NZ616748B2 - Microrna compounds and methods for modulating mir-21 activity - Google Patents

Abstract

Disclosed is a compound comprising a modified oligonucleotide consisting of 16 to 22 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside pattern I in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein each R is, independently, a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a ?-D-deoxyribonucleoside. Also disclosed is a compound comprising a modified oligonucleotide consisting of 16 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside pattern III in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a ?-D-deoxyribonucleoside. Also disclosed is the use of the above-described compounds in the manufacture of a medicament for decreasing collagen expression in a cell, wherein the medicament is to be contacted to a cell. the following nucleoside pattern I in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein each R is, independently, a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a ?-D-deoxyribonucleoside. Also disclosed is a compound comprising a modified oligonucleotide consisting of 16 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside pattern III in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a ?-D-deoxyribonucleoside. Also disclosed is the use of the above-described compounds in the manufacture of a medicament for decreasing collagen expression in a cell, wherein the medicament is to be contacted to a cell.

Description

MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY This application claims the benefit of ty to U.S. Provisional Application Nos. 61/478,767, filed April 25, 2011, and 61/565,779, filed December 1, 2011, which are incorporated herein by reference in their ties for any purpose.

FIELD OF INVENTION ed herein are methods and compositions for the modulation of miR-21 activity.

DESCRIPTION OF RELATED ART MicroRNAs RNAs), also known as “mature microRNA” are small (approximately 18-24 nucleotides in length), non-coding RNA les encoded in the genomes of plants and animals. In certain instances, highly conserved, endogenously expressed microRNAs te the expression of genes by binding to the 3'-untranslated regions (3'-UTR) of specific mRNAs. More than 1000 different microRNAs have been identified in plants and animals. Certain mature microRNAs appear to originate from long endogenous primary microRNA ripts (also known as pri-microRNAs, pri-mirs, pri-miRs or pri-pre-microRNAs) that are often hundreds of nucleotides in length (Lee, et al., EMBO J., 2002, 21(17), 4663-4670).

Functional analyses of microRNAs have revealed that these small non-coding RNAs contribute to different physiological processes in animals, including developmental timing, genesis, differentiation, patterning, embryogenesis, growth control and programmed cell death. Examples of particular processes in which microRNAs participate include stem cell differentiation, neurogenesis, angiogenesis, hematopoiesis, and exocytosis (reviewed by Alvarez-Garcia and Miska, Development, 2005, 132, 4653-4662).

SUMMARY OF ION A first aspect of the invention provides for a nd comprising a modified oligonucleotide consisting of 16 to 22 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is mentary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside n I in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ (10736574_1):KZA wherein each R is, independently, a non-bicyclic side; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a β-D-deoxyribonucleoside.

A second aspect of the invention provides for a compound comprising a modified oligonucleotide consisting of 16 to 19 linked nucleosides, n the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 uous nucleosides of the following side n II in the 5’ to 3’ orientation: NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside ses a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a β-D-deoxyribonucleoside.

A third aspect of the invention provides for a compound sing a modified ucleotide consisting of 16 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 uous nucleosides of the following nucleoside n III in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein each R is a cyclic nucleoside; X is from 1 to 4; each NB is independently a bicyclic nucleoside; each NQ is independently a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (11018705_1):KZA A ninth aspect of the ion provides for use of a compound of the first to fourth aspects of the invention or the modified ucleotide of the fifth aspect of the invention in the manufacture of a medicament for treating, preventing or delaying the onset of a disease associated with miR-21 in a subject having a disease ated with , wherein the medicament is to be administered into the subject having a disease associated with miR-21.

A tenth aspect of the invention provides for use of a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention in the manufacture of a medicament for treating a fibroproliferative disorder in a t, wherein the medicament is to be administered into the subject.

An eleventh aspect of the invention provides for a compound of the first to fourth s of the invention or the modified oligonucleotide of the fifth aspect of the invention, for use in therapy.

A twelfth aspect of the invention provides for a nd of the first to fourth s of the invention or the modified oligonucleotide of the fifth aspect of the invention, for use in the treatment of fibrosis.

A thirteenth aspect of the ion provides for a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the ion, for use in ing wound healing.

A fourteenth aspect of the invention provides for a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention, for use in treating cancer.

A fifteenth aspect of the invention provides for a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention, for use in preventing and/or delaying the onset of metastasis.

A sixteenth aspect of the invention provides for a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention, for use in treating cardiac disease.

A seventeenth aspect of the invention provides for use of a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention for the preparation of a medicament.

An eighteenth aspect of the invention provides for use of a compound of the first to fourth s of the invention or the modified oligonucleotide of the fifth aspect of the invention for the preparation of a ment for treating fibrosis. (11018705_1):KZA A nineteenth aspect of the invention provides for use of a nd of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention for the preparation of a medicament for promoting wound healing.

A twentieth aspect of the invention provides for use of a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the ion for the ation of a medicament for ng cancer.

A twenty first aspect of the invention provides for use of a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention for the preparation of a medicament for preventing and/or delaying the onset of metastasis.

A twenty second aspect of the invention provides for use of a compound of the first to fourth aspects of the invention or the modified oligonucleotide of the fifth aspect of the invention for the preparation of a ment for the treatment of cardiac disease. ed herein are compounds comprising a modified oligonucleotide, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 and n the modified oligonucleotide has a nucleoside pattern described herein.

Provided herein are methods for ting the activity of miR-21 comprising contacting a cell with a compound described herein. In certain embodiments, the cell is in vivo. In certain embodiments, the cell is in vitro.

Provided herein are methods for treating a e associated with miR-21 comprising administering to a subject having a disease associated with miR-21 a compound described herein. In certain embodiments, the animal is a human.

The compounds described herein are provided for use in therapy. (11018705_1):KZA Provided herein are compounds comprising a modified oligonucleotide consisting of 8 to 22 linked nucleosides, wherein the nucleobase ce of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous sides of the following nucleoside pattern I in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein each R is, independently, a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and each NZ is, independently, a modified nucleoside. ed herein are compounds comprising a modified oligonucleotide consisting of 8 to 19 linked nucleosides, wherein the nucleobase sequence of the modified ucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern II in the 5’ to 3’ orientation: NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein NM is, independently, a modified nucleoside that is not a bicyclic nucleoside; each NB is, independently, a bicyclic side; each NQ is, independently, a non-bicyclic nucleoside; and NZ is, ndently, a d nucleoside.

Provided herein are nds comprising a modified oligonucleotide consisting of 8 to 19 linked sides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous sides of the following nucleoside pattern III in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each NB is a ic nucleoside; each NQ is a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified nucleoside; and each NZ is a modified nucleoside.

Provided herein are compounds sing a modified oligonucleotide consisting of 8 to 19 linked nucleosides, wherein the nucleobase ce of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern IV in the 5’ to 3’ orientation: NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified nucleoside; and NZ is a modified side.

Provided herein are compounds comprising a modified oligonucleotide ting of 8 to 19 linked nucleosides, wherein the nucleobase sequence of the d oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern V in the 5’ to 3’ orientation: NM-NB-(NQ-NQ-NB-NB)4-NZ wherein NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and NZ is a modified nucleoside.

In certain embodiments of nucleoside n I or III, X is 1, X is 2, X is 3, or X is 4.

In certain embodiments of any of the compounds provided herein, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least , at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, or 22 contiguous nucleosides of nucleoside pattern I, II, III, IV or V. In certain embodiments of any of the compounds provided herein, the modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked nucleosides of nucleoside pattern I, II, III, IV or V.

In certain embodiments of any of the compounds ed herein, the nucleobase sequence of the modified oligonucleotide is at least 90% complementary is at least 95% complementary, or is 100% complementary to the nucleobase sequence of miR-21 (SEQ ID NO: 1).

In certain ments of any of the compounds provided herein, the base at position 1 of miR-21 is paired with the first nucleobase at the 3’-terminus of the modified oligonucleotide.

In certain embodiments of any of the compounds provided herein, each bicyclic nucleoside is independently selected from an LNA nucleoside, a cEt nucleoside, and an ENA nucleoside.

In certain embodiments of any of the compounds ed herein, at least two non-bicyclic nucleosides comprise sugar moieties that are different from one another. In n embodiments of any of the compounds provided herein, each non-bicyclic nucleoside has the same type of sugar moiety.

In certain embodiments of any of the compounds provided herein, each ic nucleoside is a cEt nucleoside. In certain embodiments, the cEt nucleoside is an S-cEt nucleoside. In certain embodiments, the cEt nucleoside is an R-cEt nucleoside. In certain embodiments of any of the nds provided herein, each bicyclic side is an LNA nucleoside.

In certain embodiments of any of the nds provided herein, each non-bicyclic nucleoside is independently selected from a B-D-deoxyribonucleoside, a B-D-ribonucleoside, 2’-O- methyl nucleoside, a ethoxyethyl nucleoside, and a 2’-fiuoronucleoside. In certain embodiments of any of the compounds provided herien, each non-bicyclic side is independently selected from a B-D-deoxyribonucleoside, and a 2’-O-methoxyethyl nucleoside. In certain embodiments of any of the compounds provided herein, each non-bicyclic nucleoside is a B- yribonucleoside. In certain embodiments of any of the compounds provided , each non- bicyclic nucleoside is a 2’-O-methoxyethyl nucleoside.

In certain embodiments of any of the compounds provided , each bicyclic nucleoside comprises a non-methylated nucleobase.

In certain embodiments of any of the compounds ed , no more than two non- bicyclic nucleosides are 2’-O-methoxyethyl nucleosides. In certain such embodiments, each other non-bicyclic nucleoside is a B-D-deoxyribonucleoside.

In certain ments of any of the compounds provided herein, the 5’-most and the 3’- most non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a B-D-deoxyribonucleoside. In certain ments of any of the compounds provided herein, two non-bicyclic nucleosides are 2’-MOE nucleosides and each other non-bicyclic nucleoside is a B-D-deoxyribonucleoside.

In n embodiments of nucleoside pattern I or III, each nucleoside of R is a 2’-O- methoxyethyl nucleoside. In n embodiments of nucleoside pattern I or III, three nucleosides of R are 2’-O-methoxyethyl nucleosides and one nucleoside of R is a B-D-deoxyribonucleoside.

In certain embodiments of any of the compounds provided herein, at least one internucleoside linkage is a modified internucleoside linkage. In certain embodiments of any of the compounds provided herein, each internucleoside linkage is a modified internucleoside linkage. In certain embodments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments of any of the compounds provided herein, at least one nucleoside comprises a modified nucleobase. In certain embodments of any of the compounds ed herein, at least one cytosine is a 5-methyl cytosine. In certain embodiments of any of the compounds provided herein, each ne is a 5-methylcytosine. In certain embodiments of any of the compounds ed herein, the cytosine at position two of the modified oligonucleotide is a 5- cytosine.

In certain embodiments of nucleoside pattern I, R consists of four linked nucleosides NR1- NRZ-Nm-Nm, Where NR1 is a 2’-O-methoxyethyl nucleoside and each of NRZ-Nm-NR4 is a B-D- deoxyribonucleoside; each NB is an S-cEt side; each NQ is a B-D—deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments of nucleoside pattern I, each R is a 2’-O- yethyl side; X is 1; each NB is an S-cEt nucleoside; each NQ is a B-D- deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments of nucleoside pattern I, each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a 2’-O-methoxyethyl nucleoside; and NZ is a 2’-O-methoxyethyl nucleoside.

In certain embodiments of nucleoside pattern I, each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt side; each NQ is a B-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside. In certain embodiments of nucleoside pattern I, each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl side. In certain ments of nucleoside pattern I, each R is a 2’-O- methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; each NQ is a B-D- deoxyribonucleoside; and NZ is an LNA nucleoside.

In certain embodiments of nucleoside n II, NM is a ethoxyethyl nucleoside; each NB is an S-cEt side; each NQ is a B-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments of nucleoside pattern II, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a 2’-O-methoxyethyl side; and NZ is a 2’-O- methoxyethyl nucleosid. In certain embodiments of nucleoside pattern I, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; each N is a [5-D- deoxyribonucleoside; and NZ is an S—cEt nucleoside. In certain embodiments of nucleoside pattern 11, NM is a 2’-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a B-D- deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments of nucleoside pattern II, NM is a 2’-O-methoxyethyl nucleoside; each NB is an LNA side; each NQ is a B-D-deoxyribonucleoside; and NZ is an LNA nucleoside.

In certain embodiments of nucleoside pattern III, each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt side; each NQ is a B-D-deoxyribonucleoside; NY is a [5-D- deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments of nucleoside pattern III, each R is a 2’-O-methoxyethyl side; X is 1; each NB is an S-cEt side; each NQ is a B-D-deoxyribonucleoside; NY is a B-D-deoxyribonucleoside; and NZ is an S- cEt nucleoside. In certain embodiments of nucleoside pattern 111, each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside.

In certain embodiments of nucleoside pattern IV, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; NY is a [5-D- deoxyribonucleoside; NZ is a 2’-O-methoxyethyl side. In certain embodiments of nucleoside pattern IV, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a [3-D- deoxyribonucleoside; NY is a B-D-deoxyribonucleoside; and NZ is an S—cEt nucleoside. In certain ments of nucleoside pattern IV, NM is a ethoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside.

In certain embodiments of nucleoside pattern V, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside.

In certain embodiments of any of the compounds provided herein, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is ndently selected from T and U. In certain embodiments of any of the compounds provided herein, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 4, wherein each T in the sequence is ndently selected from T and U.

Provided herein are methods for inhibiting the activity of miR-21 comprising contacting a cell With a compound provided herein. In certain embodiments, the cell is is in vivo. In certain ments, the cell is in vitro. In certain embodiments, the cell is a fibroblast cell, a hyperproliferative cell, a keratinocyte, or a hypoxic cell. In certain embodiments, the fibroblast cell is a roliferative fibroblast cell.

Provided herein are methods for decreasing collagen sion in a cell comprising contacting a cell with a compound provided herein.

Provided herein are methods to treat, prevent, or delay the onset of a disease ated with miR-21, comprising administering to a t having such a disease any of the compounds provided herein.

In n embodiments, the disease is fibrosis. In certain embodiments the fibrosis is kidney fibrosis, lung s, liver fibrosis, cardiac fibrosis, skin fibrosis, age-related fibrosis, spleen fibrosis, scleroderma, or ransplant fibrosis.

In certain embodiments, the fibrosis is kidney fibrosis and is present in a subject having a e selected from glomerulosclerosis, tubulointerstitial fibrosis, IgA nephropathy, interstitial fibrosis/tubular atrophy; chronic kidney damage, glomerular disease, glomerulonephritis, diabetes mellitus, idiopathy focal segmental glomerulosclerosis, membranous nephropathy, collapsing ulopathy, chronic recurrent kidney infection, and end stage renal e. In certain embodiments, the kidney fibrosis results from acute or repetitive trauma to the kidney.

In certain embodiments, the fibrosis is liver fibrosis and is present in a subject having a disease selected from chronic liver injury, hepatitis ion, non-alcoholic steatohepatitis, and cirrhosis.

In certain embodiments, the pulmonary fibrosis is idiopathic pulmonary fibrosis, or the t has chronic obstructive pulmonary disease.

In certain embodiments, e is an inflammatory disease.

Provided herein are methods of promoting wound healing in a subject comprising administering to a subject having an acute or chronic wound any of the compounds provided herein.

In certain embodiments, the chronic wound is an acute or chronic surgical wound, a penetrating wound, an avulsion injury, a crushing injury, a shearing injury, a burn injury, a laceration, a bite wound, an arterial ulcer, a venous ulcer, a pressure ulcer, or a diabetic ulcer. In certain embodiments, the compound is administered topically to the wound.

Provided herein are methods to treat a fibroproliferative disorder in a subject comprising administering to the subject any of the compounds provided herein.

Any of the methods provided herein may comprise selecting a subject having elevated miR- 21 expression in one or more tissues.

In certain embodiments, administering any of the compounds provided herein to a subject reduces collagen expression.

In certain ments, a subject is in need of ed organ on, wherein the organ function is selected from cardiac function, pulmonary function, liver function, and kidney on.

In n embodiments, the administering of any of the compounds provided herein improves organ function in the subject, wherein the organ on is selected from cardiac function, pulmonary function, liver function, and kidney function. 2012/034880 Any of the methods provided herein comprises evaluating kidney on in a t, which may include measuring blood urea nitrogen in the blood of the t; measuring creatinine in the blood of the subject; measuring creatinine clearance in the subject; measuring proteinuria in the subject; measuring albumin:Cr ratio in the subject; and/or measuring urinary output in the subject.

Any of the methods provided herein may comprise evaluating liver function in a subject, which may include measuring alanine aminotransferase levels in the blood of the subject; measuring aspartate aminotransferase levels in the blood of the subject; measuring bilirubin levels in the blood of the subject; ing albumin levels in the blood of the subject; measuring prothrombin time in the subject; measuring ascites in the subject; and/or measuring encephalopathy in the subject.

Any of the methods provided herein may comprise evaluating lung function in a subject, which may include measuring vital capacity in the subject; measuring forced vital ty in the subject; measuring forced expiratory volume in one second in the subject; ing peak expiratory flow rate in the subject; measuring forced expiratory flow in the t; measuring maximal voluntary ventilation in the subject; determining the ratio of forced expiratory volume in one second to forced vital capacity in the subject; measuring ventilation/perfusion ratio in the subject; measuring nitrogen washout in the subject; and/or measuring absolute volume of air in one or more lungs of a subject.

Any of the methods provided herein may comprise evaluating cardiac function in a subject, which may include measuring cardiac output in the subject; measuring stroke volume in the subject; ing mean systolic ejection rate in the subject; ing systolic blood pressure in the subject; ing left ventricular on fraction in the subject; determining stroke index in the subject; determining cardiac index in the subject; measuring left ventricular percent fractional shortening in the subject; measuring mean velocity of ferential fiber shortening in the subject; measuring left ventricular inflow velocity pattern in the subject; measuring pulmonary venous flow velocity pattern in the subject; and/ormeasuring peak early diastolic velocity of the mitral annulus of the subject.

Any of the methods provided herein may comprise administering to a subject at least one therapeutic agent selected from an anti-inflammatory agent, an immunosuppressive agent, an anti- diabetic agent, digoxin, a vasodilator, an ensin II converting enzyme (ACE) inhibitors, an angiotensin II or blockers (ARB), a calcium channel blocker, an bide dinitrate, a hydralazine, a e, a hydralazine, a beta-blocker, a natriuretic peptides, a heparinoid, and a connective tissue grth factor inhibitor. In n embodiments, the anti-inflammatory agent is a non-steroidal anti-inflammatory agent, wherein the non-steroidal anti-inflammatory agent is optionally selected from ibuprofen, a COX-l inhibitor and a COX-2 inhibitor. In certain embodiments, the immunosuppressive agent is selected from a corticosteroid, cyclophosphamide, and mycophenolate mofetil. In certain ments, nflammatory agent is a corticosteroid, wherein the corticosteroid is ally prednisone. In certain embodiments, the angiotensin II converting enzyme (ACE) inhibitors is selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril. In n embodiments, the angiotensin II receptor blockers (ARB) is selected from candesartan, irbesartan, olmesartan, an, valsartan, telmisartan, and eprosartan.

In n embodiments, a disease is . In certain embodiments, the cancer is liver cancer, breast cancer, r cancer, prostate cancer, colon cancer, lung cancer, brain cancer, hematological cancer, pancreatic cancer, head and neck cancer, cancer of the tongue, stomach cancer, skin cancer, or thyroid cancer. In certain embodiments, the liver cancer is cellular carcinoma. In certain embodiments, the brain cancer is glioblastoma multiforme. In certain embodiments, the hematological cancer is acute myelogenous leukemia, acute cytic leukemia, acute tic leukemia, multiple myeloma, chronic lymphotic leukemia, chronic d leukemia, hodgkin’s lymphoma, or non-hodgkin’s lymphoma.

In certain embodiments, the methods provided herein comprise stering at least one additional anti-cancer therapy to the subject. In certain ments, the anti-cancer y is a DNA damaging agent, a proliferation inhibitor, an anti-folate, a grth factor receptor inhibitor, an anti-angiogenic agent, a receptor tyrosine kinase inhibitor, a kinase inhibitor, a growth factor inhibitor, a cytotoxic agent, radiation y, or surgical resection of a tumor. In certain ments, the DNA damaging agent is 1,3 -bis(2-chloroethyl) -l-nitrosourea, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, daunorubicin, doxorubicin, epirubicin, etoposide, idarubicin, ifosfamide, irinotecan, lomustine, mechlorethamine, melphalan, mitomycin C, mitoxantrone, oxaliplatin, temozolomide, or topotecan. In certain embodiments, the anti-folate is methotrexate, aminopterin, thymidylate synthase, serine hydroxymethyltransferase, folyilpolyglutamyl synthetase, g-glutamyl hydrolase, glycinamide- ribonucleotide transformylase, leucovorin, imidazole-carboxamide-ribonucleotide transformylase, rouracil, or a folate transporter. In certain embodiments, the grth factor receptor inhibitor is erlotinib, or gefitinib. In certain ments, the angiogenesis inhibitor is bevacizumab, thalidomide, carboxyamidotriazole, TNP-470, CMlOl, IFN-u, platelet factor-4, suramin, SU5416, ospondin, a VEGFR antagonist, cartilage-derived angiogenesis inhibitory factor, a matrix metalloproteinase inhibitor, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, tetrathiomolybdate, prolactin, or linomide. In certain embodiments, the kinase tor is bevacizumab, BIBW 2992, cetuximab, imatinib, trastuzumab, gefitinib, ranibizumab, anib, sorafenib, dasatinib, sunitinib, erlotinib, nilotinib, lapatinib, panitumumab, vandetanib, E7080, pazopanib, mubritinib, or fostamatinib.

In certain embodiments, the stering to a subject having cancer results in reduction of tumor size and/ or tumor number. In certain embodiments, the administering to a subject having cancer prevents or delays an increase in tumor size and/or tumor number. In certain embodiments, WO 48952 the administering to a subject having cancer prevents or slows metastatic progression. In certain embodiments, the administering to a subject having cancer extends overall survival time and/or progression-free survival of the subject. In certain embodiments, the methods provided herein comprise selecting a subject having elevated serum fetoprotein and/or elevated serum desgamma-carboxyprothrombin.

In certain embodiments, the methods provided herein se reducing serum alpha-fetoprotein and/or serum des-gamma-carboxyprothrombin. In certain ments, the methods provided herein comprise selecting an animal having abnormal liver In any of the methods provided herein, subject is a human.

In any of the methods provided herien, the nd is present as a ceutical ition.

Any of the compounds provided herein may be foruse in therapy. Any of the compounds provided herein may be for use in the treatment of fibrosis. Any of the compounds provided herein may be foruse in promoting wound healing. Any of the compounds provided herein may be for use in treating . Any of the compounds provided herien may be for use in preventing and/or delaying the onset of metastatis.

Any of the compounds ed herein may be for use in treating cardiac disease.

Any of the compounds provided herein may be for use in the preparation of a medicament.

Any of the compounds ed herein may be for use in the preparation of a medicament for treating fibrosis. Any of the compounds provided herein may be for use in the preparation of a medicament for promoting wound healing. Any of the compounds ed herein may be for use in the preparation of a medicament for treating cancer. Any of the compounds provided herein may be for use in the preparation of a medicament for preventing and/or delaying the onset of metastasis.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows urinary albumin to creatinine ratio (ACR, ugAlb/mgCr) in ischemic reperfusion/nephrectomy (IR/Nx) model mice administered anti-miRZl compounds, as described in Example 5.

Figure 2 shows (A) collagen 1A1 and (B) collagen 3A1 expression in kidneys ofUUO model mice administered anti-miR21 compounds, as described in Example 6.

DETAILED DESCRIPTION Unless defined otherwise, all technical and ific terms used herein have the same meaning as is commonly understood by one of skill in the arts to which the invention s.

Unless specific definitions are provided, the nomenclature ed in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and WO 48952 pharmaceutical chemistry described herein are those well known and commonly used in the art. In the event that there is a ity of definitions for terms herein, those in this section prevail. Standard techniques may be used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and treatment of subjects. Certain such techniques and procedures may be found for example in hydrate Modifications in Antisense Research” Edited by SangVi and Cook, American Chemical Society and , Washington DC, 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th edition, 1990; and which is hereby incorporated by reference for any purpose. Where permitted, all patents, patent applications, published applications and publications, GENBANK sequences, websites and other hed materials ed to throughout the entire disclosure herein, unless noted ise, are orated by reference in their entirety. Where reference is made to a URL or other such identifier or address, it is tood that such identifiers can change and particular information on the internet can change, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.

