NZ616479B2

NZ616479B2 - Complement factor b analogs and their uses

Info

Publication number: NZ616479B2
Application number: NZ616479A
Authority: NZ
Inventors: Changhung Chen; Michael Kaleko; Beibei Li; Tianci Luo; Jeffrey Allen Miller; Ruigong Wang
Original assignee: Wellstat Immunotherapeutics Llc
Priority date: 2011-05-05
Filing date: 2012-05-04
Publication date: 2016-05-03

Abstract

Discloses a polypeptide comprising a complement factor B protein analogue, wherein the complement factor B analogue comprises a mutation of a free cysteine amino acid and is at least 90% identical to amino acids 26-764 of SEQ ID NOs: 1, 2 or 3; to amino acids 26-990 of SEQ ID NOs:22 or 23; to amino acids 26-480 of SEQ ID NO:2; or to amino acids 26-1003 of SEQ ID NO:26, wherein the sequences are as defined in the complete specification, and related methods, nucleic acids and vectors. These are used to modulate a complement pathway or for the study and/or treatment of various conditions or diseases related to a complement pathway. acids 26-480 of SEQ ID NO:2; or to amino acids 26-1003 of SEQ ID NO:26, wherein the sequences are as defined in the complete specification, and related methods, nucleic acids and vectors. These are used to modulate a complement pathway or for the study and/or treatment of various conditions or diseases related to a complement pathway.

Description

COMPLEMENT FACTOR B ANALOGS AND THEIR USES BACKGROUND OF THE INVENTION The complement system is a component of the innate and adaptive immune system (reviewed by Volanakis, J..,E 1998. Chapter 2. In The Human Complement System in Health and Disease. Edited by J. E. Volanakis, and M.M. Frank. Marcel Dekker, Inc., New York pp 9-32). Complement plays an important role in microbial killing, and for the transport and clearance of immune complexes. Many of the tion products of the complement system are also associated with proinflammatory or immunoregulatory functions. The complement system consists of plasma and membraneassociated proteins that are organized in three enzymatic-activation cascades: the classical, the , and the alternative pathways (Figure 1). All three pathways can lead to the formation of the al complement complex (TCC) and an array of biologically active products.

In some cases, complement activation is initiated either by specific antibodies recognizing and binding to a variety of ens and foreign molecules, and/or by direct ction of complement proteins with foreign nces. On activation, these pathways result in the formation of protease complexes, the C3-eonvertases. The classical pathway C3- convertase, C4b2a, and the alternative pathway C3—convertasc, C3bBb, are both able to cleave the 0. chain of C3 generating C3b. C3b has the potential to bind covalently to biological es. C3b binding leads to opsonization for ytosis by polymorphonuclear cells and macrophages. When additional C3b is available, the C3— convertases can on as C5—eonvertases, cleaving C5 and initiating the assembly of the TCC, or membrane attack complex (MAC), which mediates cellular lysis by insertion of pore-forming protein complexes into targeted cell membranes.

In the classical pathway as shown in Figure 1A, Clq, a collagenous ponent of the first component (C1), binds to immunoglobulins within immune complexes, and its associated serine proteases, Clr and C15, become activated. This complement cascade is initiated by the subsequent ge of C4 and C2, followed by C3 activation. The resulting C3b fragment not only acts as an n but also leads to the membrane attack complex (MAC) formation in the lytic pathway. In innate immunity, a complex composed of a recognition molecule (lectin) and serine proteases, termed the mannose-binding lectin (MED-associated serine protease (MASP), tes C4 and C2 upon binding to carbohydrates on the surface of microorganisms via the lectin pathway. This binding occurs PCT/U52012/036459 in the absence of immunoglobulins. Recognition molecules of the lectin pathway found in jawed vertebrates are MBLs and ficolins, both of which are terized by the presence of a collagen-like domain, like Clq, and a carbohydrate binding domain having a common binding specificity for GlcNAc. MASPs and Clr/Cls share the same domain organization and form a subfamily of serine proteases.

The lectin ment pathway in innate immunity is closely related to the classical complement pathway in adaptive immunity, e. g., with respect to the structures and functions of their components. Both pathways are typically initiated by complexes ting of enous ns and serine proteases of the e—binding lectin (MBL)-associated serine protease (MASP)/Clr/C ls family. It has been speculated that the cal pathway emerged ionarily after the lectin pathway.

Activation of the alternative complement pathway, shown in Figure 1B, typically begins when C3b protein (or C3i) binds to a cell and other surface components, e.g., of microbes. C3b can also bind to immunoglohulin G (IgG) antibodies. Alternative pathway Factor B protein then combines with the C3b protein to form C3bB. Factor D protein then splits the bound Factor B protein into fragments Bb and Ba, g C3bBb. Properdin then binds to the Bb to form C3bBbP that ons as a C3 convertase capable of enzymatically splitting typically hundreds of molecules of C3 into C3a and C3b. Some of the C3b subsequently binds to some of the C3bBb to form C3bBbC3b, a C5 convertase capable of splitting les of C5 into C5a and C5b.

Since C3b is free in the plasma, it can bind to either a host cell or pathogen surface.

To prevent complement activation from proceeding on the host cell, there are several different kinds of regulatory proteins that disrupt the complement activation process.

Complement Receptor 1 (CR1 or CD35) and DAF (also known as CD55) compete with Factor B in binding with C3b on the cell surface and can even remove Bb from an already formed C3bBb x. The formation of a C3 convertase can also be prevented when a plasma protease called Factor I cleaves C3b into its inactive form, iC3b. FactorI works with C3b-binding protein cofactors such as CR1 and Membrane Cofactor of Proteolysis (MCP or CD46). Another complement regulatory protein is Factor H which either competes with factor B, displaces Bb from the convertase, acts as a cofactor for Factor I, or preferentially binds to C3b bOund to vertebrate cells.

The precise on of the complement system depends on its regulation, as activation of the complement e leads to the production of a number of proteins that contribute to inflammation. This is beneficial when contributing to a host defense, but can be PCT/U52012/036459 detrimental if activated on self tissue. Typically, tion of C3 in the blood is kept at a low level, and C3b deposition is limited to the surface of pathogens.

The human wild type complement factor B protein is a 764 amino acid, single-chain glycoprotcin (approximately ) composed of five protein domains (Mole at ((1., 1984 The J. Biol Chem, 259:6, 3407—3412). A human wild type complement factor B protein (fB) is typically sed with an N—terminal 25 amino acid signal e, e. g., see SEQ ID NO: 1. The amino-terminal region (Ba) of human Wild type complement factor B protein consists primarily of three short consensus repeats. The middle region is a type A domain similar to those found in von Willebrand factor (Colombatti et al., Blood (1991) :2305- 15). The carboxy terminus is a serine protease (SP) domain (Perkins and Smith, Biochem J. (1993) 295( Pt 1):lO9-14; Hourcade et (11., JBC (1998) 273(40):25996~6000; Hourcade er a].

J Immunol. (1999) l62(5):2906-11; Xu et al., J Biol Chem. 2000 275(1):378—85; Milder et al.

Nat Struct Mol Biol (2007) 14(3):224-8).

Complement factor B analogs and their use for inhibiting complement and ng complement mediated diseases are described in PCT Publication No. WOOS/106644 and US.

Patent Publication No. U820100120665. For e, the human complement factor B protein analog, th3 (described in US. Patent Publication No 20100120665). is a dominant negative human factor B protein variant that efficiently inhibits the alternative complement (AP) activity. th3 protein (SEQ ID NO:4) has five amino acid changes ed to a human wild type factor B protein (SEQ ID N021). The five amino acid changes enable th3 protein to (i) bind much tighter to C3b n, (ii) resist C3b—dependent cleavage by factor D protein, and (iii) bind tighter to factor D protein when compared to the wild type factor B n. The tighter binding of th3 protein with C3b protein and factor D n sequester two essential components of the alternative complement pathway (ACP) in an inactive C3 convertase (th3), blocking the AP activity. Since C3b—bound th3 protein cannot be cleaved by factor D protein. the conformational change of th3 protein does not occur and the serine protease at the inus of th3 protein is not activated.

Both human wild type complement factor B protein and th3 contain 23 cysteine amino acids. The “active” forms of both have all of the cysteines forming disulfide bonds with one of the other cysteines, with the exception of the ne corresponding to the C292 of SEQ ID N021. The C292 of the “active forms” of th3 and wild type factor B is a free cysteine s er a]. 1983 Biochem J. 213, 201-209) and is highly conserved among various mammalian species, e. g., see Table 1, below.

PCT/U52012/036459 Citation or discussion of a reference herein shall not be construed as an admission that such is prior art to the present invention.

SUMMARY OF THE INVENTION The invention provides polypeptides comprising a ment factor B analog. The invention also provides various ment factor B s. In some embodiments, a complement factor B analog comprises a mutation of a free cysteine amino acid. The invention also provides nucleic acids and viral vectors comprising a nucleotide sequence encoding polypeptides and complement factor B protein analogs of the invention. Some embodiments of the invention provide cells, wherein the cells se a nucleic acid encoding a complement factor B n analog of the invention and wherein the cells express a complement factor B protein analog.

Additionally, the invention provides ceutical preparations comprising a polypeptide or complement factor B protein analog of the ion, a nucleic acid of the invention, a viral vector of the invention or any combination thereof.

Also provided by the present invention are methods of treating a complement- mediated disease comprising administering to a patient a pharmaceutical preparation of the invention, a ptide of the invention, a complement factor B protein analog of the invention, a nucleic acid of the invention, a viral vector of the invention or any combination thereof.

The invention also provides s of producing a polypeptide comprising a complement factor B n analog, the method sing: expressing in a cell a complement factor B protein analog of the ion and purifying said complement factor B protein analog.

Polypeptides of the invention, complement factor B analogs of the invention, and nucleic acids and vectors encoding them, can be used to te a complement pathway and for the study and/or treatment of various conditions or diseases related to a complement pathway.

The invention is based on the findings that mutation or removal of a free cysteine (i) improves the yield of an active and/or properly folded complement factor B protein analog (e. 5)., see Examples 9 and 10); (ii) enhances the thennostability of a complement factor B protein analog (e. g., see Examples 13 and 14); and/or (iii) reduces aggregation of a complement factor B n analog (e.g., see Example 6).

W0 20121151468 PCT/U52012/036459 This summary of the invention does not necessarily be all features or necessary es of the invention. The invention may also reside in a mbination of the described features.

BRIEF DESCRIPTION OF THE FIGURES For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise ements and instrumentalities of embodiments depicted in the drawings.

Figure 1A depicts the classical and lectin complement pathways. The classical pathway is initiated through Cl while the lectin pathway is initiated through mannose binding lectin (MBL). C4bC2a is a protease that cleaves C3 to C3a and C3b and is termed the C3 convertase. Similarly, C4bC2aC3b cleaves C5 to C5a and C5b and is termed the C5 convertase. C3a, C4a, and C5a have inﬂammatory properties and attract ytotic cells.

C5b6-9 forms the membrane attack complex (MAC), which s membrane pores that kill infectious agents but. can also damage host cells. MASP is mannan-binding lectin associated serine protease.

Figure 1B depicts the alternative ment pathway. This y is constitutively active at a low level through spontaneous cleavage of C3. In the presence of an appropriate e, C3b binds to complement factor B (fB). This complex is then cleaved by complement factor D (fD) to yield C3bBb. Spontaneous dissociation (“decay”) of this complex within minutes leads to its inactivation, whereas stabilization by properdin tes a complex that s C3; that is, a C3 convertase. Several of the factors that attenuate the complement pathways do so by accelerating the decay of the C3 and C5 convertases. C3b participates in the C3 convertase to generate additional C3b thereby creating a positive feedback loop as shown by the large arrow. C3bBb is a C3 convertase. C3bBbC3b is a C5 convertase.

Figure 2 is a htB3-2928 expression construct. CMV—cytomegalovirus immediate early promoter; IRES—internal ribosomal entry site; Neo-neomycin phosphotransferase gene; SynPolyA-synthetic polyA; Amp—Ampicillin-resistant gene. SEQ ID N0:8 is the tide sequence of the th3-29ZS expression construct shown in Figure 2.

Figure 3 shows Western blot analysis of raw cell culture supernatants containing either hlB3 or th3—292S protein after cell culture incubation for 72 hour (2 x 106 cells/mL).

Lane 1, one ill of cell culture medium from naive un-transfected 293 FreeStyle cells served as a negative control; Lane 2, one hundred ng of human wild type factor B (Quidel, Santa Clara, PCT/U520121036459 CA) purified from plasma served as a positive control; Lane 3, one pl of cell culture medium from th3 producing cells; Lane 4, one p1 of cell culture medium from 2S producing cells. The molecular weight markers in KDa are indicated on the right.

Figure 4 shows the results of a tic assay. These results demonstrate inhibition of human alternative complement pathway hemolytic activity by raw th3 protein or th3- 2928 protein producing cell culture medium. The relative hemolytic activity is scored by hemoglobin released after hemolysis of rRB Cs by human alternative complement pathway activity. X-axis from left to right: factor B~depleted human serum mented with 0 pg of purified human factor B n (control, no lysis of rRBCs); factor B-depleted human serum supplemented in each reaction with a mixture of 0.5 pg of purified human factor B protein and 1.0, 0.5, 0.25 or 0.125 pg of thS protein or MES-292$ n, as indicated, from the culture medium of th3 n or th3-292S protein producing cells. Note: 100% inhibition represented no lysis of rRBCs. The Y-axis represents mean OD405 and Standard Deviation (SD).

Figure 5A shows th3 protein (200 ng), ed from a three step chromatography process, subjected to SDS—PAGE and silver ng analysis. Figure 5B shows inhibition of human alternative complement pathway hemolytic activity by the purified th3 protein. X- axis from left to right: factor B protein-depleted human serum supplemented with 0 pg of purified wild type human factor B protein (wt th) (control, no lysis of ; factor B protein-depleted human serum supplemented in each reaction with a mixture of 0.5 pg of purified wild type human factor B protein and 1.0, 0.5, 0.3, 0.2, 0.1 or 0.05 pg of th3, as indicated. 100% inhibition ents no lysis of rRBCs. The Y-axis represents mean OD405 and SD.

Figure 6 shows biological activity of two tions of th3 protein. Shown are the results for hydrophobic interaction chromatography (HIC) purified th3 protein from Peak I and Peak II for inhibition of human alternative complement pathway hemolytic activity. X— axis from left to right: factor B protein—depleted human serum supplemented with 0 pg of purified human factor B protein (control, no rRBCs ; factor B protein-depleted human serum supplemented in each reaction with a mixture of 0.5 pg of purified wild type human factor B protein and various s of th3 protein ranging from 1.0 to 005 pg. 100% inhibition ents no lysis of rRBCs. The Y-axis represents mean 0D405 and SD.

Figure 7 shows reverse phase high-pressure liquid chromatography (HPLC) of raw cell culture supernatants containing either th3 protein or hlB3-2928 protein after tissue W0 2012!]51468 culture incubation for 72 hours (2x106 mL). A) atants from th3 producing cells ( ......... ), th3—292S protein ing cells (__) and naive 293 cells ( _____) , were applied to an Agilent HPl 100 HPLC system using a narrow bore rTM C4 column (Phenomenex) and eluted with a 50 minute water/ acetonitrile (25 ~ 70% acetonitrile) gradient containing 0.1% TFA. Elution was monitored at 215 nm with a PDA detector. The position of heat shock 70 protein (HSP’ZO), present in all three samples, is also shown.

B) The enlarged region of the togram shown in Figure 7A focusing on the region (25 — 29 s) ning the Peaks I and II of th3 protein and the peak containing th3— 2928 protein.

Figure 8 shows analysis of th3-Fc protein expression by subjecting 2 ul of cell culture supernatant containing thS-Fc protein to a non—reducing SDS-PAGE and Western blot analysis. (See e 12) Two bands of th3-Fc protein were detected with molecular weight markers in KDa indicated on the left.

Figure 9 shows representative H&E staining of paraffin sections of the right front paw joints of mice from a study testing th3-292S in a collagen antibody—induced arthritis (CAIA) mouse model for rheumatoid arthritis as described in Example 16. Group 1 is the vehicle control group that received no collagen antibody cocktail. Group 2 is the ted group that received the collagen antibody cocktail. Group 3 is the treated group that received the collagen antibody cocktail and was treated with th3—29’ZS.

Figure 10 shows joint swelling measurements from a study testing th3-2928 in a en antibody—induced arthritis (CAIA) mouse model for rheumatoid arthritis as bed in Example 16. The groups are the same as those in Figure 8, as described in the paragraph. th3-2928 caused a statistically significant (p<0.0003) reduction in joint swelling as compared to the untreated group (Group 2).

Figure 11 shows a Western blot analysis of cell culture medium from cells transfected with an th3-292SN480 sion construct. This Western blot analysis was performed using a monoclonal dy specific for th3~292$. The left lane contains th3—292S and the right lane is cell culture medium from cells transfected with an th3-29ZSN480 expression construct. The analysis detected a band of approximately 55 KDa from the cell culture medium of th3—292SN480 cell line (right lane).

Figure 12 shows a Western blot analysis of cell culture medium from cells transfected with an th3-292S/Fc-mono expression construct as described in Example 19, below. A W0 2012/]51468 PCT/U82012/036459 band of approximately 1 15 KDa was detected by purified goat anti-human factor B antibody from this non-reducing SDS—PAGB.

Figure 13 shows the cell culture supernatant from cells expressing th3-29’ZSN480 inhibited the human alternative complement pathway hemolytic activity in a dose dependent manner.

Figure 14 shows the cell culture supernatant from cells expressing ZS/FC- mono inhibited the human alternative complement pathway hemolytic activity in a dose— dependent manner.

BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID N021 - amino acid sequence of a wild-type human complement factor B SEQ ID N02 - amino acid sequence of a human complement factor B n analog, th3-292S, which comprises the following mutations: K258A, R259A, K260A, D279G, N285D and C2928.

SEQ ID N023 - amino acid sequence of a human complement factor B analog, th3-29ZS-74ON, comprising the following mutations as compared to SEQ ID N0: 1: K258A, R259A, K260A, D279G, N285D, D74ON and C2928.

SEQ ID NO:4 — amino acid sequence of a human complement factor B analog, th3, which ses the following mutations as compared to SEQ ID N021: K258A, R259A, K26OA, D279G and N285D.

SEQ ID NO:5 — nucleotide sequence of an thB expression construct, the construction of which is described in Example 1.

SEQ ID N026—7 — primers for site directed mutagenesis SEQ ID NO:8 — nucleotide ce of an th3-29ZS expression uct, the construction of which is described in e 2.

SEQ ID 4 — partial amino acid sequences of complement factor B proteins from a human, a mouse, a rat, a pig, a monkey and a sheep, respectively.

SEQ ID NO:l 5-16 — primers for site directed mutagenesis SEQ ID NO: 17 — amino acid sequence of a human complement factor B protein analog, th4.

SEQ ID NO: 18 — nucleotide sequence of an th3-Fc sion construct, the construction of which is described in Example 12.

SEQ ID N0219-20 — s for site directed mutagenesis.

PCT/U82012/036459 SEQ ID N021 — amino acid sequence of a human complement factor B protein analog, th3-Fc.

SEQ ID N022 — amino acid sequence of a human complement factor B protein analog, th3-29ZS-Fc.

SEQ ID N023 — amino acid sequence of a human complement factor B protein analog, ZS—74ON-Fc.

SEQ ID N024 — nucleotide sequence of an expression construct for expressing th3—292SN480.

SEQ ID N095 — nucleotide sequence gene expression construct for th3-292S/FC—mono.

SEQ ID N026 — amino acid sequence of 2S/Fc-mono.

SEQ ID N0127 - amino acid sequence of an Fe domain.

DETAILED DESCRIPTION The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular y, cell culture, gy and the like which are in the skill of one in the art. These techniques are fully disclosed herein and/or in current literature, for example, Sambrook, Fritsch and Maniatis eds, "Molecular Cloning, A Laboratory Manual", 2nd Ed, Cold Spring Harbor Laboratory Press (1989); Celis J. B. ”Cell Biology, A Laboratory Handbook" Academic Press, Inc. (1994) and n et al., J. of Virol. Methods, 54:131-143 (1995).

It is contemplated that any method, preparation or composition described herein can be implemented with respect to any other method, preparation or composition described herein. The use of the word “a” or “an” when used in conjunction with the term “comprising” in the Claims and/or the specification may mean “one,” but it is also tent [\2U1 with the meaning of “one or more,’9 1;at least one,” and “one or more than one.” The use of the term/phrase “and/or” when used with a list means one or more of the listed items may be ed, eg, it is not limited to one or all of the elements.

During production and purification of the ment factor B n analog designated th3 (SEQ ID NO:4), two populations of the complement factor B protein analog were detected. One population had the desired activity for the complement factor B protein analog (Peak I) while the other tion had substantially less of the desired activity (Peak II), e.g., see Figure 6 and 7. The results from terization of the two populations suggested that the two populations differed in their disulfide bond patterns. When the free PCT/U32012/036459 cysteine ion 292 of SEQ ID N014) was mutated to a serine, Peak II was undetectable.

Figure 6 shows that the Peak II fraction exhibits some ability to inhibit complement/hemolytie activity, but much less ability per ug of protein as compared to the Peak I fraction. It is le that the complement/hemolytic inhibitory activity seen with Peak II is mostly or solely a result of Peak II being containing some th3 with a free cysteine at position 292, possibly as a result of Peak I and Peak 11 not being fully resolved from each other.

The cysteine corresponding to on 292 of SEQ ID N021 is highly conserved among complement factor B proteins of different ian species (e. g., see Table 1).

Highly conserved sequences are typically important to the function of a protein. “The neutral theory of molecular ion states that mutations in amino acids occur in a stochastically constant manner as long as the mutations have no effect on the function of the gene product [Kimura M: The neutral theory of molecular evolution. Sci Am 1979, :98-100, 102, 108 passim]. On the other hand, amino acids that are important for protein function and structure cannot mutate without a detrimental effect on protein activity. Therefore, these amino acids will change very slowly in a given n family during evolution.” (Liu et a1.

BMC ormatics 2006, 7:37) Table 1. Conserved C steine in Com lement Factor B Protein HUMAN* IGASNFTGAKKQLVNLIEKVASY (SEQ :D NO: 9) MOUSE IGSSNFTGAKRCLTNLIEKVASY (SEQ ID NO: 10) RAT IGASNFTGAKRQLANLIEKVASY (SEQ ID NO: ll) PIG IGARNFTGAKNELKDFIEKVASY (SEQ ID NO: 12) MONKEY IGAGNFTGAKKCLVNLIEKVASY (SEQ ID NO:l3) SHEEP VGAHNFTGAKNCLRDFIEKVASY (SEQ ID NO:l4) *C corresponds to position 292 for a human factor B (SEQ ID NO:1) Mutating the cysteine at amino acid 292 of the complement factor B protein analog to a serine, e.g., as shown in SEQ ID N022 (th3-292), greatly d, if not eliminated, the amount of the Peak 11 (substantially less active) population and the th3-29ZS ment factor B protein analog retained its activity, in this case the ability to inhibit or reduce complement activity. (E. g., see Example 10, below.) Not wishing to be bound by theory, the less active population (Peak 11 fraction) of th3 protein could be the result of misfolding of th3 protein. It is possible that the generation of the majority of Peak 11 population was due to the combination of the free cysteine and the ons introduced to th3 protein because when cells were engineered to express a wild-type human complement factor B protein (SEQ ID NO: 1) in a manner similar to that used for thS protein, only one population of the wild-type human factor B protein was detected (data not shown).

This mutation of a free cysteine allows for a higher yield of the active complement factor B analog since most, if not all, of the produced complement factor B protein analog is in an active form. onally, mutation of a free cysteine results in a more stable protein since all of the remaining unmutated cysteines are part of a disulfide bond and there is no free cysteine left that can participate in possibly undesirable and detrimental reactions.

Additionally, ng the free ne unexpectedly appears to have d or eliminated ation of the complement factor B protein analog, e. g., see e 6 and Figure 3.

The complement factor B protein analogs described in PCT Publication No.

W008/106644 or US. Patent Publication No. US20100120665 (both of which are incorporated by reference in their entirety) can have their free cysteine mutated and still retain their desired function, while benefiting from the aforementioned ages of the mutation. Therefore, the present invention includes any of the complement factor B protein analogs described in PCT Publication No. WOOS/106644 or U.S. Patent Publication No.

U820100120665 with a on of a free cysteine.

The term “free cysteine” refers to a cysteine that is part of a protein or a peptide, wherein the free cysteine does not form a disulﬁde bond with another cysteine in the same protein or peptide. In some cases a “free cysteine” of a n analog does not form a disulfide bond with another cysteine (in the same protein or peptide) when the protein analog has a desired activity, but may form a disulfide bond with another cysteine (in the same n or peptide) in a less active or inactive form of the protein analog.

The term “complement-mediated” refers to a process or disease that involves complement. Typically, a “complement~mediated” disease or condition is one wherein complement activity is one of the underlying causes of the disease or condition and wherein inhibition or blocking of the complement activity lessens the extent of the disease or condition. es of numerous complement—mediated diseases or conditions are described herein.

