NZ616036B2

NZ616036B2 - Modulation of signal transducer and activator of transcription 3 (stat3) expression

Info

Publication number: NZ616036B2
Application number: NZ616036A
Authority: NZ
Inventors: Susan M Freier; Youngsoo Kim; Robert A Macleod; Eric E Swayze
Original assignee: Ionis Pharmaceuticals Inc
Priority date: 2011-04-01
Filing date: 2012-03-30
Publication date: 2016-01-06

Abstract

Disclosed is single stranded modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion ttaaccttgctgacatccaaatagaa, wherein the nucleobase sequence is complementary to ttaaccttgctgacatccaaatagaa. Also disclosed is the use of the above described single stranded modified oligonucleotide in the manufacture of a medicament for treating cancer. y to ttaaccttgctgacatccaaatagaa. Also disclosed is the use of the above described single stranded modified oligonucleotide in the manufacture of a medicament for treating cancer.

Description

BIOL0142WO MODULATION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3 (STAT3) EXPRESSION Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0142WOSEQ.txt created March 29, 2012 which is 672 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field In certain embodiments provided are methods, compounds, and compositions for inhibiting expression of STAT3 mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate hyperproliferative diseases.

Background The STAT (signal transducers and activators of transcription) family of proteins are DNA- binding proteins that play a dual role in signal transduction and activation of transcription. Presently, there are six distinct members of the STAT family (STAT1, STAT2, STAT3, STAT4, STAT5, and STAT6) and several isoforms (STAT1α, STAT1β, STAT3 α and STAT3β). The activities of the STATs are modulated by various cytokines and mitogenic stimuli. Binding of a cytokine to its receptor results in the activation of Janus protein tyrosine kinases (JAKs) associated with these receptors. This phosphorylates STAT, resulting in translocation to the nucleus and transcriptional activation of STAT responsive genes. Phosphorylation on a specific tyrosine residue on the STATs results in their activation, resulting in the formation of homodimers and/or heterodimers of STAT which bind to specific gene promoter sequences. Events mediated by cytokines through STAT activation include cell proliferation and differentiation and prevention of apoptosis.

The specificity of STAT activation is due to specific cytokines, i.e., each STAT is responsive to a small number of specific cytokines. Other non-cytokine signaling molecules, such as growth factors, have also been found to activate STATs. Binding of these factors to a cell surface receptor associated with protein tyrosine kinase also results in phosphorylation of STAT.

STAT3 (also acute phase response factor (APRF)), in particular, has been found to be responsive to interleukin-6 (IL-6) as well as epidermal growth factor (EGF) (Darnell, Jr., J.E., et al., Science, 1994, 264, 1415-1421). In addition, STAT3 has been found to have an important role in signal transduction by interferons (Yang, C.-H., et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 5568-5572). Evidence exists suggesting that STAT3 may be regulated by the MAPK pathway. ERK2 induces serine phosphorylation and also associates with STAT3 (Jain, N., et al., Oncogene, 1998, 17, 3157-3167).

BIOL0142WO STAT3 is expressed in most cell types (Zhong, Z., et al., Proc. Natl. Acad. Sci. USA, 1994, 91, 4806-4810). It induces the expression of genes involved in response to tissue injury and inflammation.

STAT3 has also been shown to prevent apoptosis through the expression of bcl-2 (Fukada, T., et al., Immunity, 1996, 5, 449-460).

Recently, STAT3 was detected in the mitochondria of transformed cells, and was shown to facilitate glycolytic and oxidative phosphorylation activities similar to that of cancer cells (Gough, D.J., et al., Science, 2009, 324, 1713-1716). The inhibition of STAT3 in the mitochondria impaired malignant transformation by activated Ras. The data confirms a Ras-mediated transformation function for STAT3 in the mitochondria in addition to its nuclear roles.

Aberrant expression of or constitutive expression of STAT3 is associated with a number of disease processes.

Summary In a first aspect, the invention provides a single stranded modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 3008 to 3033 of SEQ ID NO: 1, wherein the nucleobase sequence is complementary to SEQ ID NO: 1.

In another aspect, the invention provides a single-stranded modified oligonucleotide consisting of 12 to 22 linked nucleosides, wherein the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or a 2’- substituted nucleoside; wherein the nucleobase sequence of the modified oligonucleotide is complementary to an equal length portion of nucleobases 3016 to 3031 of the nucleobase sequence of SEQ ID NO: 1; and wherein the compound inhibits expression of STAT3 mRNA expression.

In a further aspect, the invention provides a single stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 245, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleotides; a 5’-wing segment consisting of three linked nucleosides; and a 3’-wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5’-wing segment and the 3’-wing segment; wherein each nucleotide of each wing segment comprises a constrained ethyl nucleoside; wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage; and wherein each cytosine of the modified oligonucleotide is a 5’-methylcytosine.

BIOL0142WO In further aspects, the invention provides pharmaceutical compositions comprising the single stranded modified oligonucleotides of the invention, and the use of the oligonucleotides in the manufacture of medicaments for treating cancer.

The invention is defined in the claims. However, the description which follows may also refer to additional compounds, compositions and methods outside the scope of the present claims. This description is retained for technical information.

Provided herein are methods, compounds, and compositions for modulating expression of STAT3 mRNA and protein. In certain embodiments, compounds useful for modulating expression of STAT3 mRNA and protein are antisense compounds. In certain embodiments, the antisense compounds are antisense oligonucleotides.

In certain embodiments, modulation can occur in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human. In certain embodiments, STAT3 mRNA levels are reduced. In certain embodiments, STAT3 protein levels are reduced. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.

Also provided are methods, compounds, and compositions useful for preventing, treating, and ameliorating diseases, disorders, and conditions. In certain embodiments, such diseases, disorders, and conditions are hyperproliferative diseases, disorders, and conditions. In certain embodiments such hyperproliferative diseases, disorders, and conditions include cancer as well as associated malignancies and metastases. In certain embodiments, such cancers include lung cancer, including non small cell lung cancer (NSCLC), pancreatic cancer, colorectal cancer, multiple myeloma, hepatocellular carcinoma (HCC), glioblastoma, ovarian cancer, osteosarcoma, head and neck cancer, breast cancer, epidermoid carcinomas, intestinal adenomas, prostate cancer, and gastric cancer.

Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of a hyperproliferative disease include growing older; tobacco use; exposure to sunlight and ionizing radiation; contact with certain chemicals; infection with certain viruses and bacteria; certain hormone therapies; family history of cancer; alcohol use; and certain lifestyle choices including poor diet, lack of physical activity, and/or being overweight.

Certain symptoms and outcomes associated with development of a hyperproliferative disease include a thickening or lump in the breast or any other part of the body; a new mole or a change in an existing mole; a sore that does not heal; hoarseness or a cough that does not go away; changes in bowel or bladder habits; discomfort after eating; difficulty in swallowing; unexplained weight gain or loss; unusual bleeding or discharge; fatigue; metastasis of one or more tumors throughout the body; cardiovascular complications, including, cardiac arrest and stroke; and death.

In certain embodiments, methods of treatment include administering a STAT3 antisense compound to an individual in need thereof. In certain embodiments, methods of treatment include administering a STAT3 antisense oligonucleotide to an individual in need thereof.

BIOL0142WO Detailed Description It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Unless otherwise indicated, the following terms have the following meanings: “2’-deoxynucleoside” means a nucleoside comprising 2’-H furanosyl sugar moiety, as found naturally occurring in deoxyribonucleosides (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil). “2’-O-methoxyethyl” (also 2’-MOE and 2’-O(CH ) -OCH ) refers to an O-methoxy-ethyl 2 2 3 modification of the 2’ position of a furosyl ring. A 2’-O-methoxyethyl modified sugar is a modified sugar. “2’-MOE nucleoside” (also 2’-O-methoxyethyl nucleoside) means a nucleoside comprising a 2’- MOE modified sugar moiety. “2’-substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position other than H or OH. Unless otherwise indicated, a 2’-substituted nucleoside is not a bicyclic nucleoside. “5’-methylcytosine” means a cytosine modified with a methyl group attached to the 5’ position.

A 5-methylcytosine is a modified nucleobase.

BIOL0142WO “About” means within ±10% of a value. For example, if it is stated, “the compounds affected at least about 70% inhibition of STAT3”, it is implied that the STAT3 levels are inhibited within a range of 63% and 77%.

“Active pharmaceutical agent” means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to STAT3 is an active pharmaceutical agent.

“Active target region” or “target region” means a region to which one or more active antisense compounds is targeted. “Active antisense compounds” means antisense compounds that reduce target nucleic acid levels or protein levels.

“Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

“Administering” means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.

“Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antibody” refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.

“Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

“Antisense compound” means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, snoRNAs, miRNAs, and satellite repeats.

BIOL0142WO “Antisense inhibition” means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid as compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

“Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

“Bicyclic sugar” means a furosyl ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.

“Bicyclic nucleoside” (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’-carbon of the sugar ring.

“Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound. “cEt” or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH )-O-2’.

“Constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH )-O-2’ bridge.

“Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2’-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-O- methoxyethyl modifications.

“Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions.

“Co-administration” means administration of two or more pharmaceutical agents to an individual.

The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

“Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

“Contiguous nucleobases” means nucleobases immediately adjacent to each other.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition may be a liquid, e.g. saline solution.

“Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two BIOL0142WO or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.

“Effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.

“Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

“Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” “Gap-widened” means a chimeric antisense compound having a gap segment of 12 or more contiguous 2’-deoxyribonucleosides positioned between and immediately adjacent to 5’ and 3’ wing segments having from one to six nucleosides.

“Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

“Hyperproliferative disease” means a disease characterized by rapid or excessive growth and reproduction of cells. Examples of hyperproliferative diseases include cancer, e.g., carcinomas, sarcomas, lymphomas, and leukemias as well as associated malignancies and metastases.

“Identifying an animal at risk for hyperproliferative disease” means identifying an animal having been diagnosed with a hyperproliferative disease or identifying an animal predisposed to develop a hyperproliferative disease. Individuals predisposed to develop a hyperproliferative disease include those having one or more risk factors for hyperproliferative disease including older age; history of other hyperproliferative diseases; history of tobacco use; history of exposure to sunlight and/or ionizing radiation; prior contact with certain chemicals, especially continuous contact; past or current infection with certain viruses and bacteria; prior or current use of certain hormone therapies; genetic predisposition; alcohol use; and certain lifestyle choices including poor diet, lack of physical activity, and/or being overweight. Such identification may be accomplished by any method including evaluating an individual’s medical history and standard clinical tests or assessments.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.

BIOL0142WO “Inhibiting STAT3” means reducing expression of STAT3 mRNA and/or protein levels in the presence of a STAT3 antisense compound, including a STAT3 antisense oligonucleotide, as compared to expression of STAT3 mRNA and/or protein levels in the absence of a STAT3 antisense compound, such as an antisense oligonucleotide.

“Individual” means a human or non-human animal selected for treatment or therapy.

“Internucleoside linkage” refers to the chemical bond between nucleosides.

“Linked nucleosides” means adjacent nucleosides which are bonded together.

“Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

“Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

“Modified nucleobase” refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

“Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.

“Modified oligonucleotide” means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Modified sugar” refers to a substitution or change from a natural sugar.

“Motif” means the pattern of chemically distinct regions in an antisense compound.

“Naturally occurring internucleoside linkage” means a 3' to 5' phosphodiester linkage.

“Natural sugar moiety” means a sugar found in DNA (2’-H) or RNA (2’-OH).

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

“Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

“Nucleoside” means a nucleobase linked to a sugar.

"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non- BIOL0142WO phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.

“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

“Off-target effect” refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

“Oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

“Parenteral administration” means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.

“Peptide” means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

“Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

“Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage (P=S) is a modified internucleoside linkage.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

“Prevent” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.

BIOL0142WO “Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

“Side effects” means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Signal Transducer and Activator of Transcription 3 nucleic acid” or “STAT3 nucleic acid” means any nucleic acid encoding STAT3. For example, in certain embodiments, a STAT3 nucleic acid includes a DNA sequence encoding STAT3, an RNA sequence transcribed from DNA encoding STAT3 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding STAT3.

“STAT3 mRNA” means an mRNA encoding a STAT3 protein.

“Single-stranded oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand.

“Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.

“Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

“Target nucleic acid,” “target RNA,” “target mRNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5’ target site” refers to the 5’-most nucleotide of a target segment. “3’ target site” refers to the 3’-most nucleotide of a target segment.

“Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

“Treat” refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.

“Unmodified nucleotide” means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

Certain Embodiments BIOL0142WO In certain embodiments provided are methods, compounds, and compositions for inhibiting STAT3 mRNA or protein expression.

In certain embodiments provided are methods for preventing tumor growth and tumor volume. In certain embodiments provided are methods for reducing tumor growth and tumor volume.

In certain embodiments provided are methods, compounds, and compositions for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with STAT3 in an individual in need thereof. Also contemplated are methods and compounds for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with STAT3.

STAT3 associated diseases, disorders, and conditions include hyperproliferative diseases, e.g., cancer, carcinomas, sarcomas, lymphomas, and leukemias as well as associated malignancies and metastases.

In certain embodiments provided are STAT3 antisense compounds for use in treating, preventing, or ameliorating a STAT3 associated disease. In certain embodiments, STAT3 antisense compounds are STAT3 antisense oligonucleotides, which are capable of inhibiting the expression of STAT3 mRNA and/or STAT3 protein in a cell, tissue, or animal.

In certain embodiments provided are a STAT3 antisense compound as described herein for use in treating or preventing lung cancer, including non small cell lung cancer (NSCLC), pancreatic cancer, colorectal cancer, multiple myeloma, hepatocellular carcinoma (HCC), glioblastoma, ovarian cancer, osteosarcoma, head and neck cancer, breast cancer, epidermoid carcinomas, intestinal adenomas, prostate cancer, and gastric cancer.

In certain embodiments provided are a STAT3 antisense compound as described herein for use in treating or preventing cancer from metastasizing.

In certain embodiments provided are a STAT3 antisense compound, as described herein, for use in treating, preventing, or ameliorating hyperproliferative diseases, e.g., cancer, carcinomas, sarcomas, lymphomas, and leukemias as well as associated malignancies and metastases.

In certain embodiments provided are antisense compounds targeted to a STAT3 nucleic acid. In certain embodiments, the STAT3 nucleic acid is any of the sequences set forth in GENBANK Accession No. NM_139276.2 (incorporated herein as SEQ ID NO: 1) or the complement of GENBANK Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000 (incorporated herein as SEQ ID NO: In certain embodiments, the antisense compounds provided herein are targeted to any one of the following regions of SEQ ID NO 1: 250-286; 250-285; 264-285; 264-282; 728-745; 729-745; 729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920; 1899-1920; 1899-1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963; 1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696; 2699- 2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033, 3015-3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499; 3460-3476; 3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595- 3612; 3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977-4012; 4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252; 4306-4341; 4431-4456; 4439-4454; 4471-4510; 4488- BIOL0142WO 4505; 4530-4558; 4539-4572; 4541-4558; 4636-4801; 4782-4796; 4800-4823; 4811-4847; 4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827-4844; 4842-4859.

In certain embodiments, the antisense compounds provided herein are complementary within any one of the following regions of SEQ ID NO 1: 250-286; 250-285; 264-285; 264-282; 728-745; 729-745; 729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920; 1899-1920; 1899-1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963; 1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696; 2699-2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033, 3015-3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499; 3460-3476; 3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595-3612; 3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977-4012; 4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252; 4306-4341; 4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558; 4539-4572; 4541-4558; 4636-4801; 4782-4796; 4800-4823; 4811-4847; 4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827-4844; 4842-4859. In certain embodiments, provided are compounds comprising: a modified antisense oligonucleotide consisting of 12 to 22 linked nucleosides, wherein the modified antisense oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or 2’- substituted nucleoside; wherein the nucleobase sequence of the modified antisense oligonucleotide is complementary to an equal length portion of any of nucleobases 250-286; 250-285; 264-285; 264-282; 728-745; 729-745; 729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920; 1899-1920; 1899-1919; 1899- 1918; 1899-1916; 1901-1916; 1946-1963; 1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204- 2221; 2681-2696; 2699-2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033, 3015- 3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499; 3460-3476; 3583-3608; 3591- 3616; 3595-3615; 3595-3614; 3595-3612; 3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889- 3932; 3977-4012; 4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252; 4306- 4341; 4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558; 4539-4572; 4541-4558; 4636- 4801; 4782-4796; 4800-4823; 4811-4847; 4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827- 4844; 4842-4859 of the nucleobase sequence of SEQ ID NO: 1.