Before the present compositions and methods are disclosed and described, it is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be ng. It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

Definitions “Fibrosis” means the formation or development of excess fibrous connective tissue in an organ or tissue. In certain embodiments, fibrosis occurs as a reparative or reactive process. In certain embodiments, fibrosis occurs in response to damage or . The term “fibrosis” is to be understood as the formation or development of excess fibrous connective tissue in an organ or tissue as a reparative or reactive process, as opposed to a ion of fibrous tissue as a normal constituent of an organ or tissue.

“Subject suspected of having” means a subject exhibiting one or more clinical indicators of a disease.

“Subject suspected of having fibrosis” means a subject exhibiting one or more clinical indicators of fibrosis. blast” means a cell that gives rise to connective .

“Fibroproliferative er” means a disorder characterized by excessive proliferation and/or activation of fibroblasts.

“Liver cancer” means a malignant tumor of the liver, either a y cancer or metastasized cancer. In certain embodiments, liver cancer includes, but is not d to, cancer arising from hepatocytes, such as, for example, hepatomas and hepatocellular carcinomas; fibrolamellar carcinoma; and cholangiocarcinomas (or bile duct ).

“Metastasis” means the process by which cancer spreads from the place at which it first arose as a primary tumor to other locations in the body. The metastatic progression of a primary tumor reflects multiple , including dissociation from neighboring primary tumor cells, survival in the circulation, and grth in a secondary location.

“Overall survival time” means the time period for which a subject survives after diagnosis of or treatment for a disease. In certain embodiments, the disease is cancer. In some ments, overall survival time is survival after diagnosis. In some embodiments, l survival time is survival after the start of treatment. ession-free survival” means the time period for which a subject having a disease survives, without the disease g worse. In certain embodiments, progression-free survival is assessed by staging or scoring the disease. In n embodiments, progression-free survival of a t having liver cancer is assessed by evaluating tumor size, tumor number, and/or metastasis.

“Anti-miR” means an oligonucleotide having nucleobase sequence complementary to a microRNA. In certain embodiments, an anti-miR is a modified oligonucleotide.

“Anti-miR-X” where “miR-X” ates a particular microRNA, means an oligonucleotide having a nucleobase sequence complementary to miR-X. In certain embodiments, an anti-miR-X is fully complementary to miR-X. In certain embodiments, an anti-miR-X is at least 80%, at least 85%, at least 90%, or at least 95% complementary to miR-X. In certain embodiments, an anti-miR-X is a modified oligonucleotide. “miR-Z 1 ” means the mature miRNA having the nucleobase sequence UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO: 1). “miR-21 stem-loop sequence” means the stem-loop sequence having the base sequence UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCG AUGGGCUGUCUGACA (SEQ ID NO: 2).

“Target nucleic acid” means a nucleic acid to which an oligomeric compound is designed to hybridize.

“Targeting” means the process of design and selection of nucleobase sequence that will hybridize to a target nucleic acid.

“Targeted to” means having a nucleobase sequence that will allow hybridization to a target nucleic acid.

“Target engagement” means the interaction of an oligonucleotide with the microRNA to which it is complementary, in a manner that changes the activity, sion or level of the microRNA. In n ments, target ment means an iR interacting with the microRNA to which it is complementary, such that the activity of the microRNA is inhibited. 2012/034880 “Modulation" means a perturbation of function, amount, or activity. In certain embodiments, modulation means an increase in function, amount, or activity. In certain embodiments, modulation means a decrease in function, amount, or ty.

“Expression” means any functions and steps by which a gene’s coded information is converted into structures present and operating in a cell. “5’ target site” means the nucleobase of a target c acid which is complementary to the 3 ’-most base of a particular oligonucleotide. “3’ target site” means the nucleobase of a target nucleic acid which is complementary to the ’-most nucleobase of a particular oligonucleotide.

“Region” means a portion of linked nucleosides within a nucleic acid. In certain embodiments, an oligonucleotide has a nucleobase sequence that is complementary to a region of a target nucleic acid. For example, in certain such embodiments an oligonucleotide is mentary to a region of a microRNA stem-loop sequence. In n such embodiments, an oligonucleotide is fully complementary to a region of a NA stem-loop sequence. nt” means a smaller or sub-portion of a region.

“Nucleobase sequence” means the order of contiguous nucleobases in an oligomeric compound or nucleic acid, typically listed in a 5’ to 3’ orientation, independent of any sugar, linkage, and/or nucleobase modification.

“Contiguous nucleobases” means nucleobases immediately adjacent to each other in a nucleic acid.

“Nucleobase mentarity” means the ability of two nucleobases to pair non-covalently via hydrogen bonding.

“Complementary” means that one nucleic acid is capable of hybridizing to another nucleic acid or oligonucleotide. In certain embodiments, complementary refers to an oligonucleotide capable of hybridizing to a target nucleic acid.

“Fully complementary” means each nucleobase of an oligonucleotide is capable of pairing with a nucleobase at each corresponding position in a target nucleic acid. In certain embodiments, an oligonucleotide is fully complementary to a microRNA, i.e. each nucleobase of the oligonucleotide is complementary to a base at a ponding position in the microRNA. In certain embodiments, an oligonucleotide wherein each nucleobase has complementarity to a nucleobase within a region of a microRNA stem-loop sequence is fully complementary to the microRNA stem- loop ce.

“Percent complementarity” means the percentage of nucleobases of an oligonucleotide that are complementary to an equal-length portion of a target nucleic acid. Percent mentarity is ated by dividing the number of nucleobases of the oligonucleotide that are complementary to nucleobases at corresponding positions in the target c acid by the total number of nucleobases in the oligonucleotide.

“Percent identity” means the number of nucleobases in first nucleic acid that are identical to nucleobases at corresponding positions in a second nucleic acid, divided by the total number of bases in the first nucleic acid. In certain embodiments, the first nucleic acid is a microRNA and the second nucleic acid is a microRNA. In certain embodiments, the first nucleic acid is an oligonucleotide and the second c acid is an oligonucleotide.

“Hybridize” means the annealing of complementary c acids that occurs through nucleobase complementarity.

“Mismatch” means a nucleobase of a first nucleic acid that is not capable of pairing with a nucleobase at a corresponding on of a second nucleic acid. ical” in the context of nucleobase sequences, means having the same nucleobase sequence, independent of sugar, linkage, and/or nucleobase modifications and independent of the methyl state of any pyrimidines present.

“MicroRNA” means an nous non-coding RNA between 18 and 25 nucleobases in length, which is the t of cleavage of a pre-microRNA by the enzyme Dicer. Examples of mature microRNAs are found in the microRNA database known as miRBase (http://microrna.sanger.ac.uk/). In certain embodiments, microRNA is abbreviated as “microRNA” or “miR.” “Pre-microRNA” or “pre-miR” means a non-coding RNA having a hairpin structure, which is the product of cleavage of a pri-miR by the double-stranded RNA-specific ribonuclease known as Drosha. loop sequence” means an RNA having a hairpin structure and containing a mature microRNA sequence. croRNA sequences and stem-loop ces may overlap. Examples of stem-loop sequences are found in the microRNA database known as miRBase (http://microrna.sanger.ac.uk/).

“Pri-microRNA” or “pri-miR” means a non-coding RNA having a n structure that is a ate for the double-stranded RNA-specific ribonuclease . “microRNA precursor” means a transcript that originates from a genomic DNA and that comprises a non-coding, structured RNA comprising one or more microRNA sequences. For example, in certain embodiments a microRNA precursor is a pre-microRNA. In certain embodiments, a microRNA precursor is a pri-microRNA. “microRNA-regulated transcript” means a transcript that is regulated by a microRNA.

“Monocistronic transcript” means a microRNA precursor containing a single microRNA sequence.

“Polycistronic transcript” means a microRNA precursor containing two or more microRNA sequences.

“Seed sequence” means a nucleobase sequence comprising from 6 to 8 contiguous nucleobases of bases 1 to 9 of the 5’-end of a mature microRNA sequence.

“Seed match sequence” means a base ce that is complementary to a seed sequence, and is the same length as the seed sequence.

“Oligomeric compound” means a compound that comprises a plurality of linked monomeric subunits. Oligomeric compounds included oligonucleotides. nucleotide” means a compound comprising a plurality of linked nucleosides, each of which can be modified or unmodified, independent from one another.

“Naturally occurring internucleoside linkage” means a 3’ to 5’ phosphodiester linkage between nucleosides. al sugar” means a sugar found in DNA (2’-H) or RNA (2’-OH).

“Internucleoside linkage” means a covalent linkage between nt nucleosides. d nucleosides” means nucleosides joined by a covalent linkage.

“Nucleobase” means a heterocyclic moiety capable of non-covalently pairing with another nucleobase.

“Nucleoside” means a nucleobase linked to a sugar moiety.

“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar n of a nucleoside. und comprising a modified oligonucleotide consisting of” a number of linked nucleosides means a compound that includes a modified oligonucleotide having the specified number of linked nucleosides. Thus, the compound may include additional substituents or conjugates.

Unless otherwise indicated, the compound does not include any additional nucleosides beyond those of the ucleotide. und comprising a d oligonucleotide consisting of” a number of linked nucleosides means a compound that includes a modified ucleotide having the specified number of linked nucleosides. Thus, the compound may include additional substituents or conjugates.

Unless otherwise indicated, the compound does not include any additional nucleosides beyond those of the modified oligonucleotide.

“Modified oligonucleotide” means an oligonucleotide having one or more modifications relative to a naturally occurring terminus, sugar, base, and/or internucleoside linkage. A modified oligonucleotide may comprise unmodified nucleosides.

“Single-stranded modified oligonucleotide” means a modified oligonucleotide which is not ized to a complementary strand.

“Modified nucleoside” means a side having any change from a naturally occurring nucleoside. A modified nucleoside may have a modified sugar, and unmodified nucleobase. A modified nucleoside may have a modified sugar and a modified nucleobase. A modified nucleoside may have a natural sugar and a modified base. In certain embodiments, a modified nucleoside is a bicyclic nucleoside. In certain embodiments, a modified nucleoside is a non-bicyclic nucleoside.

“Modified internucleoside linkage” means any change from a naturally ing ucleoside linkage.

“Phosphorothioate internucleoside linkage” means a linkage between nucleosides Where one of the non-bridging atoms is a sulfur atom.

“Modified sugar moiety” means tution and/or any change from a natural sugar.

“Unmodified nucleobase" means the naturally ing heterocyclic bases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methylcytosine), and uracil (U). “5 lcytosine” means a cytosine comprising a methyl group attached to the 5 on.

“Non-methylated cytosine” means a cytosine that does not have a methyl group attached to the 5 position.

“Modified nucleobase” means any nucleobase that is not an unmodified nucleobase.

“Furanosyl” means a structure comprising a 5-membered ring consisting of four carbon atoms and one oxygen atom. ally occurring furanosyl” means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.

“Sugar ” means a naturally occurring furanosyl or a modified sugar moiety.

“Modified sugar moiety” means a substituted sugar moiety or a sugar surrogate.

“Substituted sugar moiety” means a furanosyl that is not a naturally occurring furanosyl.

Substituted sugar moieties include, but are not limited to sugar moieties comprising modifications at the 2’-position, the ition and/or the ition of a naturally occurring furanosyl. Certain substituted sugar moieties are bicyclic sugar moieties.

“Sugar surrogate" means a structure that does not comprise a furanosyl and that is capable of ing the naturally occurring furanosyl of a nucleoside, such that the resulting nucleoside is capable of (l) oration into an oligonucleotide and (2) hybridization to a complementary nucleoside. Such structures include relatively simple changes to the furanosyl, such as rings comprising a ent number of atoms (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of the furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding with those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally sing additional substituents). Sugar surrogates also e more complex sugar replacements (e.g., the non-ring systems of e nucleic acid). Sugar surrogates include Without limitation morpholinos, cyclohexenyls and cyclohexitols. “2’-O-methyl sugar” or “2’-OMe sugar” means a sugar haVing a O-methyl ation at the 2’ position. “2’-O-methoxyethyl sugar” or “2’-MOE sugar” means a sugar haVing a O-methoxyethyl modification at the 2’ position. “2’-O-fluoro” or “2’-F” means a sugar having a fiuoro modification of the 2’ position.

“Bicyclic sugar moiety” means a modified sugar moiety comprising a 4 to 7 membered ring ding by not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain ments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl.

In certain such embodiments, the bridge connects the 2’-carbon and the 4’-carbon of the furanosyl.

“Locked c acid (LNA) sugar moiety” means a substituted sugar moiety comprising a (CH2)-O bridge between the 4’ and 2’ furanose ring atoms.

“ENA sugar moiety” means a substituted sugar moiety comprising a (CH2)2—O bridge between the 4’ and 2’ furanose ring atoms.

“Constrained ethyl (cEt) sugar moiety” means a substituted sugar moiety comprising a CH(CH3)-O bridge between the 4' and the 2' furanose ring atoms. In certain embodiments, the CH(CH3)-O bridge is constrained in the S orientation. In certain embodiments, the (CH2)2-O is constrained in the R orientation.

“S-cEt sugar moiety” means a substituted sugar moiety comprising an S—constrained CH(CH3)-O bridge between the 4' and the 2' furanose ring atoms.

“R-cEt sugar moiety” means a substituted sugar moiety comprising an R-constrained CH(CH3)-O bridge between the 4' and the 2' furanose ring atoms. “2’-O-methyl” nucleoside means a 2’-modified nucleoside haVing a 2’-O-methyl sugar modification. “2’-O-methoxyethyl nucleoside” means a 2’-modified nucleoside haVing a 2’-O- methoxyethyl sugar ation. A 2’-O-methoxyethyl nucleoside may comprise a modified or unmodified nucleobase. “2’-fluoro nucleoside” means a 2’-modified nucleoside having a 2’-fluoro sugar modification. A 2’-fluoro side may comprise a modified or unmodified base.

“Bicyclic nucleoside” means a 2’-modified nucleoside having a bicyclic sugar moiety. A bicyclic nucleoside may have a modified or unmodified base. “cEt nucleoside” means a nucleoside comprising a cEt sugar . A cEt nucleoside may comprise a modified or fied nucleobase.

“S-cEt nucleoside” means a nucleoside sing an S—cEt sugar moiety.

“R-cEt nucleoside” means a side comprising an R-cEt sugar moiety.

“Non-bicyclic nucleoside” means a nucleoside that has a sugar other than a bicyclic sugar. In certain embodiments, a non-bicyclic nucleoside ses a naturally ing sugar. In certain embodiments, a cyclic nucleoside ses a modified sugar. In certain embodiments, a non- bicyclic nucleoside is a B-D-deoxyribonucleoside. In certain embodiments, a non-bicyclic nucleoside is a 2’-O-methoxyethyl nucleoside.

“B-D-deoxyribonucleoside” means a naturally occurring DNA nucleoside. A [5-D- deoxyribonucleoside may comprise a modified or unmodified nucleobase.

“B-D-ribonucleoside” means a naturally occurring RNA nucleoside. A B-D-ribonucleoside may comprise a modified or unmodified nucleobase.

“LNA nucleoside” means a nucleoside sing a LNA sugar moiety.

“ENA nucleoside” means a nucleoside comprising an ENA sugar moiety.

“Motif ’ means a pattern of modified and/or unmodified nucleobases, sugars, and/or internucleoside linkages in an oligonucleotide. In certain embodiments, a motif is a nucleoside pattern.

“Nucleoside pattern” means a pattern of nucleoside modifications in a modified oligonucleotide or a region thereof. A side pattern is a motif that describes the arrangement of nucleoside ations in an oligonucleotide.

“Fully modified oligonucleotide” means each nucleobase, each sugar, and/or each internucleoside linkage is modified.

“Uniformly d oligonucleotide” means each nucleobase, each sugar, and/or each internucleoside linkage has the same modification throughout the modified oligonucleotide.

“Stabilizing modification” means a modification to a nucleoside that provides enhanced stability to a modified oligonucleotide, in the presence of nucleases, ve to that provided by 2’- deoxynucleosides linked by odiester internucleoside linkages. For example, in certain embodiments, a stabilizing modification is a stabilizing nucleoside modification. In certain embodiments, a stabilizing modification is an internucleoside linkage modification.

“Stabilizing nucleoside" means a nucleoside modified to provide enhanced nuclease stability to an oligonucleotide, relative to that provided by a 2’-deoxynucleoside. In one ment, a izing nucleoside is a 2’-modified nucleoside.

“Stabilizing internucleoside linkage" means an internucleoside linkage that provides improved nuclease stability to an oligonucleotide relative to that provided by a phosphodiester internucleoside linkage. In one ment, a stabilizing internucleoside e is a orothioate internucleoside linkage.

“Subj ect” means a human or non-human animal selected for treatment or y. ct in need thereof ’ means the state in which a t is identified as in need of a therapy or treatment.

“Subject suspected of having” means a subject exhibiting one or more clinical indicators of a disease.

“Administering” means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and dministering.

“Parenteral administration” means administration through injection or infusion.

Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, or intramuscular stration.

“Subcutaneous administration” means administration just below the skin.

“Intravenous administration” means administration into a vein.

“Intracardial administration” means administration into the heart. In certain embodiments, intracardial administration occurs by way of a er. In certain ments, intracardial administration occurs by way of open heart surgery.

“Pulmonary administration” means administration to the lungs.

“Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of stration. The effects of both agents need not manifest themselves at the same time. The effects need only be pping for a period of time and need not be coextensive.

“Duration” means the period of time during which an actiVity or event continues. In certain embodiments, the on of treatment is the period of time during which doses of a pharmaceutical agent or pharmaceutical composition are administered.

“Therapy” means a disease ent method. In certain embodiments, therapy includes, but is not limited to, chemotherapy, radiation y, or administration of a pharmaceutical agent. ment” means the application of one or more c procedures used for the cure or amelioration of a disease. In certain ments, the specific procedure is the administration of one or more pharmaceutical agents.

“Amelioration” means a lessening of severity of at least one indicator of a condition or disease. In certain embodiments, amelioration includes a delay or slowing in the progression of one or more tors of a condition or disease. The severity of indicators may be determined by subjective or objective measures which are known to those skilled in the art.

“At risk for ping” means the state in which a subject is predisposed to developing a ion or disease. In certain embodiments, a subject at risk for developing a condition or disease exhibits one or more symptoms of the condition or disease, but does not t a sufficient number of ms to be diagnosed with the condition or disease. In n embodiments, a subject at risk for developing a condition or disease exhibits one or more symptoms of the condition or disease, but to a lesser extent required to be diagnosed with the condition or disease.

“Prevent the onset of ’ means to prevent the development of a condition or disease in a subject who is at risk for developing the disease or condition. In certain embodiments, a subject at risk for developing the disease or condition receives treatment similar to the treatment received by a subject who already has the disease or condition.

“Delay the onset of" means to delay the development of a condition or disease in a subject who is at risk for developing the disease or condition. In certain embodiments, a subject at risk for developing the disease or condition receives treatment similar to the treatment received by a subject who y has the disease or condition.

“Therapeutic agent” means a pharmaceutical agent used for the cure, amelioration or tion of a e.

“Dose” means a specified quantity of a pharmaceutical agent provided in a single administration. In n embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more ions may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more ions to minimize ion site reaction in an individual. In certain embodiments, a dose is administered as a slow infusion.

“Dosage unit” means a form in which a pharmaceutical agent is provided. In n embodiments, a dosage unit is a vial containing lyophilized oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted oligonucleotide.

“Therapeutically effective amount” refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.

“Pharmaceutical composition” means a mixture of substances le for administering to an individual that includes a pharmaceutical agent. For example, a pharmaceutical composition may comprise a sterile aqueous solution.

“Pharmaceutical agent” means a substance that provides a eutic effect when administered to a subject.

“Active pharmaceutical ient” means the substance in a pharmaceutical composition that provides a desired effect.

“Improved organ function” means a change in organ function toward normal limits. In certain embodiments, organ function is assessed by measuring molecules found in a subj ect’s blood.

For example, in certain embodiments, improved liver function is measured by a reduction in blood liver transaminase levels.

“Acceptable safety profile” means a pattern of side effects that is within ally acceptable limits.

“Side effect” means a physiological response attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site ons, liver function test abnormalities, renal function abnormalities, liver ty, renal toxicity, central nervous system abnormalities, and myopathies. Such side effects may be detected directly or indirectly. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver on abnormality.

“Injection site reaction” means inflammation or abnormal redness of skin at a site of injection in an individual.

“Subject compliance” means adherence to a recommended or prescribed therapy by a subject.

“Comply” means the nce with a recommended therapy by a subject.

“Recommended therapy” means a treatment recommended by a l professional to treat, ameliorate, delay, or t a disease.

Overview miR-21 is a ubiquitously sed microRNA that is linked to a variety of cellular processes, including cell entiation, proliferation, apoptosis and matrix turnover. Additionally, miR-21 is associated with multiple diseases. miR-21 is ntly upregulated in cancer, and inhibition of miR-21 has demonstrated a reduction in tumor growth in several animal models of cancer. Inhibition of miR-21 in an animal model of cardiac hypertrophy demonstrated a role for miR- 21 in heart disease. A role in fibrosis has been demonstrated in animal models of cardiac fibrosis, kidney fibrosis, and lung fibrosis. A study of the inhibition of miR-21 in a tissue explants model illustrated that the inhibition of miR-21 promotes wound healing. As such, tors of miR-21 are useful in a variety of research and clinical settings.

To identify potent inhibitors of miR-21, a large number of iR-21 compounds were designed. The compounds varied in length, and in the number, placement, and identity of bicyclic nucleosides and non-bicyclic nucleosides. An initial series of compounds was tested in an in vitra luciferase assay, which identified a subset of compounds as active compounds vitra active compounds. These in vitra active compounds were then tested in in viva assays to identify those compounds that are potent inhibitors of miR-21 in viva. From the initial in vitra and in viva screens, certain compounds were selected as the basis for the design of onal compounds. The experimentally ed correlations n structure and activity (both in vitra and in viva) were used to inform the design of these additional compounds, with further variations in length and selection and arrangement of bicyclic and non-bicyclic nucleosides. The in vitra and in viva screening assays were then repeated for these additional compounds. Certain nds were also tested for other properties, for example, susceptibility to exonuclease activity. It was observed that the most active in vitra compounds most active in vitra were not necessarily the most active in viva compounds those most active in viva, and further that some moderately active in vitra nds moderately active in vitra were highly active in viva compounds. Of 178 compounds screened in vitra during this process, 60 were fied as active in the luciferase assay. Of these 60 active in vitra compounds, a subset was identified as active in viva. Through this iterative process of designing and screening compounds, it was ed that compounds having particular patterns of ic and non-bicyclic modifications were potent inhibitors of miR-Zlin viva. As such, these compounds are useful for the modulation of cellular processes that are promoted by the activity of miR-2 1. Further, such compounds are useful for treating, preventing, and/or delaying the onset of es associated with miR-2 1. Such diseases may be terized by abnormally high expression of , relative to non-disease samples. Such diseases include, but are not limited to, fibrosis, acute kidney injury, cardiac hypertrophy, myocardial infarction, and cancer. Additionally, the compositions and methods provided herein may be used to promote wound healing.

Certain Modified Oligonucleoiides Targeted to miR-21 Provided herein are modified oligonucleotides having n patterns of bicyclic and non- bicyclic nucleosides. Modified oligonucleotides having the patterns identified herein are effective inhibitors of miR-Zl activity.

Each of the nucleoside patterns illustrated herein is shown in the 5’ to 3’ orientation.

In certain embodiments, provided herein are nds sing a modified oligonucleotide consisting of 8 to 22 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-Zl (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern I in the 5’ to 3’ ation: B-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and each NZ is a modified nucleoside.

In certain embodiments of nucleoside pattern I, X is 1. In certain embodiments of nucleoside pattern I, X is 2. In certain embodiments of nucleoside pattern I, X is 3. In certain embodiments of nucleoside pattern I, X is 4.

In n embodiments, provided herein are compounds comprising a modified oligonucleotide consisting of 8 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-Zl (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern II in the 5’ to 3’ orientation: NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein NM is a modified nucleoside that is not a ic nucleoside; each NB is a bicyclic nucleoside; each NQ is a cyclic side; and NZ is a modified nucleoside.

