the first nucleoside is 2’-fluoro or ribose (C-G, A-C and A-U) the orothioate is preferred when the 3’-nucleoside in the linkage pair is ribose or roro. 6) Unless otherwise specified, the 3’ nucleoside member of the linkage site can have a sugar that is selected from the group consisting of ribose, 2’-fluoro, 2’- 0-methyl or 2’-deoxyribose.

In the case of the central region of seqsiRNA, seqIMiR, ss-siRNA and ss-IMiR antisense strands all the indicated modifications can frequently be accommodated without an undo negative effect on the intended silencing activity. When an undo negative effect is seen then the order in which the linkage site protections are removed to achieve a higher silencing effect will be in the reverse of what is listed (i.e. group 3 then 2 then 1). So, for example, the protection of the C-G, A-C and A-U linkage sites (group 3) is the least important.

In the case of the seed ce of seqMiR and ss-MiR antisense s the chemical modifications involved in generating nuclease resistance can affect the range of mRNA types suppressed by a endogenously occurring or novel seed sequence and may affect the levels of silencing ty caused by particular miRNA types. When these affects are adverse to the intended commercial purpose, they can be avoided by ng the level of nuclease protection. As for the central region of the other seqRNAi and ss-RNAi types, reducing the level of nuclease protection against endonucleases follows the reverse order in which they are presented with the third group being the least important.

The general means for protecting a strand of the present ion from single strand 3’-end exoribonucleases independently of any selected architecture requires that at a minimum the terminal 2 nucleosides or nucleoside substitutes (the maximum is 4) and at a minimum the terminal two es (the maximum is 4) to be ones that provide for nuclease ance. Limiting the modifications to two nucleosides or nucleoside substitutes and two linkages is preferred.

The required 3’end exonuclease tion is provided by the following: 1) In the absence of a 3’-end overhang precursor the required 3’end protection can be provided by the use of two terminal nucleosides that are individually selected from the group 2’-fluoro, 2’methyl or 2’-deoxyribose. Strands that have a 3’ terminal oro modification, however, can have a reduced yield with current manufacturing methods. 2) In the absence of a 3’-end overhang precursor the terminal two linkages will be phosphorothioate. 3) The 3’-end exonuclease protection can also be achieved in part or fully by the use of 3’-end overhang precursors as bed in the section by that name.

The ng precursor can be 1-4 units long with 2 units being preferred.

When there is only one unit the uous nucleoside is selected from the group 2’-fluoro, 2’methyl or 2’-deoxyribose and the upstream linkage is phosphorothioate.

The terminal 5’end linkage site is protected entirely or in part as follows: 1) The 5’-end terminal nucleoside is selected from the group consisting of nucleosides with the following cations: oro, 2’methyl or 2’- deoxyribose unless otherwise ied. 2) When the 5’ nucleoside to be modified is cytidine, 2’methyl is preferred unless otherwise stipulated. 3) The 3’ member of the linkage site can have a sugar that is selected from the group consisting of ribose, 2’-fluoro, 2’methyl or 2’-deoxyribose. 4) The intervening linkage can be phosphodiester or phosphorothioate unless otherwise specified but when the 5’ nucleoside is 2’-fluoro it is preferred that the intervening linkage be phosphorothioate.

Protection from double strand endoribonucleases is important for the brief period between the formation of the seqRNAi-based duplex in cells and RISC association and processing. The relevant enzymes digest both strands of normal RNA duplexes. When a segment in a i strand (single strand t) possesses four sequential phosphodiester linkages contiguous to normal ribonucleosides forms a duplex with a complementary RNA strand and is base paired with such a t of the same or longer size in the mentary strand, the ing double strand segment can support low-level ion by these enzymes. Shorter double strand ts than four do not support digestion. These enzymes, however, are significantly more active when such double strand segments have five to six or more phosphodiester linkages contiguous with normal cleosides in opposition in each strand when the duplex is formed. These enzymes can also digest a single unprotected single strand segment in a duplex if phosphorothioate linkages t the complementary RNA segment in the seqRNAi partner strand.

Modified nucleosides and 2’-deoxynucleotides of the types described herein, when employed in the single strand segment of at least one strand of a seqRNAi pair forming such a double stranded segment substantially inhibits digestion of the single strand segments of both strands by double strand endonucleases. Thus, seqRNAi strands are designed as follows: 1) When they form a seqRNAi-based duplex in cells with their partner strand there will be no complementary double stranded segments comprising 5 or more utive phosphodiester linkages contiguous with normal ribonucleosides in both strands and preferably no segment with 4 or more. 2) One or more modified nucleosides will be supplied to break up any single strand segment(s) in a seqRNAi strand(s) ise capable of forming any such double strand segment(s) with its partner strand such that the length of the double strand segment will be limited in length as described. 3) Such modifications can be limited to a single strand segment in one of the two strands in the resulting seqRNAi-based duplex or appear in both.

Alternatively, or in addition, duplexed segments of these sizes can be broken up using phosphorothioate linkages, but if this is the only method of protection then it must be applied to the duplexed segments of both strands.

The rules for protecting seqRNAi-based duplexes from double strand endoribonuclease attack is different from the rules for protection from other nucleases in that they are applied after the modifications based on all the nt rules are applied to a given seqRNAi set. This will help prevent the use of unnecessary modifications.

F. thms: Generally Applicable Architectural Independent Rules– Other 1. Essential/preferred modifications a) Applicable to seqRNAi Sense and Antisense s as well as to ss-siRNA, ss- IMiR and ss-MiR: i) Unless ise ied, it is preferred that within the seqRNAi-based duplex that any 2' ribose modified nucleoside in one strand is opposed to a nucleoside in the complementary strand that has a different ribose modification or is a normal ribonucleoside or 2'-deoxyribonucleoside. ii) It is preferred that uracil not be paired with ribose in the same nucleoside.

When uracil is paired with 2’-deoxyribose then it is preferred that the any uous nucleoside not be a 2'-deoxyribonucleoside(s). iii) It is preferred that any guanine containing 2'-deoxyribonucleoside not be used on the 3' side of a contiguous cytosine containing2'-deoxyribonucleoside unless the cytosine is methylated. iv) When the use of phosphorothioates for nuclease protection s in less than half the linkages being of this type it is red that additional phosphorothioates be inserted to achieve this level. b) Applicable to seqRNAi Sense Strands: i) It is preferred that there are no more than three e containing nucleosides in a row in any given sense strand but when four are required then one of the four preferably will be 7-deazaguanosine. ii) When a mismatch is indicated by a rule and multiple nucleosides with a standard base (A, T, U, C or G) can fill the role then the preferred nucleoside(s) is the one that es the most stable linkage site against nuclease attack. For example G-G is more stable than C-G. iii) When the introduction of a ch is indicated by a rule and the nucleoside selected for a base change to generate a mismatch is an A then the nucleoside is preferred to be changed to one of the following: • a T is preferred and it is further preferred that the sugar be 2’deoxyribonuclotide if it is in a position where that sugar is permitted by the applicable rules. • a C is preferred and it is further preferred that the sugar be 2’methyl if it is in a position where that sugar is permitted by the applicable rules • a U is acceptable but not preferred and if used it is red that the sugar be 2’methyl if it is in a position where that sugar is ted by the applicable rules. c) Applicable to seqRNAi Antisense s: i) The antisense strand is 16 to 23 nucleosides in length excluding any 3’-end overhang precursor unit(s) that may be employed. ii) More than four guanine-containing nucleosides in a row are not permitted.

It is preferred that there are no more than three guanine-containing sides in a row outside the central region but when four are required then one of the four preferably will be 7-deazaguanosine. Four guanine-containing nucleosides in a row or more are not permitted in the central region of the antisense strand. d) able to NA and seqIMiR Antisense Strands: i) In the central region preferably none of the nucleoside positions are occupied by entities that would reduce the binding affinity with the intended target compared to a perfectly complementary central region comprised of the common normal nucleosides. es of excluded modifications are UNA and abasic entities as well as nucleosides with mismatched bases with the target RNA. ii) ably no more than two contiguous nucleosides in the central region have the 2'methyl cation. iii) There are no restrictions on the number or positions of nucleosides in a seed sequence that can be a 2'-deoxyribonucleoside, however, there is a limit of no more than 40% of an antisense strand, exclusive of any overhang precursors, can be 2'-deoxyribonucleoside. In addition it is preferred that there is a limit of two such nucleosides in the central region and when there are two they are not contiguous. In the rest of the strand, exclusive of any overhang precursor(s), there is a limit of one such side. e)Applicable to seqMiR and ss-MiR Antisense Strands: i) LNA(s) can be used in the seed sequence, as needed, to increase the binding affinity with the mRNA 3’-UTR target sequence(s) with a maximum of three per seed sequence. It is preferred that when there are multiple LNAs in a given seed sequence that they be separated by at least one nucleoside that does not have the LNA modification. Note T can substitute for U in LNA. ii) A 2-thiouracil containing LNA can be used in place of uridine LNA to further boost seed sequence binding affinity with its mRNA target when the corresponding base in the target is e. iii) LNA or other ribose modified ribose nucleosides of the type provided for herein normal ribose nucleosides can be used in the seed sequence and paired with the following modified bases when the base is complementary to the ponding base in the target: 2,6-diaminopurine (pairs with adenine), 2- thiouracil, 4-thiouracil, 2-thiothymine. iv) It is red there not be any G:U base pairs between the seed sequence and the intended target sequence(s). v) It is preferred that there are no 2'-deoxyribonucleosides in the seed sequence particularly if there are no LNA modifications in the seed sequence.

There is a limit of four 2'-deoxyribonucleosides in the central region and when there are more than two they are not contiguous. In the rest of the strand, exclusive of any overhang precursor(s), there is a limit of one 2'- deoxyribonucleoside. vi) It is red that the second nucleoside from the 5’end not be ethyl or LNA and that it be 2’-fluoro or ribose.

The application of the nuclease resistance and the essential/preferred architectural ndent rules to illustrative seqsiRNA and seqMiR es is provided in Indices 6 and 7 respectively. 2. Nonessential/optional modifications: The level of nuclease resistance for seqRNAi strands and seqRNAi-based duplexes can be adjusted through the selective use of chirally specific phosphorothioate linkages. The Sp diastereoisomer phosphorothioate linkage is much more nuclease resistant than the Rp diastereoisomer. The mixed chirality of the standard phosphorothioate linkages results in sites where the Rp es are cleaved first in susceptible linkage sites. Given that there are often le susceptible linkage sites the overall ity of a strand or duplex is thus substantially d ed to an Sp chirally pure strand. Hence, when higher levels of nuclease resistance are desired for a particular commercial purpose, compared to what is provided by the standard chirally mixed phosphorothioate linkages, Sp linkages are preferably used to protect those linkage sites susceptible to cleavage. r possible alternative to the standard phosphorothioate linkage is the boranophoshate linkage with the Sp stereoisomer configuration being preferred.

Boranophosphate linkages, (Figure 1) differ from native DNA and RNA in that a borane (BH3-) group replaces one of the non-bridging oxygen atoms in the native odiester linkage. Such es can be inserted in oligos via two general methods: (1) te directed enzymatic polymerization; and (2) chemical synthesis using solid supports. A boranophosphate nucleoside monomer is illustrated in Figure 2. phosphate oligo production can be achieved by a variety of solid phase chemical synthetic s including methods that involve modifications to the very commonly used approaches employing phosphoramidites or H-phosphonates in the tion of phosphodiesters, phosphorothioates and phosphorodithioates among other chemistries (Li et al., Chem Rev 107: 4746, 2007). Other solid phase synthesis techniques more precisely directed to boranophosphates have also been developed over the last few years. Wada and his gues, for example, have developed what they call the boranophosphotriester method that can make use of H-phosphonate intermediates (Shimizu et al., J Org Chem 71: 4262, 2006; Kawanaka et al., Bioorg Med Chem Lett 18: 3783, 2008).

This method can also be applied to the synthesis of diastereometically pure boranophosphates (Enya et al., Bioorg Med Chem 16: 9154, 2008).

The generation of oligos with mixed linkages such as boranophosphate and phosphate linkages has been accomplished by several solid phase methods including one involving the use of bis(trimethylsiloxy)cyclododecyloxysilyl as the 5’protecting group (Brummel and Caruthers, Tetrahedron Lett 43: 749, 2002). In another example the 5’-hydroxyl is initially protected with a benzhydroxybis(trimethylsilyloxy)silyl group and then deblocked by Et3N:HF before the next cycle (McCuen et al., J Am Chem Soc 128: 8138, 2006). This method can result in a 99% coupling yield and can be applied to the synthesis of oligos with pure boranophosphate linkages or boranophosphate mixed with phosphodiester, orothioate, phosphorodithioate or methyl phosphonate linkages.

The boranophosphorylating reagent 2-(4-nitrophenyl)ethyl ester of boranophosphoramidate can be used to produce boranophosphate linked oligoribonucleosides (Lin, Synthesis and properties of new s of boron-containing nucleic acids, PhD Dissertation, Duke University, Durham NC, 2001). This reagent readily reacts with a hydroxyl group on the nucleosides in the presence of 1H-tetrazole as a st. The 2-(4- nitrophenyl)ethyl group can be removed by azabicyclo[5.4.0]undecene (DBU) through beta-elimination, ing the corresponding nucleoside boranomonophosphates (NMPB) in good yield.

The -controlled synthesis of oligonucleotide boranophosphates can be achieved using an adaptation of the oxathiaphospholane approach originally developed for the stereocontrolled synthesis of phosphorothioates (Li et al., Chem Rev 107: 4746, 2007). This method involves a tricoordinate phosphorus intermediate that allows for the introduction of a borane group. Other approaches include stereo-controlled synthesis by means of chiral indole-oxazaphosphorine or chiral oxazaphospholidine. Both of these approaches initially used for the stereocontrolled synthesis of phosphorothioates have been successfully adapted to boranophosphates (Li et al., Chem Rev 107: 4746, 2007). In yet another approach to the production of the stereocontrolled sis of oligos linked by boranophosphates involves the use of H-phosphonate intermediates (Iwamato et al., Nucleic Acids Sym Ser 53: 9, 2009).

Modifications Applicable to seqRNAi Sense and Antisense Strands as well as to ss-siRNA, ss- IMiR and : a) Unless otherwise provided for the terminal 3'-end nucleoside cation in a seqRNAi strand is preferably not 2'-fluoro. This is a manufacturing and not a onal issue. Using existing standard sis methods strands having a 2’- fluoro at the 3’-end terminus typically results in a reduced yield. b) Phosphorothioate linkages can be used to e odiesters in positions where they are not ed to increase nuclease resistance. This can be done, for example, to se the stickiness of an oligo for certain proteins such as albumin. c) The Sp diastereoisomer phosphorothioate linkage can be used in linkage sites selected for protection from nuclease cleavage in accordance with the present ion rather than the standard chirally mixed phosphorothioate es when a higher level of nuclease resistance is desired. d) Boranophosphate linkages may e some or all phosphorothioate linkages.

Applicable to seqRNAi Antisense Strands: The 5’-end nucleoside can be phosphorylated at the 5’ ribose position.

G. Thermodynamic erations 1. Overview: dynamic considerations related to complementary base pairing are of importance in the design of seqRNAi strands. Most importantly, efficient silencing activity for all the classes of seqRNAi compounds is dependent on optimizing thermodynamic parameters. Such parameters also play a key role in the optimization of the design of seqMiR seed sequences for particular commercial purposes. Thermodynamic stability is reflected in the g temperature (Tm) or the standard free energy change (ΔG) for duplex formation.

These parameters are highly correlated with each other and can be calculated using well established nearest neighbor calculations or be experimentally determined.

The starting point for constructing strands with the desired thermodynamic properties for use in the present invention is the basic RNA sequence of the strand where it is comprised of the normal ribonucleosides with the most common bases (U, C, G and A) and phosphodiester linkages. Nearest-neighbor calculations can be used to calculate the l Tm(s) of the strand with its partner strand under physiologic conditions as well as its ability to interact with itself through n and dimer formation (Panjkovich and Melo Bioinformatics 21: 711, 2005; Freier et al., Proc Natl Acad Sci USA 83: 9373, 1986; Davis & Znosko, Biochemistry 46: 13425, 2007; Christiansen & Znosko, Nuc Acids Res published online June 9, 2009). Nearest-neighbor ations can be aken through the use a number of readily available computer programs for oligo analysis.

Regional trand Tms play an important role in the design of seqRNAi compounds. Individually these regions can be too short for the nearest-neighbor calculation to be reliably applied. When this is the case a basic Tm ation based on A:U and G:C content can be applied using the following formula where w, x, y and z are the number of bases of the indicated type: Tm = 2(wA+xU)+4(yG+zC) Tm calculations are adjusted using the approximations shown in Table 2 which accounts for the effects of particular chemical modifications. The table can then be used as guide for making design adjustments to the strands that will result in the desired overall and regional Tms when they combine to form a duplex with the selected architecture.

TABLE 2 Approximation of Effects of Particular Chemical Modification to an RNA Oligo on Tm Measured when Duplexed with a Complementary Native RNA Oligo Degrees Change in Modification Comments Tm per Modification plus 1.0 – plus 2’-fluoro plus 0.5 – plus 2’methyl Deoxyribose Any terminal 5’-end duplexed LNA is poorly stabilizing as are terminal 3’-end duplexed uracil LNAs. These are excluded from the indicated Tm range and are not red. LNA with adenine has about one-half of the stabilizing effect of LNAs plus 4.0 – plus with other standard bases. Using 2,6- 8.0 diaminopurine or replacing a complementary uracil containing nucleoside with an LNA with a e base can reverse this. Using a 2-thiothymine replacement for a thymine can increase the affinity of a LNA brining it to the upper end of the indicated Tm range.

Replacement of e with 2,6-diaminopurine increases the Tm. It can be paired with any of the plus 1.0 – plus 2,6-diaminopurine ribose modifications provided for herein to form a side. The mentary partner nucleoside can have uracil or e. 2-thiouracil can be paired with any of the ribose plus 2.0 - plus modifications provided for herein to form a 2-thiouracil 6.0 nucleoside. The complimentary nucleoside in the partner strand should contain adenine rather than guanine when the goal is to optimize stability. The most stabilizing nucleosides have 2-thiouridine paired with LNA where the use of this base further increases the izing effect of LNA. Internal 2- thiouridine containing nucleosides are more than two fold more stable than are ones found at the most minal position of an oligo duplex. 2- thiouridine containing nucleosides at the most 3’- terminal position in an oligo duplex have little or no stabilizing effect. 4-thiouracil can be paired with any of the ribose modifications provided for herein to form a nucleoside. The complimentary nucleoside in the partner strand should contain guanine rather than plus 3.0 - plus 4-thiouracil adenine when the goal is to increase stability. The most izing nucleosides have uracil paired with LNA where the use of this base further increases the izing effect of the LNA modification. 2-thiothymine can be paired with any of the ribose modifications ed for herein to form a plus 2.0 - plus nucleoside. The most stabilizing nucleosides have 2-thiothymine 6.0 2-thiothymine paired with LNA where the use of this base further increases the stabilizing effect of LNA.

A single UNA nucleoside will reduce the Tm for the seqRNAi duplex with lower Tm reductions for minus 2.0 – UNA UNA placed near the termini and higher Tm minus 10.0 reductions for UNA placed near the center of the duplex Arabinonucleoside (ANA) minus 0 The effect of the same mismatch depends on the nature of the mismatch and on where it falls in the duplex with internal mismatches being two fold or more destabilizing than mismatches at the Mismatch duplexed termini. Substitution of a nucleoside with minus 2.0 – an adenine for one with a guanine will at most (involving nucleosides with minus 12.0 reduce the Tm about 1.0 degree given that a standard A, C, G, U or T bases) partner nucleoside with a uracil has a wobble base.

This will have little if any effect. Individual LNA mismatches are about one-third less destabilizing than mismatches involving nucleosides with 2’- modifications to the ribose or with ribose itself. minus 0.4 – Phosphorothioate minus 1.2 * Tm is measured in degrees centigrade under physiologic conditions. The numbers provided are approximations and the actual affects on Tm are influenced by a number of parameters including but not limited to the length of the , the position of the modification in the duplex and the presences of other modifications in the strand. It is to be assumed that the affinity effects of the indicated nucleoside modifications are with t to a complementary nucleoside in an oligonucleotide strand unless the cation is specifically stated to be a mismatch. 2. l and Regional Interstrand Binding Affinities: The overall Tm for the seqRNAi-based duplex formed by a particular seqRNAi set is ant. As the Tm increases above about 55 degrees centigrade, for example, the hood that AGO-2 will be preferentially loaded into RISC relative to the other argonautes increases. AGO-2 is the only argonaute with the catalytic activity that is important for NA and seqIMiR activity. In contrast, the large majority of s are relatively erent to which argonaute is incorporated into RISC, however, loading of AGO-2 has the potential to generate off target s by these compounds if it’s catalytic activity is not blocked using the appropriate design considerations. Accordingly, overall Tms of about 65 degrees centigrade and above are preferred for NA and seqIMiR sets to optimize AGO-2 loading. Lower Tms are preferred for seqMiRs unless the direct catalytic activity of AGO-2 is inhibited. The latter can be achieved by preventing the nucleosides in ons 10 and/or 11 from the 5’-end of the antisense strand from effectively base paring with an nded target.

Certain relative differences in interstrand affinities in particular regions of the seqRNAi-based duplex (regions explicitly defined in Table 3) are also important for all the seqRNAi-based duplex architectural variants other than small internally segmented. The three regions itly defined by Table 3 with respect to the sense strand are the areas in the duplex where collectively a relatively lower binding affinity ed to the overall interstrand affinity can promote efficient RISC loading and retention of the antisense strand with the removal of the sense strand. Lower Tms in s 1 and 3 appear to promote unwinding of the duplex and a substantially lower Tm in region 2, such as can be produced by a mismatch, UNA or abasic nucleoside can help promote removal of the passenger strand.

When AGO-2 is loaded into RISC and there is an appropriate cleavage site in the sense strand (opposite the linkage between nucleosides 10 and 11 of the nse strand), however, it can promote the efficient removal of the sense strand when there is no mismatch, UNA or an abasic nucleoside to region 2.

These are also the primary regions to look to for affinity lowering modifications particularly in the sense strand when it is important to reduce the l Tm of a seqRNAi duplex if it is above the preferred range. The overall Tm of a seqRNAi-based duplex can be too high to be directly measured (over about 95 degrees centigrade under physiologic conditions), however, and the compound can still produce the desired ing effect if these regional interstrand affinities are properly managed.

The general rule is that it is preferable for the combined three regions explicitly d by Table 3 to have a lower Tm than the combined intervening regions when both are considered as a continuous sequence and are ted for any size difference. These combined sequences are large enough to be evaluated using the more accurate nearest or calculation. It is also preferred that all three of the explicitly defined regions will have a relatively lower Tm corrected for size than the Tm of the combined intervening sequences. The small size of the dual regions itly defined by Table 3, however, requires the use of a basic Tm calculation that does not take the nearest-neighbor effects into account.

When the overall Tm for the compete duplex is above the preferred upper level modifications to reduce it should be preferentially made in the regions explicitly defined by the Table. Even when the overall duplex Tm is in the preferred range mismatch(s) with the antisense strand, a single UNA or a single abasic nucleoside in one or more of these regions can e the intended silencing activity. In seqsiRNA/seqIMiR sets, however, a low relative Tm in region 2 can be less important when the positions in the sense strand te positions 10 and 11 counting from the 5’-end of the antisense strand have a phosphodiester linkage and the nucleoside on the 5’side of this linkage site in the sense strand is not 2’ methyl and is preferably ribose or 2’-fluoro. This configuration facilitates the cleavage of the sense strand by AGO-2 and in turn this facilitates the removal of the sense strand from RISC.

TABLE 3 Regions Suitable for Modifications that Provide for Regional Reductions in Interstrand ty (Tm) in seqRNAi-based Duplexes Length of Sense Strand Nucleoside Position Counting from 5’-end of Sense Strand (exclusive of any Region 1 Region 2 Region 3 precursor) 23 4 – 7 14 - 16 21 - 23 22 4 – 7 13 - 15 20 - 22 21 4 - 7 12 - 14 19 - 21 4 – 7 11 - 13 18 - 20 19 4 – 7 10 - 12 17 - 19 18 4 – 6 9 - 11 16 - 18 17 4 – 5 8 - 10 15 - 17 16 4 7 - 9 14 - 16 * It is to be understood that the regions being identified include the corresponding ed n of the antisense strand. The sense strand is used as reference because the widest range of possible chemical modifications and other manipulations, such as mismatches, that can be used to reduce the interstrand affinity in these regions can be applied to the sense strand without reducing silencing activity. The indicated length of the sense strand is exclusive of any 3’-end nucleosides or nucleoside tutes that will form an overhang precursor. The range of indicated nucleoside positions includes all of those indicated in the given region.

So, for example, 4-7 is to be read to include both the 4th and 7th nucleosides.

Designs for the strands that make up a seqRNAi set of les must e means to promote the selection of the d antisense strand by RISC from the seqRNAi-based duplex. One of the means used to e the intended antisense strand being loaded into RISC as the de facto antisense strand is based on the primary mechanism for antisense strand ion from nous siRNA and miRNA duplexes. The principle behind this ism is sometimes referred to as the asymmetry rule. According to this rule the relative Tm of the 4 terminal duplexed nucleosides at one end of the duplex compared to the corresponding nucleosides at the other end of the duplex plays a key role in determining the relative degree to which each strand will function as the nse strand in RISC. The strand with its 5’-end involved in the duplexed terminus with the lower Tm more likely will be loaded into RISC as the antisense strand. The Tm effect, however, is not evenly distributed across the ed terminal nucleosides because the most terminal nucleoside is the most important with the successive nucleosides being progressively less important. Violations to this rule do not necessarily render a particular siRNA or miRNA duplexe nonfunctional but they likely will exhibit suboptimum activity because there will be more loading of the intended sense strand into RISC as the de facto antisense strand and loading of the intended sense strand can increase the likelihood of off target effects.

The asymmetry rule is important for the majority of seqRNAi architectural types. The st way of establishing it for a seqRNAi set against a particular target is simply to select sequences that will result in compliance with the asymmetry rule following the application of the necessary rules for chemical modifications to the strand. When necessary the information in Table 2 can be used to bring a strand set into compliance with the asymmetry rule. In situations where the strands are exceptionally out of compliance with the asymmetry rule the forked-variant can be employed with most of the architectures.

The two 4 nucleoside duplexes involved in determining compliance with the try rule are too short to apply the nearest neighbor calculation with a reasonable degree of confidence in determining the Tm values. Instead the more basic calculation can be used to approximate the Tms for the unmodified duplexes. Once the Tm for the unmodified es is determined then it can be adjusted based on the Tm affects of the modifications ed in Table 2. This determination, however, does not take into account the decreasing importance of the nucleosides as one moves away from the terminus. To account for this in a simple way it is preferred that the overall Tm for the 4 nucleoside duplex be lower for the one ning the 5’end of the antisense strand and that the most al two nucleoside pairs of this duplex have a lower affinity for their partner nucleoside than the corresponding pairs at the other terminus.

RISC requires that the selected antisense strand be phosphorylated at the 5’ CH2OH position of the 5’-end ribose or ribose substitute in order for the strand to be active in silencing.

Thus the simplest method to inhibit the loading of the desired sense strand into RISC as the antisense strand is to 5'-methylate the sense strand at this position. The d antisense strand can be manufactured to be 5'-phosphorylated or an intracellular enzyme can be relied on to provide the phosphorylation after the strand has entered the cell. This is to be used as a supplement to the entation of the asymmetry rule in strands ed with particular architectures in mind.

Methods for measuring the relative contributions of each of the strands in a siRNA or miRNA duplex to silencing are well established in the art. These techniques can also be applied to seqRNAi-based es to ensure that the intended antisense strand is being efficiently used by RISC. For example, expression s with a read out protein such as luciferase or enhanced green fluorescent protein can be constructed with target sequences capable of being recognized by the targeting code for any strand that s RISC silencing.

Two such vectors with read out ns that can be discriminated in the same cells can be constructed where each one responds to a different strands in a seqRNAi pair. Next these expression vectors can be transfected into a cell line along with or just prior to the administration of the seqRNAi-based duplex that is comprised of the test strands. By measuring the relative level of silencing of each of the read out proteins it is possible to determine the relative efficiencies with which each of the strands silences their tive targets. Such an assay provides the means to evaluate the extent to which an intended sense strand is being loaded into RISC as an antisense strand. 3. ing Codes and Targets: The central region and the seed sequence are the principal if not exclusive targeting codes for conventional siRNA and miRNA respectively. Modifications to these regions of the antisense strand, therefore, are particularly momentous in terms of their ability to affect the silencing of the intended target(s). These basic concepts also apply to seqRNAi, ss-siRNA, R and ss-MiR nse strands. siRNA, seqsiRNA, seqIMiR, ss-siRNA and ss-IMiR antisense strands are most effective when they are loaded into RISC with AGO-2 because this argonaute is unique in having catalytic activity against the RISC target. AGO-2 ically cleaves the target mRNA at the linkage opposite the one g nucleoside positions 10 and 11 counting from the 5’-end of the nse strand. To be effective the sides in positions 10 and 11 along with several of the contiguous nucleosides must be fully complementary with the mRNA target. Thus, mismatches in the central region of the antisense strand in particular will undermine the intended silencing ty. The binding affinity of the central region for the mRNA target, however, appears to be comparatively unimportant for ing activity within the range of affinities generated by the types of chemistries allowed by the present invention.

Outside the central region of the antisense strand and exclusive of any overhangs it is able that the sequence have a high degree of complementarity with the mRNA target. A small number of mismatches, however, typically can be tolerated.

The typical normal endogenous mechanisms that support miRNA, seqMiR and ss- MiR activity involve the induction of mRNA degradation processes where the antisense strand loaded RISC acts simply to recognize particular mRNA types as targets. Once this occurs other cellular elements form complexes with RISC that result in mRNA degradation that often starts with the poly-A tail. In this context, the details of the thermodynamic interactions involved in the complementary base g between the seed sequence and the complementary sequence in the mRNA 3’-UTR require more attention than the complementary base g between the central region of other RNAi types and their mRNA target.

One way to construct seqMiRs is simply to apply the key architectural ndent thms and a selected architectural dependent algorithm to a particular endogenous miRNA or a version of it that has been stripped of bulge structures, other mismatches between the otherwise complementary s and/or wobble base pairings. Alternatively, the seed sequence from a particular endogenous miRNA or a novel seed sequence can be placed in a duplex vehicle along with a complementary sequence into the corresponding area of the sense . Any AGO-2 based tic activity exhibited by the duplex vehicle can be inhibited, for example, by replacing nucleosides 10 and/or 11 counting from the 5’-end of the antisense strand with ones that are abasic, UNA and/or FANA. The abasic nucleosides can have any of the sugar modifications ed for herein including the unlocked variant (the sugar in UNA), 2-deoxyribose and FANA. Abasic nucleosides preferably are joined to adjacent nucleosides by phosphorothioate linkages.

Novel seed sequences can be constructed for particular purposes using a combination of recently developed computer and molecular biologic techniques that have been used to study the details of the interactions of the seed sequence of endogenous miRNAs and the complementary sequences in mRNA s that are subject to silencing (Chi et al., Nature Structural & Mol Biol 19: 321, 2012 provides some specific examples). Potential novel seed sequences initially can be identified by examining the 3’-UTRs for complementary ces in the collection of mRNAs that are of interest for silencing. These complementary sequences will have to meet certain thermodynamic criteria as described below. Next a prototype of the novel miRNA can be constructed, for example, by placing the seed sequence in a ed antisense strand that meet the design criteria for seqMiR and ss-MiR compounds. The y of the prototype seqMiR to physically recognize the collection of mRNAs of interest is then analyzed. Prototype compounds e of g to a desired collection of mRNAs can be then tested in ing studies. Finally, ments in the binding affinity of the seed ce for its mRNA target sequences can then be made as needed.

There is a substantial literature that describes the ctions of the seed sequence of endogenous miRNA with its mRNA targets. It has also been discovered that the seed sequence in conventional siRNA is a common major contributor to the off-target effects seen with this class of RNAi. Thus, it is clear siRNA can also function as a novel type of miRNA albeit one where the resulting silencing activity is usually not desired. It follows from this that the sequences of particular miRNA antisense strands that lie outside the seed sequence are not ed for achieving miRNA-type silencing.

Ui-Tei et al., (Nucleic Acids Research 36: 7100, 2008) have illuminated some key thermodynamic considerations that affect the cy of particular seed sequences in siRNA with respect to engendering miRNA-type activity against mRNA targets. They demonstrated that the thermodynamic stability of the duplex formed between the seed sequence and the mRNA target sequence has a strong positive correlation with the degree of seed sequence dependent silencing. The range of calculated seed /mRNA target duplexes tested ranged from -10°C to 36°C while the corresponding ΔG values ranged from -16 to -7 kcal/mol. This trates there is roughly a 5°C increase in Tm per -1 kcal/mol change in ΔG. The ΔG value can be converted to the dissociation constant for the seed duplex using the ished formula ΔG = -RTln(1/Kd) where T is 298.15 K. The results showed that there is a 106 fold difference in the dissociation constant between the seed/target duplex with the highest ΔG value and the lowest.

All of the 26 siRNA compounds tested had seed region dependent off target effects when used at high concentration (50nM) but only 5 of 26 (35%) had off-target effects when used at a low dose (0.5nM). These siRNA compounds were divided into two groups based on whether they resulted in greater than or less than 50% seen region based target suppression.

It was found that a calculated Tm of 21.5 s centigrade for the seed duplex distinguished the two groups with the higher Tm positively correlating with the higher silencing activity (r = -0.72 in linear regression analysis of silencing ty vs. Tm). This high level of correlation is surprising given the fact each of the siRNAs tested were distinctly different compounds that could be expected to vary in terms of factors such as the efficiency of antisense strand loading into RISC.

The seed duplex Tm calculated in y the same way for 733 human miRNAs in the miRBase database showed that 75% of them had values above 21.5 degrees centigrade.

Twenty percent were above 40 degrees centigrade and 5% were below 10 degrees. Indeed, 13 of the 733 (2%) had calculated seed duplex Tms above 50 degrees centigrade.

These thermodynamic parameters assist in the optimization of seqMiRs and ss-MiRs that are based on a particular endogenous miRNA seed sequences or to te miRNA activity based on a novel seed sequence. When they are based on a seed sequence from nous mRNA the overall level of silencing activity can be increased or decreased by increasing or decreasing respectively the l seed duplex Tm with respect to the mRNA types to be silenced. When the complementary sequence to the seed sequence in the mRNA 3’UTRs varies the relatively affinity of the seed sequence for such target sequences can be adjusted to have a higher affinity for some and a lower affinity for others based on the desired pattern of silencing activity. Based on the Ui-Tei et al. (2008) data it is clear that seed duplex ty between a seqMiR or ss-MiR seed sequence and its mRNA target ce is preferably above 21.5 degrees centigrade for Tm and/or below a ΔG of -12 for those mRNAs that are to be silenced and preferably below 15 degrees Tm and above -11 ΔG for those that are not to be silenced.

The basis for ing the binding ty for a particular seed sequence and its mRNA target sequence(s) are the chemical and other modifications provided herein that affect complementary base pairing affinity. Approaches for a number of these modifications are provided in Table 2. The use of these modifications must also take into eration all the other design rules that apply to seqMiRs and ss-MiRs including other dynamic considerations. The seed region of an antisense strand involves nucleoside positions 2-8 counting from the 5’-end and the asymmetry rule, where it applies, involves nucleosides 1-4 from the 5’end and in the case of the forked variant nucleosides 1-6 from the 5’end. Any modifications to the overlapping side positions must be made compatible. Another example is the preference for a comparatively low interstrand affinity in region 3 defined by Table 3. This also puts an ty preference on seqRNAi-based duplexes that involves the seed ce of the antisense strand that potentially conflicts with any desire to boost the affinity of the seed sequence with its mRNA 3’UTR target.

The solution to these ial conflicts is to design seqMiR strands so that any modifications to the seed sequence that increase binding affinity for the mRNA 3’UTR target sequence do not proportionally increase the l or regional interstrand affinity with the seqMiR partner sense strand. For example, one or more LNA modifications can be used in the antisense strand seed sequence where they are compensated for by mismatches, UNA, abasic nucleosides or other permissible affinity lowering modifications in the corresponding area of the partner sense strand. With this type of compensation it is preferred that the affinity ng modification involves either the binding partner or a nucleoside contiguous with the binding partner that has the affinity increasing modification.

The seed sequences, mRNA 3’-UTR sequences, calculations and experimental design used by Ui-Tei et al., (2008) can be used to help illustrate aspects of the design and testing of seqMiR compounds including those based on novel seed sequences (i.e., ones not found in endogenous miRNA). The particular methods used in the e are not meant to be limiting but rather to show one approach to reducing some of the design ts for s reduced to practice. The seed sequences taken from Ui-Tei et al., have little commercial value but are valuable as an example given that they have been used to generate real data that ground the example in actual facts. The same basic approach can be used with novel or endogenous miRNA seed sequences that are directed to the 3’UTRs of actual mRNA types that are to be silenced by a seqMiR compound.

Index 2A summarizes some of the data from Ui-Tei et al., (2008). The first column lists the names of 26 different siRNA compounds. The next two columns list the seed sequences from each of these compounds and the sequence containing the complement to the seed sequence that was constructed for insertion into an expression . The fourth column provides the calculated Tm for the seed duplex and the final column provides the t suppression of the expression vector product produced by the siRNA when transfected into cells that s it. As previously stated there is a strong ve correlation between a higher Tm for the seed duplex and a higher level of target suppression.

Key observations based on these data include the following: (1) the fact the binding affinity of the seed duplex appears to be a much more ant determinant of the level of target suppression than is the nature of the rest of the siRNA compound; and (2) a specific seed sequence from an endogenous miRNA antisense strand is not necessary in order to obtain miRNA-like silencing activity. So what appears to be important with respect to the duplex is that it simply has the necessary properties to result in the loading of the desired antisense strand into RISC. Indeed, it is not even necessary for the duplex structure to mimic any particular features of endogenous miRNA duplexes that are different from siRNA compounds in order to get miRNA-like silencing activity.

The mental design upon which the suppression data shown Index 2A were generated involves the use of expression vectors for a gene with an easily quantifiable product. Ui-Tei et al., (2008) used the a luc gene inserted into the cially available psiCHECK-1 plasmid (Promega). Twenty-one nucleoside sequences, shown in column 3 of Index 2A, that include an 8 nucleoside stretch complementary to the 5’-end nucleoside and the contiguous seed sequence were ed in the plasmid in the 3’UTR of the luc gene in the plasmid as three tandem s. The remaining 13 nucleosides in the inserted target sequence had no homology to the rest of the siRNA nse strand. This was repeated for each of the 26 siRNA compounds involved in the evaluation and listed in column 1 of the index. These plasmids were then transfected into HeLa cells that were subsequently treated with the siRNA compound with the seed sequence matching the target sequence in the transfected plasmid. The ability of the siRNA to ss the luc gene product was determined for various doses and the 5.0 nM dose result is shown in the fifth column of Table A in Index 2.

Index 2B provides a table that rates two possible steps in the modification of seed sequences for use in seqMiR or ss-MiR compounds. In the actual ce of producing commercially useful compounds the seed sequences can come from endogenous miRNA antisense strands or they can be novel seed sequences designed to target a particular group of endogenous mRNA types. The basic rules provided for achieving nuclease resistance and the other ial/preferred architectural-independent rules are applied to the seed sequences shown in the first column and the results are shown in the second column. The sugar in the most 5’ nucleoside in the seed ce can be ribose or 2’-fluoro depending on the intrinsic se stability of the first two linkage sites in the strand. Since this cannot be fully determined without knowing the 5-end nucleoside in the strand the examples all have the 2’- fluoro modification in the first seed position. The modifications, if any, to the most 3’ nucleoside in the seed sequence and the nature of its linkage to the contiguous nucleoside that is not part of the seed sequence y depends on the nature of the contiguous non-seed side. For the sake of this illustration it is assume the contiguous nucleoside is a G because this s the situation if either of the negative control duplexes shown in Index 2D are used as the duplex vehicle. To indicate this situation a G is shown in parenthesis in column 2 of Index 2B. If another duplex vehicle were used the contiguous nucleoside with the 3-end of the seed sequence could be U, C or A. In the case of the siRNA based duplex vehicle shown in Index 2D the contiguous nucleoside would be U. In column 3 examples of le modifications selected from Table 2 that can be added to substantially increase the Tm of the seed sequence with the target. The estimated increase in Tm compared to the unmodified sequence is shown in column 4. In the actual practice of producing cially useful seqMiR compounds the particulars of such modifications, if any, would be tailored to optimize the ing of the intended group of mRNA types.

Index 2C provides a table that illustrates two possible steps in the modification of the portion of the sense strand for use in seqMiR compounds that corresponds to the seed sequence of the complementary strand. The principal goal here is to reduce the effect of the affinity enhancing modifications made to the seed sequence in Index 2B on the regional and overall affinity of the sense and antisense components of the seqMiR compound. The preferred level of Tm ion in practice will depend on the exact structure of the seqMiR- based duplex. Examples of possible modifications are shown in column 3 and the estimated ion in Tm between the modified sense and antisense s is shown in column 4.

Since the preferred way to reduce affinity in this situation is to introduce mismatches the nuclease resistance modifications may have to change accordingly. Further, the modifications, if any, to the most 3’ nucleoside in the sense strand sequence in column 2 and the nature of its linkage to the contiguous 3’ nucleoside (not shown) that is not part of this section of the sense strand ce can depend on the nature of the contiguous 3’ nucleoside. This occurs if there is an overhang precursor in the sense strand. If so then the rules ed to e endonuclease protection apply to the 3’end of the sense sequence shown in column 2. In the absence of an overhang precursor then the rules for protecting the 3’end of the strand in the absence of an overhang precursor apply. This is the case with the example in Indices 2B, 2C and 2D because the strand lacks an ng precursor. As a consequence the sense strand sequences shown in 2C must end with a modified nucleoside and be connected to the contiguous 3’ nucleoside (not shown) by a phosphorothioate linkage.

Finally, in the actual practice of producing commercially useful seqMiR compounds such modifications to this portion of the sense strand would be ed to a particular duplex vehicle and the full complement of design requirements ed herein as applied to the entire duplex vehicle with the desired seed sequence inserted.

Index 2D provides three examples of duplex vehicles that are used to illustrate features of the design of seqMiR compounds that make use of such structures. These examples are based on two established negative controls for le species including mouse and human and a siRNA targeting human and mouse Apo-B. As shown these parent compounds have been modified in accordance with the essential/preferred architectural independent rules (from sections E and F). The question marks indicate places where the preceding nucleoside and/or its 3’ e modification cannot be determined in the absence of a specific insert sequence. Each of the duplex vehicles is shown with and without a modification in the antisense strand intended to t catalytic AGO-2 based silencing activity. In these instances this is specifically illustrated by the placement of an abasic 2’deoxyribonucleoside in position 11 counting from the 5’-end of the antisense strand. In practice the means to inhibit AGO-2 catalytic activity can be prophylactically made to the strand or only be made if the need arises.