In certain embodiments, the antisense compounds provided herein are targeted to any one of the following regions of SEQ ID NO 2: 2668-2688; 2703-2720; 5000-5021; 5001-5017; 5697-5722; 5699- 5716; 6475 - 6490; 6475 - 6491; 6476 – 6491; 7682-7705; 8078-8097; 8079-8095; 9862-9811; 9870- 9897; 9875-9893; 9875-9891; 9877-9893; 11699-11719; 12342-12366; 12345-12364;12346-12364; 12347-12364; 12353-12380; 12357-12376; 12358-12376; 12358-12373; 12360-12376; 14128-14148; 16863-16883; 46091-46111; 50692-50709; 50693-50709; 50693-50708; 61325-61349; 66133-66157; BIOL0142WO 66136-66157; 66136 - 66155; 66136-66153; 66138-66153; 66184-66200; 67067-67083; 4171-74220; 74199-74220; 74202-74220; 74171-74219; 74199-74219; 74202-74219; 74171-74218; 74199-74218; 74202-74218; 74723-74768; 74764-74803; 74782-74802; 74782-74801; 74782-74800; 74782-74799; 74783-74802; 74783-74801; 74783-74800; 74783-74799; 74862-74893; 74900-74977; 74902-74922; 74902-74920; 75070-75119; 75164-75199; 75254-75287; 75412-75443; 75421-75439; 75422-75439; 75422-75438; 75423-75439; 75423-75438; 75493-75528; 75616-75643; 75626-75641; 75658-75699; 75676-75692; 75717-75745; 75726-75759; 75726-75745; 75727-75745; 75728-75745; 75831-75988; 75852-75969; 75969-75984; 75987-76056; 76000-76046; 76000-76032; 76000-76018; 76014-76046; 76014-76032; 76029-76046; and 76031-76046.

In certain embodiments, the antisense compounds provided herein are complementary within any one of the following regions of SEQ ID NO 2: 2668-2688; 2703-2720; 5000-5021; 5001-5017; 5697- 5722; 5699-5716; 6475 - 6490; 6475 - 6491; 6476 – 6491; 7682-7705; 8078-8097; 8079-8095; 9862- 9811; 9870-9897; 9875-9893; 9875-9891; 9877-9893; 11699-11719; 12342-12366; 12345-12364;12346- 12364; 12347-12364; 12353-12380; 12357-12376; 12358-12376; 12358-12373; 12360-12376; 14128- 14148; 16863-16883; 46091-46111; 50692-50709; 50693-50709; 50693-50708; 61325-61349; 66133- 66157; 66136-66157; 66136 - 66155; 66136-66153; 66138-66153; 66184-66200; 67067-67083; 4171- 74220; 74199-74220; 74202-74220; 74171-74219; 74199-74219; 74202-74219; 74171-74218; 74199- 74218; 74202-74218; 74723-74768; 74764-74803; 74782-74802; 74782-74801; 74782-74800; 74782- 74799; 74783-74802; 74783-74801; 74783-74800; 74783-74799; 74862-74893; 74900-74977; 74902- 74922; 74902-74920; 75070-75119; 75164-75199; 75254-75287; 75412-75443; 75421-75439; 75422- 75439; 75422-75438; 75423-75439; 75423-75438; 75493-75528; 75616-75643; 75626-75641; 75658- 75699; 75676-75692; 75717-75745; 75726-75759; 75726-75745; 75727-75745; 75728-75745; 75831- 75988; 75852-75969; 75969-75984; 75987-76056; 76000-76046; 76000-76032; 76000-76018; 76014- 76046; 76014-76032; 76029-76046; and 76031-76046.

In certain embodiments, provided are compounds comprising: a modified antisense oligonucleotide consisting of 12 to 22 linked nucleosides, wherein the modified antisense oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or 2’- substituted nucleoside; wherein the nucleobase sequence of the modified antisense oligonucleotide is complementary to an equal length portion of any of nucleobases 2668-2688; 2703-2720; 5000-5021; 5001-5017; 5697-5722; 5699-5716; 6475 - 6490; 6475 - 6491; 6476 – 6491; 7682-7705; 8078-8097; 8079-8095; 9862- 9811; 9870-9897; 9875-9893; 9875-9891; 9877-9893; 11699-11719; 12342-12366; 12345- 12364;12346-12364; 12347-12364; 12353-12380; 12357-12376; 12358-12376; 12358-12373; BIOL0142WO 12360-12376; 14128-14148; 16863-16883; 46091-46111; 50692-50709; 50693-50709; 50693- 50708; 61325-61349; 66133-66157; 66136-66157; 66136 - 66155; 66136-66153; 66138-66153; 66184-66200; 67067-67083; 4171-74220; 74199-74220; 74202-74220; 74171-74219; 74199- 74219; 74202-74219; 74171-74218; 74199-74218; 74202-74218; 74723-74768; 74764-74803; 74782-74802; 74782-74801; 74782-74800; 74782-74799; 74783-74802; 74783-74801; 74783- 74800; 74783-74799; 74862-74893; 74900-74977; 74902-74922; 74902-74920; 75070-75119; 75164-75199; 75254-75287; 75412-75443; 75421-75439; 75422-75439; 75422-75438; 75423- 75439; 75423-75438; 75493-75528; 75616-75643; 75626-75641; 75658-75699; 75676-75692; 75717-75745; 75726-75759; 75726-75745; 75727-75745; 75728-75745; 75831-75988; 75852- 75969; 75969-75984; 75987-76056; 76000-76046; 76000-76032; 76000-76018; 76014-76046; 76014-76032; 76029-76046; and 76031-76046 of the nucleobase sequence of SEQ ID NO: 2.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 3008 to 3033 of SEQ ID NO: 1, wherein the nucleobase sequence is complementary to SEQ ID NO: 1.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 3016 to 3031 of SEQ ID NO: 1, wherein the nucleobase sequence is complementary to SEQ ID NO: 1.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 6476 to 6491 of SEQ ID NO: 2, wherein the nucleobase sequence is complementary to SEQ ID NO: 2.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 250-286; 250-285; 264-285; 264- 282; 728-745; 729-745; 729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920; 1899-1920; 1899- 1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963; 1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696; 2699-2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033, 3015- 3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499; 3460-3476; 3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595-3612; 3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977- 4012; 4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252; 4306-4341; 4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558; 4539-4572; 4541-4558; 4636-4801; 4782-4796; 4800- 4823; 4811-4847; 4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827-4844; or 4842-4859 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 1.

BIOL0142WO Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 2668-2688; 2703-2720; 5000- 5021; 5001-5017; 5697-5722; 5699-5716; 6475 - 6490; 6475 - 6491; 6476 – 6491; 7682-7705; 8078- 8097; 8079-8095; 9862-9811; 9870-9897; 9875-9893; 9875-9891; 9877-9893; 11699-11719; 12342- 12366; 12345-12364;12346-12364; 12347-12364; 12353-12380; 12357-12376; 12358-12376; 12358- 12373; 12360-12376; 14128-14148; 16863-16883; 46091-46111; 50692-50709; 50693-50709; 50693- 50708; 61325-61349; 66133-66157; 66136-66157; 66136 - 66155; 66136-66153; 66138-66153; 66184- 66200; 67067-67083; 4171-74220; 74199-74220; 74202-74220; 74171-74219; 74199-74219; 74202- 74219; 74171-74218; 74199-74218; 74202-74218; 74723-74768; 74764-74803; 74782-74802; 74782- 74801; 74782-74800; 74782-74799; 74783-74802; 74783-74801; 74783-74800; 74783-74799; 74862- 74893; 74900-74977; 74902-74922; 74902-74920; 75070-75119; 75164-75199; 75254-75287; 75412- 75443; 75421-75439; 75422-75439; 75422-75438; 75423-75439; 75423-75438; 75493-75528; 75616- 75643; 75626-75641; 75658-75699; 75676-75692; 75717-75745; 75726-75759; 75726-75745; 75727- 75745; 75728-75745; 75831-75988; 75852-75969; 75969-75984; 75987-76056; 76000-76046; 76000- 76032; 76000-76018; 76014-76046; 76014-76032; 76029-76046; or 76031-76046of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 2.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises the sequence of SEQ ID NO: 245.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide consists of the sequence of SEQ ID NO: 245.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises the sequence of SEQ ID NO: 413.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide consists of the sequence of SEQ ID NO: 413.

In certain embodiments, the modified oligonucleotide is 100% complementary to SEQ ID NO: 1 or 2.

In certain embodiments, the modified oligonucleotide consists of a single-stranded modified oligonucleotide.

In certain embodiments, the modified oligonucleotide has at least one modified internucleoside linkage.

In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleoside comprises a modified sugar.

In certain embodiments, at least one modified sugar is a bicyclic sugar.

In certain embodiments, the bicyclic sugar comprises a 4’- CH -O-2’ bridge.

In certain embodiments, the bicyclic sugar comprises a 4’-CH(CH )-O-2’ bridge.

BIOL0142WO In certain embodiments, the modified sugar comprises a 2’-O(CH ) -OCH group. 2 2 3 In certain embodiments, the modified sugar comprises a 2’-O-CH group.

In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

In certain embodiments, the modified nucleobase is a 5’-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or one 2’- substituted nucleoside.

In certain embodiments, the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside and at least one 2’-substituted nucleoside.

In certain embodiments, the 2’-substituted nucleoside comprises any of the group consisting of a 2’-O(CH ) -OCH group or a 2’-O-CH group. 2 2 3 3 In certain embodiments, the bicyclic nucleoside comprises any of the group consisting of a 4’- CH -O-2’ bridge and a 4’-CH(CH )-O-2’ bridge.

In certain embodiments, the modified oligonucleotide comprises: a 5’-wing consisting of 3 linked nucleosides; a 3’-wing consisting of 3 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 10 linked 2’-deoxynucleosides; wherein each nucleoside of each of the 5’-wing and the 3’-wing comprises a constrained ethyl nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5’-methylcytosine.

Certain embodiments provide compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 245.

Certain embodiments provide compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 413.

Certain embodiment provide compounds, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases BIOL0142WO of any of the nucleobase sequences of SEQ ID NOs: 9-426, 430-442, 445-464, 471-498, 500-1034, 1036- 1512, and 1541-2757.

In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

In certain embodiments, at least one nucleoside comprises a modified sugar.

In certain embodiments, at least one modified sugar is a bicyclic sugar.

In certain embodiments, the bicyclic sugar comprises a 4’- CH -O-2’ bridge.

In certain embodiments, the modified sugar comprises a 2’-O(CH ) -OCH group. 2 2 3 In certain embodiments, the modified sugar comprises a 2’-O-CH group.

In certain embodiments, the modified nucleobase is a 5’-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or 2’- substituted nucleoside.

In certain embodiments, the modified oligonucleotide comprises: a 5’-wing consisting of 3 linked nucleosides; a 3’-wing consisting of 3 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 10 linked 2’-deoxynucleosides; BIOL0142WO wherein each nucleoside of each of the 5’-wing and the 3’-wing comprises a constrained ethyl nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5’-methylcytosine.

Certain embodiments provide compounds comprising: a modified oligonucleotide consisting of 12 to 22 linked nucleosides, wherein the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or a 2’- substituted nucleoside; wherein the nucleobase sequence of the modified oligonucleotide is complementary to an equal length portion of nucleobases 3016 to 3031 of the nucleobase sequence of SEQ ID NO: 1; and wherein the compound inhibits expression of STAT3 mRNA expression.

Certain embodiments provide compounds comprising: a modified oligonucleotide consisting of 12 to 22 linked nucleosides, wherein the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or a 2’- substituted nucleoside; wherein the nucleobase sequence of the modified oligonucleotide is complementary to an equal length portion of nucleobases 6476 to 6491 of the nucleobase sequence of SEQ ID NO: 2; and wherein the compound inhibits expression of STAT3 mRNA expression.

In certain embodiments, at least one of the 5’-wing and the 3’-wing comprises at least one 2’- deoxynucleoside.

In certain embodiments, the modified oligonucleotide comprises at least one bicyclic nucleoside.

In certain embodiments, at least one bicyclic nucleoside comprises a 4’-CH(CH )-O-2’ bridge.

In certain embodiments, each bicyclic nucleoside comprises a 4’-CH(CH )-O-2’ bridge.

In certain embodiments, at least one bicyclic nucleoside comprises a 4’- CH -O-2’ bridge.

In certain embodiments, each bicyclic nucleoside comprises a 4’- CH -O-2’ bridge.

In certain embodiments, the modified oligonucleotide comprises at least one 2’-substituted nucleoside.

BIOL0142WO In certain embodiments, at least one 2’-substituted nucleoside comprises a 2’-O(CH ) -OCH 2 2 3 group.

In certain embodiments, each 2’-substituted nucleoside comprises a 2’-O(CH ) -OCH group. 2 2 3 In certain embodiments, at least one 2’-substituted nucleoside comprises a 2’-O-CH group.

In certain embodiments, each 2’-substituted nucleoside comprises a 2’-O-CH group.

In certain embodiments, at least one internucleoside linkage is a modified internucleoside linkage.

In certain embodiments, each modified internucleoside linkage is a phosphorothioate linkage.

In certain embodiments, the modified nucleobase is a 5’-methylcytosine.

In certain embodiments, the modified oligonucleotide has a sugar motif described by Formula A as follows: (J) -(B) -(J) -(B) -(A) -(D) -(A) -(B) -(J) -(B) -(J) m n p r t g v w x y z wherein: each A is independently a 2’-substituted nucleoside; each B is independently a bicyclic nucleoside; each J is independently either a 2’-substituted nucleoside or a 2’-deoxynucleoside; each D is a 2’-deoxynucleoside; m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that: at least one of m, n, and r is other than 0; at least one of w and y is other than 0; the sum of m, n, p, r, and t is from 2 to 5; and the sum of v, w, x, y, and z is from 2 to 5.

In certain embodiments, the modified oligonucleotide has a sugar motif of any of the group consisting of: k-d(10)-k e-d(10)-k k-d(10)-e k-k-d(10)-k-k k-k-d(10)-e-e e-e-d(10)-k-k k-k-k-d(10)-k-k-k e-e-e-d(10)-k-k-k BIOL0142WO k-k-k-d(10)-e-e-e k-k-k-d(10)-k-k-k e-k-k-d(10)-k-k-e e-e-k-d(10)-k-k-e e-d-k-d(10)-k-k-e e-k-d(10)-k-e-k-e k-d(10)-k-e-k-e-e e-e-k-d(10)-k-e-k-e e-d-d-k-d(9)-k-k-e e-e-e-e-d(9)-k-k-e wherein, k is a constrained ethyl nucleoside, e is a 2’-MOE substituted nucleoside, and d is a 2’- deoxynucleoside.

Certain embodiments provide methods of treating a hyperproliferative disease in an animal, comprising administering to an animal in need thereof a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 9-426, 430-442, 445-464, 471-498, 500-1034, 1036-1512, and 1541-2757.

Certain embodiments provide methods of treating a hyperproliferative disease in an animal, comprising administering to an animal in need thereof a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of SEQ ID NO: 245.

Certain embodiments provide methods of treating a hyperproliferative disease in an animal, comprising administering to an animal in need thereof a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of SEQ ID NO: 413.

In certain embodiments, the administering reduces tumor size in the animal.

In certain embodiments, the administering reduces tumor volume in the animal.

In certain embodiments, the administering prevents metastasis in the animal.

In certain embodiments, the administering prolongs survival of the animal.

In certain embodiments, the administering reduces cachaxia in the animal.

Certain embodiments provide methods of reducing expression of STAT3 in an animal, comprising administering to an animal in need thereof a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 9-426, 430-442, 445-464, 471-498, 500-1034, 1036-1512, and 1541-2757.

Certain embodiments provide methods of reducing expression of STAT3 in an animal, comprising administering to an animal in need thereof a compound comprising a modified BIOL0142WO oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of SEQ ID NO: 245.

Certain embodiments provide methods of reducing expression of STAT3 in an animal, comprising administering to an animal in need thereof a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of SEQ ID NO: 413.

In certain embodiments, the compound does not have the wing-gap-wing motif of 22.

Antisense compounds Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be “antisense” to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to a STAT3 nucleic acid is 12 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a STAT3 nucleic acid is 14 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a STAT3 nucleic acid is 12 to 22 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits, 14 to 30 linked subunits, or 12 to 22 linked subunits, respectively. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to , 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to linked subunits. In certain such embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.

In certain embodiments antisense oligonucleotides targeted to a STAT3 nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation). A shortened or truncated antisense compound targeted to a STAT3 nucleic acid may have two subunits deleted from the 5’ end, or alternatively may have two subunits deleted from the 3’ end, of the antisense compound. Alternatively, the deleted nucleosides may BIOL0142WO be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5’ end and one nucleoside deleted from the 3’ end.

When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5’ or 3’ end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5’ end (5’ addition), or alternatively to the 3’ end (3’ addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5’ end and one subunit added to the 3’ end.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl- xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

In certain embodiments, the compounds as described herein are efficacious by virtue of having at least one of an in vitro IC of less than 20uM, less than 19uM, less than 18uM, less than 17uM, less than 16uM, less than 15uM, less than 14uM, less than 13uM, less than 12uM, less than 11uM, less than 10uM, less than 9uM, less than 8uM, less than 7uM, less than 6uM, less than 5uM, less than 4uM, less than 3uM, less than 2uM, less than 1uM when delivered to HuVEC cells as described herein.

In certain embodiments, the compounds as described herein are efficacious by virtue of having at least one of an in vitro IC of less than 1.0uM, less than 0.9uM, less than 0.8uM, less than 0.7uM, less than 0.6uM, less than 0.5uM, less than 0.4uM, less than 0.3uM, less than 0.2uM, less than 0.1uM when delivered to HuVEC cells as described herein.