In certain ments, provided herein are compounds comprising a modified ucleotide consisting of 8 to 22 linked nucleosides, wherein the nucleobase sequence of the d oligonucleotide is complementary to miR-2l (SEQ ID NO: 1) and n the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern III in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified side; and each NZ is a modified nucleoside.

In certain embodiments of nucleoside pattern III, X is 1. In n embodiments of nucleoside pattern I, X is 2. In certain ments of nucleoside pattern III, X is 3. In certain embodiments of nucleoside pattern III, X is 4.

In certain embodiments, provided herein are nds comprising a modified oligonucleotide consisting of 8 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-2l (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 8 contiguous sides of the following nucleoside pattern IV in the 5’ to 3’ orientation: NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is a ic nucleoside; each NQ is a non-bicyclic nucleoside; NY is a modified side or an unmodified side; and NZ is a modified nucleoside.

In certain embodiments, provided herein are compounds comprising a modified oligonucleotide consisting of 8 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-2l (SEQ ID NO: 1) and wherein the modified ucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern V in the 5’ to 3’ orientation: NM-NB-(NQ-NQ-NB-NB)4-NZ wherein NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and NZ is a modified nucleoside.

The following embodiments apply to any of the nucleoside patterns described , including nucleoside patterns I to V.

WO 48952 In certain embodiments, the modified ucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, or 22 contiguous nucleosides of a side pattern described herein.

In certain embodiments of any of the nucleoside patterns described herein, the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to miR-21 (SEQ ID NO: 1).

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 95% mentary to (SEQ ID NO: 1). In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary to (SEQ ID NO: 1).

In certain embodiments of any of the nucleoside patterns described herein the nucleobase sequence of the modified ucleotide is complementary to miR-21 such that position 1 of the microRNA is paired with the 3 ’-terminal nucleobase of the oligonucleotide. For example: ’-UAGCUUAUCAGACUGAUGUUGA-3’ (miR-ZI; SEQ ID NO: I) ||||||||||||||||||| 3’-ATCGAATAGTCTGACTACA-5’ (an anti-miR-Zl; SEQ ID NO: 3); ’-UAGCUUAUCAGACUGAUGUUGA-3’ (miR-ZI; SEQ ID NO: I) |||||||||||||||||||||| 3’-ATCGAATAGTCTGACTACAACT-5’ (an anti-miR-Zl; SEQ ID NO: 4).

It is to be understood that, in SEQ ID NO: 3 and SEQ ID NO: 4, each “T” in the sequence may independently be either a “T” nucleobase or a “U” nucleobase, and that a compound having the sequence of SEQ ID NO: 3 or SEQ ID NO: 4 may se all T’s, all US, or any combination of Us and TS. Thus, the presence of “T” at various positions in SEQ ID NO: 3 and SEQ ID NO: 4 hout the present disclosure and in the accompanying sequence g is not limiting with respect to r that particular nucleobase is a “T” or a “U.” In certain embodiments of any of the nucleoside patterns bed herein, each bicyclic nucleoside is independently selected from an LNA nucleoside, a cEt nucleoside, and an ENA nucleoside. In certain embodiments, the sugar moieties of at least two bicyclic sides are different from one another. In certain embodiments, all bicyclic nucleosides have the same sugar moieties as one another. In certain embodiments, each bicyclic nucleoside is a cEt nucleoside. In certain embodiments, each bicyclic nucleoside is an LNA nucleoside.

In certain embodiments of any of the nucleoside patterns described herein, a cEt nucleoside is an S-cEt nucleoside. In certain embodiments of any of the nucleoside patterns described herein, a cEt nucleoside is an R-cEt side.

In certain embodiments of any of the nucleoside ns described herein, each non-bicyclic side is independently selected from a B-D-deoxyribonucleoside, a B-D-ribonucleoside, a 2’-O- methyl side, a 2’-O-methoxyethyl nucleoside, and a 2’-fluoronucleoside.

In certain embodiments of any of the nucleoside patterns described herein, each non-bicyclic nucleoside is independently selected from a oxyribonucleoside, and a 2’-O-methoxyethyl nucleoside.

In certain embodiments of any of the nucleoside patterns described , at least two non- bicyclic nucleosides comprise sugar moieties that are different from one another and are independently selected from a oxyribonucleoside, a B-D-ribonucleoside, a 2’-O-methyl nucleoside, a 2’-O-methoxyethyl nucleoside, and a 2’-fluoronucleoside.

In certain embodiments of any of the nucleoside patterns described herein, at least two non- bicyclic nucleosides comprise sugar moieties that are different from one r and are independently selected from a B-D-deoxyribonucleoside and a 2’-O-methoxyethyl nucleoside.

In certain ments of any of the nucleoside patterns described herein, each non-bicyclic nucleoside has the same type of sugar moiety and is selected from a B-D-deoxyribonucleoside, a B- D-ribonucleoside, a 2’-O-methyl nucleoside, a 2’-O-methoxyethyl nucleoside, and a 2’- fluoronucleoside.

In certain embodiments of any of the nucleoside patterns described herein, each non-bicyclic nucleoside is a B-D-deoxyribonucleoside. In n embodiments, each non-bicyclic nucleoside is a 2’-O-methyl nucleoside.

In certain embodiments of any of the nucleoside patterns described herein, no more than 3 of the non-bicyclic nucleosides are ethoxyethyl nucleosides. In certain embodiments, no more than 2 of the non-bicyclic nucleosides are ethoxyethyl nucleosides. In certain embodiments, no more than 1 of the non-bicyclic nucleosides is a 2’-O-methoxyethyl side.

In certain embodiments of any of the nucleoside patterns described herein, one non-bicyclic nucleoside is a 2’-MOE nucleoside and each other non-bicyclic sides is a [5-D- deoxyribonucleoside. In certain embodiments, two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other cyclic nucleoside is a B-D-deoxyribonucleoside. In certain ments, three cyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non- bicyclic nucleoside is a B-D-deoxyribonucleoside.

In certain embodiments of any of the nucleoside patterns described herein, the 5’-most non- bicyclic nucleoside and the 3’-most cyclic nucleoside are ethoxyethyl nucleosides, and each other non-bicyclic nucleoside is a B-D-deoxyribonucleoside.

In certain embodiments of any nucleoside pattern I, where X is 4, each nucleoside of R is a 2’-O-methoxyethyl nucleoside. In certain embodiments of nucleoside pattern I, where X is 4, two nucleosides of R are B-D-deoxyribonucleosides and two nucleosides of R are 2’-O-methoxyethyl nucleosides. In certain embodiments of nucleoside pattern I, where X is 4, three sides of R are B-D-deoxyribonucleosides and one nucleoside of R is a 2’-O-methoxyethyl nucleoside.

In certain embodiments of nucleoside pattern I, R is NR1 -NR2-NR3-NR4 where NR1 is a 2’- MOE nucleoside, NRZ is a B-D-deoxyribonucleoside, NR3 is a B-D-deoxyribonucleoside, and NR4 is a B-D-deoxyribonucleoside.

In certain embodiments of nucleoside pattern I, R consists of four linked nucleosides NR1- NRZ-Nm-Nm, wherein NR1 is a 2’-O-methoxyethyl nucleoside and each of NRZ-Nm-NR4 is a [3-D- deoxyribonucleoside; each NB is an S-cEt side; each NQ is a oxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain ments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 4, wherein each T in the sequence is independently selected from T and U.

In certain ments of nucleoside pattern I, X is l and each nucleoside of R is a 2’-O- methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a 2’-O-methoxyethyl nucleoside; and NZ is a ethoxyethyl nucleoside. In certain embodiments, the modified oligonucleotide has the base sequence of SEQ ID NO: 3, wherein each T in the ce is independently selected from T and U.

In certain embodiments of nucleoside pattern I, X is 4 and each nucleoside of R is a 2’-O- methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a 2’-O-methoxyethyl nucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments, the modified oligonucleotide has the base sequence of SEQ ID NO: 4, wherein each T in the sequence is independently selected from T and U.

In certain embodiments of nucleoside pattern II, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is a ethoxyethyl nucleoside. In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3, n each T in the sequence is independently selected from T and U.

In certain embodiments of nucleoside n II, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside. In n embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently selected from T and U.

In certain embodiments of nucleoside n II, NM is a 2’-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently ed from T and U.

In certain embodiments of nucleoside pattern II, NM is a 2’-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is an LNA nucleoside. In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3, n each T in the ce is independently selected from T and U.

In certain embodiments of nucleoside pattern III, R is a modified nucleoside that is not a bicyclic nucleoside; and x is 1. In certain embodiments of nucleoside pattern 111, R is a modified side that is not a bicyclic nucleoside; x is l; and each NQ is an unmodified nucleoside. In certain embodiments of nucleoside pattern III, R is a modified nucleoside that is not a bicyclic nucleoside; x is 1; each NQ is an fied nucleoside; each NB is independently selected from an S-cEt nucleoside and an LNA nucleoside; and NY is selected from a B-D-deoxyribonucleoside, a 2’- oxyethyl nucleoside, an S-cEt nucleoside, and an LNA nucleoside. In certain embodiments of nucleoside pattern III, R is a modified nucleoside that is not a bicyclic side; x is l; and each NQ is a B-D-deoxyribonucleoside. In certain embodiments of nucleoside pattern III, R is a modified side that is not a bicyclic nucleoside; x is 1; each NQ is a B-D-deoxyribonucleoside; each NB is ndently selected from an S-cEt nucleoside and an LNA side; and NY is selected from a B-D-deoxyribonucleoside, a 2’-O-methoxyethyl nucleoside, an S-cEt nucleoside, and an LNA nucleoside. In certain ments of nucleoside pattern III, R is a modified nucleoside that is not a bicyclic nucleoside; x is 1; each NQ is an unmodified side; each NB is an S-cEt nucleoside; and NY is selected from a B-D-deoxyribonucleoside, a 2’-O-methoxyethyl nucleoside, and an S-cEt nucleoside. In certain embodiments of nucleoside pattern III, R is a modified nucleoside that is not a ic side; x is 1; each NQ is a B-D-deoxyribonucleoside; each NB is an S-cEt nucleoside; and NY is selected from a B-D-deoxyribonucleoside, a 2’-O-methoxyethyl nucleoside, and an S-cEt nucleoside. In certain embodiments, the modified oligonucleotide of pattern III has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently ed from T and U.

In certain embodiments of nucleoside pattern IV, NM is a 2’-O-methoxyethyl nucleoside; each NB is selected from an S-cEt nucleoside and an LNA side; each NQ is selected from a B- D-deoxyribonucleoside and a 2’-O-methoxyethyl nucleoside; NY is selected from a 2’-O- methoxyethyl nucleoside, an S-cEt nucleoside, an LNA nucleoside, and a B-D-deoxyribonucleoside; and NZ is selected from a 2’-O-methoxyethyl nucleoside, an LNA nucleoside, and an S-cEt nucleoside. In certain embodiments, the modified ucleotide of pattern IV has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently selected from T and U.

In certain embodiments of nucleoside pattern IV, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is selected from a B-D-deoxyribonucleoside and a 2’-O- yethyl nucleoside; NY is selected from a 2’-O-methoxyethyl nucleoside, an S-cEt nucleoside, and a B-D-deoxyribonucleoside; and NZ is selected from a 2’-O-methoxyethyl nucleoside and an S- cEt nucleoside. In n embodiments, the modified ucleotide of pattern IV has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently selected from T and U.

In certain ments of nucleoside pattern IV, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside. In certain embodiments, the modified oligonucleotide of pattern IV has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently selected from T and U.

In certain embodiments of nucleoside pattern V, NM is a 2’-O-methoxyethyl nucleoside; each NB is selected from an S-cEt side and an LNA nucleoside; each NQ is selected from a B-D- deoxyribonucleoside and a 2’-O-methoxyethyl side; and NZ is selected from a 2’-O- methoxyethyl nucleoside, an LNA nucleoside, and an S-cEt nucleoside. In n embodiments, the modified oligonucleotide of n V has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is ndently selected from T and U.

In certain embodiments of nucleoside pattern V, NM is a 2’-O-methoxyethyl side; each NB is an S-cEt nucleoside; each NQ is a B-D-deoxyribonucleoside; and NZ is selected from a 2’-O- methoxyethyl nucleoside and an S-cEt side. In certain ments, the d oligonucleotide of pattern V has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently selected from T and U.

In certain embodiments of nucleoside pattern V, NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt side; each NQ is a B-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside. In certain embodiments, the modified oligonucleotide of pattern V has the nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence is independently selected from T and U.

In certain embodiments, a compound provided herein has a nucleobase sequence and modifications as shown in Table 1. Nucleoside modifications are indicated as follows: nucleosides not followed by a subscript indicate oxyribonucleosides; nucleosides followed by a subscript “E” indicate 2’-MOE nucleosides; nucleosides followed by a subscript “L” are LNA nucleosides; nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Each internucleoside e is a phosphorothioate internucleoside linkage. Superscript “Me” indicates a 5-methyl group on the base of the nucleoside.

Table 1: Anti-miR-21 compounds Compound # Sequence and Chemistry (5’ to 3’) SEQ ID NO TEMeCEAEAECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE 4 AECSATCSAGTCSTGAUSAAGCSTAE TECSAEGETECSTEGEAEUSAEAEGECSTEAE ACSATCSAGTCSTGAUSAAGCSTAE 25922 AEMeCsATMeCSAGTMSCSTGATSAAGMSCSTAE 25923 AECSATCSAGTCSTGAUSAAGCSTAS 25924 AEMSCSATMSCSAGTMSCSTGATSAAGMSCSTAS 251 14 AEMeCLATMeCLAGTMeCLTGATLAAGMSCLTAE 251 15 AEMeCLATMeCLAGTMeCLTGATLAAGMSCLTAL 25221 ABCSATCSAGTCSTGAUSAAGCsUSAs 25220 ABCsATCsAsGTCsUsGAUsAsAGCsUSAE UJUJUJUJUJUJUJ-PUJUJ In n embodiments of any of the nucleoside patterns described herein, a modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked nucleosides. In certain embodiments, the modified oligonucleotide comprises at least 8 linked nucleosides of a nucleoside pattern set forth in nucleoside pattern I. In certain embodiments, the WO 48952 modified oligonucleotide comprises at least 8 linked nucleosides of a nucleoside pattern set forth in nucleoside pattern II. In certain embodiments, the modified oligonucleotide ses at least 8 linked nucleosides of a nucleoside pattern set forth in side pattern III. In certain embodiments, the modified oligonucleotide comprises at least 8 linked nucleosides of a nucleoside pattern set forth in nucleoside pattern IV. In certain embodiments, the modified oligonucleotide comprises at least 8 linked nucleosides of a side pattern set forth in nucleoside pattern V.

In certain embodiments, a ed oligonucleotide having any of the nucleoside patterns described herein comprises at least one modified intemucleoside linkage. In certain embodiments, each intemucleoside linkage is a modified intemucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate intemucleoside linkage.

In certain embodiments, a modified oligonucleotide has a nucleobase sequence wherein at least one nucleobase is a cytosine. In certain embodiments, at least one cytosine is a 5-methyl cytosine. In certain embodiments, each cytosine is a 5-methyl cytosine. In n embodiments, at least one nucleoside ses a ed nucleobase.

Modified ucleotides may undergo cleavage by exonucleases and/or endonucleases at various positions throughout the modified oligonucleotide. The products of such enzymatic cleavage may retain miR-21 tory ty, and as such are considered active metabolites. As such, a metabolic product of a modified oligonucleotide may be used in the methods described herein.

In certain embodiments, a modified oligonucleotide ed to miR-Zl has a nucleoside pattern selected from Table 2A, where NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and NZ is a modified nucleoside.

Table 2A: Metabolic Products of Nucleoside Pattern II 57 37 NM NB NQ NQ NB NQ NQ NQ NB \Q \Q \Q \B \Q \Q \Q \B \Q \2 \. \' \ N' N' N' N' N' N' N' \' \' \' \' \' \' \' \' \' \ NQ NB NQ NQ NQ NB \Q \Q \Q \B \Q \Q \Q \B \Q \2 _--NB O O O B O O O N N N Hum-lung\' \O \O \O \. \O \ O O N N N N \ \ \ \ \ \ \ \ \ \ NQ NQ NB \Q \Q \Q \B \Q \Q \Q \B \Q \2 _--—m-m\\' \ _--—mm\'\ \ \' \' \' \' \' \' \' \' \' \ \Q \Q \B \Q \Q \Q \B \Q \2 _Fflfi-Fflm\\. \ NWimmlaaamawuuuuueN' N N N' N N N N' \ \ \ \' \ \ \ \' \ \' \' —mmlm\. \ —-mm\\ N 00 N' \0 \. \O \' \O \. \. \' NB \Q \Q \Q \B \Q \Q \Q NB \Q \Q \Q \B \Q \Q \Q NO N . \o \0 NQ BB \Q \Q \Q \Q \Q N \ In certain embodiments, a modified oligonucleotide targeted to miR-Zl has a nucleoside pattern selected from Table 2B, where NM is a modified nucleoside that is not a bicyclic nucleoside; each NB . . . . . 1s a b1cyc11c s1de; each NQ 1s a non-bicyclic nucleoside‘ NY is a modified nucleoside . . Z . . . or an fied nucleos1de; and N 1s a modlfied nucleos1de.

Table 2B: Metabolic Products of Nucleoside Pattern IV VN B O OQQ B O O O N N NNN N N N N IEBBB OQQ OQQ OQQ B \\\ \\\ \ \.

N NQ \B \Q \\\ OQQ \\\ 22 NQ \B \Q —-n N' N' N' N' O O O N n N N N OQQOQQ \\\\\\ OQQOQQ \\\\\\ OQQOQQ \' \0 BB \B \Q \B \Q N' N' \- \0 NB B \ \Q \B \Q \\\\\\ OQQOQQ \\\\\\ OQQOOQQOQQ —--—--m BBBBBBBBBBB Mflflflwwwwafla B \\ 0Q \ \O 3\\\\\\\\\\\\ ZZ22 \B \Q \\ 0Q \\ 0Q \\\\\\\\\\\\\ B \\\\\\\\\\\\\ vYvaY N N N N N N N' OQQ v n O O O N NNN N \ \ \ BBB \\\ OQQ \' \O \ NB NQ I OQQ OQQ \\\ \B \Q BBB NQ \B \Q \\\ OQQ \\\ OQQ \\\ Y —mN NN° N N N NN0Q NN.B \\ 0Q \\ 0Q \\ 0Q \ \0 \ B 0Q \\ 0Q \\ 0Q BB \B \Q \\ 0Q \\ 0Q \\ —--N N N N N N —--N N N N N N _--“-m\00 \ —--mnm\'\' —--unmlmNN -II—O 0 B \ \ \n\--- 0Q \' \.

\B \Q \\ 0Q \\ 0Q \\ BB.- Y --- O \ 3.- 00 \\nunnnOQOOQOOO \\nunnnOQOOQOOO “n00 \\\ 3.- 2012/034880 In certain embodiments, a modified oligonucleotide ed to miR-Zl has a nucleoside n selected from Table 2C, where NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and NZ is a modified nucleoside.

Table 2C: VIetabolic Products of Nucleoside Pattern VII NV 0 0 0 NN NNNN N N \ \. \. \ \ \. \. \' \ '\ NBNQ NQNBNBNQ Q N NB \B \Q \Q \B \B \Q \Q \B \B\Z N. N' N' N N' N' N. N' N N' N. B N \- \O \0 B \ \- \O \"\\'\ NB \B \Q \Q \B \B \Q \Q \Z \B \Q \Q \B \B \Q \Q Z N \ \ \ \B \Q N N N mum-nulli-\ \ N. N NB“ \ \ \0 \0 \ \ \0 \0 \' NQ \B \B \Q \Q \B \B \Q \Q \B \B NO N' \ \' \'mum-- \ \' \'mm- \' \' \'mum- —\'\' \' mum-II- —\\' \'"Hum—- \'\ 0 \ \ \0 \0 \ \ \0 \O \- \' \Q\Q \B \B \Q \Q \B \B \Q \Q \B ——-------—- \. \' \' O \ \0 \' \' \0 \0 \' \B \B \Q \Q \B \B \Q \Q \B \B ——-----—- ——-m-nn_- _-II\\ \ \ \0 \O \' \Q \Q \B \B \Q \Q \B \B In certain embodiments, a modified oligonucleotide ed to miR-Zl has a nucleoside pattern and base sequence selected from Table 3A. Nucleosides not followed by a subscript indicate B-D-deoxyribonucleosides. Nucleosides followed by a ipt “E” indicate 2’-MOE nucleosides. Nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. Nucleobases may or may not comprise a methyl group at the 5’ position.

Table 3A: Metabolic products of compound # 25070 ---—----- N12 13 N19 U1 _--- AB -III-IHIIIIIIIID1D1 “ifiI-II-I-iU1U1U1U1U1 HI-II-IHE aaa 9999 A canU1 A AB >>>> nomamamafillnmfiaa Ewawawanlllafiafiaa U1 A AE ifilliifii“U1 A AE U1 A AB U1 A AE U1 A AE aaaaaaaa 9999999999 >>>>>>>>>>>> U1 U1 >> U1 i 000 U1 Qfifilfifififififififi VIE/J o >>>>>>>>>>>>>>>>>>>>>>>>> ("F‘F‘F‘F‘F‘("C‘C‘F‘F‘C‘F‘F‘F‘F‘C‘F‘F‘F‘F‘C‘F‘F‘F‘C‘C‘F‘F‘7 (Amt/A(Amt/A(Amt/Awwwwwwwwwwwwwwwwwwwwwwww >>> amU1U1U1U1 mas i GOO U1VIE/J 000VIE/JV} iVJ I-II ii>>>>>> >>>> i >>> D> flflflfl D> In certain embodiments, a modified oligonucleotide targeted to miR-Zl has a nucleoside pattern and nucleobase sequence ed from Table 3B. Nucleosides not followed by a subscript indicate B-D-deoxyribonucleosides. Nucleosides followed by a ipt “E” indicate 2’-MOE nucleosides. Nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside e. Nucleobases may or may not comprise a methyl group at the 5’ position.

Table 3B: Metabolic ts of compound # 25923 ---—----- N12 13 N19 U1 _--- As HIIIIIIIID1D1 I-I-iU1U1U1U1U1 -I-INEHI-II-IHE aaa 9999 A canU1 A As >>>> nomamamafillnmfiaa Ewawawanlllafiafiaa U1 A AS ifilliifii“U1 A AS U1 A As U1 A AS U1 A AS aaaaaaaa 9999999999 >>>>>>>>>>>> U1 U1 >> U1 i 000 U1 Qfifilfifififififififi VIE/J o >>>>>>>>>>>>>>>>>>>>>>>>> ("F‘F‘F‘F‘F‘("C‘C‘F‘F‘C‘F‘F‘F‘F‘C‘F‘F‘F‘F‘C‘F‘F‘F‘C‘C‘F‘F‘7 (Amt/A(Amt/A(Amt/Awwwwwwwwwwwwwwwwwwwwwwww >>> amU1U1U1U1 mas i GOO U1VIE/J 000VIE/JV} iVJ I-II ii>>>>>> >>>> i >>> D> flflflfl D> In certain embodiments, a modified oligonucleotide targeted to miR-Zl has a side pattern and nucleobase sequence selected from Table 3C. Nucleosides not followed by a ipt indicate B-D-deoxyribonucleosides. Nucleosides followed by a subscript “E” indicate 2’-MOE nucleosides. Nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. Nucleobases may or may not comprise a methyl group at the 5’ position.

Table 3C: Metabolic products of compound # 25221 ---—-----__---3’ N14 N N19 -III-IHIIIIIIIID1D1 aaa 9999 A __---As >>>> nomamamafillnmfiaa Ewawawanlllafiafiaa I-I-INEHI-II-IHE CS Cs -----ASA A G Cs Ls As - __---As I CS Qfifilfifififififififi-----ASA A G Cs Ls As - __---As - __---As I I -----ASA>>>>>>>>>>>>>>>>>>>>>>>>> ("F‘F‘F‘F‘F‘("C‘C‘F‘F‘C‘F‘F‘F‘F‘C‘F‘F‘F‘F‘C‘F‘F‘F‘C‘C‘F‘F‘7 (Amt/A(Amt/A(Amt/Awwwwwwwwwwwwwwwwwwwwwwww A G Cs Ls AS - - s CS Cs CS ----LSA A CS aaaaaaaa 9999999999 >>>>>>>>>>>> 000 J . ->>> >>>> amU1U1U1U1 QIQ_ GOO U1VIE/J 000VIE/JV} I-IIi iVJ >>>> D> flflflfl D> In certain embodiments, a modified oligonucleotide targeted to miR-Zl has a nucleoside pattern and nucleobase sequence selected from Table 3D. Nucleosides not ed by a subscript te B-D-deoxyribonucleosides. Nucleosides followed by a ipt “E” indicate 2’-MOE nucleosides. Nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. Nucleobases may or may not comprise a methyl group at the 5’ position.