The term “wildtype” (or wild-type), which is used interchangeably with “native”, relates to a naturally occurring protein d by a mammalian genome, a naturally occurring nucleic acid, and so on. In some cases, there may be actually more than one protein corresponding to the wild-type version, e. g., due to c differences; different isoforms; and/or genetic variation among different individuals of a species.

PCT/USZOIZ/036459 The term “analog” refers to a structural derivative of a protein (parent protein). An analog does not necessarily retain all of the properties of the parent protein and in some cases has at least one altered property as compared to the corresponding native parent protein. In some embodiments, a parent protein is a native (naturally-occurring) protein. An analog or t protein is produced by replacing, substituting, deleting, and/or adding amino acids with regard to the corresponding native amino acid sequence of the protein. The substitutions or insertions lly involve naturally occurring amino acids, but may also e tic or entional amino acids as well. In some embodiments, an analog or variant is produced by mutating a protein, e. g., mutating a nucleic acid ng it. An analog will typically retain at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% of the corresponding native parent protein’s amino acid sequence (6. g., have that percent amino acid sequence identity with respect to the naturally occurring parent protein as determined over the length of the entire parent protein or, in n embodiments, over a ic domain or portion of the parent protein). Analogs also include nts of full length analogs that comprise a portion of the amino acid sequence and either retain one or more biological activities of the parent protein or of a full length analog or inhibit one or more of these biological activities.

The term "corresponds" or “corresponding" when referring to an amino acid in a particular protein refers to the particular amino acid in that particular protein and also to an amino acid in a related or similar protein and may provide a similar function to the n.

For e, an amino acid in a human complement factor B may be found to correspond with an amino acid in a murine complement factor B or in a human c variant of factor B, usually determined by aligning the two amino acid sequences. For example, one skilled in the art can align two or more d sequences, such as SEQ ID NOS:9-l4, to determine corresponding amino acids, e.g., using a BLAST program (e.g., see Table 1, above). Also, corresponding amino acids can be determined, e. g, by aligning motifs (e. g., a protease cleavage motif) within related or unrelated proteins. Such an alignment may also be used to derive consensus sequences of target protein or domains thereof.

As used herein, the term “gene” typically refers to a coding region for a protein.

However, in some contexts herein it will be clear that the term “gene” is also referring to elements (e.g., regulatory elements) operatively linked to a coding region such as promoters, enhancers, splice sites (acceptors and/or ), polyadenylation signals, introns, 5’ untranslated regions, 3’ untranslated regions, etc.

W0 2012/]51468 PCT/US20121036459 The term "pharmaceutically acceptable“ means approved by a regulatory agency of the Federal or a state government or listed in the US. Pharmacopeia or other lly recognized pharmacopeia for use in humans.

A “therapeutic benefit” is not necessarily a cure for a particular e or condition ding any disease or condition bed herein), but rather, asses a result which most typically includes alleviation of the disease or condition, elimination of the disease or condition, reduction of one or more ms associated with the disease or condition, prevention or alleviation of a secondary disease or condition resulting from the occurrence of a primary disease or condition, diminishing the likelihood of developing a condition or disease, diminishing the severity of a e or condition, changing the character of a disease or condition, shortening the course of a disease or condition, slowing or preventing the progression or worsening of a e or condition, and/or prevention of the disease or condition.

Complement factor B analogs The present invention includes complement factor B protein analogs and polypeptides comprising ment factor analogs and their uses. Some embodiments of the invention include a complement factor B protein analog wherein a free cysteine has been mutated. In some embodiments, this mutation of a free cysteine can se a deletion of the free cysteine or substitution of the free cysteine with another amino acid(s). A free cysteine can be substituted with essentially any amino acid, that still allows for the complement factor B protein analog to retain at least some of the desired characteristic(s), such as the ability to downregulate, diminish or ablate complement activity A substitution may be with one or more amino acids. In some embodiments, a free cysteine is substituted with a serine. In some ments, a free cysteine is substituted with one or more amino acids selected from the group consisting of alanine, histidine, cine, leucine, methionine, phenylalanine, serine, ine, tyrosine and valine. In some embodiments, a free cysteine corresponds to amino acid 292 of SEQ ID N011.

In some embodiments, the ion provides complement factor B protein analogs that do not comprise a free cysteine. The invention also provides methods of making or ing a complement factor B protein analog comprising mutating a free cysteine.

Mutation of a free cysteine can be combined with other mutations of a complement factor B protein, e. g., other mutations as described herein.

PCT/U52012/036459 The ion also provides complement factor B protein analogs wherein the cysteine corresponding amino acid 292 of SEQ ID N021 is mutated. This mutation can be a on, insertion or tution, such as a serine substitution or other mutations as described herein.

Analogs can include various muteins of a sequence other than the lly>occurring amino acid ce. For example, single or multiple amino acid substitutions (e.g., conservative or non—conservative amino acid substitutions) may be made in the lly— occurring sequence. A vative amino acid substitution generally should not substantially change the structural characteristics of the parent sequence (e.g., a ement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence). Examples of art- recognized polypeptide secondary and tertiary structures are described in Proteins, ures and Molecular Principles (Creighton, Ed, W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. n and J. Tooze, eds, Garland Publishing, New York, NY. (1991)); and Thornton et al. Nature 354: 105 (1991). Conservative substitutions include, but are not limited to, those from the following groupings: Acidic Residues Asp (D) and Glu (E); Basic Residues Lys (K), Arg (R), and His (H); Hydrophilic Uncharged Residues Ser (S), Thr (T), Asn (N), and G111 (Q); Aliphatic Uncharged Residues Gly (G), Ala (A), Val (V), Leu (L), and He (1); Non—polar Uncharged Residues Cys (C), Met (M), and Pro (P); Aromatic Residues Phe (F), Tyr (Y), and Tip (W); Alcohol group-containing residues S and T; tic residues I, L, V and M; Cycloalkenyl-associated residues F, H, W and Y; Hydrophobic residues A, C, F, G, H, I, L, M, R, T, V, W and Y; Negatively charged residues D and E; Polar residues C, D, E, H, K, N, Q, R, S and T; vely d residues H, K and R; Small residues A, C, D, G, N, P, S, T and V; Very small residues A, G and S; Residues involved in turn formation A, C, D, E, G, H, K, N, Q, R, S, P and T; and Flexible residues Q, T, K, S, G, P, D, E and R. in some embodiments, a non-conservative substitution is used.

In some embodiments, mutations include, but are not limited to, substitutions of one or more amino acids, deletions of one or more amino acids or insertions of one or more amino acids. Mutations include, but are not limited to, those which: (1) reduce susceptibility of the complement factor B analog to proteolysis, (2) reduce tibility of the complement factor B analog to oxidation, (3) alter binding affinity of the complement factor B analog for forming protein complexes, (4) alter (e. g., increase or decrease) binding afﬁnities of the complement factor B analog, (5) reduce immunogenicity of the complement factor B analog; WC 2012/151468 (6) increase stability (e.g., thermostability ) of the complement factor B analog; (7) reduce aggregation of the ment factor B protein analog; or any combinations of 1-7.

In some embodiments, a human complement factor B analog of the invention competes with binding of native complement factor B. For e native ment factor B can bind with complement factor C3b to form C3bB, e.g., see Figure 1B. Factor B that is part of the C3bB complex can bind factor D. Therefore, in some embodiments, a complement factor B analog of the invention can compete with the binding of a native factor B for (i) binding to C3b, (ii) binding to factor D or (iii) both.

In some embodiments, a ment factor B protein analog of the invention, is an analog of SEQ ID NO:4 having cysteine amino acids that form disulfide bonds and a free cysteine amino acid that has been substituted by another amino acid, more than one amino acid or has been deleted with no substitution.

In some embodiments of the invention, a complement factor B protein analog has increased C3b binding affinity as compared to a corresponding native complement factor B protein and the ment factor B protein analog comprises (i) diminished protease activity as compared to a corresponding native ment factor B protein; (ii) diminished ability to be cleaved by factor D protein as compared to a corresponding native complement factor B protein; or (iii) diminished protease activity as compared to a ponding native complement factor B protein and diminished ability to be d by a factor D protein as compared to a corresponding native complement factor B protein.

In some embodiments, a complement factor B analog comprises a mutation in the C3b binding domain and the complement factor B protein analog exhibits increased binding affinity to C3b as compared to the binding affinity of a corresponding native complement factor B protein to C3b. In some embodiments, a on in the C3b binding domain comprises (i) a substitution or deletion of an aspartic acid corresponding to amino acid 279 of SEQ ID N011, a substitution or on of an asparagine corresponding to amino acid 285 of SEQ ID N0:1 or both; or (ii) an insertion of at least one amino acid next to said aspartic acid or said gine. In some embodiments, this aspartic acid, gine or both are tuted with one or more amino acids. In some embodiments, an aspartic acid corresponding to amino acid 279 of SEQ ID NO:1 is substituted with glycine, alanine or asparagine. In some embodiments, an asparagine corresponding to amino acid 285 of SEQ ID NO:1 is substituted with glycine, alanine, or aspartic acid. In some embodiments, an aspartic acid corresponding to amino acid 279 of SEQ ID N021 is substituted with glycine W0 20121151468 PCT/U82012/036459 and an asparagine corresponding to amino acid 285 of SEQ ID NO:1 is substituted with aspartic acid.

In some embodiments, a complement factor B protein analog is a human complement factor B protein analog, based on a human complement factor protein.

The instant invention includes ment factor B n analogs, 6.3., that can be delivered as proteins and/or via gene transfer to attenuate the alternative pathway of complement tion. These analogs may overcome hurdles that impede the development of some complement inhibitors ing, for e: 1) avoiding long term systemic immune suppression; 2) achieving efficacy in the face of otherwise prohibitively high levels of complement factors in the blood; 3) achieving sufficient levels and distribution of the therapeutic complement factor B protein analog in the proximity of the retina and Brueh’s membrane for efficacy; 4) achieving activity of the therapeutic complement factor B protein analog within drusen; 5) achieving sufficient duration of therapeutic delivery to treat a chronic disease; 6) achieving efficacy without detrimentally interfering with the cal complement pathway activities in the back of the eye; and/or 7) avoiding or diminishing an immune reaction (e. g., a local immune reaction) to the therapeutic Attenuating the positive feedback loop in the alternative pathway is a means of down-regulating the entire alternative pathway. One le means for ating the alternative pathway feedback loop is to interfere with complement factor B (B) protein function or levels. Some embodiments of the invention use a complement factor B analog for attenuating complement activity.

A complement factor B protein analog of the invention may comprise at least one mutation ponding to a mutation of SEQ ID NO:l selected from the group consisting of K258A, R259A, K26OA, D279G, N285D and D740N. In some embodiments, it comprises [\J U! mutations corresponding to K258A, R259A, K26OA, D2796 and N285D of SEQ ID NO:1.

In some ments, a complement factor B protein analog comprises a mutation corresponding to D740N of SEQ ID N021.

For exemplary es, specific analogs of complement factor B protein are described herein. Factor B protein can be manipulated in a number of ways, 6. g., to inhibit or reduce activation of the alternative pathway. In some embodiments, particular sites in factor B can be altered, for example, by site directed mutagenesis, so that the molecule no longer fully functions properly. In some embodiments, the enzyme portion or domain, (e.g., the protease domain, which is a serine protease) of the molecule can be d so that the molecule no longer has tic activity or has reduced tic activity (e.g., reduced by PCT/U82012/036459 at least 2 fold, 5 fold, 10 fold, 50 fold or 100 fold). In some embodiments, a complement factor B protein analog comprises a mutation in the active site of the serine se domain, wherein the mutation decreases or ablates the complement factor B protein analog’s ability to cleave complement factor C3 as compared to a corresponding native complement factor B In some embodiments, this can be achieved by altering the residue corresponding to amino acid 740 of SEQ ID N0:1. In some embodiments, this mutation comprises a deletion or a substitution of an aspartic acid corresponding to amino acid 740 of SEQ ID N021. In some embodiments, an aspartic acid (D), corresponding to amino acid 740 of SEQ ID N021, is substituted with another amino acid such as asparagine (N), alanine (A), glutamic acid (E), serine (S), tyrosine(Y), or glycine (G). The numbering of particular factor B amino acids herein relates to the entire polypeptide including the signal peptide and is reﬂected in SEQ ID N0: 1. de er a1. (IBC (1998) 273(40):25996~6000) notes that amino acids 739-746 of SEQ ID N021 (referred to in Hourcade er a]. as amino acids 1 because the Houreade er al. numbering does not include the 25 amino acid signal sequence/peptide) play a role in the serine protease function of factor B protein. onally, N693, T694 and D740 may constitute or be part of the substrate binding site and H526, D576 and S699 may tute or be part of the catalytic center, e.gr, see Xu et al., J Biol Chem. 2000 275(1):378—85. In some embodiments, a factor B protein analog comprises a mutation of at least one of the amino acids selected from amino acids 739—746 of SEQ ID N021. In some embodiments, a complement factor B protein analog comprises a substitution of the amino acid corresponding to amino acid 739 of SEQ ID N021 with an alanine. In some embodiments, a complement factor B n analog comprises a substitution of the amino acid corresponding to amino acid 740 of SEQ ID N021 with an amino acid selected from the group consisting of asparagine, glutamic acid, alanine, serine and tyrosine. In some ments, a complement factor B protein analog comprises a substitution of the amino acid corresponding to amino acid 741 of SEQ 1D N0:1 with an amino acid selected from the group consisting of tiyptophan and alanine. In some embodiments, a complement factor B protein analog comprises a substitution of the amino acid corresponding to amino acid 742 of SEQ ID NO:1 with glutamine. In some embodiments, a ment factor B protein analog comprises a substitution of the amino acid corresponding to amino acid 743 of SEQ ID NO:1 with phenylalanine. In some embodiments, a complement factor B protein analog comprises a substitution of the amino acid corresponding to amino acid 745 of SEQ ID NO:l with alanine. In some embodiments, a complement factor B protein analog comprises a PCT/U82012/036459 tution of the amino acid corresponding to amino acid 746 of SEQ ID N0:1 with tryptophan or alanine. In some embodiments, a factor B protein analog comprises a mutation of one or two of the amino acids 693 and 694 of SEQ ID N0:1, e.g., a substitution or deletion. In some embodiments, a factor B n analog comprises a mutation of one or two of the amino acids 526, 576 and 699 of SEQ ID N0:1, e. g., a substitution or on.

Other sites in factor B that can be altered include: 1) the binding site for din (the properdin binding domain) such that binding occurs with lower afﬁnity (for example, such as 2 fold, 5 fold, 10 fold, 50 fold or 100 fold reduced affinity as compared to the wild type factor B protein) or with greater affinity (such as at least 2 fold, 5 fold, 10 fold, 50 fold or lOO fold increased affinity as compared to the wild type factor B); 2) the binding site for C3b protein (the C3b binding domain) such that binding occurs with lower affinity (such as at least 2 fold, 5 fold, 10 fold, 50 fold or 100 fold reduced affinity as compared to the wild type factor B protein) or with greater ty (such as at least 2 fold, 5 fold, 10 fold, 50 fold or 100 fold increased affinity as compared to wild type factor B protein, for example, this may be achieved by substituting the amino acid corresponding to position 279 andfor position 285 of SEQ ID N0:1 with other amino acids, for example, wherein the amino acid at the position corresponding to position 279 is tuted with asparagine (N), alanine (A) or glycine (G) and/or the amino acid at the position corresponding to position 285 is substituted with ic acid (D) or alanine (A)); 3) the site acted on by factor D such that factor D has reduced ability to cleave or no longer cleaves factor B to form Bb (for e, at the factor D cleavage site, at least one of the amino acids at the positions corresponding to position 258, 259 or 260 of SEQ ID N0:1, for example, can be altered to alanine (A) or; a combination of any of 1, 2, and/or 3 above).

In some embodiments, a complement factor B protein analog comprises an alteration in the complement factor D cleavage site wherein the alteration ses or ablates cleavage of the ment factor B protein analog by factor D n. In some embodiments, an alteration in the factor D cleavage site comprises (i) a substitution or on of an arginine corresponding to amino acid 259 of SEQ ID N0:1, a substitution or on of one or both lysines corresponding to amino acid 258 or 260 of SEQ ID N0:1 or a substitution or deletion of the arginine and both lysines; or (ii) an insertion next to the arginine, next to the one or both lysines, or next to the arginine and one or both of the lysines. In some embodiments, a complement factor B protein analog has amino acids corresponding to amino acids 258-260 of SEQ ID N0:1 each replaced with alanine.

PCT/U82012/036459 The invention es (i) complement factor B protein analogs that bind to both factors C3b and D; (ii) complement factor B protein analogs with increased g (as compared to their native form) to both factors C3b and D; (iii) complement factor B protein analogs with increased binding (as ed to their native form) to factor D protein; and (iv) complement factor B protein analogs with increased binding (as ed to their native form) to C3bB complex. The invention also includes methods of inhibiting a complement pathway using the complement factor B protein analogs of the invention, such as i-iv, above.

In some embodiments, increased g is increased by about 1.5 to about 10,000, about 10 to about 10,000, about 100 to about 10,000, about 1,000 to about 10,000, about 1.5 to about 1,000, about 1.5 to about 100, about 1.5 to about 10, about 2 to about 5, about 2 to about 10, about 5 to about 10, about 5 to about 20, about 10 to about ’20, about 10 to about 30, about 20 to about 30, about 30 to about 50, about 50 to about 100, about 100 to about 500, about 500 to about 1,000, about 1,000 to about 5,000, or about 5,000 to about 10,000 fold. In some embodiments, increased binding is increased by greater than 1.5, 2, 3, 4, 5, 10, 50, 100, 500, 1000, 5000 or 10,000 fold. In some embodiments, increased binding can be measured by immunoprecipitation or using a Biacore (GE Healthcare, Piscataway, NJ), e.g., as compared to the wild typc protein. As an e for (i) above, binding could be measured by immunoprecipitation of the protein with a binding molecule for C3b protein and then detecting factor D protein in the immunoprecipitate, e.g., using an immunoassay such as an ELISA or Western, for example, with increased g demonstrated as a band of increased ity in a Western.

Some factor B protein analogs of the invention may have increased binding to C3b protein and/0r factor D protein by a factor of 2 fold, 4 fold, 5 fold, 10 fold, 20 fold, 50 fold, 100 fold, 500 fold, 1000 fold as ed to binding of wild type factor B to C3b and/or l\)U] factor D. In some embodiments, increased binding can be measured by immunoprecipitation or using a Biacore (GE Healthcare, Piscataway, NJ).

Some modified factor B protein analogs of the invention comprise one or more of the amino acid alterations discussed herein and additionally have one or more onal amino acid substitutions, ions or alterations (e.g., at least or no more than 1, 2, 5, 8, 10, 15 20, 50, 100, or 200 alterations), which analogs retain the increased binding to C3b and/or factor D or other biological ty of the factor B protein analogs discussed herein, which mediates inhibition of the complement pathway. Such analogs may have at least 99.9%, 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% amino acid sequence identity with a wild type PCT/U52012/036459 factor B n, for example, the amino acid ce of SEQ ID N021 and retain the increased binding to C3b and/or factor D.

In the context of gene therapy and expression of complement factor B protein analogs, the alterationslmutations will be reﬂected at the level of the encoding nucleic acid. Thus, cations also can be made to the nucleic acid to enhance sion. For example, certain codons may be preferred by a particular host cell. Thus, recoding can be performed where certain codons are preferred in, for e, a particular mammalian expression system or cell.

Some embodiments of the invention are directed to polynucleotides and host cells (or host multicellular organisms) useful in the tion of a complement factor B protein analog and directed to the analogs, e.g., th3—29QS (SEQ ID NO:2), thB-29QS—74ON (SEQ ID N0:3), th3-29ZS—Fc (SEQ ID N0z22), thS—29ZS~74ON~FC (SEQ ID N023) or th3— 29ZS/Fc—m0no (SEQ ID N026). Methods of isolating and testing complement—mediated activity of these complement factor B protein analogs are also provided. Some aspects of the invention are directed to pharmaceutical compositions/preparations wherein a complement factor B protein analog is an active ingredients in a eutic and/or a prophylactic contexts. Some embodiments of the invention are also directed to methods of treating complement-mediated disorders using a therapeutically effective amount of a complement factor B protein analog.

In some embodiments of the invention, a complement factor B analog may se glycosylation patterns which are ct from glycosylation patterns on a naturally-occurring complement factor B, or may lack ylation altogether. Carbohydrates may be added to and/or removed from factor B analogs comprising glycosylation site sequences for N— and/or O—linked glycosylation in vitro, such as with a canine pancreatic microsome system (e. g., sec er and Lodish (1986) Cell 44:629 and Walter, P. (1983) Meth. Enzymol. 96:84) or the like. A complement factor B analog of the invention may be produced comprising adding or deleting/mutating an amino acid sequence ponding to a glycosylation site, e.g., changing the glycosylation pattern/status of a n can change functional characteristics of a protein. For example, thZ, th3 (SEQ ID N014), th3-29QS (SEQ ID N022), th3-29ZS- 740N (SEQ ID N03), th3-29QS-Fc (SEQ ID N0222), th3-29ZS-74ON-Ec (SEQ ID N0223) and th3-29ZS/FC-mono (SEQ ID N0226) comprise an N285D substitution, as compared to a wildtype factor B (SEQ ID NO:1), which results in the removal of an N- glycosylation site. (Both the th2 and th3 complement factor B protein analogs are bed in detail in US. Patent Publication No. U820100120665.) The loss of the N- W0 2012/]51468 PCT/U52012/036459 glycosylation site alters the teristics of the protein. The same effect may be ed by producing the protein in a cell that has an altered glycosylation pattern or that does not glycosylate this N285. For example, a factor B protein or analog may be produced in an E. coli cell that does not glycosylate the N285. In some embodiments, a complement factor B protein analog is produced in a cell (e.g, an E. coli) that does not glyCOSylate an amino acid corresponding to a Wildtype factor B protein that is lly glycosylated, e. g., corresponding to amino acid N285 of SEQ ID NO: 1.

As demonstrated in PCT Publication No. W008/106644 and US. Patent Publication No. U820100120665, in some cases a native factor B protein from one species may have activity in a complement reaction/pathway from another species. Therefore, the present invention also includes ment factor B protein analogs from one species for inhibiting complement activity in another s.

In some ments, a complement factor B protein analog of the ion is PEGylated, e.g., see Roberts at at, Advanced Drug Delivery Reviews 54(4):459-476 ; Veronese, Biomaterials 22(5):405-417 ; Fee and Alstine, Chemical Engineering e 61(3):924—939 (2006); Kodera 122512., Progress in Polymer Science 23(7):]233-1271 (1998); Morar, Biopharm International l9(4):34 (2006); and Veronese and Pasut, Drug Discovery Today 10(21):1451-l458 (2005). Polyethylene glycol (PEG) can be attached to a complement factor B protein analog of the ion. In some ments, PEG is ed with or without a multifunctional linker either through site—specific conjugation of the PEG (e. g., to the N-terminus or to the C terminus of a complement factor B analog) or via epsilon amino groups present on lysine residues. In some embodiments, linear or branched polymer derivatization that results in minimal loss of biological activity can be used. The degree of conjugation can be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to a complement factor B analog. In some embodiments, unreacted PEG can be separated from PEG conjugates by size—exclusion and/or by ion exchange tography.

In certain embodiments, the carboxy-terminus, the amino—terminus or both of a complement factor B analog, are chemically modified. Amino-terminal modifications such as acylation (e.g., acetylation) or alkylation (e. g., methylation) and carboxy—tcrminal cations Such as amidation, as well as other terminal modifications, including cyclization, may be incorporated into various embodiments of the ion. Certain amino- terminal and/or carboxy-terminal modifications and/or peptide extensions (such as fused to a heterologous polypeptide, such as albumin, immunoglobulin or portion thereof, such as an PCT/U82012/036459 globulin Fc domain) to the core sequence can provide advantageous physical, chemical, biochemical, and pharmacological properties, such as: enhanced stability, increased potency and/or efficacy, resistance to serum proteases, desirable pharmacokinetic ties, and others.

In some embodiments, a complement factor B protein analog of the invention ses an immunoglobulin Fc domain, for example, a human immunoglobulin Fc .