BIOL0142WO In certain embodiments, the compounds as described herein are efficacious by virtue of having at least one of an in vitro IC of less than 0.95uM, less than 0.90uM, less than 0.85uM, less than 0.80uM, less than 0.75uM, less than 0.70uM, less than 0.65uM, less than 0.60uM, less than 0.55uM, less than 0.50uM, less than 0.45uM, less than 0.40uM, less than 0.35uM, less than 0.30uM, less than 0.25uM, less than 0.20uM, less than 0.15uM, less than 0.10uM, less than 0.05uM, less than 0.04uM, less than 0.03uM, less than 0.02uM, less than 0.01uM when delivered to HuVEC cells as described herein.

In certain embodiments, the compound as described herein are efficacious by virtue of having at least one of an in vitro IC of less of less than 20uM, less than 15uM, less than 10uM, less than 5uM, less than 2 uM when delivered by free uptake methods to cancer cell lines as described herein.

In certain embodiments, the compounds as described herein are highly tolerable as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than %, 20%, 15%, 12%, 10%, 5%, or 2%. In certain embodiments, the compounds as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over saline treated animals. In certain embodiments, the compounds as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over saline treated animals. In certain embodiments, these compounds include ISIS 455265, ISIS 455269, ISIS 455271, ISIS 455272, ISIS 455291, ISIS 455371, ISIS 455394, ISIS 455703, ISIS 455429, ISIS 455471, ISIS 455527, ISIS 455530, ISIS 455536, ISIS 455548, ISIS 455611, ISIS 465236, ISIS 465237, ISIS 465588, ISIS 465740, ISIS 465754, ISIS 465830, ISIS 466670, ISIS 466720; ISIS 481374, ISIS 481390, ISIS 481420, ISIS 481431, ISIS 481453, ISIS 481464, ISIS 481475, ISIS 481495, ISIS 481500, ISIS 481501, ISIS 481525, ISIS 481548, ISIS 481549, ISIS 481597, ISIS 481695, ISIS 481700, ISIS 481702, ISIS 481710, ISIS 481725, ISIS 481750, and ISIS 481763. In certain embodiments, such compounds include compounds comprising the sequence of any one of SEQ ID NOs 57, 90, 90, 175, 223, 245, 267, 307, 317, 318, 366, 411, 413, 54, 258, 268, 272, 288, 464, 367, 393, 1564, 1568, 1571, 1572, 1590, 1670, 1693, 1728, 1770, 1826, 1829, 1835, 1847, 1910, 1997, 2168, 2198, 2325, 2339, 2720, 2731, 2732, and 2756.

Antisense Compound Motifs In certain embodiments, antisense compounds targeted to a STAT3 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense BIOL0142WO compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D- deoxyribonucleosides, 2'-modified nucleosides (such 2’-modified nucleosides may include 2’-MOE and 2’-O-CH , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl). In certain embodiments, wings may include several modified sugar moieties, including, for example 2’-MOE and constrained ethyl. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2’-MOE nucleosides, constrained ethyl nucleosides, and 2’-deoxynucleosides.

Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5’-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3’-wing. “X” and “Z” may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, “X” and “Y” may include one or more 2’-deoxynucleosides.

“Y” may comprise 2’-deoxynucleosides. As used herein, a gapmer described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5’-wing and the 3’ wing.

Thus, no intervening nucleotides exist between the 5’-wing and gap, or the gap and the 3’-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, “X” and “Z” are the same, in other embodiments they are different. In certain embodiments, “Y” is between 8 and nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, , 30 or more nucleosides.

In certain embodiments, gapmers provided herein include, for example, 11-mers having a motif of 11.

In certain embodiments, gapmers provided herein include, for example, 12-mers having a motif of 12, 21, or 11.

In certain embodiments, gapmers provided herein include, for example, 13-mers having a motif of 13, 22, 31, 12, or 21.

In certain embodiments, gapmers provided herein include, for example, 14-mers having a motif of 14, 23, 32, 41, 13, 22, or 31.

BIOL0142WO In certain embodiments, gapmers provided herein include, for example, 15-mers having a motif of 15, 24, 33, 42, 51, 14, 23, 32, or 41.

In certain embodiments, gapmers provided herein include, for example, 16-mers having a motif of 25, 34, 43, 52, 15, 24, 33, 42, or 51.

In certain embodiments, gapmers provided herein include, for example, 17-mers having a motif of 35, 44, 53, 25, 34, 43, or 52.

In certain embodiments, gapmers provided herein include, for example, 18-mers having a motif of 45, 54, 35, 44, or 53.

In certain embodiments, gapmers provided herein include, for example, 19-mers having a motif of 55, 45, or 54.

In certain embodiments, gapmers provided herein include, for example, 20-mers having a motif of 55.

In certain embodiments, the antisense compound has a “wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations provided herein include, but are not limited to, for example -10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.

In certain embodiments, antisense compound targeted to a STAT3 nucleic acid has a 22 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a 33 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a 55 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a 15 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a 34 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a 24 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a 43 gapmer motif.

In certain embodiments, the antisense compound targeted to a STAT3 nucleic acid has a gap- widened motif.

In certain embodiments, the antisense compounds targeted to a STAT3 nucleic acid has any of the following sugar motifs: k-d(10)-k e-d(10)-k k-d(10)-e BIOL0142WO k-k-d(10)-k-k k-k-d(10)-e-e e-e-d(10)-k-k k-k-k-d(10)-k-k-k e-e-e-d(10)-k-k-k k-k-k-d(10)-e-e-e k-k-k-d(10)-k-k-k e-k-k-d(10)-k-k-e e-e-k-d(10)-k-k-e e-d-k-d(10)-k-k-e e-k-d(10)-k-e-k-e k-d(10)-k-e-k-e-e e-e-k-d(10)-k-e-k-e e-d-d-k-d(9)-k-k-e e-e-e-e-d(9)-k-k-e wherein, k is a constrained ethyl nucleoside, e is a 2’-MOE substituted nucleoside, and d is a 2’- deoxynucleoside.

In certain embodiments, the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J) -(B) -(J) -(B) -(A) -(D) -(A) -(B) -(J) -(B) -(J) m n p r t g v w x y z wherein: each A is independently a 2’-substituted nucleoside; each B is independently a bicyclic nucleoside; each J is independently either a 2’-substituted nucleoside or a 2’-deoxynucleoside; each D is a 2’-deoxynucleoside; m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that: at least one of m, n, and r is other than 0; at least one of w and y is other than 0; the sum of m, n, p, r, and t is from 2 to 5; and the sum of v, w, x, y, and z is from 2 to 5.

Target Nucleic Acids, Target Regions and Nucleotide Sequences Nucleotide sequences that encode STAT3 include, without limitation, the following: GENBANK Accession No. NM_139276.2 (incorporated herein as SEQ ID NO: 1) and the complement of GENBANK BIOL0142WO Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000 (incorporated herein as SEQ ID NO: 2).

It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid.

For example, a target region may encompass a 3’ UTR, a 5’ UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for STAT3 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5’ target site of one target segment within the target region to a 3’ target site of another target segment within the same target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5’ target sites or 3’ target sites listed herein.

Suitable target segments may be found within a 5’ UTR, a coding region, a 3’ UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

BIOL0142WO There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in STAT3 mRNA levels are indicative of inhibition of STAT3 expression. Reductions in levels of a STAT3 protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes are indicative of inhibition of STAT3 expression. In certain embodiments, reduced cellular growth, reduced tumor growth, and reduced tumor volume can be indicative of inhibition of STAT3 expression. In certain embodiments, amelioration of symptoms associated with cancer can be indicative of inhibition of STAT3 expression. In certain embodiments, reduction of cachexia is indicative of inhibition of STAT3 expression. In certain embodiments, reduction of cancer markers can be indicative of inhibition of STAT3 expression.

Hybridization In some embodiments, hybridization occurs between an antisense compound disclosed herein and a STAT3 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a STAT3 nucleic acid.

Complementarity An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a STAT3 nucleic acid).

Non-complementary nucleobases between an antisense compound and a STAT3 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a STAT3 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a STAT3 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

BIOL0142WO For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.

For example, an antisense compound may be fully complementary to a STAT3 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.

Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5’ end or 3’ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

BIOL0142WO In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a STAT3 nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a STAT3 nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.

As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

BIOL0142WO In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, , 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Modifications A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.

BIOL0142WO Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates.

Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a STAT3 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties Antisense compounds provided herein can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, without limitation, addition of substitutent groups (including 5' and 2' substituent groups); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA); replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R)2 (R = H, C -C alkyl or a protecting group); and combinations thereof. Examples of chemically modified 1 12 sugars include, 2'-F-5'-methyl substituted nucleoside (see, PCT International Application WO 2008/101157, published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides), replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see, published U.S. Patent Application US2005/0130923, published on June 16, 2005), or, alternatively, 5'-substitution of a BNA (see, PCT International Application , published on 11/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

Examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH , and 2'-O(CH )2OCH substituent 3 2 3 groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O- C -C alkyl, OCF , O(CH )2SCH , O(CH )2-O-N(Rm)(Rn), and O-CH -C(=O)-N(Rm)(Rn), where each 1 10 3 2 3 2 2 Rm and Rn is, independently, H or substituted or unsubstituted C -C alkyl. 1 10 As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4’ to 2’ bicyclic nucleoside. Examples of such 4’ to 2’ bicyclic nucleosides, include, but are not limited to, one of the formulae: 4'-(CH )-O-2' (LNA); 4'-(CH )-S-2'; 4'-(CH ) -O-2' (ENA); 4'-CH(CH )-O-2' and 4'-C- 2 2 2 2 3 H(CH OCH )-O-2', and analogs thereof (see, U.S. Patent 7,399,845, issued on July 15, 2008); 4'- C(CH )(CH )-O-2', and analogs thereof (see, published PCT International Application WO2009/006478, BIOL0142WO published January 8, 2009); 4'-CH -N(OCH )-2', and analogs thereof (see, published PCT International Application WO2008/150729, published December 11, 2008); 4'-CH -O-N(CH )-2' (see, published U.S.

Patent Application US2004/0171570, published September 2, 2004); 4'-CH -N(R)-O-2', wherein R is H, C -C alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH -C- 1 12 2 (H)(CH )-2' (see, Chattopadhyaya, et al., J. Org. Chem.,2009, 74, 118-134); and 4'-CH -C(=CH )-2', and 3 2 2 analogs thereof (see, published PCT International Application , published on December 8, 2008). Also see, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633- 5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr.

Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr.

Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos U.S. 6,670,461, 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 7,399,845; published PCT International applications , WO 94/14226, , and ; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; and U.S. Patent Serial Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Application Nos. , , and . Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(R )(R )] -, -C(R )=C(R )-, -C(R )=N-, -C(=NR )-, -C(=O)-, -C(=S)-, -O-, -Si(R ) -, - a b n a b a a a 2 S(=O) -, and -N(R )-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R and R is, independently, H, a protecting group, hydroxyl, C -C alkyl, substituted C - a b 1 12 1 C alkyl, C -C alkenyl, substituted C -C alkenyl, C -C alkynyl, substituted C -C alkynyl, C -C 12 2 12 2 12 2 12 2 12 5 20 aryl, substituted C -C aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted 20 heteroaryl, C -C alicyclic radical, substituted C -C alicyclic radical, halogen, OJ , NJ J , SJ , N , COOJ , 7 5 7 1 1 2 1 3 1 acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) -J ), or sulfoxyl (S(=O)-J ); and 2 1 1 each J and J is, independently, H, C -C alkyl, substituted C -C alkyl, C -C alkenyl, 1 2 1 12 1 12 2 12 substituted C -C alkenyl, C -C alkynyl, substituted C -C alkynyl, C -C aryl, substituted C -C aryl, 2 12 2 12 2 12 5 20 5 20 acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C -C 1 12 aminoalkyl, substituted C -C aminoalkyl, or a protecting group. 1 12 BIOL0142WO In certain embodiments, the bridge of a bicyclic sugar moiety is, -[C(R )(R )] -, -[C(R )(R )] -O-, a b n a b n -C(R R )-N(R)-O- or, –C(R R )-O-N(R)-. In certain embodiments, the bridge is 4'-CH -2', 4'-(CH ) -2', a b a b 2 2 2 4'-(CH ) -2', 4'-CH -O-2', 4'-(CH ) -O-2', 4'-CH -O-N(R)-2', and 4'-CH -N(R)-O-2'-, wherein each R is, 2 3 2 2 2 2 2 independently, H, a protecting group, or C -C alkyl. 1 12 In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4’-2’ methylene-oxy bridge, may be in the α-L configuration or in the -O-2’) BNA's have been incorporated into β-D configuration. Previously, α-L-methyleneoxy (4’-CH antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L- Methyleneoxy (4’-CH -O-2’) BNA , (B) β-D-Methyleneoxy (4’-CH -O-2’) BNA , (C) Ethyleneoxy (4’- (CH ) -O-2’) BNA , (D) Aminooxy (4’-CH -O-N(R)-2’) BNA, (E) Oxyamino (4’-CH -N(R)-O-2’) BNA, 2 2 2 2 (F) Methyl(methyleneoxy) (4’-CH(CH )-O-2’) BNA, (G) methylene-thio (4’-CH -S-2’) BNA, (H) methylene-amino (4’-CH2-N(R)-2’) BNA, (I) methyl carbocyclic (4’-CH -CH(CH )-2’) BNA, and (J) propylene carbocyclic (4’-(CH ) -2’) BNA as depicted below.

Bx Bx O Bx Bx O N 3 (D) (E) Bx Bx Bx O O wherein Bx is the base moiety and R is, independently, H, a protecting group or C -C alkyl. 1 12 In certain embodiments, bicyclic nucleoside having Formula I: BIOL0142WO wherein: Bx is a heterocyclic base moiety; -Q -Q -Q - is -CH -N(R )-CH -, -C(=O)-N(R )-CH -, -CH -O-N(R )-, -CH -N(R )-O-, or -N(R )- a b c 2 c 2 c 2 2 c 2 c c O-CH ; R is C -C alkyl or an amino protecting group; and c 1 12 T and T are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleoside having Formula II: wherein: Bx is a heterocyclic base moiety; T and T are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; Z is C -C alkyl, C -C alkenyl, C -C alkynyl, substituted C -C alkyl, substituted C -C alkenyl, a 1 6 2 6 2 6 1 6 2 6 substituted C -C alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ , NJ J , SJ , N , c c d c 3 OC(=X)J , and NJ C(=X)NJ J , wherein each J , J , and J is, independently, H, C -C alkyl, or substituted c e c d c d e 1 6 C -C alkyl and X is O or NJ . 1 6 c In certain embodiments, bicyclic nucleoside having Formula III: BIOL0142WO wherein: Bx is a heterocyclic base moiety; T and T are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; Z is C -C alkyl, C -C alkenyl, C -C alkynyl, substituted C -C alkyl, substituted C -C alkenyl, b 1 6 2 6 2 6 1 6 2 6 substituted C -C alkynyl, or substituted acyl (C(=O)-).

In certain embodiments, bicyclic nucleoside having Formula IV: wherein: Bx is a heterocyclic base moiety; T and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; R is C -C alkyl, substituted C -C alkyl, C -C alkenyl, substituted C -C alkenyl, C -C alkynyl, d 1 6 1 6 2 6 2 6 2 6 or substituted C -C alkynyl; each q , q , q and q is, independently, H, halogen, C -C alkyl, substituted C -C alkyl, C -C a b c d 1 6 1 6 2 6 alkenyl, substituted C -C alkenyl, C -C alkynyl, or substituted C -C alkynyl, C -C alkoxyl, substituted 2 6 2 6 2 6 1 6 C -C alkoxyl, acyl, substituted acyl, C -C aminoalkyl, or substituted C -C aminoalkyl; 1 6 1 6 1 6 In certain embodiments, bicyclic nucleoside having Formula V: wherein: Bx is a heterocyclic base moiety; T and T are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; q , q q and q are each, independently, hydrogen, halogen, C -C alkyl, substituted C -C alkyl, a b, e f 1 12 1 12 C -C alkenyl, substituted C -C alkenyl, C -C alkynyl, substituted C -C alkynyl, C -C alkoxy, 2 12 2 12 2 12 2 12 1 12 substituted C -C alkoxy, OJ , SJ , SOJ , SO J , NJ J , N , CN, C(=O)OJ , C(=O)NJ J , C(=O)J , O-C(=O)- 1 12 j j j 2 j j k 3 j j k j NJ J , N(H)C(=NH)NJ J , N(H)C(=O)NJ J or N(H)C(=S)NJ J ; j k j k j k j k BIOL0142WO or q and q together are =C(q )(q ); e f g h q and q are each, independently, H, halogen, C -C alkyl, or substituted C -C alkyl. g h 1 12 1 12 The synthesis and preparation of the methyleneoxy (4’-CH -O-2’) BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (see, e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607- 3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

-O-2’) BNA, methyleneoxy (4’-CH -O-2’) BNA, and 2'-thio- Analogs of methyleneoxy (4’-CH BNAs, have also been prepared (see, e.g., Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222).

Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (see, e.g., Wengel et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog, has been described in the art (see, e.g., Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'- amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleoside having Formula VI: wherein: Bx is a heterocyclic base moiety; T and T are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; each q , q , q and q is, independently, H, halogen, C -C alkyl, substituted C -C alkyl, C -C i j k l 1 12 1 12 2 12 alkenyl, substituted C -C alkenyl, C -C alkynyl, substituted C -C alkynyl, C -C alkoxyl, substituted 2 12 2 12 2 12 1 12 C -C alkoxyl, OJ , SJ , SOJ , SO J , NJ J , N , CN, C(=O)OJ , C(=O)NJ J , C(=O)J , O-C(=O)NJ J , 1 12 j j j 2 j j k 3 j j k j j k N(H)C(=NH)NJ J , N(H)C(=O)NJ J , or N(H)C(=S)NJ J ; and j k j k j k q and q or q and q together are =C(q )(q ), wherein q and q are each, independently, H, i j l k g h g h halogen, C -C alkyl, or substituted C -C alkyl. 1 12 1 12 One carbocyclic bicyclic nucleoside having a 4'-(CH ) -2' bridge and the alkenyl analog, bridge 4'-CH=CH-CH -2', have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

As used herein, “4’-2’ bicyclic nucleoside” or “4’ to 2’ bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting the 2’ carbon atom and the 4’ BIOL0142WO carbon atom.

As used herein, “monocylic nucleosides” refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, “2’-modified sugar” means a furanosyl sugar modified at the 2’ position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2’ modifications are selected from substituents including, but not limited to: O[(CH ) O] CH , O(CH ) NH , O(CH ) CH , O(CH ) ONH , 2 n m 3 2 n 2 2 n 3 2 n 2 OCH C(=O)N(H)CH , and O(CH ) ON[(CH ) CH ] , where n and m are from 1 to about 10. Other 2'- 2 3 2 n 2 n 3 2 substituent groups can also be selected from: C -C alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; 1 12 aralkyl; O-alkaryl or O-aralkyl; SH; SCH ; OCN; Cl; Br; CN; CF ; OCF ; SOCH ; SO CH ; ONO ; NO ; 3 3 3 3 2 3 2 2 N ; NH ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving pharmacokinetic properties; and a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2’-MOE side chain (see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2’- O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (see, e.g., Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, a “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), or those compounds having Formula X: Formula X: BIOL0142WO wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula X: Bx is a heterocyclic base moiety; T and T are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T and T is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T and T is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; q , q , q , q , q , q and q are each, independently, H, C -C alkyl, substituted C -C alkyl, C -C 1 2 3 4 5 6 7 1 6 1 6 2 6 alkenyl, substituted C -C alkenyl, C -C alkynyl, or substituted C -C alkynyl; and 2 6 2 6 2 6 one of R and R is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ J , SJ , N , OC(=X)J , OC(=X)NJ J , NJ C(=X)NJ J , and CN, wherein X is O, S, or NJ , and 1 2 1 3 1 1 2 3 1 2 1 each J , J , and J is, independently, H or C -C alkyl. 1 2 3 1 6 In certain embodiments, the modified THP nucleosides of Formula X are provided wherein q , q , q , q , q , q and q are each H. In certain embodiments, at least one of q , q , q , q , q , q and q is n p r s t, u m n p r s t, u other than H. In certain embodiments, at least one of q , q , q , q , q , q and q is methyl. In certain m n p r s t u embodiments, THP nucleosides of Formula X are provided wherein one of R and R is F. In certain embodiments, R is fluoro and R is H, R is methoxy and R is H, and R is methoxyethoxy and R is H. 1 2 1 2 1 2 As used herein, “2’-modified” or “2’-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2’ position other than H or OH. 2’-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2’ carbon and another carbon of the sugar ring and nucleosides with non-bridging 2’substituents, such as allyl, amino, azido, thio, O-allyl, O-C -C alkyl, -OCF , O-(CH ) -O-CH , 2'- 1 10 3 2 2 3 O(CH ) SCH , O-(CH ) -O-N(R )(R ), or O-CH -C(=O)-N(R )(R ), where each R and R is, 2 2 3 2 2 m n 2 m n m n independently, H or substituted or unsubstituted C -C alkyl. 2’-modifed nucleosides may further 1 10 comprise other modifications, for example, at other positions of the sugar and/or at the nucleobase.

As used herein, “2’-F” refers to a sugar comprising a fluoro group at the 2’ position.

As used herein, “2’-OMe” or “2’-OCH ” or “2’-O-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH group at the 2’ position of the sugar ring.

As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).

Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art.

BIOL0142WO In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2’-MOE. In certain embodiments, the 2’-MOE modified nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a cEt. In certain embodiments, the cEt modified nucleotides are arranged throughout the wings of a gapmer motif.

Compositions and Methods for Formulating Pharmaceutical Compositions Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

An antisense compound targeted to a STAT3 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a STAT3 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense compounds Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.

Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups BIOL0142WO include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'- terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.

Cell culture and antisense compounds treatment The effects of antisense compounds on the level, activity or expression of STAT3 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors (e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor’s instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA).

Illustrative cell types include, but are not limited to, HuVEC cells, b.END cells, HepG2 cells, Hep3B cells, and primary hepatocytes.

In vitro testing of antisense oligonucleotides Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

Cells may be treated with antisense oligonucleotides when the cells reach approximately 60- 80% confluency in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

BIOL0142WO Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

Cells are treated with antisense oligonucleotides by routine methods. Cells may be harvested 16- 24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

Free Uptake Assays In certain embodiments, transfection-independent activity (i.e., free uptake) of antisense oligonucleotides in cancer cell lines is a measure of potency. Free uptake may be measured in cancer cell lines such as, for example, SK-BR-3 cells, U251-MG cells, MDA-MB-231 cells, H460 cells, A431 cells, colo205 cells, SNB-19 cells, SK-OV3 cells, H1993 lung cancer cells, H358 lung cancer cells, PC-9 lung cancer cells, KHM-35 lung cancer cells, Capan-1 pancreatic cancer cells, HPAF-11 pancreatic cancer cells, and Colo 201colorectal cancer cells.

In free uptake assays, antisense oligonucleotides are administered to cells lines without the aid of a transfection agent or electroporation. Antisense oligonucleotides are administered to cell lines at one or more doses and percent inhbition of target mRNA or protein expression is meausred. Where multiple doses are administered, IC50 may be measured. In certain embodiments, antisense oligonucleotides exhibiting a high degree of potency, as measured by percent inhbition after single dose or multiple doses, are preferred over antisense oligonucleotides exhibiting a lower degree of potency. Those antisense oligonucleotides exhibiting a high degree of in vitro potency are more likely to exhibit in vivo potency.

RNA Isolation RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommended protocols.

Analysis of inhibition of target levels or expression Inhibition of levels or expression of a STAT3 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can BIOL0142WO be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer’s instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well.

RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

Probes and primers are designed to hybridize to a STAT3 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

Analysis of Protein Levels Antisense inhibition of STAT3 nucleic acids can be assessed by measuring STAT3 protein levels. Protein levels of STAT3 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via BIOL0142WO conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human STAT3 are commercially available.

In vivo testing of antisense compounds Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of STAT3 and produce phenotypic changes, such as, reduced cellular growth, amelioration of symptoms associated with cancer, reduction of cachexia, and reduction of cancer markers. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, subcutaneous, intrathecal, and intracerebroventricular. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue and changes in STAT3 nucleic acid expression are measured. Changes in STAT3 protein levels are also measured.

In certain embodiments, xenograft tumor models are used to measure the effect of antisense oligonucleotides on tumor growth and metastasis. In xenograft tumor model described herein, cells from a cancerous cell line are inoculated into an animal. Such cell lines may include, for example, human breast cancer cells, MDA-MB-231, A431 human epidermoid carcinoma, U251 human glioma tumor cells, and human NCI-H460 non-small cell lung carcinoma cells. Certain compounds described herein and used in xenograft models described herein may target human STAT3, mouse STAT3, rat STAT3, and/or monkey STAT3. Certain compounds described herein and used in xenograft models described herein may cross-react with one or more species STAT3. In certain embodiments, compounds described herein and used in xenograft models described herein may be more potent inhibitors of tumor growth and tumor volume than the data suggests wherein endogenous STAT3 is not reduced (due to lack of cross- reactivity).

Certain Indications In certain embodiments, provided are methods, compounds, and compositions of treating an individual comprising administering one or more pharmaceutical compositions provided herein. In certain embodiments, the individual has a hyperproliferative disease. In certain embodiments, the hyperproliferative disease is cancer, e.g., carcinomas, sarcomas, lymphomas, and leukemias as well as associated malignancies and metastases. In certain embodiments, the type of cancer is lung cancer, including non small cell lung cancer (NSCLC), pancreatic cancer, colorectal cancer, multiple myeloma, hepatocellular carcinoma (HCC), glioblastoma, ovarian cancer, osteosarcoma, head and neck cancer, breast cancer, epidermoid carcinomas, intestinal adenomas, prostate cancer, and gastric cancer. In certain embodiments, the individual is at risk for a hyperproliferative disease, including, cancer, e.g., carcinomas, BIOL0142WO sarcomas, lymphomas, and leukemias as well as associated malignancies and metastases. This includes individuals having one or more risk factors for developing a hyperproliferative disease, including, growing older; tobacco use; exposure to sunlight and ionizing radiation; contact with certain chemicals; infection with certain viruses and bacteria; certain hormone therapies; genetic predisposition; alcohol use; and certain lifestyle choices including poor diet, lack of physical activity, and/or being overweight. In certain embodiments, the individual has been identified as in need of treatment for a hyperproliferative disease. In certain embodiments, are provided methods for prophylactically reducing STAT3 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a STAT3 nucleic acid.

In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing metastasis of a cancer associated with the upregulation of certain genes, such as STAT3, at the tumor bone interface to bone. In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing cancer from metastasizing to bone. In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing renal cell carcinoma, breast cancer, non small cell lung carcinoma, and prostate cancer from metastasizing to bone.

In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a STAT3 nucleic acid is accompanied by monitoring of STAT3 levels in the serum of an individual to determine an individual’s response to administration of the antisense compound. An individual’s response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.

In certain embodiments, administration of an antisense compound targeted to a STAT3 nucleic acid results in reduction of STAT3 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a STAT3 nucleic acid results in reduced cellular growth, reduced tumor growth, reduced tumor volume, amelioration of symptoms associated with cancer, and reduction of cancer markers. In certain embodiments, administration of a STAT3 antisense compound decreases cellular growth, tumor growth, and tumor volume by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to STAT3 are used for the preparation of a medicament for treating a patient suffering or susceptible to a hyperproliferative disease.

Certain Combination Therapies In certain embodiments, one or more pharmaceutical compositions provided herein are co- administered with one or more other pharmaceutical agents. In certain embodiments, such one or more BIOL0142WO other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions provided herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions provided herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions provided herein. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to produce a synergistic effect.

In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are prepared separately. In certain embodiments, one or more other pharmaceutical agents include all-trans retinoic acid, azacitidine, azathioprine, bleomycin, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, valrubicin, vinblastine, vincristine, vindesine, or vinorelbine. In certain embodiments, one or more other pharmaceutical agents include another antisense oligonucleotide. In certain embodiments, another antisense oligonucleotide is a second STAT3 antisense oligonucleotide.

In certain embodiments, one or more other pharmaceutical agents include molecular targeted therapies. In certain embodiments, the molecular targeted therapy is an EGFR inhibitor, a mTOR inhibitor, a HER2 inhibitor, or a VEGF/VEGFR inhibitor. In certain embodiments, EGFR inhibitors include gefitinib, erlotinib, lapatinib, cetuximab, panitumumbo. In certain embodiments, mTOR inhibitors include everolimus and temsirolimus. In certain embodiments, HER2 inhibitors include trastuzumab and lapatinib. In certain embodiments, VEGF/VEGFR inhibitors include pazopanib, bevacizumab, sunitinib, and sorafenib.

In certain embodiments, one more pharmaceutical compositions provided herein are administered with radiation therapy. In certain embodiments, one or more pharmaceutical compositions are administered at the same time as radiation therapy. In certain embodiments, one or more pharmaceutical compositions are administered before radiation therapy. In certain embodiments, one or BIOL0142WO more pharmaceutical compositions are administered after radiation therapy. In certain embodiments, one or more pharmaceutical compositions are administered at various time points throughout a radiation therapy regimen.

In certain embodiments, radiation therapy is useful for inhibiting tumor growth. In certain embodiments, radiation therapy is useful for increasing overall survival. In certain embodiments, radiation therapy used in conjunction with administration of one or more pharmaceuticals provided herein is advantageous over using either therapy alone because both radiation therapy and administration with one or more pharmaceuticals can be limited to achieve effective antiproliferative response with limited toxicity.

In certain embodiments, a physician designs a therapy regimen including both radiation therapy and administration of one more pharmaceutical compositions provided herein. In certain embodiments, a physician designs a therapy regimen including radiation therapy, administration of one or more pharmaceutical compositions provided herein, and administration of one or more other chemotherapeutic agents.

Tolerability In certain embodiments, the compounds provided herein display minimal side effects.

Side effects include responses to the administration of the antisense compound that are typically unrelated to the targeting of STAT3, such as an inflammatory response in the animal. In certain embodiments compounds are well tolerated by the animal. Increased tolerability can depend on a number of factors, including, but not limited to, the nucleotide sequence of the antisense compound, chemical modifications to the nucleotides, the particular motif of unmodified and modified nucleosides in the antisense compound, or combinations thereof. Tolerability may be determined by a number of factors. Such factors include body weight, organ weight, liver function, kidney function, platelet count, white blood cell count.

In certain embodiments, the compounds provided herein demonstrate minimal effect on organ weight. In certain embodiments, the compounds demonstrate less than a 7-fold, 6-fold, 5- fold, 4-fold, 3-fold, 2-fold or no significant increase in spleen and/or liver weight.

In certain embodiments, the compounds provided herein demonstrate minimal effect on liver function. Factors for the evaluation of liver function include ALT levels, AST levels, plasma bilirubin levels and plasma albumin levels. In certain embodiments the compounds provided herein demonstrate less than a 7-fold, less than a 6-fold, less than a 5-fold, less than a 4-fold, less than a 3-fold or less than a 2-fold or no significant increase in ALT or AST. In certain embodiments the compounds provided herein demonstrate less than a 3-fold, less than a 2-fold or no significant increase in plasma bilirubin levels.

BIOL0142WO In certain embodiments, the compounds provided herein demonstrate minimal effect on kidney function. In certain embodiments, the compounds provided herein demonstrate less than a 3-fold, less than a 2-fold, or no significant increase in plasma concentrations of blood urea nitrogen (BUN). In certain embodiments, the compounds provided herein demonstrate less than a 6-fold, 5-fold, 4-fold, 3-fold, 2-fold, or no significant increase in the ratio of urine protein to creatinine.

In certain embodiments, the compounds provided herein demonstrate minimal effect on hematological factors. In certain embodiments, the compounds provided herein demonstrate less than a 60%, 50%, 40%, 30%, 20%, 10% or 5% decrease in platelet count. In certain embodiments, the compounds provided herein demonstrate less than a 4-fold, less than a 3-fold, less than a 2-fold or no significant increase in monocyte count.

In certain embodiments compounds further display favorable pharmacokinetics. In certain embodiments, antisense compounds exhibit relatively high half-lives in relevant biological fluids or tissues.

In certain embodiments, compounds or compositions further display favorable viscosity.

In certain embodiments, the viscosity of the compound or composition is no more than 40cP at a concentration of 165-185 mg/mL.

In other embodiments, the compounds display combinations of the characteristics above and reduce STAT3 mRNA expression in an animal model with high efficiency.

EXAMPLES Non-limiting disclosure and incorporation by reference While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense inhibition of human STAT3 in HuVEC cells Antisense oligonucleotides were designed targeting a human STAT3 nucleic acid and were tested for their effect on human STAT3 mRNA expression in vitro. The chimeric antisense oligonucleotides presented in Tables 1 and 2 were designed as either 22 cEt gapmers or 33 cEt gapmers. The 22 cEt gapmers are 14 nucleotides in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings BIOL0142WO comprising two nucleosides each. The 33 cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising three nucleosides each. Each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has an cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5’-methylcytosines.

Potency of cEt gapmers was compared to ISIS 337332, ISIS 337333, and ISIS 345785, which are 55 MOE gapmers targeting human STAT3 and are further described in USPN 7,307,069, incorporated herein by reference.

Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS199 (forward sequence ACATGCCACTTTGGTGTTTCATAA, designated herein as SEQ ID NO: 6; reverse sequence TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as SEQ ID NO: 7; probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA, designated herein as SEQ ID NO: 8) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of STAT3, relative to untreated control cells. All cEt gapmers and MOE gapmers were tested under the same conditions.

“Human Target start site” indicates the 5’-most nucleoside to which the gapmer is targeted in the human gene sequence. “Human Target stop site” indicates the 3’-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 1 is targeted to human STAT3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each gapmer listed in Table 2 is targeted to the human STAT3 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000).