Table 3D: Metabolic products of compound # 25220 ---—- ED1 5E ._] Q rw7 U1 on; 99? 0VJ U1 ._] 00VIE/J mm 99 ("F‘ mm 0U1 ("F‘F‘ C) 0VJ (" VJ ._] 00VIE/J mm 99 ("F‘ mm II“ifiI-II-I-iU1U1U1U1U1 -I-INEHI-II-IHE olfillllfilfilla ("F‘F‘ wwwwwwwww mlfilfillfilfillal >Nfififiifiifiifiifiifiifiifiifi c—‘r‘(—‘c—‘r‘r—‘c—‘r‘flc—‘r‘flflr—‘flr—‘c—‘flr—‘c—‘r‘flc—‘r‘flfl wwwwwwwwwwwwwwwwwwwwwwwwwww 33$333333gazggzgggzzzzzggzggggggz >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>Z a 0U1 0VJ fl QQQQQ 99999 fir VIE/J >>mm I C" m ll U1 AE ("F‘C‘t‘ U1 AE aaa CDC) J 0VJ U1 II o aaa 000VIE/JV} ("F‘F‘r‘flf‘ . U1 ole ._] 0VJ mlm U1 I aa 00VIE/J ("F‘F‘ lflfilo wwwwwwwwwwwwwwww mIIII QQQQQQQQQQQQQQQQQ QQQQQQQQQQQQQQQ U1 ._] 0VJ II aaa 000VIE/JV} ("F‘r‘r‘ C" m C" m aaa 00000 MIAMI/JV} F‘F‘F‘F‘ II (AME/JV} Ls CS Ls CS Lg G Cs lililil Ls As A G Cs Ls In certain embodiments, a modified ucleotide consists of greater than 19 linked nucleosides, and comprises a nucleoside pattern described herein. The nucleosides that are present in addition to the nucleosides described by the side pattern are either modified or unmodified.

For example, a d oligonucleotide consisting of 21 linked nucleosides and having a nucleobase sequence mentary to miR-21 may have side pattern II, which is 19 linked nucleosides in length. The additional two nucleosides may be comprised of modified or unmodified sugar moieties. In certain ments, a modified oligonucleotide consists of 19 linked nucleosides and comprises any of the nucleoside patterns described herein. In n embodiments, a modified oligonucleotide consists of 20 linked nucleosides and comprises any of the side patterns described herein. In certain embodiments, a modified oligonucleotide consists of 21 linked nucleosides and comprises any of the nucleoside patterns described herein. In certain embodiments, a modified oligonucleotide consists of 22 linked nucleosides and comprises any of the nucleoside patterns described herein. In certain embodiments, a modified oligonucleotide consists of 23 linked nucleosides and comprises any of the nucleoside patterns described herein. In certain embodiments, a modified oligonucleotide consists of 24 linked nucleosides and comprises any of the nucleoside patterns described herein. In certain embodiments, a modified oligonucleotide consists of 25 linked sides and ses any of the nucleoside patterns bed herein.

Certain Uses 0fthe Invention Modulation of miR-21 Activity The compounds provided herein are potent and specific tors of miR-21 activity, and are thus useful for ting miR-21 activity.

NAs bind to and repress the sion of messenger RNAs. In certain instances, inhibiting the activity of a NA leads to de-repression of the messenger RNA, i.e. the messenger RNA expression is increased at the level of RNA and/or protein. Provided herein are methods for modulating the sion of a miRregulated transcript, comprising ting a cell with a compound of the invention, wherein the compound ses a modified oligonucleotide having a sequence complementary to a miR-Zl.

In certain embodiments, a miR-Zl-regulated transcript is YODl, and inhibition of miR—21 results in an increase in the level of YODl mRNA. In certain embodiments, a miR—21 regulated transcript is PPAR-alpha, and inhibition of miR-Zl results in an increase in the level of PPAR-alpha mRNA. In n embodiments, a miR-Zl-regulated transcript is RNFl67.

In certain embodiments, a miR-Zl-regulated transcript is SPGZO. In certain embodiments, inhibition of miR—21 in the liver results in an increase in the level of SPGZO mRNA.

In n embodiments, following contacting a cell with a compound of the invention, an at least l.5-fold increase in the mRNA level of a miRregulated transcript is observed. In n embodiments, following contacting a cell with a compound of the invention, an at least 2.0-fold increase in the mRNA level of a miRregulated transcript is observed. In certain embodiments, the mRNA level of the microRNA-regulated transcript increases at least 2.5-fold. In certain embodiments, the mRNA level of the microRNA-regulated transcript increases at least 3.0-fold. In certain embodiments, the mRNA level of the microRNA-regulated transcript increases at least 3.5- fold. In certain ments, the mRNA level of the microRNA-regulated transcript increases at least 4.0-fold. In certain ments, the mRNA level of the microRNA-regulated transcript increases at least 4.5-fold. In certain embodiments, the mRNA level of the microRNA-regulated transcript increases at least 5.0-fold.

Certain microRNAs are known to target several messenger RNAs, in some cases hundreds of messenger RNAs. Inhibiting the activity of a single microRNA can lead to detectable s in expression of many of the microRNAs s. Provided herein are methods for modulating multiple miRregulated transcripts, comprising inhibiting the activity of miR-21, wherein broad gene expression changes occur.

In certain embodiments, phenotypic changes may be ed following tion of a miR- 21 with a compound of the invention. Such ypic changes may occur with or without detectable changes in the expression of a miRregulated transcript.

Fibroproliferative Disorders A normal physiological response to damage or injury in an organ or tissue involves repair of the damaged tissue, which is a fundamental biological process necessary for survival. During the repair process, after foreign materials, bacteria, and damaged tissue are eliminated, fibroblasts migrate in to the site of injury to deposit new extracellular matrix, which then becomes structurally organized as part of the tissue remodeling phase.

Fibroblasts are the most common cells found in tive tissue, and are responsible for the synthesis of reticulin and other elastic fibres which support the extracellular matrix and play an ant part in normal wound g (Sempowski, G.D. et al., 2002. Wound Repair Regeneration. 3: 120-131). Fibroblasts are responsible for the deposition of en, which is necessary to repair d tissue and restore its structure and function. During the wound-healing process, activated fibroblasts are transformed into myofibroblasts, which are en-secreting alpha-SMA+ fibroblasts. In the initial stages of the wound-healing s, myofibroblasts produce matrix metalloproteases, which disrupt the basement membrane and permit inflammatory cells to be efficiently recruited to the site of injury. During the later stages of injury repair, myof1broblasts promote wound contraction, the process by which the edges of the wound migrate toward the center of the wound. Thus, fibroblast activity is essential to the normal healing process. lasts that participate in the normal injury repair process may be derived from local mesenchymal cells, recruited from the bone marrow, or derived by epithelial-mesenchymal transition. Epithelial-mesenchymal transition (EMT) describes a series of rapid s of cell phenotype (Kalluri, R. and Neilson, E.G. 2003. J. Clin. . 112: 1776-1784) during which static epithelial cells lose cell-cell contacts, e mesenchymal features and manifest a migratory phenotype. nt fibroblasts, infiltrating f1brocytes or pericyte-like cells may also participate in the injury repair process.

Under some conditions, the tissue repair process occurs in excess, resulting an excessive lation of extracellular matrix (ECM) components and substantial remodeling of the ECM, which contribute to the formation of a permanent fibrotic scar. The formation of this excess fibrous connective tissue, a s known as fibrosis, contributes to abnormal changes in tissue architecture and interferes with normal organ function.

Fibrosis can occur in any part of the body, and can result from a variety of physical, metabolic, ischemic, infectious, inflammatory or immunological injuries. Although the anatomical locations, origins, and clinical manifestations of fibrosis may be diverse, there are important pathological features common to all types of fibrosis. Regardless of the location in which fibrosis occurs, the fibrotic process involves the secretion and activation of profibrotic cytokines, the expansion and activation of mesenchymal cell populations, and extracellular matrix synthesis and organization, and ultimately leads to the destruction of normal . Left untreated, fibrosis can lead to a variety of conditions of the heart, lungs, , liver, eye, and skin, among other tissues.

As demonstrated herein, the inhibition of miR-21 in a model of fibrosis led to decreased collagen deposition. Accordingly, provided herein are compositions and methods for treating, preventing, and/or delaying the onset of fibrosis, comprising administering a compound sing a modified oligonucleotide, wherein the modified oligonucleotide is complementary to miR-Zl, to a t. The subject may have received a sis of fibrosis, may be at risk for developing s, or may be suspected of having fibrosis.

In certain embodiments, a subject haVing fibrosis has kidney fibrosis, lung fibrosis, liver fibrosis, cardiac fibrosis, skin fibrosis, lated fibrosis, spleen fibrosis, derma, or post- transplant fibrosis.

Many diseases or abnormalities of the kidney are terized by the presence of fibrosis.

As such, the compounds ed herein are useful for treating, ameliorating, preventing, and/or delaying the onset of any kidney disease that is characterized by the presence of s. In certain embodiments, a subject having fibrosis has a kidney e or condition. In certain embodiments, a subject at risk for developing fibrosis has a kidney disease or condition. In certain embodiments, a subject suspected of having fibrosis has a kidney disease or condition. Accordingly, provided herein are methods for treating a subject having, at risk for developing, or suspected of having fibrosis, wherein the subject has a kidney disease or condition. The kidney disease or condition may be one or more of, without limitation, glomerular disease, tubulointerstitial fibrosis, IgA nephropathy, interstitial fibrosis/tubular atrophy, glomerulosclerosis, glomerulonephritis, es mellitus, idiopathic focal segmental glomerulosclerosis, membranous nephropathy, collapsing glomerulopathy, chronic recurrent kidney infection, diabetes mellitus, diabetic nephropathy, c recurrent kidney infection, hypertension, systemic hypertension, intraglomerular ension, or end stage renal disease.

Chronic kidney disease may be characterized by the ce of fibrosis. Accordingly, in n embodiments, the kidney disease or condition is chronic kidney disease. In certain ments, the subject is at risk for developing chronic kidney disease. In certain embodiments, a subject having acute kidney injury is at risk for developing fibrosis and/or c kidney disease.

Accordingly, the compositions and methods provided herein may be administered to a subject haVing acute kidney injury, to prevent or delay the onset of fibrosis and/or chronic kidney disease.

In certain embodiments, a subject having fibrosis has kidney fibrosis that results from acute or repetitive trauma to the . The trauma may result from surgery, chemotherapy, radiation treatment, allograft rejection, chronic transplant rejection, and acute transplant rejection.

In certain embodiments, kidney fibrosis may result from exposure to any agent that may be nephrotoxic after acute or chronic re. Such agents include pharmaceutical agents, including but not limited to analgesics, non-steroidal anti-inflammatory drugs, antibiotics, lithium, cyclosporine, mesalazine, contrast media, chemotherapeutic agents; occupational toxins, including but not limited to heavy metals; and nmental toxins, ing but not limited to heavy metals (e.g. m, ic chloride) or plant nephrotoxins (e. g. aristolochic acid).

Many diseases or alities of the liver are characterized by the presence of fibrosis. As such, in certain embodiments, a subject haVing s has a liver e or condition. In certain embodiments, a subject at risk for developing fibrosis has a liver disease or condition. In certain embodiments, a subject suspected of having fibrosis has a liver disease or condition. Accordingly, provided herein are methods for treating a subject having, at risk for developing, or suspected of having fibrosis, wherein the subject has a liver disease or condition. In certain embodiments, a liver disease or condition may be one or more of, Without limitation, chronic liver injury, hepatitis virus infection (including hepatitis C virus infection and tis B virus infection), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease (ALD), alcoholic steatohepatitis, ng fibrosis, or cirrhosis. In certain embodiments a liver disease or condition is associated with exposure to toxic chemicals. In certain ments, a liver disease or condition results from exposure to pharmaceutical agents, e.g. inophen. In certain embodiments, a subject receiving chemotherapy is at risk for liver fibrosis and/or chronic liver injury.

Fibrosis may be present in many diseases or abnormalities of the lung. As such, in certain embodiments, a subject having fibrosis has a lung e or condition. In certain embodiments, a subject at risk for developing fibrosis has a lung disease or condition. In certain embodiments, a subject suspected of having fibrosis has a lung e or condition. Accordingly, provided herein are methods for treating a subject haVing, at risk for ping, or suspected of haVing fibrosis, wherein the subject has a lung disease or condition. In certain embodiments, a lung disease or condition may be one or more of, Without limitation, lung fibrosis, idiopathic pulmonary fibrosis, or chronic obstructive lung e. In certain ments, lung fibrosis may result from inhalation of particulate matter, such as those found in silica gel, asbestos, air pollutants or cigarette smoke.

In certain embodiments the fibrosis is cardiac fibrosis.

In n embodiments the fibrosis is skin fibrosis. In certain embodiments the fibrosis is age-related s. In certain embodiments the fibrosis is spleen fibrosis.

Scleroderma is a chronic autoimmune disease characterized by fibrosis, among other symptoms. In certain ments, a subject having fibrosis has derma. In certain embodiments, a subject having scleroderma has fibrosis in internal organs, in addition to fibrosis of the skin. is frequently occurs in transplanted organs, leading to loss of organ on and ultimately to chronic rejection of the transplanted organ. Prevention or treatment of fibrosis in transplanted organs may prevent or delay chronic rejection of the transplanted organ, or in other words may prolong function of the transplanted organ. Accordingly, in certain embodiments a subject has post-transplant fibrosis. In certain embodiments, the post-transplant fibrosis is kidney post-transplant fibrosis. In certain embodiments, the transplantation associated fibrosis is liver posttransplant fibrosis. In certain embodiments, a compound described herein is administered prior to transplantation. In certain embodiments, a compound described herein is stered concurrently with transplantation. In certain embodiments, a compound described herein is administered following transplantation.

Provided herein are methods for treating a subject having a fibroproliferative disorder. In n embodiments such methods comprise administering to a subject having or suspected of having a fibroproliferative disorder a modified oligonucleotide having a nucleobase sequence which is complementary to a miRNA or a precursor thereof. In certain ments, the miRNA is miR- 2 1 .

Cancer and Metastasis Abnormally high expression of miR-21 has been demonstrated in numerous types of cancer.

Further, inhibition of miR-21 in in vitro and in vivo models has demonstrated that inhibitors of miR- 21 are useful for the inhibition of cellular processes that support cancer cell growth, as well as for the treatment of cancer.

Accordingly, in certain embodiments, the compounds provided herein are used for treating, ting, ameliorating, and/or delaying the onset of cancer. In certain embodiments, the cancer is liver cancer, breast cancer, lung cancer, colon cancer, ovarian cancer, cervical cancer, leukemia, lymphoma, brain cancer, geal cancer, n lymphoma, non-Hodgkin lymphoma, kidney cancer, melanoma, myeloma, oral cancer, pancreatic cancer, prostate cancer, rectal cancer, stomach , r cancer, thyroid cancer, or testicular cancer. In certain ments, the liver cancer is hepatocellular carcinoma. In certain embodiments, the liver cancer is due to metastasis of cancer that ated in another part of the body, for example bone cancer, colon cancer or breast cancer.

In certain embodiments, in liver cancer, miR-21 is elevated and the level of one or more miRregulated transcripts is d. In certain embodiments, the reduced miRregulated transcript is SPGZO.

In certain embodiments, the liver cancer is hepatocellular carcinoma (HCC). The diagnosis of cellular carcinoma is typically made by liver g tests such as abdominal ultrasound, helical computed tomography (CT) scan or triple phase CT scan. Such imaging tests may be med in ction with measurement of blood levels of alpha-fetoprotein and/or blood levels 2012/034880 of des-gamma-carboxyprothrombin. In n subjects, MRI may be used in place of CT scan. The liver imaging tests allow the assessment of the tumor size, number, location, asis outside the liver, patency and or invasion of the arteries and veins of the liver by the tumor. This assessment aids the decision as to the mode of therapeutic or palliative intervention that is appropriate. The final diagnosis is typically confirmed by needle biopsy and athological examination.

Accordingly, in certain ments, the liver cancer is detected following a computed tomography (CT) scan that s tumors. In certain embodiments, the liver cancer is ed following magnetic resonance imaging (MRI). In certain embodiments, HCC is characterized as a single primary tumor. In certain embodiments, HCC is characterized as le primary tumors. In certain embodiments, HCC is characterized as a poorly defined primary tumor with an infiltrative growth pattern. In certain embodiments, the HCC is a single primary tumor with vascular invasion.

In certain embodiments, the HCC is characterized as multiple primary tumors with vascular invasion.

In certain embodiments, the HCC has metastasized to one or more lymph nodes. In n such embodiments, the lymph nodes are regional lymph nodes. In certain embodiments, the HCC has metastasized to one or more distant s. In certain embodiments, the HCC has metastasized to other regions of the liver, the portal vein, lymph nodes, adrenal glands, bone or lungs. In certain embodiments, fibrosis is present.

A number of systems have been employed to predict the prognosis for HCC, including the TNM system, the Okuda system, the Barcelona Clinic Liver Cancer (BCLC) and the CLIP score.

Each of these systems incorporates four features that have been recognized as being important determinants of survival: the severity of underlying liver disease, the size of the tumor, extension of the tumor into adjacent structures, and the presence of metastases. The TNM system classifies HCC as stage I, II, III, IV, or V. The BCLC classifies HCC as Stage A1, A2, A3, A4, B, C, and D, and includes consideration of a Child-Pugh score.

In certain embodiments, liver cancer is classified as Stage 1, Stage 2, Stage 3A, Stage 3B, Stage 3C, or Stage 4. Stage 1 is characterized by a cancer is no bigger than 2 cm in size and that has not begun to spread. At Stage 2, the cancer is affecting blood vessels in the liver, or there is more than one tumor in the liver. At Stage 3A, the cancer is bigger than 5 cm in size or has spread to the blood vessels near the liver. At Stage 3B, the cancer has spread to nearby organs, such as the bowel or the stomach, but has not spread to the lymph nodes. At Stage 3C the cancer can be of any size and has spread to nearby lymph nodes. At Stage 4 the cancer has spread to parts of the body further away from the liver, such as the lungs.

Biomarkers in a subj ect’s blood may be used to augment a diagnosis of liver cancer, stage a liver , or develop a prognosis for al. Such biomarkers include blood tumor biomarkers, such as alpha-fetoprotein and des-gamma carboxyprothrombin. In certain such embodiments, the t has elevated blood alpha-fetoprotein. In certain such embodiments, the subject has elevated blood des-gamma carboxyprothrombin. 2012/034880 A subject having liver cancer may also suffer from abnormal liver function. Liver function may be assessed by liver function tests, which e, among other things, blood levels of liver transaminases. In certain embodiments, a subject having abnormal liver function has elevated blood liver transaminases. Blood liver transaminases e alanine aminotransferase (ALT) and ate aminotransferase (AST). In certain embodiments, a t having abnormal liver function has elevated blood bilirubin. In certain embodiments, a subject has abnormal blood albumin levels.

In certain embodiments, a subj ect’s liver function is assessed by the Child-Pugh classification system, which defines three classes of liver function. In this classification system, points are assigned to ements in one of five categories: bilirubin levels, albumin levels, prothrombin time, ascites, and encephalopathy. One point is assigned per each of the following characteristics present: blood bilirubin of less than 2.0 mg/dl; blood albumin of greater than 3.5 mg/dl; a prothrombin time of less than 1.7 international normalized ratio (INR); ascites is absent; or encephalopathy is absent. Two points are assigned per each of the following characteristics present: blood bilirubin of 2-3 mg/dl; blood bilirubin of 3.5 to 2.8 mg/dl; prothrombin time of 1.7-2.3 INR; ascites is mild to moderate; or encephalopathy is mild. Three points are assigned per each of the following teristics present: bilirubin of r than 3.0 mg/dl; blood albumin of less than 2.8 mg/dl; prothrombin time of r than 2.3 INR; ascites is severe to refractory; or encephalopathy is severe. The scores are added and Class A is assigned for a score of 5-6 points, Class B is assigned for a score of 7-9 points, and Class C is assigned for a score of 10-15 points, A subject having liver cancer may have previously suffered from, or may currently suffer from, chronic hepatitis C infection, chronic hepatitis B infection, non-alcoholic fatty liver disease, or sis. Subjects having liver cancer accompanied by and/or ing from hepatitis C ion, hepatitis B ion, non-alcoholic fatty liver disease, or cirrhosis may be treated by the methods described herein.

A subj ect’s response to treatment may be evaluated by tests similar to those used to diagnosis the liver cancer, including, without limitation, CT scan, MRI, and needle biopsy. Response to treatment may also be assessed by measuring biomarkers in blood, for comparison to pre- treatment levels of biomarkers. miR-21 has also been linked to the process of metastasis. While EMT does occur in normal physiological processes, EMT has been connected to the process of metastasis. The nce of EMT in tumor progression has been explored in several studies (Greenburg, G. and Hay, E. 1986.

Dev. Biol. 115: 363-379; Boyer, B. et al., 1989. J. Cell. Biol. 109: 509; Uehara, Y. et al., 1992. J. Cell. Biol. 117: 889-894). Epithelial cells are held together through integrins to an underlying extracellular matrix (ECM) called the basement membrane. Mesenchymal cells, on the other hand, have the ability to invade and move h the three-dimensional ure of the ECM.

Therefore, EMT at least superficially resembles the transformation of normal adherent cells into the metastatic phenotype.

Provided herein are methods for treating, preventing, ameliorating, and/or delaying the onset of metastasis. The metastasis may result from the migration of cancer cells from any primary site of cancer to any ary site of cancer.

Acute Kidney Injury Acute kidney injury is a rapid loss of kidney function, which may be brought on by a number of causes, including low blood volume, exposure to toxins, and urinary obstruction. Elevated miR-21 has been observed in a model of acute kidney injury. Accordingly, in certain embodiments, the compounds provided herein are used for treating, preventing, rating, and/or delaying the onset of acute kidney injury. In certain embodiments, acute kidney injury may be the result of exposure to toxic substances, such as environmental toxins or cancer therapeutic agents. Acute kidney injury may arise from damage to the kidney itself, for example in ions such as ulonephritis, acute tubular is, and acute interstitial nephritis. In certain embodiments, acute kidney injury is caused by urinary tract obstruction, such as that related to benign prostatic hyperplasia, kidney stones, obstructed y catheter, bladder stone, bladder, ureteral or renal malignancy. In certain embodiments, the acute kidney injury may progress to fibrosis and/or chronic kidney disease. Thus, in some embodiments, the compounds provided herein are stered to a subject with acute kidney injury to prevent or delay the onset of fibrosis and/or c kidney disease. In some embodiments, the compounds provided herein are administered to a subject to enhance recovery from acute kidney injury.

Cardiac Diseases Elevated miR-21 expression has been found in human cardiac e, and inhibition of miR-21 in relevant animal models has demonstrated improvements in cardiac fibrosis and cardiac function. Accordingly, in n embodiments, the compounds provided herein are used for treating, preventing, rating, and/or delaying the onset of one more cardiac diseases. In certain embodiments, a c disease is cardiac fibrosis, cardiac enlargement, cardiac hypertrophy, cardiac dilation, hypertrophic cardiomyopathy, heart failure, post-myocardial infarction remodeling, myocardial infarction, myopathy (for example, hypertrophic cardiomyopathy, restrictive cardiomyopathy, dilated cardiomyopathy (DCM), idiopathic dilated cardiomyopathy, or dilated cardiomyopathy with arrhythmias), diastolic heart failure, chronic atrial fibrillation, primary pulmonary hypertension, acute respiratory distress syndrome, brugada syndrome, progressive cardiac conduction disease, uremic pericarditis, anthracycline cardiomyopathy, al fibrosis, post- radiation lymphatic fibrosis, sarcoidosis, scleroderma, endocardial astosis, serotonergic excess, cardiac valvulopathy, atrial fibrosis, atrial fibrillation, mitral ar disease, hypertension, chronic ventricular dysfunction, re and volume overload, or myocardial fibrosis.