In some embodiments, an EC domain is C-terminal to the corresponding complement factor B analog amino acid sequence. In some embodiments, an Fc domain comprises or consists of amino acids 766-990 of SEQ ID NO:21 or amino acids 766—1003 or 786-1003 of SEQ ID NOz26. In some ments, an F0 domain is amino acids 1-239 or 2-239 of SEQ ID N027. In some embodiments, an F0 domain is a human Fc domain. In some embodiments, an Fc domain is from an immunoglobin, e.g., an IgG such as IgG4. In some embodiments, an Fc domain is capable of g a dimer with another Fc domain. In some embodiments, a complement factor B analog of the invention is capable of forming dimers (e.g., gous dimers), such as, but not limited to, through interactions of EC domains. In some embodiments, a complement factor B analog does not form dimers or the majority of a complement factor B analog population/preparation is in the form of monomers. In some embodiments, a complement factor B analog comprising an F0 domain does not form dimers or the majority of this complement factor B analog population/preparation is in the form of monomers. In some embodiments, a complement factor B analog comprises an F0 domain that has one or mutations of a cysteine(s) in the Fc domain sequence, 9. g., a cysteine involved in dimerization of the Fc domain. In some embodiments, a PC domain comprises a mutation of one or more cysteincs corresponding to amino acids 17 and/or 20 of SEQ ID N0227. In some embodiments, a complement factor B analog comprises an Fc domain that has one or ons of a free cysteine(s) in the Fc domain sequence. In some embodiments, a cysteine(s) is substituted with an amino acid selected from the group consisting of histidine, cine, leucine, nine, phenylalanine, serine, threonine, ne, and valine. In some embodiments, a cysteine is deleted. In some embodiments, an amino acid sequence linker is used between amino acid sequences for a complement factor B analog and an Fc region. In some embodiments, this linker is one amino acid, e.g., argininc.

In some embodiments, a ptide comprises both a truncated complement factor B analog and an Fc region such as comprising amino acids ponding to amino acids 26- 480 of SEQ ID N02 and an Fc region. ix.) [\1 The ion further provides analogs which are fragments of a complement factor B protein or analog that contain at least a 20, 30, 50, 70, 100, 150, 200, 300, 400, 480, 500, 600 or 700 amino acid portion of the complement factor B protein or analog and/0r comprises 1, 2 or 3 domains of the protein and have or retain one or more biological activities of the wild type complement factor B protein or analog and/0r acts as an inhibitor of an aspect of the complement system (either the classical pathway, alternative pathway or both). These fragments can be further modified by linking or fusing with another protein or fragment such as an Fe to increase the stability and/or half-life of the analog, In some embodiments, an analog is fragment of a complement factor B protein or analog and the nt has at least 99.5%, 99%, 98%, 95%, 90%, 85% or 62% identity with the corresponding amino acid sequence of a wild-type ment factor B.

The invention provides proteins sing a fragment of a complement factor B n or analog, n the fragment has an N—terminal and/or C—tenninal truncation. In some embodiments, a complement factor B analog comprises a inal truncation wherein the analog is truncated at or after (C-terminal to) an amino acid ponding to amino acid 407, 427, 457, 477, 480, 484, 487, 507 or 527 of SEQ ID NOszl, 2 or 4. In some embodiments, a complement factor B analog comprises a C-terminal truncation wherein the analog is truncated at an amino acid between amino acids corresponding to amino acids 407 - 487, 470-495 or 477-487 of SEQ ID NOszl, 2 or 4. In some embodiments, a complement factor B analog of the invention does not comprise amino acids corresponding to amino acids 408—764, 428—764, 458-764, 478—764, 481064, 485~764, 4, 4, 527-764 of SEQ ID NOS: 1, 2 or 4. In some embodiments, tion or fragmentation of a factor B protein or analog can create a free cysteine. For example, a truncation can result in the deletion of one cysteine of a cysteine pair that forms a disulfide bond in a native ment factor B protein, thus creating a polypeptide that contains a cysteine, but does not contain its native cysteine “partner”. In some of these embodiments, the remaining cysteine of the pair may be mutated, e. 3., substituted with another amino acid, such as an alanine, histidine, isoleueine, leucine, methionine, phenylalanine, serine, threonine, tyrosine and valine or the cysteine may be deleted, e. g., to eliminate possible undesired disulfide bonding.

Analogs of the invention can be prepared by various techniques, including but not d to, chemical synthesis or by expression of the recombinant analog. tide sequences for genes and coding regions encoding human factor B, as well as the amino acid sequences are known in the art. For example, a gene encoding human factor B is found in NCBI Database Accession No. NG_000013. A coding sequence for a PCT/U820121036459 human factor B is found in NCBI Database Accession No. NM_001710 and an amino acid sequence for a human complement factor B preproprotein is found in NCBI Database Accession No. NP__001701 or P00751. Sequences from other animal s are also known in the art. By way of comparison, in the mouse factor B protein sequence (e.g., see NCBI se Accession No. P04186), the third SCR domain is d at positions 160-217 of this 761 amino acid preprotein, and the mature murine factor B protein spans positions 23- 761. The first 22 amino acids of mouse factor B protein comprises a signal sequence. lly, a human factor B preprotein is a 764 amino acid protein (e.g., see SEQ ID N011) with a signal peptide ng amino acid positions 1-25. The mature chain of factor B corresponds to positions 26-764 (cg, see SEQ ID N011). The three SCR regions of human factor B are SCRl, also known as Sushi 1, spanning from about position 35 to about position 100, SCR2, also known as Sushi 2, spanning from about position 101 to about on 160 and SCR3, also known as Sushi 3, spanning from about position 163 to about position 220.

PCT Publication No. W008/106644 and U.S. Patent Publication No. US20100120665 describe, inter aiia, three specific dominant negative human factor B protein analogs designated as thl, th2 and th3. The first of these three analogs, termed fBl, contains a mutated amino acid in the factor B (fB) protease site. This fB moiety binds C3b with normal affinity and kinetics, but when acted upon by factor D (fD) and ized by properdin, does not. function as a protease and does not form a C3 convertase. fBl contains a substitution with N at an amino acid corresponding to amino acid 740 of SEQ ID N011 (e.g, D740N).

The second of these complement factor B analogs, termed fB2, alters the same amino acid as fBl, but in addition, alters two additional amino acids in the C3b g domain itutions at amino acids corresponding to amino acids 279 and 285 of SEQ ID NO: 1) which increase the binding affinity of [B2 to C3b, eg, D279G, N285D and D740N changes.

The N285D tution removes a putative N-glycosylation site. The third of these complement factor B protein analogs, termed th3, combines the mutations that increase C3b binding from fB2 with a mutation that knocks out the site for cleavage by factor D, particularly with substitutions at amino acids corresponding to residues 258, 259 and 260 of SEQ ID N0:1 as well as substitutions at amino acids corresponding to residues 279 and 285, e.g., K258A, R259A, K26OA, D279G and N285D changes. ge of wild type fB by factor D activates the fB protease. Thus, th3, with its five amino acid changes, efficiently binds C3b but has minimal protease activity.

W0 2012I151468 PCT/U82012/036459 MB 1 th2 and th3 are examples of human factor B analogs which can be further modified to complement factor B analogs of the present invention by mutating a free cysteine corresponding to amino acid 292 of SEQ ID N021, e. g., by substituting the cysteine with a serinc, but the invention is not limited to these speciﬁc s. Some embodiments of the invention include any complement factor B analog that modulates a complement pathway and does not comprise a free cysteine. In some embodiments, a complement factor B analog comprises, in addition to a mutated free cysteine, one or more mutations of amino acids corresponding to one or more of the following amino acids in SEQ ID N021 : amino acid 258, 259, 260, 279, 285, 739, 740, 741, 742, 743, 744, 745 and 746. These one or more ons can be a substitution or deletion of the amino acid or an addition of at least one amino acid next to or within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids of the ponding amino acids.

In some embodiments, this addition ts, changes, enhances or ts the function of the listed amino acid, 5. g., disrupts its role (i) in cleavage of another protein (e.g., 740), (ii) as a site of cleavage by r protein (e. g., amino acids corresponding to residues 258, 259 and/or 260 of SEQ ID NO:1), or (iii) its role in binding another n (3g, amino acids corresponding to residues 279 or 285 of SEQ ID N011).

Some embodiments of the ion comprise a substitution of an amino acid corresponding to one or more of amino acids corresponding to 258, 259 and/or 260 of SEQ ID N021, e.g., with an amino acid selected from the group consisting of alanine, e, valine, leucine and isoleucine. Some embodiments of the invention comprise a deletion of an amino acid corresponding to one, two or three of amino acids ponding to amino acids 258, 259 and/or 260 of SEQ ID N021. Some embodiments of the invention comprise at least one addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids immediately next to an amino acid corresponding to amino acids 258, 259 and/or 260 of SEQ ID NO:1.

Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 739 of SEQ ID N0:1. Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 739 of SEQ ID N0: ], e. g., with an amino acid selected from the group consisting of alanine, glycine, valine, leucine and isoleucine. Some embodiments of the invention comprise a deletion of an amino acid corresponding to the 739 amino acid of SEQ ID N021.

Some ments of the invention comprise a substitution of an amino acid corresponding to amino acid 740 of SEQ ID NO:1, e.g., with an amino acid ed from the group consisting of glutamic acid, asparagine, alanine, serine, glycine and tyrosine. Some embodiments of the invention comprise a substitution of an amino acid corresponding to W0 2012/]51468 amino acid 740 of SEQ ID NO:1 with an amino acid selected from the group ting of valine, leucine, isoleucine, threonine, cysteine, nine, glutamine, phenylalanine, tyrosine, tryptophan, glutamic acid, asparagine, alanine, serine, glycine and tyrosine. Some ments of the invention comprise a deletion of an amino acid corresponding to the 740 amino acid of SEQ ID NO:1.

Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 741 of SEQ ID NO:1, e.g., with an amino acid selected from the group consisting of tryptophan and alanine. Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 741 of SEQ [D N0:1 with an amino acid selected from the group consisting of alanine, e, valine, leucine and isoleucine. Some embodiments of the invention se a substitution of an amino acid ponding to amino acid 741 of SEQ ID NO:1 with an amino acid selected from the group consisting of tryptophan, tyrosine and phenylalanine. Some embodiments of the invention comprise a deletion of an amino acid corresponding to the 741 amino acid of SEQ ID NO:1.

Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 742 of SEQ ID NO:1, e. 3., with a glutamine. Some embodiments of the invention comprise a tution of an amino acid corresponding to amino acid 742 of SEQ ID NO:1 with an amino acid selected from the group consisting of glutamine, glutamic acid, asparagine, and aspartic acid. Some embodiments of the invention comprise a deletion of an amino acid corresponding to amino acid 742 of SEQ ID NO:1.

Some embodiments of the invention se a substitution of an amino acid corresponding to amino acid 743 and/or 745 of SEQ ID NO:1, e.g., with a phenylalanine.

Some embodiments of the invention comprise a substitution of an amino acid ponding Ix) U: to amino acid 743 and/or 745 of SEQ ID NO:1 with an amino acid selected from the group consisting of phenylalanine, tyrosine and tryptophan. Some embodiments of the invention se a deletion of one or more of amino acids corresponding to amino acids 743, 744 and/or 745 of SEQ ID NO: 1.

Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 746 of SEQ ID NO:1, e. g., with an amino acid ed from the group consisting of nyptophan and alanine. Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 746 of SEQ ID NO:1 with an amino acid selected from the group consisting of alanine, glycine, , leucine and isoleucine. Some embodiments of the invention comprise a substitution of an amino acid W0 2012/]51468 PCT/U32012/036459 corresponding to amino acid 746 of SEQ ID NO:1 with an amino acid selected from the group consisting of tryptophan, tyrosine and phenylalanine. Some embodiments of the invention comprise a deletion of an amino acid corresponding to amino acid 746 of SEQ ID N0:1.

Some embodiments of the invention comprise the insertion or substitution of l, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids immediately next to or in place of any one or more of the amino acids corresponding to amino acids 739, 740, 741, 742, 743, 744. 745 and/or 746 of SEQ ID N0:1.

Some ments of the invention comprise a substitution of an amino acid corresponding to amino acid 279 of SEQ H) N021, e.g., with an amino acid ed from the group consisting of glycine, alanine and asparaginc. Some embodiments of the invention se a substitution of an amino acid corresponding to amino acid 279 of SEQ ID N0:l with an amino acid selected from the group consisting of glycine, alanine, , leucine and isoleucine. Some embodiments of the invention se a tution of an amino acid corresponding to amino acid 279 of SEQ ID N0:l with an amino acid selected from the group ting of asparagine, glutamic acid and glutamine. Some embodiments of the invention comprise a deletion of an amino acid corresponding to amino acid 279 of SEQ ID NO:1. Some embodiments of the invention comprise the insertion or substitution of l, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids immediately next to or in place of an amino acid corresponding to amino acid 279 of SEQ ID N0: 1.

Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 285 of SEQ ID N011, e. 3., with an amino acid selected from the group consisting of alanine and aspartic acid. Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 285 of SEQ ID N011 with an [\J U) amino acid selected from the group consisting of glycine, e, valine, leucine and cine. Some embodiments of the invention comprise a substitution of an amino acid corresponding to amino acid 285 of SEQ ID N01 with an amino acid selected from the group consisting of ic acid, glutamic acid and glutamine. Some ments of the invention comprise a deletion of the an amino acid corresponding to amino acid 285 of SEQ ID NO:1. Some embodiments of the invention comprise the insertion or substitution of l, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids immediately next to or in place of an amino acid corresponding to amino acid 285 of SEQ ID N021.

Some embodiments of the invention comprise a substitution of the one or more of the amino acids corresponding to amino acids 279, 282, 283, 284 and 285 of SEQ ID N021. In W0 20121151468 PCT/U52012/036459 some embodiments, these amino acids are ed with glycine, isoleucine, proline, histidine and aspartic acid, respectively.

Some embodiments of the invention se mutations of the amino acids corresponding to 258, 259, 260, 279 and 285 of SEQ ID N021 as bed herein.

In some specific embodiments, the invention provides a factor B protein analog, that comprises the amino acid sequence of SEQ ID N022, 3, 21, 22, or 23 nally without any signal sequence, e.g., amino acids 1—25 contained therein). These factor B protein analogs can be used in methods of the invention.

The invention includes complement factor B n analogs that comprise a combination of the mutations (substitutions, deletions and additions) discussed . In some embodiments, these complement factor B analogs retain one or more of the attributes of the thl, th2, th3, th3-292S or 2S—740N analogs or any other complement factor B analog discussed herein. The invention further provides analogs that are fragments (for example comprising one or more domains of a ment factor B protein having one or more of the amino acid mutations set forth herein) of these analogs that have one or more of the attributes of the analogs discussed above, e.g., th3-2928N480. In addition, the analogs may comprise additional amino acid substitutions, deletions or insertions (for example, conservative amino acid substitutions, truncations of the N-terminus or C-terminus, etc.) such that the analog has at least 99.5%, 99%, 98%, 95%, 90%, 85%, 80%, 75% or 75% identity with the corresponding wild-type complement factor B or, in the case of an analog comprising a fragment of ment factor B, the analog has at least 99.5%, 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% identity between the corresponding parts of the analog and wild-type complement factor B.

The th3—292S and ZSN48O proteins contain the ing key features from N~terminus to C—terminus: 1) factor B protein native signal sequence for efficient secretion out of ian expression cells such as human 293 cells, CHO cells, BHK cells; 2) a mutated C3b-dependent factor D protein ge site (changing amino acids from K258R259K26O to A258A259A260); 3) a mutated C3b protein binding site (changing amino acid from D279 to G279; and amino acid from N285 to D285) to enable its tight binding with and trapping of C3b protein; and 4) a mutated free cysteine (changing amino acid C292 to 8292) to increase the amount of “active” or correctly folded protein.

In some embodiments of the invention, a human complement factor B protein analog is at least 90%, at least 95%, at least 98% or at least 99% identical to (i) SEQ ID NOs:l , 2, 3, 22 or 23; (ii) amino acids 26—764 of SEQ ID NOs:l, 2 or 3; (iii) amino acids 1990 or 26-990 W0 2012/151468 PCT/U52012/036459 of either of SEQ ID NOsz22 or 23; amino acids 26-480 of SEQ ID N022; and (iv) amino acids 1-1003 or 26-1003 of SEQ ID N026. In some embodiments, a human ment factor B protein analog of the invention ses (i) SEQ ID NOsz2, 3, 22, 23 or 26; (ii) amino acids 1—480 of SEQ ID NO:2; (iii) amino acids 26-480 of SEQ ID N022; (iv) amino acids 26—764 of SEQ ID NOs:2 or 3; (v) amino acids 26-990 of SEQ ID NOsz22 or 23; or (Vi) amino acids 26—1003 of SEQ ID N0226. In some embodiments, a complement factor B protein analog consists ially of (i) amino acids 26-764 of SEQ ID NO:2 or 3; (ii) amino acids 26-480 of SEQ ID N022 or 3; (iii) amino acids 26-990 of SEQ ID NOsz22 or 23; or (iv) amino acids 26-1003 of SEQ ID NO:26.

Figure 1 depicts the classical and lectin complement pathways (Figure 1a) and the alternative complement pathway (Figure lb). Both pathways utilize C3b. The C3bBb complex is a C3 convertase which converts C3 to C3b. Spontaneous dissociation (“decay”) of the C3bBb within minutes leads to its inactivation, Whereas properdin stabilizes the C3bBb complex. C3b participates in the C3 convertase to generate additional C3b thereby creating a positive feedback loop as shown by the large arrow. Several of the factors that attenuate the complement pathways, such as decay accelerating factor (DAF), do so by accelerating the decay of the C3 convertasc, C3bBb. t wishing to be bound by theory, some of the complement factor B analogs described herein bind C3b in place of a native complement factor B, thereby competing with native ment factor B for binding to C3b. Some complement. factor B analogs of the ion bind C3b to create an inactive complex or a x with significantly reduced C3 convertase ty as compared to a native C3bBb complex.

The invention also provides complement factor B analogs comprising mutations of amino acids corresponding to those in complement factor B that interact with s/molecules that accelerate the decay of the C3bBb complex. In some embodiments, a complement factor B analog comprises mutations of amino acids that interact with DAF.

These mutations include, but are not limited to, one or more mutations of amino acids corresponding to amino acids 290, 291, 323, 363, 364, or 407 of SEQ 1D N021. in some embodiments, these mutations are a tution or deletion of one or more of the amino acids corresponding to amino acids 290, 291, 323, 363, 364, or 407 of SEQ ID N021. In some embodiments, a complement factor B analog comprises one or more of the following mutations corresponding to K323E, K290A, K291A, Y363A, S364A or D407N of SEQ ID NO: 1. In some embodiments, a complement factor B analog comprises one of the ing combinations of mutations corresponding to K290A/K291A, Y363A/S364A or W0 2012/]51468 PCT/U82012/036459 K290A/K291 /S364A of SEQ ID N021. Without wishing to be bound by theory, mutations of amino acids in a ment factor B analog that interact with s/molecules that accelerate the decay of the C3bBb complex, may inhibit the decay of complexes of C3b and a complement factor B analog of the invention, thereby allowing for a complement factor B analog to better inhibit complement activity.

Exemplary procedures for generating cDNAs (cg, human wild type fB and three complement factor B s as well as four analogous murine sequences) and their incorporation into vectors are detailed in Example 8 of PCT Publication No. W008/106644 and US. Patent Publication No. U820100120665.

Nucleic Acids The invention includes nucleic acids comprising a nucleotide sequence encoding a complement factor B protein analog of the invention and es vectors comprising these nucleic acids.

To ensure local and long term expression of a nucleic acid of interest, some embodiments of the invention contemplate transdueing a cell with a nucleic acid or vector ng a complement factor B analog of the invention. The instant invention is not to be construed as limited to any one particular nucleic delivery method, and any available nucleic acid delivery vehicle with either an in vivo or in vitro c acid delivery strategy, or the use of manipulated cells (such as the technology of Neuroteeh, Lincoln, RI, e.g., see US.

Patent Nos. 6,231,879; 6,262,034; 6,264,941; 6,303,136; 804; 6,436,427; 6,878,544) as well as nucleic acids of the invention encoding a complement factor B analog per se (cg. , “naked DNA”), can be used in the practice of the instant ion. s delivery vehicles, such as vectors, can be used with the present invention. For example, viral vectors, amphitrophie lipids, cationic rs, such as polyethylenimine (PEI) and polylysine, [\3U! dendrimers, such as combburst molecules and starburst molecules, nonionie lipids, anionic lipids, vesicles, liposornes and other synthetic nucleic acid means of gene ry (e.g., see US. Pat. Nos. 6,958,325 and 7,098,030; Langer, Science 27-1533 (1990); Treat er al., in omes” in “The Therapy of Infectious Disease and Cancer”; and Lopez-Berestein & Fidler (eds), Liss, New York, pp. 317-327 and 353-365 (1989); “naked” nucleic acids and so on can be used in the practice of the instant invention.

A vector is a means by which a nucleic acid of interest (e. g., a therapeutic nucleic acid, e. 3., that can encode a eutic protein) is introduced into a target cell of interest. A vector is typically constructed or obtained from a starting material, such as a nucleic acid capable of carrying a n gene or transgene and which is capable of entering into and being expressed in a target cell. Suitable starting materials from which a vector can be obtained include transposons, plasmids, viruses, PCR products, cDNAs, mRNAs and so on, as known in the art. Methods for obtaining or ucting a vector of interest include, but are not d to, standard gene manipulation techniques, sequencing reactions, restriction enzymes digests, rase reactions, PCR, PCR , ligations, recombinase reactions (e.g., lnvitrogen’s GATEWAY® technology) other enzymes active on nucleic acids, bacteria and Virus propagation materials and methods, chemicals and reagents, site ed mutagenesis protocols and so on, as known in the art, see, for example, the Maniatis et a]. text, “Molecular Cloning.” Nucleic acids of the invention will lly comprise a promoter operatively linked to a complement factor B protein analog coding sequence. A promoter may be a tissue specific er, a cell specific promoter, an inducible er, a sible promoter, a constitutive promoter, a synthetic promoter or a hybrid promoter, for e. Examples of promoters useful in the constructs of the invention include, but are not limited to, a phage lambda (PL) promoter; an SV40 early promoter; 3 herpes x viral (HSV) promoter; a cytomegalovirus (CMV) promoter, such as the human CMV immediate early promoter; a tetracycline-controlled trans-activator-responsive promoter (tet) system; a long terminal repeat (LTR) promoter, such as a MoMLV LTR, BIV LTR or an HIV LTR; a U3 region promoter of Moloney murine sarcoma virus; a Granzyme A promoter; a regulatory sequencets) of the metallothionein gene; a CD34 promoter; a CD8 er; 21 thymidine kinase (TK) er; a B19 parvovirus promoter; a PGK promoter; a glucocorticoid promoter; a heat shock protein (HSP) promoter, such as HSP65 and HSP70 promoters; an immunoglobulin promoter; an MMTV promoter; 21 Rous sarcoma virus (RSV) promoter; a lac promoter; a CaMV 358 promoter; and a nopaline synthetase promoter. In some embodiments, a promoter is an MND promoter (Robbins er al., 1997, J. Virol. 7129466- 9474), or an MNC er, which is a derivative of the MND promoter in which the LTR enhancers are combined with a minimal CMV promoter (Haberman er al., J. Virol. 74(18):8732—8739, 2000).

In some embodiments, a vector of the invention comprises an intron, 6. g. , as part of the gene coding for a complement factor B protein . Heterologous introns are known and non-limiting examples include a human B-globin gene intron. An intron can be from a complement factor B gene or a heterologous intron.

W0 2012/]51468 PCT/U52012/036459 Signal sequences or leader sequences are known and can be used in complement factor B analog expression constructs. Signal sequences are translated in frame as a peptide ed to the amino-terminal end of a polypeptide of choice, the secretory signal sequence will cause the secretion of the polypeptide by interacting with the machinery of the host cell.

As part of the ory s, this secretory signal sequence will be cleaved off. The human placental alkaline phosphatase secretory signal sequence is an example of a useful signal sequence. The present ion is not limited by specific ory signal sequences and others are known to those skilled in the art. The term “signal sequence” also refers to a nucleic acid sequence encoding the secretory peptide. If a signal sequence is included, it can either be a wild type complement factor B sequence, a homologous sequence, or a heterologous sequence.

Viral Vectors The present invention includes viral s encoding a complement factor B analog(s) of the invention. Examples of viral vectors useful in the present invention are described in PCT Publication No. WODS/106644 and US. Patent Publication No.

US20100120665. The present invention is not limited to a particular viral vector. Viral vectors include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors (see, for example, US. Pat. No. 7,045,344), AAV vectors (e. g., see US. Pat. No. 7,105,345), Herpes viral vectors (e. g., see US. Pat. Nos. 5,830,727 and 172), hepatitis (e. g., tis D) viral vectors (e.g., see US. Pat. No. 347), SV40 vectors, EBV vectors (e.g., see US. Pat. No. 6,521 ,449) and Newcastle disease virus vectors (e.g., see US. Pat.

Nos. 6,146,642, 7,442,379, 7,332,169 and 979). In some embodiments, a lentiviral vector is an HIV, EIAV, SIV, FIV or BIV vector. The invention also provides a cell that produces a viral vector of the invention. [0 U1 Examples of BIV s are described, for example, in Matukonis et al., 2002 Hum.

Gene Then 13, 1293-1303; Molina er al., 2002 Virology. 304, 10-23; Molina et al., 2004 Hum. Gene Ther., 15, 65—877; US. Pat. Nos. 6,864,085, 7,125,712, 7,153,512; PCT ation No. W008/106644 and US. Patent Publication No. 11820100120665.