Table 1 Inhibition of human STAT3 mRNA levels by cEt and MOE chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Wing Human Human SEQ ISIS % Chem Start Stop Sequence Motif ID NO inhibition Site Site NO 481350 76 91 TCCAGGATCCGGTTGG 33 52 481575 77 90 CCAGGATCCGGTTG 22 41 481351 132 147 GGCCGAAGGGCCTCTC 33 14 481576 133 146 GCCGAAGGGCCTCT 22 8 481352 225 240 CCTGCTAAAATCAGGG 33 15 BIOL0142WO 481577 226 239 CTGCTAAAATCAGG 22 12 481353 240 255 ATTCCATTGGGCCATC 33 78 481578 241 254 TTCCATTGGGCCAT 22 51 481354 264 279 CCGTGTGTCAAGCTGC 33 98 481579 265 278 CGTGTGTCAAGCTG 22 91 481355 322 337 ACTGCCGCAGCTCCAT 33 95 481580 323 336 CTGCCGCAGCTCCA 22 76 481356 346 361 GACTCTCAATCCAAGG 33 83 481581 347 360 ACTCTCAATCCAAG 22 31 481357 375 390 TTCTTTGCTGGCCGCA 33 97 481582 376 389 TCTTTGCTGGCCGC 22 87 481358 403 418 GATTATGAAACACCAA 33 85 481583 404 417 ATTATGAAACACCA 22 20 481359 429 444 ATACTGCTGGTCAATC 33 90 481584 430 443 TACTGCTGGTCAAT 22 42 481360 459 474 GAGAACATTCGACTCT 33 75 481585 460 473 AGAACATTCGACTC 22 77 481361 474 489 TAGATTGTGCTGATAG 33 90 481586 475 488 AGATTGTGCTGATA 22 81 481362 490 505 ACTGCTTGATTCTTCG 33 59 481587 491 504 CTGCTTGATTCTTC 22 23 481363 511 526 CAAGATACCTGCTCTG 33 84 481588 512 525 AAGATACCTGCTCT 22 58 481364 542 557 GCCACAATCCGGGCAA 33 36 481589 543 556 CCACAATCCGGGCA 22 69 481365 589 604 CAGTGGCTGCAGTCTG 33 36 481590 590 603 AGTGGCTGCAGTCT 22 30 481366 607 622 GGCCCCCTTGCTGGGC 33 1 481591 608 621 GCCCCCTTGCTGGG 22 0 481367 638 653 GTCACCACGGCTGCTG 33 70 481592 639 652 TCACCACGGCTGCT 22 48 481368 659 674 TCCAGCATCTGCTGCT 33 81 481593 660 673 CCAGCATCTGCTGC 22 46 481369 675 690 ATCCTGAAGGTGCTGC 33 29 481594 676 689 TCCTGAAGGTGCTG 22 16 481370 701 716 TCTAGATCCTGCACTC 33 79 481595 702 715 CTAGATCCTGCACT 22 47 481371 709 724 TTTTCTGTTCTAGATC 33 83 481596 710 723 TTTCTGTTCTAGAT 22 48 481372 730 745 GGAGATTCTCTACCAC 33 85 481597 731 744 GAGATTCTCTACCA 22 80 481373 751 766 AGTTGAAATCAAAGTC 33 87 481598 752 765 GTTGAAATCAAAGT 22 6 481374 788 803 AGATCTTGCATGTCTC 33 92 481599 789 802 GATCTTGCATGTCT 22 51 BIOL0142WO 481375 799 814 TGTTTCCATTCAGATC 33 65 481600 800 813 GTTTCCATTCAGAT 22 42 481376 868 883 TCCGCATCTGGTCCAG 33 82 481601 869 882 CCGCATCTGGTCCA 22 70 481785 872 885 TCTCCGCATCTGGT 22 28 481377 884 899 TCACTCACGATGCTTC 33 85 481602 885 898 CACTCACGATGCTT 22 55 481378 892 907 CCGCCAGCTCACTCAC 33 89 481603 893 906 CGCCAGCTCACTCA 22 60 481379 955 970 TCCAGTCAGCCAGCTC 33 91 481604 956 969 CCAGTCAGCCAGCT 22 70 481380 963 978 CCGCCTCTTCCAGTCA 33 73 481605 964 977 CGCCTCTTCCAGTC 22 55 481381 1010 1025 CGATCTAGGCAGATGT 33 26 481606 1011 1024 GATCTAGGCAGATG 22 35 481382 1045 1060 GAGATTCTGCTAATGA 33 81 481607 1046 1059 AGATTCTGCTAATG 22 51 481383 1053 1068 CTGAAGTTGAGATTCT 33 84 481608 1054 1067 TGAAGTTGAGATTC 22 26 481384 1098 1113 AACTTTTTGCTGCAAC 33 76 481609 1099 1112 ACTTTTTGCTGCAA 22 34 481385 1113 1128 GTCCCCTTTGTAGGAA 33 41 481610 1114 1127 TCCCCTTTGTAGGA 22 37 481386 1186 1201 AGGCACTTTTCATTAA 33 45 481611 1187 1200 GGCACTTTTCATTA 22 32 481387 1225 1240 CAGGATGCATGGGCAT 33 92 481612 1226 1239 AGGATGCATGGGCA 22 86 481388 1269 1284 TTTAGTAGTGAACTGG 33 74 481613 1270 1283 TTAGTAGTGAACTG 22 22 481389 1282 1297 CCAGCAACCTGACTTT 33 66 481614 1283 1296 CAGCAACCTGACTT 22 34 481390 1305 1320 ATAATTCAACTCAGGG 33 92 481615 1306 1319 TAATTCAACTCAGG 22 48 481391 1314 1329 TTTAAGCTGATAATTC 33 44 481616 1315 1328 TTAAGCTGATAATT 22 0 481392 1326 1341 GCACACTTTAATTTTA 33 49 481617 1327 1340 CACACTTTAATTTT 22 1 481393 1347 1362 GTCCCCAGAGTCTTTG 33 39 481618 1348 1361 TCCCCAGAGTCTTT 22 41 481394 1437 1452 GAGGCTGCCGTTGTTG 33 62 481619 1438 1451 AGGCTGCCGTTGTT 22 29 481395 1468 1483 CCCTCAGGGTCAAGTG 33 72 481620 1469 1482 CCTCAGGGTCAAGT 22 37 481396 1480 1495 CACATCTCTGCTCCCT 33 92 481621 1481 1494 ACATCTCTGCTCCC 22 74 BIOL0142WO 481397 1517 1532 ATCAGGGAAGCATCAC 33 59 481622 1518 1531 TCAGGGAAGCATCA 22 49 481398 1542 1557 GATCAGGTGCAGCTCC 33 73 481623 1543 1556 ATCAGGTGCAGCTC 22 40 481399 1563 1578 ATACACCTCGGTCTCA 33 73 481624 1564 1577 TACACCTCGGTCTC 22 43 481400 1579 1594 TCTTGAGGCCTTGGTG 33 47 481625 1580 1593 CTTGAGGCCTTGGT 22 16 481401 1589 1604 TCTAGGTCAATCTTGA 33 74 481626 1590 1603 CTAGGTCAATCTTG 22 54 481402 1599 1614 GGAGTGGGTCTCTAGG 33 52 481627 1600 1613 GAGTGGGTCTCTAG 22 13 481789 1604 1617 CAAGGAGTGGGTCT 22 10 481403 1607 1622 ACTGGCAAGGAGTGGG 33 58 481628 1608 1621 CTGGCAAGGAGTGG 22 38 481404 1633 1648 TCTGACAGATGTTGGA 33 50 481629 1634 1647 CTGACAGATGTTGG 22 64 481405 1641 1656 ATTTGGCATCTGACAG 33 75 481630 1642 1655 TTTGGCATCTGACA 22 39 481406 1691 1706 TTCTTGGGATTGTTGG 33 72 481631 1692 1705 TCTTGGGATTGTTG 22 33 481407 1729 1744 CCCAGGTTCCAATTGG 33 50 481632 1730 1743 CCAGGTTCCAATTG 22 32 481408 1780 1795 CTCGCTTGGTGGTGGA 33 53 481633 1781 1794 TCGCTTGGTGGTGG 22 35 481409 1795 1810 GCTCGATGCTCAGTCC 33 86 481634 1796 1809 CTCGATGCTCAGTC 22 43 481410 1825 1840 CCAAGAGTTTCTCTGC 33 91 481635 1826 1839 CAAGAGTTTCTCTG 22 43 481411 1840 1855 AATTCACACCAGGTCC 33 72 481636 1841 1854 ATTCACACCAGGTC 22 42 481412 1858 1873 TGATCTGACACCCTGA 33 90 481637 1859 1872 GATCTGACACCCTG 22 79 481413 1866 1881 AGCCCATGTGATCTGA 33 80 481638 1867 1880 GCCCATGTGATCTG 22 64 481414 1888 1903 CCATGTTTTCTTTGCA 33 69 481639 1889 1902 CATGTTTTCTTTGC 22 16 481415 1896 1911 CTTGCCAGCCATGTTT 33 88 481640 1897 1910 TTGCCAGCCATGTT 22 57 337332 1898 1917 GAAGCCCTTGCCAGCCATGT 55 63 481416 1901 1916 AAGCCCTTGCCAGCCA 33 87 481641 1902 1915 AGCCCTTGCCAGCC 22 68 337333 1903 1922 AAGGAGAAGCCCTTGCCAGC 55 49 481417 1903 1918 AGAAGCCCTTGCCAGC 33 97 481418 1904 1919 GAGAAGCCCTTGCCAG 33 92 BIOL0142WO 481642 1904 1917 GAAGCCCTTGCCAG 22 67 481419 1905 1920 GGAGAAGCCCTTGCCA 33 83 481643 1905 1918 AGAAGCCCTTGCCA 22 58 481644 1906 1919 GAGAAGCCCTTGCC 22 45 481420 1948 1963 ACTTTTTCACAAGGTC 33 94 481645 1949 1962 CTTTTTCACAAGGT 22 50 481421 2021 2036 CTCAAGATGGCCCGCT 33 86 481646 2022 2035 TCAAGATGGCCCGC 22 41 481422 2036 2051 CCTGGAGGCTTAGTGC 33 80 481647 2037 2050 CTGGAGGCTTAGTG 22 0 481423 2077 2092 CTCCTTCTTTGCTGCT 33 69 481648 2078 2091 TCCTTCTTTGCTGC 22 51 481424 2093 2108 CAAGTGAAAGTGACGC 33 70 481649 2094 2107 AAGTGAAAGTGACG 22 25 481425 2115 2130 ACCGCTGATGTCCTTC 33 78 481650 2116 2129 CCGCTGATGTCCTT 22 79 481426 2131 2146 ACTGGATCTGGGTCTT 33 80 481651 2132 2145 CTGGATCTGGGTCT 22 64 481427 2155 2170 GCTGCTTTGTGTATGG 33 75 481652 2156 2169 CTGCTTTGTGTATG 22 82 481428 2164 2179 TGTTCAGCTGCTGCTT 33 77 481653 2165 2178 GTTCAGCTGCTGCT 22 79 481429 2172 2187 TGACATGTTGTTCAGC 33 84 481654 2173 2186 GACATGTTGTTCAG 22 70 481430 2190 2205 CATGATGATTTCAGCA 33 67 481655 2191 2204 ATGATGATTTCAGC 22 31 481431 2206 2221 CCATGATCTTATAGCC 33 91 481656 2207 2220 CATGATCTTATAGC 22 0 481432 2233 2248 GTGGAGACACCAGGAT 33 55 481657 2234 2247 TGGAGACACCAGGA 22 58 481433 2256 2271 AATGTCAGGATAGAGA 33 73 481658 2257 2270 ATGTCAGGATAGAG 22 62 481434 2266 2281 CCTCCTTGGGAATGTC 33 73 345785 2267 2286 TGCCTCCTCCTTGGGAATGT 55 50 481659 2267 2280 CTCCTTGGGAATGT 22 51 481435 2269 2284 CCTCCTCCTTGGGAAT 33 49 481660 2270 2283 CTCCTCCTTGGGAA 22 54 481436 2275 2290 CGAATGCCTCCTCCTT 33 82 481661 2276 2289 GAATGCCTCCTCCT 22 76 481437 2296 2311 TCTCTGGCCGACAATA 33 49 481662 2297 2310 CTCTGGCCGACAAT 22 43 481438 2353 2368 ACTTGGTCTTCAGGTA 33 51 481663 2354 2367 CTTGGTCTTCAGGT 22 52 481439 2371 2386 TTGGTGTCACACAGAT 33 82 481664 2372 2385 TGGTGTCACACAGA 22 89 BIOL0142WO 481440 2387 2402 GTATTGCTGCAGGTCG 33 79 481665 2388 2401 TATTGCTGCAGGTC 22 43 481441 2395 2410 GGTCAATGGTATTGCT 33 55 481666 2396 2409 GTCAATGGTATTGC 22 36 481442 2403 2418 CATCGGCAGGTCAATG 33 44 481667 2404 2417 ATCGGCAGGTCAAT 22 31 481443 2423 2438 GAATCTAAAGTGCGGG 33 78 481668 2424 2437 AATCTAAAGTGCGG 22 41 481444 2431 2446 GCATCAATGAATCTAA 33 66 481669 2432 2445 CATCAATGAATCTA 22 0 481445 2439 2454 TCCAAACTGCATCAAT 33 70 481670 2440 2453 CCAAACTGCATCAA 22 60 481446 2460 2475 TTCAGCACCTTCACCA 33 44 481671 2461 2474 TCAGCACCTTCACC 22 41 481447 2476 2491 GCCCTCCTGCTGAGGG 33 10 481672 2477 2490 CCCTCCTGCTGAGG 22 15 481448 2484 2499 CTCAAACTGCCCTCCT 33 29 481797 2484 2497 CAAACTGCCCTCCT 22 11 481673 2485 2498 TCAAACTGCCCTCC 22 33 481449 2503 2518 CCATGTCAAAGGTGAG 33 77 481674 2504 2517 CATGTCAAAGGTGA 22 31 481450 2530 2545 GGGAGGTAGCGCACTC 33 53 481675 2531 2544 GGAGGTAGCGCACT 22 41 481451 2592 2607 GAATGCAGGTAGGCGC 33 55 481676 2593 2606 AATGCAGGTAGGCG 22 39 481452 2631 2646 TTTCAGATGATCTGGG 33 71 481677 2632 2645 TTCAGATGATCTGG 22 38 481574 2650 2665 GGAACCACAAAGTTAG 33 69 481799 2651 2664 GAACCACAAAGTTA 22 50 481453 2681 2696 GATAGCAGAAGTAGGA 33 92 481678 2682 2695 ATAGCAGAAGTAGG 22 78 481454 2702 2717 AAAGTGCCCAGATTGC 33 85 481679 2703 2716 AAGTGCCCAGATTG 22 69 481455 2722 2737 CACTCATTTCTCTATT 33 74 481680 2723 2736 ACTCATTTCTCTAT 22 39 481456 2767 2782 AACACATCCTTATTTG 33 48 481681 2768 2781 ACACATCCTTATTT 22 47 481457 2779 2794 TGGGTCTCAGAGAACA 33 88 481682 2780 2793 GGGTCTCAGAGAAC 22 77 481458 2832 2847 CAAGACATTTCCTTTT 33 54 481683 2833 2846 AAGACATTTCCTTT 22 29 481459 2908 2923 GGAGGCACTTGTCTAA 33 76 481684 2909 2922 GAGGCACTTGTCTA 22 89 481460 2943 2958 TTACAGAAACAGGCAG 33 83 481685 2944 2957 TACAGAAACAGGCA 22 36 BIOL0142WO 481461 2969 2984 AGCTATAGGTGGCCTG 33 75 481686 2970 2983 GCTATAGGTGGCCT 22 70 481462 2984 2999 ATGCCAGGAGTATGTA 33 89 481687 2985 2998 TGCCAGGAGTATGT 22 80 481463 3001 3016 CAAGGTTAAAAAGTGC 33 88 481688 3002 3015 AAGGTTAAAAAGTG 22 13 481464 3016 3031 CTATTTGGATGTCAGC 33 97 481689 3017 3030 TATTTGGATGTCAG 22 40 481465 3032 3047 TAGATAGTCCTATCTT 33 51 481690 3033 3046 AGATAGTCCTATCT 22 64 481466 3047 3062 AAGAAACCTAGGGCTT 33 74 481691 3048 3061 AGAAACCTAGGGCT 22 77 481467 3097 3112 GCTGATACAGTGTTTT 33 74 481692 3098 3111 CTGATACAGTGTTT 22 74 481468 3112 3127 ATACAGAAAGGCTATG 33 71 481693 3113 3126 TACAGAAAGGCTAT 22 25 481469 3127 3142 GCTTAAGTTTCTTAAA 33 61 481694 3128 3141 CTTAAGTTTCTTAA 22 0 481470 3461 3476 AGCACCAAGGAGGCTG 33 49 481695 3462 3475 GCACCAAGGAGGCT 22 83 481471 3476 3491 AAGCTGAATGCTTAAA 33 36 481696 3477 3490 AGCTGAATGCTTAA 22 33 481472 3491 3506 TTACCAGCCTGAAGGA 33 76 481697 3492 3505 TACCAGCCTGAAGG 22 63 481473 3506 3521 CAGGGATTATATAAAT 33 53 481698 3507 3520 AGGGATTATATAAA 22 15 481474 3521 3536 ACCTGAAGCCCGTTTC 33 80 481699 3522 3535 CCTGAAGCCCGTTT 22 57 481475 3536 3551 TGTCTTAAGGGTTTGA 33 93 481700 3537 3550 GTCTTAAGGGTTTG 22 89 481476 3551 3566 GGTTGCAGCTTCAGAT 33 92 481701 3552 3565 GTTGCAGCTTCAGA 22 60 481477 3567 3582 TCAACACCAAAGGCCA 33 95 481702 3568 3581 CAACACCAAAGGCC 22 89 481478 3585 3600 TCCTTAAACCTTCCTA 33 84 481703 3586 3599 CCTTAAACCTTCCT 22 57 481479 3600 3615 AAAATGCTTAGATTCT 33 80 481704 3601 3614 AAATGCTTAGATTC 22 32 481480 3628 3643 AAATAAGTCTATTTAT 33 5 481705 3629 3642 AATAAGTCTATTTA 22 25 481481 3648 3663 GGCCAATACATTACAA 33 63 481706 3649 3662 GCCAATACATTACA 22 56 481482 3670 3685 TGCCCAGCCTTACTCA 33 55 481707 3671 3684 GCCCAGCCTTACTC 22 43 481483 3685 3700 GTTGTAAGCACCCTCT 33 1 BIOL0142WO 481708 3686 3699 TTGTAAGCACCCTC 22 56 481484 3700 3715 AGAAAGGGAGTCAAGG 33 60 481709 3701 3714 GAAAGGGAGTCAAG 22 27 481485 3717 3732 GCAGATCAAGTCCAGG 33 90 481710 3718 3731 CAGATCAAGTCCAG 22 88 481486 3730 3745 AGCCTCTGAAACAGCA 33 75 481711 3731 3744 GCCTCTGAAACAGC 22 74 481487 3746 3761 CCCACAGAAACAACCT 33 66 481712 3747 3760 CCACAGAAACAACC 22 45 481488 3761 3776 AGCCCTGATAAGGCAC 33 23 481713 3762 3775 GCCCTGATAAGGCA 22 18 481489 3776 3791 AATCAGAAGTATCCCA 33 60 481714 3777 3790 ATCAGAAGTATCCC 22 43 481490 3833 3848 GCCTCTAGCAGGATCA 33 78 481715 