Cellular Processes Provided herein are compositions and methods for ng or preventing fibroblast proliferation or activation. Also provided herein are compositions and methods for inhibiting the synthesis of extracellular , which includes but is not limited to the synthesis of collagen, fibronectin, collagenase, or a tissue inhibitor of metalloproteinase.

Provided herein are methods for modulating the cellular processes associated with epithelial- mesenchymal transition (EMT). Such methods comprise contacting an epithelial cell with a compound consisting of a modified oligonucleotide, wherein the modified oligonucleotide is complementary to miR-Zl. In certain embodiments, the contacting delays the transition of an epithelial cell to a fibroblast. In certain embodiments, the contacting ts the transition of an lial cell to a ast.

In certain embodiments, a nd provided herein may stop, slow, or reduce the proliferation of cancer cells. In certain embodiments, a compound provided herein may induce apoptosis in cancer cells. In certain embodiments, a compound provided herein may reduce cancer cell survival.

In n ments, the epithelial cell is a cancer cell. In certain embodiments, the contacting delays the metastasis of the cancer cell. In certain embodiments, the contacting ts metastasis of the cancer cell.

Certain Clinical Outcomes In certain embodiments, stration of the compounds or methods provided herein result in one or more clinically desirable outcomes in a subject. Such improvements may be used to ine the extent to which a subject is responding to treatment.

In certain embodiments a clinically desirable e is the ration of fibrosis. In certain embodiments a clinically desirable outcome is the slowing of further progression of fibrosis.

In certain embodiments a clinically desirable outcome is the g of r progression of fibrosis.

In certain embodiments a clinically desirable outcome is a reduction in fibrosis. In certain embodiments a clinically desirable outcome is a reduction in en content in the organ having fibrosis.

In certain embodiments a clinically desirable outcome is the amelioration of fibrosis in any organ or tissue. In certain embodiments a clinically desirable outcome is the slowing of further progression of fibrosis. In n ments a clinically desirable outcome is the halting of further ssion of fibrosis. In certain embodiments a clinically desirable outcome is a reduction in fibrosis. In certain embodiments a clinically desirable outcome is a reduction in collagen content in the affected organ.

In certain embodiments a clinically desirable outcome is improved kidney function. Kidney function may be assessed by one or more known methods ly performed in a clinical setting, ing, without limitation: measuring blood urea nitrogen in the blood of the subject; measuring creatinine in the blood of the subject; measuring creatinine clearance in the subject; measuring proteinuria in the subject; measuring lbumin:creatinine ratio in the subject; measuring urinary output in the subject; measuring kidney injury le-l (KIM-l) mRNA levels in the urine; and/or ing clusterin levels in the urine.

In certain embodiments, a clinically desirable outcome is improved liver function. Liver function may be assessed by one or more known methods ly performed in a clinical setting, including, without tion: measuring alanine aminotransferase levels in the blood of the subject; measuring aspartate aminotransferase levels in the blood of the subject; measuring bilirubin levels in the blood of the subject; measuring albumin levels in the blood of the subject; measuring prothrombin time in the subject; measuring ascites in the subject; and/or measuring encephalopathy in the subject.

In certain embodiments a clinically desirable outcome is improved lung function in a subject haVing pulmonary is. In certain ments the subject has idiopathic pulmonary is.

Lung function may be assessed by one or more known methods commonly performed in a clinical setting, including, without limitation: measuring Vital capacity in the subject; ing forced Vital capacity in the subject; measuring forced expiratory volume in one second in the subject; measuring peak expiratory flow rate in the subject; measuring forced expiratory flow in the subject; measuring l voluntary ation in the subject; determining the ratio of forced expiratory volume in one second to forced Vital capacity in the subject; measuring ventilation/perfusion ratio in the subject; measuring nitrogen washout in the subject; measuring absolute volume of air in one or more lungs of a subject; and administering the 6-minute walk test.

In certain embodiments a clinically desirable outcome is ed cardiac function in a subject having cardiac fibrosis. Cardiac function may be assessed by one or more known methods commonly performed in a al setting, including, without limitation: measuring c output in the subject; measuring stroke volume in the subject; measuring mean systolic ejection rate in the subject; measuring systolic blood pressure in the subject; ing left ventricular ejection fraction in the subject; determining stroke index in the t; determining cardiac index in the subject; measuring left ventricular percent fractional shortening in the subject; ing mean velocity of circumferential fiber ning in the subject; measuring left ventricular inflow ty pattern in the subject; measuring pulmonary venous flow velocity pattern in the subject; measuring peak early diastolic velocity of the mitral annulus of the subject.

In certain embodiments a clinically desirable outcome is reduction of tumor number and/or reduction of tumor size in a subject haVing cancer. In certain embodiments a clinically desirable outcome is a reduction in cancer cell number in a subject having cancer. Additional clinically desirable es include the extension of overall survival time of the subject, and/or extension of progression-free survival time of the subject. In certain embodiments, administration of a compound provided herein ts an increase in tumor size and/or tumor number. In certain embodiments, administration of a compound provided herein prevents metastatic progression. In certain embodiments, administration of a compound provided herein slows or stops metastatic progression.

In certain embodiments, stration of a compound provided herein prevents the ence of tumors. In n embodiments, administration of a compound provided herein prevents recurrence of tumor metastasis.

Certain desirable clinical outcomes may be ed by measurements of blood kers.

In certain embodiments, administration of a nd provided herein may result in the decrease of blood alpha-fetoprotein and/or blood des-gamma carboxyprothrombin. Administration of a compound provided herein may further result in the improvement of liver function, as evidenced by a reduction in blood ALT and/or AST levels. n onal Therapies ents for fibrosis or any of the conditions listed herein may se more than one therapy. As such, in certain embodiments provided herein are methods for ng a subject having or suspected of having fibrosis comprising administering at least one therapy in addition to administering a modified oligonucleotide having a nucleobase sequence complementary to a miR-2 1.

In certain embodiments, the at least one additional therapy comprises a pharmaceutical agent.

In certain embodiments, pharmaceutical agents include anti-inflammatory agents. In certain embodiments, an anti-inflammatory agent is a steroidal anti-inflammatory agent. In certain embodiments, a steroid anti-inflammatory agent is a corticosteroid. In certain embodiments, a osteroid is prednisone. In certain embodiments, an anti-inflammatory agent is a eroidal anti-inflammatory drug. In certain embodiments, a non-steroidal anti-inflammatory agent is ibuprofen, a COX-I inhibitor, or a COX-2 inhibitor.

In certain embodiments, pharmaceutical agents include immunosuppressive agents. In certain embodiments, an immunosuppressive agent is a corticosteroid, cyclophosphamide, or mycophenolate mofetil.

In certain embodiments, pharmaceutical agents include anti-diabetic agent. Antidiabetic agents include, but are not limited to, biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones.

In certain embodiments, pharmaceutical agents include angiotensin II receptor rs (ARB). In certain embodiments, an angiotensin II receptor blocker is candesartan, irbesartan, olmesartan, an, valsartan, telmisartan, or eprosartan.

In certain embodiments, pharmaceutical agents include, but are not limited to, diuretics (e.g. sprionolactone, eplerenone, furosemide), inotropes (e.g. dobutamine, milrinone), n, vasodilators, angiotensin II ting enzyme (ACE) tors (e.g. are captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril), calcium channel blockers, isosorbide dinitrate, hydralazine, nitrates (e.g. isosorbide mononitrate, isosorbide dinitrate), hydralazine, beta- blockers (e.g. carvedilol, metoprolol), and natriuretic peptides (e.g. nesiritide).

In certain embodiments, pharmaceutical agents include heparinoids. In certain embodiments, a heparinoid is pentosan polysulfate.

In certain embodiments, a pharmaceutical agent is a pharmaceutical agent that blocks one or more responses to fibrogenic signals.

In certain embodiments, a pharmaceutical agent is an anti-connective tissue grth factor therapy. In certain embodiments, an anti-CTGF therapy is a monoclonal dy t CTGF.

In certain embodiments, an onal therapy may be a pharmaceutical agent that enhances the body's immune system, including low-dose cyclophosphamide, thymostimulin, vitamins and nutritional supplements (e.g., idants, including vitamins A, C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q-lO and echinacea), and es, e.g., the immunostimulating complex (ISCOM), Which comprises a e formulation that combines a multimeric tation of antigen and an adjuvant.

In certain embodiments, the onal therapy is selected to treat or ameliorate a side effect of one or more pharmaceutical compositions of the present invention. Such side effects include, Without limitation, injection site reactions, liver function test alities, renal on abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.

For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

Further es of additional pharmaceutical agents e, but are not limited to, immunoglobulins, including, but not limited to intravenous immunoglobulin ; analgesics (e.g., acetaminophen); salicylates; antibiotics; antivirals; antifungal ; adrenergic modifiers; es (e.g., anabolic steroids, androgen, en, calcitonin, progestin, somatostatin, and thyroid hormones); immunomodulators; muscle relaxants; antihistamines; osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens); prostaglandins, antineoplastic agents; psychotherapeutic agents; sedatives; poison oak or poison sumac products; antibodies; and vaccines.

Cancer treatments often comprise more than one therapy. As such, in certain embodiments the present invention provides methods for reducing or preventing metastasis comprising stering to a subject a compound comprising a modified oligonucleotide, wherein the modified oligonucleotide is complementary to miR-21, and administering at least one additional therapy that is an anti-cancer therapy.

In certain embodiments, an ancer therapy is chemotherapy. le chemotherapeutic agents include docetaxel, hosphamide, ifosfamide, methotrexate, vinblastine, cisplatin, 5- fluorouracil, gemcitabine, doxorubicin, mitomycin c, sorafenib, etoposide, carboplatin, epirubicin, ecan and latin. An additional suitable chemotherapeutic agent includes an eric compound, other than a composition targeted to miR-21 provided herein, that is used to treat cancer.

In certain embodiments, an anti-cancer therapy is radiation therapy. In certain embodiments, an anti-cancer therapy is surgical resection of a tumor. In certain embodiments, an anti-cancer therapy is a DNA damaging agent, a proliferation inhibitor, an anti-folate, a growth factor or tor, an ngiogenic agent, a receptor tyrosine kinase inhibitor, a kinase inhibitor, a grth factor inhibitor, or a cytotoxic agent.

In certain embodiments, a DNA damaging agent is l,3-bis(2-chloroethyl) -l-nitrosourea, busulfan, carboplatin, carmustine, chlorambucil, tin, cyclophosphamide, dacarbazine, daunorubicin, bicin, epirubicin, ide, icin, ifosfamide, irinotecan, lomustine, mechlorethamine, melphalan, mitomycin C, mitoxantrone, oxaliplatin, temozolomide, or topotecan.

In certain embodiments, an anti-folate is methotrexate, aminopterin, thymidylate synthase, serine hydroxymethyltransferase, folyilpolyglutamyl synthetase, g-glutamyl ase, glycinamide- ribonucleotide transformylase, leucovorin, amino-imidazole-carboxamide-ribonucleotide transformylase, 5-fluorouracil, or a folate transporter.

In certain embodiments, a growth factor receptor is erlotinib, or gefitinib.

In certain embodiments, an angiogenesis inhibitor is bevacizumab, thalidomide, carboxyamidotriazole, TNP-470, CMlOl, IFN-q, platelet factor-4, suramin, SU5416, thrombospondin, a VEGFR antagonist, cartilage-derived angiogenesis inhibitory factor, a matrix metalloproteinase inhibitor, angiostatin, atin, 2-methoxyestradiol, tecogalan, tetrathiomolybdate, prolactin, or linomide.

In certain embodiments, a kinase inhibitor is bevacizumab, BIBW 2992, cetuximab, imatinib, trastuzumab, gefitinib, zumab, pegaptanib, sorafenib, dasatinib, sunitinib, erlotinib, nilotinib, lapatinib, panitumumab, vandetanib, E7080, pazopanib, mubritinib, or fostamatinib.

Certain MicroRNA Nucleobase Sequences The modified oligonucleotides having a nucleoside pattern described herein have a nucleobase sequence that is complementary to miR-21 (SEQ ID NO: 1), or a precursor thereof (SEQ ID NO: 2). In certain embodiments, each nucleobase of the modified oligonucleotide is capable of undergoing base-pairing with a nucleobase at each ponding position in the nucleobase sequence of miR-Zl, or a sor thereof. In certain embodiments the nucleobase sequence of a modified oligonucleotide may have one or more ched base pairs with respect to the nucleobase sequence of miR-21 or precursor sequence, and remains capable of izing to its target sequence.

As the miR-21 ce is contained within the miR-21 precursor sequence, a modified oligonucleotide having a nucleobase ce complementary to miR-21 is also complementary to a region of the miR-21 precursor.

In certain embodiments, a modified oligonucleotide ts of a number of linked nucleosides that is equal to the length of miR-21.

In certain embodiments, the number of linked nucleosides of a modified oligonucleotide is less than the length of miR-21. A modified oligonucleotide having a number of linked nucleosides that is less than the length of miR-21, wherein each nucleobase of the modified oligonucleotide is mentary to each nucleobase at a corresponding position of miR-21, is considered to be a modified oligonucleotide having a nucleobase sequence that is fully complementary to a region of the miR-21 sequence. For example, a modified oligonucleotide consisting of 19 linked nucleosides, where each nucleobase is complementary to a corresponding position of miR-21 that is 22 nucleobases in length, is fully complementary to a 19 nucleobase region of miR-21. Such a modified oligonucleotide has approximately 86% l complementarity to the entire length of miR-21, and has 100% complementarity to a 19 nucleobase portion of miR-21.

In certain embodiments, a modified oligonucleotide comprises a nucleobase sequence that is complementary to a seed sequence, i.e. a d oligonucleotide comprises a seed-match sequence.

In certain embodiments, a seed sequence is a hexamer seed sequence. In certain such embodiments, a seed sequence is nucleobases 1-6 of miR-21. In certain such embodiments, a seed sequence is nucleobases 2-7 of miR-21. In certain such embodiments, a seed sequence is bases 3-8 of miR-21. In certain embodiments, a seed sequence is a heptamer seed sequence. In certain such embodiments, a heptamer seed sequence is nucleobases 1-7 of miR-21. In certain such embodiments, a er seed sequence is nucleobases 2-8 of miR-21. In certain embodiments, the seed sequence is an octamer seed sequence. In certain such embodiments, an octamer seed sequence is nucleobases 1-8 of . In certain embodiments, an r seed sequence is nucleobases 2-9 of miR-21.

In n embodiments, a modified oligonucleotide has a nucleobase sequence having one mismatch with respect to the nucleobase ce of miR-21, or a sor f. In certain embodiments, a modified oligonucleotide has a nucleobase sequence having two mismatches with respect to the nucleobase sequence of miR-21, or a precursor thereof. In certain such embodiments, a modified oligonucleotide has a nucleobase sequence having no more than two ches with respect to the nucleobase ce of miR-21, or a precursor f. In certain such embodiments, the mismatched nucleobases are contiguous. In certain such embodiments, the mismatched nucleobases are not contiguous.

In certain ments, the number of linked nucleosides of a modified oligonucleotide is greater than the length of . In certain such embodiments, the nucleobase of an additional nucleoside is complementary to a nucleobase of the miR-21 stem-loop sequence. In certain embodiments, the number of linked nucleosides of a modified oligonucleotide is one r than the length of miR-21. In n such embodiments, the additional nucleoside is at the 5’ terminus of an oligonucleotide. In certain such embodiments, the additional nucleoside is at the 3’ terminus of an oligonucleotide. In certain embodiments, the number of linked nucleosides of a modified oligonucleotide is two greater than the length of miR-21. In certain such embodiments, the two additional nucleosides are at the 5’ us of an oligonucleotide. In certain such embodiments, the two additional nucleosides are at the 3’ terminus of an oligonucleotide. In certain such embodiments, one additional nucleoside is located at the 5’ terminus and one additional nucleoside is located at the 3’ terminus of an oligonucleotide. In certain embodiments, a region of the oligonucleotide may be fully mentary to the base sequence of miR-21, but the entire modified ucleotide is not fully complementary to miR-21. For example, a modified oligonucleotide consisting of 24 linked nucleosides, where the nucleobases of nucleosides 1 through 23 are each complementary to a corresponding position of miR-21 that is 22 nucleobases in length, has a 22 nucleoside portion that is fully complementary to the nucleobase sequence of miR-21 and approximately 96% overall complementarity to the nucleobase sequence of miR-21.

Certain Modified Oligonucleotz'des In certain embodiments, a modified ucleotide consists of 8 to 30 linked sides. In certain embodiments, a modified oligonucleotide consists of 15 to 30 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 15 to 25 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 15 to 19 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 15 to 16 linked nucleosides. In certain embodiments, a d oligonucleotide consists of 19 to 24 linked nucleosides. In certain embodiments, a modified oligonucleotide ts of 21 to 24 linked nucleosides.

In certain embodiments, a modified oligonucleotide consists of 8 linked nucleosides. In certain embodiments, a modified ucleotide consists of 9 linked nucleosides. In certain ments, a modified oligonucleotide consists of 10 linked nucleosides. In certain embodiments, a d oligonucleotide consists of 11 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 12 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 13 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 14 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 15 linked sides. In certain embodiments, a modified ucleotide consists of 16 linked nucleosides. In n embodiments, a modified oligonucleotide consists of 17 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 19 linked nucleosides. In certain embodiments, a modified oligonucleotide ts of 20 linked nucleosides. In certain embodiments, a modified ucleotide consists of 21 linked nucleosides. In n embodiments, a modified oligonucleotide ts of 22 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 23 linked nucleosides. In certain embodiments, a modified WO 48952 oligonucleotide consists of 24 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 25 linked sides.

The nucleobase sequences set forth herein, including but not limited to those found in the examples and in the sequence listing, are independent of any modification to the nucleic acid. As such, nucleic acids defined by a SEQ ID NO may comprise, independently, one or more modifications to one or more sugar moieties, to one or more intemucleoside es, and/or to one or more nucleobases.

Although the sequence listing accompanying this filing identifies each nucleobase sequence as either “RNA” or “DNA” as required, in ce, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such ation as “RNA” or “DNA” to describe modified oligonucleotides is somewhat arbitrary. For example, a modified oligonucleotide comprising a nucleoside sing a 2'-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA having a modified base (thymine (methylated ) for natural uracil of RNA).

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass c acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of r example and without tion, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any ucleotide having such nucleobase sequence, whether modified or unmodified, including, but not d to, such nds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligonucleotides having other modified bases, such as “ATmeCGAUCG,” wherein meC indicates a ylcytosine. Similarly, an oligonucleotide having the nucleobase sequence “AUCGAUCG” encompasses any oligonucleotide having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising DNA bases, such as those having sequence “ATCGATCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligonucleotides having other modified bases, such as “ATmeCGAUCG,” wherein meC indicates a 5-methylcytosine.

Certain ations In certain embodiments, oligonucleotides provided herein may comprise one or more modifications to a nucleobase, sugar, and/or intemucleoside linkage, and as such is a modified oligonucleotide. A modified nucleobase, sugar, and/or intemucleoside linkage may be selected over an unmodified form because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets and sed stability in the presence of nucleases.

In certain embodiments, a modified oligonucleotide comprises one or more d nucleosides. In certain such embodiments, a modified nucleoside is a stabilizing nucleoside. An e of a stabilizing nucleoside is a sugar-modified nucleoside.

In certain embodiments, a modified nucleoside is a sugar-modified nucleoside. In certain such ments, the sugar-modified nucleosides can further comprise a natural or d heterocyclic base moiety and/or a natural or modified internucleoside linkage and may include further modifications independent from the sugar ation. In certain embodiments, a sugar d nucleoside is a 2’-modified nucleoside, wherein the sugar ring is modified at the 2’ carbon from natural ribose or 2’-deoxy-ribose.

In certain embodiments, a 2’-modified nucleoside has a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety is a D sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is a D sugar in the beta ration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the beta configuration.

In n embodiments, the ic sugar moiety comprises a bridge group between the 2' and the 4'-carbon atoms. In certain such embodiments, the bridge group ses from 1 to 8 linked biradical groups. In certain ments, the bicyclic sugar moiety comprises from 1 to 4 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises 2 or 3 linked biradical groups. In n embodiments, the bicyclic sugar moiety comprises 2 linked biradical groups.

Examples of such 4’ to 2’ sugar substituents, include, but are not limited to: -[C(Ra)(Rb)]n-, '[C(Ra)(Rb)]n'O'a 'C(RaRb)'N(R)'O' 0T» —C(RaRb)-O'N(R)'; 4"CH2-2', 4"(CH2)2-2', 4"(CH2)3-2'; 4'- (CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (cEt) and 4'-CH (CHZOCH3)-O-2', and analogs thereof (see, e. g., U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH3)(CH3)-O-2' and analogs thereof, (see, e. g., WO2009/006478, published January 8, 2009); 4'-CH2-N(OCH3)-2' and analogs thereof (see, e. g., WO2008/150729, published December 11, 2008); -O-N(CH3)-2' (see, e. g., US2004/017l570, published September 2, 2004 ); 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2'-, wherein each Ris, independently, H, a protecting group, or C1-C12 alkyl; 4'- CHZ-N(R)-O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see, e. g., Chattopadhyaya, er al., J. Org.

Chem.,2009, 74, 118-134); and -C(=CH2)-2' and s thereof (see, published PCT ational ation WC 2008/154401, published on December 8, 2008).

In certain embodiments, such 4’ to 2’ bridges independently comprise l or from 2 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and 'N(Ra)'; wherein: x is 0, l, or 2; nis l,2,3,or4; each Ra and Rb is, ndently, H, a ting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic l, halogen, OJ 1, NJJ2, SJ1, N3, COOJ1, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or yl —J1); each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Nucleosides comprising such bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. In n embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L- Methyleneoxy (4’-CH2-O-2’) BNA; (B) B-D-Methyleneoxy (4’-CH2-O-2’) BNA; (C) Ethyleneoxy (4’-(CH2)2-O-2’) BNA; (D) Aminooxy (4’-CH2-O-N(R)-2’) BNA; (E) Oxyamino (4’-CH2-N(R)-O- 2’) BNA; (F) Methyl(methyleneoxy) (CH3)-O-2’) BNA (also ed to as constrained ethyl or cEt); (G) methylene-thio (4’-CH2-S-2’) BNA; (H) methylene-amino (4’-CH2-N(R)—2’) BNA; (1) methyl carbocyclic (4’-CH2-CH(CH3)-2’) BNA; (J) c-MOE (4’-CH2-OMe-2’) BNA and (K) propylene carbocyclic (4’-(CH2)3-2’) BNA as depicted below. .111— i \o \o (A) (B) (C) i O BX H3C \o o Bx § 0 Bx E o BX \S \N (I) G (H) E 0 BX g 0 BX (J) (K) w CH3 M wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C1-C12 alkyl.

In certain ments, a ified nucleoside comprises a 2'—substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-, S-, or N(Rm)-alkyl; O-, S-, or N(Rm)- alkenyl; O-, S- or N(Rm)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O- aralkyl, ZSCH3, O-(CH2)2-O-N(Rm)(Rn) or O-CHZ-C(=O)-N(Rm)(Rn), Where each RIn and RH is, independently, H, an amino protecting group or substituted or unsubstituted C1-C10 alkyl. These 2'—substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N02), thiol, thioalkoxy (S-alkyl), n, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, a 2’-modified nucleoside ses a 2’-substituent group selected from F, NHZ, N3, OCF3, O-CH3, O(CH2)3NH2, CHZ-CH=CH2, O-CHZ-CH=CH2, OCHZCHZOCHg, O(CH2)ZSCH3, O-(CH2)2-O-N(Rm)(Rn), -O(CH2)ZO(CH2)2N(CH3)2, and N- tuted acetamide (O-CHz-C(=O)-N(Rm)(Rn) where each RIn and RH is, independently, H, an amino ting group or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2’-modified nucleoside comprises a 2’-substituent group selected from F, OCF3, O-CH3, OCHZCHZOCHg, 2'—O(CH2)ZSCH3, O-(CH2)2-O-N(CH3)2, -O(CH2)ZO(CH2)2N(CH3)2, and C(=O)-N(H)CH3.