Vector virions of the invention may be administered in vivo or in vitro to cells (e. g., mammalian cells). s (viral or nonviral) can be used to uce or transform cells including, but not limited to, undifferentiated cells, differentiated cells, somatic cells, primitive cells and/or stem cells. in some embodiments, stem cells are intended for administration to a human and not for implantation in a suitably pseudopregnant woman for differentiation and development into an infant.

In some embodiments, a viral vector of the ion comprises a decay rating factor (DAF). For example, an enveloped viral vector includes a DAF on the viral membrane. In some embodiments, a DAF is a Wild-type DAF. In some embodiments, a DAF is part of a fusion protein with an envelope protein, e. g., see Guibinga e! at. Mo] Ther. 2005 11(4):645-51. In some embodiments, a BIV producer cell ses a DAF.

Production Of Complement Factor B Analogs Of The Invention The complement factor B n analogs of the invention can be produced from a cell. In some embodiments, the complement factor B protein analog is then purified from the cell and/or from cell culture medium.

The invention includes ('1) cells comprising a nucleic acid comprising a nucleotide sequence ng a complement factor B analog of the invention and/or (ii) cells expressing a complement factor B protein analog of the invention. In some embodiments, a mammalian cell is utilized. In some embodiments, a prolcaryotic cell is utilized.

Host cells are typically transfected or transduced with an expression or cloning vector for protein production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, amplifying the genes encoding the desired sequences or for ream purification and/or concentration procedures.

Suitable host cells for cloning or expressing a coding region in a vector are prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes for this purpose include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobaeteriaceae such as Escherichia, e. g., E. coli, Enterobaeter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e. g., Serratia marcescans, and Shigella, as well as Bacilli such as B. is and B. licheniforrnis (e.g., B. licheniformis 41F), monas such as P. aeruginosa, and Streptomyces. In some embodiments, an E. coli cloning host is E. coli 294 (e.g., ATCC 31,446). although other strains such as E. coli B, E. coli X1776 (e.g., ATCC 31,537), and E. coli W3110 (e. g., ATCC ) may be suitable.

In addition to prokaryotes, otic microbes such as filamentous fungi or yeast are suitable g or expression hosts. Saccharomyces cerevisiae, or common baker‘s yeast, is commonly used among lower eukaryotic host rganisms. r, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as, e.g., K. lactis, K. fragilis (e.g..

A'l‘CC 12,424), K. bulgaricus (e.g., ATCC 16,045), K. wickeramii (e.g., ATCC 24,178), K. waltii (e.g., ATCC 56,500), K. drosophilarum (e.g., ATCC 36,906), K. thermotolerans, and K. marxiamis; yan'owia (e. g., EP402,226); Pichia pastoris (e.g., EP183,070); Candida; Trichoderma reesia (e. g., EP244,234); Neurospora crassa; Schwanniomyces such as Schwanniomyces occidentalis; and ﬁlamentous fungi such as, e.g., Neurospora, Penicillium, cladium, and Aspergillus hosts such as A. nidulans and A. niger. le host cells, 6. g., for the expression of glycosylated proteins, can be derived from multicellular organisms. es of invertebrate cells e plant and insect cells.

Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedcs acgypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitﬂy), and Bombyx mori have been identiﬁed and can be used for sing proteins. A variety of viral strains for transfection can be used for n expression and are publicly available, e.g., the L-1 variant of Autographa califomica NPV and the Bin-5 strain of Bombyx mori NPV, and such viruses may be used according to the present invention, for example, for transfection of Spodoptera frugiperda cells. Plant cell cultures of cotton, corn, potato, n, petunia, tomato, and tobacco can also be utilized as hosts Some embodiments of the invention utilize vertebrate or mammalian cells. and propagation of vertebrate cells in culture (tissue culture) can be a routine procedure.

Examples of useful mammalian host cell lines are a monkey kidney CV1 cell line transformed by SV40 (e.g., COS—7, ATCC CRL 1651); human embryonic kidney line (e.g., 293 or 293T cells including either cell line subcloned for growth in sion culture, Graham at (11., J.

Gen Virol. 36:59 (1977) such as 293 Freestyle rogen, Carlsbad, CA)) or 293F1‘; baby hamster kidney cells (e.g., BHK, ATCC CCL 10); e hamster ovary cells; Chinese hamster ovary cellsl—DHFR (e.g, CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 7724216 (1980)); mouse i cells (e.g., TM4, , Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (e. g., CV1 ATCC CCL 70); African green monkey kidney cells (e.g., VERO-76, ATCC CRL-1587); human cervical oma cells (e.g., HELA, ATCC CCL 2); canine kidney cells (e.g., MOCK, ATCC CCL 34); CF2TH cells; buffalo rat liver cells (e. g., BRL 3A, ATCC CRL 1442); human lung cells (e.g., W138, ATCC CCL 75); human liver cells (e. g., Hep G2, HB 8065); mouse mammary tumor cells (e.g., MMT 060562, ATCC CCL51); ’l‘RI cells (Mather er (1]., Annals NY. Acad. Sci. 383:44-68 (1983)); MRC 5 cells; and PS4 cells.

WO 51468 PCT/U52012/036459 In some instances, a host cell may be modified to decrease or eliminate expression of an endogenous protein. For example, if a complement. factor B protein analog is to be produced in a particular host cell (e. g., a CHO cell), then the host cell could be modified so as expression of the host cell’s native factor B protein (e.g., hamster factor B) is reduced or eliminated. This may be advantageous for the downstream cation of the complement factor B protein analog. Therefore, the invention provides a method of producing a complement protein analog of the invention sing reducing or eliminating the expression of the corresponding native ment protein in the host cell. Methods for reducing, eliminating or knocking out expression of a host cell protein are known in the art.

For e, a protein’s expression level may be reduced or eliminated by engineering the host cell to express inhibitory RNA (eg. , RNAi) specific for the RNA coding for the protein.

For example, Clontech (Mountain View, CA) sells s vectors and kits, such as those referred to as part of the KNOCKOUTTM RNAi s, for knocking down expression of proteins in a host cell. Other methods include gene targeting by homologous recombination which allows the introduction of specific mutations into any cloned gene, e.g., see t Protocols in Molecular y, John Wiley & Sons, Inc, 1994-1998, Sections 9.16 and 9.17. This can be used to knockout the gene expressing the host cell protein.

Another method which may be utilized to reduce expression of an endogenous protein, involves using a targeted ription factor that represses expression of the endogenous protein. For example, a repressor domain from a ription factor may be attached or fused to a DNA binding domain such as a zinc finger polypeptide. One skilled in the art can design zinc finger polypeptides that bind specific DNA sequences, e. g., see U.S.

Patent Nos. 6,140,081; and 7,067,617; and U.S. Published Patent ations 20060078880; 20040224385; and 20070213269. One skilled in the art can associate designed zinc finger polypeptides with a transcriptional repressor domain (e.g., a KRAB (Kriippel—associated box) domain). Examples of such molecules and techniques are described in Beerli at all (Proc Natl Acad Sci U S A. 2000 97(4):ié95~1500) and US. Published Patent Application 20070020627. in some embodiments of the invention, a host ceii would be transtiuced with a vector expressing the transcriptionai repressor. This approach has an advantage over knocking out the gene of interest using homologous recornbinatirm e, in most cases, a host celi wiii he diploid and it would be ble to knock out both gene copies. Whereas, expression or" a transcriptional repressor should repress expression of both gene copies.

The expression of particular endogenous protein may also be reduced using compounds that will directly or ctly reduce the expression of the particular endogenous W0 51468 PCT/U82012/036459 protein. Using fB as an example, various compounds can be used to reduce the expression of endogenous fB sion. For example, fB protein expression has been shown to be inhibited by histamine (Falus & Meretey, Immunology 1987 60:547-551 and Falus & Merctcy, Mol Immunol 1988 25(11):1093—97), sodium butyrate (Andoh er a}. Clin Exp Immuno 1999 118:23-29), a glucocorticoid such as dexamethasone (Dauchel e! al. Eur J Immunol 1990 1669-75), platelet derived growth factor (Circolo e1 (ti. 1990 The Journal of Biol Chem 265(9):5066-5071), epidermal growth factor (Circolo er a1. 1990), and fibroblast growth factor (Circolo at at. 1990). A host. cell of the invention may be cultured in the presence of any one or combination of these molecules to reduce the endogenous expression of complement factor B n. Therefore, in some embodiments of the ion, a host cell expressing a complement factor B protein analog is cultured in the presence of any one or more compounds selected from the group consisting of a histamine, a sodium butyrate, a glucocorticoid (e.g., dexamethasone), a platelet d growth factor, an epidermal growth factor, or a fibroblast growth factor.

Various compounds and proteins have been shown to upregulate or maintain expression of complement factor B protein. For example, complement factor B n expression has been shown to be uprcgulatcd or ined by tumor necrosis factor (TNF) (Andoh et a}. Clin Exp Immune 1999 118:23-29), estrogen (Sheng—Hsiang er a}. y of Reproduction 2002 66322-332), Interleukin-1 (Dauchel at al. Eur J Immunol 1990 (8):1669—75), dexamethasone (Lappin & Whaley, Biochem J 1991 280:117-123), prednisolone (Lappin & Whaley 1991), cortical (Lappin & Whaley 1991), and Interferon- gamma (Huang et a3. 2001 Eur J Immunol 31:3676-3686). A host cell of the invention may be cultured in the absence of any one or combination of these molecules to reduce the endogenous expression of complement factor B protein. Additionally, a host cell may be cultured in the ce of an inhibitor of any one or more of these compounds. Therefore, in some ments of the invention, a host cell expressing an ment factor B protein analog is cultured in the presence of any one or more nds that inhibit a compound selected from the grOup consisting of a TNF, estrogen, interleukin-1, dexamethasone, prednisolone, cortical, and interferon-gamma. In some embodiments, expression by the host cell of one or more of these compounds is reduced, e.g., using s as described herein.

Examples of inhibitors of estrogen include, but are not limited to, tamoxifen. tors also include antibodies that bind and reduce the activity of the compound. For example, various antibodies that bind and inactivate TNF are know in the art.

A complement factor B n analog containing composition prepared from cells can be puriﬁed using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, size exclusion chromatography, ty chromatography, afﬁnity chromatography, tangential flow purification, diafiltration, ion ge chromatography, hydrophobic interaction tography (HIC), reverse phase chromatography, n sepharose afﬁnity chromatography and other known forms of separation and concentration.

Following any preliminary purification step(s), a mixture comprising a complement factor B protein analog and contaminants, if any, may be subjected to low pH hydrophobic ction tography, 6. 3., using an elution buffer at a pH between about 2.5-4.5, in some cases performed at low salt concentrations (e.g., from about 0-0.25M salt) or other procedures for further purification.

In some embodiments, a complement factor B protein analog of the invention is at least 90%, at least 93%, at least 95%, at least 98%, at least 99.5% or at least 99.9% pure in relation to total protein.

The invention also provides methods of producing a complement factor B protein analog comprising expressing in a cell a complement factor B protein analog of the ion and purifying the complement factor B protein analog.

Complement ed Conditions/Diseases There are three ys of complement activation, the classical pathway, the alternative pathway, and the lectin pathway (Figure l). Described herein are examples of complement factor B protein analogs of the invention. In some embodiments, these complement factor B protein analogs can attenuate the alternative pathway of complement activation. However, based on the way all three ment pathways intersect, these analogs can diminish inflammation caused by any of the three complement pathways and Ix) U! y provide therapy for any illness whose etiology involves, at least in part, complement activation. These include, but are not limited to, early AMD, wet AMD, and geographic atrophy. Figures lA and 1B outline complement pathways. Note that they intersect at C3b.

The invention provides methods of treating a complement-mediated disease comprising stering to a t a pharmaceutical preparation of the invention, a complement factor B analog of the invention or a nucleic acid or vector encoding a complement factor B analog of the invention. The invention also includes methods of inhibiting complement activity, wherein the method comprises administering to a human subject a d human complement factor B analog in an amount sufficient to inhibit a PCT/U82012/036459 complement pathway by competing with binding of native complement factor B in the subject, wherein the mutated human complement factor B analog is an active complement factor B analog of SEQ ID NO:4 having cysteine amino acids that form de bonds and a free cysteine amino acid that has been substituted by an amino acid selected from the group consisting of histidine, isoleueine, leucine, methionine, phenylalanine, serine, threonine, tyrosine, and valine‘ In some embodiments, the mutated complement factor B analog comprises SEQ ID N02, 3, 22 or 23.

The invention also provides methods of inhibiting complement activity, wherein the methods comprise ucing to a site of the complement ty a complement factor B analog of the ion, a nucleic acid of the ion, a viral vector of the invention, a pharmaceutical composition/preparation of the invention, or any combination thereof in an amount sufficient to inhibit the complement activity. In some embodiments, a method of the invention utilizes a complement factor B is an analog of SEQ ID NO:4 having ne amino acids that form disulfide bonds and a free cysteine amino acid that has been tuted by another amino acid.

The invention provides methods of inhibiting complement activity, n the methods se introducing to a site of the complement activity a d human complement factor B analog in an amount sufficient to inhibit the complement activity by the mutated human complement factor B analog ing with binding of native complement factor B, wherein the mutated human complement factor B analog is an active complement factor B analog of SEQ ID NO:4 having cysteine amino acids that form disulfide bonds and a free cysteine amino acid that has been substituted by an amino acid. In some embodiments, this method utilizes a complement factor B analog comprising amino acids 26-764 of SEQ ID N02, amino acids 26-764 of SEQ ID NO:3, amino acids 26-990 of SEQ ID N022 or amino acids 26—990 of SEQ ID N0223.

Complement pathways are a part of the immune system known as the innate immune System that provides immediate protection from infection prior to activation of the humoral and cell mediated branches of the immune system. They are activated and vated through cascading reactions that exhibit high order kinetics but are remarkably well— regulated. The alternative complement pathway, in ular, has evolved to cycle up with great rapidity through a positive feedback loop.

Complement factor B protein analogs of the invention and/or the vectors that express them may advantageously be used for local and/or systemic administration to a mammal and/or to treat chronic diseases. In some embodiments of the invention, a complement factor WO 2012151468 PCT/U52012/036459 B analog inhibits a complement pathway by ing with binding of the native complement factor B, e. g. to C3b protein and/or factor D protein. This can allow attenuation of complement ty as opposed to complete blockade of the pathway. Therefore, it may be possible to downregulate complement activity to a level that is therapeutic (e.g., alleviates some ms or their severity) without completely blocking ment activity. Thus, ng or decreasing the risks associated with blockage of complement activity, such as increased risk of infection. Therefore, the present invention provides methods for treating a ment mediated disease (e.g, a c disease) by local or systemic administration (e. g., i.v., intraperitoneal or oral) of a complement factor B protein analog of the invention.

In some embodiments, the present invention provides compositions and methods for modulating, regulating, inhibiting and/or enhancing a complement activity. Complement— related pathways include, but are not d to, the classical, lectin and alternative complement ys. In some cases, a complement~related pathway may play a role in a particular condition, disease or diseases. ore, some embodiments of the invention provide methods of regulating, ing, curing, inhibiting, preventing, ameliorating, slowing progression of and/or ng a disease state mediated by one or more complement- related pathways by administering a ment factor B analog of the invention or a nucleic acid or vector encoding a complement factor B analog of the invention. Such disease states or conditions include, but are not limited to, drusen formation, macular degeneration, AMD, dry eye, corneal ulcers, atherosclerosis, diabetic retinopathy, vitreoretinopathy (Grisanti e: at.

Invest. Ophthalmol. Vis. Sci. 322711-2717), corneal inflammation, airway hyperresponsiveness, -related diseases, autoimmune-related diseases, lupus nephritis, systemic lupus crythcmatosus (SLE), arthritis (e.g., rheumatoid arthritis), rheumatologic diseases, anti—phospholipid antibody syndrome, intestinal and renal I/R injury, asthma, atypical tic—uremic me, Type II membranoproliferative glomerulonephritis, non—proliferative glomerulonephritis, fetal loss (e.g, spontaneous fetal loss), glaucoma, uveitis, ocular hypertension, brain injury (e.g., traumatic brain injury), stroke (e.g., see Arumugam er a], PNAS 93(12):5872~6 (1996)), post~traumatic organ damage, thermal trauma (e. g., burn injury)post infarction organ damage (cg, c, neurological), vasculitis, ki disease, hereditary angioedema (HAE), paroxysmal nocturnal hemoglobinuria (PNH, sometimes referred to as Marchiafava—Micheli syndrome), s, inflammatory bowel disease, tumor metastasis, ischemic-reperfusion injury, cerebrovascular accident, Alzheimer's disease, transplant rejection (e. g., xeno and allo), infections, sepsis, septic shock, n’s syndrome, myasthenia gravis, antibody-mediated skin diseases, all antibody- mediated organ-specific diseases ding Type I and Type II diabetes mellitus, thyroiditis, idiopathic thrombocytopenic purpura and hemolytic anemia, and neuropathies), insulin resistance syndrome (e. g., see Weyer et at. (2000) Diabetes Care, 23(6):779-785), gestational diabetes, multiple sclerosis, psoriasis, cardiopulmonary bypass injury, polyarteritis nodosa, Henoch Schonlein purpura, serum sickness, Goodpasture‘s disease, systemic izing itis, post streptococcal glomerulonephritis, idiopathic pulmonary fibrosis (usual interstitial nitis), membranous glomerulonephritis, myocarditis (e. g., mune myocarditis) (Kaya et al. Nat Immunol. 2001;2(8):739-45), myocardial infarction, muscular dystrophy (e. g. , ated with dystrophin-deficiency), acute shock lung syndrome, adult respiratory distress syndrome, usion, and/or a complement mediated disease.

In some embodiments, a complement-mediated disease is a disease of the eye. In some embodiments, a complement factor B analog or pharmaceutical composition is administered to the eye, for example, by intravitreal injection, subretinal injection, injection to the intraanterior chamber of the eye, injection or application locally to the cornea, subconjunctival injection, subtenon injection, or by eye drops. In some embodiments, a pharmaceutical composition is administered to the eye, wherein the pharmaceutical composition comprises at least one complement factor B analog, 6. g., selected from the group MES-292$ (SEQ ID N02), th3-292S-740N (SEQ ID N023), thB—29ZS-Fc (SEQ ID N022) and th3-29ZS-74ON-Fc (SEQ ID N023).

Age-related macular degeneration (AMD) is the most common cause of decreased vision in individuals over 65 years of age in the developed world. Dry AMD is characterized by a progressive degeneration of the macula causing central field visual loss. A more acute tating AMD includes ﬂorid neovascularization and extravasation in the retina, known as wet AMD. There is currently no effective therapy for AMD.

A characteristic of AMD is the accumulation of , located between the basal lamina of the retinal pigment epithelium (RPE) and the inner layer of Bruch’s ne (Pauleikhoff et (11., 1990 Am. J. lmol. 109, 38—43; Bressler et all, 1990 Arch.

Ophthalmol. 108, 1442-1447). Drusen, as well as other age—related changes that occur proximal to Bruch’s membrane, are believed to contribute to the dysfunction and degeneration of the RPE and retina by inducing ischemia as well as restricting the exchange of nutrient and waste products between the retina and choroid wed by Bird, 1992 hysiology of AMD. In Age-Related Macular Degeneration: Principles and Practice on, G., and Nelsen, P.T., eds.) Chap. 3, Raven Press, New York). Several studies have ted -mediated processes in the development of AMD. Importantly, 2012/036459 autoantibodies were detected in the sera of AMD patients (Penfold 61611., 1990 Graefes Arch.

Clin. Exp. Ophthalmol. 228, 4), as predicted by the hypothesis that immune and inﬂammatory-mediated processes are involved in the development and/or removal of drusen.

The formation of drusen in the eye can be ated with various diseases such as macular degeneration. In some cases, drusen formation and/or its ation with a disease has been implicated to be related to ment activity. Some embodiments of the invention provide compositions and methods for ting, regulating, inhibiting, reducing. retarding and/or reversing the formation or growth of drusen in an animal, such as a human.

For example, compositions or molecules of the invention may be delivered. to drusen (e.g., by direct injection into drusen {intradrnsen ion). adjacent to drusen or intravitreal injection). Some embodiments of the invention can be utilized to slow the. progression of macuiar degeneration, possibly by inhibiting drusen formation. ectin, an abundant component of drusen, is also a component of extracellular deposits associated with atherosclerosis (Nieulescu et (11., 1989 Atherosclerosis, 78, 197-203), amyloidosis (Dahlback er (1]., 1993 J. Invest. Dermatol. 100, 166-170), elastosis (Dahlback et (1]., 1988 Acta Derm.

Venereol. 68, 107—115), and MPGN type II (Jansen et al., 1993 Am. J. Pathol. 143, 1356— 1365). Vitronectin is a multifunctional protein that functions in cell adhesion, nance of tasis, and inhibition of complement-induced cell lysis (Preissner, 1991 Ann. Rev.

Cell Biol. 7, 275-310). Furthermore, atherosclerotic plaques share a number of other constituents with drusen, such as complement components and apoliproprotein E. An association between advanced AMD and sclerosis of carotid arteries was reported in an epidemiological study (Vingerling et (11., 1995 Am. J. Epidemiol. 142, 404-409) and another study fied a significant correlation between elastotic degeneration of nonsolar—exposed dermis and choroidal neovascularization in AMD patients (Blumenkranz et (11., 1986 Ophthalmology, 93, 552—558). Finally, amyloid B peptide, a major constituent of neuritic plaques in Alzheimer’s disease, is also found in drusen (Johnson et al., 2002 Proc. Natl.

Acad. Sci. USA, 99, 11830—11835). Amyloid B peptide has been implicated as a primary activator of complement (Bradt et (11., 1998 J. Exp. Med. 188, 431-438). hensive analysis of the molecular composition of human drusen, as well as of the RPE cells that ﬂank or e drusen, trated immunoreactivity to immunoglobulins and components of the complement system that are associated with immune complex tion (Johnson et (11., 2000 Exp. Eye Res. 70, 441-449). Drusen also contains multifunctional proteins such as vitronectin (Hageman et ((1., 1999 FASEB J. 13, 477—484) and apolipoprotein E (Anderson et al., 2001 Am. J. Ophthalmol. 131, 767-781) that 20121036459 play a role in immune system modulation. In addition, molecules involved in the acute phase response to inflammation, such as amyloid P component and al-antitrypsin, have also been identified in drusen ns et al., 2000 The FASEB Journal, 14, 835-846), as well as proteins involved in coagulation and fibrinolysis (factor X, thrombin, and fibrinogen) (Mullins eta]., 2000 The FASEB Journal, 14, 835-846). Drusen formation and associated RPE pathology were suggested to bute to a chronic inﬂammatory response that activates the complement cascade (Hageman er (11., 2001 Prog. Retin, Eye Res. 20, 2; Johnson et al., 2001 Exp. Eye Res. 73, 887896).

One other form of an optic disorder arising from AMD and resulting in perturbations of the retina is geographic atrophy, which leads to death of patches of rod and cone cells, as well as of the RPE cells.

Atherosclerosis has been shown to typically involve complement related pathways, 6.3., see Niculescu at of. immunologic Research, 30(1):73~80{8) (2004,) and Niculescu anti l—lorea, immunologic Research 30( l )t73ASO (2004). (’Ioinplement activation and (3510—9 deposition lly occurs both in human and experimental atherosclerosis. 9 may be responsible for cell lysis, and sublytic assembly of (Eb-9 induces smooth muscle cell (SMC) and endothelial cell (EC) tion and proliferation. Complement {16 deficiency has a rotective effect on diet—induced atherosclerosis, suggesting that est—9 assembly is required for, or at least plays a significant role, in the progri-zssion of atherosclerotic lesions. sag see Niculescu and l—lorea, immunologic Research 30(l}:73-80 (2004). Some embodiments of the ion maybe used to inhibit the formation of (lib-9‘ and/or t atherosclerosis. In some embodiments, a complement factor 3 protein analog of the invention is administered to a site or potential site of atherosclerosis. This complement factor El protein analog inhibits a pathway (e.g., the classical and/or alternative complement pathway) which in turn inhibits the. formation or activation of (lib—9 or another complement pathway related compound involved in ametosclerosis. There may be other complement related proteins ed in atheroselerosis whose formation and/or tion may he inhibited or blocked in a similar Airway hyperresponsiveness (AHR) is teristic of s diseases including, but not limited to, asthma (e. g., allergic asthma). AHR has been shown to lly involve complement related pathways, e. g., see Taube at £115., 20061’NAS 103(21):8084~80$9; l’arii at at, American Journal of Respiratory and Critical Care Medicine 169726—732, (2004): tnan and Hotels, 1 Immunology l76:l305—i3 l 0 {2006) and US l‘atent l’ublication No. 20050260198. Park. at (1.}. showed that Crry—lg administered by intrapezitoneal injection had W0 2012/151468 an effect on ARR. Some. embodiments of the invention provide compositions and methods for inodniating, regulating, ting anclfor reducing AER in an animal, such as a human.