3834 3847 CCTCTAGCAGGATC 22 79 481491 3848 3863 CACGCAAGGAGACATG 33 70 481716 3849 3862 ACGCAAGGAGACAT 22 68 481492 3863 3878 TGAGGGACCTTTAGAC 33 61 481717 3864 3877 GAGGGACCTTTAGA 22 44 481493 3886 3901 CAGGATTCCTAAAACA 33 43 481718 3887 3900 AGGATTCCTAAAAC 22 7 481494 3901 3916 ATGAGGTCCTGAGACC 33 60 481719 3902 3915 TGAGGTCCTGAGAC 22 29 481495 3940 3955 CATCATGTCCAACCTG 33 92 481720 3941 3954 ATCATGTCCAACCT 22 63 481496 3955 3970 GGGCCCCATAGTGTGC 33 29 481721 3956 3969 GGCCCCATAGTGTG 22 19 481497 3977 3992 AGCTCAACCAGACACG 33 67 481722 3978 3991 GCTCAACCAGACAC 22 69 481498 3992 4007 GAACCATATTCCCTGA 33 90 481723 3993 4006 AACCATATTCCCTG 22 49 481499 4007 4022 CAAGAAACTGGCTAAG 33 43 481724 4008 4021 AAGAAACTGGCTAA 22 17 481500 4022 4037 GCCACTGGATATCACC 33 92 481501 4048 4063 AACTGAATGAAGACGC 33 91 481726 4049 4062 ACTGAATGAAGACG 22 56 481502 4063 4078 CCTTTGCCCTGCATGA 33 85 481727 4064 4077 CTTTGCCCTGCATG 22 70 481503 4078 4093 AAGTTTATCAGTAAGC 33 57 481728 4079 4092 AGTTTATCAGTAAG 22 22 481504 4093 4108 TACGAGGGCAGACTCA 33 60 481729 4094 4107 ACGAGGGCAGACTC 22 22 481505 4108 4123 AGGTATACACCCTCAT 33 45 481730 4109 4122 GGTATACACCCTCA 22 47 481506 4123 4138 CCTCAGAGGGAGGCCA 33 32 BIOL0142WO 481731 4124 4137 CTCAGAGGGAGGCC 22 0 481507 4138 4153 GGGAGGAGTCACCAGC 33 64 481732 4139 4152 GGAGGAGTCACCAG 22 59 481508 4205 4220 TAGCCAGCCAAGGCGG 33 33 481733 4206 4219 AGCCAGCCAAGGCG 22 50 481509 4220 4235 ACAGGAGAGGCGAGCT 33 46 481734 4221 4234 CAGGAGAGGCGAGC 22 28 481510 4237 4252 TAGGTGTTCCCATACG 33 95 481735 4238 4251 AGGTGTTCCCATAC 22 22 481511 4258 4273 GGCAGCCCATCCAGCA 33 43 481736 4259 4272 GCAGCCCATCCAGC 22 54 481512 4275 4290 CATGCCTCTGAGTCAG 33 30 481737 4276 4289 ATGCCTCTGAGTCA 22 31 481513 4290 4305 GTTGCCAAATCCGGCC 33 85 481738 4291 4304 TTGCCAAATCCGGC 22 70 481514 4305 4320 GCAAGGTGGTTTTGAG 33 85 481739 4306 4319 CAAGGTGGTTTTGA 22 60 481515 4325 4340 AGAAACTCTGATCAGC 33 88 481740 4326 4339 GAAACTCTGATCAG 22 71 481516 4364 4379 CAGAGACCAGCTAATT 33 78 481741 4365 4378 AGAGACCAGCTAAT 22 80 481517 4394 4409 ATCTTAGAGAAGGTCG 33 87 481742 4395 4408 TCTTAGAGAAGGTC 22 64 481518 4425 4440 CCAGGCAGGAGGACTG 33 67 481743 4426 4439 CAGGCAGGAGGACT 22 75 481519 4437 4452 CATCAACTGTCTCCAG 33 29 481744 4438 4451 ATCAACTGTCTCCA 22 69 481520 4439 4454 CACATCAACTGTCTCC 33 73 481745 4440 4453 ACATCAACTGTCTC 22 74 481521 4459 4474 GAAGTAAGAGCTCTGC 33 86 481746 4460 4473 AAGTAAGAGCTCTG 22 67 481522 4474 4489 AAGAGTGTTGCTGGAG 33 92 481747 4475 4488 AGAGTGTTGCTGGA 22 95 481523 4489 4504 GCTTATTATGTACTGA 33 95 481748 4490 4503 CTTATTATGTACTG 22 15 481524 4530 4545 GCCCAAGTCTCACCTT 33 70 481749 4531 4544 CCCAAGTCTCACCT 22 70 481525 4541 4556 CCCAATGGTAAGCCCA 33 93 481750 4542 4555 CCAATGGTAAGCCC 22 94 481526 4543 4558 AACCCAATGGTAAGCC 33 82 481751 4544 4557 ACCCAATGGTAAGC 22 54 481527 4560 4575 TAGGTCCCTATGATTT 33 55 481752 4561 4574 AGGTCCCTATGATT 22 62 481528 4579 4594 AAGCCCTGAACCCTCG 33 77 481753 4580 4593 AGCCCTGAACCCTC 22 71 BIOL0142WO 481529 4615 4630 CCTAAGGCCATGAACT 33 64 481754 4616 4629 CTAAGGCCATGAAC 22 53 481530 4630 4645 ACCAGATACATGCTAC 33 87 481755 4631 4644 CCAGATACATGCTA 22 84 481531 4646 4661 TACAATCAGAGTTAAG 33 66 481756 4647 4660 ACAATCAGAGTTAA 22 5 481532 4664 4679 TCCTCTCAGAACTTTT 33 65 481757 4665 4678 CCTCTCAGAACTTT 22 81 481533 4666 4681 GCTCCTCTCAGAACTT 33 80 481758 4667 4680 CTCCTCTCAGAACT 22 62 481534 4693 4708 TTCTTTAATGGGCCAC 33 79 481759 4694 4707 TCTTTAATGGGCCA 22 74 481535 4767 4782 ACGGGATTCCCTCGGC 33 78 481760 4768 4781 CGGGATTCCCTCGG 22 78 481536 4782 4797 GTAGGTAAGCAACCCA 33 91 481761 4783 4796 TAGGTAAGCAACCC 22 78 481537 4830 4845 GAATTTGAATGCAGTG 33 84 481762 4831 4844 AATTTGAATGCAGT 22 2 481538 4844 4859 TGAAGTACACATTGGA 33 92 481763 4845 4858 GAAGTACACATTGG 22 96 481539 4860 4875 ATAAATTTTTACACTA 33 19 481764 4861 4874 TAAATTTTTACACT 22 1 481765 4869 4882 CAATAATATAAATT 22 0 481541 4934 4949 CTGGAAGTTAAAGTAG 33 71 481766 4935 4948 TGGAAGTTAAAGTA 22 10 Table 2 Inhibition of human STAT3 mRNA levels by cEt and MOE chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 Wing Human Human SEQ ISIS % Chem Start Stop Sequence Motif ID NO inhibition Site Site NO 481350 1065 1080 TCCAGGATCCGGTTGG 33 52 9 481575 1066 1079 CCAGGATCCGGTTG 22 41 10 481351 1121 1136 GGCCGAAGGGCCTCTC 33 14 11 481576 1122 1135 GCCGAAGGGCCTCT 22 8 12 481542 1988 2003 GGCTCAATTATTTATC 33 64 399 481767 1989 2002 GCTCAATTATTTAT 22 0 400 481543 1996 2011 AATGCAATGGCTCAAT 33 84 401 481768 1997 2010 ATGCAATGGCTCAA 22 95 402 481544 2004 2019 ATCCAGTAAATGCAAT 33 58 403 481769 2005 2018 TCCAGTAAATGCAA 22 55 404 481545 2061 2076 AGAAAACTCCCACTCT 33 36 405 481770 2062 2075 GAAAACTCCCACTC 22 42 406 481546 2113 2128 CTGTCTTTGTTTCCCT 33 70 407 481771 2114 2127 TGTCTTTGTTTCCC 22 75 408 BIOL0142WO 481547 2121 2136 AGGCCAGCCTGTCTTT 33 87 409 481772 2122 2135 GGCCAGCCTGTCTT 22 53 410 481548 2705 2720 CTAATGGTTCTTTGTG 33 78 411 481773 2706 2719 TAATGGTTCTTTGT 22 9 412 481549 6476 6491 GAAATTCATTCTTCCA 33 96 413 481774 6477 6490 AAATTCATTCTTCC 22 56 414 481550 10001 10016 ACACACACAGATGTGA 33 48 415 481775 10002 10015 CACACACAGATGTG 22 35 416 481551 10337 10352 CTACCCAAACATCCCC 33 69 417 481776 10338 10351 TACCCAAACATCCC 22 62 418 481552 10345 10360 TACAAAAACTACCCAA 33 30 419 481777 10346 10359 ACAAAAACTACCCA 22 1 420 481553 10364 10379 AGTTTTCAGAAATGGC 33 96 481778 10365 10378 GTTTTCAGAAATGG 22 47 481554 15469 15484 CAAGCTTTTCTATGAA 33 86 481779 15470 15483 AAGCTTTTCTATGA 22 60 481555 24588 24603 TTATTCAGGTCACTTT 33 73 481780 24589 24602 TATTCAGGTCACTT 22 60 481352 40953 40968 CCTGCTAAAATCAGGG 33 15 13 481577 40954 40967 CTGCTAAAATCAGG 22 12 14 481353 40968 40983 ATTCCATTGGGCCATC 33 78 15 481578 40969 40982 TTCCATTGGGCCAT 22 51 16 481354 40992 41007 CCGTGTGTCAAGCTGC 33 98 17 481579 40993 41006 CGTGTGTCAAGCTG 22 91 18 481355 41050 41065 ACTGCCGCAGCTCCAT 33 95 19 481580 41051 41064 CTGCCGCAGCTCCA 22 76 20 481356 41074 41089 GACTCTCAATCCAAGG 33 83 21 481581 41075 41088 ACTCTCAATCCAAG 22 31 22 481556 42765 42780 GCATATGCCCTAGGAA 33 23 430 481781 42766 42779 CATATGCCCTAGGA 22 15 431 481357 42778 42793 TTCTTTGCTGGCCGCA 33 97 23 481582 42779 42792 TCTTTGCTGGCCGC 22 87 24 481358 42806 42821 GATTATGAAACACCAA 33 85 25 481583 42807 42820 ATTATGAAACACCA 22 20 26 481359 42832 42847 ATACTGCTGGTCAATC 33 90 27 481584 42833 42846 TACTGCTGGTCAAT 22 42 28 481360 42862 42877 GAGAACATTCGACTCT 33 75 29 481585 42863 42876 AGAACATTCGACTC 22 77 30 481361 42877 42892 TAGATTGTGCTGATAG 33 90 31 481586 42878 42891 AGATTGTGCTGATA 22 81 32 481362 42893 42908 ACTGCTTGATTCTTCG 33 59 33 481587 42894 42907 CTGCTTGATTCTTC 22 23 34 481557 43043 43058 GCTAATTACTTCTCCT 33 57 432 481782 43044 43057 CTAATTACTTCTCC 22 25 433 481588 43826 43839 AAGATACCTGCTCT 22 58 36 BIOL0142WO 481364 43856 43871 GCCACAATCCGGGCAA 33 36 37 481589 43857 43870 CCACAATCCGGGCA 22 69 38 481365 43903 43918 CAGTGGCTGCAGTCTG 33 36 39 481590 43904 43917 AGTGGCTGCAGTCT 22 30 40 481558 50069 50084 GCCCCCTTGCTGCCAA 33 0 434 481783 50070 50083 CCCCCTTGCTGCCA 22 39 435 481367 50101 50116 GTCACCACGGCTGCTG 33 70 43 481592 50102 50115 TCACCACGGCTGCT 22 48 44 481368 50122 50137 TCCAGCATCTGCTGCT 33 81 45 481593 50123 50136 CCAGCATCTGCTGC 22 46 46 481369 50138 50153 ATCCTGAAGGTGCTGC 33 29 47 481594 50139 50152 TCCTGAAGGTGCTG 22 16 48 481559 50668 50683 TGTTCTAGATCCTGTT 33 72 436 481784 50669 50682 GTTCTAGATCCTGT 22 79 437 481371 50673 50688 TTTTCTGTTCTAGATC 33 83 51 481596 50674 50687 TTTCTGTTCTAGAT 22 48 52 481372 50694 50709 GGAGATTCTCTACCAC 33 85 53 481597 50695 50708 GAGATTCTCTACCA 22 80 54 481373 50715 50730 AGTTGAAATCAAAGTC 33 87 55 481598 50716 50729 GTTGAAATCAAAGT 22 6 56 481599 51626 51639 GATCTTGCATGTCT 22 51 58 481375 51636 51651 TGTTTCCATTCAGATC 33 65 59 481600 51637 51650 GTTTCCATTCAGAT 22 42 60 481376 51705 51720 TCCGCATCTGGTCCAG 33 82 61 481601 51706 51719 CCGCATCTGGTCCA 22 70 62 481560 51708 51723 CTCTCCGCATCTGGTC 33 63 438 481785 51709 51722 TCTCCGCATCTGGT 22 28 63 481378 51905 51920 CCGCCAGCTCACTCAC 33 89 66 481603 51906 51919 CGCCAGCTCACTCA 22 60 67 481379 51968 51983 TCCAGTCAGCCAGCTC 33 91 68 481604 51969 51982 CCAGTCAGCCAGCT 22 70 69 481380 51976 51991 CCGCCTCTTCCAGTCA 33 73 70 481605 51977 51990 CGCCTCTTCCAGTC 22 55 71 481381 52023 52038 CGATCTAGGCAGATGT 33 26 72 481606 52024 52037 GATCTAGGCAGATG 22 35 73 481382 55443 55458 GAGATTCTGCTAATGA 33 81 74 481607 55444 55457 AGATTCTGCTAATG 22 51 481383 55451 55466 CTGAAGTTGAGATTCT 33 84 481608 55452 55465 TGAAGTTGAGATTC 22 26 481384 55496 55511 AACTTTTTGCTGCAAC 33 76 481609 55497 55510 ACTTTTTGCTGCAA 22 34 481385 55511 55526 GTCCCCTTTGTAGGAA 33 41 481610 55512 55525 TCCCCTTTGTAGGA 22 37 481387 55748 55763 CAGGATGCATGGGCAT 33 92 84 481612 55749 55762 AGGATGCATGGGCA 22 86 BIOL0142WO 481388 55792 55807 TTTAGTAGTGAACTGG 33 74 481613 55793 55806 TTAGTAGTGAACTG 22 22 481561 57949 57964 TGACCAGCAACCTATT 33 43 481786 57950 57963 GACCAGCAACCTAT 22 59 481390 57969 57984 ATAATTCAACTCAGGG 33 92 481615 57970 57983 TAATTCAACTCAGG 22 48 481391 57978 57993 TTTAAGCTGATAATTC 33 44 481616 57979 57992 TTAAGCTGATAATT 22 0 481392 57990 58005 GCACACTTTAATTTTA 33 49 481617 57991 58004 CACACTTTAATTTT 22 1 481562 59703 59718 CCCAGAGTCTCTGTAA 33 36 441 481787 59704 59717 CCAGAGTCTCTGTA 22 22 442 481394 59895 59910 GAGGCTGCCGTTGTTG 33 62 481619 59896 59909 AGGCTGCCGTTGTT 22 29 481396 60034 60049 CACATCTCTGCTCCCT 33 92 102 481621 60035 60048 ACATCTCTGCTCCC 22 74 103 481563 60064 60079 TTACATCACAATTGGC 33 24 445 481788 60065 60078 TACATCACAATTGG 22 3 446 481398 63306 63321 GATCAGGTGCAGCTCC 33 73 106 481623 63307 63320 ATCAGGTGCAGCTC 22 40 107 481399 63327 63342 ATACACCTCGGTCTCA 33 73 108 481624 63328 63341 TACACCTCGGTCTC 22 43 109 481400 63343 63358 TCTTGAGGCCTTGGTG 33 47 110 481625 63344 63357 CTTGAGGCCTTGGT 22 16 111 481401 63353 63368 TCTAGGTCAATCTTGA 33 74 112 481626 63354 63367 CTAGGTCAATCTTG 22 54 113 481564 64421 64436 GCAAGGAGTGGGTCTG 33 33 446 481789 64422 64435 CAAGGAGTGGGTCT 22 10 116 481403 64425 64440 ACTGGCAAGGAGTGGG 33 58 117 481628 64426 64439 CTGGCAAGGAGTGG 22 38 118 481404 64451 64466 TCTGACAGATGTTGGA 33 50 119 481629 64452 64465 CTGACAGATGTTGG 22 64 120 481405 64459 64474 ATTTGGCATCTGACAG 33 75 121 481630 64460 64473 TTTGGCATCTGACA 22 39 122 481407 64663 64678 CCCAGGTTCCAATTGG 33 50 125 481632 64664 64677 CCAGGTTCCAATTG 22 32 126 481408 64714 64729 CTCGCTTGGTGGTGGA 33 53 127 481633 64715 64728 TCGCTTGGTGGTGG 22 35 128 481409 64729 64744 GCTCGATGCTCAGTCC 33 86 129 481634 64730 64743 CTCGATGCTCAGTC 22 43 130 481410 64759 64774 CCAAGAGTTTCTCTGC 33 91 131 481635 64760 64773 CAAGAGTTTCTCTG 22 43 132 481411 65859 65874 AATTCACACCAGGTCC 33 72 133 481636 65860 65873 ATTCACACCAGGTC 22 42 134 481412 65877 65892 TGATCTGACACCCTGA 33 90 135 BIOL0142WO 481637 65878 65891 GATCTGACACCCTG 22 79 136 481413 65885 65900 AGCCCATGTGATCTGA 33 80 137 481638 65886 65899 GCCCATGTGATCTG 22 64 138 481565 66119 66134 TTTCCTGGAGAAAAGA 33 4 447 481790 66120 66133 TTCCTGGAGAAAAG 22 3 448 481566 66127 66142 AGCCATGTTTTCCTGG 33 62 449 481791 66128 66141 GCCATGTTTTCCTG 22 73 450 481415 66133 66148 CTTGCCAGCCATGTTT 33 88 141 481640 66134 66147 TTGCCAGCCATGTT 22 57 142 337332 66135 66154 GAAGCCCTTGCCAGCCATGT 55 63 143 481416 66138 66153 AAGCCCTTGCCAGCCA 33 87 144 481641 66139 66152 AGCCCTTGCCAGCC 22 68 145 337333 66140 66159 AAGGAGAAGCCCTTGCCAGC 55 49 146 481417 66140 66155 AGAAGCCCTTGCCAGC 33 97 481418 66141 66156 GAGAAGCCCTTGCCAG 33 92 481642 66141 66154 GAAGCCCTTGCCAG 22 67 481419 66142 66157 GGAGAAGCCCTTGCCA 