The portions of the strands to be replaced by the ed seed sequence and the ponding sense strand sequence are underlined. As shown the rules for generating nuclease resistance along with the essential/preferred architectural-independent rules have been applied to the strands of the duplex vehicles with the ion of the underlined portion. After the selected seed sequence and the corresponding sequence in the sense strand have been inserted and an architecture selected then the design of a ular seqMiR compound can be finalized. es of seed sequences and the ponding sense strand sequences for the purposes of this ration are provided by Indices 2B and 2C respectively. The insertion of a new seed sequence into a negative control has the potential to generate a compound with off target AGO-2 catalytic activity. If this occurs it can be inhibited by the methods provide .

In the actual practice of producing commercially useful seqMiR compounds the pool of potential duplex es can be comprised of any duplex capable of meeting the design ia provide herein and where the duplex results in the ent loading of the duplex and retention of the desired antisense strand by RISC. Sources of duplex vehicles include endogenous miRNA duplexes, conventional siRNA compounds and es that are established to be miRNA/siRNA ve controls for the subject species of interest for treatment with seqMiR compounds. Negative controls will need to be ked for a lack of induction of unintended siRNA-based silencing activity once the selected seed sequence and corresponding sense strand sequence are inserted. Any AGO-2 based catalytic silencing activity generated by a duplex e can be inhibited by replacing the nucleosides in positions 10 and/or 11 counting from the 5’-end of the antisense strand with modified nucleosides that will inhibit this catalytic ty without preventing duplex formation by the s. Suitable modifications for this purpose include abasic, UNA and FANA. The abasic nucleosides can have any of the sugar modifications provided for herein including the unlocked variant (i.e., the sugar in UNA), 2-deoxyribose and FANA. Abasic nucleosides preferably are joined to nt nucleosides by phosphorothioate linkages.

Index 2E provides another seqMiR design variant that is based on the use of a dimer forming antisense strand. One of the ways this variant is unusual is that it functions as a seqMiR but only requires a single strand. This design involves placing both the seed sequence and the complementary sequence in the same strand rather than separating them between a sense and an antisense strand.

In the illustrative example shown in Index 2E seed sequence number 12 (from siRNA ITGA10-2803) in the Table in 2B and the corresponding portion of the sense sequence shown in Index 2C are placed in the antisense strand in the first duplex vehicle shown in Index 2D.

The placement of the sequence previously associated with the sense strand is placed in same position in the antisense strand that it would be in a sense strand. These seed and corresponding sense strand sequences are underlined in the first illustration in Index 2E.

Two things are immediately clear from Index 2E: (1) The nse strand forms a dimer or more ically a duplex with itself: and (2) The antisense stand will also form a hairpin with itself. These factors will also be true of any other seqMiR designed in this manner. The ated overall Tm for the unmodified two-stranded duplex is 58 degrees centigrade under physiological salt conditions and 50nM compound concentration using the nearest-neighbor calculation. The portion of the strand ting the hairpin is represented along with the intervening unpaired loop.

Two potential advantages to this design are the following: (1) Only one strand has to be used in treatment; and (2) The hairpin can provide nuclease protection to the seed sequence. As a result the seed sequence does not have to be chemically modified to protect it from se . This would allow, for e, seed sequences from endogenous miRNA to be used without al modification. A disadvantage of this design is that it is cannot be efficiently administered to the circulation e the kidneys will rapidly clear the double strand duplexed portion of the interchanging double and single strand forms. This approach is more likely to be most useful in situations were the compound is inserted into comparatively static environments such as the cerebral spinal fluid, joint fluids, ascites and bladder rather than into the circulation. Here the double strand species in effect serves as a reservoir for the single strand species that can be more efficiently taken up by cells.

This approach can be used with architectures other than small internally segmented and the asymmetric variant where there is a 5’-end overhang. The asymmetry rule that applies to these architectures, however, has to be ed because it does matter which strand is loaded since they are the same. Thus, the requirement for a differential Tm n the duplex termini is lowered in this situation. The concept that the 4 most terminal nucleosides have a graded affinity with the lowest affinity being relegated to the 2 most terminal nucleosides, however, is retained. Since the 5’end terminal nucleoside is not part of the seed region it can be configured as a ch with the 3’end terminal nucleoside with no effect on the seed duplex Tm. This is preferred when the one or both of the nucleosides in the 2 terminal positions are G and/or C. The most 5’ of the seed sequence nucleosides can also be mismatched with the corresponding nucleoside on the 3’-end but not with the target sequence. This is preferred if the seed sequence starts with Gs and Cs in the initial 2 positions from the 5’end.

It is also preferred that the strands be inhibited from supporting AG0-2 catalytic activity that could generate off target effects. This can be achieved by replacing the nucleosides in positions 10 and/or 11 from the 5’-end with modified nucleosides that will inhibit this catalytic activity without preventing duplex formation by the strands. le modifications for this purpose include abasic, UNA and FANA. The abasic sides can have any of the sugar modifications provided for herein including the unlocked variant (i.e., the sugar in UNA), 2-deoxyribose and FANA. Abasic nucleosides preferably are joined to adjacent nucleosides by phosphorothioate linkages. The design rules affecting regional interstrand affinities just discussed in this and the preceding paragraph also fulfill the ence for lower regional affinities in regions 1, 2 and 3 defined by Table 3.

In the illustration in Index 2E, the A in position 10 and the U in position 11 are rendered abasic 2’-deoxyribonucleotides as indicated by the 0D subscript (Index 1). Such modifications involving two positions can result in overall Tm drops of 10-20 degrees centigrade. When required such a drop can be compensated for by using a slightly longer strand and/or by adding one or more modifications that increase Tm. This is not necessary in the present example given the starting Tm of 58 and the increases to Tm provided by the other modified nucleotides. It is also not necessary if the compound does not produce unacceptable off-target s due to AGO-2 catalytic activity.

As for seqMiR sets lly, cations can be made to the seed ce that will se the Tm of the seed duplex without undermining important thermodynamic considerations with respect to overall and regional interstrand affinities. This is achieved by making compensatory changes in the sequence complementary with the seed sequence in the seqMiR strand set that in this case is in the same strand. Various means to enhance or reduce interstrand or antisense strand/target affinities are listed in Table 2.

One specific e or increasing the Tm of the seed duplex out of the numerous possibilities is shown in the last illustration in Index 2E. Here the LNA modification is used in positions 5 and 8 counting from the 5’-end. These are sated for by the UOD in position 11 and by the use of a mismatch in position 15. The UOD in position 11 is contiguous with the binding r for the LNA in position 8 and the mismatch in position 15 is the binding partner for the LNA in position 5. This illustrates that this type of compensation can involve either the g partner or a nucleoside contiguous with the binding partner.

Index 2F provides examples of the application of these design principles to a seed sequence taken from an endogenous miRNA that has potential relevance for drug development. Let-7 family members can act as anti-oncogenes and the levels of one or more family members is suppressed in a number of cancer types. mentally increased levels of the suppressed family member(s) has been shown to produce a y of anticancer effects.

The seed sequence illustrated in Index 2F is common to le members of the let-7 miRNA family and to multiple s such as human and mouse. By inserting this sequence and the corresponding sense strand ce into a duplex vehicle a seqMiR can be constructed that can mimic features of multiple let-7 family members. Further, the affinity of this seed ce for the target mRNAs can be increased with a resulting increase in silencing ty. Five examples of this are shown along with 5 examples of compensatory reductions in binding affinity capacity in the corresponding area of the sense strand.

In Index 2G these sequences are ed into the appropriate places in the duplex vehicle shown in 2D that is based on a siRNA to Apo-B. The nse strands are shown with and without examples of blocking AGO-2 catalytic activity against any unintended mRNA target. Further, the antisense strands are shown with 2 overhang unit precursors.

These can be selected from those ed in the overhang precursor section, for example, ~U~U or ~dT~dT.

Examples of dimer forming single strands based on the antisense strands shown in 2G are illustrated in 2H. As described in the description associated with 2E such dimer forming single strands are most suitable for used in compartments, such as the CNS, in subjects other than the circulation where the dimer form can be cleared in a matter of minutes by the kidneys. 4. Summary of minimal essential rules for seqRNAi compounds: In addition to the essential/preferred architectural-independent rules provided in sections E and F there are minimal thermodynamic ements for the most basic seqRNAi compound suitable for use in accordance with the present invention. The stand-alone architectures provided differ in the ing: (1) whether or not they provide for an overhang precursor(s) in strands and if so how many units are there and where are they; and (2) whether or not they provide for one sense strand and one antisense strand or for two sense strands and one antisense strand or for two antisense s and one sense strand as members of the same seqRNAi set. It is obviously ary for a seqRNAi-based duplex to have an architecture. From a thermodynamic point of view the blunt-ended architecture is the simplest in terms of describing the minimal set or rules for a seqRNAi set. This is because dual sense or nse strands in the same i set require additional thermodynamic considerations and an overhang longer than one unit has the potential to affect interstrand binding affinity of the seqRNAi-based duplex. This can occur when the ng is long enough to double back on the duplex and interact with it. The overhang effect, however, is typically not a major concern and can be d in general design considerations. Thus, nearly all situations the cal and asymmetric architecture (with only a 3’-end overhang precursor) are no more thermodynamically complex in terms of the rules presented than the end architecture.

Given these ations the minimal requirements for seqRNAi compounds requires the essential/preferred architectural-independent rules provided in ns E and F along with the essential/preferred rules for the blunt-end architecture. In this simplest case the length of the strands will be assumed to be 19-mers since this length corresponds to that of the largest proportion of tional siRNA and miRNA compounds exclusive of any overhangs. The architectural-dependent algorithms include rules with additional thermodynamic considerations that are not considered here as the simplest case. The dynamic rules for the simplest case seqRNAi set can be summarized as follows: 1) Table 3 explicitly defines three regions in a seqRNAi-based duplex based on the sense strand where it is preferred that the ed contribution of the three regions have a Tm that is lower than the Tm for the overall duplex when corrected for the smaller number of contributing nucleosides. It is preferred that all three regions have relatively lower Tms but they are individually too short to allow for reasonably reliable Tm determinations. Adjustments in affinity can be achieved by using affinitylowering modifications in the sense strand portion of one of these explicitly defined regions and/or by increasing the affinity in the intervening areas in the sense strand.

When the overall Tm of a seqRNAi duplex is above the preferable range then the use of affinity lowering modifications to reduce the overall Tm preferably are made to one or more of the regions explicitly defined in Table 3. The general steps involved in achieving these goals are the following: a. The collective interstrand duplex Tm for the 3 regions explicitly d by Table 3 and the overall duplex Tm are determined for the unmodified strands using the t-neighbor calculation. b. Next the effects of the al modifications on the regional and overall Tms are adjusted for the modifications made following the applications of the se resistance and essential/preferred architectural-independent rules using the information in Table 2. c. Finally, the information in Table 2 is used to reduce the combined regional Tm and/or to increase the intervening Tms as needed. These modifications should be evenly distributed as much as possible. The modifications are made to the sense strand. 2) The asymmetry rule is applied next. a. The Tm n the duplexed 4 nucleosides at each terminus based on the unmodified RNA sequence is estimated using the following equation:Tm = 2(wA+xU)+4(yG+zC), where w, x, y and z are the numbers of the ted nucleosides in the 4 nucleoside duplex. b. Table 2 is used to make adjustments in the overall 4 nucleoside duplex Tm based on the modifications applied to these nucleosides and to the ening linkages following the applications of the nuclease resistance, essential/preferred architectural-independent and the thermodynamic rules just provided in (1). c. The determinations in (a) and (b), r, do not take into account the decreasing importance of the nucleosides as one moves away from the terminus. To account for this in a simple way it is preferred that the overall Tm for the 4 nucleoside duplex be lower for the one containing the 5’end of the antisense strand and that the most terminal two nucleoside pairs of this duplex have a lower affinity for their partner nucleoside than the corresponding pairs at the other terminus. If it is necessary to make an adjustment either in one or both of the terminal nucleoside pairs or in the overall Tm for the terminal 4 nucleosides the needed modification information can be obtained from Table 2. In general, the magnitude of the modification should be in alignment with the magnitude of the needed adjustment. d. When major affinity adjustments of this type are in order mismatches are preferred over UNA and abasic and they are made to the sense strand.

Not all the permitted strand modifications ed for herein have been well terized with respect to their impact on interstrand or antisense /target affinity and they do not appear in Table 2. Those that have been characterized lly vary in their effect with their position within the strand (terminal positions, for example, typically result in a reduced effect) and by other details of the adjacent /duplex context.

The next most basic considerations to seqRNAi set design involve adding the essential/preferred rules for the targeting codes. These are the central region of the nse strand of seqsiRNA and seqIMiRs and the seed sequence of seqMiRs. These rules also apply to the corresponding ss-siRNA, ss-IMiR and ss-MiR antisense strands respectively.

The application of these essential rules to an example of an seqsiRNA (seqIMiRs follow the same design process only the type of target RNA is different) in Index 8 where the target is mouse PTEN and in Index 9 where the seqMiR example is based on let-7i. These s illustrate the essential basic design of seqsiRNA/seqIMiR and seqMiR compounds. In standard practice the some or all of the thermodynamic rules can be left to later in the design Index 8 carries over the three strands from Index 6 as a starting point. The three regions defined by Table 3 are underlined in the sense strand. The sequence of the combined three regions are shown next followed by the ed intervening regions. Table 4 provides the Tm calculation results for the overall duplex and for the combined al and combined intervening sequences with and with out adjustments for the modifications made to the strands. Table 2 is used to provide the estimated effects of the various modifications on the Tm. The combined regions 1-3 sequence is 10 nucleosides in length while the combined intervening sequence is 9 sides in length so the Tm for the former has been proportionally decreased.

TABLE 4 Duplex (degrees centigrade) Unmodified Modified Overall 70 79 Combined Regions 1-3 34* 38* Combined ening 37 41 Regions *Reduced 10% to compensate for longer length ed to combined intervening regions It can be seen in Table 4 that both the differential Tms for the two combined regions and the overall Tm are within the preferred parameters without further modification. Further, the Tm calculations for the two termini of the duplex meet the requirements of the asymmetry rule. The terminus with the 5’-end of the sense strand has a calculated Tm of 28 degrees that increases to 32 with the modifications while the other us has a calculated Tm of 20 s that increases to 22 degrees with the modifications. In l practice, the asymmetry rule would not be applied at this point if the small internally segmented or asymmetric architecture with a 5’-end overhang had been selected as part of the design.

Index 9 s over the three strands from Index 7 as a ng point except the overhang precursors have been removed because the simplest case is being ered in the example. The three regions defined by Table 3 are underlined in the n of the sense strand that has the wobble base pairs and mismatch with the nse strand removed. The sequences of the combined three regions are shown next ed by the combined intervening regions. Table 5 provides the Tm calculation results for the overall duplex and for the combined regional and combined intervening sequences with and with out adjustments for the cations made to the strands. Table 2 is used to provide the estimated effects of the various modifications on the Tm.

The data shows that the estimated overall duplex Tm is high (82 degrees) so there will be an expected preference for loading AGO-2. This can increase the likelihood that this seqMiR compound without further modification could have off-target siRNA like activity. If this is a problem for the intended commercial purpose the overall Tm of the duplex can be d to the preferred range or the nucleosides in ons 10 and/or 11 from the 5’-end of the antisense strand can be modified to inhibit AGO-2 from carrying out a direct cleavage of an unintended mRNA target(s).

The data also shows that combined Tm of the three regions defined by Table 3 is lower than the Tm of the combined intervening region. Thus, this duplex meets this thermodynamic preference without further modification.

TABLE 5 Duplex (degrees centigrade) Unmodified Modified Overall 70 82 Combined Regions 1-3 30 36 ed Intervening 41 47 Regions Index 9 also provides the 4-nucleoside duplexes from each terminus for consideration of their compatibility with the asymmetry rule. The terminus with the 5’-end of the sense strand has a calculated Tm of 14 degrees centigrade unmodified and 16 degrees with the modifications shown while the other terminus has Tms of 12 degrees and 14 s respectively. Thus, termini are in general compliance with the broader requirement of the asymmetry rule, but the second pair of nucleosides from the termini are suboptimum in that the pair in the terminus with the 5’end of the antisense strand has a comparatively higher affinity than the corresponding pair in the other terminus. Given that the terminus with the 5’end of the sense strand already has a high Tm with 3 of the 4 nucleoside pairs being G:C the second pair in the other terminus can equally well have an A or a G to replace the C but G is selected for this example. The indifference to the A or G replacement is that r provides an advantage over the other with respect to introducing a more nuclease ant linkage pair.

H. Algorithms: Architectural Dependent - cal 1.Description: Canonical is the naturally occurring siRNA ecture. It is also the commonly used ecture for manufactured conventional siRNA. This architecture is defined by the ce of 1 to 4 nucleosides or nucleoside substitutes called ngs on the 3'- ends of both strands that extend beyond the duplexed portion of the compound. It is generally preferred that overhangs be 2-3 nucleosides or nucleoside substitutes in number.

With the seqRNAi approach the compounds delivered to subjects are single strands rather than duplexes so it is meaningless to talk about such strands having overhangs. Instead they have overhang precursors and in the case of the canonical architecture format both i strands have overhang precursors. Exclusive of the overhang precursors the two strand of a given seqRNAi set have the same length.

Overhang sors are discussed in more detail in the section by that name.

The asymmetry rule is important for the canonical ecture. This and other thermodynamic considerations relevant to the canonical architecture are considered in more detail in the thermodynamics section.

The application of the canonical architecture dependent algorithm to the rative seqsiRNA and seqMiR examples is provided in Indices 10 and 11 respectively.

The sense and nse strands from Index 8 are carried over as the starting point for the modifications introduced in Index 10. The latter Index illustrates 7 of the sense strand variants and 3 of the antisense strand variants that are consistent with the canonical architecture. Any of these sense strands can be used with any antisense strand. As required by the canonical architecture both strand types are shown with overhang precursors. These can be any of those described in the n by that name.

For the sake of illustration those in the e can be said to be ~UF~UM. The same strands can be used according to the blunt-end architecture simply by dropping the overhang precursors.

Index 11 carries over the adjusted sense strand and the antisense strand from Index 9. The sense strand with the wobble bases and mismatch retained could be used but it is not continued to simply the illustration. The cal architecture requires 3’-end overhang precursors on both the sense and nse strands. In the illustration 2 overhang units are shown since this is the preferred number. The units and the intervening linkages can be any of those provided for in the overhang precursor section. For the sake of illustration those in the example can be said to be .

Two es are shown to illustrate the two principal ways that unintended off target effects due to a siRNA-like activity can be reduced in a seqMiR set. In duplex one the overall Tm is reduced to below 60 degrees centigrade. One additional mismatch and one abasic side are added to the mismatch inserted in the sense strand in accordance with the asymmetry rule. The new modifications are within the regions 1 and 2 that are explicitly defined by Table 3. These will have the effect of reducing the 82 degree Tm to a Tm under 60 degrees. In the second duplex position 11 from the 5’end of the antisense strand is converted to an abasic nucleoside. 2. Applicable to seqRNAi Sense Strands: a) The strand is required to have at least one overhang precursor unit at the 3’-end. b) Unless otherwise provided for the strand can have one modification per region in one or more of the three regions explicitly defined by Table 3 where the modifications are selected from the group consisting of a nucleoside mismatched with its partner (opposite) nucleoside in the antisense strand, an abasic nucleoside, UNA and ANA.

When a UNA is used in region 1 it is preferred that it be in the most downstream position from the 5’-end that is allowed by the Table. Abasic nucleosides preferably are joined to nt nucleosides by phosphorothioate linkages. c) Except when one of the modifications just bed in (b) is used in region 2, the ing is preferred: The two nucleoside positions opposite positions 10 and 11 from the 5'-end of the antisense strand when the strands are duplexed is joined by a phosphodiester linkage and the nucleoside in the sense strand opposite position 11 in the antisense strand is selected from the group consisting of ribose and oro and the nucleoside in on 11 is selected from the group consisting of ribose, 2’-fluoro or 2methyl. So, for example, if the sense strand is a 19-mer exclusive of any overhang precursors then position 9 from the 5’-end of the sense strand would be opposite position 11 in the antisense strand. Further, when the linkage site opposite positions 10 and 11 of the antisense strand is so configured, it is preferred that the four sense strand nucleoside positions opposite nucleoside ons 9-12 from the 5'- end of the antisense strand when the strands are duplexed not have any ches with the antisense strand. d) When the strand has only one 3’-end overhang precursor unit then the 3’-end terminal nucleoside or nucleoside substitute and the terminal two linkages are ed by the 3’-end overhang section herein and the nucleoside next to the overhang sor will be selected from the group 2’-fluoro, 2’methyl or 2’- deoxyribose. e) When the strand has 3’end overhang precursors that are at least two nucleoside or nucleoside substitute units in length the required 3’-end lease protection is provided by the 3’-end ng designs described herein. f) The terminal 5’-end nucleoside preferably is chemically modified, for example, by methylation to prevent its 5’ ribose position from being orylated by endogenous enzymes. g) Should they occur, undesirable off target silencing due to the seed sequence promoting miRNA-like activity can be inhibited using one or more of three alternatives that can inhibit the interaction with the unintended mRNA target(s): (i) one or both of the following stipulations are met: the second nucleoside from the 5'- end is not ribose or ro and ably is 2'methyl and/or one of the sides in positions 3-7 from the 5'-end is UNA or . Destabilizing modifications, r, should not fall in the central region of the antisense strand; (ii) If the target sequence in the unintended mRNA target site(s) complementary to the seed sequence has one or more U and/or G containing nucleosides then the seed sequence can be adjusted to generate at least one G:U wobble base pair between it and the target sequence; or (3) a multiplicity of the nucleosides in the seed sequence can be 2’deoxyribonucleosides. The presence of 5 or more consecutive2’- deoxyribonucleosides is discouraged, however, since it has the potential to promote RNaseH based degradation of endogenous RNA complementary to the strand. Abasic nucleosides preferably are joined to adjacent nucleosides by phosphorothioate linkages. 3. able to i nse Strands: a) The strand is required to have at least one but not more than four overhang precursor units at the 3’-end with two units being preferred. b) When the strand has only one 3’-end overhang precursor unit then the 3’-end terminal nucleoside or nucleoside substitute and the terminal two linkages are provided by the 3’-end overhang section herein and the nucleoside next to the overhang precursor will be selected from the group oro, 2’methyl or 2’- deoxyribose. c) When the strand has 3’end ng precursors that are at least two nucleoside or nucleoside substitute units in length the required 3’-end exonuclease protection is provided by the 3’-end overhang designs described herein. 4. Applicable to seqsiRNA and seqIMiR Antisense Strands: Should they occur, undesirable off target silencing due to the seed sequence promoting miRNA-like activity can be inhibited using one of two atives that can inhibit the interaction with the unintended mRNA target(s): (i) one or both of the following ations are met: the second nucleoside from the 5'-end is not ribose or 2-fluoro and preferably is 2'methyl and/or one of the nucleosides in positions 3-7 from the 5'-end is UNA or abasic; or (ii) If the target sequence in the nded mRNA target site(s) complementary to the seed sequence has one or more U and/or G containing nucleosides then the seed sequence can be adjusted to generate at least one G:U wobble base pair between it and the target sequence. Abasic nucleosides preferably are joined to adjacent nucleosides by phosphorothioate linkages.

. Applicable to seqMiR nse Strands: Particularly, for strands that will generate an overall Tm of greater than 60 degrees centigrade with their partner strand it is red that any catalytic activity of AGO-2 directed against an endogenous RNA target by the antisense strand is inhibited. This can be achieved through making certain modifications to the nucleosides in positions 10 and/or 11 from the 5’-end of the antisense strand. When off target activity against a known target is to be avoided this can be achieved by making one or both of the indicated nucleosides be mismatches with the target. It is red in this situation that there not be a single A:C mismatch. Any AGO-2 based catalytic silencing activity can be inhibited by replacing the nucleosides in positions 10 and/or 11 with modified nucleosides that will inhibit this tic activity without preventing duplex formation by the s. Suitable modifications for this purpose include abasic, UNA and FANA. The abasic nucleosides can have any of the sugar modifications provided for herein including the unlocked variant (i.e., the sugar in UNA), 2- deoxyribose and FANA. Abasic nucleosides preferably are joined to adjacent sides by phosphorothioate linkages. 6. Applicable to NA-based and seqIMiR-based Duplexes: The overall Tm, under physiological conditions, will be at least 55 and preferably at least 65 degrees but preferably under about 95 degrees rade. The means to adjust overall Tm is presented in the thermodynamics section. 7. Applicable to seqMiR-based Duplexes: The overall Tm under logical conditions will be at least 45 and preferably under 60 s centigrade unless the antisense strand is modified to t AGO-2 from having a direct tic action on mRNA when it is loaded as such into RISC. In the latter case the preference for an overall Tm limit of 60 degrees is removed.

I. Algorithms: Architectural Dependent - Blunt-end 1. Description: Sense and antisense s for a given seqRNAi set have the same length and do not have 3’-end overhang precursors. The asymmetry rule is important for the blunt-end architecture. This and other thermodynamic considerations relevant to the blunt architecture are considered in more detail in the thermodynamics section. The ation of the blunt-end architecture dependent algorithm to the illustrative seqsiRNA and seqMiR is the same as the canonical rated in Indices10 and 11 respectively except there are no overhang precursors. 2. Applicable to seqRNAi Sense s: a) the required 3’end protection from exonuclease attack can be provided by the use of two terminal nucleosides that are individually ed from the group 2’-fluoro, 2’methyl or 2’-deoxyribose and where the terminal two linkages will be phosphorothioate. Strands that have a 3’ terminal 2’-fluoro modification, however, often have a reduced yield with t manufacturing methods so this modification is not preferred in this position. b) In other respects the rules for the canonical architecture apply here except the strand lacks an overhang precursor. 3. Applicable to seqsiRNA and seqIMiR Antisense Strands a) the required 3’end protection from exonuclease attack can be provided by the use of two terminal nucleosides that are individually selected from the group 2’-fluoro, 2’methyl or 2’-deoxyribose and where the terminal two linkages will be orothioate. Strands that have a 3’ terminal 2’-fluoro cation, however, often have a reduced yield with current manufacturing methods so this modification is not preferred in this position. b) In other ts the rules for the canonical architecture apply here except the strand lacks an ng precursor. 4. Applicable to seqMiR Antisense Strands: a) the required 3’end protection from lease attack can be provided by the use of two terminal nucleosides that are individually selected from the group 2’-fluoro, 2’methyl or xyribose and where the terminal two linkages will be phosphorothioate. s that have a 3’ terminal 2’-fluoro modification, however, often have a reduced yield with current manufacturing methods so this modification is not preferred in this position. b) In other respects the rules for the canonical architecture apply here except the strand lacks an ng precursor.

J. Algorithms: Architectural Dependent - Asymmetric 1. Description: seqRNAi antisense strands have 1-4 unit overhang precursors at the 5’ or 3’ ends or both while the sense strands in the same set do not have overhang precursors. With respect to antisense strands with 3’-end overhang precursors the terminal sense strand 5-end nucleoside preferably is paired with the 3’-end nucleoside in the antisense strand that is contiguous with the overhang precursor. It is preferred for most strand sequences that the overhang precursor only occurs at the 3'-end of the antisense strand. When there is only a 3’-end overhang precursor, it is preferred that it be 2-3 sides and/or nucleoside substitutes in . 5’-end overhang precursors follow the same rules that apply to the rest of the strand save the 3’-end overhang precursor that can follow other rules. Overhang precursors are sed in more detail in the section by that name.

The asymmetry rule applies to seqRNAi strand sets designed according to the asymmetric architecture when the antisense strand lacks a 5’-end overhang sor. When the asymmetric architecture provides for a 5’-end overhang precursor with or without a 3’- end overhang precursor the importance of the asymmetry rule basis for antisense strand selection is nullified. As a consequence, the importance of other factors that affect the level of efficiency in the removal of the intended sense strand and the retention of the intended antisense strand by RISC is increased, for e, by introducing reductions in interstrand affinities in particular s explicitly defined by the Table 3 relative to other interstrand areas particularly in region 2.These and other thermodynamic considerations relevant to the tric architecture are considered in more detail in the thermodynamics section.

Hence, all three forms of the asymmetric architecture have essentially the same antisense strands differing only in having a 3’-end overhang precursor or not. The ted canonical or blunt-end antisense strands can simply be transposed to the asymmetric architecture. The sense strands used in the asymmetric architecture are either simply transposed from the blunt-end architecture or they are d at the 3’end to generate a 5’- end overhang precursor in the r antisense strand when the duplex forms. When the sense strand is truncated in this way, it is particularly preferred that regions 1 and 2, defined in Table 3, have vely low Tms compared to the rest of the strand unless the result is to reduce the overall interstrand Tm below the preferred range. The oning of regions 1 and 2 in this case are based on the length of the ended sense strand even though this sense strand is truncated at the 3’-end.

Thus it is only necessary to show the seqsiRNA and seqMiR sets in Indices 12 and13 that only illustrate the case where the sense strand is shortened at the 3’-end. In the specific examples used it is shortened by 3 nucleosides. The antisense strand partner is rated as having either a 3’-end overhang or being blunt-ended with the 5’-end of the sense strand.

Where the 3’-end has been modified the appropriate changes have been made to comply with the nuclease resistance and essential/preferred architectural independent rules. 2. Applicable to seqRNAi Sense s that are paired with Antisense Strands without a 5’- end Overhang Precursor: Same rules apply as for end architecture. 3. Applicable to seqRNAi Sense Strands that are paired with Antisense Strands with a 5’- endoverhang precursor with or without a 3’-end Overhang Precursor: a) Is at least 13 nucleosides long and is no more than 6 nucleosides shorter than the antisense strand in the set. It is preferred that the 3’end be d by no more than 3 nucleosides and that the 5’-end not be shortened. b) Unless otherwise provided for the strand can have one modification per region in one or more of the three regions explicitly described by Table3 where the modifications are selected from the group consisting of a nucleoside mismatched with its partner (opposite) nucleoside in the antisense strand, an abasic nucleoside, UNA and an ANA. When a UNA is used in region 1 it is preferred that it be in the most downstream position from the 5’-end that is allowed by the Table. Abasic nucleosides preferably are joined to adjacent nucleosides by phosphorothioate linkages. 4. able to seqsiRNA and seqIMiR Antisense s: Same rules apply as for canonical or blunt-end architecture depending on whether or not there is a 3’-end overhang precursor.

. Applicable to seqMiR Antisense Strands: Same rules apply as for canonical or blunt-end architecture depending on whether or not there is a 3’-end overhang precursor.

K. Algorithms: Architectural Dependent - Forked-variant 1. Description: The -variant algorithm is the most radical solution to fulfilling the asymmetry rule for those seqRNAi architectures where it is important. Thus, its use is limited to being a supplemental variant of these architectures. It is applied to strands that will form seqRNAibased es where the asymmetry between the duplexed i is so severely the opposite of what is desired that it cannot be corrected by using the types of chemical modifications used to achieve nuclease resistance in accordance with the present invention.

Instead, it es interrupting the complementary base pairing n some or all of the terminal 6 nucleosides at the 3'-end of the sense strand with the 5'-end of the otherwise complimentary nse strand by introducing between 2 and 6 mismatches in the sense strand. Thus, the forked variant is an ion to the general rule that destabilizing modifications are not preferred between regions 2 and 3 as defined by Table 3. The specific thermodynamic considerations are discussed in more detail in the section by that name.

The application of the forked-variant architecture dependent algorithm to the rative seqsiRNA and seqMiR examples is provided in Indices 14 and 15 respectively.

Index 14 carries over the canonical architecture sense and antisense strands from Index 10. In the discussion of Index 8 it was pointed out the terminal duplex differential Tm for the seqsiRNA Mouse PTEN compounds serves the asymmetry rule well without any added modification. Nevertheless it is conceivable that a modest application of the forked variant could further boost the activity of this these highly related compounds. ingly, the AR in position 14 and the CR in position 16 of the sense strand are changed to CM and GR respectively.

Index 15 carries over the two duplexes from Index 11 using the canonical architecture as the example of an architecture where the asymmetry rule is applicable. These duplexes have already been adjusted for the asymmetry rule in Index 9 but conceivably could t r from having a greater ential between the two termini. Accordingly a second mismatch is introduced into position 17 of the sense strands counting from the 5’-end. 2. Applicable to seqRNAi Sense Strands that form a seqRNAi-based Duplex with their Partner Strand that has an Architecture where the try Rule is Important ularly when the Given Duplex is Too out of Alignment with the Rule to be Corrected by Less l Means: The complementary base pairing between some or all of the terminal 6 nucleosides at the 3'-end of the sense strand (exclusive of any overhang precursor) with the ponding nucleosides in the 5'-end of the antisense partner strand is interrupted by introducing between 2 and 6 mismatches in the sense strand.

L. Algorithms: Architectural Dependent - Small Internally ted 1. Description: The more general form of this architecture is characterized by the use of two short sense strands that are complementary to a single antisense . In the case of seqMiRs this arrangement can be reversed, i.e., there can be two short antisense strands that are complementary to a single sense strand. In either case these short strands are separated by no more than two nucleoside positions when they form a seqRNAi-based duplex with their partner . It is preferred that the short strands be immediately contiguouswhen duplexed with the partner strand. This can be achieved by simply omitting one e in what would ise be a single seqRNAi sense strand.

Further, the opposing termini of short strands as they appear in the duplex with the partner strand can be modified to prevent the possibility that they will be ligated in vivo. The hood of this occurring, however, has not been established. One method to prevent the possibility of RNA ligation is to use an inverted abasic residue (such as 3’-2’ or 3’-3’) at one of the ng termini or to have a one or two nucleoside separation between the short strands when they form a duplex with the partner strand.

For more general use in seqsiRNA and seqIMiRs this architecture has the effect of essentially eliminating the possibility that the d sense strand is loaded into RISC as the antisense strand. In the case of seqMiRs the use of two short antisense strands can ate any contribution of 3'-supplementary sites to mRNA target recognition. In instances where a 3'-supplementary site would otherwise be used, for example, this approach can be employed to restrict the range of targets being recognized particularly in cases when the restriction reduces the number of undesired targets.

The short size of the two sense or antisense strands can reduce their ty with the partner strand to the point that the resulting duplex is not ently stable. Often this can be compensated for by judiciously using modifications to the sense strand(s) that are particularly efficacious in increasing the affinity between them and the full-length partner strand.

Thermodynamic considerations are discussed in more detail in the section by that name.

The application of the small internally segmented ecture dependent thm to the illustrative seqsiRNA and seqMiR examples is provided in Indices 16 and 17 respectively.

The starting two sense and three antisense strands for the application of the small internally segmented ecture as shown in Index 16 come from Index 10. The sense strand only differed with respect to the presence or absence of overhang sors were divided into two strands by removing the linkage n nucleoside positions 9 and 10.

Next the nuclease resistance rules were applied to the two new termini. The Tms for each of these dual sense strands was determined using the nearest neighbor calculation followed by an adjustment for the chemical modifications. The final Tms were 51 degrees and 34 degrees for the sense strand forming a duplex with the 3’end of the antisense strand or the 5’-end of the antisense strand tively. To bring the second sense strand above the 40 degree lower limit and to make the Tms similar, the LNA modification was used in positions 4 and 7 counting from the 5’-end of the second sense strand.

In Index 17 the starting sense s for the application of this architecture are the sense strand with the wobble base pairings and mismatches removed in Index 9. If the design began with an endogenous miRNA with a bulge structure(s) this ure would also have been removed at the start of the ation of the small internally segmented architecture.

The two antisense s come from Index 11. One of these strands has a modification that inhibits AGO-2 tic activity while the other does not.

The sense strand is split between ons 10 and 11 as indicated by &. The calculated Tm for the unmodified dual sense strands is 32 or 39 and 42 degrees respectively for the strands with the single strand 5’-end and 3’-end. The basis for the alternative Tms for the sense strand with the former single sense strand 5’-end is the presence (Duplex #1) or absence (Duplex #2) of the abasic nucleoside in the antisense strand. The 3’-end nucleosides in each of the sense strands are modified and phosphorothioate linkages are added between nucleoside positions 8-9 and 9-10. These modifications are in keeping with the nuclease resistance rules and the preference for 2’methyl modifications in the terminal nucleoside where there is no overhang sor with based on a chemistry not ted in the duplex.The 5-end nucleoside in the antisense strand is change to a 2’-fluoro to meet the preference for 2’methyls to not be in both members of a complementary nucleoside pair.

The chemical modifications add about 5 degrees in Tm to each of the sense strands with their partner antisense . To increase the Tms for the two sense strands two LNA modifications are added to the first strand and one to the second.

Splitting the antisense strand in Index 17 into two strands at the 10-11 linkage does not alter the basic Tm calculations made for the dual sense strands since the deleted linkage in each case opposes the other. The single sense strand in Duplex 3 has the same LNA modifications and the switch of the AF for an AM at the terminal 3’-position and a switch in the UM in position11 for UF to accommodate the change in the complementary nucleoside in the antisense strand. In keeping with the nuclease resistance rules the A in position 10 s ethyl, the G in position 11 becomes 2’-fluoro and phosphorothioate linkages are inserted between positions 8-9 and 11-12 basing the count on a single antisense strand. 2. able to seqRNAi Sense Strands when Two Sense Strands are Used: a) It is ed that there be two sense s that are separated by no more than two nucleoside positions when they form a seqRNAi-based duplex with their r antisense strand but it is preferred that they be contiguous. An inverted abasic residue (such as 3’-2’ or 3’-3’) can be used to replace a nucleoside at one of the two termini that will be in opposition when the seqRNAi-based duplex is formed. b) The sequence of the s and their chemical modifications determine the Tm of each of the strands with the partner antisense strand. These factors must result in a minimum Tm of 40 degrees centigrade for each sense strand with the antisense strand under physiologic conditions with 50-65 degrees being preferred. It is also preferred the Tms for each of the sense strands with the partner antisense strand be at most only a few degrees apart. c) LNA(s) can be used in one or both sense strands, as needed, to stabilize the seqRNAi-based duplex under physiologic conditions with a m of three per strand. It is preferred that: (1) when there are two or three LNAs in a given strand that they be separated by at least one nucleoside that does not have the LNA modification; (2) LNAs not be in the first position at the 5’-end of the strand; (3) they not be in the terminal 3’-end position if the base is a uracil; and (4) ering the two sense strands as a single unit LNAs preferably are placed between the three regions explicitly defined by Table 3. d) A 2-thiouridine containing nucleoside can be used in place of LNA to boost interstrand binding affinity when the nucleoside in question has a uracil base and it forms a complementary base pair with an e containing nucleoside in the antisense strand. In such an instance the nature of any modifications to the sugar in this nucleoside will follow the relevant ectural independent rules provided herein. e) The sense strand undergoing complementary base pairing with the 5’-end of the antisense strand can have an overhang precursor. 3. Applicable to seqRNAi nse Strand when Two Sense Strands are Used: Can follow the rules relevant for the canonical, end or asymmetric architectures ing on the presence or absence of 5’ and/or 3’-end overhang precursors. A 2- 3-unit3’-end overhang precursor is preferred. 4. Applicable to seqsiRNA and seqIMiR Antisense Strands when Two Sense s are Used: Can follow the rules relevant for the canonical, blunt-end or asymmetric architectures depending on the presence or absence of 5’ and/or 3’-end overhang precursors. 5. Applicable to seqMiR Antisense Strand when Two Sense Strands are Used: Can follow the rules relevant for the canonical, blunt-end or asymmetric architectures depending on the presence or absence of 5’ and/or 3’-end overhang precursors. 6. Applicable to seqMiR Sense Strand when Two Antisense Strands are Used: a) The ce of the strands and their chemical modifications determine the Tm of the strand with the two partner antisense strands. These factors must result in a minimum Tm of 40 degrees centigrade for each antisense strand with the sense strand under physiologic conditions with 50-65 degrees being preferred. It is also preferred the Tms for each of the antisense strands with the partner sense strand be at most only a few degrees apart. b) LNA(s) can be used in one or both sense strands, as needed, to stabilize the i-based duplex under physiologic conditions with a maximum of three per strand. It is preferred that: (1) when there are two or three LNAs in a given strand that they be ted by at least one nucleoside that does not have the LNA modification; (2) LNAs not be in the first position at the 5’-end of the strand; (3) they not be in the terminal 3’-end position if the base is a uracil; and (4) considering the two sense s as a single unit LNAs are placed between the three regions explicitly defined by Table 3 if le. c) A 2-thiouridine containing nucleoside can be used in place of LNA to boost interstrand binding affinity when the nucleoside in question has a uracil base and it forms a complementary base pair with an adenine containing nucleoside in the antisense strand. In such an instance the nature of any modifications to the sugar in this nucleoside will follow the relevant architectural independent rules provided herein. d) The terminal 5’-end nucleoside preferably is ally modified, for example, by methylation to prevent its 5’ ribose on from being phosphorylated by endogenous enzymes. e) In other respects the sense strand will follow the design of the canonical or bluntend architectures depending on whether it has an overhang precursor or not. 7. Applicable to seqMiR Antisense Strands when Two are Used: a) It is required that there be two antisense s that are ted by no more than two nucleoside positions when they form a seqRNAi-based duplex with their partner sense strand but it is preferred that they be contiguous. An inverted abasic residue (such as 3’-2’ or 3’-3’) can be used to e a nucleoside at one of the two termini that will be in opposition when the seqRNAi-based duplex is formed. b) It can otherwise follow the rules relevant for the canonical or blunt-end architecture depending on the presence or absence of a 3’-end overhang precursor.

M. Algorithms: Architectural Dependent –seqRNAi Antisense Strand Based ss-RNAi 1. Description: A seqRNAi antisense strand based ss-RNAi has three general features: (1) it can be administered to a subject with out a carrier or g ; (2) a complementary partner sense strand is not administered to the same subject over a timeframe where both strands can combine in the subject’s cells; and (3) it es the intended silencing effect in cells in a subject. Such antisense s occur in three specific versions: ss-MiR, ss-IMiR and ss- siRNA depending on r the antisense strand functions as a miRNA mimic, miRNA inhibitor or a siRNA when loaded into RISC.

The application of the ss-RNAi architecture dependent algorithm to the illustrative sssiRNA and ss-MiR examples is provided in Indices 18 and 19 respectively.

Index 18 shows how the antisense strands shown in Index 10 can be adjusted for ss- siRNA use.