Specific AER related diseases that may be treated, alleviated, inhibited anthor ameliorated include, but are not limited. to, asthma, chronic obstructive pulmonary disease (CORD), allergic bronchopuiinonaiy aspergiliosis, hypersensitivity pneumonia, eosinophilic pnenn’ionia, yseina, bronchitis allergic bronchitis bronchiectasis, cystic fibrosis, tubercuhasis, hypersensitivity pneumonitis. occupational . sarcoid. reactive airy 'ay disease me, titiai lung disease, eosinophilic syndrome, rhinitis, sinusitis, exercise-induced asthma, pollution-induced asthma, cough variant asthma parasitic ung disease, respiratory syncytial virus (RS V) infection, parainfluenza virus (13W) infection, rhinovirus (RV) infection, Hantazin virus (6. g., four—corners strain) and adenovirus infection related diseases such as autoimmune-related diseases, HLA-B27 associated inﬂammatory diseases, lupus nephritis and ic lupus erythematosus (SLE) have been shown to typically involve complement related pathways, e. g., see Tlmi‘inan and Holers, J Innnunology 176:1305-1310 (2006). Lupus nephritis is one cation of SLE. It is related to the autoimmune process of lupus, where the irnn'iune system produces antibodies (antinuclear antibody and others) against body ents. Complexes of these antibodies and complement ents typically accumulate in the kidneys and result in an inflammatory response. Some embodiments of the invention prmiide methods and compositions for regulating, modifying, curing, inhibiting, preventing, ameliorating and/or treating an immune-related disease, e.g, ing or related to a complement pathway, such as SLE.

Arthritis has been shown to lly involve complement related pathways, e.g., see ' n and Holcrs, J immunology 176:1305-1310 (2006) and Honda er al. J l. :1904—12 (2006). line alternative complement y plays a significant role in the ion of arthritis and the alternative eornplen‘ient pathway may even he required. Some embodiments of the invention provide methods and compositions for regulating, modifying, , inhibiting, ting, ameliorating and/or treating arthritis, e. g, rheumatoid arthritis or inﬂammatory arthritis.

Paroxysmal nocturnal hemoglobinuria (PNH) a potentially life—threatening disease of the blood characterized by complement-induced intravascular hemolytic anemia and thrombosis due to intravascular destruction of red blood cells (RBCs) by complement resulting in uncontrolled amplification of the complement system that leads to destruction of the RBC membrane. Persons with this disease typically have blood cells that are missing a W0 2012/]51468 PCT/U52012/036459 gene called PIG-A. This gene allows a substance called glycosyl—phosphatidylinositol (GPI) to help certain proteins stick to cells. Without PIG-A, complement regulating proteins cannot connect to the cell surface and protect the cell from complement. Some embodiments of the ion provide iriethods and compositions for regulating, modifying, curing, inhibiting, preventing, ameliorating and/or treating Paroxysmal nocturnal obinuria.

Hereditary angioedema (HAE) is a potentially life-threatening genetic condition typically caused by a ency of the C1 inhibitor, a protein of the complement system.

Symptoms include episodes of edema (swelling) in s body parts including the hands, feet, face and airway. Hereditary angioedema (HAE) exists in three forms, all of which are caused by a genetic mutation that is inherited in an autosomal dominant form. Types I and II are caused by mutations in the SERPINGl gene, which result in either diminished levels or dysfunctional forms of the Cl—inhibitor protein (type I HAE). Type III HAD has been linked with mutations in the F12 gene, which encodes the coagulation protein Factor XII. All forms of HAE lead to abnormal activation of the ment system. Some current treatments include Ecallantide a peptide inhibitor of kallikrein (e.g., see US. Patent Publication No.

US20070213275), ant (Firazyr, Jerini) which is a selective bradykinin receptor antagonist, and Cinryze (Viropharma, Inc.) a C1 esterase inhibitor. Some embodiments of the invention provide methods and compositions for ting, modifying, curing, inhibiting, preventing, ameliorating and/or treating Paroxysmal nocturnal obinuria.

Glaucoma is a group of diseases of the optic nerve involving loss of retinal ganglion cells in a characteristic pattern of optic neuropathy. Approximately 25% of glaucoma ts with retinal ganglion cell loss have normal ocular re. Ocular hypertension (OHT) is a significant risk factor for developing glaucoma and lowering it via pharmaceuticals or y is currently the ay of glaucoma treatment. Ocular hypertension and glaucoma have been shown to typically involve complement related pathways, e. g., see a at (11., Molecular Vision, 13:293-308 (2007); Stasi at (if. IOVS 47(3): 1024—1029 (2007); and Kuehn at all, Experimental Eye Research 83:620-628 (2006).

Expression and/or the presence of Clq and C3 have been shown to be higher in retina subjected to OHT. Some embodiments of the invention provide methods and compositions for regulating, modifying, curing, inhibiting, preventing, ameliorating andfor treating Uveitis has been shown to typically be associated with the ment pathway, e. g., see Mondino and Rao, Investigative lmology & Visual Science 24:380-384 (1983) and Jha (at (22. Molecular Immunology 1—3908 (2007). Mondino and Rao found that W0 2012/151468 2012/036459 mean values of all tested complement components in aqueous humor to serum measurements were increased in patients with a history of previous eye surgeries and were highest in patients with anterior s. Some embodiments of the invention provide methods and cen'iposititms for regulating, modifying, curing, inhibiting, preventing, ameliorating and/or treating s.

Diabetic retinopathy is one of the leading causes of vision loss in middle-aged individuals. Activation of the complement system is believed to play an important role in the pathogenesis of diabetic retinopathy (e.g., see Jha at a]. Molecular Immunology 44:3901 — 3908 (2007)). Some embodiments of the invention provide methods and compositions for regulating, modifying, curing, inhibiting, ting, ameliorating and/or treating ic retinopathy, Proliferative vitreoretinopathy (PV) is one of the most common complications of retinal ment. PV has been linked to complement activity, e. g., see Grisante e: at.

Invest Ophthalmol Vis Sci. 1991 ;32(l O):27 l l-7 and Grisante at al. Uplithalmologe. 9(i):50-4. Some embodiments or" the invention provide methods and compositions for ting, modifying, curing, inhibiting, preventing, ameliorating and/or treating PV.

Anti-phospholipid antibody syndrome, intestinal and renal ischemic reperfusion l/R injury, atypical hemolytic-uremic me, Type II membranoproliferative glomerulonephiitis, and fetal loss (e.g., spontaneous fetal loss), have been shown to typically involve complement related pathways, e.g. , see Thurman and Heller's, I lmmunoiogy 176113054310 .

Brain injury (e.g., traumatic brain injury) has been shown to typically involve complement related pathways, 6. 3., see Leinhase at at, J Neuroinﬂammation 4: 13 (2007) and BMC Neurosci.7:55 (2006). Leinhase 2006, showed that after experimental traumatic brain injury in wild—type (fB+/+) mice, there was a time—dependent ic complement activation. In contrast, the extent of systemic complement tion was significantly attenuated in fB-l- mice. Some embodiments of the invention provide. methods and itions for regulating, modifying, curing, inhibiting, preventing, rating and/or treating neuronal cell death, traumatic neural injury (a. g. brain), complement-mediated neuroinflammation and/or neuropathology.

Ischemia—reperfusion injury can cause increases in the production of or oxidation of various potentially l compounds produced by cells and tissues, which can lead to oxidative damage to or death of cells and tissues. For example, renal ischemia-reperfusion injury can result in histological damage to the s, including kidney tubular damage and changes characteristic of acute tubular is. The resultant renal dysfunction permits the accumulation of enous wastes ordinarily excreted by the , such as serum urea nitrogen (SUN). ia-reperfusion may also cause injury to remote organs, such as the lung. Some embodiments of the ion utilize modulators, such as inhibitors, of a complement pathway (e.g., inhibitors of factor B activity), e. 3., when administered to an animal that has, or is at risk of experiencing or developing, ischemia-reperfusion. In some embodiments, these modulators, t, reduce or inhibit at least one symptom of injury due to isehemia-reperfusion. Other types of ischemia-reperfusion injury, that can be prevented or reduced using methods and compositions of the invention, include, but are not limited to, cardiac ischemia—reperfusion injury such as myocardial infarction or coronary bypass surgery, central nervous system ischemia-reperfusion injury, ischemia—reperfusion injury of the limbs or digits, ischemia-reperfusion of internal organs such as the lung, liver or intestine, or ischemia-reperfusion injury of any transplanted organ or tissue. See, e.g., PCT Publication No. WOO3/061765 which discusses myocardial infarction and complement pathways.

Inﬂammation is a major gic determinant of myocardial infarction r, 2007 Nutr. Rev. 65(12 Pt 2):8253-9). It has also been shown that delivery (e.g., oronary) of bone marrow (stem) cells leads to an improvement in systolic function after acute dial infarction (Wollert, 2008, Curr. Opin. Pharmacol. Jan 31 [Epub]). Also, bone marrow stem cells can regenerate infarcted myocardium (Orlie at at 2003 Pediatr. Transplant. 7 Suppl 3:86-88). Mesenchymal stem cells have been shown to provide a cardiac protective effect in isehemic heart disease (One at a]. 2007 Inflammation 30(3-4):97-104). In the t invention, delivery of the stem cells can be by any means, such as intraeoronary injection, injection directly into myocardium (e. g., into diseased and/or healthy myocardium (e.g., adjacent to the injured area». In some embodiments, a mammal is d with nes to ze their bone marrow stem cells in the circulation allowing the stem cells to traffic to the myocardial infarct.

Various stem cells have been used in viva for various applications. One problem with the use of stem cells in vivo is the lower than desired survival and/or seeding of the stem cells, e. g., in the area of interest. One significant reason for low seeding and survival of stems cells can be inﬂammation at the site. Therefore, the present invention provides a method of treatment and/or a method of improving stem cell survival and/or seeding. In some embodiments, these methods comprise administering a composition of the invention before, during and/or after administration or zation of stem cells. In some embodiments, complement inhibitors of the invention act as anti-inﬂammatory agents that will create a W0 2012/]51468 PCT/U52012/036459 favorable environment for stem cells to home in and survive in the area of desired g (e. g., damaged heart or bone marrow) and therefore repair or e the damaged tissue.

Stem cells may be administered in a solution that also contains a complement factor B protein analog of the invention. Stem cells may be, but are not limited to, hematopoietic stem cells, embryonic stem cells, mesenehymal stem cells, neural stem cells, mammary stem cells, olfactory stem cells, pancreatic islet stem cells, totipotent stem cells, multipotent stem cells or pluripotent stem cells. The stem cells may be autologous, allogeneic, or syngeneic.

Complement activity appears to be involved in muscular phy (e.g., associated with dystrophin—deﬁciency). For example, see PCT ation No. W0200713003l, Spuler & Engel 1998 ogy 50:41-46, and Selcen e; (.23. 2001 Neurology 56:1472—1481.

Therefore, some embodiments of the invention provide methods and compositions for regulating, modifying, curing, inhibiting, preventing, ameliorating and/or ng muscular dystrophy.

Complement activity may contribute to corneal inﬂammation. Therefore, some embodiments of the invention provide methods and compositions for regulating, ing, , inhibiting, ting, ameliorating and/or treating corneal inﬂammation, e.g., after surgery. In some embodiments, a ment factor B analog of the invention is administered via eye drops or as ise described herein.

In some ments, complement factor B analogs of the invention are used for regulating, modifying, euring, inhibiting, preventing, ameliorating and/or treating corneal neovascularization.

Some embodiments of the invention provide methods for ing the efficacy of post-coronary or peripheral artery bypass grafting or angioplasty. In some embodiments, a vector of the invention encoding a complement factor B protein analog of the invention (6. g., th3-29’ZS or thS-29ZS-74ON) is used to transduce cells of a blood vessel (e.g., endothelial cells). In some embodiments, cells of a blood vessel are transdueed prior to implantation in an animal. in some embodiments, cells of a blood vessel are transduced in. viva.

Alleviating pain and suffering and inflammation in postoperative patients is an area of l focus in clinical medicine, especially with the growing number of out—patient ions performed each year. Complement factor B analogs of the present ion can be utilized to inhibit inﬂammation, e. g.._ by inhibiting a complement activity. Therefore, complement factor B analogs can be used to reduce inflammation, e.g., in postoperative patients. In some embodiments, a complement factor B analog is administered locally (e.g., perioperative delivery) to a site of surgery to inhibit inﬂammation, which in some cases will W0 2012;151:168 PCT/U82012/036459 reduce pain and suffering. In some embodiments, a complement factor B analog is administered in a solution, e.g., in a physiologic electrolyte carrier ﬂuid. In some embodiments, a complement factor B analog is delivered via perioperative delivery directly to a surgical site of an irrigation solution containing the composition. In some ments, due to the local perioperative delivery method of the present ion, a desired therapeutic effect may be achieved with lower doses of agents than are necessary when employing other methods of delivery, such as intravenous, intramuscular, subcutaneous and oral. In some embodiments, when used perioperatively, the solution will result in a ally significant decrease in operative site pain and/or inflammation, thereby allowing a decrease in the patient‘s postoperative analgesic (eg, opiate) requirement and, where appropriate, allowing earlier patient mobilization of the operative site. In some embodiments, no extra effort on the part of the n and operating room personnel is required to use the t solution relative to conventional irrigation ﬂuids. In some embodiments, a composition of the invention is used (.9. g., in tion fluid) for arthroscopy, cardiovascular and l vascular therapeutic and diagnostic procedures, urologic procedures, general al wounds and wounds in general. Compositions of the invention may be delivered by, but not limited to, injection (e. g., via syringe), via irrigation ﬂuid, as part of a bandage over a wound, or in a topical application such as a solution, cream, gel or the like.

In some embodiments of the invention, a ment factor B analog and/or vector of the invention is administered in combination with a complement inhibiting factor, prior to, concurrently with, or after administration of the complement factor B analog and/or vector.

A complement inhibiting factor includes, but is not d to, a Factor H, a Factor H—like 1, an MCP, a DAF, or a soluble form of an MCP.

In some embodiments of the invention, a complement factor B analog or vector of the invention is administered in combination with an anti-angiogenic factor. Anti~angiogenic factors include, but is not limited to, endostatin, a VEGF g molecule, PEDF, T2—TrpRS (e. g, see US. Patent No. 844), sFLT (e.g., see Kong et (1]. Hum Gene Ther (1998) 833), aflibercept (VEGF Trap), VEGF Trap-eye, kininostatin, ranibizumab and bevacizumab.

In some embodiments, a complement factor B analog and/or vector of the invention is stered in combination with LUCENTIS® (ranibizumab), AVASTIN® (bevacizumab), VEGF Trap—eye, aﬂibercept or a molecule(s) that binds VEGF and/or that inhibits angiogenesis. LUCENTTS® is used to treat wet AMD. Some ments of the invention can also be used to treat wet AMD. Therefore, the present invention provides methods and W0 2012/]51468 PCT/U820121036459 compositions for treating wet AMD comprising administering, separately or together, a ition of the invention in combination with LUCENTIS® (ranibizumab), AVASTIN® izumab) VEGF Trap-eye, aflibercept and/or a molecule(s) that binds VEGF and/or that inhibits angiogenesis. Additionally, intraocular inﬂammation is one of the most common adverse ons reported after administration of LUCENTIS®, e. g., see the “Full Prescribing Information” for LUCENTIS®. The present invention es a method for inhibiting or reducing intraoeular ation (cg, resulting from the administration of LUCENTIS®) comprising administering a molecule or composition of the invention prior to, at the same time, and/or after the administration of LUCENTIS®, VEGF Trap-eye or aﬂibercept.

In some embodiments of the invention, a complement factor B analog or vector of the invention is administered in combination with r compound(s), such as a compound that inhibits T-cell activation, B-eells, TNF, interleukin-l (e.g, interleukin-1b), interleukin—6 and/or interferon-gamma. A complement factor B analog or vector of the invention can also be administered in ation with a compound(s) that inhibits complement activity, e.g., alternative complement ty. Compounds that can be used and which inhibt TNF include, but are not limited to, compounds that bind TNF, such as antibodies (cg, Infliximab ADE®), Golimumab (SIMPONI®) and Adalimumab A®)) or soluble receptors that bind TNF such as Etanercept (ENBREL®), Other compounds that can be used and which inhibit T—cell activation include, but are not limited to, compounds that bind B7 such as abatacept (ORENCIA®). Also compounds which downregulate B-cells can be used including, but not limited to, compounds that bind CD20 such as Rituximab (RITUXAN® and MABTHERA®).

Complement ys contributing to and/or causing a disease can be modulated, regulated, inhibited and/0r activated using various methods and/or complement factor B protein analogs that are part of the present invention. itions, Formulations and Preparations Some embodiments of the invention provide compositions, e. g., pharmaceutical compositions ning a complement factor B analog of the ion, such as for therapeutic uses. In some embodiments, a pharmaceutical composition comprises a complement factor B analog comprising amino acids 26-764 of SEQ ID N022, amino acids 26—764 of SEQ ID NO:3, amino acids 26—990 of SEQ ID NO:22 or amino acids 26-990 of SEQ ID N023, for example, th3-29ZS (SEQ ID N02), th3-29ZS-74ON (SEQ ID N023), th3-29ZS-Fc (SEQ ID N022) or th3~292$—74ON-Fc (SEQ ID N023). in some W0 2012f151468 embodiments, a pharmaceutical composition comprises a complement factor B analog consisting of amino acids 26-764 of SEQ ID N022, amino acids 26-764 of SEQ ID NO:3, amino acids 26-990 of SEQ ID N0222 or amino acids 26-990 of SEQ ID N0223. Examples of pharmaceutical compositions and formulations that can be used with the complement factor B analogs of the invention are described in PCT Publication No. W008/106644 and US Patent Publication No. U320100120665.

Some ments of the invention include ceutical preparations comprising a complement factor B protein analog of the invention, a nucleic acid of the invention, a viral vector of the ion or any combination thereof.

Formulations (sag, for injection) are generally, but not necessarily, biocompatible solutions of the active ingredient, e.g., comprising Hank's solution or 's solution.

Formulations for transdennal or transmucosal administration generally include, but are not limited, penetrants such as fusidic acid or bile salts in combination with detergents or e- active agents. In some embodiments, formulations can be manufactured as aerosols, suppositories, or patches. In some embodiments, oral administration may not be favored for protein or peptide active ingredients; r, this type of composition may be suitably formulated, e. g., in an enteric coated form, in a depot, in a capsule and so on, so as to be protected from the digestive enzymes, so that oral stration can also be employed.

Some formulations of the invention comprise balanced salt solution (Alcon Laboratories, Inc., Fort. Worth, Texas) or balanced salt solution plus (Alcon Laboratories, Inc.). In some ments, a formulation comprises one or more of the following: citrate, NaCl (e.g., 0.64%), potassium chloride (KCl) (e.g., ), calcium chloride dihydrate (CaC12~2H20) (e.g., 0.048%), magnesium chloride hexahydrate (MgC12'6HzO) (e. g., 0.03%), sodium acetate trihydrate (CH3COgNa- 3HZO) (e.g. , 0.39%), sodium citrate dihydrate 7Nam2HzO) (e. g., , sucrose and sodium hydroxide and/0r hydrochloric acid (to adjust pH) and water. The preceding list includes some molecules that are listed as particular hydrates, e.g.. dihydrate, trihydrate, hexahydrate, etc. It is understood that various hydrates of these compounds can be used in the present ion and the invention is not limited to these particular hydrate forms of the listed molecules. In some ments, a formulation comprises one or more of the following: NaCl, sie phosphate monohydrate, c sodium phosphate heptahydrate and hydrochloric acid and/or sodium hydroxide to adjust pH and water. In some embodiments, a pharmaceutical composition comprises at least one ingredient selected from the group consisting of histidine, MgClz, trehalose, a polysorbate, polysorbate 20, NaCl, e, arginine and proline. In some embodiments, a formulation 20121’036459 comprises one or more of the following: histidine (e.g., about 10 mM); or, a-trehalose dehydrate (e.g., about 10% or about SOmM); MgClz (e.g., about IOmM); a polysorbate such as poiysorbate 20 (e.g., about ; and NaCl (e. g., about 0.1%). In some ments, a formulation may comprise one or more of the following: e, arginine or proline. In some embodiments, a formulation comprises or consists of a molecule(s) of the present invention, lOmM histidine, IOInM MgClz, 50111M trehaiose and 0.01% polysorbate 20. In some ments, a ation comprises or consists of a molecule(s) of the present invention, 1.0% NaCl and IOmM MgClz. In some embodiments, a formulation comprises or consists of a molecule(s) of the present invention, and a balanced salt solution enriched with bicarbonate, dextrose, and glutathione, such as BSS PLUS®. In some embodiments, a formulation does not comprise ose. In some embodiments, a formulation or composition is at a pH of about 5.5. In some embodiments, a formulation or ition is at a pH of between from about 5.0 to 9.0, about 5.0 to 5.5, about 5.3 to 5.7, about 5.5 to 60, about 5.8 to 6.2, about 6.0 to 6.5, about 6.3 to 6.7, about 6.5 to 7.0, about 6.8 to 7.2, about 7.0 to 7.5, about 7.3 to 7.7, about 7.5 to 8.0, about 7.8 to 8.2, about 8.0 to 8.5, about 8.3 to 8.7 and about 8.5 to 9.0, whatever is le to retain the biological activity and stability of the active ingredient(s).

Some formulations of the invention can be manufactured as aerosols, suppositories, eye drops or patches.

Examples of suitable formulations and formulatory methods for a desired mode of administration may be found in Remington‘s Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton, PA and in US. Patent No. 7,208,577.

In some ments, a composition for use in viva contains a “carrier” or a "pharmaceutically acceptable carrier". The term er" refers to a diluent, nt, excipient, or vehicle with which the vector of interest is administered. The term “carrier’ includes, but is not limited to, either solid or liquid material, which may be inorganic or organic and of synthetic or natural origin, with which an active ent(s) of the composition is mixed or formulated to facilitate administration to a subject.

In general, a suitable oil(s), saline, aqueous se (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are typically suitable carriers for parenteral solutions. In some embodiments, solutions for parenteral administration n a water soluble salt of the active ingredient, suitable stabilizing agents, and if desirable or necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, can be used as stabilizing W0 2012/151468 PCT/U820121036459 agents. Also used are citric acid and its salts and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl— or propyl- paraben, and chlorobutanol.

Carriers can e carbohydrates such as trehalose, mannitol, hione, xylitol, sucrose, lactose, and sorbitol. Other ingredients for use in formulations may include, for example, DPPC (1,2-Dideeanoy1—sn—glycero-3—phosphocholine), DOPE (1,2-Dioleoyl-sn— glycero~3-phosphoethanolamine), DSPC istearoyl-sn—glycero—3-phosphocholinez 1,2- royl-sn—glycero—3-phosphocholine) and DOPC ioleoyl—sn~glycero phosphocholine). Natural or tic surfactants may be used. Polyethylene glycol may he used (even apart from its use in derivatizing a protein). Dextrans, such as eyelodextran, may be used. In some embodiments, cyclodextrin, tertiary amines and/or beta-cyclodextrin may be used. Bile salts and other related enhancers may be used. Cellulose and cellulose derivatives may be used. Amino acids may be used, such as use in a buffer formulation.

Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.

Suitable pharmaceutical excipients include, but are not limited to, starch, glucose, e, sucrose, gelatin, antibiotics, preservatives, malt, rice, ﬂour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, ol, propylene, glycol, water, ethanol and the like. A composition, if d, can also n wetting and/or emulsifying agents, and/or pH buffering agents. Where necessary, a composition may also include a solubilizing agent and/or a local etic such as lignocaine to ease pain at the site of the injection.

Also contemplated herein is pulmonary delivery of an agent or protein (or tive thereof) of the present invention. In some embodiments, a complement factor B analog(s) is (Q U] delivered to the lungs of a mammal while inhaling and can mostly remain in the lungs or in some embodiments traverses across the lung epithelial lining to the blood stream. (e.g., see Adjei et (11., Pharmaceutical Research 7:565—569 (1990); Adjei 121111., International Journal of Pharmaceutics -144 (1990); Braquet et (11., Journal of Cardiovascular Pharmacology 13(suppl. 5):s.143-146 (1989); Hubbard er (1]., Annals of Internal Medicine 3:206—212 (1989); Smith et al., J. Clin. Invest. 84:1145—1146 (1989); Oswein (31111., Proceedings of Symposium on Respiratory Drug Delivery [1, Keystone, Colo, March, 1990; Debs et (11., The Journal of Immunology 82—3488 (1988) and Platz 61111., US. Pat. No. 5,284,656).

Contemplated for use in the practice of this invention are a wide range of ical devices designed for pulmonary delivery of therapeutic products, including but not limited to W0 2012/]51468 nebulizers, metered dose inhalers, and powder inhalers. Some specific examples of commercially available devices suitable for the practice of some embodiments of the ion are the ULTRAVENTTM nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the ACORN II® nebulizer, manufactured by st Medical Products, Englewood, Colo; the VENTOLIN metered dose inhaler, ctured by Glaxo Inc, Research Triangle Park, NC; and the SPINHALER powder inhaler, manufactured by Fisons Corp, Bedford, Mass.

In some embodiments, a protein is prepared in particulate form. In some ments, this particulate form has an average particle size of less than 10 pm (or microns), most preferably 0.5 to 5 pm, for delivery to the distal lung.