33 83 481643 66142 66155 AGAAGCCCTTGCCA 22 58 481644 66143 66156 GAGAAGCCCTTGCC 22 45 481420 66185 66200 ACTTTTTCACAAGGTC 33 94 481645 66186 66199 CTTTTTCACAAGGT 22 50 481421 66374 66389 CTCAAGATGGCCCGCT 33 86 481646 66375 66388 TCAAGATGGCCCGC 22 41 481422 66389 66404 CCTGGAGGCTTAGTGC 33 80 481647 66390 66403 CTGGAGGCTTAGTG 22 0 481423 66430 66445 CTCCTTCTTTGCTGCT 33 69 481648 66431 66444 TCCTTCTTTGCTGC 22 51 481424 66446 66461 CAAGTGAAAGTGACGC 33 70 481649 66447 66460 AAGTGAAAGTGACG 22 25 481425 66468 66483 ACCGCTGATGTCCTTC 33 78 481650 66469 66482 CCGCTGATGTCCTT 22 79 481426 66993 67008 ACTGGATCTGGGTCTT 33 80 481651 66994 67007 CTGGATCTGGGTCT 22 64 481427 67017 67032 GCTGCTTTGTGTATGG 33 75 481652 67018 67031 CTGCTTTGTGTATG 22 82 481428 67026 67041 TGTTCAGCTGCTGCTT 33 77 481653 67027 67040 GTTCAGCTGCTGCT 22 79 481429 67034 67049 TGACATGTTGTTCAGC 33 84 481654 67035 67048 GACATGTTGTTCAG 22 70 481430 67052 67067 CATGATGATTTCAGCA 33 67 481655 67053 67066 ATGATGATTTCAGC 22 31 481431 67068 67083 CCATGATCTTATAGCC 33 91 481656 67069 67082 CATGATCTTATAGC 22 0 481432 67095 67110 GTGGAGACACCAGGAT 33 55 481657 67096 67109 TGGAGACACCAGGA 22 58 BIOL0142WO 481433 67118 67133 AATGTCAGGATAGAGA 33 73 481658 67119 67132 ATGTCAGGATAGAG 22 62 481434 67128 67143 CCTCCTTGGGAATGTC 33 73 345785 67129 67148 TGCCTCCTCCTTGGGAATGT 55 50 481659 67129 67142 CTCCTTGGGAATGT 22 51 481435 67131 67146 CCTCCTCCTTGGGAAT 33 49 481660 67132 67145 CTCCTCCTTGGGAA 22 54 481436 67137 67152 CGAATGCCTCCTCCTT 33 82 481661 67138 67151 GAATGCCTCCTCCT 22 76 481437 67158 67173 TCTCTGGCCGACAATA 33 49 481662 67159 67172 CTCTGGCCGACAAT 22 43 189 481567 67194 67209 AACAACTACCTGGGTC 33 20 451 481792 67195 67208 ACAACTACCTGGGT 22 0 452 481438 72272 72287 ACTTGGTCTTCAGGTA 33 51 190 481663 72273 72286 CTTGGTCTTCAGGT 22 52 191 481568 72290 72305 ACGGTGTCACACAGAT 33 85 453 481793 72291 72304 CGGTGTCACACAGA 22 93 454 481569 72430 72445 AACACACAAGGTCACT 33 62 455 481794 72431 72444 ACACACAAGGTCAC 22 81 456 481570 72438 72453 GCTTTTTAAACACACA 33 79 457 481795 72439 72452 CTTTTTAAACACAC 22 0 458 481571 72528 72543 TGACAAGACACAATGG 33 12 459 481796 72529 72542 GACAAGACACAATG 22 36 460 481440 72586 72601 GTATTGCTGCAGGTCG 33 79 481665 72587 72600 TATTGCTGCAGGTC 22 43 481441 72594 72609 GGTCAATGGTATTGCT 33 55 481666 72595 72608 GTCAATGGTATTGC 22 36 481442 72602 72617 CATCGGCAGGTCAATG 33 44 481667 72603 72616 ATCGGCAGGTCAAT 22 31 481443 72622 72637 GAATCTAAAGTGCGGG 33 78 481668 72623 72636 AATCTAAAGTGCGG 22 41 481444 72630 72645 GCATCAATGAATCTAA 33 66 481669 72631 72644 CATCAATGAATCTA 22 0 481445 72638 72653 TCCAAACTGCATCAAT 33 70 481670 72639 72652 CCAAACTGCATCAA 22 60 481446 72659 72674 TTCAGCACCTTCACCA 33 44 481671 72660 72673 TCAGCACCTTCACC 22 41 481447 72675 72690 GCCCTCCTGCTGAGGG 33 10 481672 72676 72689 CCCTCCTGCTGAGG 22 15 209 481572 72682 72697 CCAAACTGCCCTCCTG 33 51 461 481797 72683 72696 CAAACTGCCCTCCT 22 11 211 481573 73535 73550 GGTCAGAAAAGCCAGA 33 55 462 481798 73536 73549 GTCAGAAAAGCCAG 22 59 463 481449 73690 73705 CCATGTCAAAGGTGAG 33 77 481674 73691 73704 CATGTCAAAGGTGA 22 31 BIOL0142WO 481450 73717 73732 GGGAGGTAGCGCACTC 33 53 481675 73718 73731 GGAGGTAGCGCACT 22 41 481451 73779 73794 GAATGCAGGTAGGCGC 33 55 481676 73780 73793 AATGCAGGTAGGCG 22 39 481452 73818 73833 TTTCAGATGATCTGGG 33 71 481677 73819 73832 TTCAGATGATCTGG 22 38 481574 73837 73852 GGAACCACAAAGTTAG 33 69 481799 73838 73851 GAACCACAAAGTTA 22 50 481453 73868 73883 GATAGCAGAAGTAGGA 33 92 481678 73869 73882 ATAGCAGAAGTAGG 22 78 481454 73889 73904 AAAGTGCCCAGATTGC 33 85 481679 73890 73903 AAGTGCCCAGATTG 22 69 481455 73909 73924 CACTCATTTCTCTATT 33 74 481680 73910 73923 ACTCATTTCTCTAT 22 39 481456 73954 73969 AACACATCCTTATTTG 33 48 481681 73955 73968 ACACATCCTTATTT 22 47 481457 73966 73981 TGGGTCTCAGAGAACA 33 88 481682 73967 73980 GGGTCTCAGAGAAC 22 77 481458 74019 74034 CAAGACATTTCCTTTT 33 54 481683 74020 74033 AAGACATTTCCTTT 22 29 481459 74095 74110 GGAGGCACTTGTCTAA 33 76 481684 74096 74109 GAGGCACTTGTCTA 22 89 481460 74130 74145 TTACAGAAACAGGCAG 33 83 481685 74131 74144 TACAGAAACAGGCA 22 36 481461 74156 74171 AGCTATAGGTGGCCTG 33 75 481686 74157 74170 GCTATAGGTGGCCT 22 70 481462 74171 74186 ATGCCAGGAGTATGTA 33 89 481687 74172 74185 TGCCAGGAGTATGT 22 80 481463 74188 74203 CAAGGTTAAAAAGTGC 33 88 481688 74189 74202 AAGGTTAAAAAGTG 22 13 481464 74203 74218 CTATTTGGATGTCAGC 33 97 481689 74204 74217 TATTTGGATGTCAG 22 40 481465 74219 74234 TAGATAGTCCTATCTT 33 51 481690 74220 74233 AGATAGTCCTATCT 22 64 481466 74234 74249 AAGAAACCTAGGGCTT 33 74 481691 74235 74248 AGAAACCTAGGGCT 22 77 481467 74284 74299 GCTGATACAGTGTTTT 33 74 481692 74285 74298 CTGATACAGTGTTT 22 74 481468 74299 74314 ATACAGAAAGGCTATG 33 71 481693 74300 74313 TACAGAAAGGCTAT 22 25 481469 74314 74329 GCTTAAGTTTCTTAAA 33 61 481694 74315 74328 CTTAAGTTTCTTAA 22 0 481470 74648 74663 AGCACCAAGGAGGCTG 33 49 481695 74649 74662 GCACCAAGGAGGCT 22 83 481471 74663 74678 AAGCTGAATGCTTAAA 33 36 BIOL0142WO 481696 74664 74677 AGCTGAATGCTTAA 22 33 481472 74678 74693 TTACCAGCCTGAAGGA 33 76 481697 74679 74692 TACCAGCCTGAAGG 22 63 481473 74693 74708 CAGGGATTATATAAAT 33 53 481698 74694 74707 AGGGATTATATAAA 22 15 481474 74708 74723 ACCTGAAGCCCGTTTC 33 80 481699 74709 74722 CCTGAAGCCCGTTT 22 57 481475 74723 74738 TGTCTTAAGGGTTTGA 33 93 481700 74724 74737 GTCTTAAGGGTTTG 22 89 481476 74738 74753 GGTTGCAGCTTCAGAT 33 92 481701 74739 74752 GTTGCAGCTTCAGA 22 60 481477 74754 74769 TCAACACCAAAGGCCA 33 95 481702 74755 74768 CAACACCAAAGGCC 22 89 481478 74772 74787 TCCTTAAACCTTCCTA 33 84 481703 74773 74786 CCTTAAACCTTCCT 22 57 481479 74787 74802 AAAATGCTTAGATTCT 33 80 481704 74788 74801 AAATGCTTAGATTC 22 32 481480 74815 74830 AAATAAGTCTATTTAT 33 5 481705 74816 74829 AATAAGTCTATTTA 22 25 481481 74835 74850 GGCCAATACATTACAA 33 63 481706 74836 74849 GCCAATACATTACA 22 56 481482 74857 74872 TGCCCAGCCTTACTCA 33 55 481707 74858 74871 GCCCAGCCTTACTC 22 43 481483 74872 74887 GTTGTAAGCACCCTCT 33 1 481708 74873 74886 TTGTAAGCACCCTC 22 56 481484 74887 74902 AGAAAGGGAGTCAAGG 33 60 481709 74888 74901 GAAAGGGAGTCAAG 22 27 481485 74904 74919 GCAGATCAAGTCCAGG 33 90 481710 74905 74918 CAGATCAAGTCCAG 22 88 481486 74917 74932 AGCCTCTGAAACAGCA 33 75 481711 74918 74931 GCCTCTGAAACAGC 22 74 481487 74933 74948 CCCACAGAAACAACCT 33 66 481712 74934 74947 CCACAGAAACAACC 22 45 481488 74948 74963 AGCCCTGATAAGGCAC 33 23 481713 74949 74962 GCCCTGATAAGGCA 22 18 481489 74963 74978 AATCAGAAGTATCCCA 33 60 481714 74964 74977 ATCAGAAGTATCCC 22 43 481490 75020 75035 GCCTCTAGCAGGATCA 33 78 481715 75021 75034 CCTCTAGCAGGATC 22 79 481491 75035 75050 CACGCAAGGAGACATG 33 70 481716 75036 75049 ACGCAAGGAGACAT 22 68 481492 75050 75065 TGAGGGACCTTTAGAC 33 61 481717 75051 75064 GAGGGACCTTTAGA 22 44 481493 75073 75088 CAGGATTCCTAAAACA 33 43 481718 75074 75087 AGGATTCCTAAAAC 22 7 BIOL0142WO 481494 75088 75103 ATGAGGTCCTGAGACC 33 60 481719 75089 75102 TGAGGTCCTGAGAC 22 29 481495 75127 75142 CATCATGTCCAACCTG 33 92 481720 75128 75141 ATCATGTCCAACCT 22 63 481496 75142 75157 GGGCCCCATAGTGTGC 33 29 481721 75143 75156 GGCCCCATAGTGTG 22 19 481497 75164 75179 AGCTCAACCAGACACG 33 67 481722 75165 75178 GCTCAACCAGACAC 22 69 481498 75179 75194 GAACCATATTCCCTGA 33 90 481723 75180 75193 AACCATATTCCCTG 22 49 481499 75194 75209 CAAGAAACTGGCTAAG 33 43 481724 75195 75208 AAGAAACTGGCTAA 22 17 481500 75209 75224 GCCACTGGATATCACC 33 92 481725 75210 75223 CCACTGGATATCAC 22 88 464 481501 75235 75250 AACTGAATGAAGACGC 33 91 481726 75236 75249 ACTGAATGAAGACG 22 56 481502 75250 75265 CCTTTGCCCTGCATGA 33 85 481727 75251 75264 CTTTGCCCTGCATG 22 70 481503 75265 75280 AAGTTTATCAGTAAGC 33 57 481728 75266 75279 AGTTTATCAGTAAG 22 22 481504 75280 75295 TACGAGGGCAGACTCA 33 60 481729 75281 75294 ACGAGGGCAGACTC 22 22 481505 75295 75310 AGGTATACACCCTCAT 33 45 481730 75296 75309 GGTATACACCCTCA 22 47 481506 75310 75325 CCTCAGAGGGAGGCCA 33 32 481731 75311 75324 CTCAGAGGGAGGCC 22 0 481507 75325 75340 GGGAGGAGTCACCAGC 33 64 481732 75326 75339 GGAGGAGTCACCAG 22 59 481508 75392 75407 TAGCCAGCCAAGGCGG 33 33 481733 75393 75406 AGCCAGCCAAGGCG 22 50 481509 75407 75422 ACAGGAGAGGCGAGCT 33 46 481734 75408 75421 CAGGAGAGGCGAGC 22 28 481510 75424 75439 TAGGTGTTCCCATACG 33 95 481735 75425 75438 AGGTGTTCCCATAC 22 22 481511 75445 75460 GGCAGCCCATCCAGCA 33 43 481736 75446 75459 GCAGCCCATCCAGC 22 54 481512 75462 75477 CATGCCTCTGAGTCAG 33 30 481737 75463 75476 ATGCCTCTGAGTCA 22 31 481513 75477 75492 GTTGCCAAATCCGGCC 33 85 481738 75478 75491 TTGCCAAATCCGGC 22 70 481514 75492 75507 GCAAGGTGGTTTTGAG 33 85 481739 75493 75506 CAAGGTGGTTTTGA 22 60 481515 75512 75527 AGAAACTCTGATCAGC 33 88 481740 75513 75526 GAAACTCTGATCAG 22 71 481516 75551 75566 CAGAGACCAGCTAATT 33 78 BIOL0142WO 481741 75552 75565 AGAGACCAGCTAAT 22 80 481517 75581 75596 ATCTTAGAGAAGGTCG 33 87 481742 75582 75595 TCTTAGAGAAGGTC 22 64 481518 75612 75627 CCAGGCAGGAGGACTG 33 67 481743 75613 75626 CAGGCAGGAGGACT 22 75 481519 75624 75639 CATCAACTGTCTCCAG 33 29 481744 75625 75638 ATCAACTGTCTCCA 22 69 481520 75626 75641 CACATCAACTGTCTCC 33 73 481745 75627 75640 ACATCAACTGTCTC 22 74 481521 75646 75661 GAAGTAAGAGCTCTGC 33 86 481746 75647 75660 AAGTAAGAGCTCTG 22 67 481522 75661 75676 AAGAGTGTTGCTGGAG 33 92 481747 75662 75675 AGAGTGTTGCTGGA 22 95 481523 75676 75691 GCTTATTATGTACTGA 33 95 481748 75677 75690 CTTATTATGTACTG 22 15 481524 75717 75732 GCCCAAGTCTCACCTT 33 70 481749 75718 75731 CCCAAGTCTCACCT 22 70 481525 75728 75743 CCCAATGGTAAGCCCA 33 93 481750 75729 75742 CCAATGGTAAGCCC 22 94 481526 75730 75745 AACCCAATGGTAAGCC 33 82 481751 75731 75744 ACCCAATGGTAAGC 22 54 481527 75747 75762 TAGGTCCCTATGATTT 33 55 481752 75748 75761 AGGTCCCTATGATT 22 62 481528 75766 75781 AAGCCCTGAACCCTCG 33 77 481753 75767 75780 AGCCCTGAACCCTC 22 71 481529 75802 75817 CCTAAGGCCATGAACT 33 64 481754 75803 75816 CTAAGGCCATGAAC 22 53 481530 75817 75832 ACCAGATACATGCTAC 33 87 481755 75818 75831 CCAGATACATGCTA 22 84 481531 75833 75848 TACAATCAGAGTTAAG 33 66 481756 75834 75847 ACAATCAGAGTTAA 22 5 481532 75851 75866 TCCTCTCAGAACTTTT 33 65 481757 75852 75865 CCTCTCAGAACTTT 22 81 481533 75853 75868 GCTCCTCTCAGAACTT 33 80 481758 75854 75867 CTCCTCTCAGAACT 22 62 481534 75880 75895 TTCTTTAATGGGCCAC 33 79 481759 75881 75894 TCTTTAATGGGCCA 22 74 481535 75954 75969 ACGGGATTCCCTCGGC 33 78 481760 75955 75968 CGGGATTCCCTCGG 22 78 481536 75969 75984 GTAGGTAAGCAACCCA 33 91 481761 75970 75983 TAGGTAAGCAACCC 22 78 481537 76017 76032 GAATTTGAATGCAGTG 33 84 481762 76018 76031 AATTTGAATGCAGT 22 2 481538 76031 76046 TGAAGTACACATTGGA 33 92 481763 76032 76045 GAAGTACACATTGG 22 96 BIOL0142WO 481539 76047 76062 ATAAATTTTTACACTA 33 19 481764 76048 76061 TAAATTTTTACACT 22 1 481765 76056 76069 CAATAATATAAATT 22 0 481541 76121 76136 CTGGAAGTTAAAGTAG 33 71 481766 76122 76135 TGGAAGTTAAAGTA 22 10 Example 2: Antisense inhibition of murine STAT3 in b.END cells Antisense oligonucleotides tested in the study described in Example 1 were also tested for their effects on STAT3 mRNA in b.END cells. Cultured b.END cells at a density of 20,000 cells per well were transfected using electroporation with 7,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Murine primer probe set RTS2381 (forward sequence GCCACGTTGGTGTTTCATAATCT, designated herein as SEQ ID NO: 465; reverse sequence GATAGAGGACATTGGACTCTTGCA, designated herein as SEQ ID NO: 466; probe sequence TTGGGTGAAATTGACCAGCAATATAGCCG, designated herein as SEQ ID NO: 467) was used to measure RNA. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®.