Index 19 shows es of several variants of a ss-MiR based on let-7i with and without potential AGO-2 catalytic activity prevented prophylactically and with and without modifications that increase the binding affinity of the seed sequence for its targets. The starting strands came from the antisense strands in Index 11 that illustrate the application of the canonical architecture. 3. Applicable to ss-RNAi a) The 5’-end nucleoside is phosphorylated at the 5’ ribose position. b) Preferably the strand is 16-20 nucleosides in length with a 2-3 unit overhang precursor for a total length of 18-23. Most preferred are ng precursors that have a relatively high affinity for the PAZ domain of RISC. These can be distinguished by their ability to extend the duration of the intended silencing activity. 4. Applicable to ss-siRNA and Rs: The nuclease resistance rules, the ial/preferred architecturally independent rules and the canonical or blunt ended rules appropriate to a seqsiRNA/seqIMiR antisense strand are applied. However, 2’-fluoro modifications are preferred over other modifications save ribose and save the overhang precursors if any. There are two exceptions as follows: (1) the use of a minimal number of 2’methyl modifications, if needed, to reduce activation of any unacceptable innate immune response; and (2) the use of an UNA in the seed regionand/or a 2’methyl in position 2 from the 5’-end to inhibit miRNA-like off target effects.

. Applicable to s: The nuclease resistance rules, the essential/preferred architecturally independent rules and the canonical or blunt ended rules riate to a seqMiR antisense strand are applied.

However, 2’-fluoro modifications are preferred over other modifications save ribose and save the overhang precursors if any. There are three exceptions as follows: (1) the use of a minimal number of ethyl modifications, if needed, to reduce tion of any unacceptable innate immune response; (2) the use of modifications such as LNA in the seed sequence to increase the seed duplex Tm; and (3) the use of the modifications ed herein to inhibit the catalytic activity of AGO-2 against nded RNA targets.

N. ng Precursors Overhangs in naturally occurring siRNA are typically complementary to their target RNA. Overhangs, however, appear to play little, if any, role in target recognition. The oldest and most used conventional siRNA architecture (canonical) for synthetic compounds is comprised of a 19-mer duplex with two deoxythymidine 3'-end ngs (dTdT) on both strands. These overhangs were selected because of their convenience and low cost. se resistant linkages to protect against the 3’ -end leases in biologic fluids commonly join the nucleosides in overhangs.

It was originally thought that overhangs were required for siRNA activity in all cell types and that they could be comprised of any native ribonucleoside or ibonucleoside without affecting activity. Subsequently, it was discovered that 3’-end overhangs were not required for siRNA ty in mammalian cells when it was shown siRNA with a blunt-end architecture is e of producing substantial silencing activity against the intended target.

Endogenous miRNAs have 3’-end overhangs that are generated during the processing of miRNA precursors to become ed miRNA that is ready for RISC loading. As for siRNA the overhangs in miRNA are not involved in recognizing the target. Instead the 3’-end antisense strand overhang in siRNA or miRNA has been shown to interact with the PAZ domain in the RNA binding pocket of RISC in a manner that prevents interaction with the target transcript. As a result of this interaction this 3’end ng can affect RISC loading and nse strand ion.

Variations in overhang design and chemistry, as well as the option of not using ngs, can be used to modulate the activity of seqRNAi compounds in commercially useful ways. For example, i treatments that sensitize cancers to other therapeutics (typically targeting molecules that inhibit apoptosis) would only be required to be active during the comparatively short period of time required for producing such sensitization. By limiting the duration of such an effect some possible side effects might be reduced or eliminated. In st, it would generally be advantageous to structure seqRNAi strands to produce a comparatively long silencing effect when treating chronic diseases such as diabetes or cardiovascular diseases such as atherosclerosis. In addition, particular overhang precursors and designs can be used to promote the selection of the desired antisense stand by RISC and/or to boost the peak silencing activity of the antisense strand/RISC complex as well as its duration.

Overhang precursors in seqRNAi can be of 1 to 4 nucleosides in length, can involve neither, either or both of the 3’-ends of a strand pair as well as the 5’-end of the antisense strand. 3'-end overhangs can have substantially different chemical modifications compared to the rest of the strand while 5'-end overhangs are based on the same nucleoside and linkage chemistries as the portion of the strand that forms a duplex with its partner strand.

The 3’-end overhang precursors in seqRNAi can be sed of any of the naturally occurring deoxyribonucleosides. In on, several groups have described variations in overhang design/chemistry that can affect the duration of the silencing effect of conventional siRNA. These same structures can be used as overhang precursors in seqRNAi strands.

Zhang et al., (Bioorganic & Medicinal Chemistry 17: 2441, 2009), for example, showed that two nucleoside 3'-end ngs with line rings replacing the ribose in both the sense and antisense strands or just the nse strands of conventional siRNA can result in a longer lasting silencing effect than the same siRNA with the standard dTdT overhangs. s et al., (Nucl Acids Res 38: 4788, 2010), in another example, found that the dTdT ngs were associated with a significantly reduced silencing period both in vitro and in vivo compared to the other overhang types tested. The latter consisted of the ing: two 2'methyl uridines; two 2'methyl modified nucleosides complementary to the RNA target; or unmodified ribonucleosides complementary to the RNA target. Differences in duration of effect were found to not be due to either a difference in IC50 values or to variable degrees of maximal target silencing. These data suggest that ribonucleosides may have a stronger binding to the PAZ domain than deoxyribonucleosides.

Numerous other 3'-end ng precursor chemistries can promote i ty and nuclease resistance. These include but are not limited to the following where the indicated nucleoside analog chemistries can be used with any of the normal bases: (1) 2' Methyl; (2) 2'-fluoro; (3) FANA; (4) 2'methyoxyethyl (5) LNA; (6) morpholino; (7) tricyclo-DNA (Ittig et al., Artif DNA, PNA & XNA 1: 9, 2010); (8) ribo-difluorotoluyl (Xia et al., ACS Chem Biol 1: 176, 2006); (9) 4'-thioribonucleotides (Hoshika et al., Chem Bio Chem 8: 2133, 2007); (10) 2'methyl-4'-thioribonucleotide (Takahashi et al., Nucleic Acids Res 37: 1353, 2009; Matsuda, Yakugaku Zasshi 131: 285, 2011); (11) altritol-nucleoside (ANA) (Fisher et al., Nucleic Acids Res 35: 1064, 2007); (12) cyclohexenyl-nucleoside (CeNA) (Nauwelaerts et al., J Am Chem Soc 129; 9340, 2007; (13) piperazine (US patent 675); and (14) 5-bis(aminoethyl) aminoethylcarbamoylmethyl-2'-deoxyuridine or 5- bis(aminoethyl) aminoethylcarbamoylmethyl-thymidine (Masud et al., Bioorg Med Chem Lett 21: 715, 2010).

The nucleosides used in overhang precursors in seqRNAi strands can be used in various combinations in 3'-end overhangs and are preferably joined er and to the adjacent non-overhang nucleoside by a se ant linkage such as orothioate, phosphonoacetate, thiophosphonoacetate, methylborane phosphine, amide, carbamate or urea (Sheehan et al., Nucleic Acids Res 31: 4109, 2003; Krishna & ers, J Amer Chem Soc 133: 9844, 2011; Iwase et al., Nucleic Acids Symposium Series 50: 175, 2006; Iwase et al., Nucleosides Nucleotides Nucleic Acids 26: 1451, 2007; Iwase et al., Nucleic Acids ium Series 53: 119, 2009; Ueno et al. Biochem Biophys Res Comm 330: 1168, 2005). In addition unmodified nucleosides can be used in overhangs when they are joined together using these linkages but preferably not orothioate with ribonucleosides.

These linkages can also be used in 5'-end overhangs but preferably the nucleosides are d to the following: (1) 2'Methyl; (2) 2'-fluoro; (3) FANA; and (4) RNA (native ribose). In the case of seqMiRs, however, such 5’-end cations have to be evaluated for their effects on what mRNAs will be targeted for silencing.

Further, 3'-end overhang precursors can be sed of certain hydrophobic aromatic moieties. For example, those that are comprised of one to three units containing two six membered rings joined by phosphodiester or one of the other es just listed where the unit(s) are attached to the ucleotide by the same linkage and when multiple units are used they are also joined by the same linkage. Two unit structures are preferred.

Suitable ring structures include benzene, pyridine, morpholine and piperazine (US patent 6,841,675). Structures based on the benzene and pyridine rings have been previously described for 3'-end overhang use in conventional siRNA by Ueno et al., (Bioorg Med Chem Lett 18:194, 2008; Bioorganic & Medicinal Chemistry 17: 1974, 2009). Specifically, these units are 1,3-bis(hydroxymethyl)benzene, 1,3-bis(hydroxymethyl)pyridine and 1,2- bis(hydroxymethyl)benzene. These are also suitable for seqRNAi use as overhang precursors.

In another example of possible non-nucleoside overhang precursors the aromatic es can be biaryl units where the linkages holding the units together and to the oligo are covalently attached to benzene rings where the benzene ring is further covalently attached to a non-bridging moiety selected from the group benzene, naphthalene, threne, and pyrene. Further, one such biaryl group may be attached to the 5'-end of the intended sense strand to substantially reduce the hood it will be selected as the antisense strand by RISC once the complementary seqRNAi strands form a duplex in cells. (Ueno et al., Nucleic Acids Symposium Series 53: 27, 2009; Yoshikawa et al., Bioconjugate Chem 22: 42, 2011) When these units are used as overhang precursors one to three units are red and two are most preferred.

In addition, the 3'-end overhangs, or lack thereof, can affect the distribution of seqRNAi-based duplexes between the cytoplasm and s. Individual i strands released into the asm and the duplexes formed by a seqRNAi strand pair can diffuse into the nucleus. Once in the nucleus individual seqRNAi strands can form seqRNAi-based duplexes and any duplexes that were formed in the cytoplasm that subsequently diffused into the nucleus can be expelled from the nucleus by Exportin-5 (Exp-5). This activity of Exp-5 can be rate-limiting for silencing activity at low doses of duplexes. Exp-5 binds to the first two nucleosides or their analogs in any 3'-end overhang(s) while possibly binding more weakly to the ed portion. Thus, seqRNAi strands designed to have 3'-end overhang precursors comprising nucleosides have a potential advantage over seqRNAi strands that do not have overhang precursors because they can produce a greater duplex presence in the cytoplasm particularly at lower seqRNAi concentrations. Finally, the nature of the 3’-end overhang precursors, if any, affects the l and regional interstrand affinities of seqRNAibased duplexes. This topic is discussed in the section dealing with thermodynamics.

O. Methods of stration of the single strand oligo compounds of the Invention A major age of the present invention in effecting RNAi is that many of the modifications described employ chemistries commonly used in conventional antisense oligos where the pharmacology and toxicology of the compounds is already largely understood described in the ture. References that summarize much of pharmacology for a range of ent types of oligo therapeutics includes the following: Antisense Drug Technology: Principles, gies, and Applications, 2nd ed., Stanley T. Crooke (ed.) CRC Press July 2007; Encyclopedia of Pharmaceutical Technology, - 6 Volume Set, J Swarbrick (Editor) 3rd edition, 2006, Informa HealthCare; Pharmaceutical Perspectives of Nucleic Acid-Based Therapy, RI Mahato and SW Kim (Editora) 1 edition, 2002, CRC press; Pharmaceutical s of Oligonucleotides, P ur and C Malvy rs) 1st edition, 1999, CRC press; Therapeutic Oligonucleotides (RSC Biomolecular Sciences) (RSC Biomolecular Sciences) (Hardcover) by Jens Kurreck (Editor) Royal Society of Chemistry; 1 edition, 2008, CRC press; Clinical Trials of Genetic Therapy with nse DNA and DNA Vectors, E Wickstrom (Editor) 1st edition, 1998, CRC press.

The fact the compounds of the present ion are sequentially delivered does add an additional complication. There must be a long enough period between the administration of the first strand and the second for cells to have taken up most of the first strand. The periods of time involved have been worked out for conventional antisense oligos and can be applied here. For example, when these compounds are infused into the circulation the clearance time half-life from the plasma to the tissues is about 20 minutes. Thus, after one hour most of the compound is in the tissues. The tissue retention time s on dose but within the dose range commonly used to treat subjects the tissue retention can be measured in days or weeks. The nd in the tissues is distributed between a bioavailable form and a unavailable form, but it is clear the former can exist at effective levels for days or weeks based on the protracted suppression of the target in tissues.

It follows, therefore, that the seqRNAi compounds of the present invention will be given to subjects in the dose range established for conventional antisense oligos and that the spacing between the two strands for i.v. or i.a. administration will range from about one hour to a week, but 4 hours to 24 hours between strand administrations is preferred. For most systemic in vivo purposes stration of a strand over one hour at an infusion rate of up to 6 mg/kg/h is appropriate.

The timing of strand administration i.v. or i.a. can also serve for a number of other strative routes where the nds are juxtaposed to the target tissue such as i.p., hecal, intraocular and intravesical. The treatment regimens will for the seqRNAi compounds will also mirror those used for tional antisense oligos. For the ss-RNAi compounds of the t invention the sequential delivery related issues do not apply so they can be fully treated like conventional nse oligos.

In certain embodiments, (e.g., for the treatment of lung disorders, such as pulmonary fibrosis or asthma or to allow for self administration for local or systemic es) it may desirable to deliver the oligos described herein in aerosolized form. A pharmaceutical composition comprising at least one oligo can be administered as an aerosol ation that contains the oligos in dissolved, suspended or emulsified form in a propellant or a mixture of solvent and propellant. The aerosolized formulation is then administered through the respiratory system or nasal passages.

An l formulation used for nasal administration is lly an aqueous solution designed to be administered to the nasal passages as drops or sprays. Nasal solutions are generally prepared to be similar to nasal secretions and are generally isotonic and slightly buffered to maintain a pH of about 5.5 to about 6.5, although pH values outside of this range can also be used. Antimicrobial agents or preservatives can also be included in the formulation.

An aerosol ation for use in inhalations and inhalants is designed so that the oligos are d into the respiratory tree of the patient. See (WO 01/82868; WO 01/82873; WO 01/82980; WO 02/05730; WO 02/05785. Inhalation solutions can be administered, for example, by a nebulizer. Inhalations or insufflations, comprising finely powdered or liquid drugs, are delivered to the respiratory system as a pharmaceutical aerosol of a solution or suspension of the drug in a lant.

An aerosol formulation generally contains a propellant to aid in disbursement of the oligos. Propellants can be liquefied gases, including halocarbons, for e, fluorocarbons such as fluorinated chlorinated hydrocarbons, hydrochlorofluorocarbons, and hydrochlorocarbons as well as hydrocarbons and hydrocarbon ethers (Remington's Pharmaceutical Sciences 18th ed., Gennaro, A.R., ed., Mack Publishing Company, Easton, Pa. (1990)).

Halocarbon propellants useful in the invention e fluorocarbon propellants in which all hydrogens are replaced with fluorine, hydrogen-containing fluorocarbon propellants, and en-containing chlorofluorocarbon propellants. Halocarbon propellants are described in Johnson, U.S. Pat. No. 5,376,359, and Purewal et al., U.S. Pat.

No. 5,776,434. arbon propellants useful in the invention include, for example, propane, isobutane, n-butane, pentane, isopentane and neopentane. A blend of arbons can also be used as a propellant. Ether propellants include, for example, dimethyl ether as well as numerous other ethers.

The oligos can also be dispensed with a compressed gas. The compressed gas is generally an inert gas such as carbon dioxide, nitrous oxide or nitrogen.

An aerosol ation of the invention can also n more than one propellant. For example, the aerosol formulation can contain more than one propellant from the same class such as two or more fluorocarbons. An l formulation can also contain more than one propellant from different classes. An aerosol formulation can contain any combination of two or more propellants from different classes, for example, a fluorohydrocarbon and a hydrocarbon.

Effective aerosol formulations can also e other components, for example, ethanol, isopropanol, propylene glycol, as well as surfactants or other components such as oils and detergents (Remington's Pharmaceutical Sciences, 1990; Purewal et al., U.S. Pat. No. ,776,434). These l components can serve to stabilize the formulation and lubricate valve components.

The aerosol formulation can be packaged under pressure and can be formulated as an aerosol using solutions, sions, emulsions, powders and semisolid preparations. A solution aerosol consists of a solution of an active ingredient such as oligos in pure propellant or as a mixture of propellant and solvent. The solvent is used to dissolve the active ingredient and/or retard the evaporation of the lant. Solvents useful in the invention include, for example, water, ethanol and glycols. A on aerosol contains the active ingredient peptide and a propellant and can include any combination of solvents and preservatives or antioxidants.

An aerosol formulation can also be a dispersion or suspension. A suspension aerosol formulation will generally contain a suspension of an effective amount of the oligos and a dispersing agent. Dispersing agents useful in the invention include, for example, sorbitan trioleate, oleyl l, oleic acid, lecithin and corn oil. A suspension aerosol ation can also include lubricants and other aerosol components.

An l formulation can similarly be formulated as an emulsion. An emulsion can include, for example, an alcohol such as ethanol, a surfactant, water and propellant, as well as the active ingredient, the . The surfactant can be nonionic, anionic or cationic. One example of an emulsion can include, for example, ethanol, surfactant, water and propellant. Another e of an on can include, for example, vegetable oil, glyceryl monostearate and propane.

Oligos may be formulated for oral delivery (Tillman et al., J Pharm Sci 97: 225, 2008; Raoof et al., J Pharm Sci 93: 1431, 2004; Raoof et al., Eur J Pharm Sci 17: 131, 2002; US 6,747,014; US 2003/0040497; US 2003/0083286; US 2003/0124196; US 2003/0176379; US 2004/0229831; US 2005/0196443; US 2007/0004668; US 2007/0249551; WO 02/092616; WO 03/017940; WO 03/018134; WO 99/60012). Such ations may incorporate one or more permeability enhancers such as sodium caprate that may be incorporated into an enteric-coated dosage form with the oligo.

There are also delivery mechanisms applicable to oligos with or without rs that can be applied to particular parts of the body such as the CNS. These include the use of convection-enhanced delivery methods such as but not limited to intracerebral clysis (convection-enhanced microinfusion into the brain – Jeffrey et al., Neurosurgery 46: 683, 2000) to help deliver the cell-permeable carrier/NABT x to the target cells in the CNS as described in .

Drug delivery mechanisms based on the exploitation of so-called leverage-mediated uptake mechanisms are also suitable for the practice of this invention (Schmidt and Theopold, Bioessays 26: 1344, 2004). These mechanisms involve targeting by means of e adhesion molecules (SAMs) such as tetrameric lectins, linked membrane-anchored molecules (MARMs) around lipoproteins or bulky hinge les leveraging MARMs to cause a local inversion of the cell membrane curvature and formation of an internal endosome, lysosome or phagosome. More specifically leverage-mediated uptake involves lateral clustering of MARMs by SAMs thus generating the configurational energy that can drive the reaction towards internalization of the oligo carrying complex by the cell. These compositions, methods, uses and means of production are provided in .

As for many drugs, dose schedules for ng patients with oligos can be readily extrapolated from animal studies. The extracellular concentration that must be generally achieved with highly active conventional antisense or complementary sense and antisense oligos for use in the two-step method is in the 1-200 nanomolar (nM) range. Higher extracellular levels, up to 1.5 micromolar, may be more appropriate for some applications as this can result in an increase in the speed and the amount of the oligos driven into the tissues.

Such levels can readily be achieved in the plasma.

For in vivo applications, the concentration of the oligos to be used is readily calculated based on the volume of physiologic ed-salt solution or other medium in which the tissue to be d is being bathed. With fresh , 1-1000 nM ents the concentration extremes needed for oligos with moderate to excellent activity. Two hundred nanomolar (200 nM) is a generally serviceable level for most applications. With most cell lines a r will typically be needed for in vitro administration. tion of the tissue with the oligos at 5% rather than atmospheric (ambient) oxygen levels may improve the results significantly.

Pharmacologic/toxicologic studies of phosphorothioate , for example, have shown that they are tely stable under in vivo conditions, and that they are y taken up by all the tissues in the body following ic administration with a few exceptions such as the central nervous system (Iversen, Anticancer Drug Design 6:531, 1991; Iversen, Antisense Res. Develop. 4:43, 1994; Crooke, Ann. Rev. Pharm. Toxicol. 32: 329, 1992; Cornish et al., Pharmacol. Comm. 3: 239, 1993; Agrawal et al., Proc. Natl. Acad. Sci. USA 88: 7595, 1991; Cossum et al., J. Pharm. Exp. Therapeutics 269: 89, 1994). These compounds readily gain access to the tissue in the central nervous system in large amounts following injection into the cerebral spinal fluid (Osen-Sand et al., Nature 364: 445, 1993; Suzuki et al., Amer J. Physiol. 266: R1418, 1994; Draguno et al., eport 5: 305, 1993; Sommer et al., Neuroreport 5: 277, 1993; Heilig et al., Eur. J. Pharm. 236: 339, 1993; Chiasson et al., Eur J. Pharm. 227: 451, 1992). Phosphorothioates per se have been found to be relatively non-toxic, and the class specific adverse effects that are seen occur at higher doses and at faster infusion rates than is needed to obtain a therapeutic effect with a well- chosen sequence. In addition to providing for nuclease resistance, one potential advantage of phosphorothioate and boranophosphate linkages over the odiester linkage is the promotion of binding to plasma proteins and albumin in particular with the resulting effect of an increased plasma half-life. By retaining the oligo for a longer period of time in plasma the oligo has more time to enter tissues as opposed to being excreted by the kidney. Oligos with primarily or exclusively phosphodiester linkages have a plasma half-life of only a few minutes. Thus, they are of little use for in vivo applications when used without a carrier. In the case of oligos with a preponderance of or exclusively phosphodiester es, plasma protein binding can be improved by covalently attaching the oligo a molecule that binds a plasma protein such as serum n. Such molecules include, but are not limited to, an arylpropionic acid, for example, ibuprofen, suprofen, ketoprofen, pranoprofen, tiaprofenic acid, naproxen, flurpibrofen and carprofen (US 6,656,730). As for other es that might be linked to the oligos suitable for use with the present invention the preferred site is the 3’- end of the oligo. Intravenous strations of oligos can be continuous for days or be administered over a period of minutes depending on the particular oligos and the medical indication. Phosphorothioate-containing oligos have been tested containing 18 nucleotides (e.g., oblimersen) to 20 nucleotides (e.g., cenersen, orsen, aprinocarsen, ISIS 14803, ISIS 5132 and ISIS 2503) in length. When so administered such oligos show an alpha and a beta phase of elimination from the plasma. The alpha phase oligo half-life is 30 to 60 minutes while the beta phase is longer than two weeks for oligos with both orothioate linkages and 2’-0 substitutions in at least the terminal four nucleosides on each end of the oligo.

The most ent toxicities associated with intravenous administration of orothioates have been related to the chemical class and generally independent of the mRNA target sequence and, therefore, independent of hybridization. The observed and measured toxicities have been consistent from drug to drug pre-clinically and clinically, with non-human primates being most similar to humans for certain key toxicities.

The class-related toxicities that have been most compelling in choosing dose and schedule for pre-clinical and clinical evaluation occur as a function of binding to ic plasma proteins and include transient inhibition of the clotting cascade and activation of the complement cascade. Both of these toxicities may be d to the polyanionic nature of the les.

The effect of phosphorothioates on the clotting e results in plasma tration-related prolongation of the activated partial thromboplastin (aPPT) time.

Maximum prolongation of the aPTT correlates closely with the maximum plasma concentration so doses and schedules that avoid high peak trations can be selected to avoid significant effects on the aPTT. Because the plasma half-life of these drugs is short (30 to 60 minutes), the effect on clotting is transient. Several of these drugs have been evaluated in the clinic with prolonged intravenous infusions lasting up to 3 weeks. r IV infusions (e.g., 2 hours) have also been studied. For example, aprinocarsen (ISIS 3521) and ISIS 5132 were studied with both 2 hour and 3-week continuous infusion schedules. At a dose of 3 mg/kg/dose over 2 hours, transient prolongation of the aPTT was observed. When 3 mg/kg was given daily by continuous infusion for 21 days, there was no effect on aPTT.

The effect of nse molecules of this chemical class on the clotting cascade is consistent.

Similarly, the activation of complement is a consistent observation; however, the relationship between plasma concentration of oligonucleotides and complement activation is more complex than the effect on clotting. Also, while the effect on clotting is found in rats as well as monkeys, the effect on the complement cascade has only been ed in monkeys and humans.

When these drugs are given to cynomolgus monkeys by 2-hour infusion, increases in complement split products (i.e., C3a, C5a, and Bb) occur only when plasma concentrations exceed a threshold value of 40-50 mg/mL. In monkeys, there is a low incidence of vascular collapse associated with increases in these proteins. For the most part, clinical investigations of orothioates have been designed to avoid these high plasma concentrations.

When ISIS 3521 was given as a weekly 24 hour infusion at doses as high as 24 mg/kg (1 mg/kg/hour x 24 hours), the steady state plasma concentrations reached imately 12 mg/mL at the high dose. On this schedule, however, there were substantial increases in C3a and Bb even though these plasma levels were much lower than those seen with the shorter infusions. Thus, activation of complement may be associated with both dose and le where plasma trations that are well tolerated over shorter periods of time (e.g. 2 hours), are associated with toxicity when the plasma trations are ined for longer. This likely provides the explanation for the findings with cenersen in rhesus monkeys where complement activation was observed at concentrations of 14-19 mg/mL.

When ISIS 3521 was given at 1.0 and 1.25 mg/kg/hour x 2 hours, the mean peak plasma concentrations were 11.1+0.98 and 6.82+1.33 μg/mL, respectively. There was no complement activation at these or other higher doses and no other safety issues. It is expected that the maximum peak plasma concentrations for similarly sized phosphorothioate given at 1.2 hour x 1 hour would be similar to that ed with ISIS 3521.

Thus, limiting infusion rates for orothioates to 3.6 mg/kg/h or less is highly preferred. With somewhat higher infusion rates the effects of complement activation can be expected. Decisions made about the sequential shortening of the infusion below one hour using a constant total dose of approximately 22 mg/kg should be readily achieved based on review of the safety information, including evaluation of complement split products.

The following examples are provided to illustrate certain embodiments of the present invention. They are not intended to limit the invention in any way.

EXAMPLE I APPLICATIONS FOR seqsiRNA The seqsiRNA genes targeted for silencing are shown in Table 6 and in the examples.

They are not meant to provide an exhaustive set of illustrations of how the designs presented herein can be d in general or in particular. One skilled in the art can readily use the design principles and the examples provided herein to arrive at a very limited set of compounds that can be generated in ance with the present invention using any given gene target in a subject.

TABLE 6 EXAMPLES OF COMMERCIAL APPLICATIONS FOR NA INHIBITORS FOR ILLUSTRATIVE GENE TARGETS MEDICAL CONDITIONS TO BE TREATED OR OTHER GENE TARGET COMMERCIAL OBJECTIVES FOR seqsiRNA p53 INHIBITORS Atherosclerosis; tive heart failure; Familial hypercholesterolemia; Statin Apoliprotein B (Apo B) resistant hypercholesterolemia; HDL/LDL cholesterol imbalance; dyslipidemias; ed hyperlipidemia; Coronary artery disease; Thrombosis Myocardial tion; Fatty liver disease; ant hepatitis; Cirrhosis of the liver; Alcoholic hepatitis; Cholestatic liver injury; Acute liver failure; Cystic FAS/APO-1 fibrosis; Systemic lupus erythematosus; Arthritis; Parkinson’s Disease; (CD-95; Tnfrsf6) Autoimmune diabetes; l nervous system injuries, inating es; Stroke; Chemotherapy-induced neuropathy; Neurodegenerative diseases; Spinal cord injury; Ischemia –reperfusion injury p53 Sensitize cancers with wild type p53 to cytotoxic therapies; Cancers with mutant p53; Sensitize cancers with mutant p53 to the induction of apoptosis by anyapoptosis inducer; Stem cell quiescence including malignant stem cells (expand normal stem cells and progeny or put malignant stem cells in cycle so they can be attacked by cell cycle dependent anti-cancer agents; Heart failure; Medical conditions where sis is promoted; Inhibiting sis in nonmalignant stem cells; Huntington’s disease; Diamond-Blackfan syndrome; Shwachman Diamond Syndrome and other disorders involving defective ribosomes and/ or imbalances in ribosomal components (ribosomopathies); Fatty liver disease; Stress induced immunosuppression; lae associated with chnoid hemorrhage; Pathologic hyperpigmentation; Hyperkeratosis; Toxic effects of cancer chemotherapy and radiation including but not limited to the following: hair loss, tis, myelosupression, hearing loss, peripheral nerve damage, ed brain function and kidney damage; Inflammatory bowel disease; Crohn’s disease; ARDS; Multiple organ failure; Sensitize cancers to cytotoxic treatments dependent on cell proliferation and/or DNA replication; Amyloid deposition; Neurodegenerative diseases; Ischemia-reperfusion injury; Avoidance of effects of xic therapy due to quiescence of malignant stem cells; Reduced expansion of non-malignant tissue due to stem cell quiescence; Prevent demyelination; Multiple sclerosis; Alzheimer’s Disease; Parkinson’s disease; Prevent cell death associated with diabetic ischemia; Spontaneous apoptosis, cell cycle arrest, ence and differentiation in stem cells including embryonic stem cells and iPS such as reduces the efficiency of preparing such cells for transplantation organ generation, the generation of animals or for use in ific research; Prevent cell death associated with cerebral ischemia; Prevent cell death associated with myocardial infarction including uent heart wall rupture; Schizophrenia; Psoriasis; AIDS; Prevent rupture of atherosclerotic plaques; Prevent aneurysm rupture; Graft vs host disease; Systemic lupus erythematosus; Promote healing of hard to heal wounds; Capillary leak syndrome; Emphysema; Reduce enodosomal, lysosomal or phagosomal sequestration of oligo therapeutics with the effect of increasing their biologic activity; Promote proliferation of stem cells such as hematopoietic or neural; Diabetes mellitus including insulin resistant diabetes; 5q- syndrome; Porokeratosis; Ferritin induced cell death such as occurs in iron overload; Anemia; Dyskeratosis congentia including that form with telomerase insufficiency; Prevent emphysema; Prevent COPD; Insulin resistance in heart failure Atherosclerosis; Hypercholesterolemia; Statin resistant hypercholesterolemia; PCSK9 HDL/LDL terol imbalance; dyslipidemias; Acquired hyperlipidemia; (NARC-1) ry artery e Cancers with mutated p53; te cell proliferation including poietic PTEN stem and progenitor cells; Increase efficiency of gene er including into (MMAC1; TEP1) hematopoietic stem and progenitor cells; Nerve cell regeneration PTP-1B Insulin resistance; Type II Diabetes Stat3 Cancer, Autoimmune disease A. Compounds for Down-regulating p53 Expression p53 is involved in the regulation of a variety of cellular ms including those involving stem cell self-renewal, cellular proliferation and viability such as proliferation, differentiation, apoptosis, senescence, mitotic catastrophe and autophagy. Indices 24-30, 61 and 62 provide compounds suitable for use in accordance with the present invention.

The pathological expression or failure of expression of such ms, and the death programs in particular, underlie many of the morbidities associated with a wide variety of medical conditions where blocking p53 function can prevent much if not all of such morbidity.

In cancer, for e, both wild type and mutant p53 play key roles in tumor maintenance that include increasing the threshold for the ion of programs that can lead to the death of the cancer cells. Typically the use of a p53 inhibitor, such as a siRNA directed to the p53 gene target, in combination with an inducer of a cell death program, such as a DNA damaging agent, can be used to promote the death of cancer cells. At the same time inhibition of p53 protects many normal tissues from the toxic s of many such second agents including herapy and radiation.

Further, the present inventor has found that Boron Neutron e Therapy (BNCT) can be used in combination with ss-siRNA, double stranded siRNA or conventional antisense oligos that inhibit p53 (such as but not limited to those described in PCT/US09/02365) as a method for treating cancer (Brownell et al., “Boron Neutron Capture Therapy” In; “Therapy of Nuclear ne,” RP Spencer (ed), Grune and Stratton, NY, 1978; Barth et al. Cancer Res 50: 1061, 1990; Summers and Shaw, Curr Med Chem 8: 1147, 2001). Specifically, the 10B atom undergoes fission to generate 7Li and energetic alpha (helium) particles following capturing a thermal neutron. Within their 10-14mm path, such particles cause DNA and other types of damage that enhance apoptosis and other inactivating effects on cancer cells when wild type or mutated p53 is inhibited.

The use of conventional antisense oligos which function using an RNAse H mechanism of action and ed to the p53 gene target have been studied in vitro and in patients. These oligos have been shown to promote the anti-cancer effects of certain conventional treatments and to protect normal tissues from genome damaging agents. Few cell types, with the exception of stem cells, s sufficient levels of RNase H to support tional antisense oligos dependent on this enzyme for their activity. Consequently, RNAi directed to the p53 gene target which are not dependent on RNAse H ty for function offer the potential advantage of being active in vivo in a broader range of cell types while still being catalytic. As for RNAi, generally this potential is severely limited by the well known problems associated with the poor uptake of conventional siRNA uptake in vivo and the lack of carriers that can broadly address this problem.

Molitoris et al. (J Am Soc Nephrol 20: 1754, 2009) ts data showing that tional siRNA directed to the p53 gene target can attenuate cisplatin induced kidney damage in rats. The siRNA described was a blunt ended 19-mer with alternating 2’ methy/native ribose nucleosides. A carrier was not needed because the proximal tubule cells in the kidney are both a major site of kidney injury associated with ischemia or nephrotoxicity such as that caused by cisplatin and is the site of oligo reabsorption by the kidney. Thus, this carrier free approach with conventional siRNA is of very limited use for preventing the pathologic effects of p53-dependent programs that kill cells or otherwise incapacitate them, but it does illustrate the potential usefulness of inhibiting p53 for this medical indication.

Zhao et al. (Cell Stem Cell 3: 475, 2008) trated that inhibiting p53 expression with siRNA can be used to enhance the production of iPSC. Human fibroblasts, for example, were ted to iPSC by using sion vectors for several genes to gain their expression in the cells. The efficiency of iPSC production was very low but was increased approximately two logs when shRNA directed to the p53 gene target was installed in the cells using a iral . The approach bed herein provides the means to transiently suppress p53 compared to the long term suppression ed by shRNA. This is important when the iPSC are to be induced to differentiate into particular cell type such as would be needed in tissue repair applications. As described herein the two-step administration approach combined with the linkage of a short cell penetrating peptide (CPP) to each strand provides an ent way to obtain RNAi activity in stem cells in vitro with minimal carrier related toxicity.

RNAi compounds directed to the human p53 gene target that can be reconfigured for use in the two-step method provided by the present invention are found in , US 2009/0105173 and US 2004/0014956.

Table 6 lists a variety of disorders that would benefit with treatment of the p53 directed compounds described herein. For example, heart failure is a s condition that results from various cardiovascular diseases. p53 plays a significant role in the development of heart failure. Cardiac angiogenesis directly related to the maintenance of c function as well as the pment of cardiac hypertrophy induced by pressure-overload.

Upregulated p53 d the tion from cardiac hypertrophy to heart failure through the suppression of hypoxia inducible factor-1(HIF-1), which tes angiogenesis in the hypertrophied heart. In addition, p53 is known to promote sis, and apoptosis is thought to be involved in heart failure. Thus, p53 is a key molecule that triggers the development of heart failure via multiple mechanisms.

Accordingly, the p53 directed compounds of the ion can be employed to diminish or alleviate the pathological symptoms associated with cardiac cell death due to apoptosis of heart cells. Initially the compound(s) will be incubated with a cardiac cell and the ability of the oligo to modulate p53 gene function (e.g., reduction in production p53, apoptosis, improved cardiac cell signaling, Ca++ ort, or morphology etc.) can be assessed. For example, the H9C2 cardiac muscle cell line can be obtained from American Type e Collection (Manassas, VA, USA) at passage 14 and cultured in DMEM complete culture medium (DMEM/F12 supplemented with 10% fetal calf serum (FCS), 2 mM α-glutamine, 0·5 mg/l Fungizone and 50 mg/l gentamicin). This cell line is suitable for terizing the inhibitory functions of the p53 directed compounds of the invention and for characterization of modified versions thereof. HL-1 cells, described by Clayton et al. (1998) PNAS 95:2979-2984, can be edly passaged and yet in a cardiac-specific phenotype. These cells can also be used to further characterize the s of the oligos described herein.

It appears that expression of the apoptosis regulator p53 is governed, in part, by a molecule that in mice is termed murine double minute 2 (MDM2), or in man, human double minute 2 (HDM2), an E3 enzyme that targets p53 for ubiquitination and proteasomal processing, and by the deubiquitinating enzyme, herpesvirus-associated ubiquitin-specific protease (HAUSP), which rescues p53 by removing ubiquitin chains from it. Birks et al.

(Cardiovasc Res. 2008 Aug 1;79 (3):472-80) examined whether elevated expression of p53 was ated with dysregulation of ubiquitin-proteasome system (UPS) components and activation of downstream effectors of sis in human dilated cardiomyopathy (DCM). In these studies, left ventricular myocardial samples were obtained from patients with DCM (n = 12) or from non-failing (donor) hearts (n = 17). Western blotting and immunohistochemistry revealed that DCM tissues contained elevated levels of p53 and its regulators HDM2, MDM2 or the gs f found in other species, and HAUSP (all P < 0.01) compared with non-failing hearts. DCM tissues also contained elevated levels of polyubiquitinated proteins and possessed enhanced 20S-proteasome chymotrypsin-like ties (P < 0.04) as measured in vitro using a fluorogenic substrate. DCM s contained activated caspases 9 and 3 (P < 0.001) and reduced expression of the caspase ate PARP-1 (P < 0.05). Western blotting and histochemistry ed that DCM tissues ned elevated expression levels of caspaseactivated DNAse (CAD; P < 0.001), which is a key effector of DNA fragmentation in sis and also contained elevated expression of a potent inhibitor of CAD (ICAD-S; P < 0.01). These investigators concluded that expression of p53 in human DCM is associated with dysregulation of UPS components, which are known to regulate p53 stability. Elevated p53 expression and caspase activation in DCM was not associated with activation of both CAD and its inhibitor, ICAD-S. These findings are consistent with the concept that apoptosis may be upted and therefore potentially reversible in human HF.

In view of the foregoing, it is clear that the p53 directed compounds provided herein should exhibit efficacy for the treatment of heart failure. Accordingly, in one embodiment of the invention, p53 directed compounds are administered to patients to t c cell apoptosis, thereby reducing the incidence of heart failure.

Cellular transformation during the development of cancer involves multiple alterations in the normal n of cell growth regulation and dysregulated transcriptional control. Primary events in the process of carcinogenesis can involve the activation of oncogene function by some means (e.g., amplification, mutation, chromosomal rearrangement) or altered or nt expression of transcriptional regulator functions, and in many cases the removal of anti-oncogene function. One reason for the enhanced growth and invasive properties of some tumors may be the acquisition of increasing numbers of mutations in oncogenes and anti-oncogenes, with cumulative effect (Bear et al., Proc. Natl.

Acad. Sci. USA 86:7495-7499, 1989). Alternatively, insofar as oncogenes function h the normal cellular ing pathways required for organismal growth and cellular on (reviewed in McCormick, Nature 363:15-16, 1993), onal events corresponding to mutations or deregulation in the nic signaling pathways may also contribute to tumor malignancy (Gilks et al., Mol. Cell Biol. 13:1759-1768, 1993), even though ons in the signaling pathways alone may not cause cancer. p53 provides a powerful target for efficacious anti-cancer agents. Combination of the p53 directed compounds with one or more therapeutic agents that promote apoptosis effectively induces cell death in cancer cells. Such agents include but are not limited to conventional chemotherapy, radiation and biologic agent such as monoclonal antibodies and agents that manipulate hormone pathways. p53 protein is an important transcription factor which plays a central role in cell cycle tion mechanisms and cell proliferation control. Baran et al. performed studies to fy the expression and localization of p53 protein in lesional and non-lesional skin samples taken from psoriatic ts in comparison with healthy controls (Acta Dermatovenerol Alp Panonica . ( 2005) 83). Sections of psoriatic lesional and non-lesional skin (n=18) were examined. A control group (n=10) of healthy volunteers with no al and family history of psoriasis was also examined. The expression of p53 was demonstrated using the avidin-biotin complex immunoperoxidase method and the monoclonal antibody DO7. The count and localization of cells with stained nuclei was evaluated using a light microscope in 10 fields for every skin biopsy. In lesional psoriatic skin, the count of p53 ve cells was significantly higher than in the skin samples taken from healthy individuals (p<0.01) and non-lesional skin taken from psoriatic patients (p=0.02). No significant difference between non-lesional psoriatic skin and normal skin was observed (p=0.1). A strong positive correlation between mean count and mean per cent of p53 positive cells was found (p<0.0001). p53 positive cells were located most commonly in the basal layer of the epidermis of both healthy skin and non-lesional psoriatic skin. In lesional psoriatic skin p53 positive cells were present in all layers of the epidermis. In view of these data, it is clear that p53 protein appears to be an important factor in the pathogenesis of psoriasis. ingly, compounds which effectively down te p53 expression in the skin used alone or in combination with other agents used to treat psoriasis should alleviate the symptoms of this painful and unsightly disorder.

B. Compounds for Down-regulating Fas (Apo-1 or CD95) sion Fas (APO-1 or CD95) is a cell e or that controls a y leading to cell death via apoptosis. This pathway is involved in a number of medical conditions where ng fas function can provide a clinical benefit. See Table 6. Fas-mediated apoptosis, for example, is a key contributor to the pathology seen in a broad spectrum of liver diseases where inhibiting hepatocyte death can be life saving. Indices 22 and 31-35 provide novel compositions of matter that include many of the features heretofore described for increasing cellular uptake and/or stability for down modulating fas expression in target cells.

Lieberman and her associates have studied the effects of siRNA directed to the murine fas receptor gene target in murine models of fulminant hepatitis and renal ischemiareperfusion injury (Song et al., Nature Med 9: 347, 2003; Hamar et al., Proc Natl Acad Sci USA 101: 14883, 2004). siRNA delivered by a ynamic transfection method showed that such siRNA protects mice from concanavalin A generated hepatocyte apoptosis as evidenced by a reduction in liver fibrosis or from death associated with injections of a more hepatotoxic fas specific antibody. In the second study, siRNA was shown to protect mice from acute renal failure after clamping of the renal .

RNAi compounds directed to the human fas (apo-1 or CD95) receptor or ligand gene target are provided in , US 2005/0119212, and US 2008/0227733.

Recently, Feng et al. reported that during myocardial ischemia, cardiomyocytes can o apoptosis or compensatory hypertrophy (Coron Artery Dis. 2008 Nov;19(7):527-34).

Fas expression is upregulated in the myocardial ischemia and is d to both apoptosis and hypertrophy of cardiomyocytes. Some reports suggested that Fas might induce myocardial hypertrophy. Apoptosis of ischemic cardiomyocytes and Fas expression in the nonischemic myocytes occurs during the early stage of ic heart failure.