Formulations suitable for use with a nebulizer (e.g., jet or ultrasonic) will typically comprise a complement factor B analog dissolved in water, in some embodiments, at a concentration of about 0.1 to about 25 mg of biologically active protein per mL of solution.

A formulation may also include a buffer and/or a simple sugar (e.g., for protein stabilization and regulation of c pressure). A nebulizer ation may also contain a surfactant, to reduce or prevent surface induced aggregation of a protein(s) caused by atomization of the solution in forming the l.

Formulations for use with a metered-dose inhaler device will generally comprise a finely divided powder containing a complement factor B analog of the invention suspended in a propellant, ag. the aid of a surfactant. A propellant may be any conventional , with material employed for this purpose, such as a chlorofluorocarbon, a hydrochloroﬂuorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichloroﬂuoromethane, dichlorodifluoromcthanc, dichlorotetraﬂuoroethanol, and l, 1,1,2—tetrafluoroethane, or combinations f. le surfactants e an trioleate and soya lecithin. Oleic Ix) U1 acid may also be useful as a surfactant. In some embodiments, formulations for dispensing from a powder inhaler device will comprise a finely divided dry powder containing a complement factor B analog of the invention and may also e a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.

Administration and Delivery It is understood that when introduction or administration of a nucleic acid encoding a complement factor B protein analog is discussed, that the ion also contemplates the introduction or administration of the complement factor B protein analog itself. It is PCT/U82012/036459 understood that when introduction of a complement factor B anaiog is discussed, that the invention also contemplates the introduction of a nucleic acid ng the complement factor B protein analog.

In some embodiments, complement factor B analogs or compositions of the invention can be administered locally or systemically. Useful routes of administration are described herein and known in the art. Methods of introduction or administration include, but are not d to, intradermal, intramuscular, eritoneal, enous, subcutaneous, intranasal, intratracheal, topical, inhaled, ennal, rectal, parenteral routes, epidural, intracranial, into the brain, intraventricular, subdural, intraarticular, hecal, intracardiae, intracoronary, intravitreal, subretinal, intraanterior chamber of the eye, particular, locally on the cornea, subconjunctival, subtenon injection, by applying cycdrops, oral routes, via balloon catheter, via stent or any combinations thereof. In some embodiments, a composition or complement factor B analog of the ion is administered to a drusen, e.g., by injecting directly into a drusen. Systemic administration may be, but is not limited to, by intravenous or intra-arterial injection or by transmucosal, subcutaneous and/or transdermal delivery. In some ments, a composition of the invention may be initially directed to a site other than a diseased site. For example regarding AHR which occurs in the lungs of an animal, an intraperitoneal injection of a protein, vector or nucleic acid of the invention may result in a change in AHR in the lungs, e.g., see Park. at at, American Journal of Respiramry and Critical Care Medicine 169726-332, (2004). In some embodiments, a dosage level and/or mode of administration of a composition may depend on the nature of the composition, the nature of a condition(s) to be treated, and/or a y of an individual patient. In some ments, cells expressing a complement factor B analog of the invention are administered. These cells can be a cell line, xenogeneic, allogeneic or autologous.

In some embodiments, e. g., comprising administration to the eye, a complement factor B protein analog or vector of the invention is administered about once every week, month, 2 months, 3 months, 6 months, 9 months, year, 18 months, 2 years, 30 months, 3 years, 5 years, 10 years or as needed. In some embodiments, e. g., comprising administration to the eye, a molecule or vector of the invention is stered from about every 1 to 4 weeks, about every 4 to 8 weeks, about every 1 to 4 months, about every 3 to 6 months, about every 4 to 8 months, about every 6 to 12 months, about every 9 to 15 months, about every 12 to 18 , about every 15 to 21 , about every 18 to 24 , about every 1 to 2 years, about every 1.5 to 3 years, about every 2 to 4 years, about every 3 to 5 years, about every 5 to 7 years, about every 7 to 10 years or about every 10 to 20 years. It is expected that PCT/US20121’036459 administration of a vector coding for a complement factor B protein analog would be less frequent than administration of the complement factor B protein analog. In some embodiments of the invention, a pharmaceutical preparation comprises a vector encoding a complement factor B analog of the invention and the pharmaceutical preparation is administered only once to the patient.

In some embodiments, e.g., sing administration to the eye, a vector coding for a complement factor B analog is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times to a patient in their lifetime. In some ments, e.g., comprising administration to the eye, a lentiviral vector of the invention is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times to a patient in their lifetime.

In some embodiments, a complement factor B protein analog of the invention is administered by intravitreal injection to a human eye. In some ments, about 15 pg to about 5 mg; about 15 pg to about 500 pg; about 100 pg to about 900 pg; about 300 pg to about 700 pg; about 500 pg to about 1 mg; about 1 mg to about 5 mg; about 1mg; or about 500 pg of a complement factor B protein analog is administered by itreal injection to a human eye.

In some embodiments, a complement factor B protein analog of the invention is administered by subretinal injection or intravitreal injection of a lentiviral or adeno associated viral (AAV) vector. In some embodiments, about 57:106 to about 5x108; about 5x106 to about 5x107; about 5x107 to about 5x108; about 1x107 to about lxlOs; about 3x107 to about 5x107; about 2.5x107; about 5x107; about 7.5x107; or about 1x108 ucing units of a iral vector is administered by inal injection. In some embodiments, about 5x108 to about 1x109; about 5x108 to about 7.5x103; about 7.5XlO8 to about 1x109; about 6x108 to about 9x108; about 7x108 to about 8x108; about 5x103; about 6x108; about 7x108; about 8x108; about 9x108; or about 1x109 transducing units of an AAV vector is administered by inal injection. in some embodiments, about 5x108 to about 1x10“); about 5x108 to about 5X109; about 5X108 to about 2x109; about 2x109 to about 5x109; about 5x109 to about 1x10“); about 5x108 to about 1X109; about 1x109 to about 3x109; about 3X109 to about 6X109; about 6x109 to about 1x10"); or about 1x109 to about 1x1010 transducing units of an AAV vector is administered by intravitreal injection.

In some embodiments, about 50 pl to about 100 pl, about 50 pl to about 75 p1, about 75 pl to about 100 pl, about 60 pl to about 90 pl, about 70 pl to about 80 pl, about 50 pl; about 60 pl; about 70 pl; about 80 pl; about 90 p1; or about 100 p1 of a complement factor B PCTfU82012/036459 protein analog or a vector encoding a complement factor B protein analog is injected inally. In some ments, about 50 pl to about 1 ml, about 50 pl to about 500 pl, about 500 p1 to about 1 m1, about 250 pl to about 750 pl, about 250 pl to about 500 pl, about 500 p1 to about 750 pl, about 400 p] to about 600 p1, or about 750 pl to about 1 ml of a ment factor B protein analog or a vector encoding a complement factor B protein analog is injected intravitreally.

In some embodiments, an anti—inflammatory may be delivered in combination with a complement factor B protein analog (3g, th3-29ZS or th3-2928—740N), vector or nucleic acid of the invention. An anti-inflammatory may be delivered prior to, concurrently with, and/or after administration of a molecule or vector of the invention. In some embodiments, an anti—inflammatory is administered in the same solution and/or same syringe as a complement factor B protein analog, nucleic acid or vector of the invention. In some embodiments, a complement factor B protein analog or vector of the invention and an anti— inﬂammatory are co—administered to the eye, e.g., as described herein.

Many anti-inﬂammatory drugs are known in the art and include, but are not limited to, dexamethasone, dexamethasone sodium metasulfobenzoate, dexamethasone sodium phosphate, metholonc, bromfcnac, pranoprofen, RESTASISN, cyclosporine ophthalmic emulsion, naproxen, glucocorticoids, ketorolac, ibuprofen, tolmetin, non-steroidal anti—inﬂammatory drugs, steroidal anti-inﬂammatory drugs, diclofenac, ﬂurbiprofen, indomethacin, and suprofen.

Some embodiments of the invention include administration of both a complement factor B protein analog and a vector ng it. A complement factor B protein analog of the invention may be delivered prior to, concurrently with, and/or after stration of a vector of the invention. In some ments, a complement factor B n analog of the invention is administered in the same solution and/or same syringe as a vector of the invention. In some ments, a complement factor B protein analog of the invention and a vector of the invention are co-administered to the eye, e.g., as described herein.

Additionally, a complement factor B analog or a nucleic acid encoding it can be delivered or administered to an animal via a cell, 3.3., as cell therapy. For example, this can be accomplished by administering or delivering a cell(s) sing a complement factor B analog(s). In some embodiments, a complement factor B analog(s) is expressed from the cell via. a table, ble and/0r sible promoter. In some embodiments, encapsulated cells that s a complement factor B analog(s) are delivered to an animal, 9. g., see PCT Publication No. WOO7078922 related to encapsulated cells. In some embodiments, cells are W0 20121151468 PCT/U82012/036459 administered locally (2. g., in a joint, intravitreal, intraretinal, intracranially etc.) or systemically (e.g., i.v.).

Cells to be administered to an animal can be autologous, allogeneic or xenogeneic. In some embodiments, autologous cells are manipulated ex viva to cause them to produce a complement factor B n analog of the invention and, in some embodiments, the cells are introduced back to the animal. Transferring a nucleic acid comprised of a coding region to cells ex viva can be by any method, such as, electroporation, microinjection, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, lipofection, microparticle bombardment, calcium phosphate mediated transfection, viral infection and so on. Optionally, a selectable marker also can be introduced into the cells. If a selectable marker is utilized, the cells can be then placed under selection, e.g., to e expression and/or to isolate those cells that express the transferred coding region (see, e. g., Loefﬂer & Behr, Meth. Enzymol. 9-618 (1993); Cohen et (41., Meth. Enzymol. 217:618-644 ; and Cline, Pharmac. Ther. 29:69-92 (1985)).

Recombinant cells (e. g., autologous or allogeneic cells transduced in vitro) can be delivered to a patient by various methods known in the art. For example, cells can be encapsulated prior to administration, as known in the art. In some embodiments, when encapsulated, the cells are not autologous. In some embodiments, recombinant blood cells (e.g., hematopoietic stem and/or progenitor cells) are administered intravenously. In some embodiments, eye cells and/or pluripotential cells can be injected directly into the eye. The amount of cells needed depends on the desired effect, the ’s state, etc.

In some embodiments of the invention, a gene delivery system can result in uction and/or stable integration of a gene or coding region for a complement factor B analog into a target cell. In some embodiments, target cells are mammalian cells such as primate cells, and human cells. In some embodiments, target cells are cells of the eye, such as retinal pigment lial cells, retinal cells, or pluripotential cells. Target cells can be in vitra, ex viva or in viva. In some embodiments, a target cell is a stem cell. Stem cells include, but are not d to, pluripotent stem cells, tent stem cells, hematopoietic stem cells, cancer stem cells and nic stem cells. In some ments, pluripotential cells contemplated herein are not those for propagating a living entity from a zygote or blastomere. The instant invention also contemplates the use of a partially undifferentiated cell for implantation into the eye of a patient in need of treatment, e.g., to regenerate cells of the eye.

Transgenic Animals Some embodiments of the invention provide a transgenic animal (e.g., nonhuman) expressing a complement factor B analog of the invention. Methods for making a transgenic animal are known in thc art. In some embodiment, a transgenic animal (such as a mouse) will also comprise a on, deletion or disruption in the Fas gene, 6. g., see Macmicking et a]. Cell. 811641650 (1995).

EXAMPLES The invention is now described with reference to the following examples. These es are provided for the purpose of illustration only and the invention should in no way be construed as being limited to these examples but rather should be construed to encompass any and all variations which become evident as a result of the teachings provided herein.

Whereas, particular embodiments of the invention have been described herein for purposes of description, it will be appreciated by those d in the art that us variations of the details may be made without departing from the invention as described in the appended claims.

Example 1. Generation of th3 Expression Construct A plasmid was designed to include the coding sequence for human th3 with an IRES—Neo able marker (th3—IRES—Neo). The plasmid was sized by GENEART AG (Regensburg, Germany, d), a fee for e contract organization. An Nhe I ction site was incorporated into both the 5’ and 3’ ends of the coding sequence. The th3 nucleic acid coding ce was codon zed for optimal expression in mammalian cells.

The gene expression plasmid, pCI (Promega, Madison, WI), was modiﬁed. First, the BGH (Bovine Growth Hormone) polyA was removed from pCI and replaced with a synthetic polyA. Next, the hiB3 coding sequence with a selectable marker (thB‘IRES—Neo) was cut out by Nhe I from a plasmid and cloned into the Sal I site of the modified pCI as a blunt-end ligation to create an th3 expression construct. The plasmid was sequenced in its entirety to conﬁrm the sequence integrity of the construct (SEQ ID N015).

Example 2. tion of th3-29ZS Expression Construct A further modification was introduced to th3 protein. Human wild type factor B protein and th3 protein have 23 cysteine amino acids (C), suggesting there is at least one unpaired free cysteine present in the protein. ide bond mapping suggested the free C in biologically active th3 is d at the amino acid 292. The C at 292 is highly conserved in factor B n among different species (Table 1, above). In this Example, this C at 292 is changed to serine (S), generating th3-29QS.

To create the hiB3-2928 expression construct, site-speciﬁc mutation was introduced into the th3 expression construct (SEQ ID N05).

The th3 expression construct was used as the template to make the site mutation changing the C at position 292 to S using Stratagene’s Site-Directed Mutagenesis Kit ing to the manufacture’s instructions, creating the th3—292S expression construct.

Two primers were used: Forward primer 5’— CACCGGCGCCAAGAAGﬂCCTGGTCAACCTGATC-3’ (SEQ ID NO:6) and Reverse primer 5’—GATCAGGTTGACCAGQCICTI‘CTTGGCGCCGGTGS’ (SEQ ID N027). The underlined nucleotides indicate the mutated amino acid from C to S. The th3-292S expression te includes, from 5’ to 3’, a CMV promoter, a chimeric , a codon optimized coding ce for th3-292S, an [RES-Nee selectable marker, and a synthetic polyA e 2). The entire construct was sequenced to conﬁrm the mutation and the integrity of the construct (SEQ ID NO:8). The expected amino acid sequence for th3-292S is shown in SEQ ID NO:2.

Example 3. Generation of Stable th3 and th3-29ZS Expression Cell Lines Stable cell lines expressing th3 or th3-2925 protein were generated by transfecting 293 FreeStyle cells (Invitrogen, Cat. No. R79007) with the th3 or th3-292S sion construct. Transfection of plasmid DNA into the 293 yle cells was mediated by PEI (Polyethylenimine, Sigma, Cat. No. 23966)-based transfeetion. A PEI solution was prepared in sterile water at a final concentration of 1 mg/mL. The pH was adjusted to 7.0 with N HCl. The solution was sterilized using a 0.22 urn filter. Aliquots of the PEI were stored frozen at -80°C until use.

The transfection protocol was as follows: One day prior to transfeetion, the cells were seeded at l x 106 cells/mL in serum-free 293E Expression Medium rogen, Cat. No. 12338-018).

The next day, the cells were washed with basal RPMll64O medium (Invitrogen, Cat.

No. 22400-089) supplemented only with HT Supplement (Cat. No. 11067—030, Invitrogen), resuspended in the same medium at 2 x 106 mL and dispensed into a new 6-well plate with 1 ml, in each well.

W0 2012/]51468 PCT/U32012/036459 Stock solutions of DNA and PEI were prepared in sterile 150 mM NaCl as follows: 2.5 ttg hiB3 or th3-2928 expression construct DNA (in 2.5 ttL) was diluted into 47.5 ttL of 150 mM NaCl and mixed with ing (DNA solution). Ten microlitcrs (10 itL) of PEI solution was diluted into 40 itl, of 150 mM NaCl, followed by a gentle vortex (PEI solution).

The DNA and PEI solutions were incubated at room temperature for 5 minutes. 'lhe PEI solution was then added to the DNA solution and the mixture was d to te at room temperature for an additional 10 minutes and then the DNA/PEI mixture was added to the cells in the 6-well plate and the cells were incubated with agitation (200 RPM) for 5 hours at 37°C in an tor with 8% CO; and 85% humidity. After 5 hours, 1.1 mL of complete 293E Expression Medium (no additives) was added to each of the wells and the incubation was continued for 72 hours.

The cells were then harvested, washed once with the 293F Expression Medium, and placed into fresh 293F Expression Medium containing 300 ug/mL G418 (Teknova). As a negative control, an equal number of un-transfected 293F naive cells were cultured in the same G418-c0ntaining . The cells were under G418 selection for approximately 3 weeks. By which time, the un-transfected cells in the G418—containing medium were dead.

The transfected cells were passed over a FICOL gradient ) to remove the dead or dying cells from the G418-rcsistant livc population. The G418-resistant live population was further expanded over a period of about 2 weeks, during which the cells were spun down every 2-3 days and resuspended in fresh 293E Expression Medium containing 300 ug/mL G418.

Example 4. Production of th3 and th3~292S The esistant th3 or th3-292S producing cells were seeded at a y of 2x106 mL in the 293F Expression Medium either in 6-well plates with 2 mL culture in each well, in 500 mL spinner ﬂasks with 100 mL culture in each ﬂask, or in 3,000 mL spinner ﬂasks with 1,000 mL culture in each ﬂask. The cells were incubated for 72 hours with shaking at 100 rpm on an orbital shaker in a 370C incubator with 8% C02 and 80% humidity.

The cell culture medium supernatant containing th3 protein or htB3-292S protein was then harvested and centrifuged at 2,000 rpm for 10 minutes to clear cell debris after which the culture medium was filtered through a 0.22 pm filter.

Example 5. Quantitation of thS and th3-292S Proteins PCT/U52012/036459 An ochemiluminescent assay (ECL) was developed for quantitation of th3 and th3—29ZS with human wild type factor B as standard. The assay was a sandwich immunoassay based on BioVeris’s ECL Technology. Brieﬂy, the ECL assay is formatted as a 96-well plate sandwich, one—step, and no wash assay. The quality control samples (purified factor B from human plasma, Quidel, Cat. No. A408) and test samples were incubated with a master mix reagent containing a biotinylated h monoclonal antibody (anti-human factor B monoclonal antibody, R&D s, Cat. No. 9), a BV-TAG plus~labeled h onal antibody (anti-human factor B polyclonal antibody, R&D Systems, Cat.

No. AF2739), and streptavidin-coated paramagnetic beads. The mixture was incubated for 150 minutes. Following the incubation, a stop solution (Borate Buffer, 250 mM, pH9.2 containing 500 mM sodium chloride and 1.6 mg/mL BSA) was added and then the plate was read on MlMR Analyzer. The estimated dynamic range for the assay was 9.0 to 950 ng/mL.

Example 6. Western blot Analysis for th3 and thS-29ZS rylamide electrophoresis of th3 protein and th3—29BS protein under denturing but ducing conditions (SDS-PAGE) was performed by mixing samples of th3 protein or hiB3-29ZS protein with non—reducing protein sample buffer (Pierce). Human factor B protein purified from plasma (100 ng per sample, Quidel) was used as a positive control. Each gel also contained a well with pre-stained protein molecular weight markers (15 e) (Invitrogen). The samples and the markers were heated at 95°C for 5 minutes in non-reducing protein sample buffer. The samples were loaded onto a 7.5% Tris-HCL Precast mini gel (Bio-Rad). The gel was run (10X SDS/Tris/Glycine Running Buffer, Bio-Rad) at 75 V for 15 minutes or until the dye front passed through the stacking gel into the resolving gel. Once the dye front entered the resolving gel, the e was increased to 100 V and electrophoresis contintued until the dye front ran off the gel.

Western blot analysis was performed by washing and equilibrating the gel in transfer buffer (10 X Tri s/Glyeine Transfer Buffer, Bio-Rad) for 20 s while rocking gently. A nitrocellulose membrane (Bio-Rad) and blotting paper were also equilibrated in the transfer buffer. Proteins separated by SDS—PAGB were transferred electrophoretically onto a ellulose using a Trans Blot ry Transfer Cell (Bio—Rad) (20V for 45 minutes).

Once the transfer was complete, the membrane was blocked with a 1X casein solution (Vector tories) for at least an hour at room temperature with gentle agitation on a . The membrane was probed with a primary antibody (monoclonal antibody against human factor B, R&D Systems, Cat. No. MAB2739) diluted to 1210000 in 1X casein PCT/U82012/036459 solution at room temperature for 1 hour with gentle agitation and washed in 10 mL of IX casein solution 3 times for 5 minutes each at room temperature with gentle agitation on a rocker. The membrane was incubated with a biotinylated goat anti-mouse IgG (secondary antibody, R&D Systems, Cat. No. BAF007), diluted to 0 in 1X casein solution, for '1 hour at room temperature with gentle ion on a rocker and washed in 10 mL of IX casein solution 3 times for 5 minutes each at room temperature with gentle agitation. The membrane was incubated in tain ABC~AmP reagent (Vector Laboratories) in 20 mL of IX casein solution for 45 s containing 40 _LtL of Reagent A and 40 uL of Reagent B.

The membrane was washed in 10 mL of lX casein solution 3 times for 5 minutes each at room ature with gentle agitation.

To aquire the chemiluminescent signal from the Western blots, the membranes were equilibrated in 20 mL of 0.1 M Tris pH 9.5 for 5 minutes without agitation. Excess buffer was removed from the membrane by holding the membrane vertically and touching the edge of the membrane to a Kimwipe. The target side of the membrane was placed facing up in a new container. Duolox Substrate (7 mL, Vector tories) was placed directly onto the target side of the membrane which was incubated for 5 minutes in the dark. Excess Duolox was removed from the membrane by holding the ne vertically and touching the edge of the membrane to a Kimwipe. The membrane was washed by ging it in 20 mL of 0.1 M Tris pH 9.5 for 5 minutes with agitation in the dark. Excess buffer was removed from the membrane by holding the membrane vertically and ng the edge of the membrane to a Kimwipe. The membrane was placed in a folded plastic wrap sheet and exposed to Kodak BioMax MS X—ray film in a ﬁlm cassette for l to 5 minutes. The film was placed in Kodak Developer solution e 26 mL of the Developer solution into 92 mL of ) for 1 minute. The ﬁlm was removed from the Developer solution and placed in Kodak Fixer solution (dilute 26 mL of the Fixer solution into 92 mL of ddHZO) for 1 minute. Finally, the film was rinsed with tap water and allowed to dry at room temperature.

As shown in Figure 3, G418-resistant th3 and th3-292S ing cells produced, in the cell culture medium, thB protein (Lane 3) and th3—292S protein (Lane 4) at the appropriate size (approximately 100 KDa). These proteins migrated at approximately the same rate as the wild type human factor B prufied from human plasma (Lane 2). No visible band was detected in the un—transfeeted cell e medium (negative control) indicating the specificity of the monoclonal anti-human factor B antibody (Lane '1). Interestingly, presumed ates at approximately 200-260 KDa were readily detected in th3 samples (lane 3), PCT/U82012/036459 while no aggregates were detected in the th3-292S s (lane 4) produced under the same experimental conditions. Aggregates could be caused by misfolded populations of th3 in the cell culture medium. When proteins are misfolded, they expose hydrophobic regions that are prone to the ion of aggregates through hydrophobic—hydrophobic interactions. These data suggest that in the th3-29QS protein ation, misfolding was either eliminated or significantly reduced as compared to th3 protein.

Example 7. Alternative Complement Pathway Hemolytic ty Assay Human alternative complement pathway ty can be measured using a hemolytic assay as described in this Example.

One milliliter (1 mL) of rabbit erythrocytes (rRB Cs) (Lampire Biological tory, Cat. No. 7246408) suspension was washed with freshly made cold Mg2+-EGTA buffer. The erythrocytes were transferred to a 50 mL conical centrifuge tube, 30 mL of the Mg2+-EGTA buffer was added and the cells were mixed gently. The rRB Cs were pelleted in a Beckman Allegra 6KR centrifuge at 1,200 rpm at 4°C without brake for 5 minutes and resuspended in the Mg2+-EGTA buffer. This wash step was repeated twice. The rRBCs were resuspended in 2 mL of ice-cold Mg2+—EGTA buffer and a cell count was obtained using a hemoeytometer.

The tic activity reaction mixture was set up in V-bottom shaped 96-well plates placed on ice. To determine if th3 protein or th3-29ZS protein can compete with the wild type human factor B protein and inhibit its hemolytic activity, a competition assay was set up in a total volume of 40 LLL including 500 ng of wild type human factor B, increasing amounts of th3 protein or th3—29ZS protein, and GVBH buffer (Sigma, Cat. No. 66415). Fifty microliters (50 ILL) of factor B depleted human serum diluted 25~fold with MgZ+—EGTA buffer was added to each well, followed by 10 in; of Mg2+-EGTA washed 5 x 107 rRBCs.

After adding the rRBCs, each sample was gently mixed in the 96 well plate using a multi- channel pipette.