In certain embodiments, a 2’-modified nucleoside comprises a 2’-substituent group selected from F, O-CH3, and OCHZCHZOCHg.

In certain embodiments, a sugar-modified nucleoside is a 4’-thio modified nucleoside. In certain embodiments, a sugar-modified nucleoside is a 4’-thio-2’-modified nucleoside. A o modified nucleoside has a B-D-ribonucleoside Where the 4'-O replaced with 4'-S. A 4'-thio-2'- modified nucleoside is a 4'-thio modified nucleoside having the 2'—OH replaced with a 2'—substituent group. Suitable 2’-substituent groups include 2'—OCH3, 2'—O-(CH2)2-OCH3, and 2'—F.

In certain embodiments, a modified oligonucleotide comprises one or more cleoside modifications. In n such embodiments, each intemucleoside linkage of a modified ucleotide is a modified cleoside linkage. In certain embodiments, a modified intemucleoside e comprises a phosphorus atom.

WO 48952 In certain embodiments, a d oligonucleotide comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate internucleoside e.

In certain embodiments, a modified internucleoside linkage does not comprise a phosphorus atom. In certain such embodiments, an internucleoside linkage is formed by a short chain alkyl internucleoside linkage. In certain such embodiments, an internucleoside linkage is formed by a lkyl internucleoside linkages. In n such embodiments, an internucleoside linkage is formed by a mixed atom and alkyl internucleoside linkage. In certain such embodiments, an internucleoside linkage is formed by a mixed heteroatom and cycloalkyl internucleoside linkages. In certain such embodiments, an internucleoside linkage is formed by one or more short chain heteroatomic internucleoside linkages. In certain such embodiments, an ucleoside linkage is formed by one or more heterocyclic internucleoside linkages. In certain such embodiments, an internucleoside linkage has an amide backbone. In certain such embodiments, an internucleoside linkage has mixed N, O, S and CH2 component parts.

In certain embodiments, a modified oligonucleotide comprises one or more modified nucleobases. In n embodiments, a modified oligonucleotide comprises one or more 5- methylcytosines. In n embodiments, each ne of a modified oligonucleotide comprises a 5- methylcytosine.

In certain embodiments, a modified base is selected from 5-hydroxymethyl cytosine, 7-deazaguanine and 7-deazaadenine. In certain embodiments, a modified nucleobase is selected from 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. In certain embodiments, a modified nucleobase is selected from 5-substituted dines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In n embodiments, a modified nucleobase comprises a polycyclic cycle. In certain embodiments, a modified nucleobase comprises a tricyclic cycle. In certain embodiments, a modified nucleobase comprises a phenoxazine derivative. In certain embodiments, the phenoxazine can be further modified to form a nucleobase known in the art as a G-clamp.

Certain ceutical Compositions Provided herein are pharmaceutical compositions comprising ucleotides. In certain embodiments, such pharmaceutical itions are used for the ent of metabolic disorders, and associated conditions. In certain embodiments, a pharmaceutical composition provided herein comprises a nd comprising a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence complementary miR-21, or a precursor thereof. In certain embodiments, a pharmaceutical composition provided herein comprises a nd consisting of a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence complementary to miR-Zl, or a precursor thereof.

Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracardiac, intraventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, uscular, intramedullary, and aneous). In certain ments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For e, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the .

In certain embodiments, a pharmaceutical composition is administered in the form of a dosage unit (e.g., tablet, capsule, bolus, etc.). In some embodiments, a pharmaceutical compositions comprises a modified oligonucleotide at a dose Within a range selected from 25 mg to 800 mg, 25 mg to 700 mg, 25 mg to 600 mg, 25 mg to 500 mg, 25 mg to 400 mg, 25 mg to 300 mg, 25 mg to 200 mg, 25 mg to 100 mg, 100 mg to 800 mg, 200 mg to 800 mg, 300 mg to 800 mg, 400 mg to 800 mg, 500 mg to 800 mg, 600 mg to 800 mg, 100 mg to 700 mg, 150 mg to 650 mg, 200 mg to 600 mg, 250 mg to 550 mg, 300 mg to 500 mg, 300 mg to 400 mg, and 400 mg to 600 mg. In certain ments, such pharmaceutical compositions comprise a modified oligonucleotide in a dose ed from 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 270 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400 mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg, 445 mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485 mg, 490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg, 530 mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570 mg, 575 mg, 580 mg, 585 mg, 590 mg, 595 mg, 600 mg, 605 mg, 610 mg, 615 mg, 620 mg, 625 mg, 630 mg, 635 mg, 640 mg, 645 mg, 650 mg, 655 mg, 660 mg, 665 mg, 670 mg, 675 mg, 680 mg, 685 mg, 690 mg, 695 mg, 700 mg, 705 mg, 710 mg, 715 mg, 720 mg, 725 mg, 730 mg, 735 mg, 740 mg, 745 mg, 750 mg, 755 mg, 760 mg, 765 mg, 770 mg, 775 mg, 780 mg, 785 mg, 790 mg, 795 mg, and 800 mg. In certain such embodiments, a pharmaceutical composition of the comprises a dose of modified oligonucleotide selected from 25 mg, 50 mg, 75 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg, 600 mg, 700 mg, and 800mg.

In certain embodiments, a pharmaceutical agent is sterile lyophilized modified oligonucleotide that is tituted with a suitable diluent, e.g., sterile water for injection or sterile saline for injection. The reconstituted product is administered as a subcutaneous ion or as an intravenous infusion after on into saline. The lyophilized drug product consists of a modified oligonucleotide which has been prepared in water for injection, or in saline for injection, adjusted to pH 7.0-9.0 With acid or base during preparation, and then lyophilized. The lyophilized modified oligonucleotide may be 25-800 mg of an oligonucleotide. It is understood that this encompasses 25, 50, 75, 100,125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, and 800 mg of modified lyophilized oligonucleotide.

Further, in some embodiments, the lyophilized modified oligonucleotide is an amount of an oligonucleotide within a range selected from 25 mg to 800 mg, 25 mg to 700 mg, 25 mg to 600 mg, mg to 500 mg, 25 mg to 400 mg, 25 mg to 300 mg, 25 mg to 200 mg, 25 mg to 100 mg, 100 mg to 800 mg, 200 mg to 800 mg, 300 mg to 800 mg, 400 mg to 800 mg, 500 mg to 800 mg, 600 mg to 800 mg, 100 mg to 700 mg, 150 mg to 650 mg, 200 mg to 600 mg, 250 mg to 550 mg, 300 mg to 500 mg, 300 mg to 400 mg, and 400 mg to 600 mg. The lyophilized drug t may be ed in a 2 mL Type I, clear glass vial (ammonium sulfate-treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum FLIP-OFF® al.

In certain embodiments, the pharmaceutical compositions provided herein may additionally n other adjunct components conventionally found in pharmaceutical compositions, at their art- ished usage levels. Thus, for example, the compositions may contain additional, compatible, ceutically-active materials such as, for example, antipruritics, gents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating s dosage forms of the itions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if d, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting , emulsifiers, salts for influencing c pressure, buffers, colorings, ings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.

Lipid moieties have been used in nucleic acid therapies in a variety of methods. In one method, the nucleic acid is introduced into preformed liposomes or exes made of mixtures of cationic lipids and neutral lipids. In another method, DNA xes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

In certain embodiments, IPID is used to prepare a pharmaceutical composition comprising an oligonucleotide. Intralipid is fat emulsion prepared for intravenous administration. It is made up of 10% soybean oil, 1.2% egg yolk phospholipids, 2.25% glycerin, and water for injection. In addition, sodium hydroxide has been added to adjust the pH so that the final product pH range is 6 to 8.9.

In certain ments, a pharmaceutical composition provided herein ses a polyamine nd or a lipid moiety complexed with a nucleic acid. In certain embodiments, such preparations comprise one or more nds each individually having a structure defined by formula (Z) or a pharmaceutically acceptable salt thereof, RZN/[ \N}a b x x \NR R n wherein each Xa and Xb, for each occurrence, is independently C1_6 alkylene; n is 0, l, 2, 3, 4, or 5; each R is independently H, wherein at least n + 2 of the R moieties in at least about 80% of the molecules of the nd of formula (Z) in the preparation are not H; m is l, 2, 3 or 4; Y is O, NR2, or S; R1 is alkyl, alkenyl, or alkynyl; each of which is ally substituted with one or more substituents; and R2 is H, alkyl, alkenyl, or alkynyl; each of which is optionally substituted each of which is optionally substituted with one or more tuents; provided that, if n = 0, then at least n + 3 of the R moieties are not H. Such preparations are described in PCT publication WO/2008/042973, which is herein incorporated by reference in its entirety for the disclosure of lipid preparations.

Certain additional preparations are described in Akinc et al., Nature Biotechnology 26, 561 - 569 (01 May 2008), which is herein incorporated by reference in its entirety for the disclosure of lipid preparations.

In certain embodiments, pharmaceutical itions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such ments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

In certain ments, a pharmaceutical composition provided herein is prepared using known techniques, ing, but not limited to mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes.

In certain embodiments, a pharmaceutical composition provided herein is a liquid (e.g., a suspension, elixir and/or solution). In certain of such ments, a liquid pharmaceutical composition is prepared using ingredients known in the art, including, but not limited to, water, glycols, oils, alcohols, flavoring agents, preservatives, and coloring agents.

In certain embodiments, a pharmaceutical composition provided herein is a solid (e.g., a powder, tablet, and/or capsule). In certain of such embodiments, a solid pharmaceutical composition comprising one or more ucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating , lubricants, binders, and disintegrating agents.

In n embodiments, a ceutical composition provided herein is formulated as a depot preparation. Certain such depot preparations are typically longer acting than non-depot preparations. In certain embodiments, such preparations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. In n embodiments, depot ations are ed using suitable polymeric or hobic materials (for example an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

In certain embodiments, a pharmaceutical composition provided herein ses a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. n delivery systems are useful for preparing certain pharmaceutical compositions including those sing hydrophobic nds. In certain ments, certain organic solvents such as dimethylsulfoxide are used.

In n embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

In certain embodiments, a pharmaceutical composition provided herein comprises a co- solvent system. n of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% W/v benzyl alcohol, 8% W/v of the nonpolar surfactant Polysorbate 80““ and 65% W/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably Without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of vent components may be varied: for example, other surfactants may be used instead of Polysorbate 80““; the fraction size of polyethylene glycol may be varied; other patible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

In certain embodiments, a ceutical composition provided herein comprises a sustained-release . A non-limiting example of such a sustained-release system is a semi- permeable matrix of solid hydrophobic polymers. In certain embodiments, ned-release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks or months.

In certain ments, a pharmaceutical composition provided herein is prepared for oral administration. In certain of such ments, a pharmaceutical composition is formulated by 2012/034880 ing one or more compounds comprising a modified oligonucleotide with one or more pharmaceutically acceptable carriers. Certain of such carriers enable pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, s, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject. In certain embodiments, pharmaceutical compositions for oral use are obtained by mixing oligonucleotide and one or more solid excipient. Suitable excipients include, but are not limited to, fillers, such as , including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize , Wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl ose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). In certain ments, such a mixture is optionally ground and auxiliaries are optionally added. In certain embodiments, pharmaceutical compositions are formed to obtain s or dragee cores. In certain embodiments, disintegrating agents (e.g., cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate) are added.

In certain embodiments, dragee cores are provided with coatings. In certain such embodiments, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, hylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to tablets or dragee coatings.

In certain embodiments, pharmaceutical compositions for oral administration are push-fit capsules made of gelatin. Certain of such push-fit capsules comprise one or more pharmaceutical agents of the present invention in admixture with one or more filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In certain ments, pharmaceutical compositions for oral administration are soft, sealed es made of gelatin and a plasticizer, such as glycerol or sorbitol. In certain soft capsules, one or more pharmaceutical agents of the present invention are be dissolved or suspended in suitable s, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.

In certain embodiments, pharmaceutical compositions are prepared for buccal administration. Certain of such pharmaceutical compositions are tablets or lozenges formulated in conventional manner.

In certain embodiments, a pharmaceutical composition is prepared for stration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a ceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's on, Ringer's on, or logical saline buffer. In certain embodiments, other ingredients are ed (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, inj e suspensions are prepared using appropriate liquid rs, suspending agents and the like. Certain pharmaceutical compositions for injection are ted in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain forrnulatory agents such as ding, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also n suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.

In certain embodiments, a ceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

In certain embodiments, a pharmaceutical composition is prepared for administration by inhalation. n of such pharmaceutical compositions for inhalation are ed in the form of an aerosol spray in a rized pack or a nebulizer. Certain of such pharmaceutical compositions comprise a propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, rotetrafiuoroethane, carbon dioxide or other suitable gas. In certain embodiments using a pressurized aerosol, the dosage unit may be determined with a valve that delivers a metered amount.

In n embodiments, capsules and cartridges for use in an inhaler or insufflator may be formulated. Certain of such formulations comprise a powder mixture of a pharmaceutical agent of the invention and a suitable powder base such as lactose or .

In certain embodiments, a ceutical composition is ed for rectal administration, such as a suppositories or retention enema. Certain of such pharmaceutical compositions comprise known ingredients, such as cocoa butter and/or other glycerides.

In certain embodiments, a pharmaceutical composition is ed for topical administration.

Certain of such ceutical compositions comprise bland moisturizing bases, such as nts or creams. Exemplary suitable ointment bases include, but are not limited to, petrolatum, petrolatum plus volatile silicones, and lanolin and water in oil ons. Exemplary suitable cream bases e, but are not limited to, cold cream and hydrophilic ointment.

In certain embodiments, a pharmaceutical ition provided herein comprises a modified oligonucleotide in a eutically effective amount. In certain embodiments, the eutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.

In certain embodiments, one or more modified ucleotides provided herein is formulated as a prodrug. In certain embodiments, upon in viva administration, a g is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In n embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a g is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the ponding active form.

In certain embodiments, a prodrug is ed by modifying a pharmaceutically active compound such that the active compound will be regenerated upon in vivo administration. The prodrug can be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug. By virtue of knowledge of pharmacodynamic processes and drug metabolism in vivo, those of skill in this art, once a pharmaceutically active compound is known, can design prodrugs of the nd (see, e.g., Nogrady (1985) Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388-3 92).

Certain Routes ofAdministration In certain embodiments, administering to a subject comprises parenteral stration. In certain ments, administering to a subject comprises enous administration. In certain embodiments, administering to a subject comprises aneous stration.

In certain embodiments, administering to a subject comprises rterial administration. In certain embodiments, administering to a subject comprises intracardial administration. Suitable means for intracardial administration e the use of a er, or administration during open heart surgery. In certain embodiments, administration comprises use of a stent.

In certain embodiments, administration includes pulmonary administration. In certain embodiments, pulmonary administration comprises delivery of aerosolized oligonucleotide to the lung of a subject by inhalation. Following inhalation by a t of aerosolized ucleotide, oligonucleotide distributes to cells of both normal and d lung tissue, including alveolar macrophages, eosinophils, epithelium, blood vessel endothelium, and bronchiolar epithelium. A suitable device for the delivery of a pharmaceutical composition comprising a modified oligonucleotide includes, but is not d to, a standard nebulizer device. Formulations and methods for modulating the size of droplets using zer devices to target specific portions of the atory tract and lungs are well known to those skilled in the art. Additional suitable devices include dry powder rs or metered dose inhalers.

In certain embodiments, pharmaceutical compositions are administered to achieve local rather than systemic exposures. For e, pulmonary administration delivers a pharmaceutical composition to the lung, with minimal systemic exposure. onal suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, intrathecal, intraventricular, intraperitoneal, intranasal, intraocular, intramuscular, intramedullary, and umoral.

Certain Compounds Provided herein are compounds comprising a modified oligonucleotide having certain side patterns, and uses of these compounds to modulate the activity, level or expression of a target nucleic acid. In certain ments, the compound comprises an ucleotide. In certain such embodiments, the compound consists of an oligonucleotide. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is complementary to a small non-coding RNA. In certain embodiments, the small non-coding RNA is miR-2 l.

In certain such embodiments, the compound comprises a modified oligonucleotide hybridized to a complementary strand, i.e. the compound comprises a double-stranded oligomeric compound. In certain embodiments, the hybridization of a modified oligonucleotide to a complementary strand forms at least one blunt end. In certain such embodiments, the hybridization of a modified oligonucleotide to a complementary strand forms a blunt end at each terminus of the double-stranded oligomeric compound. In certain ments, a us of a modified oligonucleotide comprises one or more additional linked nucleosides ve to the number of linked nucleosides of the complementary strand. In certain embodiments, the one or more additional nucleosides are at the 5’ terminus of an oligonucleotide. In certain ments, the one or more additional nucleosides are at the 3’ terminus of an oligonucleotide. In certain embodiments, at least one nucleobase of a nucleoside of the one or more onal nucleosides is complementary to the target RNA. In certain embodiments, each base of each one or more additional nucleosides is complementary to the target RNA. In certain embodiments, a us of the complementary strand comprises one or more additional linked nucleosides relative to the number of linked nucleosides of an oligonucleotide. In certain embodiments, the one or more additional linked nucleosides are at the 3’ terminus of the complementary strand. In certain embodiments, the one or more additional linked sides are at the 5’ terminus of the complementary strand. In certain embodiments, two additional linked nucleosides are linked to a terminus. In certain embodiments, one additional nucleoside is linked to a terminus.

In certain ments, the compound comprises a modified oligonucleotide conjugated to one or more moieties which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. In certain such ments, the moiety is a cholesterol moiety. In certain ments, the moiety is a lipid . Additional es for conjugation include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, ceins, rhodamines, coumarins, and dyes. In certain embodiments, a conjugate group is attached directly to an oligonucleotide. In n ments, a conjugate group is attached to a modified oligonucleotide by a linking moiety selected from amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4- (N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC), 6-aminohexanoic acid (AHEX or AHA), substituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, and substituted or unsubstituted C2-C10 alkynyl. In certain such embodiments, a substituent group is selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain such embodiments, the compound comprises a modified oligonucleotide having one or more stabilizing groups that are ed to one or both termini of a modified oligonucleotide to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal ations protect a modified oligonucleotide from lease degradation, and can help in delivery and/or localization Within a cell. The cap can be present at the '—terminus (5'—cap), or at the 3'—terminus (3'—cap), or can be present on both termini. Cap structures include, for example, inverted deoxy abasic caps.

Suitable cap structures include a 4',5'—methylene nucleotide, a 1-(beta-D-erythrofuranosyl) nucleotide, a o nucleotide, a yclic tide, a 1,5 -anhydrohexitol nucleotide, an L- nucleotide, an alpha-nucleotide, a modified base tide, a phosphorodithioate linkage, a threo- pentofuranosyl nucleotide, an c seco nucleotide, an acyclic 3,4-dihydroxybutyl nucleotide, an acyclic 3,5-dihydroxypentyl nucleotide, a 3'—3'—inverted nucleotide moiety, a 3'—3'—inverted abasic moiety, a 3'—2'—inverted nucleotide moiety, a 3'-2'—inverted abasic moiety, a 1,4-butanediol phosphate, a 3'-phosphoramidate, a hexylphosphate, an aminohexyl phosphate, a 3'—phosphate, a 3'- phosphorothioate, a phosphorodithioate, a bridging methylphosphonate , and a non-bridging methylphosphonate moiety 5'—amino-alkyl phosphate, a 1,3-diaminopropyl phosphate, 3- aminopropyl phosphate, a 6-aminohexyl phosphate, a inododecyl phosphate, a hydroxypropyl phosphate, a 5'—5'—inverted nucleotide moiety, a 5'—5'—inverted abasic moiety, a 5'—phosphoramidate, a '—phosphorothioate, a 5'—amino, a bridging and/or non-bridging 5'—phosphoramidate, a orothioate, and a 5'—mercapto moiety.

Certain onal Therapies Treatments for a disease associated with miR-21 may comprise more than one therapy. As such, in certain ments ed herein are methods for treating a subject having or suspected of having a disease associated with miR-21 comprising administering at least one therapy in addition to administering a modified oligonucleotide having a nucleobase sequence complementary to the microRNA.

In certain embodiments, the at least one additional therapy comprises a pharmaceutical agent.

In certain embodiments, pharmaceutical agents include anti-inflammatory agents. In certain embodiments, an anti-inflammatory agent is a steroidal anti-inflammatory agent. In certain embodiments, a steroid nflammatory agent is a corticosteroid. In certain embodiments, a corticosteroid is prednisone. In certain embodiments, an anti-inflammatory agent is a eroidal anti-inflammatory drugs. In certain embodiments, a non-steroidal anti-inflammatory agent is ibuprofen, a COX-I inhibitor, or a COX-2 inhibitor.

In certain embodiments, pharmaceutical agents include anti-diabetic agents. Antidiabetic agents include, but are not limited to, biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones.

In certain embodiments, pharmaceutical agents e, but are not limited to, diuretics (e.g. sprionolactone, eplerenone, furosemide), inotropes (e.g. dobutamine, milrinone), digoxin, vasodilators, ensin II ting enzyme (ACE) tors (e.g. are captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril), angiotensin II receptor blockers (ARB) (e.g. candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan, eprosartan), calcium channel blockers, isosorbide dinitrate, hydralazine, nitrates (e.g. isosorbide mononitrate, isosorbide dinitrate), hydralazine, beta-blockers (e.g. carvedilol, metoprolol), and natriuretic peptides (e.g. nesiritide).

In certain embodiments, pharmaceutical agents include heparinoids. In certain embodiments, a heparinoid is pentosan lfate.

In certain embodiments, a pharmaceutical agent is a ceutical agent that blocks one or more responses to fibrogenic signals.

In certain embodiments, a pharmaceutical agent is an anti-connective tissue grth factor therapy. In certain embodiments, an anti-CTGF y is a monoclonal antibody t CTGF.

In certain ments, an additional therapy may be a pharmaceutical agent that enhances the body's immune system, including low-dose cyclophosphamide, thymostimulin, vitamins and nutritional supplements (e.g., antioxidants, including vitamins A, C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q-lO and echinacea), and vaccines, e.g., the immunostimulating x (ISCOM), Which ses a vaccine formulation that combines a multimeric presentation of n and an adjuvant.

In certain embodiments, the additional therapy is ed to treat or ameliorate a side effect of one or more pharmaceutical itions of the present invention. Such side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.

For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

Further examples of additional pharmaceutical agents e, but are not limited to, globulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); salicylates; antibiotics; antivirals; antifungal agents; adrenergic ers; hormones (e.g., anabolic steroids, androgen, en, onin, tin, somatostan, and thyroid hormones); modulators; muscle relaxants; antihistamines; osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens); prostaglandins, oplastic agents; psychotherapeutic agents; ves; poison oak or poison sumac products; antibodies; and vaccines.

Certain Kits The present invention also provides kits. In some embodiments, the kits comprise one or more compounds of the invention comprising a modified oligonucleotide, wherein the nucleobase sequence of the oligonucleotide is complementary to the nucleobase sequence of miR-21. The compounds complementary to miR-21 can have any of the nucleoside ns described . In some embodiments, the compounds complementary to miR-21 can be present within a vial. A plurality of vials, such as 10, can be present in, for example, sing packs. In some embodiments, the vial is ctured so as to be accessible with a syringe. The kit can also contain instructions for using the compounds complementary to miR-21.

In some embodiments, the kits may be used for administration of the compound complementary to miR-21 to a subject. In such instances, in addition to nds complementary to miR-Zl, the kit can further comprise one or more of the following: syringe, alcohol swab, cotton ball, and/or gauze pad. In some embodiments, the compounds complementary to miR-21 can be present in a pre-filled syringe (such as a single-dose syringes with, for example, a 27 gauge, 1/2 inch needle with a needle guard), rather than in a vial. A plurality of lled syringes, such as 10, can be present in, for example, dispensing packs. The kit can also contain instructions for administering the compounds complementary to miR-21.

Certain Experimental Models In n embodiments, the present invention provides methods of using and/or testing modified oligonucleotides of the present invention in an experimental model. Those having skill in the art are able to select and modify the protocols for such experimental models to evaluate a pharmaceutical agent of the invention.

Generally, d oligonucleotides are first tested in cultured cells. Suitable cell types include those that are related to the cell type to which delivery of a modified oligonucleotide is desired in vivo. For example, suitable cell types for the study of the methods described herein include primary or cultured cells.