Hypertrophic cardiomyocytes easily undergo apoptosis in response to ischemia, after which apoptotic cardiomyocytes are replaced by fibrous tissue. In the late stage of ischemic heart e, hypertrophy, apoptosis, and fibrosis are thought to accelerate each other and might thus form a vicious circle that eventually results in heart failure. Based on these observations, it is clear that Fas directed compounds provide useful therapeutic agents for ameliorating the pathological effects associated with myocardial ischemia and hypertrophy.

Accordingly, fas directed oligos will beadministered cardiac cells and their effects on apoptosis assessed. As discussed above, certain modifications of the fas ed compounds will also be assessed. These include conjugation to heart homing peptides, inclusion of CPPs, as well as encapsulation in liposomes or nanoparticles as appropriate.

In their article entitled, “Fas Pulls the r on Psoriasis”, Gilhar et al. describe an animal model of psoriasis and the role played by Fas mediated signal transduction (2006) Am. J. Pathology 168:170-175). Fas/FasL signaling is best known for induction of sis.

However, there is an alternate pathway of Fas signaling that induces inflammatory cytokines, particularly tumor necrosis factor alpha (TNF-α) and interleukin-8 . This pathway is prominent in cells that express high levels of anti-apoptotic molecules such as Bcl-xL.

Because TNF-α is central to the pathogenesis of psoriasis and tic epidermis has a low tic index with high expression of Bcl-xL, these authors esized that inflammatory Fas signaling mediates induction of psoriasis by activated lymphocytes.

Noninvolved skin from sis patients was grafted to beige-severe combined immunodeficiency mice, and psoriasis was induced by ion of FasL-positive autologous natural killer cells that were activated by IL-2. Induction of sis was inhibited by injection of a blocking as (ZB4) or anti-FasL (4A5) antibody on days 3 and 10 after natural killer cell ion. as monoclonal antibody significantly reduced cell proliferation (Ki-67) and epidermal thickness, with inhibition of epidermal expression of TNF-α, IL-15, HLA-DR, and ICAM-1. Fas/FasL signaling is an essential early event in the induction of psoriasis by activated lymphocytes and is necessary for ion of key inflammatory cytokines ing TNF-α and IL-15.

Such data provide the rationale for therapeutic regimens entailing topical administration of Fas directed compounds and/or BCL-xL directed compounds for the treatment and alleviation of symptoms associated with psoriasis.

C. nds for Down-regulating Apo-B Expression Apolipoprotein B (apoB) is an essential protein for the formation of low-density lipoproteins (LDL) and is the ligand for LDL receptor. LDL is responsible for carrying cholesterol to tissues. High levels of apoB can lead to plaques that cause atherosclerosis.

Accordingly, ng apo B expression is a useful treatment modality for a variety of medical disorders including those listed in Table 6. Indices 20, 36-44, 63 and 64 provide compounds suitable for use in accordance with the present invention to silence apoB expression.

Soutschek et al. (Nature 432: 173, 2004) have described two siRNA compounds simultaneously ed to both the murine and human apoB gene s suitable for use in the present invention. These compounds have 21-mer passenger and 23-mer guide strands with cholesterol conjugated to the 3’-ends of the passenger strand. The cholesterol promoted both nuclease resistance and cellular uptake into the target tissues. The reductions in apoB sion in liver and jejunum were associated with reductions in plasma levels of apoB-100 protein and LDL. The authors indicated that the unconjugated compounds (lacking cholesterol) were inactive and concluded that the conjugated compounds need further optimization to achieve improved in vivo potency at doses and dose regimens that are clinically able.

The same group of investigators filed US20060105976, WO06036916 and US 7,528,118 that also provide siRNA compounds suitable for down ting both human and mouse apoB gene expression. Eighty-one distinct RNAi compounds with demonstrated ty in the human HepG2 and/or the murine liver cell line NmuLi that expresses apoB were described. -seven of these double stranded siRNA compounds were found to reduce apoB protein expression in HepG2 cells to less than 35% of control. One of these siRNA was tested in human apoB-100 transgenic mice where following three daily tail vein ions, the siRNA reduced mouse apoB mRNA levels 43+/- 10% in liver and 58 +/-12% in jejunum and also reduced human apoB mRNA in livers to 0%. Other siRNA compounds ed to apoB suitable for use in the present invention have been disclosed in US 2006/0134189. These have been described for use in ation with the SNALP (stable nucleic acid lipid particles) delivery technology.

Conventional antisense oligos ed to gene targets such as the apoB can be converted to RNAi compounds in accordance with the present invention and can be used as described herein. A series of conventional antisense oligos directed to apoB and suitable for use with the present invention have been described in Merki et al., Circulation 118: 743, 2008; Crooke et al., J Lipid Res 46: 872, 2005; Kastelein et al., Circulation 114: 1729, 2006; US 7,407,943, US 2006/0035858 and .

The conventional antisense oligos described in filing are 8 mers. It is known that guide s r than 15-mers are not active. Further 16-mer guide strands are the shortest suggested for use with the present invention. Thus, the compounds listed in this filing that are le for use in the present example are limited to 16-mers or to 15mers that are extended to 16-mers using the human ApoB sequence. Such 16-mers can be further lengthened by the use of ngs which as described herein do not necessarily need to base pair with the gene target.

A number of treatment regimens suitable for use with such tional antisense oligos or for use with the two-step administration described by the present invention are provided in .The sequence used for human ApoB is provided in k, Accession No. X04714.1.

Atherosclerosis is a ion in which vascular smooth muscle cells are pathologically rammed. Fatty material collects in the walls of arteries and there is typically c inflammation.This leads to a situation where the vascular wall thickens, hardens, forms plaques, which may eventually block the arteries or promote the blockage of arteries by promoting clotting. The latter becomes much more prevalent when there is a plaque rupture.

If the coronary arteries become narrow due to the effects of the plaque formation, blood flow to the heart can slow down or stop, causing chest pain (stable angina), shortness of breath, heart attack, and other symptoms. Pieces of plaque can break apart and move through the bloodstream. This is a common cause of heart attack and stroke. If the clot moves into the heart, lungs, or brain, it can cause a stroke, heart attack, or pulmonary sm.

Risk factors for atherosclerosis include: diabetes, high blood pressure, high cholesterol, high-fat diet, obesity, personal or family history of heart e and smoking.

The following conditions have also been linked to sclerosis: cerebrovascular disease, kidney disease involving dialysis and peripheral vascular disease. Down modulation of apoB s can have a beneficial therapeutic effect for the treatment of atherosclerosis and associated pathologies. WO/2007/030556 provides an animal model for assessing the effects of apoB directed compounds on the formation of atherosclerotic lesions.

D. Compounds for Down-regulating PCSK9 Expression Protein convertase subtilisin-like kexin type 9 (PCSK9) is a serine protease that destroys LDL receptors in liver and consequently the level of LDL in plasma. PCSK9 mutants can have gain-of-function attributes that promote certain medical disorders associated with alterations in the proportions of plasma lipids. Agents that inhibit PCSK9 function have a role to play in the treatment of such medical disorders including those listed in Table 6. Indices 21 and 45-51 provide compounds suitable for use in accordance with the present invention to silence PCSK9 sion.

Frank-Kamenetsky et al. (Proc Natl Acad Sci USA 105: 11915, 2008) have described four siRNA compounds suitable for use in the present invention with three different sequences directed to the PCSK9 gene targets of human, mouse, rats, and nonhuman es (and have characterized their activity in model systems. These siRNA were selected from a group of 150 by screening for activity using HepG2 cells. These compounds were formulated in lipidoid nanoparticles for in vivo testing. These nds reduced PCSK9 expression in the livers of rats and mice by 50-70% and this was associated with up to a 60% reduction in plasma cholesterol levels. In transgenic mice carrying the human PCSK9 gene siRNA compounds were shown to reduce the levels of the transcripts of this gene in livers by >70%. In nonhuman primates after a single bolus injection of PCSK9 siRNA the ve effect on PCSK9 expression lasted 3 weeks. During this time apoB and LDL cholesterol (LDLc) levels were reduced. There were no detectable effects on HDL cholesterol or cerides. US2008/0113930 and disclose additional PCSK9 RNAi compounds which can be modified as disclosed herein.

Conventional antisense oligos directed to the PCSK9 gene target provide another example g how conventional antisense oligos can be reconfigured to provide novel compositions of matter suitable for use in the present invention. Such a reconfiguration is useful in situations where siRNA has advantages over conventional antisense oligos as described . A series of tional nse oligos directed to human PCSK9 and suitable for use with the present invention have been described in . These ces were among the most active of those that were screened for PCSK9 inhibiting activity in vitro using the Hep3B cell line. The tional antisense oligos described in this filing are 8mers. It is known that guide strands shorter than 15-mers are not .

Further 16-mer guide strands are the shortest suggested for use with the present invention.

Such 16-mers can be further lengthened by the use of overhangs which as described herein do not necessarily need to base pair with the gene target in the case of the guide strand.

A number of treatment regimens suitable for use with such conventional antisense oligos or for use with the two-step strationof strands capable of forming siRNA in cells and where the guide strand is directed to PCSK9 are described in WO 18883. The conventional antisense oligos in this filing are targeted to apoB but the tissues involved and the therapeutic purposes involving PCSK9 are the same and thus essentially the same treatment regimens can be used.

This protein plays a major regulatory role in cholesterol homeostasis. PCSK9 binds to the epidermal growth factor-like repeat A (EGF-A) domain of the low-density lipoprotein receptor (LDLR), inducing LDLR degradation. d LDLR levels result in decreased metabolism of low-density lipoproteins, which could lead to hypercholesterolemia. Inhibition of PSCK9 function provides a means of ng cholesterol levels. PCSK9 may also have a role in the differentiation of cortical neurons.

Further, the usefulness of conventional antisense oligos directed to the murine PCSK9 gene target for the ent of hypercholesterolemia has been demonstrated by Graham et al.

(J lipid Res 48: 763, 2007). A series of antisense oligos were screened for activity and the most active (ISIS 394814) selected for in vivo studies. Administration of ISIS 394814 to high fat fed mice for 6 weeks resulted in a 53% reduction in total plasma cholesterol and a 38% reduction in plasma LDL. This was accompanied by a 92% reduction in liver PCSK9 expression.

E. Compounds for Down-regulating Phosphatase and Tensin Homolog (PTEN) Expression PTEN is a phosphatase (phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase) that is frequently mutated in cancers with wild type p53 where the effect or the mutation is to inhibit its tic ty. In this context, PTEN is t to function as a tumor suppressor. In cancers with mutated p53, however, PTEN supports the viability and growth of the tumor in part by increasing the levels of gain-of-function p53 mutants (Li et al., Cancer Res 68: 1723, 2008). PTEN also modulates cell cycle regulatory proteins with the effect of inhibiting cell proliferation. Thus, PTEN inhibitors have a role in the treatment of some cancers and in ing cell eration such as expanding cell populations for purposes such as transplantation. Indices 8, 10, 12, 14, 16, 18, 52, 53 and 55-57 provide compounds suitable for use in accordance with the t invention to e PTEN sion.

In vivo regeneration of peripheral neurons is constrained and rarely complete, and unfortunately patients with major nerve trunk transections experience only limited recovery.

Intracellular inhibition of neuronal growth signals may be among these constraints. Christie et al. igated the role of PTEN (phosphatase and tensin homolog deleted on chromosome ) during regeneration of peripheral neurons in adult Sprague Dawley rats (J. Neuroscience :9306-9315 (2010). PTEN inhibits phosphoinositide 3-kinase (PI3-K)/Akt signaling, a common and central outgrowth and survival y downstream of neuronal growth factors.

While PI3-K and Akt outgrowth signals were expressed and activated within adult peripheral neurons during regeneration, PTEN was similarly expressed and poised to inhibit their support. PTEN was sed in neuron perikaryal cytoplasm, nuclei, regenerating axons, and Schwann cells. Adult sensory neurons in vitro responded to both graded pharmacological inhibition of PTEN and its mRNA knockdown using siRNA. Both approaches were associated with robust rises in the plasticity of neurite outgrowth that were independent of the mTOR (mammalian target of rapamycin) pathway. Importantly, this accelerated outgrowth was in addition to the increased outgrowth generated in neurons that had undergone a preconditioning lesion. Moreover, following severe nerve ction injuries, local pharmacological inhibition of PTEN or siRNA knockdown of PTEN at the injury site accelerated axon outgrowth in vivo. The findings indicated a remarkable impact on peripheral neuron plasticity through PTEN inhibition, even within a complex regenerative milieu.

Overall, these findings identify a novel route to propagate intrinsic regeneration pathways within axons to benefit nerve . In view of these findings, it is clear that the PTEN directed compounds of the invention can be useful for the treatment of nerve injury and damage. In a preferred embodiment, such agents would be administered intrathecally as described for insulin in Toth et al., Neuroscience(2006) 139:429-49.Czauderna et al. (Nuc Acids Res 31: 2705, 2003) have described an active siRNA compound that is directed to the human PTEN gene target which is le for use in accordance with the present ionas described herein. Allerson et al. (J Med Chem 48: 901, 2005) have described two siRNA nds le for use in the present invention that are targeted to human PTEN.

F. nds for Down-regulating PTP1B Expression PTP1B, a ansmembrane protein tyrosine phosphatase that has long been studied as a negative regulator ofinsulin and leptin ing, has received renewed ion as an unexpected positive factor in genesis. These dual characteristics make PTP1B a particularly attractive therapeutic target for diabetes, obesity, and perhaps breast cancer.

Indices 54, 59, 60 and 65 provide compounds suitable for use in accordance with the present ion to silence PTP1B expression.

In the case of insulin signaling, PTP1B dephosphorylates the insulin receptor (IR) as well as its primary substrates, the IRS proteins; by contrast, in leptin signaling a downstream element, the tyrosine kinase JAK2(Janus kinase 2), is the primary target for dephosphorylation.However, hints that PTP1B might also play a positive signaling role in cell eration began to emerge a few years ago, with the finding by a number of groups that PTP1B dephosphorylates the inhibitory Y529 site in Src, thereby activating this kinase.

Other PTP1B substrates might also contribute to owth effects. Indeed, the idea that PTP1B can serve as a signaling stimulant in some cases ed key confirmation in previous work that showed PTP1B plays a positive role in a mouse model of ErbB2-induced breast cancer. See Yip et al. Trends in Biochemical Sciences 35:442-449 (2010). For these reasons, PTP1B has attracted particular attention as a potential therapeutic target in obesity, diabetes, and now, cancer. Accordingly, the compounds directed at PTP1B can be used to advantage for the treatment of such disorders.

EXAMPLE II ATIONS FOR Rs MiRNAs have been shown to have wide ranging effects on gene expression. In certain instances, these effects are detrimental and related to certain pathologies.

Accordingly, specific miRNA inhibitors which target such miRNAs for degradation are highly desirable. The present or has devised strategies for the synthesis of miRNA inhibitors suitable for in vivo delivery which exhibit enhanced stability, the ability to form active duplexes in cells, which act in turn to inhibit the activity of endogenous miRNAs associated with disease. These design paradigms and the resulting miRNA inhibitors are described herein below.

Table 7 provides a listing of some of the medical uses of the seqIMiRs ed to the indicated miRNAs. Indices 66-79 provide pairs of seqIMiR strands that are effective to inhibit the actions of these miRNA targets. The methods of the present invention, however, can be used to te Rs against any miRNA. Methods for administration of the oligos of the invention are provided in detail above.

TABLE 7 MICRORNA TARGETS FOR INHIBITION BY seqIMiRs AND COMMERCIAL APPLICATIONS Medical Conditions to be Treated using the MicroRNA Targets seqIMiR nds of the Invention miR-24 Treat cancer ing hormone resistant prostate miR-29a Inhibit pathologic sis including that due to ia reperfusion injury such as occurs after the removal of a clot miR-29b Inhibit pathologic apoptosis miR-29c Inhibit pathologic apoptosis including that due to ischemia reperfusion injury such as occurs after the removal of a clot miR-33 Raise good cholesterol (HDL) levels 2 Hepatitis C miR-155 Arthritis; Autoimmune inflammation including that associated with cystic fibrosis; Atopic itis miR-208a Chronic heart failure Conventional antisense oligos of different types are under development for potential use as competitive inhibitors of ular endogenous miRNAs for research, development and therapeutic purposes. Such oligos are designed to bind particularly tightly one strand of the miRNA whose actions are to be inhibited. These oligos work by a steric hindrance mechanism.

Elevated levels of miR-21, for example, occur in us cancers where it promotes oncogenesis at least in part by preventing the translation and accumulation of PDCD4.

Another example is miR-122 a liver specific miRNA that promotes replication of the hepatitis C virus. Conventional antisense oligos that inhibit these miRNAs are in development as potential therapeutic agents. ed to antisense oligos that engender catalytic activity t their s, such as those that are RNase H dependent, the nse oligos that function as competitive inhibitors must be used at substantially higher concentrations. In vivo various tissues take up oligos in widely ranging amounts. For example, liver and kidney take up vely large s while resting lymphocytes, testis, skeletal muscle the CNS and other tissues take up much smaller amounts. Further, antisense oligos that have a itive inhibitor function have been shown to perform poorly in tissues that do not avidly take up oligos. Therefore, it would be highly desirable to have oligonucleotide based miRNA inhibitors that have a catalytic activity against them so that a wider range of tissues types can be subject to ent miRNA inhibition. The present invention provides a solution to this pressing need.

EXAMPLE III EXAMPLES OF APPLICATIONS FOR seqMiRs Table 8 below es a g of miRNAs for which examples of specific seqMiR compounds have been provided herein. The methods of the present invention can be used to mimic any endogenous miRNA, to improve on the mRNA type silencing pattern of an endogenous miRNA for commercial purposes and can be used to generate designer novel miRNA-like compounds.

TABLE 8 MICRORNAS MIMICKED BY seqMiRs AND COMMERCIAL APPLICATIONS MicroRNA Medical Conditions to be Treated using the seqMiR Compounds Mimicked by of the Invention seqMiR Let-7i and Let-7 family Cancer generally miR1 Ischemia reperfusion injury including that associated with myocardial infarction; Diabetes miR2 Ischemia usion injury including that associated with myocardial infarction; Diabetes miR-26a-1 Cancer including liver, head and neck, breast a-2 Cancer including liver, head and neck, breast miR-29a Fibrosis including liver, lung, kidney and heart; Systemic sis; Cancers ing lung, liver, chronic lymphocytic ia; Osteoporosis; ic sclerosis; miR-29b-1 Fibrosis including liver, lung, kidney and heart; Systemic sclerosis; s including lung, liver, colon breast, chronic lymphocytic leukemia, acute myeloid leukemia miR-29b-2 is including liver, lung, kidney and heart; Systemic sclerosis; Cancers including lung, liver, colon, breast, rhabdomyosarcoma, chronic lymphocytic leukemia, acute myeloid leukemia; miR-29c is including liver, lung, kidney and heart; Systemic sclerosis; Cancers including lung, liver, rhabdomyosarcoma, chronic lymphocytic leukemia; miR-34a Cancer including prostate, ovarian, non-small cell lung cancer, pancreatic cancer, stomach cancer, retinoblastoma and chronic lymphocytic leukemia; miR-34b Cancer including prostate, ovarian, non-small cell lung cancer, pancreatic , stomach cancer, retinoblastoma and chronic lymphocytic leukemia; miR-34c Cancer ing prostate, ovarian, non-small cell lung cancer, pancreatic cancer, stomach , retinoblastoma and chronic lymphocytic leukemia; miR-122 Cancer including liver, lung and cervical; miR-146a Atherosclerosis miR-203 Sensitize cancers with mutant p53 including colon cancer to chemotherapy including taxanes miR-214 Nerve regeneration; Diabetes including type 2; miR-499 Myocardial infarction including the ischemia-reperfusion injury related to reversing vessel occlusion; It is now well established that post-transcriptional gene silencing (PTGS) by miRNA and other ssociated pathways represents an essential layer of complexity to gene regulation.Gene silencing using RNAi additionally trates huge potential as a therapeutic strategy for eliminating gene sion associated with the pathology underlying a number of different disorders.

A number of conventional miRNA compounds closely based on their endogenous miRNA counterparts are in development as possible therapeutic agents. Cancer is one area of focus since it has been found that several different miRNAs are expressed at very low levels in cancer cells compared to their normal counterparts. Further, it has been shown that ing these miRNAs can have profound anticancer effects. Several ic examples are provided in the Table. Indices 2, 9, 11, 13, 15, 17, 19 and 80-95 provide a variety of different seqMiR compounds, including potential anticancer agents that are based on the endogenous miRNAs shown in Table 8 that should be useful for the treatment of the indicated conditions.

The miRNA mimics provided should also be effective in cell culture in vitro. In this approach, the first strand can be transfected into the target cells following by subsequent ection of the second strand after a certain time frame has elapsed. This method should facilitate drug discovery efforts, target validation and also provide the means to reduce or eliminate any undesirable off target effects. ed ents from original figures 1. KEY TO STRAND MODIFICATIONS Each of the possible strand modifications in a number of figures will be designated according to the ing abbreviations as subscripts that follow the letter (A, T, U, C or G) indicating the base being used or substituted for. When there are two modifications they will both be indicated as subscripts.