The l plate was placed in a glass tray with a layer of 37°C water submerging the bottom of the plate. The tray was then placed in a 37°C water bath with l shaking at 110 rpm for 40 minutes. After tion, the plate was placed on ice, 150 nL of ice-cold 0.9% saline was added to each well, and each reaction gently mixed by pipetting to stop the reaction. The 96-well plate was centrifuged at 2,000 rpm in an orf 5810K centrifuge for 5 minutes (min) at 4°C t brake to pellet the rRBC at the bottom of the plate. The supernatant (180 ttL) was removed from each well without disturbing the pellet and transferred to the corresponding well of a new 96-well plate. The absorbance of each sample was measured at 405 nm in a microplate reader.

Example 8. Biological ty of thS and thS-29ZS The biological activity of hiB3 protein and th3-29ZS n was examined by measuring the alternative complement pathway mediated hemolysis of rRBCs. The assay bed in Example 7 was used to test the potency of th3 protein or th3-29ZS protein in inhibiting the human alternative complement pathway. Each reaction was performed in triplicate. As shown in Figure 4, the raw cell culture medium from th3-29ZS protein and th3 protein producing cells ently inhibited/reduced the alternative complement pathway activity in a dose~dependent manner. Although not wishing to be bound by theory, thB and th3—29ZS protein may be inhibiting alternative complement pathway activity by competing against the wild type factor B protein and/or by sequestering C3b and/or ment factor D.

Example 9. Purification of th3 and thS-29ZS proteins Cell culture medium from a human 293 FreeStyle cell line transfected and stably expressing and ing th3 n or th3-29ZS protein was used as the starting material for purification of th3 protein or hiB3-29’ZS protein. Soluble secreted th3 or th3-29ZS protein was purified from the cell culture supernatant by a combination of anion exchange (AEX), hydrophobic interaction (HIC) and size exclusion chromatography (SEC) for capturing, intermediate purification and polishing steps, respectively, using a GE AKTA Purifier. Two purification schemes are described below. These two schemes differ in that one uses one HIC chromatography step and the other uses two HIC chromatography steps.

The cell culture supernatant containing th3 protein was d with distilled water at 4:] volume ratio of culture supernatant/water to lower the conductivity to ~8 Milli Siemens per eter (mS/em) and adjusted to pH 7.5 with 50 mM phosphate buffer. This material was loaded directly onto a pre-packed ion ge column (POROS HQ 50, ABI) on an AKTA er using a P—960 pump at a ﬂow rate of 30 mL per minute. Tire column was previously equilibrated with buffer A (50 mM phosphate buffer (PB), pH7.5, conductivity ~8 mS/cm), at a linear flow rate of 600 mL/hr (~‘l Column Volume/min, CV/min). The efﬂuent was monitored by UV detection at 280 nm. After washing away unbound material, retained material was eluted with a near nt of buffer A and buffer B (50 mM PB and l M NaCl, pH 7.5) to sequentially raise the conductivity of the mobile phase stepwise from 8 PCT/U82012/036459 mS/em (0% of buffer B for 2 CV), to 33 mS/em (25% of buffer B for 8 CV) and finally to 105 mS/cm (100% of buffer B for 5 CV).

To further facilitate removal of host n contaminants, an intermediate, hydrophobic ction (HIC) chromatography step was introduced, which purifies and separates proteins based on differences in their surface hydrophobicity. The major fractions (from the AEX chromatography step) containing th3 protein were pooled and ed to contain approximately 1.4 M um e and 47 mM phosphate buffer, pH 7.5 (conductivity 216 mS/cm) (1.0 M ammonium sulfate and 33.7 mM phosphate buffer, pH 7.5, conductivity 169 mS/cm for th3-2928) by adding buffer C (1.5 M ammonium e and 50 mM phosphate buffer, pH 7.5) to the sample at approximately 30:1 volume ratio of the ammonium sulfate/phOSphate buffer vs. the sample. The pooled sample was ﬁltered through a 0.2 pm ﬁlter and applied to a hydrophobic interaction column (HiTrap Phenyl HP, GE care) pre—equilibrated with 1.5 M ammonium sulfate and 50 mM Phosphate , pH 7.5 (buffer C) (1.0 M ammonium sulfate and 33.7 mM ate buffer for thg-29ZS) at the ﬂow rate of 300 mL/hr (l CV/min). The retained material was eluted by decreasing the ammonium sulfate concentration in a non-linear fashion.

Alternatively, the intermediate HIC chromatography step can be ed with a two- steps HIC chromatography, e.g., to make the purification process easier to scale-up. In this two-step HIC purification s, the majority of host cell proteins were separated from i133 or fB3~292S by the first step HIC chromatography, HIC negative selection, by binding to HIC column (HiTrap Phenyl HP, GE Healthcare) at low salt condition (0.75 M ammonium sulfate and 25 mM phosphate buffer, pH 7.5 for fB3 and 0.6 M ammonium sulfate and 20 111M phosphate buffer, pH 7.5, conductivity 100 mS/cm for th3~29ZS). The ﬂow—thru fraction from the HIC negative selection step containing thS or 928 protein was then re-adjusted to contain approximately 1.5 M ammonium sulfate and 50 mM phosphate buffer, pH 7.5 (conductivity 216 mS/em) for fB3 or 1.0 M ammonium sulfate and 33.7 mM phosphate buffer, pH 7.5, (conductivity 169 mS/cm) for th3-2928. For the second step HIC tography, the sample was ﬁltered through a 0.2 um filter and applied to a hydrophobic interaction column (HiTrap Phenyl HP, GE Healthcare) pre-equilibrated with 1.5 M ammonium sulfate and 50 mM Phosphate buffer, pH 7.5 for B3 and 1.0 M ammonium sulfate and 33.7 mM phosphate buffer for thg-29ZS at the ﬂow rate of 300 mL/hr (l ). The retained material was eluted by decreasing the ammonium sulfate 2012/036459 concentration in a non-linear fashion to r separate fB3 or fB3—29ZS protein from the remaining host cell proteins.

The fractions containing biologically active th3 protein from the HIC chromatography step were pooled and concentrated with a centrifugal ﬁlter device (Millipore, Amicon Ultra, Cat. No. 901024, 10,000 MW Cut-off). The concentrated sample was ted to size exclusion chromatography on a Sephacryl 8300 26/60 HR column (maximum loading volume: 3% of CV, ~10 mL), equilibrated in PBS buffer (4 mM phosphate, 150 mM NaCl, pH 7.4, (GIBCO)). The elution of th3 n was performed at a constant linear ﬂow rate of 60 cm/hr using PBS, monitoring the efﬂuent by UV detection at 280 nm. The purified th3 protein was stored at 80°C in aliquots.

This procedure permitted almost complete separation of th3 protein from other contaminants. The purity of thS protein after the three step chromatography process was quite high, as indicated by the fact that SDS~PAGE silver staining analysis of 0.2 ttg of purified th3 n only produced a single sharp band (Figure 5, left . When thS protein puriﬁed by the above three step chromatography process was subjected to a competition assay against human wild-type factor B in a hemolytic assay, it suppressed hemolytic activity of the human alternative complement pathway, demonstrating that the purified th3 n was biologically active (Figure 5, right panel). singly, two populations of th3 were detected by HIC, one was biologically active nated as Peak I or active population) and the other had a much reduced biological activity (designated as Peak 11 or less active population) (Figure 6). These two forms were readily detected by reverse—phase HPLC (RP—HPLC) in the un—processed cell e medium of stable thB protein producing cells (Figure 7).

Example 10. ZS Protein Producing Cell Line Does Not Produce the Peak 11 lo Ul tion The raw th3-29ZS protein cell culture medium containing a complement factor B analog with the free cysteine substituted with sen’ne at the position 292 was subjected to RP- HPLC analysis with raw naive 293 FreeStyle cell culture medium as a negative control and raw th3 protein cell culture medium as a positive control (Figure 7). The QS protein cell culture medium did not produce any detectable Peak H population, whereas analysis of th3 protein cell e medium showed that 35% of thB was in the less active, Peak 11, population. (Figures 7A & B.) PCT/USZOl2/036459 Example 11. Generation and Characterization of th4 Expression Construct and th4 protein th4 protein was designed to change the aspartic acid, at amino acid 740 in hiBS, to an asparagine. This change is thought to attenuate or t the function of the serine se function of this ment factor B protein analog.

To create the th4 sion construct, site—specific mutation was uced into the th3 expression construct.

The th3 sion construct (SEQ ID N025) described in Example l was used as a template to make a mutation changing the aspartic acid (D) at position 740 in SEQ [D N0:4 to asparagine (N) using Stratagene’s Site—Directed Mutagenesis Kit (Stratagene, Santa Clara, CA) according to the manufacture’s instructions, creating the th4 expression construct.

Two primers were used: Forward primer ’-GTCCCCGCCCACGCCCGGAAQTTCCACATCAACCTGTTCCS’ (SEQ ID N0215) and Reverse primer ACAGGTTGATGTGGAAmCCGGGCGTGGGCGGGGAC- 3’ (SEQ ID . The underlined nucleotides indicate the nucleotide change that results in the amino acid change from D to N. This th4 expression construct includes, from 5’ to 3’, a CMV promoter, a ic intron, at codon optimized coding sequence for th4, an IRES- Neo selectable marker, and a tic polyA. The entire construct was sequenced to confirm the mutation and the integrity of the construct. The expected amino acid sequence for hlB4 is shown in SEQ ID NO:17. The only difference between the amino acid sequence of th3 and th4 is the D74ON change.

A stable cell line that expresses htB4 protein was generated by PEI—mediated transfection and drug selection of 293 cells as described in Example 3. The concentration of th4 protein in the cell culture medium of the selected cell population was measured by ECL [\J U] as described in Example 5.

Biological activity of th4 protein, purified as described in Example 9 using the one HIC chromatography step method, was examined by hemolytic activity assay as described in Example 7. Table 2 shows the inhibition of human ative complement pathway hemolytic activity by cell culture medium containing th4 protein. Relative hemolytic ty was scored by hemoglobin released after hemolysis of rRBC by human alternative complement pathway activity. As shown in Table 2, hiB4 protein efficiently inhibited the alternative ment pathway activity.

PCT/U82012/036459 Table 2. th4 inhibition of human alternative com lement athwa hemol tic activity Competed with 0.5ug wt th 1-0118 0-5115; 0.25ug 0-125ug mm 29a 3933 :03: 2%: Example 12. Generation and Characterization of an th3-Fc Expression Construct and an thS—Fc Protein th3-Fc is a fusion protein between th3 and an IgG Fc. Specifically, the full length of the th3 protein was fused with a human IgG4 PC.

To create an thS-Fc sion construct, a PCR product was amplified from the th3 expression construct (SEQ ID NO:5) described in e 1 using two s: the forward primer ’-GCGCACCGGTGCTAGCGAATTCGGCGACAAGAAGGGCAGCTGCGA-3’ (SEQ ID NO: 19); and the reverse primer CAGATCTCAGGAAGCCCAGGTCCTCAT—S’ (SEQ ID NO:20). The 377 hp PCR product containing the coding region for the C-terminus of th3-Fc was then digested with Age I and Bgl II and ligated into pFUSE—hIgG4Fc (Invivogen, Cat. Code: pfuse-hg4fc1) which was previously digested with Age I and Bgl II, creating the d pth3Cterm-Fc. The th3 expression construct (SEQ ID N025, bed in Example 1) was digested with ECOR I and EcoR V. The EcoR I/EcoR V fragment containing the inus of th3 was ligated into pth3Cten11-Fc which was previously digested with ECOR I and EcoR V, creating c. The pth3-Fc plasmid was digested with Nhe I and the fragment ning the th3 and Fe coding sequences was ligated into the modified pCI construct with IRES~Neo described in Example 1, creating the th3-Fc expression construct (SEQ ID NO: 18). This thS-Fc expression construct includes, from 5’ t0 3’, a CMV promoter, a chimeric intron, a coding sequence for , an IRES- Neo selectable marker, and a synthetic polyA. The entire construct was sequenced to confirm the integrity of the construct (SEQ ID NO: 18). SEQ ID NO:21 is the amino acid sequence of the th3-Fc protein.

A stable cell line that expresses th3-Fc n was generated by PEI-mediated transfection and drug selection of 293 cells as described in Example 3. The drug selected cells were cultured at 2 x 106 cells/mL for 72 hours. Then th3-Fc protein expression was examined by ting 2 pl of the cell culture supernatant to a non-reducing SDS—PAGE and Western blot analysis. As shown in Figure 8, two hands of th3-Fc protein were detected by a goat anti-factor B specific antibody (R&D Systems, Cat. No. AF2739). The molecular weight markers in KDa are ted on the left. Not wishing to be bound by theory, these two bands of th3-Fc protein might represent monomers and dimers of the protein.

Biological activity of th3-Fc protein (in cell culture atant) was examined by a hemolytic activity assay as described in Example 7. As shown in Table 3, th3—Fc protein inhibited the alternative ment pathway activity.

Table 3. th3-Fc inhibition of human alternative complement pathway hemolytic activity Control w/o wt compete with 0.5ug wt th 1 Sup. of th3-Fe 0 35ul 20u1 [ % inhibition 100 i 0.0 100.2 i 0.8 92.6 i 8.5 | Example 13. Effect of Repeated Freeze/Thaw on thS-292S Complement Inhibition ZS protein was purified as described in Example 9 using the one HIC tography step method. Purified th3-2928 protein in PBS, removed from a —80°C freezer and thawed at room temperature, was d as the first freeze and thaw cycle.

After this thaw, the th3-29QS protein concentration was ed to 2 mg/mL with PBS and one aliquot of th3-29ZS was sampled and saved on ice as the first free7e—and thaw sample.

The tube of th3-29QS protein was then frozen by sitting the tube in a methanol/dry ice bath for 20 minutes and then thawing at room ature till completely thawed (the second freeze and thaw cycle). One aliquot of the sample was sampled and set aside before repeating the next freeze and thaw cycle. The biological activity of samples from each cycle of freeze and thaw (total 7 times) were analyzed by measuring their ability to compete with wild type human factor B in the alternative complement pathway mediated hemolytic assay as described in Example 7. Each reaction contained a fixed amount of wild type human factor B (0.5 ttg) with increasing amounts of ’ZS. The results in Table 4 represent the percentage of inhibition in the hemolytic assay.

These results demonstrate that th3-29ZS protein can still effectively inhibit alternative pathway mediated hemolysis even after seven cycles of freeze and thaw (Table 4).

A similar level of hemolysis inhibition was observed through out all samples g that repeated freeze and thaw (up to 7 times) did not affect the th3—29ZS protein’s ability to inhibit complement ed hemolysis.

W0 20121151468 PCT/U82012/036459 Table 4. th3-29ZS After Freeze/Thaw cycles Freeze 'lhaw Cycles Amount of th3-29’ZS in Each Reaction 103.6 103.9 103.3 100.6 101.3 102.5 ‘ “g +/—0.4 +/—1.3 +/—0.1 +/-0.5 +/_1.4 +/—1.2 104.5 102.7 102.6 101.5 102.9 10234 0.5 pg +/—0.6 +/—1.0 +/—0.5 +/-l.5 +/—2.1 +/-0.9 98.8 99.8 99.5 97.9 97.1 97.8 95.5 095-~ “g +/-1.0 +/—2.0 +/—0.6 +/-1.5 +/—0.8 +/—0.5 +/-0.6 80.7 88.3 77.6 80.0 74.8 0105'7 “g +/—2.2 +/-1.3 +/—1.1 +/—0.8 +/-3.7 +/-1.4 +/—2.3 e 14. Greater Thermostability of th3-29ZS Protein Than th3 Protein hiB3 and th3-29QS proteins were ed as described in Example 9 using the one HIC chromatography step method. Purified th3 and ZS protein, both in PBS, were removed from -80°C. n concentration was re-adjusted to 2 mg/mL in PBS (pH 7.4). th3 and th3—29ZS proteins were equally aliquoted into three 0.6 mL eppendorf tubes (40 til. per tube) and then stored at 4°C, -80°C and 37°C conditions for 7 days. The biological activity (ability to inhibit complement ed hemolysis) of each of the stored samples was analyzed by measuring their ability to inhibit alternative complement pathway mediated hemolysis as described in e 7. The results of this tic assay showed that storage at 4°C or -80°C over 7 days did not affect the ability of either th3 or th3—29QS to t alternative complement pathway 111ediated heinolysis. However, th3 protein stored at 37°C for 7 days lost essentially all of its biological activity in all four samples tested. Remarkably, th3~29QS stored at 37°C for 7 days preserved its biological activity well and still could compete with wild-type human factor B effectively (Table 5). The results in the Table 5 represent the percentage of inhibition of human alternative complement activity (with standard deviation) by either thS or th3—29ZS. These results indicated that th3-29ZS protein has greater stability than th3 protein at 37°C.

PCT/U82012/036459 Table 5. Thermostability of th3 and th3-29ZS Amount of Purified th3 in Each on + 0.5 pg Wild Type Human Factor B Sam 1e Treatment 1.0 pg 0.5 pg 0.25 pg 0.125 pg 4°Cf0r7days 99.6i0.2 99.1i0.9 98.2i0.6 88.7i0.7 th3 —80°Cf0r7days 99.8i1.2 9821-18 97.2i1.1 89.2i5.8 37°C for 7 days 0.0 a. 5.5 0.0 a 3.7 0.3 a 5.8 4.1 i 6.4 Amount of Purified th3-292S in Each Reaction + 0.5 pg Wild Type Human Factor B 1.0pg l 0.5pg 0.25pg 0.125pg 4°Cfor7days 98.4i0.6 98.4i0.9 97.8i0.3 83.1i3.0 th3—292S —80°C for 7 days 99.0 i0.3 98.4 $0.7 96.8 i0.8 81.7 i111 37°C for 7 days 98.2 $0.4 94.6 4.0.9 78.2 $2.9 48.0 i- 1.3 Example 15. Protein Melting Point Determination of Human factor B, fB3, and B3- 2928 Proteins n melting temperature (Tm) is a measure of the thermal stability of a protein and changes in the amino acid sequence of a protein may affect, among other things,the protein’s l stability. Human factor B protein (th) contains twenty-three cysteine residues, twenty-two of which occur as ide bond pairs (cystine) and one of which, C292, is present in an un-paired free sulfhydn'le form.

The melting temperature profiles of th3 protein (K258A, R259A, K260A, D279G, N285D) and th3—29ZS protein (the single unpaired cysteine e of htB3 protein was modified to ) were compared to that of MB protein by incubating each protein in the presence of l-anilinonapthalene-S-sulfonic acid (ANS) and measuring the increase in ﬂuorescence of ANS at 460 nm. ANS binds to protein hydrophobic regions r, 1.

Molecular Biology (1965) -495) and has been used to igate the effect of temperature on the surface hydrophobicity of MB n (Takada, at. (Ll., Complement (1985) 22193-203). Samples containing th protein (35 pg), th3 protein (50 pg) and thB- 292$ protein (39 pg) were prepared in 100 pL of PBS (137 111M NaCl, 2.7 mM KCl, 10 mM phosphate, pH 7.4) buffer containing 10 mM ANS (lnvitrogen, Catalog # A—47). Samples of each protein (in triplicate) were incubated in closed polypropylene tubes for thirty minutes at 21°C, 30°C, 37°C, 44°C, 47°C, 50°C, 55°C, 60°C, and 65°C. The samples were transferred to a clear 96-well microplate (Costar, Catalog# 3635) and the ﬂuorescence was measured in a Perceptive Biosystems or 4000 microplate spectroﬂuorometer (excitation: 60/40 nm, emission=460140 nm). The results were analyzed using a non-linear 4PL curve fit. The Tm W0 20121151468 values (average of the results from two experiments) for wild type th protein, th3 protein and th3-292S protein were determined to be 46.4°C, 451°C, and 470°C, respectively. The five amino acid changes made in th3 protein with respect to wild type hiB protein (K258A.

R259A, K260A, D279G, N285D) resulted in a ATm = —1.3°C, indicating that th3 n was less thermally stable compared to a corresponding wild type th protein. r, the Tm of th3-292S protein (470°C) resulted in a ATm = +1.9”C with respect to th3 protein and indicated that th3-292S protein was at least as thermally stable as wild type th protein (464°C).

Therefore, ry to the results of Culajay, et. a1. (Biochemistry (2000) 3927153— 7158) which showed that substitution of a cysteine residue with serine in human fibroblast growth factor (FGF-l) protein (C838 or C1178) decreased the Tm by 13°C and 2°C, tively, the serine substitution of th3 at amino acid C292 resulted in th3-292S being more thermal stable than th3.

Example 16. thS-292S Protein Prevents Joint Inﬂammation and Damage in a Mouse Rheumatoid Arthritis Model Collagen antibody-induced arthritis (CAIA) is an aggressive mouse model for rheumatoid arthritis (Terato K et at, J. Immunol. (1992) 148(7):2103-8; Terato K et at, munity (1995) 22(3): 1 37—47). In this model, a collagen dy cocktail containing 4 monoclonal antibodies against collagen (Chondrex, lnc., Catalogue Number: 10010) with LPS boost was used to induce arthritis in ek—old DBA/lJ male wild type mice (Jackson Laboratory).

Forty mice were divided into three . Group 1 had '10 mice serving as a vehicle control group where 100 ML PBS (phosphate buffered saline, pH 7.4) was injected into the tail vein on day 0, a booster ion of 25 ug LPS (List Biological Lab, Campbell, California, Catalogue Number: 421) per mouse was administrated intraperitoneal (LPS was in PBS at a concentration 500 ug/mL) on day 3, and 100 ttL of PBS via the tail vein again on days 3, 5, 7, and 9. Group 2 had 15 mice that were injected with the en antibody cocktail (0.25 mg in 100 ttL PBS per mouse) via tail vein on day 0, received a r injection of 25 pg LPS on day 3, and were administered 100 tLL PBS via the tail vein on days 3, 5, 7, and 9. Group 3 had 15 mice that were injected with 0.25 mg of the collagen antibody cocktail and 1 mg of th3-292S protein, both together in 100 11L PBS per mouse via the tail W0 51468 PCT/U52012/036459 vein on day 0, administered a booster injection of 25 ttg LPS on day 3, and administered 1 mg of th3-29ZS protein in 100 uL PBS via tail vein on days 3, 5, 7, and 9.

Mice were examined every day. Each mouse weight was recorded when joint measurement took place. Forepaws and hind limb joints were ed using calipers for both width and thickness on days - l, 4, 6, 9 and ll. The measuring sequence was left front limb, left hind limb, right hind limb and right front limb. On day 11, all animals were sacrificed and all the limbs (left front limb, right front limb, left hind limb and right hind limb) were collected and stored in individually—labeled plastic cassettes. Each cassette was placed in a histology container box containing 10% neutral buffered formalin solution.

These mouse limbs were subjected to parafﬁn sectioning and H&E staining to examine the pathogenesis in the joints. Specifically, following ﬁxation, each limb from each mouse was transferred to a plastic cassette separately. The limbs were rinsed with running water in a beaker for 30 s (min) at room temperature (RT) to remove fixative solution.

Then each cassette was transferred to a beaker containing deealcified solution (Themio Scientific, Catalogue number 8340) by immersion of the cassette into the solution. Front limbs were decalcified for 8 hours and hind limbs were decalcified for 9 hours. After 8 hours or 9 hours, the limbs were again rinsed with running water for 30 min at RT to remove decalcified solution. After decalcifieation, limbs were stored in 70% ethanol overnight (O/N) for the next dehydration step. Limbs were dehydrated by sequentially immersing into: 75% ethanol (made from 100% ethanol) for two times; 85% ethanol for two times, 95% l for two times and 100% l for two times, each time for 15 min at RT with shaking.

Next, the limbs were immersed in a 1:1 mixture of 100% l and cedar wood oil (Fisher, Catalogue Number: 040—1) for 15 min at RT with shaking, and repeated two more times for a total of three times. The limbs were then immersed in 100% cedar wood oil and incubated at 40°C for 5 hrs. Following the 5 hour incubation, limbs were immersed in a 1:1 mixture of cedar wood oil and methyl salicylate , Catalogue number 1198) for 60 min at RT. The limbs were then immersed in another 1:1 mixture of cedar wood oil and methyl salicylate O/N at RT. Following the O/N tion, limbs were immersed in 100% methyl salicylate for 40 min at RT, repeated one more time (a total of two times). Finally, limbs were embedded in paraffin that was prepared by tion at 60°C for 7 hrs. in sections of the mouse limbs were prepared using a microtome and cut to a 7 ttm thickness. The sections were ted on a 40°C water bath and transferred to a Superfrost Plus cope slide. The slides were dried O/N at RT, and further dried by incubation O/N on a slide warmer. The slides were kept at RT until staining. d paraffin ns of the mouse limb were subjected to H&E staining. The sections were de—paraffinized and rehydrated by immersion into xylene for 3 min repeated 2 times for a total of 3 times. The excess xylene was then blotted, and sections were immersed in 100% l for 3 min. for a total of 3 times, then 95% ethanol for 3 min, once, 80% ethanol for 3 min, once, and deionized water for 5 min, once. All incubations were at RT.