In certain embodiments, the extent to which a modified oligonucleotide interferes with the ty of miR-21 is assessed in cultured cells. In certain embodiments, inhibition of NA activity may be assessed by measuring the levels of the microRNA. Alternatively, the level of a predicted or validated NA-regulated transcript may be measured. An inhibition of NA ty may result in the increase in the miRregulated transcript, and/or the protein d by miR-Zl-regulated transcript. Further, in certain ments, certain phenotypic outcomes may be measured.

Several animal models are available to the skilled artisan for the study of miR-21 in models of human disease. For example, inhibitors of miR-21 may be studied in models of cancer, such as orthotopic xenograft models, toxin-induced cancer models, or cally-induced cancer models. In such cancer models, the studies may be performed to evaluate the s of inhibitors of miR-21 on tumor size, tumor , overall al and/or progression-free survival.

The effects of inhibitors of miR-21 on cardiac function and s may be studied in models of transaortic banding or myocardial infarction, each of which induces abnormal cardiac function and fibrosis. Models of kidney fibrosis include unilateral ureteral obstruction and ischemia/reperfusion injury. During early time points, the kidney ischemia reperfusion injury model may be used as a model for acute kidney , while later time points serve as a model for kidney fibrosis. Liver fibrosis models are induced by, for example, carbon tetrachloride intoxication or bile duct resection. The effects of miR-21 on lung fibrosis may be studied, for example, in a model of bleomycin-induced pulmonary fibrosis. Wound g models are also available to the skilled artisan, for example the C57Bl/KsJ-db/db mice, which exhibit several characteristics of adult onset diabetes, such as markedly delayed wound e.

Certain Quantitation Assays The s of antisense inhibition of miR-21 following the administration of modified oligonucleotides may be assessed by a variety of methods known in the art. In certain embodiments, these methods are be used to quantitate microRNA levels in cells or tissues in vitro or in vivo. In certain embodiments, changes in microRNA levels are measured by microarray analysis. In certain embodiments, changes in microRNA levels are measured by one of several commercially available PCR assays, such as the TaqMan® MicroRNA Assay (Applied Biosystems). In certain embodiments, antisense inhibition of miR-21 is assessed by measuring the mRNA and/or protein level of a target of miR-2l. Antisense inhibition of miR-2l generally results in the increase in the level ofmRNA and/or n of a target of the microRNA.

Target ment Assay Modulation of microRNA activity with an anti-miR or microRNA mimic may be assessed by measuring target engagement. In certain embodiments, target engagement is ed by microarray ng of mRNAs. The sequences of the mRNAs that are modulated (either increased or decreased) by the anti-miR or microRNA mimic are searched for microRNA seed sequences, to e modulation of mRNAs that are targets of the microRNA to modulation of mRNAs that are not targets of the microRNA. In this manner, the interaction of the anti-miR with miR-2l, or miR-2l mimic with its targets, can be evaluated. In the case of an anti-miR, mRNAs whose expression levels are increased are screened for the mRNA sequences that se a seed match to the microRNA to which the anti-miR is complementary.

EXAMPLES The following examples are ted in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention.

Those of ordinary skill in the art will readily adopt the underlying principles of this discovery to design various compounds without departing from the spirit of the current invention.

Example 1: In vitro screening of anti-miR-Zl compounds s anti-miRs targeted to miR-21 and comprising cEt nucleosides were evaluated for their tory effects on miR-2l activity. As shown in Table A, these compounds varied in length and in number, type and placement of d nucleosides. 25919 comprises 2’-MOE and 2’-fluoro nucleosides and is known to inhibit miR-2l, and was thus included as a positive control. The remaining compounds comprise cEt nucleosides in combination with 2’-MOE nucleosides and/or BD-deoxyribonucleosides.

Table A: anti-miR-Zl compounds Compound # ce and chemistry (5’ to 3’) SEQ ID NO 259 19 AFCFAFUFCFAFGFUFCEUEGEAFUFAFAFGFCFUEAE 4 25067 TCWCASAeCAsTSCAGSTSCTGASTAAGSSCTAS V eCEAEAECSAETECSAEGETEC 25068 TE STEGEAEUSAEAEGECSTEAE 25070 AECSATCSAGTCSTGAUSAAGCSTAE 25071 Aem'eCAsTeCAGgTeCTGASTASAGseCTAe 25072 AECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE 25077 WO 48952 25082 TEMSCAACSATCSAGTCSTGAUSAAGCSTAE 4 25731 ACTe eCeAeGeTe eCeTeGsASTeASASGe eCeUsAS 5 In the preceding Table A, nucleosides not followed by a subscript indicate B-D- deoxyribonucleosides. Nucleosides followed by a ipt “E” indicate 2’-MOE nucleosides.

Nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Nucleosides followed by a subscript “F” te 2’-fluoro nucleosides. Each ucleoside linkage is a orothioate internucleoside e. Superscript “Me” indicates a 5-methyl group on the pyrimidine base of the nucleoside.

The compounds were assessed for miR-21 inhibitory activity in a luciferase assay. A microRNA luciferase sensor construct was engineered using pGL3-MCSZ (Promega). The construct was uced into Hela cells to test the ability of anti-miR compounds to inhibit activity of miR-21.

In this assay, miR-21 present in the Hela cells binds to its cognate site(s) in the luciferase sensor construct, and sses luciferase expression. When the riate anti-miR is introduced into the cells, it binds to miR-2l and relieves suppression of luciferase expression. Thus, in this assay anti- miRs that are effective inhibitors of miR-2l expression will cause an increase in luciferase expression.

M:Hela cells (ATCC), stably transfected with a luciferase construct engineered to contain a sequence complementary of miR-21, were seeded in T-l70 flasks (BD Falcon) at 3.5 *106 cells/flask. Hela cells were grown in Dulbecco’s Modified Eagle Medium with High Glucose (Invitrogen).

D_afi: Each flask of Hela cells was transfected with 0.5ug of a thL sensor plasmid (Promega) expressing Renilla to be used in normalization. Hela cells were transfected using 20ul Lipofectamine 2000/flask (Invitrogen). After 4 hours of transfection, cells were washed with PBS and trypsinized. Hela cells were plated at 40k/well in 24 well plates (BD Falcon) and left overnight.

M3: Hela cells were transfected with anti-miRs using Lipofectin (Invitrogen) at 2.5ul Lipofectin/lOOnM ASO/ml Opti-MEM I Reduced Serum Medium (Invitrogen) for 4 hours. After ASO ection, Hela cells were refed with Dulbecco’s ed Eagle Medium with High Glucose (Invitrogen).

D_afi: Hela cells are passively lysed and luciferase ty measured using the Dual- Luciferase Reporter Assay System (Promega).

The luciferase assay was performed to test the ability of anti-miRs with the nucleoside patterns described herein to t the activity of miR-2 1. Results were compared to a ‘mock’ treatment, in which cells received no anti-miR treatment. The ment was repeated and results of two experimental replicates are shown in the following Table B, as the luciferase value normalized to alactosidase activity.

Table B: Inhibitory activity of anti-miR-21 compounds Concentration of Oli_onucleotide Treatment 500nM 100nM 20nM .8nM .16nM 40 47 33 45 25919 171 114 Iz- 53 40 25067 30 41 23 38 25068 97 86 m- 54 45 25070 165 132 128 99 87 65 25071 42 53 63 50 36 48 25072 143 115 86 76 49 40 25077 40 42 33 45 33 34 25082 202 176 147 112 89 70 25731 59 38 39 32 45 34 AS rated in Table B, several cEt-containing compounds demonstrated inhibition of miR- 21 in a dose-dependent : 25068, 25070, 25072, and 25082.

Example 2: Modified nucleoside variations of anti-miR-21 compound 25070 AS shown in the preceding Example, 25070 is a potent inhibitor of miR-21 ty in the luciferase assay. To te changes in the type of modified nucleoside at various positions of 25070, additional anti-miR-Zl compounds were ed as shown in Table C.

Table C: Additional anti-miR-21 compounds Reference Sequence and Chemistry (5’ to 3’) Variation relative to 25070 25070 AECSATCSAGTCSTGAUSAAGCSTAE (SEQ ID NO: 3) None AE'WCSATeCsAGTeCSTGATsAAGeCSTAE Each ne is a 5-methyl SEQ ID NO: 3 c osine 3’-terminal nucleoside is a AECSATCSAGTCSTGAUSAAGCSTAS (SEQ ID NO: 3) cEt nucleoside rather than 2’-MOE nucleoside 3’-terminal nucleoside is a cEt nucleoside rather than ATMeCSAGTMeCSTGATSAAGMSCSTAS 2’-MOE nucleoside and (SEQ ID NO: 3) each cytosine is a 5-methyl cytosine Each non-bicyclic nucleoside is a 2’-MOE AE MeCSAETEMSCSAEGETEMSCSTEGEAEMeTSAEAEGEMeCSTEAE nucleoside and each each (SEQ ID NO: 3) cytosine is a 5-methyl c osine Each non-bicyclic nucleoside is a 2’-MOE AEMeCLAETEMSCLAEGETEMSCLTEGEAEMSTLAEAEGEMSCLTEAE side and each each (SEQ ID NO: 3) cytosine is a 5-methyl c osine In the preceding Table F, nucleosides not followed by a subscript indicate B-D- deoxyribonucleosides. Nucleosides followed by a subscript “E” indicate 2’-MOE nucleosides.

Nucleosides followed by a subscript “S” indicate S-cEt nucleosides. Nucleosides followed by a subscript “F” indicate 2’-fluoro sides. Each intemucleoside linkage is a phosphorothioate internucleoside linkage. Superscript “Me” indicates a 5-methyl group on the dine base of the nucleoside.

The rase assay was performed as described herein to test the ability of iRs in Table F to inhibit the actiVity of miR-21. Results were compared to a ‘mock’ treatment, in which cells received no anti-miR treatment. The ment was repeated and results of two experimental replicates are shown in the following Table D, as fold change in rase value relative to the mock treatment.

Table D: Luciferase assay g various anti-miR-21 compounds Concentration of anti-miR compound Treatment 25070 1.04 8.81 1.02 .18 1.06 7.80 1.37 1.25 1.10 2.47 1.06 0.98 1.06 3.64 1.05 As illustrated in Table D, several cEt-containing nds demonstrated inhibition of miR-21 in a dose-dependent manner, in addition to 25 070: 25922, 25923, and 25924. The anti-miR- 21 compounds 25116 and 25117, each of which has a sugar modification at each nucleoside, where each ne is a 5-methylcytosine, were not effective inhibitors of miR-2 1.

Example 3: Comparison of nucleoside patterns conferring activity to anti-miR-21 compounds To ine the relationship amongst the nucleoside patterns that conferred activity to anti- miR-Zl compounds, the placement of modified and unmodified nucleosides was compared across the active anti-miR-21 compounds, which are shown in Table E.

Table E: Active cEt-containing anti-miR-21 compounds Corresponding Row in Table Compound # Sequence and Chemistry (5’ to 3’) ID below NO \lONUI-PUJNH 25068 TEeCEAEAECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE 4 25070 AECSATCSAGTCSTGAUSAAGCSTAE 25072 AECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE 25082 TEeCAACsATCSAGTCSTGAUSAAGCSTAE 25922 AEMSCSATMSCSAGTMGCSTGATSAAGMSCSTAE 25923 AECSATCSAGTCSTGAUSAAGCSTAS 25924 AEMSCSATMSCSAGTMSCSTGATSAAGMSCSTAS 3 m6 6 m0 6% fico Ellflfiiflfllllflfllli m< < < < < < < m: 5 HZmEL<m aims—fins mDADOmm wiifiacoémo >3on Ema m0 6% mo 9% K 952w ac 8302052 8.585: m0 8:32 Aoammoodmmv ”m QdeBRNEmabomm The comparison of the placement of modified and unmodified nucleosides (Table F above) revealed certain nucleoside patterns that were common to each highly active anti-miR-2l compound.

For example, a comparison of the structure at the 5’-terminus of each compound revealed a region that ranges in length from 1 to 4 nucleosides, each of which is non-bicyclic nucleoside (Column ‘R’ in Table G below). The next region has one bicyclic nucleoside, followed by two non-bicyclic nucleosides, ed by one bicyclic nucleoside (Column ‘1’ in Table G below).

Next follows a repeating block of four nucleosides, three non-bicyclic sides followed by one bicyclic nucleoside, and this block of four nucleosides occurs a total of three times (Column ‘2’ in Table G below).

In each active anti-miR-21 the two 3’-terminal nucleosides are non-bicyclic nucleosides (Column ‘T’ in Table G below).

Table G: Nucleoside pattern structure Nucleoside NQ B Q Q B N _N "N "N (N 'N 'N -NQ Q Q B)3 Q Z N -N Length of 1 to4 This nucleoside pattern is represented by the following formula I, in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3- NQ—NZ wherein each R is a cyclic nucleoside; X is from 0 to 4; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and each NZ is a d side.

This formula encompasses each of the nucleoside patterns of the active anti-miR-2l compounds 25068, 25070, 25072, 25082, 25922, 25923, and 25924, demonstrating that nucleoside pattern 1 yields an active anti-miR activity, with a flexibility allowed in the choice of bicyclic side, non-bicyclic side, and modified side. ingly, ed herein are compositions comprising modified oligonucleotides having base complementarity to miR-21 and a nucleoside pattern described by formula I.

To determine the relationship amongst the nucleoside patterns that conferred activity to the active anti-miR-2l compounds that are 19 linked nucleosides in length, the placement of modified and unmodified nucleosides was compared across all of the highly active compounds, which are shown in WO 48952 Table H. To illustrate the similar placement of certain nucleosides, the compounds are shown again in Table I.

Table H: Active iR-Zl compounds ponding Sequence and Chemistry (5’ to 3’) Row in Table I Compound # AECSATCSAGTCSTGAUSAAGCSTAE 25922 AEMCCSATM"CSAGTMCCSTGATSAAGMCCSTAE 25923 AECSATCSAGTCSTGAUSAAGCSTAS 25924 ATM"CSAGTMeCsTGATsAAGMeCSTAS 25072 AECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE A T MeCsA G T MeCsT G A A T G A The comparison of the placement of modified and unmodified nucleosides (Table 1 above) revealed certain nucleoside patterns that were common to each highly active anti-miR-21 compound that is 19 linked sides in length.

For example, a comparison of the structures at the 5’-terminus of each compound revealed one modified nucleoside, which is not a bicyclic nucleoside (Column ‘NM’ in Table J below). The next region has one bicyclic nucleoside, ed by two non-bicyclic nucleosides, followed by one bicyclic nucleoside (Column ‘1’ in Table J below).

Next follows a repeating block of four nucleosides, three non-bicyclic nucleosides ed by one bicyclic nucleoside, and this block of four nucleosides occurs a total of three times (Column ‘2’ in Table J below).

In each active anti-miR-21 the next-to-last nucleoside at the 3’-terminus is an unmodified nucleoside (Column ‘N’ in Table J below). The nucleoside at the 3’ terminus, which is complementary to the base at position 1 of miR-21, is a modified nucleoside (Column ‘NZ’ in Table J below).

Table J: side Pattern Similarities Nucleoside Type This nucleoside n is represented by the following formula 11, in the 5’ to 3’ orientation: NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein NM is a modified side that is not a bicyclic nucleoside; each NB is a bicyclic nucleoside; each NQ is a non-bicyclic nucleoside; and NZ is a modified nucleoside.

The data provided herein demonstrate that this nucleoside pattern confers activity to an anti- miR-21 compound, and further that the activity of the compound is ined with a variety of modified nucleosides. Accordingly, provided herein are compositions comprising a d oligonucleotide having a nucleobase sequence complementary to miR-21 and a nucleoside pattern of formula 11. r analyses were conducted with the group of anti-miR-21 compounds, include 25211 and 25220. As a result of the foregoing analyses, formulas 111 to V were established.

Example 2: Inhibition of miR-21 in a model of kidney fibrosis Unilateral ureteral ction (UUO) is a well-established experimental model of renal injury leading to interstitial fibrosis, and thus is used as an experimental model that is reflective of human kidney disease. UUO is induced by surgically ligating a single ureter. As fibrosis is characterized by an increase in collagen, the ce and extent of kidney fibrosis may be determined by measuring collagen content. Both en 1A1 (Col 1A1) and collagen 3A1 (Col 3A1) are measured to assess collagen content. Kidney fibrosis may be ized by staining tissue samples with picro-sirius red to detect increases in collagen content. Kidney fibrosis may also be observed by measuring the amount of hydroxyproline, which is a major component of collagen, in a sample.

The cEt—containing anti-miR-21 compounds found to be active in the luciferase assay were tested in in the UUO model of kidney fibrosis. 25919 sing 2’-MOE and ro modifications is known to inhibit miR-21 activity in vivo and was included as a positive control. Groups of 8 animals each were treated as follows: UUO only, UUO with PBS, or UUO with anti-miR-21 compound. Relative to the day of the UUO procedure, PBS or anti-miR-21 compound was administered at days -3, -1, and +5. iR-21 compounds were administered at a dose of 20 mg/kg. As the anti-miR compounds were administered prior to the UUO procedure, this dosing regimen is considered a prophylactic treatment. At day 11, animals were sacrificed and kidney was isolated for measurement of collagen expression.

Collagen expression was ed by real-time PCR and normalized first to GAPDH and then to the sham control animals. Collagen 1A1 and collagen 3A1 sion are shown in Table K below.

Table K: Several anti-miR—Zl compounds reduce collagen expression in the UUO model Collagen 1A1 Collagen 3A1 Treatment Animal (Normalized Mean lized Mean Group # Expression) Expression) WNt—‘OOQ@M-hUJNt—QQUIkWNl—‘OOQQUI-hWNl—‘OOQQUI-hWNH 0.5 Sham 96.9 108.4 115.0 102.0 UUO-PBS 103.1 144.5 134.3 115.0 84.7 75.1 85.5 UUO-25068 89.1 90.4 125.8 124.4 67.7 97.7 88.8 95.9 UUO-25070 71.4 44.5 73.0 109.4 96.2 69.4 UUO-25072 85.7 113.8 54.5 65.5 127.4 58.8 4 100.0 69.2 159.2 93.8 6 120.5 65.8 7 108.0 46.9 1 122.2 62.9 2 188.3 78.9 3 102.5 82.2 4 67.6 43.8 UUO-25082 91.7 59.1 40.6 32.6 6 44.1 34.3 7 73.8 75.8 8 94.7 62.5 1 150.2 2 54.2 3 84.6 4 67.7 UUO-25919 78.7 6 62.2 7 89.2 8 106.2 This study was repeated 2 to 3 times with each of the above treatment . A meta-analysis of the studies revealed that 25070 treatment exhibited the st potency as judged by collagen expression, resulting in a 40% inhibition of collagen 1A1 and a 30% inhibition of collagen 3A1. 25068 was also active in reducing collagen expression, but to a lesser extent than 25070. 25072 and 25082, while active inhibitors of miR-21 in the in vitro tests described herein, did not consistently demonstrate a reduction in collagen expression.

The UUO study was repeated to confirm the ty of 25070. The anti-miR was administered subcutaneously at a dose of 20 mg/kg. The results in Table L below confirm that 25070 is a potent tor of collagen 1A1 and collagen 3A1 expression.

Table L: Prophylactic administration of 25070 reduces collagen expression in the UUO model en Collagen . 1A1 3A 1 Treatment An1mal Mean Mean (Normalized (Normalized Expression) Expression) UUO-25070 20 mg/kg SC OO\]O\UIJ>UJN'—‘OO\]O\UIJ> The comparison of the UUO studies revealed 25070 as a highly potent inhibitor of collagen expression in the UUO model, thus 25 070 is a candidate therapeutic agent for the treatment of fibrosis, ing kidney fibrosis.

Example 3: Comparison of anti-miR—Zl to an angiotensin receptor blocker The ensin receptor blocker irbesartan has been shown to block the formation of tubulointerstitial fibrosis in a model of chronic renal injury terized by fibrosis. The effects of 25070 were compared to irbesartan in the UUO model of fibrosis.

Control ent groups included UUO only (sham) and UUO with PBS administered subcutaneously. An additional control group included UUO with Tween-MC/20 carrier perorally. 25070 administered subcutaneously at dose of 20 mg/kg at 5 days prior to, 2 days prior to, and 3 days after, the UUO procedure. lrbesartan was administered perorally on daily on days 0 h 7 following the UUO procedure. Animals were sacrificed on Day 10 following the UUO procedure. Kidney tissue was collected for ement of collagen 1A1 and en 3A1 expression. The results are shown in Table M below, and illustrate a statistically significant ion (p < .05 by one-way ANOVA) in CollAl expression in the 25 070-treated animals, relative to saline-treated s. lrbesartan did not yield a statistically significant reduction in CollAl expression. Both irbesartan and 25 070 produced statistically significant reductions in Col3a1 expression, with 25070 producing a greater reduction compared to irbesartan. 2012/034880 Table M: 25070 reduces collagen expression to a greater extent than irbesartan in the UUO model Collagen 1A1 en 3A1 Animal # (Normalized lized Expression) Expression) UUO-PBS (s.c.) UUO+25070 (20 mg/kg s.c.) een/MC vehicle (PO) (no sample) UUO-Irbesartan (PO) OO\]O\UI.50)Nl—‘OOQQUIhWNl—‘OOQQM-hWNl—‘OOQQM-RWNl—‘JkWNH An additional indicator of fibrosis is the percentage of kidney tissue that exhibits collagen expression following the UUO procedure. Accordingly, kidney tissue was also collected for histological analysis, to assess the fraction of kidney tissue that exhibits increased collagen expression; the results are in Table N below. The gen area fraction’ is measured histologically through quantitative image processing of the area of kidney tissue that is stained red by the picrosirius red stain; the percent detected as red is ized by the area of kidney section. As the tissue sections were analyzed in a blinded fashion, While the s in Tables M and N are from the same study, the numbering of the samples in Table N below does not necessarily correspond to the numbering of samples in Table M above.

Table N: 25070 reduces collagen expression to a greater extent than irbesartan in the UUO model (not the Collagen same as Area Group Mean numbers Fraction as PCR) (%) 1.419 1.178 1.675 12.988 17.691 12.55 9.99 8.828 ‘ n9394 9.491 1 7.632 9.937 8.015 UUo+25070 6.611 (20 mg/kgs.c.) 6.319 ‘ n11.272 6.803 7.405 1 10.587 8.499 11.339 UUO- 3244 Tween/MC 8.0 2954 vehicle (PO) n8.748 n 9.29 6.105 7.481 .877 UUO- 7.914 Irbesartan (PO) 6.614 ' n5.706 7.798 -_ 6.154 These results demonstrate that inhibition of miR-21 with 25070 inhibits en expression with r activity than irbesartan, r confirming that 25070 is a candidate agent for the treatment, tion and/or amelioration of fibrosis.

Example 4: Inhibition of miR-Zl in model of ischemia/reperfusion injury A model of ischemia reperfusion injury (1R1) is d in the mouse through unilateral or bilateral clamping of kidney arteries, which leads to tubule damage, inflammation, and s. Kidney dysfunction can occur either early (<5 days) or late (>7 days) in this model, with the early time points useful to test candidate agents for the treatment of acute kidney injury, and the later time points useful to model chronic s.

Anti-miR-21 compounds were tested in the eral 1R1 model. Unilateral 1R1 was induced for a period of 30 minutes. Treatment groups were as follows: sham 1R1 procedure; 1R1 with PBS administered subcutaneously; 1R1 with anti-miR-21 compound 25070 administered intraperitoneally at a dose of 20 mg/kg; the 2’-fluoro/2’-MOE modified anti-miR-21 25919 administered intraperitoneally at a dose of 20 mg/kg; and a 2’-fluoro/2’ modified mismatch iR-21 (haVing three mismatches to the sequence of ) 25319 administered intraperitoneally at a dose of 20 mg/kg. PBS or anti-miR compound was administered on days 5, 6, and 7 following 1R1, and animals were sacrificed 14 days after 1R1. As anti-miR compound is administered 5 days following the injury to the kidney, or later, when fibrosis has already occurred to some extent, this treatment regimen is considered a therapeutic regimen, rather than a prophylactic regimen.