BASES: 1) Abasic is 0 2) 2,6-Diaminopurine is 2 3) 2-thiouracil is 3 4) 4-thiouracil is 4 ) 2-thiothymidine is 5 SUGARS: 1) ANA is B 2) DNA is D 3) FANA is H 4) 2’-Fluoro is F ) LNA is L (note TL can substitute for ULeven if the sequence is written with 6) 2’Methyl is M 7) Ribose is R 8) UNA is N ’-END TERMINAL MODIFICATIONS: 1) When the 5’ -end of the antisense strand is orylated a P precedes the terminal nucleoside designation. 2) When the 5’-end of the sense strand is methylated a Yprecedes the terminal nucleoside designation. 3’- END OVERHANG SORS: An overhang precursor unit that is not used in hairpin formation is capital X 1) Phosphodiester is - - or no linkage indicated 2) Phosphorothioate is ~ 3) Overhang precursor linkages of other types are a double colon :: 4) A missing linkage is & 2. ILLUSTRATIONS OF DESIGN OF seqMiR COMPOUNDS WITH NOVEL SEED SEQUENCES 2A. Summary of Some of the Data from Ui-Tei et al., (2008) 4. Tm 3. Sequence with Seed Sequence . Luc 2. Seed Calculated 1. siRNA ssio Sequence Target Site that was Inserted into Seed n at 5.0 nM the Expression Vector Duplex Designation (5’-3’) (5’-3’) (degrees centigrade) 1. PLS3-1657 AUUAAAU UCGUGCUGAAAGUAUUUAAUUGA -10 0 2. CTLCAAUUUAU ACUUGCUCGAGUCAUAAAUUAGA -10 <10 4819 3.Luc-309 UAUAAAU CCCUAAUAUUUAUAAUG -8 25 4. CLTCUAAUAUA CACUUGCCACUCAUAUAUUAACC -6 20 3114 .GRK4-934 AUAUUCU AGGCAAGCGGCGAAGAAUAUUCU +3 0 6. VIM-1261 UUAGUUU CAUGUCAUUACACAAACUAAUCU +5 25 7.VIM-812 U CUAGGUGAAACUUAUAUGAAAGU +5 22 8.KIF23-430 CGUUUAG GAAUGCGCAACACCUAAACGAUA +12 50 9. OCT-821 UCUUUUG GCGGUUUCAAAAGAUCA +12 22 . TUBA2- CAAAUCG CUAUGACCGGCACCGAUUUGACG +14 20 11. LUC-774 UUAAGAC UAGGAUGCCAUCGGUCUUAAUGU +15 22 12. - AUUGGAU ACGUAUGAACUGGAUCCAAUAUG +20 35 2803 13. LUC2- CGAAGUA AAGCGGUGCCAAGUACUUCGAAA +21 35 14. VIMAUUCACG GAGGCAAAUGACGCGUGAAUACC +21 <10 1128 .MC4RAUGAUGA CAUCCUCUGGUUUUCAUCAUAAG +22 >90 16.CCNCAUCAUGA CUCUCGAUCAUGAUAGC +22 75 17.OCT-670 AUGCUAG UACCUACACUAAUCUAGCAUUGA +25 90 18. OCT-797 ACAGAAC GCUGAAGCUAGUAGUUCUGUAAC +26 45 19. VIM-270 UGAACUC AAGGAAGGGAGAGGAGUUCAAGA +26 85 . VIM-596 G CGUUACUCUCGGAGCAAUCUUUC +26 40 21. VIM-269 GAACUCG CAAUGAUGCACCAGGAGUUCAAG +27 90 -36 CUUCCAG CUUUGGAUGAAACCUGGAAGAUG +28 25 23. PLS3- CCAUCUC GGUUAUCUCUUCCGAGAUGGUCA +31 60 1528 24. CLTCAGUCGAC CCGAGCAAGUGGUGUCGACUUCC +33 85 2416 . PLS3- ACUCCAG GCCAAUAUCGAUCCUGGAGUAAG +35 42 1310 26. VIM-805 UGCUGAC GGUGCCCAAGGAAGUCAGCAAUA +36 90 2B. Modifications to Seed Sequences 3. Examples of Modification(s) 1. Seed 2. Nuclease Resistance Rules 4. Estimated to Seed ce to Sequence Applied to Seed Sequence Tm Increase Tm of Seed Duplex (5’-3’) (5’-3’) Increase with Target (5’-3’) Sequence ~AF~UFUM~ARARAFUM~(G) ~AF2~UFUM~ALARAFUL4~ +25 ~AFAMUFUMUF~AMUF~(G) ~AFAMULUMUL~AMUL~ +20 AAUUUAU ~UF~AMUF~AMARAF~UM~(G) ~UF~ALUF~AMARLF~UM~ +15 UAUAAAU ~UF~ARAFUM~AFUM~AF(G) ~UF~ARALUM~ALUM~AL +20 UAAUAUA ~AFUF~AMUFUM~CMUF~(G) ~AFUL~AMULUM~CMUL~ +20 ~UFUM~AFGRUMUFUM~(G) ~UFUM~AF2GLUMUFUL~ +20 ~UFUM~CM~AFUM~AFUM~(G) ~UFUM~CL~AF2UM~ALUM~ +15 UUCAUAU ~CFGRUMUFUM~ARGF(G) ~CFGRUMULUM~ARGL~ +15 CGUUUAG ~UF~CMUFUMUFUM~GF(G) ~UF~CMULUMULUM~GL~ +20 UCUUUUG ~CF~ARARAMUF~CMGR(G) ~CF~AR2ARALUF~CMGL +20 CAAAUCG ~UFUM~ARARGRAFCM(G) ~UFUM~ALAR2GRALCM +15 UUAAGAC F~GRGRAMUR~(G) ~AFULUF~GLGRAMUL~ +20 AUUGGAU ~CFGRARARGRUM~AF(G) ~CFGRALARGRUL~AF +15 CGAAGUA ~AFUMUF~CM~AFCMGF(G) ~AFUMUL~CM~AFCMGL +15 AUUCACG ~AFUM~GRAFUM~GRAF(G) ~AFUM~GRAFUM~GRAF +15 AUGAUGA ~AFUMCF~ARUM~GFAM(G) ~AFUMCL~ARUM~GFAL +15 AUCAUGA ~AFUM~GRCRUM~ARGR(G) ~AFUM~GLCRUM~ALGR +15 AUGCUAG ~AFCM~ARGRARAFCM(G) ~AFCL~ARGRALAFCL +20 ACAGAAC ~UF~GRARAF~CRUMCF(G) ALAFCRUMCL +15 ~GFCRUFUMUFUM~GF(G) GFCRULUMULUM~GL +20 ~GFARAMCRUM~CF~GR(G) ~GFARALCRUM~CFGL +15 GAACUCG ~CFUFUM~CF~CM~ARGR(G) ~CFULUM~CL~CM~ARGL +20 CUUCCAG ~CFCM~AFUM~CRUF~CM(G) ~CFCM~ALUM~CRUL~CM +15 CCAUCUC ~AFGRUM~CRGRAFCM(G) ~AFGLUM~CRGRALCM +15 AGUCGAC ~AF~CRUM~CF~CM~ARGR(G) M~CL~CM~ARGL +20 ACUCCAG ~UF~GRCRUM~GRAFCM(G) ~UF~GRCRUM~GLAFCM +10 UGCUGAC 2C. Modifications to Area of Sense Strand Corresponding to Seed Sequence 3. Examples of Modification(s) to 2. Nuclease Resistance Rules 4. Estimated Tm 1. Seed Corresponding Sense Strand Applied to Sense Strand Sequence Region to Reduce Sequence Decrease with Senses/Antisense Interstrand Tm Seed Sequence (5’-3’) (5’-3’) Partner AF~UMUFUM~ARAM~UM~ ~GR~ARAF~UM~ -15 AUUAAAU AMUF~ARARAMUFUM~ AMUF~AMCMCMGRUM -15 AAUUUAU AF~UMUMUF~AMUF~AM~ AFGRUM~GRARGF~AM -15 UAUAAAU UM~AFUM~AFUMUF~AM~ UM~GFUM~GFUM~GFAM~ -20 UAAUAUA AMGRARAFUM~AFUM~ AMGRAFCMUF~CM~AM~ -20 AUAUUCU AFARAFCMUM~AFAM~ AFCMAFGRUM~AFAM~ -15 UUAGUUU AFUM~AFUM~GFAFAM~ AFUM~AFUM~CRUF~AM~ -15 UUCAUAU CMUM~AFARAMCFGM~ GMUM~AF~CR~AMCFGM~ -15 CGUUUAG RARARGRAM~ GRARARAFUMUF~AM~ -20 UCUUUUG CMGRAMUFUMUF~GM~ UGUMUF~GM~ -20 CAAAUCG GFUM~CRUFUM~AFAM~ GFAM~CRUF~AM~AFAM~ -15 UUAAGAC AMUF~CM~CF~ARAFUM~ TDUF~GMCF~ARTDUM~ -20 AUUGGAU UM~AF~CFUMUF~CMGM~ UM~TD~CFUMGF~CMGM~ -15 CMGFUM~GFARAFUM~ GMGFUM~GFCRAFUM~ -15 AUUCACG UMCM~AFUMCM~AFUM~ UMCM~TDUMCM~TDUM~ -15 AUGAUGA UFCM~AFUM~GRAFUM~ FUM~CM~AFUM~ -15 AUCAUGA CMUM~AFGFCM~AFUM~ CMGR~AFGFGR~AFUM~ -15 AUGCUAG GRUMUMCRUM~GRUM~ CRUM~GRCRUM~CRUM~ -20 ACAGAAC UMUMCF~AM~ UM~ARGRUM~GFCM~AF~ -15 UGAACUC CM~ARARARARGRCM~ GRAFTD~ARTD~GRCM~ -20 GCUUUUG CMGMAFGRUFUM~CM~ GRGMAFGRAFUM~CM~ -15 GAACUCG CRUM~GRGRARARGM~ CM~ARGRCM~AFCMGM~ -20 CUUCCAG GFAMGFAMUM~GFGM~ GFCMGFAMAMGFGM~ -15 CCAUCUC MGRAF~CRUM~ GFAMCMGRAFGRUM~ -15 AGUCGAC CMUM~GFGRARGRUM~ GRUM~GFCMARCMUM~ -20 ACUCCAG M~AFGRCM~AM~ GFUM~GRAFGRCM~AM~ -10 UGCUGAC 2D. Examples of Possible Duplex Vehicles for the Seed Sequences and Corresponding Sense Sequences NEGATIVE CONTROL DUPLEX #1SELECTED FOR USE AS A DUPLEX VEHICLE Sense strand (UU 3’-end overhang in parent compound is not retained): UF~GMUM~ARUF~GRCMGRAMUM~C?G- -C- -A- -G- -A- -C- -U~AM Antisense strand (UU 3’-end overhang in parent nd is ed): UF~A- -G- -U- -C- -U- -G- -C?GRAF~UF~CMGFCM~AMUF~AF~CF~AM~UF~UM NEGATIVE CONTROL DUPLEX #1 MODIFIED TO BLOCK ANTISENSE STRAND AGO-2 CATALYTIC ACTIVITY Antisense : UF~A- -G- -U- -C- -U- -G- -C?GRAF~U0D~CMGFCM~AMUF~AF~CF~AM~UF~UM NEGATIVE CONTROL DUPLEX #2 SELECTED FOR USE AS A DUPLEX VEHICLE Sense strand (5’ al nucleoside [C] in parent is removed): GF~UM~GRAFCM~AFCMGRUMUF~C?G- -G- -A- -G- -A- -A- -U~UM Antisense strand (3’ terminal nucleoside [G] in parent is removed and two unit overhang precursor added): AF~A- -U- -U- -C- -U- -C- -C?GRARAFCMGRUM~GRUM~CM~AF~CM:X:X NEGATIVE CONTROL DUPLEX #2 MODIFIED TO BLOCK ANTISENSE STRAND AGO-2 CATALYTIC ACTIVITY Antisense strand: AF~A- -U- -U- -C- -U- -C- -C?GRAR~A0D~CMGRUM~GRUM~CM~AF~CM:X:X siRNA DIRECTED TO HUMAN AND MOUSE APO-B Sense strand (parent has no overhang): CM~AMUF~CM~AFCM~AF~CRUM~GFA?A- -U- -A- -C- -C- -A- -A~UM Antisense strand (parent has ~A~C 3’-end ng that is replaced by a unit overhang precursor): AF~U- -U- -G- -G- -U- -A- -U?UF~CM~AFGRUM~GRUM~GRAMUF~GRAF~CM:X:X siRNA DIRECTED TO HUMAN AND MOUSE APO-B MODIFIED TO BLOCK ANTISENSE STRAND AGO-2 CATALYTIC ACTIVITY Antisense strand: AF~U- -U- -G- -G- -U- -A- -U?UF~CM~A0D~GRUM~GRUM~GRAMUF~GRAF~CM:X:X 2E. Example ofSelf-Dimer Forming Antisense Strand Unmodified: 5’ AUGAUAUCCAAUAUU 3’ 3’ UUAUAACCUAUAGUAGGUUAU 5’ Calculated dominant hairpin duplex: ’ UAUUGGA 3’ 3’ AUAACCU 5’ Calculated dominant hairpin unpaired loop: ’ UGAUA 3’ Modified according to essential/preferred ectural-independent rules and for prevention of ARO-2 catalytic activity against the target: ’PUM~AF~UFUM~GRGRAM~UF~GM~A0D~U0D~AMUF~CM~CM~ARAMUM~AF~UF~UM 3’ Further modified for increased seed duplex affinity for : ’ PUM~AF~UFUM~GLGRAM~UL~GM~A0D~U0D~AMUF~CM~AMARAMUM~AF~UF~UM 3’ 2F. Examples of Possible Modifications to the Seed Sequence found in Multiple Let-7 Family Members and the Corresponding Sense Strand Sequence Let-7 family seed sequence: GAGGUAG Let-7 family seed sequence ed for nuclease resistance: GRARGRGRUM~ARGR Sense strand sequence corresponding to let-7 family seed sequence: CUACCUC Sense strand sequence corresponding to let-7 family seed sequence modified for nuclease ance: CRUM~AFCMCRUM~CR Examples of Modifications to let-7 Seed Sequence Examples of Modification(s) to Seed ce to Estimated Tm Increase Tm of Seed Duplex Increase with Target (5’-3’) Sequence GRALGRGRUL~ARGL +25 GRARGLGRUM~ARGL +15 GRA2GRGLUM~A2GR +15 GRARGRGLUM~ARGR +10 GRARGRGRUL3~ARGR +15 Examples of Modifications to Area of Sense Strand Corresponding to Seed Sequence Examples of cation(s) to Estimated Tm Corresponding Sense Strand Region to Reduce Decrease with Senses/Antisense Interstrand Tm Seed Sequence Partner (5’-3’) GRUMTDCM~CR~AM~CR -20 GRUM~AFCMGRUM~CR -15 CM~AMAFGMCRUM~CR -15 CF~CM~CRUM~CR -10 CRUM~AFCN~CRUM~CR -10 Note: the 3’-end C has been converted to a mismatch in section G. in accordance with the try rule. This will further reduce the estimated Tm by about -5 degrees. 2G. Examples of Let-7 Seed Sequence and Corresponding Sense Stand Sequence Inserted into a Duplex Vehicle Duplex #1 Sense strand: GF~UM~CM~AMUF~CM~AFCM~AF~CRUM~GFARGRUMTDCM~CR~AM~AR~UM Antisense strand: AF~GRALGRGRUL~ARGLUF~CM~AFGRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRALGRGRUL~ARGLUF~CM~AD0~GRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRALGRGRUL~ARGLUF~CMANGRUM~GRUM~GRAMUF~GRAF~CM:X:X Duplex #2 Sense strand: GF~UM~CM~AMUF~CM~AFCM~AF~CRUM~GFARGRUM~AFCMGRUM~GR~UM Antisense : AF~GRARGLGRUM~ARGLUF~CM~AFGRUM~GRUM~GRAMUF~GRAF~CM:X:X nse strand (AGO-2 catalytic activity inhibited): AF~GRARGLGRUM~ARGLUF~CM~A0~GRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRARGLGRUM~ARGLUF~CMANGRUM~GRUM~GRAMUF~GRAF~CM:X:X Duplex #3 Sense strand: GF~UM~CM~AMUF~CM~AFCM~AF~CRUM~GFAFCM~AMAFGMCRUM~AR~UM Antisense : AF~GRAR2GRGLUM~AR2GRUF~CM~AFGRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRAR2GRGLUM~AR2GRUF~CM~AD0~GRUM~GRUM~GRAMUF~GRAF~CM:X:X nse strand (AGO-2 catalytic activity inhibited): AF~GRAR2GRGLUM~AR2GRUF~CMANGRUM~GRUM~GRAMUF~GRAF~CM:X:X Duplex #4 Sense strand: GF~UM~CM~AMUF~CM~AFCM~AF~CRUM~GFAMCR~CM~CF~CM~CRUM~GR~UM Antisense strand: AF~GRARGRGLUM~ARGRUF~CM~AFGRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRARGRGLUM~ARGRUF~CM~AD0~GRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRARGRGLUM~ARGRUF~CMANGRUM~GRUM~GRAMUF~GRAF~CM:X:X Duplex #5 Sense strand: GF~UM~CM~AMUF~CM~AFCM~AF~CRUM~GFAMCRUM~AFCNCRUM~AR~UM Antisense : AF~GRARGRGRUL3~ARGRUF~CM~AFGRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRARGRGRUL3~ARGRUF~CM~A0~GRUM~GRUM~GRAMUF~GRAF~CM:X:X Antisense strand (AGO-2 catalytic activity inhibited): AF~GRARGRGRUL3~ARGRUF~CMANGRUM~GRUM~GRAMUF~GRAF~CM:X:X 2H. Examples of Let-7 Seed Sequence and Corresponding Sense Stand ce Inserted into the Same Strand to Generate Dimer Forming Single Strands Group #1 Antisense strand: PAF~GRALGRGRUL~ARGLUF~CM~AFGRUM~ARGRUMTDCM~CR~AM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRALGRGRUL~ARGLUF~CM~AD0~GRUM~ARGRUMTDCM~CR~AM~CR~UM:X:X nse strand (AGO-2 catalytic activity inhibited): PAF~GRALGRGRUL~ARGLUF~CMANGRUM~ARGRUMTDCM~CR~AM~CR~UM:X:X Group #2 Antisense strand: PAF~GRARGLGRUM~ARGLUF~CM~AFGRUM~GRUM~AFCMGRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic ty inhibited): PAF~GRARGLGRUM~ARGLUF~CM~A0~GRUM~GRUM~AFCMGRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRARGLGRUM~ARGLUF~CMANGRUM~GRUM~AFCMGRUM~CR~UM:X:X Group #3 Antisense strand: PAF~GRA2GRGLUM~A2GRUF~CM~AFGRUM~CM~AMAFGMCRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRA2GRGLUM~A2GRUF~CM~AD0~GRUM~CM~AMAFGMCRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRA2GRGLUM~A2GRUF~CMANGRUM~CM~AMAFGMCRUM~CR~UM:X:X Group #4 Antisense strand: PAF~GRARGRGLUM~ARGRUF~CM~AFGRUM~CR~CM~CF~CM~CRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRARGRGLUM~ARGRUF~CM~AD0~GRUM~CR~CM~CF~CM~CRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRARGRGLUM~ARGRUF~CMANGRUM~CR~CM~CF~CM~CRUM~CR~UM:X:X Group #5 Antisense strand: PAF~GRARGRGRUL3~ARGRUF~CM~AFGRUM~CRUM~AFCNCRUM~CR~UM:X:X Antisense strand (AGO-2 tic activity ted): PAF~GRARGRGRUL3~ARGRUF~CM~A0~GRUM~CRUM~AFCNCRUM~CR~UM:X:X Antisense strand (AGO-2 catalytic activity inhibited): PAF~GRARGRGRUL3~ARGRUF~CMANGRUM~CRUM~AFCNCRUM~CR~UM:X:X 3. UNMODIFIED STRANDS COMPRISING A siRNA COMPOUND DIRECTED TO MOUSE PTEN Sense strand: ’ CAGCUAGAACUUA 3’ Antisense strand: ’ UAAGUUCUAGCUGUGGUGG 3’ 4. UNMODIFIED STRANDS COMPRISING HUMAN/MOUSE Let-7i ‘Iva?“ ‘4’?!”thgwm L§‘§’ &¥;Mx&wv* ~ I m: TI Wham? gagmmaéawgsgxgmg Sense : ’ CUGCGCAAGCUACUGCCUUGCU 3’ Antisense strand: ’ UGAGGUAGUAGUUUGUGCUGUU 3’ . STRANDS COMPRISING HUMAN/MOUSE Let-7i WITH REMOVAL OF WOBBLE BASE PAIRSAND MISMATCH v Sense strand (removed wobble base pairings): ’ AAACUACUACCUCACU 3’ Sense strand (removed wobble base pairings and mismatch): ’ CAGCACAAACUACUACCUCACU 3 ’ Antisense strand: » 5’ UGAGGUAGUAGUUUGUGCUGUU 3’ 6. APPLICATION OF NUCLEASE RESISTANCE AND ESSENTIAL/PREFERRED ECTURAL INDEPENDENT RULES TO STRANDS ILLUSTRATING THE INITIAL STEPS IN THE DESIGN OF A seqsiRNA SET DIRECTED TO MOUSE PTEN Sense strand: ’ CF~CM~AFCM~CM~AFCM~ARGRCRUM~ARGRARAF~CRUM~UF~AM 3’ Antisense strand: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM 3’ 7. APPLICATION OF NUCLEASE RESISTANCE AND ESSENTIAL/PREFERRED ECTURAL INDEPENDENT RULES TO STRANDS ILLUSTRATING AN EARLY STEP IN THE DESIGN OF A seqMiR SET BASED ON HUMAN/MOUSE Let-7i Sense strand: ’ CF~UM~GRCMGRCM~ARARGRCRUM~AF~CRUM~GRCM~CRUMUF~GF~CF~UM 3’ Sense strand (removed wobble base pairings and mismatch): ’ CF~AMGRCM~AFCM~ARARAF~CRUM~AF~CRUM~AFCM~CMUF~CM~AF~CF~UM Antisense : ’ RGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM~UF~UM 3’ 8. APPLICATION OF THERMODYNAMIC RULES TO NUCLEASE RESISTANT STRANDS ILLUSTRATING A PREFERRED STEPS IN THE DESIG Sense strand: ’ CF~CM~AFCM~CM~AFCM~ARGRCRUM~ARGRARAF~CRUM~UF~AM 3’ Sense strand sequence of ed regions 1-3 from Table 3 lined): ’ CCACCUAUUA 3’ Combined intervening sense strand sequence: ’ CCAAGGAAC 3’ Antisense strand: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM 3 Four nucleoside terminus with 5’-end sense strand: ’ CCAC 3’ 3’ GGUG 5’ Four nucleoside terminus with 5’-end antisense strand: ’ UAAG3’ 3’ AUUC 5’ Adjusted sense strand: No adjustments required 9. APPLICATION OF THERMODYNAMIC RULES TO NUCLEASE RESISTANT STRANDS ILLUSTRATING PREFERRED STEPS IN THE DESIGN OF A seqMiR SET BASED ON HUMAN/MOUSE Let-7i Sense strand: ’ CF~UM~GRCMGRCM~ARARGRCRUM~AF~CRUM~GRCM~CRUMUF~GM 3’ Sense strand ed wobble base pairings and mismatch): ’ CF~AMGRCM~AFCM~ARARAF~CRUM~AF~CRUM~AFCM~CMUF~CM~AM 3’ Sense strand sequence of combined regions 1-3 from Table 3 (underlined): ’ CACAUACUCA 3’ Combined intervening sense strand sequence: 5’ CAGAACUACC 3’ Antisense strand: ’ UF~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM 3’ Four nucleoside terminus with 5’-end sense strand: 5’ CF~AMGRCM 3’ 3’ GM~UFCRGR 5’ Four nucleoside terminus with 5’-end antisense strand: ’ UM~GRARGR3’ 3’ UFCM 5’ Adjusted sense strand with mismatch introduced: ’ CF~AMGRCM~AFCM~ARARAF~CRUM~AF~CRUM~AFCM~CMUF~GM~AM 3’ . ATION OF CANONICAL ECTURAL-DEPENDENT ALG Sense strand variants: ’ CF~CM~AFCM~CM~AFCM~ARGRCRUM~ARGRARAF~CRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~CM~AFCM~ARGRGRUM~ARGRARAF~CRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~CM~AFCM~ARGR~CDo~UM~ARGRARAF~CRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~CM~AFCM~ARGRCNUM~ARGRARAF~CRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~GM~AFCM~ARGRGRUM~ARGRARAF~CRUM~UF~AM:X:X 3’ ’ AFCM~GM~AFCM~ARGR~CDo~UM~ARGRARAF~CRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~GM~AFCM~ARGRCNUM~ARGRARAF~CRUM~UF~AM:X:X 3’ Antisense strand variants: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X3 ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3 ’ UF~AM~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3 11. APPLICATION OF CANONICAL ARCHITECTURAL-DEPENDENT ALGORITH Duplex #1 Sense strand (overall Tm of duplex reduced): ’ CF~AMGRCM~AFGM~ARARAF~CR~UD0~AF~CRUM~AFCM~CMUF~GM~AF:X:X 3’ Antisense strand: ’ UM~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM:X:X 3’ Duplex #2 Sense strand: 5’ CF~AMGRCM~AFCM~ARARAF~CRUM~AF~CRUM~AFCM~CMUF~GM~AF:X:X 3’ Antisense strand (AGO-2 catalytic activity against mRNA inhibited): ’ UM~GRARGRGRUM~ARGRUM~AR~GD0~URURUM~GRUM~GRCRUF~GM:X:X 3’ 12. APPLICATION OF ASYMMETRIC ARCHITECTURAL-DEPENDENT ALGORITH Form with 5’ and 3’ overhang precursors in antisense strand Sense strand variants: ’ CF~CM~AFCM~CM~AFCM~ARGRCRUM~ARGRAR~AF~CM 3’ ’ CF~CM~AFCM~CM~AFCM~ARGRGRUM~ARGRAR~AF~CM 3’ ’ CF~CM~AFCM~CM~AFCM~ARGR~CDo~UM~ARGRAR~AF~CM 3’ ’ CF~CM~AFCM~CM~AFCM~ARGRCNUM~ARGRAR~AF~CM 3’ 5’ CF~CM~AFCM~GM~AFCM~ARGRGRUM~ARGRAR~AF~CM 3’ ’ AFCM~GM~AFCM~ARGR~CDo~UM~ARGRAR~AF~CM 3’ ’ CF~CM~AFCM~GM~AFCM~ARGRCNUM~ARGRAR~AF~CM 3’ Antisense strand variants: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ 5’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM3’ ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM3’ ’ UF~AM~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ UF~AM~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM3’ Form with 3’ overhang sors in antisense strand Sense strand variants: ’ CF~CM~AFCM~CM~AFCM~ARGRCRUM~ARGRARAF~CRUM~UF~AM 3’ ’ CF~CM~AFCM~CM~AFCM~ARGRGRUM~ARGRARAF~CRUM~UF~AM 3’ ’ CF~CM~AFCM~CM~AFCM~ARGR~CDo~UM~ARGRARAF~CRUM~UF~AM 3’ 5’ CF~CM~AFCM~CM~AFCM~ARGRCNUM~ARGRARAF~CRUM~UF~AM3’ ’ CF~CM~AFCM~GM~AFCM~ARGRGRUM~ARGRARAF~CRUM~UF~AM 3’ ’ CF~CM~AFCM~GM~AFCM~ARGR~CDo~UM~ARGRARAF~CRUM~UF~AM 3’ ’ CF~CM~AFCM~GM~AFCM~ARGRCNUM~ARGRARAF~CRUM~UF~AM 3’ Antisense strand ts: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM3’ ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM3’ 5’ UF~AM~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM3’ 13. APPLICATION OF ASYMMETRIC ARCHITECTURAL-DEPENDENT ALGORITH Duplex #1 Sense strand (overall Tm of duplex reduced): ’ CF~AMGRCM~AFGM~ARARAF~CR~UD0~AF~CRUM~AF~CM~CM 3’ Antisense strand: ’ UM~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM:X:X 3’ 5’ UM~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCR~UF~GM 3’ Duplex #2 Sense strand: ’ RCM~AFCM~ARARAF~CRUM~AF~CRUM~AF~CM~CM 3’ nse strand (AGO-2 catalytic activity against mRNA inhibited): ’ UM~GRARGRGRUM~ARGRUM~AR~GD0~URURUM~GRUM~GRCRUF~GM:X:X 3’ ’ UM~GRARGRGRUM~ARGRUM~AR~GD0~URURUM~GRUM~GRCR~UF~GM 3’ Duplex #3 Sense strand: 5’ CF~AMGRCM~AFCM~ARARAF~CRUM~AF~CRUM~AF~CM~CM 3’ Antisense strand: ’ UM~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM:X:X 3’ ’ UM~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCR~UF~GM 3’ 14. APPLICATION OF FORKED-VARIANT ARCHITECTURALDEPENDENT ALGORITHM TO CANONICAL ARCHITECTURE STRANDS ILLUSTRAT Sense strand variants: ’ AFCM~CM~AFCM~ARGRCRUM~ARGRCMAF~GRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~CM~AFCM~ARGRGRUM~ARGRCMAF~GRUM~UF~AM:X:X 3’ ’ AFCM~CM~AFCM~ARGR~CDo~UM~ARGRCMAF~GRUM~UF~AM:X:X 3’ 5’ CF~CM~AFCM~CM~AFCM~ARGRCNUM~ARGRCMAF~GRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~GM~AFCM~ARGRGRUM~ARGRCMAF~GRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~GM~AFCM~ARGR~CDo~UM~ARGRCMAF~GRUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~GM~AFCM~ARGRCNUM~ARGRCMAF~GRUM~UF~AM:X:X 3’ Antisense strand variants: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ ’ UF~AM~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3’ . APPLICATION OF FORKED-VARIANT ARCHITECTURALDEPENDENT ALGORITHM TO CANONICAL ARCHITECTURE STRANDS ILLUSTRAT Duplex #1 Sense strand (overall Tm of duplex reduced): ’ CF~AMGRCM~AFGM~ARARAF~CR~UD0~AF~CRUM~AFCM~GMUF~GM~AF:X:X 3’ Antisense strand: ’ UM~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM:X:X 3’ Duplex #2 Sense strand: ’ CF~AMGRCM~AFCM~ARARAF~CRUM~AF~CRUM~AFCM~GMUF~GM~AF:X:X 3’ Antisense strand (AGO-2 catalytic activity against mRNA inhibited): ’ UM~GRARGRGRUM~ARGRUM~AR~GD0~URURUM~GRUM~GRCRUF~GM:X:X 3’ 16. APPLICATION OF SMALL INTERNALLY SEGMENTED ARCHITECTURAL-DEPENDENT ALGORITHM ILLUSTRATING A STEP IN THE DESIGN OF A seqsiRNA SET DIRECTED TO MOUSE PTEN Sense : 5’ CF~CM~AFCM~CM~AFCM~AF~GM&CF~UM~ARGLARAF~CLUM~UF~AM:X:X 3’ ’ CF~CM~AFCM~CM~AFCM~AF~GM&CF~UM~ARGLARAF~CLUM~UF~AM 3’ Antisense strand variants: ’ UF~AM~AR~GRUMUF~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3 ’ UF~AR~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3 5’ UF~AM~AR~GRUMUN~CRUM~ARGRCRUM~GRUM~GRGRUM~GF~GM:X:X 3 17. APPLICATION OF SMALL INTERNALLY TED ECTURAL-DEPENDENT ALGORITHM ILLUSTRATING A STEP IN THE DESIGN OF A seqMiR SET BASED ON HUMAN/MOUSE Let-7i Duplex #1 (Dual Sense Strands) Sense strand: ’ CF~AMGLCM~AFCM~ARAL~AF~CM&UM~AF~CRUM~AFCL~CMUF~CM~AM 3’ Antisense strand: ’ UF~GRARGRGRUM~ARGRUM~ARGRURURUM~GRUM~GRCRUF~GM:X:X 3’ Duplex #2 (Dual Sense Strands) Sense strand: 5’ CF~AMGLCM~AFCM~ARAL~AF~CM&UM~AF~CRUM~AFCL~CMUF~CM~AM 3’ Antisense strand (AGO-2 catalytic activity against mRNA inhibited): ’ UF~GRARGRGRUM~ARGRUM~AR~GD0~URURUM~GRUM~GRCRUF~GM:X:X 3’ Duplex #3 (Dual Antisense Strands) Sense : ’ CF~AMGLCM~AFCM~ARALAF~CRUF~AFCRUM~AFCL~CMUF~CM~AM 3’ Antisense strand: 5’ UF~GRARGRGRUM~ARGR~UM~AM&GF~URURUM~GRUM~GRCRUF~GM:X:X 3’ ATION OF ss-RNAi ARCHITECTURAL-DEPENDENT ALGORITHM TO AN ANTISENSE STRAND ILLUSTRATING A STEP IN THE DESIGN OF A A DIRECTED TO MOUSE PTEN ’ PUF~AF~AR~GRUFUF~CRUF~ARGRCRUF~GRUF~GRGRUF~GF~GF:X:X 3 ’ PUF~AM~AR~GRUFUN~CRUF~ARGRCRUF~GRUF~GRGRUF~GF~GF:X:X 3 ’ ~AR~GRUFUN~CRUF~ARGRCRUF~GRUF~GRGRUF~GF~GF:X:X 3 APPLICATION OF ss-RNAi ARCHITECTURAL-DEPENDENT ALGORITHM TO AN ANTISENSE STRAND ILLUSTRATING A STEP IN THE DESIGN OF A ss-MiR BASED ON HUMAN/MOUSE Let-7i Antisense strand: ’ PUF~GRARGRGRUF~ARGRUF~ARGRURURUF~GRUF~GRCRUF~GF:X:X 3’ nse strand (AGO-2 catalytic activity against mRNA inhibited): 5’ ARGRGRUF~ARGRUF~AR~GD0~URURUF~GRUF~GRCRUF~GF:X:X 3’ Antisense strand (binding affinity for mRNA targets is increased): ’ PUF~GRARGLGRUF~ARGRUF~ARGRURURUF~GRUF~GRCRUF~GF:X:X 3’ Antisense strand (AGO-2 catalytic activity against mRNA inhibited and binding affinity for mRNA s isincreased): ’ PUF~GRARGLGRUF~ARGRUF~AR~GD0~URURUF~GRUF~GRCRUF~GF:X:X 3’ Antisense strand (binding affinity for mRNA targets is further increased): ’ PUF~GRALGRGRUF~ALGRUF~ARGRURURUF~GRUF~GRCRUF~GF:X:X 3’ Antisense strand (AGO-2 catalytic activity against mRNA inhibited and binding affinity for mRNA targets is further increased): ’ PUF~GRALGRGRUF~ALGRUF~AR~GD0~URURUF~GRUF~GRCRUF~GF:X:X 3’ . seqsiRNA COMPOUNDS DIRECTED TO MOUSE APO-B FOR SEQUENTIAL ION OF RNAi ACTIVITY Canonical architecture Sense: ’ CF~AMARGRUM~GRUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ 5’ CF~AMARGRUM~CRUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ ’ CF~AMARGRUM~GNUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ ’ CF~AMARGRUM~GRUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ ’ RGRUM~CRUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ ’ CF~AMARGRUM~GNUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ 5’ CF~AMARGRUM~GRUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ ’ CF~AMARGRUM~CRUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ ’ CF~AMARGRUM~GNUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM:X:X 3’ Antisense: ’ UF~UM~CF~ARGRUM~GRUM~GRARUF~GRAF~CM~AF~CRUM~UF~GM:X:X 3’ ’ UF~UM~CF~ARGRUM~GRUM~GRARUR~GRAF~CM~AF~CRUM~UF~GM:X:X 3’ ’ UF~UM~CF~ARGRUM~GRUMGFARUMGFAF~CM~AF~CRUM~UF~GM:X:X 3’ end architecture Sense: ’ CF~AMARGRUM~GRUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~CRUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ 5’ CF~AMARGRUM~GNUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GRUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~CRUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GNUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GRUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ 5’ CF~AMARGRUM~CRUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GNUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ Antisense: ’ UF~UM~CF~ARGRUM~GRUM~GRARUF~GRAF~CM~AF~CRUM~UF~GM 3’ ’ UF~UM~CF~ARGRUM~GRUM~GRARUR~GRAF~CM~AF~CRUM~UF~GM 3’ 5’ UF~UM~CF~ARGRUM~GRUMGFARUMGFAF~CM~AF~CRUM~UF~GM 3’ Asymmetric architecture Sense: ’ CF~AMARGRUM~GRUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~CRUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GNUM~CF~ARUF~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GRUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ 5’ CF~AMARGRUM~CRUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GNUM~CF~AR~UD0~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GRUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~CRUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ ’ CF~AMARGRUM~GNUM~CF~ARUN~CM~AF~CM~AF~CRUM~GR~AF~AM 3’ Antisense: ’ CF~ARGRUM~GRUM~GRARUF~GRAF~CM~AF~CRUM~UF~GM:X:X 3’ ’ UF~UM~CF~ARGRUM~GRUM~GRARUR~GRAF~CM~AF~CRUM~UF~GM:X:X 3’ ’ UF~UM~CF~ARGRUM~GRUMGFARUMGFAF~CM~AF~CRUM~UF~GM:X:X 3’ Forked variant Sense: ’ CF~AMARGRUM~GRUM~CF~ARUF~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ ’ CF~AMARGRUM~CRUM~CF~ARUF~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ 5’ CF~AMARGRUM~GNUM~CF~ARUF~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ ’ CF~AMARGRUM~GRUM~CF~AR~UD0~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ ’ CF~AMARGRUM~CRUM~CF~AR~UD0~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ ’ RGRUM~GNUM~CF~AR~UD0~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ ’ CF~AMARGRUM~GRUM~CF~ARUN~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ 5’ CF~AMARGRUM~CRUM~CF~ARUN~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ ’ CF~AMARGRUM~GNUM~CF~ARUN~CM~AF~CM~AF~GRUM~UM~AF~AM 3’ Antisense: ’ UF~UM~CF~ARGRUM~GRUM~GRARUF~GRAF~CM~AF~GRUM~UF~GM:X:X 3’ ’ UF~UM~CF~ARGRUM~GRUM~GRARUR~GRAF~CM~AF~GRUM~UF~GM:X:X 3’ 5’ UF~UM~CF~ARGRUM~GRUMGFARUMGFAF~CM~AF~GRUM~UF~GM:X:X 3’ Small internally segmented architecture Sense: ’ CF~AM~ARGRUM~GRUM~CL~AR~UM&CM~AF~CM~AL~CRUM~GR~AF~AM 3’ ’ CF~AM~ARGRUM~GRUM~CL~AR~UM&CM~AF~CM~AL~CRUM~GR~AF~AM:X:X 3’ nse: ’ UF~UM~CF~ARGRUM~GRUM~GRARUF~GRAF~CM~AF~GRUM~UF~GM:X:X 3’ 5’ UF~UM~CF~ARGRUM~GRUM~GRARUR~GRAF~CM~AF~GRUM~UF~GM:X:X 3’ ’ UF~UM~CF~ARGRUM~GRUMGFARUMGFAF~CM~AF~GRUM~UF~GM:X:X 3’ ss-siRNA ’ PUF~UM~CF~ARGRUF~GRUF~GRARUF~GRAF~CF~AF~CRUF~UF~GF:X:X 3’ ’ PUF~UM~CF~ARGRUF~GRUF~GRARUR~GRAF~CF~AF~CRUF~UF~GF:X:X 3’ ’ PUF~UM~CF~ARGRUF~GRUFGFARUMGFAF~CF~AF~CRUF~UF~GF:X:X 3’ 5’ PUF~UF~CF~ARGRUF~GRUF~GRARUF~GRAF~CF~AF~CRUF~UF~GF:X:X 3’ ’ PUF~UF~CF~ARGRUF~GRUF~GRARUR~GRAF~CF~AF~CRUF~UF~GF:X:X 3’ ’ PUF~UF~CF~ARGRUF~GRUFGFARUMGFAF~CF~AF~CRUF~UF~GF:X:X 3’ 21. seqsiRNA COMPOUNDS DIRECTED TO HUMAN/MOUSE PCSK9 FOR TIAL INDUCTION OF RNAi ACTIVITY Canonical architecture Sense: 5’ GF~CMGRGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRGRCM~CF~UM:X:X 3’ ’ GF~CMGRGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~CF~UM:X:X 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRGRCM~CF~UM:X:X 3’ ’ RGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRGRCM~GF~UM:X:X 3’ ’ GF~CMGRGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~GF~UM:X:X 3’ 5’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRGRCM~GF~UM:X:X 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUF~CM~AF~UM~ARGRGRCM~GF~UM:X:X 3’ ’ GF~CMGRGRCM~AF~GM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~GF~UM:X:X 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUN~CM~AF~UM~ARGRGRCM~GF~UM:X:X 3’ Antisense: 5’ AF~GMGRCM~CRUM~AF~UM~GRARGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRARGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAMGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ 5’ AF~GM~GRCM~CRUM~AF~UM~GRAFGMGRGRUM~GRCM~CF~GF~CM:X:X 3’ Blunt-end architecture Sense: ’ GF~CMGRGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRGRCM~CF~UM 3’ ’ RGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~CF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRGRCM~CF~UM 3’ 5’ GF~CMGRGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUF~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~GM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~GF~UM 3’ 5’ GF~CMGRGRCM~AF~GM~CM~CRUN~CM~AF~UM~ARGRGRCM~GF~UM 3’ Antisense: ’ AF~GMGRCM~CRUM~AF~UM~GRARGRGRGRUM~GRCM~CF~GF~CM 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRARGFGRGRUM~GRCM~CF~GF~CM 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGRGRGRUM~GRCM~CF~GF~CM 3’ 5’ AF~GM~GRCM~CRUM~AF~UM~GRAFGFGRGRUM~GRCM~CF~GF~CM 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAMGFGRGRUM~GRCM~CF~GF~CM 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGMGRGRUM~GRCM~CF~GF~CM 3’ Asymmetric architecture Sense: ’ GF~CMGRGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRGRCM~CF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~CF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRGRCM~CF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRGRCM~GF~UM 3’ 5’ GF~CMGRGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUF~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ RGRCM~AF~GM~CM~CR~UD0~CM~AF~UM~ARGRGRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUN~CM~AF~UM~ARGRGRCM~GF~UM 3’ Antisense: ’ AF~GMGRCM~CRUM~AF~UM~GRARGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRARGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ 5’ AF~GM~GRCM~CRUM~AF~UM~GRAMGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGMGRGRUM~GRCM~CF~GF~CM:X:X 3’ Forked variant Sense: ’ GF~CMGRGRCM~AF~CM~CM~CRUF~CM~AF~UM~ARGRCF~CM~GF~UM 3’ ’ RGRCM~AF~CM~CM~CR~UD0~CM~AF~UM~ARGRCF~CM~GF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CM~CRUN~CM~AF~UM~ARGRCF~CM~GF~UM 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUF~CM~AF~UM~ARGRCF~CM~GF~UM 3’ 5’ GF~CMGRGRCM~AF~GM~CM~CR~UD0~CM~AF~UM~ARCF~GRCM~GF~UM 3’ ’ GF~CMGRGRCM~AF~GM~CM~CRUN~CM~AF~UM~ARGRCF~CM~GF~UM 3’ Antisense: ’ AF~GMGRCM~CRUM~AF~UM~GRARGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRARGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ 5’ AF~GM~GRCM~CRUM~AF~UM~GRAFGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAMGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGMGRGRUM~GRCM~CF~GF~CM:X:X 3’ Small internally segmented architecture Sense: ’ GF~CMGRGRCM~AF~CM~CF~CM&UF~CM~AF~UM~ARGRGRCM~CF~UM:X:X 3’ ’ RGRCM~AF~CM~CF~CM&UF~CM~AF~UM~ARGRGRCM~CF~UM 3’ ’ GF~CMGRGRCM~AF~CM~CF~CM&UF~CM~AF~UM~ALGRGRCM~CF~UM:X:X 3’ 5’ GF~CMGRGRCM~AF~CM~CF~CM&UF~CM~AF~UM~ALGRGRCM~CF~UM 3’ Antisense: ’ AF~GMGRCM~CRUM~AF~UM~GRARGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRARGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGRGRGRUM~GRCM~CF~GF~CM:X:X 3’ 5’ AF~GM~GRCM~CRUM~AF~UM~GRAFGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAMGFGRGRUM~GRCM~CF~GF~CM:X:X 3’ ’ AF~GM~GRCM~CRUM~AF~UM~GRAFGMGRGRUM~GRCM~CF~GF~CM:X:X 3’ ss-siRNA ’ PAF~GMGRCF~CRUF~AF~UF~GRARGRGRGRUM~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GM~GRCF~CRUF~AF~UF~GRARGFGRGRUM~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GM~GRCF~CRUF~AF~UF~GRAFGRGRGRUF~GRCF~CF~GF~CF:X:X 3’ 5’ PAF~GM~GRCF~CRUF~AF~UF~GRAFGFGRGRUF~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GM~GRCF~CRUF~AF~UF~GRAFGFGRGRUF~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GM~GRCF~CRUF~AF~UM~GRAFGFGRGRUF~GRCF~CF~GF~CF:X:X 3’ ’ GRCF~CRUF~AF~UF~GRARGRGRGRUM~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GF~GRCF~CRUF~AF~UF~GRARGFGRGRUM~GRCF~CF~GF~CF:X:X 3’ 5’ PAF~GF~GRCF~CRUF~AF~UF~GRAFGRGRGRUF~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GF~GRCF~CRUF~AF~UF~GRAFGFGRGRUF~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GF~GRCF~CRUF~AF~UF~GRAFGFGRGRUF~GRCF~CF~GF~CF:X:X 3’ ’ PAF~GF~GRCF~CRUF~AF~UM~GRAFGFGRGRUF~GRCF~CF~GF~CF:X:X 3’ 22. seqsiRNA COMPOUNDS DIRECTED TO MOUSE FAS FOR SEQUENTIAL INDUCTION OF RNAi ACTIVITY cal architecture Sense: ’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~ARGR~AF~CM:X:X 3’ ’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~ARGR~AF~GM:X:X 3’ ’ GF~UM~GRCM~ARARGRUM~GR~CD0~ARARAF~CM~CF~ARGR~AF~GM:X:X 3’ 5’ GF~UM~GRCM~ARARGRUM~GRCN~ARARAF~CM~CF~ARGR~AF~GM:X:X 3’ nse: ’ GF~UM~CRUM~GRGRURURUF~GRCF~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRURURUF~GMCF~AMCR~UM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGMCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GFCM~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCMAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GFCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRUR~URUFGFCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GRCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ Blunt-end architecture Sense: ’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~ARGR~AF~CM 3’ ’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~ARGR~AF~GM 3’ ’ GF~UM~GRCM~ARARGRUM~GR~CD0~ARARAF~CM~CF~ARGR~AF~GM 3’ 5’ GF~UM~GRCM~ARARGRUM~GRCN~ARARAF~CM~CF~ARGR~AF~GM 3’ Antisense: ’ GF~UM~CRUM~GRGRURURUF~GRCF~AMCRUM~UF~GRCM~AF~CM 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCFAMCRUM~UF~GRCM~AF~CM 3’ ’ GF~UM~CRUM~GR~GRURURUF~GMCF~AMCR~UM~UF~GRCM~AF~CM 3’ 5’ GF~UM~CRUM~GR~GRUR~URUFGMCFAMCRUM~UF~GRCM~AF~CM 3’ ’ GF~UM~CRUM~GR~GRURURUF~GFCM~AMCRUM~UF~GRCM~AF~CM 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCMAMCRUM~UF~GRCM~AF~CM 3’ ’ CRUM~GR~GRURURUF~GFCR~AMCRUM~UF~GRCM~AF~CM 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCRAMCRUM~UF~GRCM~AF~CM 3’ 5’ GF~UM~CRUM~GR~GRURURUF~GRCR~AMCRUM~UF~GRCM~AF~CM 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCRAMCRUM~UF~GRCM~AF~CM 3’ Asymmetric architecture Sense: ’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~ARGR~AF~CM 3’ ’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~ARGR~AF~GM 3’ ’ GF~UM~GRCM~ARARGRUM~GR~CD0~ARARAF~CM~CF~ARGR~AF~GM 3’ ’ GF~UM~GRCM~ARARGRUM~GRCN~ARARAF~CM~CF~ARGR~AF~GM 3’ Antisense: ’ GF~UM~CRUM~GRGRURURUF~GRCF~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GMCF~AMCR~UM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGMCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRURURUF~GFCM~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ CRUM~GR~GRUR~URUFGFCMAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GFCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GRCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRUR~URUFGRCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ Forked variant Sense: 5’ GF~UM~GRCM~ARARGRUM~GRCF~ARARAF~CM~CF~AF~CM~AF~GM 3’ ’ GF~UM~GRCM~ARARGRUM~GR~CD0~ARARAF~CM~CF~AF~CM~AF~GM 3’ ’ GF~UM~GRCM~ARARGRUM~GRCN~ARARAF~CM~CF~AF~CM~AF~GM 3’ Antisense: ’ GF~UM~CRUM~GRGRURURUF~GRCF~AMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRUR~URUFGRCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GMCF~AMCR~UM~UF~GRCM~AF~CM:X:X 3’ ’ CRUM~GR~GRUR~URUFGMCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GFCM~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCMAMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRURURUF~GFCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GRCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ Small internally segmented architecture Sense: ’ GF~UM~GRCM~ARARGR~UM~GM&CF~ARARAF~CM~CF~ARGR~AF~CM:X:X 3’ ’ GF~UM~GRCM~ARARGR~UM~GM&CF~ARARAF~CM~CF~ARGR~AF~CM 3’ ’ GF~UM~GRCM~ARARGR~UL~GM&CF~ARARAF~CM~CL~ARGR~AF~CM:X:X 3’ 5’ GF~UM~GRCM~ARARGR~UL~GM&CF~ARARAF~CM~CL~ARGR~AF~CM 3’ nse: ’ GF~UM~CRUM~GRGRURURUF~GRCF~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GMCF~AMCR~UM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRUR~URUFGMCFAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ CRUM~GR~GRURURUF~GFCM~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCMAMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRURURUF~GFCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGFCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ 5’ GF~UM~CRUM~GR~GRURURUF~GRCR~AMCRUM~UF~GRCM~AF~CM:X:X 3’ ’ GF~UM~CRUM~GR~GRUR~URUFGRCRAMCRUM~UF~GRCM~AF~CM:X:X 3’ ss-siRNA 5’ PGF~UM~CRUF~GRGRURURUF~GRCF~AFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRUR~URUFGRCFAFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRURURUF~GFCF~AFCR~UF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRUR~URUFGFCFAFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRURURUF~GFCF~AMCRUF~UF~GRCF~AF~CF:X:X 3’ 5’ PGF~UM~CRUF~GR~GRUR~URUFGFCFAFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRURURUF~GFCR~AFCRUM~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRUR~URUFGFCRAFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRURURUF~GRCR~AFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UM~CRUF~GR~GRUR~URUFGRCRAFCRUF~UF~GRCF~AF~CF:X:X 3’ 5’ PGF~UF~CRUF~GRGRURURUF~GRCF~AFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UF~CRUF~GR~GRUR~URUFGRCFAFCRUF~UF~GRCF~AF~CF:X:X 3’ ’ PGF~UF~CRUF~GR~GRURURUF~GFCF~AFCR~UF~UF~GRCF~AF~CF:X:X 3’ 23. seqsiRNA COMPOUNDS DIRECTED TO MOUSE STAT3 FOR SEQUENTIAL INDUCTION OF RNAi TY Canonical architecture Sense: 5’ M~CF~CM~ARGRGRARCF~GRAMCRUM~UFUM~GR~AF~UM:X:X 3’ ’ CF~CMUM~CF~CM~CMGRGRARGF~GRAMCRUM~UFUM~GR~AF~UM:X:X 3’ ’ CF~CMUM~CF~CM~CMGRGRAR~CD0~GRAMCRUM~UFUM~GR~AF~UM:X:X 3’ ’ CF~CMUM~CF~CM~CMGRGRARCN~GRAMCRUM~UFUM~GR~AF~UM:X:X 3’ Antisense: 5’ AF~UM~CF~ARARARGRUF~CF~GRUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GMUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUM~CM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARAR~ARGRUF~CFGRUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGMUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUMCM~CRUF~GRGRAF~GF~GM:X:X 3’ Blunt-end ecture Sense: ’ CF~CMUM~CF~CM~ARGRGRARCF~GRAMCRUM~UFUM~GR~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRARGF~GRAMCRUM~UFUM~GR~AF~UM 3’ 5’ CF~CMUM~CF~CM~CMGRGRAR~CD0~GRAMCRUM~UFUM~GR~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRARCN~GRAMCRUM~UFUM~GR~AF~UM 3’ Antisense: ’ AF~UM~CF~ARARARGRUF~CF~GRUF~CM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARARARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM 3’ 5’ AF~UM~CF~ARARARGRUF~CF~GFUF~CM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARARARGRUF~CF~GMUF~CM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUM~CM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGRUFCM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARAR~ARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM 3’ 5’ AF~UM~CF~ARAR~ARGRUF~CFGFUFCM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGMUFCM~CRUF~GRGRAF~GF~GM 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUMCM~CRUF~GRGRAF~GF~GM 3’ Asymmetric architecture Sense: ’ CF~CMUM~CF~CM~ARGRGRARCF~GRAMCRUM~UFUM~GR~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRARGF~GRAMCRUM~UFUM~GR~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRAR~CD0~GRAMCRUM~UFUM~GR~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRARCN~GRAMCRUM~UFUM~GR~AF~UM 3’ Antisense: ’ AF~UM~CF~ARARARGRUF~CF~GRUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ CF~ARARARGRUF~CF~GMUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARARARGRUF~CF~GFUM~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGRUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGMUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARAR~ARGRUF~CFGFUMCM~CRUF~GRGRAF~GF~GM:X:X 3’ Forked variant Sense: ’ CF~CMUM~CF~CM~ARGRGRARCF~GRAMCRUM~AF~UM~CM~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRARGF~GRAMCRUM~AF~UM~CM~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRAR~CD0~GRAMCRUM~AF~UM~CM~AF~UM 3’ ’ CF~CMUM~CF~CM~CMGRGRARCN~GRAMCRUM~AF~UM~CM~AF~UM 3’ Antisense: ’ AF~UM~CF~ARARARGRUF~CF~GRUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ CF~ARARARGRUF~CF~GMUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARARARGRUF~CF~GFUM~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGRUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGMUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARAR~ARGRUF~CFGFUMCM~CRUF~GRGRAF~GF~GM:X:X 3’ Small ally segmented architecture Sense: ’ CF~CMUM~CF~CM~AR~GF~GM&AM~CF~GRAMCRUM~UFUM~GR~AF~UM:X:X 3’ ’ CF~CMUM~CF~CL~AR~GF~GM&AM~CF~GRAMCRUL~UFUM~GR~AF~UM:X:X 3’ ’ CF~CMUM~CF~CM~AR~GF~GM&AM~CF~GRAMCRUM~UFUM~GR~AF~UM 3’ ’ CF~CMUM~CF~CL~AR~GF~GM&AM~CF~GRAMCRUL~UFUM~GR~AF~UM 3’ 5’ CF~CMUM~CF~CM~ARGR~GF~AM&CF~GRAMCLUM~UFUL~GR~AF~UM:X:X 3 ’ CF~CMUM~CL~CM~ARGR~GF~AM&CF~GRAMCLUM~UFUL~GR~AF~UM:X:X 3 ’ CF~CMUL~CF~CM~ARGR~GL~AM&CF~GLAMCLUM~UFUL~GR~AF~UM:X:X 3 ’ CF~CMUM~CF~CM~ARGR~GF~AM&CF~GRAMCLUM~UFUL~GR~AF~UM 3 ’ CF~CMUM~CL~CM~ARGR~GF~AM&CF~GRAMCLUM~UFUL~GR~AF~UM 3 5’ CF~CMUL~CF~CM~ARGR~GL~AM&CF~GLAMCLUM~UFUL~GR~AF~UM3 Antisense: ’ AF~UM~CF~ARARARGRUF~CF~GRUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARARARGRUF~CF~GMUF~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARARARGRUF~CF~GFUM~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ CF~ARAR~ARGRUF~CFGRUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CF~GRUR~CM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ 5’ AF~UM~CF~ARAR~ARGRUF~CFGMUFCM~CRUF~GRGRAF~GF~GM:X:X 3’ ’ AF~UM~CF~ARAR~ARGRUF~CFGFUMCM~CRUF~GRGRAF~GF~GM:X:X 3’ ss-siRNA 5’ PAF~UM~CF~ARARARGRUF~CF~GRUF~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARARARGRUF~CF~GRUR~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARARARGRUF~CF~GFUF~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARARARGRUF~CF~GFUF~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARARARGRUF~CF~GFUF~CF~CRUF~GRGRAF~GF~GF:X:X 3’ 5’ PAF~UM~CF~ARAR~ARGRUF~CFGRUFCF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARAR~ARGRUF~CF~GRUR~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARAR~ARGRUF~CFGFUFCF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARAR~ARGRUF~CFGFUFCF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UM~CF~ARAR~ARGRUF~CFGFUFCF~CRUF~GRGRAF~GF~GF:X:X 3’ 5’ PAF~UF~CF~ARARARGRUF~CF~GRUF~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UF~CF~ARARARGRUF~CF~GRUR~CF~CRUF~GRGRAF~GF~GF:X:X 3’ ’ PAF~UF~CF~ARARARGRUF~CF~GFUF~CF~CRUF~GRGRAF~GF~GF:X:X 3’ 24. seqRNAi siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense Strands: ’ A~C~C~U~A-U-G-G-A~A~A~C~U~A~C~U~U 3’ (#) ’ C~A~G~A~C~C~U~A-U-G-G-A~A~A~C~U~A~C~U~U 3’ (#) ’ C~A~G~A~C~C~U~A-U-G-G-A~A-A~C~U~A~C~U~U 3’ (#) 5’ C~A~G~A~C~C~U~A-U-Y-G-A~A-A~C~U~A~C~U~U 3’ (#) ’ C~A~G~A~C~C~U~A-U-Y-G-A~A-A~C~U~A~C*~U~U 3’ (#) ’ C~A~G~A~C~C*~U~A-U-Y-G-A~A-A~C~U~A~C*~U~U 3’ (#) ’ C~A~G~A~C~C~U~A~U-Y~G~A~A~A~C~U~A~C*~U~U 3’ (#) ’ C~A~G~A~C~C*~U~A~U~Y~G~A~A~A~C~U~A~C*~U~U 3’ (#) 5’ C~A~G~A~C~C~U~A~U-G*~G~A~A~A~C~U~A~C*~U~U 3’ (#) ’ C~A~G~A~C~C*~U~A~U~G~G*~A~A~A~C~U~A~C*~U~U 3’ (#) ’ C~A~G~A~C~C~U~A~U~GXG~A~A~A~C~U~A~C~U~U 3’ (#) ’ A~C~C~U~A~U~G~G~A~A~A~C~U~A~C 3’ (#) Antisense Strands: 5' U~A~G-U~U-U-C-C-A-U~A-G~G~U~C~U~G 3' (#) ' A~A~G~U~A~G-U~U-U-C-C-A-U~A-G~G~U~C~U~G 3' (#) ' A~A~G~U~A~G-U~U-U-C-C-A-U~A-G~G~U~C~U~G 3' (#) ' A~A~G~U~A~G-U~U-U-C-C-A-U~A-G~G~U~C~U~G 3' (#) ' A~A~G~U~A~G~U-U-U-C-C-A-U-A~G~G~U~C~U~G 3' (#) ' A~A~G~U*~A~G-U~U-U-C-C-A-U~A-G~G~U~C~U~G 3' (#) ' A~A~G~U~A~G~U*-U-U-C-C-A-U-A~G~G~U~C~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes ent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the nse strand which may be in italics are the ones opposite the argonaute 2 cleavage site . seqRNAi siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense Strands: ’ C~C~G~U~C~C~C~A-A-G-C-A~A~U~G~G~A~C~G~A 3’ (#) ’ C~C~G~U~C~C~C~A-A-G-C-A~A~U~G~G~A~C~G~A 3’ (#) ’ C~C~G~U~A~C~C~A~A~A~C~A~A~U~G~G~A~U~G~A 3’ (#) ’ C~C~G~U~C~C~C~A-A-Y-C-A~A~U~G~G~A~C~G~A 3’ (#) 5’ C~C~G~U~C~C~C~A-A-Y-C-A~A~U~G~G~A*~C~G~A 3’ (#) ’ C~C~G~U~C~C~C*~A-A-Y-C-A~A~U~G~G~A*~C~G~A 3’ (#) ’ C~C~G~U~C~C~C~A~A~Y~C~A~A~U~G~G~A~C~G~A 3’ (#) ’ C~C~G~U~C~C~C~A~A~Y~C~A~A~U~G~G~A*~C~G~A 3’ (#) ’ C~C~G~U~C~C~C*~A~A~Y~C~A~A~U~G~G~A*~C~G~A 3’ (#) 5’ C~C~G~U~C~C~C~A~A~GXC~A~A~U~G~G~A~C~G~A 3’ (#) ’ G~U~C~C~C~A~A~G~C~A~A~U~G~G~A 3’ (#) ’ G~U~C~C~C~A~A*~G~C~A~A~U~G~G~A 3’ (#) Antisense Strands: ' U~C~G~U~C~C-A-U-U-G-C-U-U-G-G~G~A~C~G~G 3' (#) 5' U~C~G~U~C~C-A-U-U-G-C-U-U-G-G~G~A~C~G~G 3' (#) ' U~C~G~U~C~C-A-U-U-G-C-U-U-G-G~G~A~C~G~G 3' (#) ' U~C~G~U~C~C-A-U-U-G-C-U-U-G-G~G~A~C~G~G 3' (#) ' U~C~G~U~C~C-A~U-U-G-C-U-U~G-G~G~A~C~G~G 3' (#) ' U~C~G~U*~C~C-A~U-U-G-C-U-U~G-G~G~A~C~G~G 3' (#) 5' U~C~G~U~C~C-A*~U-U-G-C-U-U~G-G~G~A~C~G~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 26. i siRNA Compounds Directed to Human p53 for tial ion of RNAi Sense s: 5’ C~C~G~A~G~U~G~G-A-A-G-G~A~A~A~U~U~U 3’ (#) Antisense Strands: ' A~A~A~U~U-U-C-C-U-U-C-C-A-C~U~C~G~G 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or ethyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 27. seqRNAi siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense Strands: 5’ G~G~A~G~A~A~U~A-U-U-U-C~A~C~C~C~U~U 3’ (#) Antisense Strands: ' A~A~G~G~G-U-G-A-A-A-U-A-U-U~C~U~C~C 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter tes it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X tes the lack of a linkage ) Any Y tes an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 28. seqRNAi siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense s: 5’ G~G~A~G~G~G~A~G-A-A-U-A~U~U~U~C~A~C~C~C~U 3’ (#) Antisense Strands: ' G~A~G~G~G-U-G-A-A-A-U-A-U-U-C-U-C-C~C~U~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These sides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones te the argonaute 2 cleavage site 29. seqRNAi siRNA Compounds Directed to Human p53 for tial induction of RNAi Sense s: ’ G~G~A~C~G~G~A~A-C-A-G-C~U~U~U~G~A~G~G~U 3’ (#) Antisense s: ' A~C~C~U~C-A-A-A-G-C-U-G-U-U-C-C~G~U~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate es 3) Any asterisk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 on 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site . i siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense Strands: ’ C~A~U~G~U~U~C~A-A-G-A-C~A~G~A~A~G~G~G~C~C 3’ (#) nse Strands: 5' G~G~C~C~C-U-U-C-U-G-U-C-U-U-G-A-A~C~A~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group 8) The 5'end of an nse strand may have a sphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 31. i siRNA Compounds Directed to Human Fas for sequential induction of RNAi Sense s: 5’ G~G~A~A~G~A~C~U-G-U-U-A~C~U~A~C~A~G~T~T 3’ (#) nse Strands: ' A~G~A~C~U-G-U-A-G-U-A-A-C-A-G-U-C~U~U~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 32. seqRNAi siRNA Compounds Directed to Human Fas for tial induction of RNAi Sense Strands: ’ G~U~G~A~U~G~A~A-G-G-A-C-A~U~G~G~C~U~U~A 3’ (#) Antisense Strands: ' U~A~A~G~C-C-A-U-G-U-C-C-U-U-C-A~U~C~A~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more uous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 33. seqRNAi siRNA nds Directed to Human Fas for sequential induction of RNAi Sense Strands: ’ G~C~C~A~U~G~A~A-G-G-A-C~A~U~G~G~C~U~U~A 3’ (#) Antisense Strands: ' U~A~A~G~C-C-A-U-G-U-C-C-U-U-C-A~U~G~G~C 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be ated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the ute 2 cleavage site 34. seqRNAi siRNA nds Directed to Human Fas for sequential induction of RNAi Sense Strands: ’ G~A~A~G~C~G~U~A-U-G-A-C~A~C~A~U~U~G~A~T 3’ (#) Antisense Strands: ' A~U~C~A~A-U-G-U-G-U-C-A-U-A-C-G~C~U~U~C 3' (#) 1) The nucleosides shown in bold have the ethyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes ent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 35. seqRNAi siRNA Compounds Directed to Human Fas for sequential induction of RNAi Sense Strands: ’ G~G~A~C~A~U~U~A-C-U-A-G~U~G~A~C~U~C~A 3’ (#) Antisense Strands: ' U~G~A~G~U-C-A-C-U-A-G-U-A-A-U~G~U~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any sk after a letter indicates it is an ed nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones te the argonaute 2 cleavage site 36. seqRNAi siRNA Compounds Directed to Murine ApoB for sequential induction of RNAi Sense Strands: ' A~C~U~U~C-C-U-G-A~A~U~A~A~C~U~A 3' (#) Antisense Strands: ' U~A~G~U~U-A-U-U-C-A-G-G-A-A-G~U~C~U~A 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more uous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an ed c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 on 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 37. seqRNAi siRNA Compounds Directed to Human/Murine ApoB for sequential induction of RNAi Sense Strands: ’ A~G~G~G~U~G~U~A-U-G-G-C-U~U~C~A~A~C~C~C~U 3’ (#) Antisense Strands: ' A~G~G~G~U-U-G-A-A-G-C-C-A-U-A-C-A~C~C~C~U 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native . 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate es 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the ute 2 cleavage site 38. seqRNAi siRNA Compounds ed to Human/Murine ApoB for sequential induction of RNAi Sense Strands: ’ G~G~A~G~U~U~U~G-U-G-A-C~A~A~A~U~A~U~G~G~G~C~A 3’ (#) nse Strands: ' U~G~C~C~C-A-U-A-U-U-U-G-U-C-A-C-A-A-A~C~U~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y tes an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 39. seqRNAi siRNA nds Directed to Human/Murine ApoB for sequential ion of RNAi Sense s: ’ G~A~U~U~G~A~U~U-G-A-C~C~U~G~U~C~C~A~U~U 3’ (#) Antisense Strands: ' A~A~U~G~G-A-C-A-G-G-U-C-A-A-U-C~A~A~U~C 3' (#) 1) The sides shown in bold have the ethyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 40. seqRNAi siRNA Compounds Directed to Human/Murine ApoB for tial induction of RNAi Sense Strands: ’ G~U~A~U~U~C~A~C-A-C-U-G~A~A~U~A~C~C~A~A~U 3’ (#) Antisense Strands: ' A~U~U~G~G-U-A-U-U-C-A-G-U-G-U-G-A~A~U~A~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an ed nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 on 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 ge site 41. seqRNAi siRNA Compounds Directed to Human ApoB for sequential induction of RNAi Sense Strands: ’ G~G~U~G~C~G~A~A-G-C-A-G~A~C~U~G~A~G~G~C~T~A 3’ (#) Antisense Strands: ' T~A~G~C~C-U-C-A-G-U-C-U-G-C-U-U-C-G~C~A~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate es 3) Any asterisk after a letter tes it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 42. seqRNAi siRNA Compounds Directed to Human ApoB for sequential induction of RNAi Sense Strands: 5’ U~G~C~G~A~A~G~C~A~G~A~C~U~G~A 3’ (#) Antisense Strands: ' G~C~C~U~C-A-G-U-C-U-G-C-U-U-C-G-C~A~G~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent odiester es and ~ represents phosphorothioate linkages 3) Any sk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y tes an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 43. seqRNAi siRNA nds Directed to Human ApoB for sequential induction of RNAi Sense Strands: ’ C~G~G~C~A~U~U~C-G-G-C-U~A~U~G~U~G~U~U 3’ (#) Antisense Strands: ' A~A~C~A-C-A-U-A-G-C-C-G-A-A-U~G~C~C~G 3' (#) Sense Strands as 16-mer: ’ C~G~G~C~A~U~U~C-G-G-C-U~A~U~G~U 3’ (#) Antisense Strands as 16-mer: ' A~C~A~U~A-G-C-C-G-A-A-U-G~C~C~G 3' 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ ents phosphorothioate es 3) Any sk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two sides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 44. seqRNAi siRNA Compounds Directed to Human ApoB for tial induction of RNAi Sense Strands: ’ C~A~C~A~G~G~G~C~U~C~A~C~C~C~U 3’ (#) Antisense Strands: ' U~C~A~G~G-G-U-G-A-G-C-C-C-U-G-U~G~U~G~U 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent odiester linkages and ~ represents phosphorothioate es 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 45. seqRNAi siRNA nds Directed to Human/Murine/Rat/Nonhuman Primate PCSK9 for sequential ion of RNAi Sense Strands: 5’ C~U~A~G~A~C~C~U-G-U-U-U~U~G~C~U~U~U 3’ (#) Antisense Strands: ' A~A~A~G~C-A-A-A-A-C-A-G-G-U~C~U~A~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor ined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 46. seqRNAi siRNA Compounds Directed to Human/Murine/Rat/Nonhuman Primate PCSK9 for sequential induction of RNAi Sense Strands: ’ G~A~G~G~U~G~U~A-U-C-U-C~C~U~A~G~A~C~A 3’ (#) Antisense Strands: ' U~G~U~C~U-A-G-G-A-G-A-U-A-C-A~C~C~U~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ ents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These sides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the ute 2 cleavage site 47. seqRNAi siRNA Compounds Directed to Human/Murine/Rat/Nonhuman Primate PCSK9 for tial induction of RNAi Sense Strands: ’ G~A~G~G~U~G~U~A-U-C-U-C~C~U~C~G~A~C~A 3’ (#) Antisense Strands: ' U~G~U~C~G-A-G-G-A-G-A-U-A-C-A~C~C~U~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more uous dashes ent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 on 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a sphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones te the argonaute 2 cleavage site 48. seqRNAi siRNA Compounds Directed to Human PCSK9 for sequential induction of RNAi Sense Strands: ’ G~G~G~U~G~G~U~C-A-G-C-G~G~C~C~G~G~G~A~U 3’ (#) Antisense Strands: ' C~C-G-G-C-C-G-C-U-G-A-C-C~A~C~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ ents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 49. seqRNAi siRNA Compounds Directed to Human PCSK9 for sequential induction of RNAi Sense Strands: ’ G~C~U~G~C~C~C~A-C-G-U-G~G~C~U~G~G~C~A~U 3’ (#) Antisense Strands: ' A~U~G~C~C-A-G-C-C-A-C-G-U-G-G-G~C~A~G~C 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or ethyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the nse strand which may be in s are the ones opposite the ute 2 cleavage site 50. seqRNAi siRNA Compounds Directed to Human PCSK9 for sequential induction of RNAi Sense Strands: ’ G~C~U~G~C~C~C~A~C~G~U~G~G~C~U 3’ (#) Antisense Strands: 5' C~C~A~G~C-C-A-C-G-U-G-G-G-C-A-G~C~A~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent odiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y tes an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 51. seqRNAi siRNA Compounds Directed to Human PCSK9 for sequential induction of RNAi Sense Strands: 5’ G~G~U~G~A~G~G~G~U~G~U~C~U~A~C 3’ (#) Antisense Strands: ' G~G~C~G~U-A-G-A-C-A-C-C-C-U-C-A-C~C~G~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are oro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or ethyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 52. seqRNAi siRNA Compounds Directed to Human PTEN for sequential induction of RNAi Sense Strands: ’ C~G~U~U~A~G~C~A-G-A-A-A~C~A~A~A~A~G~G~A 3’ (#) ’ C~G~U~U~A~G~C~A-G-A-A~A-C~A~A~A~A~G~G~A 3’ (#) ’ C~G~U~U~A~G*~C~A-G-A-A~A-C~A~A~A~A~G~G~A 3’ (#) ’ U~A~G*~C~A-G-A-A~A-C~A~A~A~A*~G~G~A 3’ (#) 5’ C~G~U~U~A~G~Y~A-G-A-A-A~C~A~A~A~A~G~G~A 3’ (#) ’ C~G~U~U~A~G~Y~A-G-A-A-A~C~A~A~A~A*~G~G~A 3’ (#) ’ C~G~U~U~A~G~C~A-G-Y-A-A~C~A~A~A~A*~G~G~A 3’ (#) ’ C~G~U~U~A~G*~C~A-G-Y-A-A~C~A~A~A~A*~G~G~A 3’ (#) ’ C~G~U~U~A~G*~C~A~G~Y~A~A~C~A~A~A~A*~G~G~A 3’ (#) 5’ C~G~U~U~A~U~C~A-G-A-A~A-C~A~A~U~A~G~G~A 3’ (#) ’ U~A~U~C~G-G-A-A~A-C~A~A~U~A~G~G~A 3’ (#) ’ C~G~U~U~A~G~C~A~G~AXA~A~C~A~A~A~A~G~G~A 3’ (#) ’ U~A~G~C~A~G~A~A~A~C~A~A~A~A 3’ (#) ’ U~A~G~C~A~G~A+~A~A~C~A~A~A~A 3’ (#) Antisense Strands: ' U~C~C~U~U-U-U-G-U-U-U-C-U-G-C-U~A~A~C~G 3' (#) ' U~C~C~U~U~U-U-G-U-U-U-C-U-G-C~U~A~A~C~G 3' (#) ' U~C~C~U~U~U-U~G-U-U-U-C-U~G-C~U~A~A~C~G 3' (#) ' U~C~C~U~U~U-U~G-U-U-U-C-U~G-C~U~A~A~C~G 3' (#) ' U~C~C~U~U~U-U~G-U-U-U-C-U~G-C~U~A~A~C~G 3' (#) ' U~C~C~U~U~U-U~G-U-U-U-C-U~G-C~U~A~A~C~G 3' (#) ' U~U~U~U~G-U-U-U-C-U~G~C~U~A~A~C~G 3' (#) 1) The nucleosides shown in bold have the ethyl modification, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any plus after a letter indicates it is an locked c acid monomer (LNA).