For the hematoxylin staining, slides were immersed in hematoxylin for 4 min, one time, and rinsed with deionized water. The slides were immersed in tap water for 5 min one time to allow the stain to develop. The slides were dipped quickly, 8-12 times, into acid ethanol (200 ml 70% ethanol plus 150 uL trated HCL) to destain the sections. The slides were then rinsed twice for l min in tap water, and then once for 2 min in deionized water. The excess water was blotted from the slides prior to eosin staining.

For the eosin staining, slides were immersed in eosin once for 20 seconds. Slides were then dehydrated by immersion into 95% l 3 times for 5 min. Slides were incubated in 100% ethanol 3 times for 5 min. The excess ethanol was blotted, and the slides were incubated in xylene three times for 15 min. Coverslips were adhered to the slides using the xylene-based Permount (EMS, Catalogue number 17986-01) by placing a drop of Permount on the slide using a glass rod being careful not to form bubbles. The coverslip was then angled onto the slide and dropped gently onto the slide. The Permount was allowed to spread beneath the coverslip covering the entire n. The slides were dried O/N at RT in a chemical hood.

As shown in Figure 10, the group ed with collagen antibody cocktail in the absence of th3-29ZS (Group 2) induced severe front paw ng. Mice ed with the antibody cocktail, but were treated with him-2928 protein (Group 3) showed a 65% reduction in the size of the paw (p<0.0003) (Figure 10). These results demonstrate a significant tory effect ofjoint arthritis in this model by th3—292S. At 250 ug collagen antibody il dosage per mouse for the induction of CAIA, the hind limbs of the mice did not show obvious swelling. No significant adverse effect for th3-29ZS protein treatment on mouse weight was observed. The average weight of all mice maintained steadily. The average weight for all mice in all three groups was 20.4:t1.l grams by the end of the study.

As shown in Figure 9, the mice in Group I appeared to have normal joints, no detectable inﬂammatory cell infiltration into the joint and the cartilage and bones appeared W0 2012/151468 PCT/U82012/036459 normal (Figure 9, top panel). The mice in Group 2 had severe inﬂammation in the joints, inﬂammatory cell infiltration, pannus formation, cartilage damage and bone erosion (Figure 9, middle panel). The mice in Group 3 treated with th3-292S had normal joint structure, no inflammatory cell infiltration, no cartilage or bone erosion or damage (Figure 9, bottom panel).

These data demonstrated that th3-292S was significantly cious in preventing joint inﬂammation and damage in this CAIA mouse model, trating the therapeutic y of th3—29ZS n for rheumatoid arthritis Example 17. Generation and Characterization of an 2S-Fc Expression Construct and an th3-29ZS-Fe Protein A stable cell line that expresses th3-292S—FC protein (SEQ ID N0222) was generated by PEI-mediated transfection and drug selection of 293 cells as described in Example 3. The drug selected cells were cultured at 2 x 106 cells/mL for 72 hours. Then th3~292S—Fc protein expression was examined by subjecting 2 pl. of the cell culture 13 supernatant to a non-reducing SDS-PAGE and Western blot analysis. Two bands of th3— 2928-Fc protein were detected by a goat anti-factor B ic antibody. (Data not shown.) Not wishing to be bound by theory, these two bands of th3-29QS-Fc protein might represent monomers and dimers of the protein. th3-29ZS—Fc was purified with a Protein A column. Biological activity of purified th3-29ZS—Fc protein was examined by a hemolytic activity assay as described in Example 7.

As shown in Table 6, th3—292S-Fc protein inhibited the alternative ment y activity in a dose dependent manner.

Table 6. th3-292S-Fc inhibition of human alternative com lement athway hemolytic activity Control é w/o wt E e with 0.5 ttg wt th Amount of th3- 0 2.0 i 1.0 0.5 0.3 292S—Fc (pg) % inhibition 100+/—0.0 —l.9 | 75.4+/-1.2 47.3+/-3.2 I 34.o+/-5.3 Example 18. C-terminus Truncated MES-2928 A gene expression construct was made that. sed a truncated form of 2$ with the C-terminal 284 amino acids (the serine protease domain) being deleted. The molecule is designated as th3-292SN480 which is made up of the N-terminal 480 amino acids of th3—29ZS (amino acids 1-480 of SEQ ID N022 or amino acids 26—480 of SEQ ID N022 after cleavage of the secretion peptide ). The DNA sequence of the expression construct for th3—292SN480 is shown in SEQ ID NO:24 with tides 1064-2509 being the coding sequence for MB3—292SN480. The expression uct was transfected into 293 FreeStyle cells and selected with G418 as described previously in Example 3. The G418 resistant onal cell culture medium was subjected to Western blot is for th3- 29ZSN480 expression using full—length th3-2928 as a control (left lane). As shown in Figure 11, the Western blot analysis with a monoclonal antibody cally for th3-29ZS detected a band imately 55 KDa from the cell culture medium of th3-2923N480 cell line (right lane), suggesting that even with a 280 amino acid deletion from the C-terminus of th3-29QS, the N-terminal 480 amino acids can be expressed at an appropriate size.

An ative complement activity assay was performed as described previously, to determine if th3—292SN480 can inhibit alternative complement activity. As shown in Figure 13 the cell culture supernatant, from cells expressing th3-29ZSN480, inhibited the alternative complement activity in a dose-dependent . This demonstrates that fragments of th3—292S can still retain the ability to inhibit complement activity and ore can be utilized the same as described herein for 2S (SEQ ID N02) e 19. Monomeric th3-292S/Fc fusion protein th3-292S/Fc-mono A gene expression construct encoding a full-length 2S “fused” to a human IgG4 F0 was engineered. th3-29ZS is a monomer when it is ed in mammalian cells, such as human cells as described previously, e. g., see Figure 3 described in Example 6 which shows th3—292S was detected as one band at approximately MW 100 KDa under non- reducing conditions, suggesting th3-29ZS is a monomer. Two cysteines in the hinge region of the human IgG4 Fe were mutated to ensure the fusion protein would be monomer and retain hiB3—2928’s biological property for inhibiting complement activity. The two cysteines were mutated by substituting them each with a serine. This fusion protein of hiB3—2928 and the mutated IgG4 PC was designated th3-2928/Fc-mono. The DNA sequence for this fusion protein expression construct is shown in SEQ ID N0126. The corresponding amino acid sequence for th3 2928/Fc mono is shown in SEQ ID NO:25 with amino acids 1-764 being the hiB3-292S region and amino acids 765—1003 being the human IgG4 Fc region with amino acids 782 and 785 being serine amino acids that were substituted for cysteine residues found in a native human IgG4 Fe.

PCT/U52012/036459 The th3-292S/Pc-mono gene expression construct (SEQ ID NO:26) was transfected into human 293 FreeStyle cells. The cells were then subjected to G418 selection. The culture medium from the drug resistant cells was ted to Western blot analysis for the fusion protein. As shown in Figure 12, a band at approximately 115 KDa was detected by purified goat anti-human factor B antibody in this non-reducing SDS—PAGE and Western blot analysis. The two higher bands most likely were ates of the monomeric fusion protein.

The data suggested that the monomeric fusion protein between th3-29ZS and human IgG4 Fe (th3—29ZZS/Fe—mono) was successfully expressed in mammalian cells and that the majority of the fusion protein appeared to be monomeric.

To examine if th3-29ZS/Fc—mono preserved HEB—2923’s property of blocking ative complement activity, an alternative complement activity assay was performed as described previously. As shown in Figure 14, the cell culture supernatant from 9ZS/Fc—mono producing cells inhibited the alternative complement activity in a dose- dependent , suggesting that th3—29’ZS’S complement inhibitory activity was not lost in this monomeric th3—29ZS/Fc-mono fusion protein.

All ations, patents and patent applications ned in this specification are herein incorporated by reference in their entirety into the specification to the same extent as if each dual publication, patent or patent application was speciﬁcally and dually indicated to be incorporated herein by reference.

Claims

CLAIMS 1. The invention claimed is:

1. A polypeptide comprising a complement factor B protein analog, wherein the complement factor B analog ses a mutation of a free cysteine amino acid and is at least 90% identical to amino acids 26-764 of SEQ ID NOszl, 2 or 3; to amino acids 26-990 of SEQ ID NOs:22 or 23; to amino acids 26-480 of SEQ ID N012; or to amino acids 26—1003 of SEQ ID NO:26.

2. The polypeptide of claim 1, wherein the mutation comprises a substitution of the free cysteine. 10

3. The polypeptide of claim 2, wherein the free cysteine is substituted with more than one amino acid.

4. The polypeptide of claim 1, wherein the complement factor B protein analog is an analog of SEQ ID N014 and the complement factor B protein analog has ne amino acids that form disulfide bonds and a free cysteine amino acid has been substituted by another amino 15 acid.

5. The polypeptide of any one of the ing claims, wherein the free ne is substituted with an amino acid selected from the group consisting of alanine, histidine, isoleucine, leucine, methionine, phenylalanine, serine, threonine, tyrosine and valine.

6. The ptide of any one of the preceding claims, wherein the human complement 20 factor B analog competes with g of a native complement factor B.

7. The polypeptide of claim 1, n the mutation comprises a deletion of the free

8. The polypeptide of any one of the preceding claims, wherein the complement factor B protein analog is a human complement factor B protein . 25

9. The polypeptide of any one of the preceding claims, wherein the free cysteine corresponds to amino acid 292 of SEQ ID NO:1.

10. The polypeptide of any one of the preceding claims, wherein the complement factor B protein analog comprises at least one mutation corresponding to a mutation of SEQ ID NO:1 selected from the group consisting of K258A, R259A, K260A, D279G, N285D and D74ON. 30

l 1. The polypeptide of any one of the ing claims, wherein the complement factor B protein analog comprises mutations corresponding to K258A, R259A, K260A, D279G and N285D of SEQ ID NO:1.

12. The polypeptide of any one of the preceding , wherein the complement factor B protein analog comprises a mutation corresponding to D740N of SEQ ID NO:1.

13. The polypeptide of claim 1, wherein the complement factor B protein analog comprises amino acids 26—480 of SEQ ID N02.

14. The polypeptide of claim 13, n the complement factor B protein analog comprises amino acids 26-764 of SEQ ID NO:2.

15. The ptide of claim 1, wherein the complement factor B protein analog does not comprise amino acids 481-764 of SEQ ID NO:2.

16. The polypeptide of any one of claims 1—9, wherein said complement factor B IO protein analog has increased C3b binding afﬁnity as compared to a ponding native complement factor B protein and said complement factor B protein analog comprises (i) diminished protease activity as compared to the corresponding native complement factor B protein; (ii) diminished ability to be d by factor D protein as compared to the 15 corresponding native complement factor B protein; or (iii) diminished protease activity as compared to the corresponding native complement factor B protein and diminished ability to be cleaved by a factor D protein as ed to the corresponding native complement factor B protein.

17. The polypeptide of any one of the preceding claims, wherein the complement 20 factor B protein analog comprises a mutation in the C3b binding domain and the complement factor B protein analog exhibits increased binding afﬁnity to C3b as compared to the g afﬁnity of a corresponding native ment factor B protein to C3b.

18. The polypeptide of claim 17, wherein the on in the C3b binding domain comprises: 25 (i) a tution or deletion of an aspartic acid corresponding to amino acid 279 of SEQ ID NO:1, a tution or deletion of an asparagine corresponding to amino acid 285 of SEQ ID NO] or both; or (ii) an insertion of at least one amino acid next to said aspartic acid or said asparagine.

19. The polypeptide of claim 18, wherein said aspartic acid, said asparagine or both 3O are substituted with one or more amino acids.

20. The polypeptide of claim 18 or 19, wherein said aspartic acid is substituted with glycine, alanine or gine.

21. The polypeptide of any one of claims 18, 19 or 20, wherein said gine is substituted with glycine, alanine, or aspartic acid.

22. The polypeptide of claim 18, wherein said substitution comprises replacing said aspartic acid with glycine and said asparagine with ic acid.

23. The polypeptide of claim 16, wherein said complement factor B protein analog ses an alteration in the complement factor D cleavage site wherein the alteration decreases or s cleavage of the complement factor B protein analog by factor D protein.

24. The polypeptide of claim 23, wherein said alteration in the factor D cleavage site 10 comprises: (i) a substitution or deletion of an arginine corresponding to amino acid 259 of SEQ ID NO: 1, a substitution or deletion of one or both lysines ponding to amino acid 258 or 260 of SEQ ID NO:1 or a substitution or deletion of the arginine and both lysines; or (ii) an insertion next to the arginine, next to the one or both lysines, or next to the 15 arginine and one or both of the lysines.

25. The polypeptide of claim 24, wherein said amino acids corresponding to amino acids 258-260 of SEQ ID NO:1 are each replaced with alanine.

26. The polypeptide of any one of the preceding claims, wherein the complement factor B protein analog comprises a mutation in the active site of the serine protease domain, 2O wherein the on decreases or ablates the complement factor B protein analog’s ability to cleave complement factor C3 as compared to a corresponding native ment factor B protein.

27. The polypeptide of claim 26, n said mutation comprises a deletion or a substitution of an aspartic acid corresponding to amino acid 740 of SEQ ID N021. 25

28. The polypeptide of claim 27, wherein said aspartic acid corresponding to amino acid 740 of SEQ ID NO:1 is substituted with a serine, ne, glycine, alanine or glutamic acid.

29. The polypeptide of claim 27, wherein said substitution comprises substituting said aspartic acid with asparagine. 30

30. The ptide of any one of the preceding claims, wherein the human complement factor B protein analog is at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID N0:1, 2, 3, 22, 23 or 26.

31. The polypeptide of any one of claims 1—29, wherein the human complement factor B protein analog is at least 95%, at least 98% or at least 99% identical to amino acids 26-764 of SEQ ID NOszl, 2 or 3; to amino acids 26-990 of SEQ ID NOs:22 or 23; to amino acids 26-480 of SEQ ID NO:2; or to amino acids 26-1003 of SEQ ID NO:26.

32. The polypeptide of claim 1, wherein the complement factor B n analog ses SEQ ID NO:2, 3, 22, 23, 26, or amino acids 1—480 of SEQ ID N012.

33. The polypeptide of claim 1, wherein the complement factor B protein analog ses amino acids 26-764 of SEQ ID NO:2, amino acids 26—764 of SEQ ID N023, amino 10 acids 26-480 of SEQ ID NO:2, amino acids 26—990 of SEQ ID N0:22, amino acids 26-990 of SEQ ID N0z23, or amino acids 26-1009 of SEQ ID NO:26.

34. The ptide of claim 1, wherein the complement factor B protein analog consists essentially of amino acids 26—764 of SEQ ID NO:2, amino acids 26-764 of SEQ ID N023, amino acids 26-480 of SEQ ID NO:2, amino acids 26—990 of SEQ ID NO:22, amino 15 acids 26—990 of SEQ ID NO:23 or amino acids 26-1009 of SEQ ID NO:26.

35. The polypeptide of claim 1, wherein the polypeptide comprises an immuneglobulin Fc domain.

36. The polypeptide of claim 35, wherein the Fc domain is C-tenninal to the complement factor B analog. 2O

37. The polypeptide of claim 35 or 36, wherein the Fc domain has one or mutations of a cysteine(s) in the Fc domain sequence, wherein the one or more mutations inhibit dimer formation.

38. The ptide of any one of claims 35—3 7, wherein an EC domain comprises a mutation of one or more cysteines corresponding to amino acids 17 or 20 of SEQ ID N0:27. 25

39. The polypeptide of claim 37 or 38, wherein the one or more cysteines are substituted with an amino acid selected from the group consisting of histidine, isoleucine, leucine, methionine, phenylalanine, , threonine, ne, and valine.

40. The polypeptide of claim 35 or 36, wherein the Fc domain comprises an amino acid sequence selected from amino acids 766-990 of SEQ ID N0:21, 766-1003 of SEQ ID 30 NO:26, 786-1003 of SEQ ID N0226, 1-238 of SEQ ID NO:27.

41. The polypeptide of any one of claims 1-3 or 35-40, wherein the amino acid sequence of the complement factor B analog corresponds to a fragment of a complement factor B.

42. The polypeptide of claim 41, wherein the complement factor B analog comprises a truncation ponding to an N—terminal truncation of factor B.

43. The polypeptide of claim 41 or 42, wherein the complement factor B analog comprises a truncation corresponding to a C»terminal truncation of factor B.

44. The polypeptide of claim 43, wherein the complement factor B analog comprises a C—terminal truncation corresponding to a truncation C-terminal to an amino acid 10 corresponding to amino acid 407, 427, 457, 477, 480, 484, 487, 507 or 527 of SEQ ID NOszl, 2 or 4.

45. The polypeptide of claim 43, n the complement factor B analog comprises a truncation corresponding to a C-terminal truncation at an amino acid between amino acids corresponding to amino acids 7, 470-495 or 477—487 of SEQ ID NOszl, 2 15 or 4.

46. The polypeptide of any one of claims 41-43, wherein the complement factor B analog does not comprise amino acids corresponding to amino acids 408-764, 428-764, 458— 764, 4, 481-764, 4, 488-764, 508—764, 528-764 of SEQ ID NOs:1, 2 or 4.

47. The polypeptide of any one of the preceding claims, wherein the complement 20 factor B analog comprises mutations of amino acids corresponding to those in complement factor B that ct decay acceleration factor.

48. The polypeptide of any one of the preceding claims, wherein the complement factor B analog comprises one or more mutations of amino acids corresponding to amino acids 290, 291, 323, 363, 364, or 407 of SEQ ID N021. 25

49. The polypeptide of claim 48, wherein the one or more mutations are a substitution or deletion.

50. The polypeptide of claim 49, n the one or more ons correspond to one or more of K290A, K291A, K323E,Y363A, S364A or D407N of SEQ ID NO:1.

51. The polypeptide of claim 50, wherein the complement factor B analog ses 30 one of the following ations of mutations corresponding to K290A/K291A, Y363A/S364A or K290A/K291A/Y363A/S364A of SEQ ID NO:1.

52. The polypeptide of any one of the ing claims, wherein the ment factor B protein analog is at least 90%, at least 93%, at least 95%, at least 98%, at least 99.5% or at least 999% pure in relation to total protein.

53. The polypeptide of any one of the preceding claims, wherein the polypeptide inhibits or s complement activity.

54. The polypeptide of claim 53, wherein the polypeptide inhibits the alternative complement pathway.

55. The polypeptide of claim 1, wherein the complement factor B protein analog exhibits increased binding afﬁnity to factor D as compared to the binding afﬁnity of a 10 corresponding native complement factor B protein to factor D.

56. A c acid comprising a nucleotide sequence encoding the polypeptide of any one of the preceding claims.

57. A viral vector sing the nucleic acid of claim 56.

58. The viral vector of claim 57, wherein said viral vector is selected from the group 15 consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, a Herpes viral vector, a Hepatitis viral vector, an SV4O viral vector, an AAV , an EBV vector and an NDV vector.

59. The viral vector of claim 58, wherein said lentiviral vector is a BIV, HIV, EIAV, SIV or FIV vector. 20

60. The viral vector of claim 59, wherein the viral vector comprises a decay accelerating factor.

61. A ceutical preparation comprising the ptide of any one of claims 1- 55, the nucleic acid of claim 56, the viral vector of any one of claims 57-60 or any combination thereof. 25

62. The pharmaceutical preparation of claim 61, comprising at least one ingredient selected from the group consisting of histidine, MgClz, trehalose, a polysorbate, polysorbate 20, sucrose, arginine and proline.

63. Use of the polypeptide of any one of claims 1-55, the nucleic acid of claim 56, the viral vector of any one of claims 57—60, the pharmaceutical composition of claim 61 or 30 62, or any combination thereof in the cture of a medicament for inhibiting complement activity.

64. The use of claim 63, wherein the medicament is adapted to administer to a patient the polypeptide, the nucleic acid, the Viral vector, the pharmaceutical composition or any combination thereof.

65. The use of claim 63 or 64, wherein the ptide competes with binding of a native complement factor B.

66. Use of the polypeptide of any one of claims 1—55, the nucleic acid of claim 56, the viral vector of any one of claims 57—60, the pharmaceutical composition of claim 61 or 62, or any combination thereof in the cture of a medicament for treating a 10 complement mediated disease in a patient.

67. The use of claim 66, wherein the complement-mediated disease is a disease of the eye.

68. The use of claim 66, n the ment is formulated for administration to the eye. 15

69. The method of claim 68, wherein the medicament is formulated for administration by intravitreal injection, subretinal injection, injection to the intraanterior chamber of the eye, injection or application locally to the cornea, subconjunctival injection, subtenon injection, or by eye drops.

70. The use of any one of claims 66-69, wherein the complement-mediated disease is 20 macular degeneration, lated macular degeneration (AMD), geographic atrophy, wet AMD, myocardial infarction, dry AMD, drusen formation, arthritis, stroke, ischemic reperfusion injury, diabetic retinopathy, vitreoretinopathy, traumatic organ injury, corneal inﬂammation, corneal neovascularization, uveitis, ocular hypertension or glaucoma.

71. The use of any one of claims 66—69, wherein the complement—mediated disease is 25 selected from the group consisting of atherosclerosis, airway esponsiveness, immune related es, autoimmune related diseases, lupus nephritis, systemic lupus erythematosus (SLE), arthritis, rheumatologic diseases, hospholipid antibody me, intestinal and renal l/R injury, asthma, atypical hemolytic—uremic syndrome, Type II membranoproliferative glomerulonephritis, non-proliferative glomerulonephritis, fetal loss, 30 brain , post-traumatic organ damage, post infarction organ damage, itis, hereditary angioedema, paroxysmal nal hemoglobinuria, cerebrovascular accident, Alzheimer's disease, transplant ion, infections, sepsis, septic shock, Sjogren’s me, myasthenia , antibody-mediated skin diseases, Type I and Type II diabetes mellitus, n resistance syndrome, gestational diabetes, thyroiditis, idiopathic ocytopenic purpura and hemolytic anemia, neuropathies, multiple sclerosis, pulmonary bypass injury, polyarteritis nodosa, Henoch Schonlein purpura, serum sickness, Goodpasture’s disease, systemic necrotizing itis, post streptococcal glomerulonephritis, idiopathic pulmonary ﬁbrosis, membranous glomerulonephritis, acute shock lung syndrome, adult respiratory distress syndrome, and reperfusion.

72. The use of any one of claims 66-71, wherein the medicament is adapted for administration prior to, concurrently with, or after a complement inhibiting factor or an anti— 10 angiogenic factor.

73. The use of claim 72, wherein said complement inhibiting factor is selected from the group consisting of a Factor H, a Factor H—like 1, an MCP, a DAF, or a e form of an MCP.

74. The use of claim 72 or 73, wherein said anti—angiogenic factor is selected from 15 the group consisting of endostatin, a VEGF binding molecule, PEDF, T2-TrpRS, sFLT, aﬂibercept and kininostatin.

75. The use of any one of claims 66-74, wherein the medicament is adapted for administration prior to, concurrently with, or after an anti-inﬂammatory.

76. The use of claim 75, wherein the medicament 20 (i) is adapted for administration concurrently with the anti-inﬂammatory or (ii) comprises the anti-inﬂammatory.

77. The use of claim 75 or 46, wherein the anti-inﬂammatory is formulated for administration to the eye.

78. The use of any one of claims 75, 76 or 77, wherein the anti—inﬂammatory is 25 selected from the group ting of dexamethasone, dexamethasone sodium metasulfobenzoate, dexamethasone sodium phosphate, ﬂuorometholone, bromfenac, rofen, a cyclosporine ophthalmic emulsion, naproxen, glucocorticoids, ketorolac, ibuprofen, tolmetin, non—steroidal antidnflammatory drugs, steroidal anti-inﬂammatory drugs, diclofenac, rofen, indomethacin, and suprofen. 30

79. The use of any one of claims 64—66, wherein the medicament comprising the Viral vector is adapted for administration about once every week, month, 2 months, 3 months, 6 months, 9 months, year, 18 , 2 years, 30 months, 3 years, 5 years, or 10 years.

80. The use of any one of claims 66-79, wherein the medicament is adapted for administration prior to, concurrently with, or after a compound that inhibits complement activity, T-cell activation, B-cells, tumor necrosis factor (TNF), estrogen, eukin—1 or eron-gamma.

81. The use of claim 80, n the compound is selected from the group consisting of inﬂiximab, adalimumab, golimumab, etanercept, abatacept and rituximab.

82. The use of any one of claims 64—66, wherein the medicament comprising the Viral vector is adapted for administration only once to the patient. 10

83. A cell sing the nucleic acid of claim 56, wherein the cell expresses the polypeptide, provided that if the cell is a human cell it is ex vivo.

84. The cell of claim 83, wherein the cell is a mammalian cell.

85. The cell of claim 83, wherein the cell is selected from the group consisting of a 293 cell, a CHO cell, a PerC6 cell or a Vero cell. 15

86. The cell of claim 83, wherein the cell is a prokaryotic cell.

87. The cell of claim 83, wherein the cell is an E. coli cell.

88. A method of producing a polypeptide comprising a complement factor B protein analog, the method comprising: a. sing in a cell the polypeptide of any one of claims 1-55, provided that if 20 the cell is a human cell it is ex viva; and b. purifying said polypeptide.

89. The polypeptide of claim 1, substantially as herein described with reference to any one of the Examples and/or