Kidney tissue was collected for analysis of collagen 1A1 and collagen 3A1 expression (shown in Table 0), and collagen area fraction (shown in Table P). The ‘collagen area on’ was analyzed in a blinded fashion, while the samples in Tables 0 and P are from the same study, the ing of the samples in Table 0 does not correspond to the numbering of samples in Table P. A sample processing error prevented collagen area fraction from being analyzed for the anti-miR-21 mismatch control treatment, thus results for this treatment group are presented only for collagen 1A1 and collagen 3A1 sion. In this study, 25070 produced a statistically significant reduction in colleen area fraction.

Table 0: 25070 reduces collagen expression in the IRI model with dosing on days 5, 6, and 7 Collagen lAl Collagen 3A1 (Normalized (Normalized Expression) Expression) 3 0.7 0.7 4 0.7 0.7 1.0 0.7 0.7 0.9 7 0.9 1.0 1.3 1.3 1 83.5 64.9 34.8 29.4 79.0 61.9 IRI-PBS 4 74.5 85.1 46.6 63.9 102.3 61.9 n 128.6 99.5 92.9 82.8 11111135319 79.3 IRI-25919 59.9 IRI-25070 34.2 Table P: 25070 reduces collagen area fraction in the IRI model with dosing on days 5, 6, and 7 Animal (not en Area same as Fraction (#) PCR) IRI-259l9 IRI-25070 A similar study was med with the same treatment groups and onal days of treatment.

In this study, treatments were administered intraperitoneally at days 5, 6, 7, 14, and 21 ing the 1R1 procedure. Animals were sacrificed on Day 27, and kidney tissue was collected for analysis of collagen 1A1 and collagen 3A1 expression, as well as en area fraction. The ‘collagen area fraction’ was analyzed in a blinded fashion, while the samples in Tables Q and R from the same study, the numbering of the samples in Table Q below does not correspond to the numbering of samples in Table R. In this study, 25070 produced a statistically significant reduction in collagen area fraction.

Table Q: 25070 reduces collagen expression in the IRI model with dosing on days 5, 6, 7, 14, and Collagen 1A1 Collagen 3A 1 Animal Group (Normalized Mean (Normalized Mean Expression) Expression) WO 48952 PCT/U82012/034880 1.1 1.1 6 0.8 -_ 7 0.8 -m_ 1 44.8 33.4 2 38.7 3 4.7 IRI-PBS 4 44.3 47.1 29.8 26.7 6 55.6 7 115.2 1213.53)” 4 44.2 1 26.4 2 37.4 3 41.9 4 36.8 IRI-25070 31.4 20.8 141 6 27.7 7 29.4 8 37.6 23.1 Table R: 25070 reduces collagen area fraction in the IRI model with dosing on days 5, 6, 7, 14, and 21 Animal (not Collagen Area Group same as PCR) Fraction (#) l . l 95 Sham .431 13.394 IRI-PBS IRI-253 19 (MM) IRI-25919 IRI-25070 These studies demonstrate a reduction in collagen content following inhibition of miR-21 in a model of acute kidney injury. Thus, the anti-miR-21 compound 25070 is a therapeutic agent for the treatment of acute kidney injury. For example, preventing or delaying the onset of fibrosis ing acute kidney injury may prevent or delay the onset of chronic kidney disease.

In order to assess the flexibility of administration of the anti-miR-21 compound 25 070, the ty of the compound in the 14 day study above, where anti-miR-21 was administered at days 3, 5, and 7 following the 1R1 procedure, to a different 14 day study where anti-miR-21 was administered intraperitoneally at days 3, 5, and 7 ing the 1R1 procedure. The data in Table S demonstrate that similar inhibition of collagen expression was observed in either study, indicating that the dosing schedule can be flexible. The fold change in en 1A1 or collagen 3A1 expression, relative to sham animals is shown in Table S, and rates the statistically significant ion of collagen expression with either dosing schedule.

Table S: 25070 decreases collagen expression in the IRI model with dosing on days 3, 5, and 7 Collagen 1A 1 Collagen 3A 1 (Normalized lized Mean Expression) Expression) 2 Ol—‘l—‘O \iwwxo p— O l—‘l— NN 1.0 w >1 Ox 39.6 25070 ‘- 27'9 (Day 3,5,7) fl \O J; \O U} 25070 26.2 (Day 5,6,7) 7 \0 \l Example 5: Inhibition of miR—21 in an ischemia reperfusion injury / nephrectomy model An ischemia reperfusion injury/nephrectomy (IR/Nx) model is created in the mouse through temporary unilateral clamping of an artery in one , which leads to tubule damage, inflammation, and fibrosis, followed by removal of the second kidney at a later timepoint. In this model, the acute kidney dysfunction phase is useful to test candidate agents for the treatment of acute kidney injury (i.e. up to about the first 5 days), and the later phases of kidney dysfunction are useful to model chronic fibrosis (i.e. after about the first 5 days).

Anti-miR—21 compounds were tested in the IR/Nx model. 25109, a 6-base mismatch to miR-21, was used as a control compound (AEAsATCsTGTCsTCAUsAATAsAAE; where nucleosides not followed by a subscript indicate B-deoxynucleosides; nucleosides followed by a subscript “E” indicate 2’-MOE nucleosides; sides followed by a subscript “S” indicate S-cEt nucleosides; and all internucleoside es are phosphorothioate internucleoside es).

Unilateral IR was induced for a period of 30 minutes. Treatment groups were as follows: sham IR procedure; IR with PBS stered subcutaneously; IR with ched control 25109 administered subcutaneously at a dose of 20 mg/kg; IR with iR-21 compound 25070 administered subcutaneously at a dose of 20 mg/kg; and IR with anti-miR-21 compound 25923 administered subcutaneously at a dose of 20 mg/kg. PBS or anti-miR was administered on days 2, 3, 4, and 8 following IR. On day 8, the healthy kidney was removed by nephrectomy from each , and animals were sacrificed on day 9. Just prior to sacrifice, urine was collected by direct r puncture.

Urinary albumin to creatinine ratio was measured in the urine from each mouse. The results of that experiment are shown in Figure 1. In this study, both 25070 and 25923 ed statistically significant reductions in urinary albumin to creatinine ratio. The geometric mean of the n to creatinine ratio in each group of mice was 16 mgCr (nephrectomy-only control), 127 ugAlb/mgCr (IR/Nx, PBS control), 140 ugAlb/mgCr (IR/Nx, 25109 control), 40 ugAlb/mgCr (IR/Nx, 25070), and 31 ugAlb/mgCr (IR/Nx, 25923). Blood urea nitrogen and serum creatinine levels were similar across all IR/Nx mice, and were elevated relative to nephrectomy-only control mice (data not shown).

Example 6: Survival of IRMx model mice following administration of anti-miR—Zl nds The survival rate of IR/Nx model mice two days after nephrectomy was ined across six different experiments to determine if administration of anti-miR—21 compounds increases survival. In the first three experiments, anti-miR-21 compound was administered on days 5, 6, and 7 after ischemia reperfusion injury, and nephrectomy occurred on day 10 or day 11. In the second three experiments, 2012/034880 anti-miR-21 nd was administered on days 2, 3, and 4, and nephrecromy occurred on day 7. The rates of survival of the IR/Nx mice in each experiment are shown in Table T.

Table T: 25070 increases al rate of IR/Nx mice two days after nephrectomy.

Study Day ofNx Survival rate 2 days after Nx 25070 dose Day 10 30 mg/kg Summary (dale/lle) 55% (20/36) 80% ) 6 Day 7 66.7% 66.7% 20 mg/kg Summary (day7Nx) 52% (19/36) 69%(25/36) In the first three ments, in which nephrectomy ed on day 10 or day 11, the survival rate of PBS-treated mice was 55%, while the survival rate of 25070-treated mice was 80% (P=0.02 using a 1- sided Fisher’s Exact Test). In the second three experiments, in which nephrectomy occurred on day 7, the survival rate of PBS-treated mice was 52%, while the survival rate of 25070-treated mice was 69% (P=O.ll using a l-sided Fisher’s Exact Test).

Example 7: Design of additional anti-miR-Zl nds Following administration of compound 25070 to mice, it has been found that about 50% of the compound present in kidney tissue is lacking the 3’-terminal nucleoside by 7 days post-inj ection. The stability of 25070 and 25923 was ed in an ex vivo liver homogenate assay. In this assay, 5 uM of oligonucleotide was incubated in liver homogenate (50 mg tissue per ml) for 24 hours at 37 °C.

Following this incubation, oligonucleotide was extracted by Liquid-Liquid Extraction (LLE) followed by Solid-Phase Extraction (SPE). Oligonucleotide lengths and amounts were measure by high-performance liquid chromatography time-of—flight mass spectrometry (HPLC—TOF MS). Nuclease activity in the liver tissue nate was confirmed by using reference oligonucleotides, which included a compound with known resistance to nuclease activity, a compound susceptible to 3’-exonuclease activity, and a compound susceptible to endonuclease activity. An internal standard compound was used to l for extraction efficiency. In this assay, about 58% of compound 25070 is t as the full-length compound, and about 27% of compound 25070 lacks the 3’-terminal nucleoside. About 68% of compound 25923 is present as the full-length compound, and about 18% of the compound lacks the 3’- terminal nucleoside. onal compounds were designed, and these compounds were tested for for stability ex vivo and in vivo. Ex vivo was performed as describe above. For testing in vivo, compounds were administered to mice, kidney tissue was isolated, and the extraction and detection of compound was performed as for the ex vivo assay. Table U shows the structures for the compounds 25923, 25220 and 25221, and the results of the stability ements.

Table U: 25923, 25220 and 25221 ex vivo and in vivo stability Compound Structure ex vivo ) in vivo (kidney) Ill- AECSATCSAGTCSTGAUSAAGCsUsAs Compounds 25220 and 25221, as well as 25923, were tested in the UUO model for their effects on fibrosis. Groups of 8 s each were treated as follows: sham surgery, UUO with PBS, UUO with 25220, UUO with 25221, or UUO with 25923. Relative to the day of the UUO ure, PBS or anti- miR-21 compound was administered at days -5, -3, and +3. Anti-miR-21 nds were administered at a dose of 20 mg/kg. As the anti-miR compounds were administered prior to the UUO procedure, this dosing regimen is considered a prophylactic treatment. At day 10, animals were sacrificed and kidney was isolated for measurement of collagen expression. Collagen expression was measured by real-time PCR and normalized to GAPDH.

The s of that ment are shown in Figure 2. Collagen 1A1 and collagen 3A1 sion are shown in Figure 2A and 2B, respectively. Administration of compound 25220 or 25221 reduced collagen 1A1 and en 3A1 sion by a stastically significant amount (* = p < 0.05; ** = p < 0.01; *** = p < 0.001), as did administration of compound 25923.

Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference (including, but not limited to, journal articles, US. and non-U.S. patents, patent application publications, international patent application publications, 2012/034880 GENBANK® accession numbers, and the like) cited in the present application is specifically incorporated herein by reference in its entirety.

Claims (59)

We Claim:

1. A compound comprising a modified oligonucleotide ting of 16 to 22 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and n the modified oligonucleotide 5 comprises at least 16 contiguous nucleosides of the following nucleoside pattern I in the 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein each R is, independently, a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; 10 each NQ is, independently, a non-bicyclic nucleoside; and NZ is a ed nucleoside, and wherein (i) each ic side comprises a non-methylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a β-D-deoxyribonucleoside. 15

2. A compound comprising a modified oligonucleotide consisting of 16 to 19 linked nucleosides, wherein the nucleobase ce of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and n the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside pattern II in the 5’ to 3’ orientation: 20 NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NQ-NZ wherein NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and NZ is a modified nucleoside, and wherein 25 (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two cyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a oxyribonucleoside. (11018705_1):KZA

3. A compound comprising a modified oligonucleotide consisting of 16 to 19 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and wherein the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside pattern III in the 5 5’ to 3’ orientation: (R)X-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a ic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; 10 NY is a modified nucleoside or an fied nucleoside; and NZ is a modified nucleoside, and wherein (i) each bicyclic nucleoside comprises a non-methylated nucleobase, or (ii) no more than two cyclic nucleosides are ethoxyethyl nucleosides and each other non-bicyclic nucleoside is a β-D-deoxyribonucleoside. 15

4. A compound comprising a modified oligonucleotide consisting of 16 to 19 linked nucleosides, wherein the nucleobase ce of the modified ucleotide is complementary to miR-21 (SEQ ID NO: 1) and n the modified oligonucleotide comprises at least 16 contiguous nucleosides of the following nucleoside pattern IV in the 5’ to 3’ orientation: 20 NM-NB-NQ-NQ-NB-(NQ-NQ-NQ-NB)3-NY-NZ n NM is a modified nucleoside that is not a bicyclic nucleoside; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; NY is a modified nucleoside or an unmodified nucleoside; and 25 NZ is a modified nucleoside, and n (i) each bicyclic side comprises a thylated nucleobase, or (ii) no more than two non-bicyclic nucleosides are 2’-O-methoxyethyl nucleosides and each other non-bicyclic nucleoside is a β-D-deoxyribonucleoside.

5. The compound of any one of claims 1 to 4, wherein the modified oligonucleotide 30 comprises at least 17, at least 18, at least 19, at least 20, at least 21, or 22 contiguous nucleosides of nucleoside pattern I, II, III, or IV. (11018705_1):KZA

6. The compound of any one of the preceding claims, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary, is at least 95% mentary, or is 100% complementary to the nucleobase sequence of miR-21 (SEQ ID NO: 1). 5

7. The compound of any one of the ing claims wherein each ic nucleoside is independently selected from an LNA nucleoside, a cEt nucleoside, and an ENA nucleoside.

8. The compound of any one of claims 1 to 6, wherein each bicyclic nucleoside is an S-cEt nucleoside. 10

9. The compound of any one of claims 1 to 6, wherein each bicyclic nucleoside is an LNA nucleoside.

10. The compound of any one of the preceding claims wherein each non-bicyclic nucleoside is independently selected from a β-D-deoxyribonucleoside and a 2’-O- methoxyethyl nucleoside. 15

11. The compound of any one of claims 1 to 9 wherein each cyclic nucleoside is a β-D-deoxyribonucleoside.

12. The compound of any one of claims 1 to 9 wherein each non-bicyclic nucleoside is a 2’-O-methoxyethyl nucleoside.

13. The compound of any one of the preceding claims wherein the modified 20 oligonucleotide ts of 16, 17, 18, 19, 20, 21, or 22 linked nucleosides of side n I, II, III, or IV.

14. The compound of any one of claims 1 to 13 wherein at least one cytosine is a 5- methyl cytosine, or wherein each cytosine is a 5-methylcytosine. (11018705_1):KZA

15. The compound of claim 1 wherein: a. R consists of four linked nucleosides NR1-NR2-NR3-NR4, wherein NR1 is a 2’-O-methoxyethyl nucleoside and each of NR2-NR3-NR4 is a β-D-deoxyribonucleoside; each NB is an S-cEt side; 5 each NQ is a β-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside; b. each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and 10 NZ is a ethoxyethyl nucleoside; c. each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt side; each NQ is a 2’-O-methoxyethyl nucleoside; and NZ is a 2’-O-methoxyethyl nucleoside; 15 d. each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; e. each R is a 2’-O-methoxyethyl nucleoside; X is 1; 20 each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl side; or f. each R is a 2’-O-methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; 25 each NQ is a β-D-deoxyribonucleoside; and NZ is an LNA nucleoside. (11018705_1):KZA

16. The compound of claim 1, wherein the modified oligonucleotide has a structure selected from: TEMeCEAEAECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE, and TEMeCAACSATCSAGTCSTGAUSAAGCSTAE 5 wherein nucleosides not followed by a subscript are β-D-deoxyribonucleosides, nucleosides followed by a subscript “E” are 2’-MOE nucleosides, nucleosides followed by a subscript “S” are S-cEt nucleosides, and superscript “Me” indicates a 5-methyl group on the base of the nucleoside.

17. The compound of claim 2 wherein: 10 a. NM is a ethoxyethyl nucleoside; each NB is an S-cEt side; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside; b. NM is a 2’-O-methoxyethyl nucleoside; 15 each NB is an S-cEt nucleoside; each NQ is a 2’-O-methoxyethyl nucleoside; and NZ is a 2’-O-methoxyethyl nucleoside; c. NM is a ethoxyethyl nucleoside; each NB is an S-cEt nucleoside; 20 each NQ is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; d. NM is a 2’-O-methoxyethyl side; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and 25 NZ is a 2’-O-methoxyethyl side; or e. NM is a 2’-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an LNA nucleoside. (11018705_1):KZA

18. The nd of claim 2, wherein the modified oligonucleotide has a structure selected from: AECSATCSAGTCSTGAUSAAGCSTAE, AECSAETECSAEGETECSTEGEAEUSAEAEGECSTEAE, 5 AEMeCSATMeCSAGTMeCSTGATSAAGMeCSTAE, AECSATCSAGTCSTGAUSAAGCSTAS, and AEMeCSATMeCSAGTMeCSTGATSAAGMeCSTAS, wherein nucleosides not followed by a subscript are β-D-deoxyribonucleosides, nucleosides followed by a ipt “E” are 2’-MOEnucleosides, nucleosides followed 10 by a subscript “S” are S-cEt nucleosides, and superscript “Me” indicates a 5-methyl group on the base of the nucleoside.

19. The compound of claim 18, wherein the modified oligonucleotide has the structure: AECSATCSAGTCSTGAUSAAGCSTAE, 15 wherein nucleosides not ed by a subscript are β-D-deoxyribonucleosides, nucleosides followed by a subscript “E” are 2’-MOE sides, and nucleosides followed by a subscript “S” are S-cEt nucleosides.

20. The compound of claim 3 wherein: a. each R is a 2’-O-methoxyethyl nucleoside; X is 1; 20 each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is a 2’-O-methoxyethyl nucleoside; b. each R is a 2’-O-methoxyethyl nucleoside; X is 1; 25 each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; or c. each R is a 2’-O-methoxyethyl side; X is 1; 30 each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside. (11018705_1):KZA

21. The compound of claim 4 wherein: a. NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; 5 NY is a β-D-deoxyribonucleoside; NZ is a 2’-O-methoxyethyl nucleoside; and b. NM is a 2’-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; 10 NY is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; c. NM is a ethoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; 15 NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside.

22. The compound of any one of the preceding claims wherein the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3 or wherein the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 4, and wherein each T in the 20 sequence is independently selected from a T and a U.

23. The compound of any one of the preceding claims, n at least one internucleoside linkage is a modified internucleoside e, or wherein each internucleoside linkage is a modified ucleoside linkage, and wherein the modified internucleoside linkage is optionally a phosphorothioate internucleoside linkage. 25

24. A modified oligonucleotide having the structure: AECSATCSAGTCSTGAUSAAGCSTAE, n sides not followed by a subscript are oxyribonucleosides, nucleosides followed by a subscript “E” are 2’-MOE nucleosides, and nucleosides followed by a subscript “S” are S-cEtnucleosides; and wherein each internucleoside 30 e is a phosphorothioate linkage. (11018705_1):KZA

25. A pharmaceutical composition comprising the compound of any one of claims 1 to 23 or the modified oligonucleotide of claim 24 and a pharmaceutically acceptable carrier.

26. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide 5 of claim 24 in the manufacture of a medicament for inhibiting the activity of miR-21 in a cell, wherein the medicament is to be contacted to a cell.

27. The use of claim 26, wherein the cell is in vivo or wherein the cell is in vitro.

28. The use of claim 26 or 27 wherein the cell is a fibroblast cell, a hyperproliferative cell, a keratinocyte, or a hypoxic cell. 10

29. Use of a compound of any one of claims 1 to 23 or the modified ucleotide of claim 24 in the manufacture of a medicament for decreasing collagen expression in a cell, n the medicament is to be contacted to a cell.

30. Use of a nd of any one of claims 1 to 23 or the modified oligonucleotide of claim 24 in the manufacture of a medicament for treating, preventing or ng the 15 onset of a disease associated with miR-21 in a subject having a disease associated with miR-21, wherein the medicament is to be stered into the subject having a e associated with miR-21.

31. The use of claim 30, wherein the disease is fibrosis.

32. The use of claim 31, wherein the fibrosis is selected from kidney fibrosis, lung 20 fibrosis, liver fibrosis, cardiac is, skin fibrosis, age-related fibrosis, spleen fibrosis, scleroderma, and post-transplant fibrosis. (11018705_1):KZA

33. The use of claim 32 wherein: a. the kidney fibrosis is present in a subject having a e selected from glomerulosclerosis, tubulointerstitial fibrosis, IgA nephropathy, interstitial fibrosis/tubular atrophy; chronic kidney damage, glomerular disease, glomerulonephritis, diabetes 5 mellitus, idiopathy focal segmental glomerulosclerosis, membranous nephropathy, collapsing glomerulopathy, chronic recurrent kidney infection, and end stage renal disease; b. the kidney fibrosis results from acute or repetitive trauma to the kidney; c. the liver fibrosis is present in a subject having a disease ed from 10 chronic liver injury, hepatitis infection, non-alcoholic steatohepatitis, and cirrhosis; the pulmonary fibrosis is idiopathic pulmonary is; and/or d. the subject has chronic obstructive pulmonary disease.

34. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide of claim 24 in the manufacture of a medicament for treating a fibroproliferative disorder 15 in a subject, n the medicament is to be administered into the subject.

35. The use of any one of claims 30 to 34 sing selecting a subject having elevated miR-21 expression in one or more tissues.

36. The use of any one of claims 30 to 34 wherein the subject is in need of improved organ function, wherein the organ function is selected from cardiac function, pulmonary 20 function, liver function, and kidney function.

37. The use of any one of claims 30 to 36 wherein the stration improves organ on in the subject, wherein the organ on is selected from cardiac function, pulmonary function, liver on, and kidney function.

38. The use of any one of claims 30 to 37 wherein said treatment comprises 25 administration of at least one eutic agent selected from an anti-inflammatory agent, an immunosuppressive agent, an anti-diabetic agent, digoxin, a vasodilator, an angiotensin II converting enzyme (ACE) inhibitors, an ensin II receptor blockers (ARB), a calcium channel blocker, an isosorbide dinitrate, a azine, a nitrate, a hydralazine, a locker, a natriuretic peptides, a heparinoid, and a connective tissue 30 growth factor inhibitor. (11018705_1):KZA

39. The use of claim 38, wherein said therapeutic agent is at least one ACE inhibitor.

40. The use of claim 39, wherein the ACE inhibitor is selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril.

41. The use of claim 38, comprising administration of at least one ARB inhibitor. 5

42. The use of claim 41, wherein the ARB inhibitor is selected from artan, irbesartan, olmesartan, losartan, valsartan, telmisartan, and eprosartan.

43. The use of claim 30, wherein the disease is cancer.

44. The use of claim 43 n the cancer is liver cancer, breast cancer, bladder cancer, prostate cancer, colon cancer, lung cancer, brain cancer, hematological cancer, 10 pancreatic cancer, head and neck cancer, cancer of the tongue, stomach cancer, skin cancer, or thyroid cancer.

45. The use of any one of claims 43 or 44 wherein said ent further comprises administration of at least one additional anti-cancer therapy to the subject.

46. The use of any one of claims 30 to 45, n the subject is a human. 15

47. The use of any one of claims 30 to 46, wherein the compound is present as a ceutical composition.

48. A compound of any one of claims 1 to 23 or the modified oligonucleotide of claim 24, for use in therapy.

49. A compound of any one of claims 1 to 23 or the modified ucleotide of 20 claim 24, for use in the treatment of fibrosis.

50. A compound of any one of claims 1 to 23 or the modified ucleotide of claim 24, for use in promoting wound healing.

51. A nd of any one of claims 1 to 23 or the modified oligonucleotide of claim 24, for use in treating cancer. 25

52. A compound of any one of claims 1 to 23 or the modified ucleotide of claim 24, for use in preventing and/or delaying the onset of metastasis. (11018705_1):KZA

53. A nd of any one of claims 1 to 23 or the modified ucleotide of claim 24, for use in treating cardiac disease.

54. Use of a compound of any one of claims 1 to 23 or the modified ucleotide of claim 24 for the preparation of a medicament. 5

55. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide of claim 24 for the ation of a medicament for treating fibrosis.

56. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide of claim 24 for the preparation of a medicament for promoting wound healing.

57. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide 10 of claim 24 for the preparation of a medicament for treating cancer.

58. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide of claim 24 for the preparation of a ment for preventing and/or delaying the onset of metastasis.

59. Use of a compound of any one of claims 1 to 23 or the modified oligonucleotide 15 of claim 24 for the preparation of a medicament for the treatment of cardiac disease.