) Any X indicates the lack of a linkage 6) Any Y indicates an abasic nucleoside 7) The C in any CpG may be methylated at the C5 on 8) The 5'end of the sense strand may have a 5'methyl group 9) The 5'end of an antisense strand may have a 5'-phosphate group ) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 53. seqRNAi siRNA Compounds ed to Human/Murine PTEN for sequential induction of RNAi Sense Strands: 5’ A~A~G~U~A~A~G~G~AXC~C~A~G~A~G~A~C~A~A 3’ (#) ’ G~U~A~A~G~G-A~C~C~A~G~A~G~A~C 3’ (#) Antisense Strands: ' U~U~G~U~C-U~C-U-G-G-U-C-C~U-U~A~C~U~U 3' (#) ' U~U~G~U~C~U~C-U~G-G-U-C-C~U-U~A~C~U~U 3' (#) 5' U~U~G~U~C~U~C-U~G-G-U-C-C~U-U~A~C~U~U 3' (#) ' U~U~G~U~C~U~C-U~G-G-U-C-C~U-U~A~C~U~U 3' (#) ' U~U~G~U~C~U~C-U~G-G-U-C-C~U-U~A~C~U~U 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These sides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two sides in positions 10 and 11 from the 5'-end of the antisense strand which may be in s are the ones opposite the argonaute 2 cleavage site 54. seqRNAi siRNA Compounds Directed to Human PTP-1B for sequential induction of RNAi Sense Strands: ' U~A~G~G~U~A~C~A-G-A-G~A-C~G~U~C~A~G~U 3' (#) ' U~A~G~G~U~A~C~A-G-A-G-A~C~G~U~C~A~G~U 3' (#) ' U~A~G~G~U~A~C~A-G-A-G-A~C~G~U~C~A~G~U 3' (#) 5' U~A~G~G~U~A*~C~A-G-A-G-A~C~G~U~C~A~G~U 3' (#) ' U~A~G~G~U~A*~C~A-G-A-G-A~C~G~U~C*~A~G~U 3' (#) ' U~A~G~G~U~A~C-Y-G-A-G-A~C~G~U~C~A~G~U 3' (#) ' U~A~G~G~U~A~C-Y-G-A-G-A~C~G~U~C~G~G~U 3' (#) Antisense Strands: 5' A~C~U~G~A-C-G-U-C-U-C-U-G-U-A~C~C~U~A 3' (#) ' A~C~U~G~A~C-G~U-C-U-C-U-G~U-A~C~C~U~A 3' (#) ' A~C~U~G~A~C-G~U-C-U-C-U-G~U-A~C~C~U~A 3' (#) ' A~C~U~G~A~C-G~U-C-U-C-U-G~U-A~C~C~U~A 3' (#) ' A~C~U~G~A~C~G-U~C-U-C-U~G-U~A~C~C~U~A 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X tes the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 55. seqRNAi siRNA Compounds Directed to Human PTEN for sequential induction of RNAi Sense Strands: 5’ G~G~G~A~A~A~A~U~A~C~A~U~U~C~U~U~U~C~C 3’ (#) ’ G~G~G~A~A~A~A~U~A~CXA~U~U~C~U~U~C~C~C 3’ (#) ’ G~G~G~A~A~A~A~U~A~C~A~U~U~C~U~U*~C~C~C 3’ (#) ’ G~G~G~A~A~A~A~U~A~Y~A~U~U~C~U~U*~C~C~C 3’ (#) ’ G~G~G~A~A*~A~A~U~A~Y~A~U~U~C~U~U*~C~C~C 3’ (#) 5’ G~A~A~A~A~U~A~C~A~U~U~C~U~U~C 3’ (#) Antisense Strands: ' G~G~G~A~A~G-A-A-U-G-U-A-U-U~U~U~C~C~C 3' (#) ' G~G~G~A~A~G-A-A-U-G-U-A-U-U~U~U~C~C~C 3' (#) ' G~G~G~A~A~G-A~A-U-G-U-A-U-U~U~U~C~C~C 3' (#) 5' G~G~G~A~A~G-A~A-U-G-U-A-U-U~U~U~C~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate es 3) Any sk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the nse strand which may be in s are the ones opposite the argonaute 2 cleavage site 56. seqRNAi siRNA Compounds Directed to Human/Nonhuman Primate PTEN for sequential induction of RNAi Sense Strands: 5’ G~G~G~U~A~A~A~U-A-C-A-U-U~C~U~U~C~A~U 3’ (#) ’ G~G~G~U~A~A~A~U-A-Y-A-U-U~C~U~U~C~A~U 3’ (#) ’ U~A*~A~A~U-A-Y-A-U-U~C~U~U~C~A~U 3’ (#) ’ G~G~G~U~A*~A~A~U~A~Y~A~U~U~C~U~U~C~A~U 3’ (#) ’ G~G~G~U~A*~A~A~U-A-Y-A-U-U~C~U~U*~C~A~U 3’ (#) 5’ G~G~G~U~A*~A~A~U~A~Y~A~U~U~C~U~U*~C~A~U 3’ (#) ’ G~G~G~U~A~A~A~U-A-C-A-U-U~C~U~C~C~A~U 3’ (#) ’ G~G~G~C~A~A~A~U-A-C-A-U-U~C~U~C~C~A~U 3’ (#) ’ G~G~G~C~A~A~A~U-A-C-G-U-U~C~U~C~C~A~U 3’ (#) ’ G~G~G~U~A~A~A~U~A~CXA~U~U~C~U~U~C~A~U 3’ (#) 5’ G~U~A~A~A~U~A~C~A~U~U~C~U~U~C 3’ (#) Antisense Strands: ' A~U~G~A~A-G~A-A-U-G-U-A-U~U~U~A~C~C~C 3' (#) ' A~U~G~A~A~G-A~A-U-G-U-A-U~U-U~A~C~C~C 3' (#) ' A~U~G~A~A~G~A~A~U-G-U-A~U~U~U~A~C~C~C 3' (#) 5' A~U~G~A~A~G~A*~A~U-G-U-A~U~U~U~A~C~C~C 3' (#) ' A~U~G~A~A~G~A~A~U-G-U-A~U~U~U~A*~C~C~C 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 57. i siRNA Compounds Directed to Mouse PTEN for sequential induction of RNAi Sense Strands: ’ G~G~G~U~A~A~A~U-A-C-G-U-U~C~U~U~C~A~U 3’ (#) ’ G~G~G~U~A~A~A~U-A-Y-G-U-U~C~U~U~C~A~U 3’ (#) ’ G~G~G~U~A*~A~A~U-A-Y-G-U-U~C~U~U~C~A~U 3’ (#) ’ G~G~G~U~A*~A~A~U~A~Y~G~U~U~C~U~U~C~A~U 3’ (#) 5’ G~G~G~U~A*~A~A~U-A-Y-G-U-U~C~U~U*~C~A~U 3’ (#) ’ G~G~G~U~A*~A~A~U~A~Y~G~U~U~C~U~U*~C~A~U 3’ (#) ’ G~G~G~U~A~A~A~U-A-C-G-U-U~C~U~C~C~A~U 3’ (#) ’ G~G~G~C~A~A~A~U-A-C-G-U-U~C~U~C~C~A~U 3’ (#) ’ G~G~G~C~A~A~A~U-A-C-G-U-U~C~U~C~C~A~U 3’ (#) 5’ G~G~G~U~A~A~A~U~A~CXG~U~U~C~U~U~C~A~U 3’ (#) ’ G~U~A~A~A~U~A~C~G~U~U~C~U~U~C 3’ (#) Antisense Strands: ' A~U~G~A~A-G~A-A-C-G-U-A-U~U~U~A~C~C~C 3' (#) ' A~U~G~A~A~G-A~A-C-G-U-A-U~U-U~A~C~C~C 3' (#) 5' A~U~G~A~A~G~A~A~C-G-U-A~U~U~U~A~C~C~C 3' (#) ' A~U~G~A~A~G~A*~A~C-G-U-A~U~U~U~A~C~C~C 3' (#) ' A~U~G~A~A~G~A~A~C-G-U-A~U~U~U~A*~C~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent odiester linkages and ~ represents phosphorothioate linkages 3) Any sk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or ethyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 on 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 58. seqRNAi siRNA Compounds Directed to Human/Mouse PCSK9 for sequential induction of RNAi Sense s: ’ G~C~C~U~G~G~A~G-U-U-U-A~U~U~C~G~G~A~A 3’ (#) ’ G~C~C~U~G~G~A~G-U-U-U-A~U~U~C~G~G~A~A 3’ (#) 5’ G~C~C~U~G~G~A~G-U-U-U-A~U~U~C~G~G~A~A 3’ (#) ’ G~C~C~U~G~G~A~G-U-U-U~A-U~U~C~G~G~A~A 3’ (#) ’ U~G~G*~A~G-U-U-U~A-U~U~C~G~G~A~A 3’ (#) ’ G~C~C~U~G~G*~A~G-U-U-U~A-U~U~C~G*~G~A~A 3’ (#) ’ G~C~C~U~G~G*~A~G-U-Y-U-A~U~U~C~G*~G~A~A 3’ (#) 5’ G~C~C~U~G~G*~A~G~U~Y~U~A~U~U~C~G*~G~A~A 3’ (#) ’ G~C~C~U~G~U~A~G-U-U-U-A~U~U~C~G~U~A~A 3’ (#) ’ G~C~C~U~G~U~A~G~U-C-U~A~U~U~C~G~U~A~A 3’ (#) ’ G~C~C~U~G~G~A~G~U~UXU~A~U~U~C~G~G~A~A 3’ (#) ’ C~U~G~G~A~G~U~U~U~A~U~U~C~G~G 3’ (#) Antisense Strands: ' U~U~C~C~G-A~A-U-A-A-A-C-U~C-C~A~G~G~C 3' (#) ' U~U~C~C~G-A~A-U-A-A-A-C-U~C-C~A~G~G~C 3' (#) ' U~U~C~C~G-A~A-U-A-A-A-C-U~C-C~A~G~G~C 3' (#) ' U~U~C~C~G-A~A-U-A-A-A-C-U~C-C~A~G~G~C 3' (#) ' U~U~C~C~G~A-A~U-A-A-A-C~U-C~C~A~G~G~C 3' (#) ' U~U~C~C~G*~A-A~U-A-A-A-C~U-C~C~A~G~G~C 3' (#) ' U~U~C~C~G~A-A*~U-A-A-A-C~U-C~C~A~G~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes ent phosphodiester linkages and ~ represents phosphorothioate es 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be ated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 59. seqRNAi siRNA Compounds Directed to Mouse PTP1B for sequential induction of RNAi Sense Strands: ’ G~A~A~G~C~C~C~A-G-A-G~G-A~G~C~U~A~U~A 3’ (#) 5’ G~A~A~G~C~U~C~A-G-U-G~G-A~U~C~U~A~U~A 3’ (#) ’ G~A~A~G~C~U~C~A-G-A-G-G~A~U~C~U~A~U~A 3’ (#) ’ G~A~A~G~C~C~C-A-Y-A-G~G-A~G~C~U~A~U~A 3’ (#) ’ G~A~A~G~C~C~C~A~Y~A~G~G~A~G~C~U~A~U~A 3’ (#) ’ G~A~A~G~C~C~C~A~Y~A~G~G~A~G~C*~U~A~U~A 3’ (#) 5’ G~A~A~G~C~C~C~A-Y-A-G~G-A~G~C*~U~A~U~A 3’ (#) ’ G~A~A~G~C*~C~C~A-Y-A-G~G-A~G~C*~U~A~U~A 3’ (#) ’ G~C*~C~C~A-G*-A-G~G-A~G~C*~U~A~U~A 3’ (#) ’ G~A~A~G~C*~C~C~A-G-A*-G~G-A~G~C~U*~A~U~A 3’ (#) ’ G~A~A~G~C~C~C~A~GXA~G~G~A~G~C~U~A~U~A 3’ (#) ’ G~C~C~C~A~G~A~G~G~A~G~C~U~A 3’ (#) Antisense Strands: ' U~A~U~A~G~C-U~C-C-U-C-U-G~G-G~C~U~U~C 3' (#) ' U~A~U~A~G~C-U~C-C-U-C-U-G~G-G~C~U~U~C 3' (#) ' U~A~U~A~G~C-U~C-C-U-C-U-G~G-G~C~U~U~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more uous dashes represent odiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in s are the ones opposite the argonaute 2 cleavage site 60. seqRNAi siRNA Compounds Directed to Human/Mouse PTP1B for sequential induction of RNAi Sense Strands: ’ U~C~A~A~A~G~U~C-C-G-A-G~A~G~U~C~a~g~g 3’ (#) 5’ U~C~A~A~A~G~U~C-C-G-A-G~A~G~U~C~a~g~g 3’ (#) ’ U~C~A~A~A~G~U~C-C-G-A-G~A~G~U~C~A~G~A 3’ (#) ’ U~C~A~A~A~G~U~C-C-G-A-G~A~G~U~C~A~A~G 3’ (#) ’ U~C~A~A~A~G~U~C-C-G-A-G~A~G~U~C~U~A~G 3’ (#) ’ U~C~A~A~A~G~U~C-C-Y-A-G~A~G~U~C~U~A~G 3’ (#) 5’ A~A~G~U~C-C-G*-A-G~A~G~U~C~U~A~G 3’ (#) ’ U~C~A~A~A~G~U~C~C~G*~A~G~A~G~U~C~U~A~G 3’ (#) ’ U~C~A~A~A~G~U~C~C~G*~A~G~A~G~U~C*~A~G~G 3’ (#) ’ U~C~A~A~A~G*~U~C~C~G*~A~G~A~G~U~C*~A~G~G 3’ (#) ’ U~C~A~A~A~G~U~C~C~GXA~G~A~G~U~C~A~G~G 3’ (#) 5’ A~A~A~G~U~C~C~G~A~G~A~G~U~C~A 3’ (#) Antisense s: ' C~C~U~G~A~C-U~C-U-C-G-G-A~C-U~U~U~G~A 3' (#) ' C~C~U~G~A~C-U~C-U-C-G-G-A~C-U~U~U~G~A 3' (#) ' C~C~U~G~A~C-U~C-U-C-G-G-A~C-U~U~U~G~A 3' (#) 5' C~C~U~G~A~C~U-C~U-C-G-G~A-C~U~U~U~G~A 3' (#) ' C~C~U~G~A~C~U*-C~U-C-G-G~A-C~U~U~U~G~A 3' (#) ' C~C~U~G~A*~C~U-C~U-C-G-G~A-C~U~U~U~G~A 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any sk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y tes an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site ) Small letters designate nucleosides that have deoxyribose 61. seqRNAi siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense Strands: ’ U~G~G~A~G~G~A~G-C-C-G-C~A~G~U~C~A~G~A~U 3’ (#) ’ U~G~G~A~G~G~A~G-C-C-G-C~A~G~U~C~A~G~A~U 3’ (#) ’ U~G~G~A~G~G~A~G-C-C-G~C-A~G~U~C~A~G~A~U 3’ (#) ’ U~G~G~A~G~G~A~G-C-C-G-C~A~G~U~C~A~G*~A~U 3’ (#) 5’ U~G~G~A~G~G~A*~G-C-C-G-C~A~G~U~C~A~G*~A~U 3’ (#) ’ U~G~G~A~G~G~A*~G-C-Y-G-C~A~G~U~C~A~G*~A~U 3’ (#) ’ U~G~G~A~G~G~A*~G~C~Y~G~C~A~G~U~C~A~G*~A~U 3’ (#) ’ U~G~G~A~G*~G~A~G~C~Y~G~C~A~G~U~C~A~G*~A~U 3’ (#) ’ U~G~G~A~G~G~A~G~C~CXG~C~A~G~U~C~A~G~A~U 3’ (#) 5’ G~A~G~C~C~G~C~A~G~U~C~A 3’ (#) ’ G~A~G~G~A~G~C~Y~G~C~A~G~U~C~A 3’ (#) ’ G~A~G~G~A~G~C~G~G~C~A~G~U~C~A 3’ (#) ’ G~A~G~G~A~G~C~C*~G~C~A~G~U~C~A 3’ (#) Antisense Strands: 5' A~U~C~U~G-A~C-U-G-C-G-G-C-U~C-C~U~C~C~A 3' (#) ' A~U~C~U~G-A~C-U-G-C-G-G-C-U~C-C~U~C~C~A 3' (#) ' A~U~C~U~G-A~C-U-G-C-G-G-C-U~C-C~U~C~C~A 3' (#) ' U~G~A-C~U-G-C-G-G-C~U-C~C~U~C~C~A 3' (#) ' A~U~C~U~G~A-C*~U-G-C-G-G-C~U-C~C~U~C~C~A 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ ents phosphorothioate es 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 62. seqRNAi siRNA Compounds Directed to Human p53 for sequential induction of RNAi Sense Strands: 5’ A~U~G~G~A~U~G~A-U-U-U-G~A~U~G~C~U~G~U 3’ (#) ’ A~U~G~G~A~U~G~A-U-U-U-G~A~U~G~C~U~G~U 3’ (#) ’ G~A~U~G~A-U-U-U-G~A~U~G~C~A~G~U 3’ (#) ’ A~U~G~G~A~U~G~A-U-Y-U-G~A~U~G~C~U~G~U 3’ (#) ’ A~U~G~G~A~U~G~A~U~Y~U~G~A~U~G~C~U~G~U 3’ (#) 5’ A~U~G~G~A~U~G~A~U~Y~U~G~A~U~G~C~A~G~U 3’ (#) ’ A~U~G~G~A~U~G~A~U~Y~U~G~A~U~G~C*~U~G~U 3’ (#) ’ A~U~G~G~A~U~G*~A~U~Y~U~G~A~U~G~C*~U~G~U 3’ (#) ’ A~U~G~G~A~U~G~A~U~UXU~G~A~U~G~C~U~G~U 3’ (#) ’ G~G~A~U~G~A~U~U~U~G~A~U~G~C~U 3’ (#) Antisense Strands: ' A~C~A~G~C~A-U~C-A-A-A-U-C~A-U~C~C~A~U 3' (#) ' A~C~A~G~C~A-U~C-A-A-A-U-C~A-U~C~C~A~U 3' (#) ' A~C~A~G~C~A-U~C-A-A-A-U-C~A-U~C~C~A~U 3' (#) 5' A~C~A~G~C~A-U~C-A-A-A-U-C~A-U~C~C~A~U 3' (#) ' A~C~A~G~C~A-U*~C-A-A-A-U-C~A-U~C~C~A~U 3' (#) ' A~C~A~G*~C~A-U~C-A-A-A-U-C~A-U~C~C~A~U 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 63. seqRNAi siRNA Compounds ed to Human/Mouse ApoB for sequential induction of RNAi Sense Strands: ’ A~U~C~A~C-A-C-U-G~A~A~U~A~C~C~A~A~U 3’ (#) ’ G~U~C~A~U~C~A*~C-A-C-U-G~A~A~U~A~C~C~A~A~U 3’ (#) 5’ G~U~C~A~U~C~A*~C-A-C-U-G~A~A~U~A~C~C*~A~A~U 3’ (#) ’ G~U~C~A~U~C~A~C-A-C-U-G~A~A~U~A~C~C~A~A~U 3’ (#) ’ G~U~C~A~U~C~A*~C-A-C-U-G~A~A~U~A~C~C~A~A~U 3’ (#) ’ G~U~C~A~U~C~A~C-A-C-U-G~A~A~U~A~C~C*~A~A~U 3’ (#) ’ G~U~C~A~U~C~A*~C-A-C-U-G~A~A~U~A~C~C*~A~A~U 3’ (#) 5’ G~U~C~A~U~C~A*~C~A~Y~U~G~A~A~U~A~C~C*~A~A~U 3’ (#) ’ G~U~C~A~U~C~A*~C~A~C~U~G*~A~A~U~A~C~C*~A~A~U 3’ (#) ’ G~U~C~A~U*~C~A~C~A*~C~U~G~A*~A~U~A~C~C*~A~A~U 3’ (#) ’ G~U~C~A~U~C~A~C~A~C~U~G~A~A~U~A~C~C~A~A~U 3’ (#) ’ A~U~C~A~C~A~CXU~G~A~A~U~A~C~C~A~A~U 3’ (#) 5’ C~A~U~C~A~C~A~C~U~G~A~A~U~A~C 3’ (#) ’ C~A~U~C~A~C~A~Y~U~G~A~A~U~A~C 3’ (#) Antisense Strands: ' A~U~U~G~G~U-A~U-U-C-A-G-U~G-U~G~A~U~G~A~C 3' (#) ' A~U~U~G~G~U-A~U-U-C-A-G-U~G-U~G~A~U~G~A~C 3' (#) 5' A~U~U~G~G~U-A~U-U-C-A-G-U~G-U~G~A~U~G~A~C 3' (#) ' A~U~U~G~G~U-A~U-U-C-A-G-U~G-U~G~A~U~G~A~C 3' (#) ' A~U~U~G~G~U~A~U-U-C-A-G-U~G~U~G~A~U~G~A~C 3' (#) ' A~U~U~G~G~U~A*~U-U-C-A-G-U~G~U~G~A~U~G~A~C 3' 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X tes the lack of a e ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in ons 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 64. seqRNAi siRNA Compounds Directed to Human/Mouse ApoB for sequential induction of RNAi Sense Strands: ’ G~G~U~G~U~A~U~G-G-C-U-U~C~A~A~C~C~C~U~G 3’ (#) ’ G~G~U~G~U~A~U~G-G-C-U-U~C~A~A~C~C~C~U~G 3’ (#) 5’ G~G~U~G~U~A~U~G-G-C-U-C~C~A~A~C~C~A~U~G 3’ (#) ’ G~G~U~G~U~A~U~G-G-Y-U-U~C~A~A~C~C~C~U~G 3’ (#) ’ G~G~U~G~U~A~U~G~G~Y~U~U~C~A~A~C~C~C~U~G 3’ (#) ’ G~G~U~G~U~A~U~G~G~Y~U~U~C~A~A~C~C*~C~U~G 3’ (#) ’ G~U~A~U*~G~G~Y~U~U~C~A~A~C~C*~C~U~G 3’ (#) 5’ G~G~U~G~U~A~U~G~G~C*~U~U~C~A~A~C~C*~C~U~G 3’ (#) ’ G~G~U~G~U~A~U*~G~G~C~U*~U~C~A~A~C~C*~C~U~G 3’ (#) ’ G~G~U~G~U~A~U~G-G-C-U-U~C~A~A~C~C*~C~U~G 3’ (#) ’ G~G~U~G~U~A~U~G-GXC-U-U~C~A~A~C~C~C~U~G 3’ (#) ’ G~U~A~U~G~G-C~U~U~C~A~A~C~C~C 3’ (#) 5’ G~U~A~U~G~G-C~U~U*~C~A~A~C~C~C 3’ (#) nse Strands: ' C~A~G~G~G~U-U-G-A-A-G-C-C-A-U~A~C~A~C~C 3' (#) ' C~A~G~G~G~U-U-G-A-A-G-C-C-A-U~A~C~A~C~C 3' (#) ' C~A~G~G~G~U-U-G-A-A-G-C-C-A-U~A~C~A~C~C 3' (#) ' G~G~U-U~G-A-A-G-C-C~A-U~A~C~A~C~C 3' (#) ' C~A~G~G~G~U~U~G-A-A-G-C-C~A~U~A~C~A~C~C 3' (#) ' C~A~G~G~G~U~U*~G-A-A-G-C-C~A~U~A~C~A~C~C 3' (#) ' C~A~G~G~G~U-U*~G-A-A-G-C-C~A-U~A~C~A~C~C 3' (#) 5' C~A~G~G~G~U-U*~G-A-A-G-C-C~A-U~A*~C~A~C~C 3' (#) ' G*~G~U-U~G-A-A-G-C-C~A-U~A*~C~A~C~C 3' (#) 1) The nucleosides shown in bold have the ethyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 ge site 65. seqRNAi siRNA Compounds Directed to Human PTP1b for sequential induction of RNAi Sense Strands: ’ G~G~A~A~G~A~A~A-A-A-G-G~A~A~G~C*~C~C 3’ (#) ’ G~G~A~A~G~A~A~A-A-A-G-G~A~A~G*~C~C~C 3’ (#) ’ G~G~A~A~G~A~A~A-A-A-G-G~A~A~G*~C~C~C 3’ (#) ’ G~G~A~A~G~A~A*~A-A-A-G-G~A~A~G*~C~C~C 3’ (#) 5’ G~G~A~A~G~A~A*~A-A-Y-G-G~A~A~G*~C~C~C 3’ (#) ’ G~G~A~A~G~A*~A~A-A-Y-G-G~A~A~G*~C~C~C 3’ (#) ’ G~G~A~A~G~A*~A~A~A~Y~G~G~A~A~G*~C~C~C 3’ (#) ’ G~G~A~A~G~A~A~A~A~A~G~G~A~A~G~C~C~C 3’ (#) ’ A~G~A~A~A~A~AXG~G~A~A~G~C~C~C 3’ (#) Antisense Strands: 5' G~G~G~C~U~U-C~C-U-U-U-U-U~C-U~U~C~C 3' (#) ' G~G~G~C~U~U-C~C-U-U-U-U-U~C-U~U~C~C 3' (#) ' G~G~G~C~U~U-C~C-U-U-U-U-U~C-U~U~C~C 3' (#) ' G~G~G~C~U~U-C~C-U-U-U-U-U~C-U~U~C~C 3' (#) ' G~G~G~C~U~U~C-C-U-U-U-U-U-C~U~U~C~C 3' (#) 5' G~G~G~C~U~U-C~C-U-U-U-U-U~C-U~U*~C~C 3' (#) ' G~G~G~C~U~U*-C~C-U-U-U-U-U~C-U~U*~C~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native 2) One or more contiguous dashes represent odiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 66. seqRNAi miRNA Inhibitor Compounds Based on Mouse miR-24 for sequential administration to inhibit the s f.

Endogenous miRNA antisense strands (overhang in bold): ' AGUUCAGCAGGAACAG 3' Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: ' UGGCUCAGUUCAGCAGGAACAG 3' (#) Prototype antisense strand sequence: with G:U intact: ' GUUCCUGCUGAGCUGAGCUAGU 3' (#) with G:U converted to G:C ' GUUCCUGCUGAACUGAGCCAGU3' (#) mentary sense and antisense strands for use in accordance with this invention: Sense strands: ' C~U~G~G~C~U~C~A-G-U-U-C~A~G~C~A~G~G~A~A~C 3' (#) ' C~U~G~G~C~U~C~A-G-U-U-C~A~G~C~A~G~G~A~A~C 3' (#) ' C~U~G~G~C~U~C~A-G-Y-U-C~A~G~C~A~G~G~A~A~C 3' (#) 5' C~U~G~G~C~U~C~A~G~Y~U~C~A~G~C~A~G~G~A~A~C 3' (#) ' C~U~G~G~C~U~C~A-G-Y-U-C~A~G~C~A~G~G~A*~A~C 3' (#) ' C~U~G~G~C~U~C~A~G~Y~U~C~A~G~C~A~G~G~A*~A~C 3' (#) ' C~U~G~G~C~U~C*~A-G-Y-U-C~A~G~C~A~G~G~A*~A~C 3' (#) 5' C~U~G~G~C~U~C*~A~G~Y~U~C~A~G~C~A~G~G~A*~A~C 3' (#) ' C~U~G~G~C~U*~C~A-G-U*-U-C~A~G~C~A~G~G~A*~A~C 3' (#) ' C~U~G~G~C~U*~C~A~G~C~U~C~A~G~C~A~G~G~A*~A~C 3' (#) ' C~U~G~G~C~G~C~A-G-C-U-C~A~G~C~A~G~G~U~A~C 3' (#) ' C~U~G~G~C~G~C~A~G~C~U~C~A~G~C~A~G~G~U~A~C 3' (#) 5' C~U~G~G~C~U~C~A~G~U~UXC~A~G~C~A~G~G~A~A~C 3' (#) ' C~U~G~G~C~U~C~A~G~U~UXC~A~G~C~A~G~G~A~A~C 3' (#) ' C~U~G~G~C~A~C~A~G~U~UXC~A~G~C~A~G~A~A~A~C 3' (#) ' C~U~G~G~C~U~C~A-G-U-U-C~A~G~C~A~G~G~A~A 3' (#) ' G~C~U~C~A-G-U-U-C~A~G~C~A~G~G 3' (#) 5' G~C~U~C~A~G~U~U~C~A~G~C~A~G~G 3' (#) nse s: ' G~U~U~C~C~U-G~C-U-G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' G~U~U~C~C~U-G~C-U-G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' G~U~U~C~C~U-G~C-U-G-A-A-C-U~G-A~G~C~C~A~G 3' (#) 5' G~U~U~C~C~U-G~C-U-G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' G~U~U~C*~C~U-G~C-U-G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' G~U~U~C~C~U-G*~C-U-G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' G~U~U~C~C~U~G-C~U-G-A-A-C~U-G~A~G~C~C~A~G 3' (#) ' G~U~U~C*~C~U~G-C~U-G-A-A-C~U-G~A~G~C~C~A~G 3' (#) 5' G~U~U~C~C~U~G*-C~U-G-A-A-C~U-G~A~G~C~C~A~G 3' (#) ' U~U~C~C~U~G-C~U-G-A-A-C-U-G~A-G~C~C~A~G 3' (#) ' U~U~C~C~U~G-C~U-G-A-A-C-U-G~A-G~C~C~A~G 3' (#) ' C~U~G-C~U-G-A-A-C-U-G~A-G~C~C~A~G 3' (#) ' C~U~G-C~U-G-A-A-C-U-G~A-G~C~C~A~G 3' (#) ' U~U~C~C*~U~G-C~U-G-A-A-C-U-G~A-G~C~C~A~G 3' (#) ' U~U~C~C~U~G-C*~U-G-A-A-C-U-G~A-G~C~C~A~G 3' (#) 5' U~U~C~C~U~G~C-U~G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' U~U~C~C*~U~G~C-U~G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ' U~U~C~C~U~G~C*-U~G-A-A-C-U~G-A~G~C~C~A~G 3' (#) ) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 11) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 12) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 13) Any X indicates the lack of a e 14) Any Y indicates an abasic side ) The C in any CpG may be methylated at the C5 position 16) The 5'end of the sense strand may have a 5'methyl group 17) The 5'end of an antisense strand may have a 5'-phosphate group 18) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 67. seqRNAi miRNA Inhibitor Compounds Based on Human miR-24 for sequential administration to t the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): ' UGGCUCAGUUCAGCAGGAACAG 3' (#) Sense and nse strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: 5' UGGCUCAGUUCAGCAGGAACAG 3' (#) ype antisense strand sequence: with G:U intact: ' UUCCUGCUGAGCUGAGCUAGU 3' (#) with G:U converted to G:C 5' UUCCUGCUGAACUGAGCCAGU 3' (#) Complementary sense and antisense strands for use in accordance with this invention: Sense strands: Same as mouse miR-24 Antisense strands: Same as mouse miR-24 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native . 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a sphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the nse strand which may be in italics are the ones opposite the argonaute 2 cleavage site 68. seqRNAi miRNA Inhibitor nds Based on Mouse miR-29a for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense strands ang in bold): ' UAGCACCAUCUGAAAUCGGUUA 3' (#) Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: ' UAGCACCAUCUGAAAUCGGUUA 3' (#) Prototype antisense strand sequence: with G:U intact: ' UUCAGAUGGUGUUA 3' (#) with G:U converted to G:C: ' ACCGAUUUCAGAUGGUGCUA 3' (#) mentary sense and antisense strands for use in accordance with this invention: Sense strands: ' G~C~A~C~C~A~U~C-U-G-A-A~A~U~C~G~G~U~U~A 3' (#) ' G~C~A~C~C~A~U~C-U-G-A-A~A~U~C~G~G~U~U~A 3' (#) ' G~C~A~C~C~A~U~C-U-Y-A-A~A~U~C~G~G~U~U~A 3' (#) ' G~C~A~C~C~A~U~C~U~Y~A~A~A~U~C~G~G~U~U~A 3' (#) 5' C~C~A~U~C-U-Y-A-A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~U~C~U~Y~A~A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~U~C-U-Y-A-A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~U~C~U~Y~A~A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~U*~C-U-Y-A-A~A~U~C~G~G*~U~U~A 3' (#) 5' G~C~A~C~C~A~U*~C~U~Y~A~A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~U*~C-U-G*-A-A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~U*~C~U~G*~A~A~A~U~C~G~G*~U~U~A 3' (#) ' G~C~A~C~C~A~G~C-U-U-A-A~A~U~C~G~U~U~U~A 3' (#) ' G~C~A~C~C~A~G~C~U~U~A~A~A~U~C~G~U~U~U~A 3' (#) 5' G~C~A~C~C~A~U~C~U~GXA~A~A~U~C~G~G~U~U~A 3' (#) ' G~C~A~C~C~A~U~C~U~GXA~A~A~U~C~G~G~U~U~A 3' (#) ' G~C~A~C~C~C~U~C~U~GXA~A~A~U~C~G~A~U~U~A 3' (#) ' A~U~C-U-G-A-A~A~U~C~G~G 3' (#) ' A~C~C~A~U~C~U~G~A~A~A~U~C~G~G 3' (#) Antisense strands: ' U~A~A~C~C~G-A~U-U-U-C-A-G-A~U-G~G~U~G~C 3' (#) ' U~A~A~C~C~G-A~U-U-U-C-A-G-A~U-G~G~U~G~C 3' (#) ' U~A~A~C~C~G-A~U-U-U-C-A-G-A~U-G~G~U~G~C 3' (#) ' U~A~A~C~C~G-A~U-U-U-C-A-G-A~U-G~G~U~G~C 3' (#) 5' U~A~A~C~C~G~A-U~U-U-C-A-G~A-U~G~G~U~G~C 3' (#) ' U~A~A~C~C~G-A*~U-U-U-C-A-G-A~U-G~G~U~G~C 3' (#) ' U~A~A~C~C~G~A*-U~U-U-C-A-G~A-U~G~G~U~G~C 3' (#) ' U~A~A~C*~C~G-A~U-U-U-C-A-G-A~U-G~G~U~G~C 3' (#) ' U~A~A~C*~C~G~A-U~U-U-C-A-G~A-U~G~G~U~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X tes the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 69. seqRNAi miRNA Inhibitor Compounds Based on Human miR-29a for sequential administration to t the actions thereof.

Endogenous miRNA antisense strands ang in bold): Same as for mouse miR-29a Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand ce: Same as for mouse miR-29a Prototype antisense strand sequence: with G:U intact: Same as for mouse miR-29a with G:U converted to G:C: Same as for mouse miR-29a Complementary sense and antisense s for use in accordance with this invention: Sense strands: Same as for mouse miR-29a nse strands: Same as for mouse miR-29a 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more uous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked c acid monomer. These sides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be ated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 ge site 70. seqRNAi miRNA Inhibitor Compounds Based on Mouse miR-29b for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): ' UAGCACCAUUUGAAAUCAGUGUU 3' (#) Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: 5' UAGCACCAUUUGAAAUCAGUGUU 3' (#) Prototype antisense strand sequence: with G:U intact: ' GCUGGUUUCAAAUGGUGCUA 3' (#) with G:U converted to G:C: ' ACUGAUUUCAAAUGGUGCUA 3' (#) Complementary sense and antisense strands for use in accordance with this invention: Sense s: 5' G~C~A~C~C~A~U~U-U-G-A-A~A~U~C~A~G~U~G~U~U 3' ' G~C~A~C~C~A~U~U-U-G-A-A~A~U~C~A~G~U~G~U~U 3' ' G~C~A~C~C~A~U~U-U-Y-A-A~A~U~C~A~G~U~G~U~U 3' ' G~C~A~C~C~A~U~U~U~Y~A~A~A~U~C~A~G~U~G~U~U 3' ' G~C~A~C~C~A~U~U-U-Y-A-A~A~U~C~A~G~U*~G~U~U 3' 5' G~C~A~C~C~A~U~U~U~Y~A~A~A~U~C~A~G~U*~G~U~U 3' ' G~C~A~C~C~A~U*~U-U-Y-A-A~A~U~C~A~G~U*~G~U~U 3' ' G~C~A~C~C~A~U*~U~U~Y~A~A~A~U~C~A~G~U*~G~U~U 3' ' G~C~A~C~C*~A~U~U-U-Y-A-A~A~U~C~A~G~U*~G~U~U 3' ' G~C~A~C~C*~A~U~U~U~Y~A~A~A~U~C~A~G~U*~G~U~U 3' 5' G~C~A~C~A~A~U~U-U-Y-A-A~A~U~C~A~G~C~G~U~U 3' ' G~C~A~C~A~A~U~U~U~Y~A~A~A~U~C~A~G~C~G~U~U 3' ' G~C~A~C~A~A~U~U~U~A~A~A~A~U~C~A~G~C~G~U~U 3' ' G~C~A~C~C~A~U~U~U~GXA~A~A~U~C~A~G~U~G~U~U 3' ' G~C~A~C~C~A~U~U~U~GXA~A~A~U~C~A~G~U~G~U~U 3' 5' G~C~A~C~A~A~U~U~U~GXA~A~A~U~C~A~A~U~G~U~U 3' ' C~C~A~U~U~U~G~A~A~A~U~C~A~G~U 3' ' U~U~U~G~A~A~A~U~C~A~G~U 3' Antisense strands: ' A~A~C~A~C-U~G-A-U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' A~A~C~A~C-U~G-A-U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' A~A~C~A~C-U~G-A-U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' A~A~C~A~C-U~G-A-U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' A~A~C~A*~C-U~G-A-U-U-U-C-A-A~A-U~G~G~U~G~C 3' 5' A~A~C~A*~C-U~G-A-U-U-U-C-A-A~A-U~G*~G~U~G~C 3' ' A~A~C~A~C~U-G~A-U-U-U-C-A~A-A~U~G~G~U~G~C 3' ' A~A~C~A~C~U-G~A-U-U-U-C-A~A-A~U~G~G~U~G~C 3' ' A~A~C~A*~C~U-G~A-U-U-U-C-A~A-A~U~G~G~U~G~C 3' ' A*~C~U-G~A-U-U-U-C-A~A~A~U~G*~G~U~G~C 3' 5' A~A~C~A~C~U~G~A~U-U-U-C~A~A~A~U~G~G~U~G~C 3' ' A~A~C~A~C~U~G~A~U-U-U-C~A~A~A~U~G~G~U~G~C 3' ' A~A~C~A*~C~U~G~A~U-U-U-C~A~A~A~U~G~G~U~G~C 3' ' A~A~C~A*~C~U~G~A~U-U-U-C~A~A~A~U~G*~G~U~G~C 3' ' A~A~C~A~C~U~G~A~U~U~U~C~A~A~A~U~G~G~U~G~C 3' 5' A~A~C~A~C~U~G~A~U~U~U~C~A~A~A~U~G~G~U~G~C 3' ' A~A~C~A*~C~U~G~A~U~U~U~C~A~A~A~U~G~G~U~G~C 3' ' A~A~C~A*~C~U~G~A~U~U~U~C~A~A~A~U~G*~G~U~G~C 3' 1) The sides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an ed nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 71. i miRNA Inhibitor Compounds Based on Human miR-29b for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): Same as for mouse miR-29b Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: Same as for mouse miR-29b Prototype antisense strand sequence: with G:U intact: Same as for mouse miR-29b with G:U converted to G:C: Same as for mouse miR-29b Complementary sense and antisense strands for use in accordance with this invention: Sense s: Same as for mouse miR-29b nse strands: Same as for mouse miR-29b 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an nse strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 72. seqRNAi miRNA Inhibitor nds Based on Mouse miR-29c for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense s (overhang in bold): ' UAGCACCAUUUGAAAUCGGUUA 3' (#) Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: ' UAGCACCAUUUGAAAUCGGUUA 3' (#) Prototype antisense strand ce: with G:U intact: ' UGACCGAUUUCAAAUGGUGUUA 3' (#) with G:U converted to G:C: ' UAACCGAUUUCAAAUGGUGCUA 3' (#) Complementary sense and antisense strands for use in accordance with this invention: Sense strands: ' G~C~A~C~C~A~U~U-U-G-A-A~A~U~C~G~G~U~U~A 3' 5' G~C~A~C~C~A~U~U-U-G-A-A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~C~A~U~U-U-Y-A-A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~C~A~U~U~U~Y~A~A~A~U~C~G~G~U~U~A 3' ' C~C~A~U~U-U-Y-A-A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U~U~U~Y~A~A~A~U~C~G*~G~U~U~A 3' 5' G~C~A~C~C~A~U*~U-U-Y-A-A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U*~U~U~Y~A~A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A*~U~U-U-Y-A-A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A*~U~U~U~Y~A~A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U~U-U-G*-A-A~A~U~C~G~G~U~U~A 3' 5' C~C~A~U~U~U~G*~A~A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~C~A~U~U-U-G*-A-A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U~U~U~G*~A~A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U*~U-U-G*-A-A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U*~U~U~G*~A~A~A~U~C~G*~G~U~U~A 3' 5' G~C~A~C~C~A*~U~U-U-G*-A-A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A*~U~U~U~G*~A~A~A~U~C~G*~G~U~U~A 3' ' G~C~A~C~C~A~U~U-U-A-A-A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~C~A~U~U~U~A~A~A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~C~A~U~U-U-A-A-A~A~U~C~A~G~U~U~A 3' 5' G~C~A~C~C~A~U~U~U~A~A~A~A~U~C~A~G~U~U~A 3' ' G~C~A~C~C~A~C~U-U-A-A-A~A~U~C~A~G~U~U~A 3' ' G~C~A~C~C~A~C~U~U~A~A~A~A~U~C~A~G~U~U~A 3' ' G~C~A~C~C~C~U~U-U-A-A-A~A~U~C~A~G~U~U~A 3' ' G~C~A~C~C~C~U~U~U~A~A~A~A~U~C~A~G~U~U~A 3' ' G~C~A~C~C~A~U~U~U~GXA-A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~C~A~U~U~U~GXA-A~A~U~C~G~G~U~U~A 3' ' G~C~A~C~U~A~U~U~U~GXA-A~A~U~C~U~G~U~U~A 3' ' A~C~C~A~U~U~U~G~A~A~A~U~C~G~G 3' 5' A~C~C~A~U~U~U~G~A~A~A~U~C~G~G 3' ' A~C~C~A~U~U~A~G~A~A~A~U~C~G~G 3' Antisense strands: ' U~A~A~C~C-G~A-U-U-U-C-A-A-A~U-G~G~U~G~C 3' 5' U~A~A~C~C-G~A-U-U-U-C-A-A-A~U-G~G~U~G~C 3' ' U~A~A~C~C-G~A-U-U-U-C-A-A-A~U-G~G~U~G~C 3' ' C~C-G~A-U-U-U-C-A-A-A~U-G~G~U~G~C 3' ' U~A~A~C~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' 5' C~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C~C~G-A*~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C~C~G-A*~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C~C~G-A*~U-U-U-C-A-A~A-U~G~G~U~G~C 3' 5' U~A~A~C~C~G-A*~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G*~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G*~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G*~G~U~G~C 3' ' U~A~A~C*~C~G-A~U-U-U-C-A-A~A-U~G*~G~U~G~C 3' 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester es and ~ represents phosphorothioate es 3) Any asterisk after a letter tes it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 73. i miRNA Inhibitor Compounds Based on Human miR-29c for sequential stration to t the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): Same as for mouse miR-29c Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: Same as for mouse miR-29c Prototype antisense strand ce: with G:U intact: Same as for mouse miR-29c with G:U converted to G:C: Same as for mouse miR-29c Complementary sense and antisense strands for use in accordance with this invention: Sense strands: Same as for mouse c Antisense strands: Same as for mouse miR-29c 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or ethyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 on 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones te the argonaute 2 cleavage site 74. i miRNA Inhibitor Compounds Based on Mouse miR-33 for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand ce: Prototype antisense strand sequence: with G:U intact: with G:U converted to G:C: 75. seqRNAi miRNA tor Compounds Based on Human miR-33 for sequential administration to inhibit the s thereof. 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native . 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter tes it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a e 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the ute 2 cleavage site 76. seqRNAi miRNA Inhibitor Compounds Based on Mouse miR-122 for sequential stration to inhibit the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): 5' UGGAGUGUGACAAUGGUGUUUG 3' (#) Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: ' UGGAGUGUGACAAUGGUGUUUG 3' (#) Prototype antisense strand sequence: with G:U intact: ' AAACGCCAUUGUCACACUCC 3' (#) with G:U converted to G:C: ' AAACACCAUUGUCACACUCC 3' (#) mentary sense and antisense strands for use in accordance with this invention: Sense strands: ' G~G~A~G~U~G~U~G-A-C-A-A~U~G~G~U~G~U~U~U 3' ' G~G~A~G~U~G~U~G-A-C-A-A~U~G~G~U~G~U~U~U 3' 5' G~G~A~G~U~G~U~G-A-Y-A-A~U~G~G~U~G~U~U~U 3' ' G~G~A~G~U~G~U~G~A~Y~A~A~U~G~G~U~G~U~U~U 3' ' G~U~G~U~G-A-Y-A-A~U~G~G~U~G*~U~U~U 3' ' G~G~A~G~U~G~U~G~A~Y~A~A~U~G~G~U~G*~U~U~U 3' ' G~G~A~G~U*~G~U~G-A-Y-A-A~U~G~G~U~G*~U~U~U 3' 5' G~G~A~G~U*~G~U~G~A~Y~A~A~U~G~G~U~G*~U~U~U 3' ' G~G~A~G~U~G~U*~G-A-Y-A-A~U~G~G~U~G*~U~U~U 3' ' G~G~A~G~U~G~U*~G~A~Y~A~A~U~G~G~U~G*~U~U~U 3' ' G~G~A~G~U*~G~U~G-A-C*-A-A~U~G~G~U~G*~U~U~U 3' ' G~G~A~G~U*~G~U~G~A~C*~A~A~U~G~G~U~G*~U~U~U 3' 5' G~G~A~G~U~G~U~G-A-G-A-A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~U~G~U~G~A~G~A~A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~C~G~U~G-A-G-A-A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~C~G~U~G~A~G~A~A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~U~G~C~G-A-G-A-A~U~G~G~U~C~U~U~U 3' 5' G~G~A~G~U~G~C~G~A~G~A~A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~C~G~U~G-A-C*-A-A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~C~G~U~G~A~C*~A~A~U~G~G~U~C~U~U~U 3' ' G~G~A~G~U~G~U~G~A~CXA~A~U~G~G~U~G~U~U~U 3' ' G~G~A~G~U~G~U~G~A~CXA~A~U~G~G~U~G~U~U~U 3' ' G~G~A~G~C~G~U~G~A~CXA~A~U~G~G~U~A~U~U~U 3' ' A~G~U~G~U~G~A~C~A~A~U~G~G~U~G 3' ' A~G~U~G~U~G~A~C~A~A~U~G~G~U~G 3' ' A~G~U~G~U~G~A~G~A~A~U~G~G~U~G 3' Antisense strands: ' A~A~A~C~A-C~C-A-U-U-G-U-C-A~C-A~C~U~C~C 3' ' A~A~A~C~A-C~C-A-U-U-G-U-C-A~C-A~C~U~C~C 3' ' A~A~A~C~A-C~C-A-U-U-G-U-C-A~C-A~C~U~C~C 3' ' A~A~A~C~A-C~C-A-U-U-G-U-C-A~C-A~C~U~C~C 3' 5' A~A~A~C~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' 5' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C~A~C-C*~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' A~A~A~C~A~C-C*~A-U-U-G-U-C~A-C~A~C~U~C~C 3' 5' A~A~A~C~A~C-C*~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' C~A~C-C*~A-U-U-G-U-C~A-C~A~C~U~C~C 3' ' C*~A~C-C~A-U-U-G-U-C~A-C~A*~C~U~C~C 3' ' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A*~C~U~C~C 3' ' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A*~C~U~C~C 3' ' A~A~A~C*~A~C-C~A-U-U-G-U-C~A-C~A*~C~U~C~C 3' ' A~A~A~C~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' 5' A~A~A~C~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A~C~U~C~C 3' 5' A~A~A~C~A~C~C*~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C*~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C*~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C*~A~U-U-G-U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A*~C~U~C~C 3' 5' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A*~C~U~C~C 3' ' C*~A~C~C~A~U-U-G-U~C~A~C~A*~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U-U-G-U~C~A~C~A*~C~U~C~C 3' ' C~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' 5' A~A~A~C~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' ' A~A~A~C~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' ' A~A~A~C*~A~C~C~A~U~U~G~U~C~A~C~A~C~U~C~C 3' 1) The nucleosides shown in bold have the ethyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group 8) The 5'end of an antisense strand may have a 5'-phosphate group 9) The two sides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 77. seqRNAi miRNA Inhibitor Compounds Based on Human miR-122 for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): ' UGGAGUGUGACAAUGGUGUUUG 3' (#) Sense and antisense strands for use in i miRNA inhibitors: Prototype sense strand ce: Same as mouse miR-122 Prototype antisense strand sequence: with G:U intact: Same as mouse miR-122 with G:U converted to G:C: Same as mouse miR-122 Complementary sense and antisense strands for use in accordance with this ion: Sense strands: Same as mouse miR-122 Antisense strands: Same as mouse miR-122 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group 8) The 5'end of an nse strand may have a 5'-phosphate group 9) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the argonaute 2 cleavage site 78. seqRNAi miRNA Inhibitor Compounds Based on Mouse miR-155 for sequential administration to inhibit the actions thereof.

Endogenous miRNA antisense strands (overhang in bold): Sense and antisense strands for use in seqRNAi miRNA inhibitors: Prototype sense strand sequence: Prototype antisense strand sequence: with G:U intact: with G:U converted to G:C 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 19) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages ) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 21) Any X indicates the lack of a linkage 22) Any Y indicates an abasic nucleoside 23) The C in any CpG may be ated at the C5 position 24) The 5'end of the sense strand may have a 5'methyl group ) The 5'end of an antisense strand may have a 5'-phosphate group 26) The two nucleosides in positions 10 and 11 from the 5'-end of the antisense strand which may be in italics are the ones opposite the ute 2 ge site 79. seqRNAi miRNA Inhibitor Compounds Based on Human 5 for sequential administration to inhibit the actions thereof. 80. miRNA Mimic Compounds Based on Mouse miR-24 for use in the tial administration method described herein. miR1 hairpin (unmatched nucleosides are offset - U may pair with G): g g a ua ucuca cucc gu ccu cugagcuga ucagu u |||| || ||| ||||||||| ||||| u gagg ca gga gacuugacu gguca u a a c -c cacac miR2 hairpin (unmatched nucleosides are offset - U may pair with G): - ucu ---- ccgc c g a aa ug u gcc cucc gggcu cucc gu ccu cugagcuga cagu au c ||| |||| ||||| |||| || ||| ||||||||| |||| || cgg gagg cccga gagg ca gga gacuugacu guca ug c a -uc aucc -ccu a a c cg cg a Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold. X represents no corresponding nucleoside: miR1 5' GUGCCUACUGAGCUGAUAUCAGU3' (#) 3' GACAAGGACGACUUGACUXCGGU 5' miR2 ' GUGCCUACUGAGCUGAAACAGU 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' Sense strand top and antisense strand bottom where sense strand has been ed to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is ted in bold: miR1 ' GUUCCUGCUGAGCUGAGCUAGU 3' (#) 3' GACGACUUGACUCGGU 5' miR2 ' GUUCCUGCUGAGCUGAGCCAGU 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' Sense strand top and nse strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: miR1 ' GUUCCUGCUGAACUGAGCCAGU3' (#) 3' GACAAGGACGACUUGACUCGGU 5' miR2 ' GUUCCUGCUGAACUGAGCCAGU 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' Endogenous nse strand with overhang shown in bold and shown written in both directions: ' UGGCUCAGUUCAGCAGGAACAG 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' s modified for seqRNAi miRNA use (note these compounds based on mouse miR- 24 may also be effectively used with other species including human). Any sense strand can be used with a complementary antisense strand: Set 1 Sense strands: miR1 sense strands based on: ' GUGCCUACUGAGCUGAUAUCAGU 3' Related strands ed for seqRNAi use: ' G~U~G~C~C~U~A~C-U-G-A~G~C-U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G-A~G~C-U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) 5' G~U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G-A-G~C~U~G~A-U-A-U-C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C~U~GXA~G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-Y-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C~U~Y~A~G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G*-A-G~C~U~G~A~U~A*~U~C~A~G~U 3' (#) ' G~U~G~C~C*~U~A~C-U-G*-A-G~C~U~G~A~U~A*~U~C~A~G~U 3' (#) 5' G~U~G~C*~C~U~A~C*-U-G-A-G~C*~U~G~A~U~A~U*~C~A~G~U 3' (#) ' G~U~G~C*~C~U~A~G-U-G-A-G~C*~U~G~A~U~A~G~C~A~G~U 3' (#) ' G~U~G~C~C~U~A*~C-U-G-A-G~C~U~G~A~U~A~U~C*~A~G~U 3' (#) ' C~C~U~A~C~U~G~A~G~C~U~G~A~U~A~U 3' (#) ' C~C~U~A~C~U~G~A~G~C~U~G*~A~U~A~U 3' (#) 5' C~C~U~A~C~U~G~A~G*~C~U~G~A~U~A~U 3' (#) 27) The nucleosides shown in bold have the ethyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 28) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 29) Any asterisk after a letter indicates it is an ed nucleic acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl.

) Any X indicates the lack of a linkage 31) Any Y indicates an abasic nucleoside 32) The C in any CpG may be methylated at the C5 position 33) The 5'end of the sense strand may have a 5'methyl group Set 2 Sense strands: miR1 sense strands based on: ' GCUGAGCUGAGCUAGU 3' Related s modified for seqRNAi use: 5' G~U~U~C~C~U~G~C-U-G-A~G~C-U~G~A~G~C~U~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A-G~C~U~G~A~G~C~U~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A~G~C-U~G~A~G~C~U~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A-G~C~U~G~A~G~C~U~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-Y-A-G~C~U~G~A~G~C~U~A~G~U 3' (#) ' G~U~U~C~C~U~G~C~U~Y~A~G~C~U~G~A~G~C~U~A~G~U 3' (#) 5' G~U~U~C~C*~U~G~C~U~Y~A~G~C~U~G~A~G~C*~U~A~G~U 3' (#) ' C~C*~U~G~C~U~G*~A~G~C~U~G~A~G~C*~U~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C-U-G*-A-G~C~U~G~A~G~C*~U~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C~U-G*-A-G~C~U~G*~A~G~C*~U~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C~U-G*-A-G~C~U~C~A~G~C*~U~A~G~U 3' (#) 5' G~U~U~C~G~U~G~C~U~G*~A~G~C~U~G~A~G~G~U~A~G~U 3' (#) ' G~U~U~C~C~U~G~C~U~GXA~G~C~U~G~A~G~C~U~A~G~U 3' (#) ' C~C~U~G~C~U~G~A~G~C~U~G~A~G~C 3' (#) ' G~C~U~G*~A~G~C~U~G~A~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 3 Sense s: miR1 sense strands based on: ' GCUGAACUGAGCCAGU 3' d strands modified for seqRNAi use: ' G~U~U~C~C~U~G~C-U-G-A~A~C-U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A-A~C~U~G~A~G~C~C~A~G~U 3' (#) 5' G~U~U~C~C~U~G~C-U-G-A~A~C-U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A-A~C~U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-Y-A-A~C~U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C~U~Y~A~A~C~U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C~U~Y~A~A~C~U~G~A~G~C*~C~A~G~U 3' (#) 5' G~U~U~C~C*~U~G~C~U~G*~A~A~C~U~G~A~G~C*~C~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C-U-G*-A-A~C~U~G~A~G~C*~C~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C~U-G*-A-A~C~U~G*~A~G~C*~C~A~G~U 3' (#) ' G~U~U~C*~C~U~G~C*~U-G-A-A~C*~U~G~A~G*~C~C~A~G~U 3' (#) ' G~U~U~C~G~U~G~C~U~G*~A~A~C~U~G~A~G~G~C~A~G~U 3' (#) 5' G~U~U~C~C~U~G~C~U~GXA~A~C~U~G~A~G~C~C~A~G~U 3' (#) ' C~C~U~G~C~U~G~A~A~C~U~G~A~G~C 3' (#) ' G~C~U~G~A*~A~C~U~G~A~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 4 Sense strands: miR2 sense strands based on: ' GUGCCUACUGAGCUGAAACAGU 3' Related strands ed for seqRNAi use: ' G~U~G~C~C~U~A~C-U-G-A~G~C-U~G~A~A~A~C~A~G~U 3' (#) 5' G~U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~A~A~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G-A~G~C-U~G~A~A~A~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~A~A~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C~U~GXA~G~C~U~G~A~A~A~C~A~G~U 3' (#) ' C~C~U~A~C-U-Y-A-G~C~U~G~A~A~A~C~A~G~U 3' (#) 5' G~U~G~C~C~U~A~C~U~Y~A~G~C~U~G~A~A~A~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G*-A-G~C~U~G~A~A~A~C~A~G~U 3' (#) ' G~U~G~C~C*~U~A~C-U-G*-A-G~C~U~G~A~A~A*~C~A~G~U 3' (#) ' G~U~G~C~C~U~A~C-U-G*-A-G~C~U~G~A~A~A*~C~A~G~U 3' (#) ' G~U~G~C~C~U~A*~C-U-G-A-G~C~U~G~A~A~A~C~A~G~U 3' (#) 5' C~C~U~A~C~U~G~A~G~C~U~G~A~A~A~C 3' (#) 1) The sides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X tes the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be ated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 5 Sense strands: miR2 sense strands based on: ' GUUCCUGCUGAGCUGAGCCAGU 3' Related strands modified for seqRNAi use: ' G~U~U~C~C~U~G~C-U-G-A~G~C-U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A-G~C~U~G~A~G~C~C~A~G~U 3' (#) 5' G~U~U~C~C~U~G~C-U-G-A~G~C-U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-G-A-G~C~U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C-U-Y-A-G~C~U~G~A~G~C~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C~U~Y~A~G~C~U~G~A~G~C~C~A~G~U 3' (#) ' C~C*~U~G~C~U~Y~A~G~C~U~G~A~G~C*~C~A~G~U 3' (#) 5' G~U~U~C~C*~U~G~C~U~G*~A~G~C~U~G~A~G~C*~C~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C-U-G*-A-G~C~U~G~A~G~C*~C~A~G~U 3' (#) ' G~U~U~C~C*~U~G~C~U-G*-A-G~C~U~G*~A~G~C*~C~A~G~U 3' (#) ' G~U~U~C~G~U~G~C~U~G*~A~G~C~U~G~A~G~G~C~A~G~U 3' (#) ' G~U~U~C~C~U~G~C~U~GXA~G~C~U~G~A~G~C~C~A~G~U 3' (#) ' C~C~U~G~C~U~G~A~G~C~U~G~A~G~C 3' ' C~C~U~G~C~U~G~A*~G~C~U~G~A~G~C 3' 1) The sides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 6 Sense strands: miR2 sense strands based on: ' GUUCCUGCUGAACUGAGCCAGU 3' Related s modified for seqRNAi use: Same as Set 3 for miR1 Set 7 Sense strands: These sense strands have been designed to be complementary to the miR-24 antisense strands that form hairpins. They will produce activity in both mouse and human cells and in cells from any other species that has the same miR-24 antisense strand.

' C~G~G~C~U~C~C~G-G-C-U~G-A~A-C~U~G~A~G~C~C~A 3' (#) 5' C~G~G~C~U~C~C~G-G-Y-U~G-A~A-C~U~G~A~G~C~C~A 3' (#) ' C~G~G~C~U~C~C~G~G~Y~U~G~A~A~C~U~G~A~G~C~C~A 3' (#) ' C~G~G~C~C~C~C~G~G~Y~U~G~A~A~C~U~G~A~G~A~C~A 3' (#) ' C~G~G~C~U~C~C~G~G~C*~U~G~A~A~C~U~G~A~G~C~C~A 3' (#) ' C~G~G~C~U~C~C~G~G~C*~U~G~A~A~C~U~G~A~G*~C~C~A 3' (#) ' C~U~C~C~G~G~C~U~G~A~A~C~U~G~A~G 3' (#) 5' C~U+~C~C~G~G~C~U~G~A~A~C~U~G~A+~G 3' (#) 1) The sides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any + after a letter indicates the nucleoside is an LNA ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Antisense strands for both miR1 and miR2 all sense strand sets: miR-24 antisense s (both miR1 and 2 for both mouse and human) based on: ' UGGCUCAGUUCAGCAGGAACAG 3' (seed region is underlined) Related strands modified for seqRNAi use: Group 1 (alternating oro modified nucleosides with native ribose): ' U~R~G-C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G-C-U-C-A-G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) 5' U~R~G~C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C-U-C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U-C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U~C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U~C~A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) 5' U~R~G~C~U~C~A~G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) Group 2 (alternating 2'-fluoro with 2'methyl modified nucleosides): ' U~R~G-C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G-C-U-C-A-G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) 5' U~R~G~C-U-C-A-G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C-U-C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U-C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U~C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U~C~A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) 5' C~U~C~A~G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U-R-G-C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R-G~C-U~C-A~G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G-C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) 5' U~R~G-C-U-C-A-G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C-U-C-A-G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C-U-C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U-C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U~C-A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) 5' U~R~G~C~U~C~A-G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R~G~C~U~C~A~G~U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U-R-G-C-U-C-A-G-U-U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) ' U~R-G~C-U~C-A~G-U~U~C~A~G~C~A~G~G~A~A~C~A~G 3' (#) Group 3 (hair pin design): ' U-G-G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~G~C~C~G 3' (#) ' U-G-G-C-U-C-A-G-U-U-C~A~G~C~C~G~G~A~G~C~C~G 3' (#) ' U-G-G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) ' U-G-G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~G~C~C~G 3' (#) 5' U-G-G-C-U-C-A-G-U-U-C~A~G~C~C~G~G~A~G~C~C~G 3' (#) ' C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) ' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~G~G~A~G~C~C~G 3' (#) ' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) ' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~G~C~C~G 3' (#) 5' U~G~G~C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) ' U~G~G~C-U-C-A-G-U-U-C~A~G~C~C~G~G~A~G~C~C~G 3' (#) ' U~G~G~C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) ' U~G~G~C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~G~C~C~G 3' (#) ' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) 5' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~G~C~C~G 3' (#) ' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~A~C~C~G 3' (#) ' U~G~G-C-U-C-A-G-U-U-C~A~G~C~C~U~G~A~G~C~C~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter tes it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) The C in any CpG may be methylated at the C5 position 5) The 5'end of the antisense strand may have a 5'-phosphate group 6) R is G (ribose), G (2'-fluoro), U (ribose) or U (2'-fluoro) 81. seqRNAi miRNA Mimic Compounds Based on Human miR-24 for use in the sequential stration method described herein. miR1 hairpin (unmatched nucleosides are offset - U may pair with G): g g a ua ucuca cucc gu ccu cugagcuga ucagu u |||| || ||| ||||||||| ||||| u gagg ca gga gacuugacu gguca u a a c -c cacau miR2 hairpin (unmatched nucleosides are offset - U may pair with G): cc cg -cu --aa u cucug ucc ugc acugagcug acacag u ||||| ||| ||| ||||||||| |||||| g gggac agg acg ugacucggu uguguu g -a -- acu caca u Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold. X represents no corresponding nucleoside: miR1 ' UGCCUACUGAGCUGAUAUCAGU 3' (#) 3' GACAAGGACGACUUGACUXCGGU 5' miR2 ' UGCXCUACUGAGCUGAAACACAG 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: miR1 5' UUCCUGCUGAGCUGAGCUAGU 3' (#) 3' GACGACUUGACUCGGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U ated by adjusting sense strand to have standard match to the corresponding antisense strand side the overhang is shown in bold: miR1 ' UUCCUGCUGAACUGAGCCAGU 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' UGGCUCAGUUCAGCAGGAACAG 3' (#) 3' GACAAGGACGACUUGACUCGGU 5' s modified for seqRNAi miRNA use: Set 1 Sense strands: miR1 sense strands based on: ' UGCCUACUGAGCUGAUAUCAGU 3' Related strands modified for seqRNAi use: ' U~G~C~C~U~A~C-U-G-A~G~C-U~G~A~U~A~U~C~A~G~U 3' (#) ' C~U~A~C-U-G-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' U~G~C~C~U~A~C-U-G-A~G~C-U~G~A~U~A~U~C~A~G~U 3' (#) ' U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) 5' U~G~C~C~U~A~C-U-G-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' U~G~C~C~U~A~C-U-G-A-G~C~U~G~A-U-A-U-C~A~G~U 3' (#) ' U~G~C~C~U~A~C~U~GXA~G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' U~G~C~C~U~A~C-U-Y-A-G~C~U~G~A~U~A~U~C~A~G~U 3' (#) ' U~G~C~C~U~A~C~U~Y~A~G~C~U~G~A~U~A~U~C~A~G~U 3' (#) 5' U~G~C~C~U~A~C-U-G*-A-G~C~U~G~A~U~A*~U~C~A~G~U 3' (#) ' U~G~C~C*~U~A~C-U-G*-A-G~C~U~G~A~U~A*~U~C~A~G~U 3' (#) ' U~G~C*~C~U~A~C*-U-G-A-G~C*~U~G~A~U~A~U*~C~A~G~U 3' (#) ' U~G~C*~C~U~A~G-U-G-A-G~C*~U~G~A~U~A~G~C~A~G~U 3' (#) ' U~G~C~C~U~A*~C-U-G-A-G~C~U~G~A~U~A~U~C*~A~G~U 3' (#) 5' C~U~A~C~U~G~A~G~C~U~G~A~U~A~U 3' (#) ' C~U~A~C~U~G~A~G~C~U~G*~A~U~A~U 3' (#) ' C~U~A~C~U~G~A~G*~C~U~G~A~U~A~U 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X tes the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 2 Sense strands: miR1 sense strands based on: 5' CUGAGCUGAGCUAGU 3' Related strands ed for seqRNAi use: ' U~U~C~C~U~G~C-U-G-A~G~C-U~G~A~G~C~U~A~G~U 3' (#) ' U~U~C~C~U~G~C-U-G-A-G~C~U~G~A~G~C~U~A~G~U 3' (#) 5' U~U~C~C~U~G~C-U-G-A~G~C-U~G~A~G~C~U~A~G~U 3' (#) ' U~U~C~C~U~G~C-U-G-A-G~C~U~G~A~G~C~U~A~G~U 3' (#) ' U~U~C~C~U~G~C-U-G-Y-G~C~U~G~A~G~C~U~A~G~U 3' (#) ' U~U~C~C~U~G~C~U~G~Y~G~C~U~G~A~G~C~U~A~G~U 3' (#) ' U~U~C~C*~U~G~C~U~G~Y~G~C~U~G~A~G~C*~U~A~G~U 3' (#) ' U~U~C~C*~U~G~C~U~G~A*~G~C~U~G~A~G~C*~U~A~G~U 3' (#) 5' U~U~C~C*~U~G~C-U-G-A*-G~C~U~G~A~G~C*~U~A~G~U 3' (#) ' U~U~C~C*~U~G~C~U-G-A*-G~C~U~G*~A~G~C*~U~A~G~U 3' (#) ' U~U~C~C*~U~G~C~U-G-A*-G~C~U~C~A~G~C*~U~A~G~U 3' (#) ' U~U~C~G~U~G~C~U~G~A*~G~C~U~G~A~G~G~U~A~G~U 3' (#) ' U~U~C~C~U~G~C~U~G~AXG~C~U~G~A~G~C~U~A~G~U 3' (#) 5' C~C~U~G~C~U~G~A~G~C~U~G~A~G~C 3' (#) ' C~C~U~G~C~U~G~A*~G~C~U~G~A~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes ent phosphodiester linkages and ~ represents phosphorothioate es 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 3 Sense strands: miR1 sense strands based on: ' UUCCUGCUGAACUGAGCCAGU 3' Related s modified for seqRNAi use: ' U~U~C~C~U~G~C~U-G-A-A~C-U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-A-A~C~U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-A-A~C-U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-A-A-C~U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-Y-A-C~U~G~A~G~C~C~A~G~U 3' (#) 5' U~U~C~C~U~G~C~U~G~Y~A~C~U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U*~G~C~U~G~Y~A~C~U~G~A~G~C*~C~A~G~U 3' (#) ' U~U~C~C~U*~G~C~U~G~A*~A~C~U~G~A~G~C*~C~A~G~U 3' (#) ' U~U~C~C*~U~G~C-U-G-A*-A~C~U~G~A~G~C*~C~A~G~U 3' (#) ' U~U~C~C*~U~G~C~U-G-A*-A~C~U~G*~A~G~C*~C~A~G~U 3' (#) 5' U~U~C*~C~U~G~C*~U-G-A*-A~C*~U~G~A~G*~C~C~A~G~U 3' (#) ' U~U~C~G~U~G~C~U~G~A*~A~C~U~G~A~G~G~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U~G~AXA~C~U~G~A~G~C~C~A~G~U 3' (#) ' C~C~U~G~C~U~G~A~A~C~U~G~A~G~C 3' (#) ' C~C~U~G~C~U~G~A~A*~C~U~G~A~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more uous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group Set 4 Sense strands: miR2 sense strands based on: Mouse set 4 sense strand without 5'-end G Related s modified for seqRNAi use: ' U~G~C~C~U~A~C~U-G-A-G~C-U~G~A~A~A~C~A~G~U 3' (#) 5' U~G~C~C~U~A~C~U-G-A-G-C~U~G~A~A~A~C~A~G~U 3' (#) ' U~G~C~C~U~A~C~U-G-A-G~C-U~G~A~A~A~C~A~G~U 3' (#) ' U~G~C~C~U~A~C~U-G-A-G-C~U~G~A~A~A~C~A~G~U 3' (#) ' U~G~C~C~U~A~C~U~G~AXG~C~U~G~A~A~A~C~A~G~U 3' (#) ' C~U~A~C-U-G-Y-G~C~U~G~A~A~A~C~A~G~U 3' (#) 5' U~G~C~C~U~A~C~U~G~Y~G~C~U~G~A~A~A~C~A~G~U 3' (#) ' U~G~C~C~U~A~C-U-G-A*-G~C~U~G~A~A~A~C~A~G~U 3' (#) ' U~G~C~C*~U~A~C-U-G-A*-G~C~U~G~A~A~A*~C~A~G~U 3' (#) ' U~G~C~C~U~A~C-U-G-A*-G~C~U~G~A~A~A*~C~A~G~U 3' (#) ' U~G~C~C~U~A~C*-U-G-A-G~C~U~G~A~A~A~C~A~G~U 3' (#) 5' C~C~U~A~C~U~G~A~G~C~U~G~A~A~A~C 3' 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more uous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or ethyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 5 Sense strands: miR2 sense strands based on: Mouse set 4 sense strand without 5'-end G Related strands modified for seqRNAi use: ' U~U~C~C~U~G~C~U-G-A-G~C-U~G~A~G~C~C~A~G~U 3' (#) 5' U~U~C~C~U~G~C~U-G-A-G-C~U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-A-G~C-U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-A-G-C~U~G~A~G~C~C~A~G~U 3' (#) ' U~U~C~C~U~G~C~U-G-Y-G-C~U~G~A~G~C~C~A~G~U 3' (#) ' C~U~G~C~U~G~Y~G~C~U~G~A~G~C~C~A~G~U 3' (#) 5' U~U~C~C~U*~G~C~U~G~Y~G~C~U~G~A~G~C*~C~A~G~U 3' (#) ' U~U~C~C~U*~G~C~U~G~A~G*~C~U~G~A~G~C*~C~A~G~U 3' (#) ' U~U~C~C~U*~G~C-U-G-A-G*~C~U~G~A~G~C*~C~A~G~U 3' (#) ' U~U~C~C~U*~G~C~U-G-A-G*~C~U~G*~A~G~C*~C~A~G~U 3' (#) ' U~U~C~G~U~G~C~U~G~A~G~C~U~G~A~G~G~C~A~G~U 3' (#) 5' C~U~G~C~U~G~AXG~C~U~G~A~G~C~C~A~G~U 3' (#) ' C~C~U~G~C~U~G~Y~G~C~U~G~A~G~C 3' (#) ' G~C~U~G~Y~G~C~U~G~A~G~C 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group Set 6 Sense s: miR2 sense strands based on: ' UUCCUGCUGAACUGAGCCAGU 3' Related strands modified for seqRNAi use: Same as human Set 3 for miR1 Set 7 Sense strands: These sense strands have been designed to be complementary to the miR-24 antisense strands that form hairpins. They will produce activity in both mouse and human cells and in cells from any other species that has the same miR-24 antisense strand.

These are the same as the mouse miR-24 Set 7 sense strands 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester es and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any + after a letter indicates the nucleoside is an LNA ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Antisense strands for both miR1 and miR2 all sense strand sets: miR-24 antisense strands (both miR1 and 2 for both mouse and human) based on: ' UGGCUCAGUUCAGCAGGAACAG 3' (seed region is ined) Related strands modified for seqRNAi use: Group 1 (alternating 2'-fluoro ed nucleosides with native ribose): Same as for mouse miR-24 Group 2 nating 2'-fluoro with 2'methyl modified nucleosides): Same as for mouse miR-24 Group 3 (hair pin design): Same as for mouse miR-24 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent odiester linkages and ~ ents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) The C in any CpG may be methylated at the C5 position ) The 5'end of the antisense strand may have a 5'-phosphate group 6) R is G (ribose), G (2'-fluoro), U (ribose) or U (2'-fluoro) 82. seqRNAi miRNA Mimic Compounds Based on Mouse miR-26a for use in the sequential stration method described herein. miR-26a-1 hairpin (unmatched nucleosides are offset - U may pair with G): a - g u c g gca g aggcc gug ccucgu caaguaauc aggauaggcu u g u ||||| ||| |||||| ||||||||| |||||||||| | | uccgg cgc ggggca guucauugg ucuuauccgg g c c g g a c u g -aa c miR-26a-2 hairpin (unmatched nucleosides are offset - U may pair with G): g gg ug uu c -- uc gcugc c ga caaguaauc aggauaggcu gug c ||||| | || ||||||||| |||||||||| ||| cgacg g cu guucauuag ucuuguccgg uac g g ga gu uu u ag cu Endogenous sense strand top and antisense strand bottom with unmatched sides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: miR-26a-1 5' CCUAUUCUUGGUUACUUGCACG 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' miR-26a-2 ' CCUGUUCUUGAUUACUUGUUUC3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U s indicated by underline and overhang is indicated in bold: miR-26a-1 ' CCUAUUCUGGGUUACUUGAACG 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' miR-26a-2 ' CCUGUUCUGGAUUACUUGAAUC3' (#) 3' AGGACCUAAUGAACUU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U ated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: miR-26a-1 ' CCUAUCCUGGAUUACUUGAACG 3' (#) 3' AGGACCUAAUGAACUU 5' miR-26a-2 5' CCUAUCCUGGAUUACUUGAAUC3' (#) 3' AGGACCUAAUGAACUU 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' UUCAAGUAAUCCAGGAUAGGCU 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' Strands modified for seqRNAi miRNA use: Set 1 Sense strands: miR-26a-1 sense strands based on: ' CCUAUUCUUGGUUACUUGCACG 3' Related strands modified for seqRNAi use: ' C~C~U~A~U~U~C~U-U-G-G~U~U-A~C~U~U~G~C~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-U-G-G-U~U~A~C~U~U~G~C~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-U-G-G~U~U-A~C~U~U~G~C~A~C~G 3' (#) 5' C~C~U~A~U~U~C~U-U-G-G-U~U~A~C~U~U~G~C~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-U-Y-G-U~U~A~C~U~U~G~C~A~C~G 3' (#) ' C~C~U~A~U~U~C~U~U~Y~G~U~U~A~C~U~U~G~C~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U~U~Y~G~U~U~A~C~U~U~G*~C~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U~U~G*~G~U~U~A~C~U~U~G*~C~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U-U-G*-G-U~U~A~C~U~U~G*~C~A~C~G 3' (#) 5' C~C~U~A~U*~U~C~U~U-G*-G-U~U~A~C*~U~U~G*~C~A~C~G 3' (#) ' C~C~U~A*~U~U~C~U*~U-G-G-U~U*~A~C~U~U*~G~C~A~C~G 3' (#) ' C~C~U~A~G~U~C~U~U~G*~G~U~U~A~C~U~U~A~C~A~C~G 3' (#) ' A~U~U~C~U~U~GXG~U~U~A~C~U~U~G~C~A~C~G 3' (#) ' A~U~U~C~U~U~G~G~U~U~A~C~U~U~G 3' (#) 5' A~U~U~C~U~U~G~G*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 2 Sense strands: miR-26a-1 sense strands based on: ' CCUAUUCUGGGUUACUUGAACG 3' Related strands ed for seqRNAi use: ' C~C~U~A~U~U~C~U-G-G-G~U~U-A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-G-G-G-U~U~A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-G-G-G~U~U-A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-G-G-G-U~U~A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~U~C~U-G-Y-G-U~U~A~C~U~U~G~A~A~C~G 3' (#) 5' C~C~U~A~U~U~C~U~G~Y~G~U~U~A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U~G~Y~G~U~U~A~C~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U~G~G*~G~U~U~A~C~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U-G-G*-G-U~U~A~C~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A~U*~U~C~U~G-G*-G-U~U~A~C*~U~U~G*~A~A~C~G 3' (#) 5' C~C~U~A*~U~U~C~U*~G-G-G-U~U*~A~C~U~U*~G~A~A~C~G 3' (#) ' C~C~U~A~G~U~C~U~G~G*~G~U~U~A~C~U~U~A~A~A~C~G 3' (#) ' C~C~U~A~U~U~C~U~G~GXG~U~U~A~C~U~U~G~A~A~C~G 3' (#) ' A~U~U~C~U~G~G~G~U~U~A~C~U~U~G 3' (#) ' C~U~G~G~G*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor ined are native ribose. 2) One or more uous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 3 Sense strands: miR-26a-1 sense strands based on: ' CUGGAUUACUUGAACG 3' Related strands ed for seqRNAi use: ' C~C~U~A~U~C~C~U-G-G-A~U~U-A~C~U~U~G~A~A~C~G 3' (#) 5' A~U~C~C~U-G-G-A-U~U~A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~C~C~U-G-G-A~U~U-A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~C~C~U-G-G-A-U~U~A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~C~C~U-G-Y-A-U~U~A~C~U~U~G~A~A~C~G 3' (#) ' C~C~U~A~U~C~C~U~G~Y~A~U~U~A~C~U~U~G~A~A~C~G 3' (#) 5' C~C~U~A~U*~C~C~U~G~Y~A~U~U~A~C~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A~U*~C~C~U~G~G*~A~U~U~A~C~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A~U*~C~C~U-G-G*-A-U~U~A~C~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A~U*~C~C~U~G-G*-A-U~U~A~C*~U~U~G*~A~A~C~G 3' (#) ' C~C~U~A*~U~C~C~U*~G-G-A-U~U*~A~C~U~U*~G~A~A~C~G 3' (#) 5' C~C~U~A~G~C~C~U~G~G*~A~U~U~A~C~U~U~A~A~A~C~G 3' (#) ' C~C~U~A~U~C~C~U~G~GXA~U~U~A~C~U~U~G~A~A~C~G 3' (#) ' A~U~C~C~U~G~G~A~U~U~A~C~U~U~G 3' (#) ' A~U~C~C~U~G~G~A*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any sk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 4 Sense strands: miR-26a-2 sense strands based on: ' CCUGUUCUUGAUUACUUGUUUC3' Related strands ed for seqRNAi use: ' C~C~U~G~U~U~C~U-U-G-A~U~U-A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~G~U~U~C~U-U-G-A-U~U~A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~G~U~U~C~U-U-G-A~U~U-A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~G~U~U~C~U-U-G-A-U~U~A~C~U~U~G~U~U~U~C 3' (#) 5' C~C~U~G~U~U~C~U-U-Y-A-U~U~A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~G~U~U~C~U~U~Y~A~U~U~A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~G~U*~U~C~U~U~Y~A~U~U~A~C~U~U~G*~U~U~U~C 3' (#) ' C~C~U~G~U*~U~C~U~U~G*~A~U~U~A~C~U~U~G*~U~U~U~C 3' (#) ' C~C~U~G~U*~U~C~U-U-G*-A-U~U~A~C~U~U~G*~U~U~U~C 3' (#) 5' C~C~U~G~U*~U~C~U~U-G*-A-U~U~A~C*~U~U~G*~U~U~U~C 3' (#) ' C~C~U~G*~U~U~C~U*~U-G-A-U~U*~A~C~U~U*~G~U~U~U~C 3' (#) ' G~G~U~C~U~U~G*~A~U~U~A~C~U~U~A~U~U~U~C 3' (#) ' C~C~U~G~U~U~C~U~U~GXA~U~U~A~C~U~U~G~U~U~U~C 3' (#) ' G~U~U~C~U~U~G~A~U~U~A~C~U~U~G 3' (#) ' G~U~U~C~U~U~G~A*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as ro or 2'methyl. 4) Any X tes the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group Set 5 Sense strands: miR-26a-2 sense strands based on: 5' CCUGUUCUGGAUUACUUGAAUC3' Related strands modified for seqRNAi use: ' C~C~U~G~U~U~C~U-G-G-A~U~U-A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~G~U~U~C~U-G-G-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~G~U~U~C~U-G-G-A~U~U-A~C~U~U~G~A~A~U~C 3' (#) 5' C~C~U~G~U~U~C~U-G-G-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~G~U~U~C~U-G-Y-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' G~U~U~C~U~G~Y~A~U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~G~U*~U~C~U~G~Y~A~U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' C~C~U~G~U*~U~C~U~G~G*~A~U~U~A~C~U~U~G*~A~A~U~C 3' (#) 5' C~C~U~G~U*~U~C~U-G-G*-A-U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' C~C~U~G~U*~U~C~U~G-G*-A-U~U~A~C*~U~U~G*~A~A~U~C 3' (#) ' G*~U~U~C~U*~G-G-A-U~U*~A~C~U~U*~G~A~A~U~C 3' (#) ' C~C~U~G~G~U~C~U~G~G*~A~U~U~A~C~U~U~A~A~A~U~C 3' (#) ' C~C~U~G~U~U~C~U~G~GXA~U~U~A~C~U~U~G~A~A~U~C 3' (#) ' G~U~U~C~U~G~G~A~U~U~A~C~U~U~G 3' (#) 5' G~U~U~C~U~G~G~A*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl cation, those that are underlined are oro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent odiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These sides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 6 Sense strands: miR-26a-2 sense strands based on: ' CCUAUCCUGGAUUACUUGAAUC3' (#) Related strands modified for seqRNAi use: 5' C~C~U~A~U~C~C~U-G-G-A~U~U-A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~C~C~U-G-G-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~C~C~U-G-G-A~U~U-A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~C~C~U-G-G-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~C~C~U-G-Y-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) 5' C~C~U~A~U~C~C~U~G~Y~A~U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U*~C~C~U~G~Y~A~U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' C~C~U~A~U*~C~C~U~G~G*~A~U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' A~U*~C~C~U-G-G*-A-U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' C~C~U~A~U*~C~C~U~G-G*-A-U~U~A~C*~U~U~G*~A~A~U~C 3' (#) ' A*~U~C~C~U*~G-G-A-U~U*~A~C~U~U*~G~A~A~U~C 3' (#) 5' C~C~U~A~G~C~C~U~G~G*~A~U~U~A~C~U~U~A~A~A~U~C 3' (#) ' C~C~U~A~U~C~C~U~G~GXA~U~U~A~C~U~U~G~A~A~U~C 3' (#) ' A~U~C~C~U~G~G~A~U~U~A~C~U~U~G 3' (#) ' A~U~C~C~U~G~G~A*~U~U~A~C~U~U~G 3' (#) Set 7 Sense strands: These sense strands have been designed to be complementary to the miR-26a antisense strands that form hairpins. They will produce activity in both mouse and human cells and in cells from any other species that has the same miR-26a antisense strand.

' C~U~C~A~A~A~U~A-A-U-G~G-A~U-U~A~C~U~U~G~A~A 3' (#) ' A~A~A~U~A-A-Y-G~G-A~U-U~A~C~U~U~G~A~A 3' (#) 5' C~U~C~A~A~A~U~A~A~Y~G~G-A~U~U~A~C~U~U~G~A~A 3' (#) ' C~U~C~A~A~A~U~A~A~Y~G~G-A~U~U~A~C~U~U~U~A~A 3' (#) ' C~U~C~A~A~A~U~A~A~U*~G~G-A~U~U~A~C~U~U~G~A~A 3' (#) ' C~U~C~A~A~A~U~A~A~U*~G~G-A~U~U~A~C~U~U*~G~A~A 3' (#) ' A~A~A~U~A~A~U~G~G-A~U~U~A~C~U~U 3' (#) 5' A~A+~A~U~A~A~U~G~G-A~U~U~A~C~U+~U 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an ed nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any + after a letter indicates the nucleoside is an LNA ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Antisense strands for both miR-26a-1 and miR-26a-2 all sense strand sets: miR-26a nse s (both miR-26a-1 and 2 for both mouse and human) based on: ' UUCAAGUAAUCCAGGAUAGGCU 3' (seed region is underlined) Related strands modified for i use: Group 1 (alternating 2'-fluoro modified nucleosides with native ribose): ' U~R~C-A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C-A-A-G-U-A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) 5' U~R~C~A-A-G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A-G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' A~A~G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G~U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G~U~A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) Group 2 (alternating 2'-fluoro with 2'methyl modified nucleosides): ' U~R~C-A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C-A-A-G-U-A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A-A-G-U-A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) 5' U~R~C~A-A-G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A-G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G~U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G~U~A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) 5' U-R-C-A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R-C~A-A~G-U~A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C-A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C-A-A-G-U-A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) 5' A-A-G-U-A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A-A-G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A-G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G-U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R~C~A~A~G~U-A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) 5' U~R~C~A~A~G~U~A~A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U-R-C-A-A-G-U-A-A-U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) ' U~R-C~A-A~G-U~A-A~U~C~C~A~G~G~A~U~A~G~G~C~U 3' (#) Group 3 (hair pin design): ' A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) 5' U-U-C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U-U-C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U-U-C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U-U-C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U~U-C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) 5' U~U~C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U~U~C~A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U~U~C~A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U~U~C-A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) 5' U~U~C~A-A-G-U-A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U~U~C~A-A-G-U~A-A-U-C~C~A~U~U~A~U~U~U~G~A~G 3' (#) ' U~U~C~A-A-G-U~A-A-U-C~C~A~U~U~A~U~A~U~G~A~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are r bold nor underlined are native . 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) The C in any CpG may be methylated at the C5 position ) The 5'end of the antisense strand may have a 5'-phosphate group 6) R is U (ribose) or U (2'-fluoro) 83. seqRNAi miRNA Mimic Compounds Based on Human miR-26a for use in the sequential administration method described . miR-26a-1 hairpin (unmatched nucleosides are offset - U may pair with G): g u c --g ca gug ccucgu caaguaauc aggauaggcu ug g ||| |||||| ||||||||| |||||||||| || g cgc ggggca guucauugg ucuuauccgg ac u a c u gua cc miR-26a-2 hairpin (unmatched nucleosides are offset - U may pair with G): gg ug uu c guuucc ggcugu c ga caaguaauc aggauaggcu a |||||| | || ||||||||| |||||||||| ucgacg g cu uag ucuuauccgg u ga gu uu u aguguc Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: miR-26a-1 5' CUUGGUUACUUGCACG 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' miR-26a-2 ' CCUAUUCUUGAUUACUUGUUUC 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: miR-26a-1 ' CCUAUUCUGGGUUACUUGAACG 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' miR-26a-2 ' CCUAUUCUGGAUUACUUGAAUC 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U ated by adjusting sense strand to have standard match to the ponding antisense strand side the overhang is shown in bold: miR-26a-1 ' CCUAUCCUGGAUUACUUGAACG 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' miR-26a-2 ' CCUAUCCUGGAUUACUUGAAUC 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' Endogenous antisense strand with overhang shown in bold and shown n in both directions: ' UUCAAGUAAUCCAGGAUAGGCU 3' (#) 3' UCGGAUAGGACCUAAUGAACUU 5' s modified for seqRNAi miRNA use: Set 1 Sense strands: miR-26a-1 sense strands based on: ' CCUAUUCUUGGUUACUUGCACG 3' Related strands modified for seqRNAi use: Same as mouse miR-26a-1 Set 1 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester es and ~ represents phosphorothioate linkages 3) Any sk after a letter indicates it is an unlocked c acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic side 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 2 Sense strands: miR-26a-1 sense strands based on: ' CCUAUUCUGGGUUACUUGAACG 3' Related strands modified for seqRNAi use: Same as mouse miR-26a-1 Set 2 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a e ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 3 Sense strands: miR-26a-1 sense strands based on: ' CUGGAUUACUUGAACG 3' Related strands modified for seqRNAi use: Same as mouse miR-26a-1 Set 3 1) The sides shown in bold have the ethyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ ents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an ed nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 4 Sense strands: miR-26a-2 sense strands based on: ' CUUGAUUACUUGUUUC 3' Related strands modified for seqRNAi use: ' C~C~U~A~U~U~C~U-U-G-A~U~U-A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~A~U~U~C~U-U-G-A-U~U~A~C~U~U~G~U~U~U~C 3' (#) 5' C~C~U~A~U~U~C~U-U-G-A~U~U-A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~A~U~U~C~U-U-G-A-U~U~A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~A~U~U~C~U-U-Y-A-U~U~A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~A~U~U~C~U~U~Y~A~U~U~A~C~U~U~G~U~U~U~C 3' (#) ' C~C~U~A~U*~U~C~U~U~Y~A~U~U~A~C~U~U~G*~U~U~U~C 3' (#) 5' C~C~U~A~U*~U~C~U~U~G*~A~U~U~A~C~U~U~G*~U~U~U~C 3' (#) ' A~U*~U~C~U-U-G*-A-U~U~A~C~U~U~G*~U~U~U~C 3' (#) ' C~C~U~A~U*~U~C~U~U-G*-A-U~U~A~C*~U~U~G*~U~U~U~C 3' (#) ' C~C~U~A*~U~U~C~U*~U-G-A-U~U*~A~C~U~U*~G~U~U~U~C 3' (#) ' C~C~U~A~G~U~C~U~U~G*~A~U~U~A~C~U~U~A~U~U~U~C 3' (#) 5' C~C~U~A~U~U~C~U~U~GXA~U~U~A~C~U~U~G~U~U~U~C 3' (#) ' A~U~U~C~U~U~G~A~U~U~A~C~U~U~G 3' (#) ' A~U~U~C~U~U~G~A*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are ined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents orothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Set 5 Sense strands: miR-26a-2 sense strands based on: 5' CCUAUUCUGGAUUACUUGAAUC 3' d s modified for seqRNAi use: ' C~C~U~A~U~U~C~U-G-G-A~U~U-A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~U~C~U-G-G-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~U~C~U-G-G-A~U~U-A~C~U~U~G~A~A~U~C 3' (#) 5' A~U~U~C~U-G-G-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~U~C~U-G-Y-A-U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U~U~C~U~G~Y~A~U~U~A~C~U~U~G~A~A~U~C 3' (#) ' C~C~U~A~U*~U~C~U~G~Y~A~U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' C~C~U~A~U*~U~C~U~G~G*~A~U~U~A~C~U~U~G*~A~A~U~C 3' (#) 5' C~C~U~A~U*~U~C~U-G-G*-A-U~U~A~C~U~U~G*~A~A~U~C 3' (#) ' C~C~U~A~U*~U~C~U~G-G*-A-U~U~A~C*~U~U~G*~A~A~U~C 3' (#) ' C~C~U~A*~U~U~C~U*~G-G-A-U~U*~A~C~U~U*~G~A~A~U~C 3' (#) ' C~C~U~A~G~U~C~U~G~G*~A~U~U~A~C~U~U~A~A~A~U~C 3' (#) ' C~C~U~A~U~U~C~U~G~GXA~U~U~A~C~U~U~G~A~A~U~C 3' (#) 5' A~U~U~C~U~G~G~A~U~U~A~C~U~U~G 3' (#) ' A~U~U~C~U~G~G~A*~U~U~A~C~U~U~G 3' (#) 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid monomer. These sides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) Any X indicates the lack of a linkage ) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a ethyl group Set 6 Sense strands: miR-26a-2 sense strands based on: 5' CCUAUCCUGGAUUACUUGAAUC 3' Related strands modified for seqRNAi use: Same as Set 6 for mouse miR-26a-1 Set 7 Sense strands: These sense strands have been designed to be complementary to the a antisense s that form hairpins. They will produce activity in both mouse and human cells and in cells from any other species that has the same miR-26a antisense .

Same as Set 7 for mouse miR-26a 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose cations such as 2'-fluro or 2'methyl. 4) Any + after a letter indicates the nucleoside is an LNA 5) Any Y indicates an abasic nucleoside 6) The C in any CpG may be methylated at the C5 position 7) The 5'end of the sense strand may have a 5'methyl group Antisense strands for both miR-26a-1 and a-2 all sense strand sets: miR-26a antisense strands (both miR-26a-1 and 2 for both mouse and human) based on: ' UUCAAGUAAUCCAGGAUAGGCU 3' (seed region is underlined) Related strands modified for seqRNAi use: Group 1 (alternating 2'-fluoro modified nucleosides with native ribose): Same as antisense strands for mouse miR-26a Group 2 (alternating 2'-fluoro with 2'methyl modified nucleosides): Same as nse strands for mouse miR-26a Group 3 (hair pin design): Same as antisense strands for mouse miR-26a 1) The nucleosides shown in bold have the 2’methyl modification, those that are underlined are 2’-fluoro and those that are neither bold nor underlined are native ribose. 2) One or more contiguous dashes represent phosphodiester linkages and ~ represents phosphorothioate linkages 3) Any asterisk after a letter indicates it is an unlocked nucleic acid r. These nucleosides do not have other ribose modifications such as 2'-fluro or 2'methyl. 4) The C in any CpG may be methylated at the C5 position ) The 5'end of the antisense strand may have a 5'-phosphate group 6) R is U (ribose) or U (2'-fluoro) 84. seqRNAi miRNA Mimic Compounds Based on Mouse miR-29 for use in the tial administration method described herein. 84A. Mouse a: miR-29a n (unmatched nucleosides are offset - U may pair with G): a uuagagg uuu c ucaa cccc gauuuc ugguguu agag u |||| |||||| ||||||| |||| a gggg cuaaag accacga ucuu g a uuaguaa ucu - uuaa Endogenous sense strand top and nse strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold. X represents no corresponding nucleoside: ' ACUGAUUUCUUUUGGUGUUCAG 3' (#) 3' AUUGGCUAAAGUCUACCACGAXU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' ACUGAUUUCAGAUGGUGUUA 3' (#) 3' UAAAGUCUACCACGAU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only d nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: ' ACCGAUUUCAGAUGGUGCUA 3' (#) 3' AUUGGCUAAAGUCUACCACGAU 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' UAGCACCAUCUGAAAUCGGUUA 3' (#) 3' AUUGGCUAAAGUCUACCACGAU 5' Strands modified for seqRNAi miRNA use (note these also apply to human miR-29a): 84B. Mouse miR-29b: miR-29b-1 n (unmatched nucleosides are offset - U may pair with G): a u gu uuaaa agga gcugguuuca auggug uuagau u |||| |||||||||| |||||| |||||| a ucuu ugacuaaagu uaccac gaucug g g u -- uuagu miR-29b-2 hairpin (unmatched nucleosides are offset - U may pair with G): - c g u uuuucc gaa gcugguuuca auggug cu agau a ||||||||| |||||||||| |||||| || |||| gaggauuuu ugacuaaagu uaccac ga ucua u g u - - uguuuc Endogenous sense strand top and antisense strand bottom with hed nucleosides indicated by both italics and ine, with G:U matches underlined and overhangs in bold. X Represents no corresponding nucleoside: miR-29b-1 5' GCUGGUUUCAUAUGGUGGUUUA 3' (#) 3' UUGUGACUAAAGUUUACCACXXGAU 5' miR-29b-2 ' CUGGUUUCACAUGGUGGCUUAGAUU 3' (#) 3' UUGUGACUAAAGUUUACCACXGAU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: miR-29b-1 ' GCUGGUUUCAAAUGGUGCUA 3' (#) 3' UUGUGACUAAAGUUUACCACGAU 5' miR-29b-2 5' CUGGUUUCAAAUGGUGCUAGAUU 3' (#) 3' UUGUGACUAAAGUUUACCACGAU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: miRb1 ' ACUGAUUUCAAAUGGUGCUA 3' (#) 3' UUGUGACUAAAGUUUACCACGAU 5' miRb2 5' CUGAUUUCAAAUGGUGCUAGAUU 3' (#) 3' UUGUGACUAAAGUUUACCACGAU 5' Endogenous nse strand with overhang shown in bold and shown n in both ions: ' UAGCACCAUUUGAAAUCAGUGUU 3' (#) 3' UUGUGACUAAAGUUUACCACGAU 5' Strands modified for seqRNAi miRNA use: miR-29b-1 (note these also apply to human miR-29b-1): miR-29b-2 (note these also apply to human miR-29b-2): 84C. Mouse miR-29c: miR-29c hairpin (unmatched nucleosides are offset - U may pair with G): a - ggc ucc --- u aca ca ugaccgauuuc ugguguu cagag c ||||||||| || ||||||||||| ||||||| ||||| u gggggaugu gu auuggcuaaag accacga guuuu g a a --- uuu ucu u nous sense strand top and antisense strand bottom with unmatched nucleosides ted by both italics and underline, with G:U matches underlined: ' UGACCGAUUUCUCCUGGUGUUC 3' (#) 3' AUUGGCUAAAGUUUACCACGAU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline: ' UGACCGAUUUCAAAUGGUGUUA 3' (#) 3' AUUGGCUAAAGUUUACCACGAU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have standard match to the ponding antisense strand nucleoside: ' UAACCGAUUUCAAAUGGUGCUA 3' (#) 3' AUUGGCUAAAGUUUACCACGAU 5' Endogenous antisense strand with overhang shown in bold and shown n in both directions: ' UAGCACCAUUUGAAAUCGGUUA 3' (#) 3' AUUGGCUAAAGUUUACCACGAU 5' Strands modified for seqRNAi miRNA use (note these also apply to human miR-29c): 85. seqRNAi miRNA Mimic Compounds Based on Human miR-29 for use in the sequential administration method described herein. 85A. Human miR-29a: Pre-miRNA (unmatched nucleosides are offset - U may pair with G): uuu c ucaa augacugauuuc ugguguu agag u |||||| | |||| a uauuggcuaaag accacga ucuu u ucu - uuaa Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and ine, with G:U matches ined and overhangs in bold: Same as for mouse miR-29a Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and es G:U matches indicated by underline and overhang is indicated in bold: Same as for mouse miR-29a Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: Same as for mouse miR-29a nous antisense strand with overhang shown in bold and shown written in both directions: Same as for mouse a Strands ed for seqRNAi miRNA use: Same as for mouse miR-29a 85B. Human miR-29b: miR-29b-1 hairpin (unmatched nucleosides are offset - U may pair with G): - - u gu uuaaa cuucaggaa gcugguuuca auggug uuagau u ||||||||| |||||||||| |||||| |||||| a gggguucuu ugacuaaagu uaccac gaucug g g g u -- uuagu miR-29b-2 hairpin (unmatched nucleosides are offset - U may pair with G): - c g u uuuucc cuucuggaa gcugguuuca auggug cu agau a ||||||||| |||||||||| |||||| || |||| gaggauuuu ugacuaaagu uaccac ga ucua u g u - - uguuuc Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: Same as for mouse miR-29b-1 (except human has a GA rhang in the sense ) Same as for mouse miR-29b-2 (except human lacks terminal AUU in 3'-overhang in the sense strand) Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is ted in bold: Same as for mouse miR-29b-1 Same as for mouse miR-29b-2 Sense strand top and antisense strand bottom where sense strand has been adjusted to have only d sides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: Same as for mouse miR-29b-1 Same as for mouse miR-29b-2 nous antisense strand with overhang shown in bold and shown written in both ions: Same as for mouse miR-29b-1 Same as for mouse miR-29b-2 Strands modified for seqRNAi miRNA use: Same as for mouse miR-29b-1 Same as for mouse miR-29b-2 85C. Human miR-29c: miR-29c hairpin (unmatched nucleosides are offset - U may pair with G): a - ggc ucc --- u ucucuuaca ca ugaccgauuuc ugguguu cagag c ||||||||| || ||||||||||| ||||||| ||||| u gggggaugu gu auuggcuaaag accacga guuuu g a a --- uuu ucu u Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: Same as for mouse miR-29c Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the nse strand and includes G:U matches indicated by ine and overhang is indicated in bold: Same as for mouse miR-29c Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by ing sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: Same as for mouse miR-29c Endogenous nse strand with overhang shown in bold and shown written in both directions: Same as for mouse miR-29c Strands modified for seqRNAi miRNA use: Same as for mouse c 86. seqRNAi miRNA Mimic Compounds Based on Mouse miR-122 for use in the sequential administration method described herein. miR-122 hairpin (unmatched nucleosides are offset - U may pair with G): gg c - uc agcugu aguguga aaugguguuug ug c |||||| ||||||| ||||||||||| || a ucgaua ucacacu uuaccgcaaac ac a aa a u ca Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U s underlined and overhangs in bold: ' AAACGCCAUUAUCACACUAA 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' AAACGCCAUUGUCACACUCC 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only d nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: ' CAUUGUCACACUCC 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' nous antisense strand with overhang shown in bold and shown written in both directions: ' UGGAGUGUGACAAUGGUGUUUG 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Strands modified for seqRNAi miRNA use: 87. seqRNAi miRNA Mimic nds Based on Human miR-122 for use in the sequential administration method described herein. miR-122 hairpin (unmatched sides are offset - U may pair with G): c - gg c --u c cuuagcag agcugu a aaugguguuug gu u |||||||| |||||| ||||||| ||||||||||| || ggaucguc ucgaua ucacacu uuaccgcaaac ca a c a aa a uau a Endogenous sense strand top and nse strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: 5' AACGCCAUUAUCACACUAAAUA 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by ine and ng is indicated in bold: ' AACGCCAUUGUCACACUCCAUA 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: ' AACACCAUUGUCACACUCCAUA 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' UGGAGUGUGACAAUGGUGUUUG 3' (#) 3' GUUUGUGGUAACAGUGUGAGGU 5' Strands modified for i miRNA use: 88. seqRNAi miRNA Mimic Compounds Based on Mouse miR-146a for use in the sequential administration method described herein. miR-146a hairpin ched nucleosides are offset - U may pair with G): cu c auauc agcu gagaacugaauu cauggguu a |||| |||||||||||| |||||||| ucga uucuugacuuaa guguccag a -c a acugu Endogenous sense strand top and antisense strand bottom with hed nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold. X represents no ponding nucleoside: ' CCUGUGAAAUUCAGUUCUUCXAG 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and ng is indicated in bold: ' CCUGUGGAAUUCAGUUCUUAAG 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U ated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: 5' CCCAUGGAAUUCAGUUCUCAAG 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Endogenous antisense strand with overhang shown in bold and shown written in both ions: ' UGAGAACUGAAUUCCAUGGGUU 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Strands modified for seqRNAi miRNA use: 89. seqRNAi miRNA Mimic nds Based on Human miR-146a for use in the sequential administration method described herein. miR-146a n (unmatched nucleosides are offset - U may pair with G): c -----u u uu c u g uc cgaug guaucc cagcu gagaacugaauu ca ggguu ug a ||||| |||||| ||||| |||||||||||| || ||||| || g gcuac uauagg gucga uucuugacuuaa gu uccag ac u u ugucuc - -c a c - ug Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: ' CCUCUGAAAUUCAGUUCUUCAG 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched sides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' CCUAUGGAAUUCAGUUCUUAAG 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have rd match to the corresponding antisense strand nucleoside the overhang is shown in bold: 5' CCCAUGGAAUUCAGUUCUCAAG 3' (#) 3' UUGGGUACCUUAAGUCAAGAGU 5' Endogenous antisense strand with overhang shown in bold and shown n in both directions: ' UGAGAACUGAAUUCCAUGGGUU 3' (#) 3' ACCUUAAGUCAAGAGU 5' Strands modified for seqRNAi miRNA use: 90. seqRNAi miRNA Mimic Compounds Based on Mouse miR-203 for use in the sequential administration method bed herein. miR-203 hairpin (unmatched nucleosides are offset - U may pair with G): u c u g a c gcc gguc agugguucu gaca uuca caguu ugu ||| |||| ||||||||| |||| |||| ||||| || a cgg ccag ucaccagga uugu aagu guuaa acg c a u a - c Endogenous sense strand top and antisense strand bottom with hed nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold. X represents no corresponding nucleoside: ' AGUGGUUCUUGACAGUUCAACA 3' (#) 3' CAGGAUUUGUAAAGUXG 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' AGUGGUUCUAGACAUUUCACA 3' (#) 3' GAUCACCAGGAUUUGUAAAGUG 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by ing sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: ' AGUGGUCCUAAACAUUUCACA 3' (#) 3' GAUCACCAGGAUUUGUAAAGUG 5' Note: this strand pair is the same as for human miR-203 Endogenous antisense strand with ng shown in bold and shown n in both directions: ' UGUUUAGGACCACUAG 3' (#) 3' GAUCACCAGGAUUUGUAAAGUG 5' Strands modified for i miRNA use: 91. seqRNAi miRNA Mimic Compounds Based on Human miR-203 for use in the sequential administration method described herein. miR-203 hairpin (unmatched nucleosides are offset - U may pair with G): g gg a u g c u g a - ug uguug g c cgc cgcuggguc agugguucu aaca uuca caguu c u ||||| | | ||| ||||||||| ||||||||| |||| |||| ||||| | gcgac c g gcg cag ucaccagga uugu aagu guuaa g a a ag g c g a u a - c cg Endogenous sense strand top and nse strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold. X represents no corresponding nucleoside: ' AGUGGUUCUUAACAGUUCAACA 3' (#) 3' GAUCACCAGGAUUUGUAAAGUXG 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' AGUGGUUCUAAACAUUUCACA 3' (#) 3' GAUCACCAGGAUUUGUAAAGUG 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U ated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: Same as for mouse miR-203 Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' GUGAAAUGUUUAGGACCACUAG 3' (#) 3' GAUCACCAGGAUUUGUAAAGUG 5' Strands modified for seqRNAi miRNA use: 92. seqRNAi miRNA Mimic Compounds Based on Mouse miR-214 for use in the sequential stration method described herein. miR-214 hairpin (unmatched nucleosides are offset - U may pair with G): ggccu acaga u aca aacau ggcugg guugucaugug gucu cuugcugugcag c |||||| ||||||||||| |||||||||| |||||||||||| c ccgacc caacaguacac caga ggacgacauguc g ----u ----- u cac cacuc nous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: ' UGCCUGUCUACACUUGCUGUGC 3' (#) 3' UGACGGACAGACACGGACGACA 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only d nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' UCUGUGCUUGCUGUGC 3' (#) 3' UGACGGACAGACACGGACGACA 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only d nucleosides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: 5' UGCCUGUCUGUGCCUGCUGUGC 3' (#) 3' UGACGGACAGACACGGACGACA 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' ACAGCAGGCACAGACAGGCAGU 3' (#) 3' UGACGGACAGACACGGACGACA 5' Strands modified for seqRNAi miRNA use: 93. seqRNAi miRNA Mimic Compounds Based on Human miR-214 for use in the sequential administration method described herein. miR-214 hairpin (unmatched nucleosides are offset - U may pair with G): ggccu acaga u aca aacau ggcugg augug cugccugucu cuugcugugcag c |||||| ||||||||||| |||| |||||||||||| c ccgacc caacaguacac gacggacaga ggacgacauguc g ----u ----- u cac cacuc Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both s and underline, with G:U matches underlined and overhangs in bold: ' UGCCUGUCUACACUUGCUGUGC 3' (#) 3' UGACGGACAGACACGGACGACA 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and overhang is indicated in bold: ' UGCCUGUCUGUGCUUGCUGUGC 3' (#) 3' UGACGGACAGACACGGACGACA 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U eliminated by adjusting sense strand to have rd match to the corresponding antisense strand nucleoside the overhang is shown in bold: 5' UGCCUGUCUGUGCCUGCUGUGC 3' (#) 3' UGACGGACAGACACGGACGACA 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' ACAGCAGGCACAGACAGGCAGU 3' (#) 3' ACAGACACGGACGACA 5' s modified for seqRNAi miRNA use: 94. seqRNAi miRNA Mimic Compounds Based on Mouse miR-499 for use in the tial administration method described herein. miR-499 hairpin (unmatched nucleosides are offset - U may pair with G): gggu u ua a --- uc gggcagc gu gc gugauguuua gc c ||||||| || |||||||| |||||||||| || g cg ucugaacg aagu cg u ---- u ug a gua uc Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: ' GAACAUCACAGCAAGUCUGUGCU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U s indicated by underline and overhang is indicated in bold: ' GAACAUCACUGCAAGUCUUAGCU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched sides where G:U eliminated by adjusting sense strand to have standard match to the corresponding antisense strand nucleoside the overhang is shown in bold: ' AAACAUCACUGCAAGUCUUAACU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: ' UUAAGACUUGCAGUGAUGUUU 3' (#) 3' GUGACGUUCAGAAUU 5' Strands modified for i miRNA use: 95. seqRNAi miRNA Mimic Compounds Based on Human miR-499 for use in the sequential administration method described herein. miR-499 hairpin (unmatched nucleosides are offset - U may pair with G): ccugu cuu - c u ua a acucc gcccugucc gc ggg cggg ggc gu gc gugauguuua u ||||||||| || ||| |||| ||| || |||||||| |||||||||| c ugggacggg cg ccc gccc ucg cg ucugaacg cacuacaagu u uccgu cau u u u ug a gcacc Endogenous sense strand top and antisense strand bottom with unmatched nucleosides indicated by both italics and underline, with G:U matches underlined and overhangs in bold: miR5p ' AACAUCACAGCAAGUCUGUGCU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' miR3p ' CUUGCAGUGAUGUUU 3' (#) 3' UCGUGUCUGAACGACACUACAA 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides with the antisense strand and includes G:U matches indicated by underline and ng is indicated in bold: miR5p 5' AACAUCACUGCAAGUCUUAGCU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' miR3p ' UACAGACUUGCUGUGAUGUUU 3' (#) 3' UCGUGUCUGAACGACACUACAA 5' Sense strand top and antisense strand bottom where sense strand has been adjusted to have only matched nucleosides where G:U ated by adjusting sense strand to have standard match to the corresponding nse strand nucleoside the overhang is shown in bold: 9-5p 5' AACAUCACUGCAAGUCUUAACU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' miR3p ' CACAGACUUGCUGUGAUGUUU 3' (#) 3' UCGUGUCUGAACGACACUACAA 5' Endogenous antisense strand with overhang shown in bold and shown written in both directions: miR5p ' UUAAGACUUGCAGUGAUGUUU 3' (#) 3' UUUGUAGUGACGUUCAGAAUU 5' miR3p ' AACAUCACAGCAAGUCUGUGCU 3' (#) 3' UCGUGUCUGAACGACACUACAA 5' Strands ed for seqRNAi miRNA use: While certain of the preferred embodiments of the present invention have been described and specifically ified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

We Claim 1. An in vitro screening method for selecting an antisense strand binding site on a ribonucleic acid target of interest, said method comprising; (i) identifying a site on said target that is available for antisense strand g using an antisense oligonucleotide; (ii) obtaining a set of a first and a second oligonucleotide with sequences capable of forming a duplex or a set of a first and a second oligonucleotide that are not complementary to each other but which are capable of forming a duplex with a third strand where in at least one strand is complementary to the site identified as available for binding in (i); (iii) modifying said oligonucleotide strands to increase their stability and activity; (iv) contacting a cell expressing said target with said first oligonucleotide strand or said two non-complementary strands and providing a suitable amount of time for said (s) to enter said cell; (v) contacting said cell with said second or said second and third ucleotide strands not complementary to each other but complementary to a strand in (iv) and; (vi) determining the expression of the target ce as compared to the expression of the target sequence without step (iii). 2. An in vitro method according to claim 1 wherein said first oligonucleotide is ted with respect to the second oligonucleotide. 3. An in vitro method according to claim 1or 2 wherein one or both of said strands comprise an overhang precursor at the 3’ end and/or where one strand comprises a 5’ end overhang precursor. 4. An in vitro method according to any one of claims 1 to 3 n two or more first oligonucleotides are provided as a contiguous sequence.

. An in vitro method according to any one of claims 1 to 4 wherein said first oligonucleotide is a sense strand and the second oligonucleotide is an antisense sense strand. 6. An in vitro method according to any one of claims 1 to 5 wherein said oligonucleotides are selected from the group provided in any one of indices 1 - 95. 7. An in vitro method according to any one of claims 1 to 6 wherein said first or second strand is an antisense strand and said target ribonucleic acid sequence is a mRNA that comprises a region of complementarity with said antisense strand within its 3’ UTR that is 6-7 contiguous nucleosides in , said region being complementary to a sequence t at positions 2-7 or 2-8 counting from the 5’-end of said antisense strand and n nucleoside positions 10 and/or 11 from the 5’end of said antisense strand optionally comprise a modification selected from the group consisting of abasic, UNA and FANA. 8. An in vitro method according to any one of claims 1 to 7 wherein said complementary region in said mRNA is mentary to a sequence t at positions 2-7 or 2-8 counting from the 5’- end of said antisense strand and is the same as an endogenous miRNA seed sequence. 9. An in vitro method according to any one of claims 1 to 8 wherein said complementary region in said mRNA is complementary to a sequence present at positions 2-7 or 2-8 counting from the 5’- end of said antisense strand and comprises a novel seed sequence complementary to a ce in the 3’-UTR of at least one mRNA target sequence.

. An in vitro method according to any one of claims 1 to 9 wherein said sequence present at positions 2-7 or 2-8 counting from the 5’-end of said antisense strand is modified such that affinity for said target is altered. 11. An in vitro method ing to any one of claims 1 to 10, wherein said first or second strand is an antisense strand and said target ribonucleic acid is a mRNA or miRNA that comprises a region of complementarity that is at least 8 uous nucleosides in length with a sequence present in said antisense strand at positions 7-14 counting from the 5’-end.

Figure 1 Figure 2 1:} Base OH (33’

Claims (11)

We Claim

1. An in vitro screening method for selecting an antisense strand binding site on a ribonucleic acid target of interest, said method comprising; (i) identifying a site on said target that is available for antisense strand g using an antisense oligonucleotide; (ii) obtaining a set of a first and a second oligonucleotide with sequences capable of forming a duplex or a set of a first and a second oligonucleotide that are not complementary to each other but which are capable of forming a duplex with a third strand where in at least one strand is complementary to the site identified as available for binding in (i); (iii) modifying said oligonucleotide strands to increase their stability and activity; (iv) contacting a cell expressing said target with said first oligonucleotide strand or said two non-complementary strands and providing a suitable amount of time for said (s) to enter said cell; (v) contacting said cell with said second or said second and third ucleotide strands not complementary to each other but complementary to a strand in (iv) and; (vi) determining the expression of the target ce as compared to the expression of the target sequence without step (iii).

2. An in vitro method according to claim 1 wherein said first oligonucleotide is ted with respect to the second oligonucleotide.

3. An in vitro method according to claim 1or 2 wherein one or both of said strands comprise an overhang precursor at the 3’ end and/or where one strand comprises a 5’ end overhang precursor.

4. An in vitro method according to any one of claims 1 to 3 n two or more first oligonucleotides are provided as a contiguous sequence.

5. An in vitro method according to any one of claims 1 to 4 wherein said first oligonucleotide is a sense strand and the second oligonucleotide is an antisense sense strand.

6. An in vitro method according to any one of claims 1 to 5 wherein said oligonucleotides are selected from the group provided in any one of indices 1 - 95.

7. An in vitro method according to any one of claims 1 to 6 wherein said first or second strand is an antisense strand and said target ribonucleic acid sequence is a mRNA that comprises a region of complementarity with said antisense strand within its 3’ UTR that is 6-7 contiguous nucleosides in , said region being complementary to a sequence t at positions 2-7 or 2-8 counting from the 5’-end of said antisense strand and n nucleoside positions 10 and/or 11 from the 5’end of said antisense strand optionally comprise a modification selected from the group consisting of abasic, UNA and FANA.

8. An in vitro method according to any one of claims 1 to 7 wherein said complementary region in said mRNA is mentary to a sequence t at positions 2-7 or 2-8 counting from the 5’- end of said antisense strand and is the same as an endogenous miRNA seed sequence.

9. An in vitro method according to any one of claims 1 to 8 wherein said complementary region in said mRNA is complementary to a sequence present at positions 2-7 or 2-8 counting from the 5’- end of said antisense strand and comprises a novel seed sequence complementary to a ce in the 3’-UTR of at least one mRNA target sequence.

10. An in vitro method according to any one of claims 1 to 9 wherein said sequence present at positions 2-7 or 2-8 counting from the 5’-end of said antisense strand is modified such that affinity for said target is altered.

11. An in vitro method ing to any one of claims 1 to 10, wherein said first or second strand is an antisense strand and said target ribonucleic acid is a mRNA or miRNA that comprises a region of complementarity that is at least 8 uous nucleosides in length with a sequence present in said antisense strand at positions 7-14 counting from the 5’-end.