Certain sequences complementary to the STAT3 mouse gene sequence showed good inhibition in b. END cells. Results are presented in Table 3 as percent inhibition of STAT3, relative to untreated control cells. The human oligonucleotides in Table 3 were compared to the mouse STAT-3 genomic sequence, designated herein as SEQ ID NO: 3 (the complement of GENBANK Accession No.

NT_165773.2 truncated from nucleotides 12286001 to 12344000). “Mouse Target start site” indicates the ’-most nucleotide to which the gapmer is targeted in the murine sequence. “Mouse Target stop site” indicates the 3’-most nucleotide to which the gapmer is targeted murine sequence.

Table 3 Inhibition of human STAT3 mRNA levels by certain cEt chimeric antisense oligonucleotides complementary to SEQ ID NO: 1 and SEQ ID NO: 3 Mouse Mouse ISIS % SEQ ID Start Stop NO inhibition NO Site Site 481549 5283 5298 96 413 481553 9913 9928 94 421 481768 3189 3202 91 402 481356 30356 30371 83 21 481548 4045 4060 82 411 481554 14662 14677 82 423 481426 48328 48343 82 165 481580 30333 30346 81 20 481412 47413 47428 81 135 481417 47636 47651 81 147 BIOL0142WO 481418 47637 47652 80 148 481355 30332 30347 79 19 481396 43120 43135 79 443 481416 47634 47649 79 144 481420 47681 47696 79 153 481358 32842 32857 78 25 481363 33520 33535 78 35 481570 51870 51885 78 457 481382 37857 37872 77 74 481378 36560 36575 76 66 481431 48403 48418 76 175 481453 53034 53049 76 223 481621 43121 43134 75 444 481641 47635 47648 75 145 481637 47414 47427 74 136 481380 36631 36646 73 70 481574 53000 53015 73 221 481601 36392 36405 71 62 481419 47638 47653 71 150 481371 35938 35953 70 51 481642 47637 47650 70 149 481542 3180 3195 69 399 481547 3313 3328 69 409 481772 3314 3327 69 410 481362 32929 32944 69 33 481653 48362 48375 69 170 481786 38812 38825 68 440 481415 47629 47644 68 141 481543 3188 3203 67 401 481793 51714 51727 67 454 481443 52060 52075 67 200 481684 53229 53242 67 236 481398 45226 45241 66 106 481560 36394 36409 65 438 481643 47638 47651 65 151 481430 48387 48402 65 173 481440 52024 52039 65 194 Example 3: Tolerability of antisense oligonucleotides targeting STAT3 in BALB/c mice Forty antisense oligonucleotides exhibiting a high level of potency, selected from among the 452 compounds evaluated in Example 1, were further tested for in vivo tolerability.

Groups of 2-4 male BALB/c mice were injected subcutaneously twice a week for 3 weeks with mg/kg of ISIS antisense oligonucleotides. One group of 4 male BALB/c mice was injected BIOL0142WO subcutaneously twice a week for 3 weeks with PBS. This group of mice was utilized as a control group to which the treatment groups were compared. One day after the last dose, body weights were taken, mice were euthanized, and organs and plasma were harvested for further analysis.

The body weights of the mice were measured pre-dose and at the end of the treatment period.

Percent increase over the initial body weight was calculated. Liver, spleen, and kidney weights were measured at the end of the study and were compared to PBS treated mice.

To evaluate the effect of ISIS oligonucleotides on metabolic function, plasma concentrations of transaminases and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (alanine transaminase), AST (aspartate transaminase), and BUN were measured.

Among the forty antisense oligonucleotides tested, certain antisense oligonucleotides, including ISIS 481374, ISIS 481390, ISIS 481420, ISIS 481431, ISIS 481453, ISIS 481464, ISIS 481475, ISIS 481495, ISIS 481500, ISIS 481501, ISIS 481525, ISIS 481548, ISIS 481549, ISIS 481597, ISIS 481695, ISIS 481700, ISIS 481702, ISIS 481710, ISIS 481725, ISIS 481750, and ISIS 481763 met tolerability thresholds for body weight, organ weight, ALT, AST, and BUN parameters.

Example 4: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from Examples 1 and 2 exhibiting significant in vitro inhibition of STAT3 were tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, and 1,0000 nM concentrations of antisense oligonucleotide, as specified in Table 4. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199 (forward sequence ACATGCCACTTTGGTGTTTCATAA, designated herein as SEQ ID NO: 6; reverse sequence TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as SEQ ID NO: 7; probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA, designated herein as SEQ ID NO: 8) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 4 and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of STAT3 mRNA expression achieved at each concentration and noting the concentration of oligonucleotide at which 50% inhibition of STAT3 mRNA expression was achieved compared to the control. As illustrated in Table 4, STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

BIOL0142WO Table 4 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells using electroporation 31.25 62.5 125.0 250.0 500.0 1000.0 ISIS No nM nM nM nM nM nM (μM) 481355 19 15 36 61 75 89 0.18 481374 25 42 52 72 82 88 0.10 481390 17 37 44 60 73 86 0.15 481420 23 20 40 60 81 92 0.16 481453 21 37 52 69 79 88 0.12 481464 57 73 81 90 94 94 <0.03 481475 22 46 54 78 83 92 0.10 481500 25 37 42 75 83 90 0.12 481501 32 57 69 82 94 94 0.05 481523 35 60 74 85 90 93 0.04 481525 36 53 60 79 89 92 0.06 481549 0 16 60 81 90 96 0.15 481554 0 15 28 49 70 86 0.25 481597 8 18 39 48 64 83 0.24 481695 15 27 39 50 64 80 0.22 481700 0 17 44 58 80 88 0.20 481710 12 39 65 79 86 90 0.11 481715 11 26 32 44 53 69 0.36 481725 27 40 56 77 89 93 0.09 481750 7 24 46 63 83 89 0.16 481755 17 28 30 54 68 80 0.20 481768 7 21 27 44 67 85 0.26 Example 5: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in SK-BR-3 cells Gapmers from Example 4 were tested at various doses in SK-BR-3 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated with 0.02 μM, 0.1 μM, 0.5 μM, 1 μΜ. 2.5 μΜ, and μM concentrations of antisense oligonucleotide, as specified in Table 5. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real- time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 5. As illustrated in Table 5, most of the ISIS oligonucleotides were able to penetrate the cell membrane and STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

BIOL0142WO Table 5 Dose-dependent antisense inhibition of human STAT3 by free-uptake of ISIS oligonucleotide by SK-BR- 3 cells ISIS No 0.02 μM 0.1 μM 0.5 μM 1 μM 2.5 μM 10 μM IC (μM) 481374 10 18 18 16 8 25 15.9 481390 0 10 11 12 40 72 3.2 481453 14 13 27 45 58 79 1.3 481464 23 32 57 70 85 93 0.5 481475 0 0 35 49 72 88 1.0 481500 7 9 26 45 49 75 1.7 481501 0 0 4 5 53 65 2.7 481523 9 24 56 67 83 92 0.5 481525 0 17 13 15 32 68 4.4 481549 0 0 0 16 33 54 8.2 481597 1 0 11 14 22 44 10.6 481710 5 0 10 13 27 66 6.0 481725 29 45 47 39 39 63 2.6 481750 19 24 36 42 71 80 1.1 481763 30 38 51 63 81 89 0.6 481768 12 5 34 25 32 35 12.4 Example 6: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in U251-MG cells Gapmers from Example 5 were further tested at various doses in U251-MG cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated with 0.02 μM, 0.1 μM, 0.5 μM, 1 μΜ. 2.5 μΜ, and 10 μM concentrations of antisense oligonucleotide, as specified in Table 6. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 6. As illustrated in Table 6, most of the ISIS oligonucleotides were able to penetrate the cell membrane and STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 6 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by U251-MG cells ISIS No 0.02 μM 0.1 μM 0.5 μM 1 μM 2.5 μM 10 μM IC (μM) 481374 0 0 10 0 12 25 15.7 481390 0 4 10 8 16 31 13.9 BIOL0142WO 481453 4 3 15 16 20 42 11.0 481464 13 11 41 42 54 79 1.3 481475 3 13 26 37 41 67 2.6 481500 2 12 14 12 25 38 11.7 481501 0 0 2 1 14 47 10.3 481523 22 27 39 45 63 83 1.1 481525 1 1 17 17 35 60 6.3 481549 0 0 0 0 9 29 14.5 481597 3 3 12 18 18 47 10.1 481695 0 14 12 22 25 33 12.9 481710 0 0 0 0 6 23 16.8 481725 0 0 5 7 20 38 11.8 481750 4 15 18 18 17 33 13.2 481763 15 16 25 36 36 64 3.2 481768 22 16 18 22 21 37 12.2 Example 7: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in U251-MG cells ISIS 481464 and ISIS 481549, from the studies described above, were further tested at different doses in U251-MG cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated with 0.1 μM, 1 μM, 5 μM, 10 μΜ, and 20 μM concentrations of antisense oligonucleotide, as specified in Table 7. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 7. As illustrated in Table 7, both the ISIS oligonucleotides were able to penetrate the cell membrane.

Table 7 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by U251-MG cells ISIS No 0.1 μM 1 μM 5 μM 10 μM 20 μM IC (μM) 481464 0 30 69 80 79 2.3 481549 0 0 26 35 38 >20 Example 8: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in MDA-MB-231 cells BIOL0142WO ISIS 481464 and ISIS 481549 were further tested at different doses in MDA-MB-231 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated with 0.02 μM, 0.2 μM, 1.0 μM, 5.0 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 8. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 8. As illustrated in Table 8, both the ISIS oligonucleotides were able to penetrate the cell membrane and significantly reduce STAT3 mRNA levels in a dose-dependent manner.

Table 8 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by MDA-MB-231 cells ISIS No 0.02 μM 0.2 μM 1.0 μM 5.0 μM 10.0 μM IC (μM) 481464 0 25 71 85 87 0.6 481549 0 2 33 49 66 4.4 Example 9: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in A431 cells ISIS 481464 and ISIS 481549 were further tested at different doses in A431 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated with 0.02 μM, 0.2 μM, 1.0 μM, 5.0 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 9. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 9. As illustrated in Table 9, both the ISIS oligonucleotides were able to penetrate the cell membrane and significantly reduce STAT3 mRNA levels in a dose-dependent manner.

Table 9 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by A431 cells ISIS No 0.02 μM 0.2 μM 1.0 μM 5.0 μM 10.0 μM IC (μM) 481464 79 93 98 98 98 <0.02 481549 0 38 68 82 84 0.6 BIOL0142WO Example 10: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in H460 cells ISIS 481464 and ISIS 481549 were further tested at different doses in H460 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated with 0.02 μM, 0.2 μM, 1.0 μM, 5.0 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 10. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 10. As illustrated in Table 10, both the ISIS oligonucleotides were able to penetrate the cell membrane and significantly reduce STAT3 mRNA levels in a dose-dependent manner.

Table 10 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by H460 cells ISIS No 0.02 μM 0.2 μM 1.0 μM 5.0 μM 10.0 μM IC (μM) 481464 46 89 96 97 98 0.01 481549 8 53 78 96 98 0.23 Example 11: Antisense inhibition of human STAT3 in HuVEC cells Antisense oligonucleotides were designed targeting a human STAT3 nucleic acid and were tested for their effect on human STAT3 mRNA expression in vitro. Cultured HuVEC cells at a density of ,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide.

After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS199 (forward sequence ACATGCCACTTTGGTGTTTCATAA, designated herein as SEQ ID NO: 6; reverse sequence TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as SEQ ID NO: 7; probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA, designated herein as SEQ ID NO: 8) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The chimeric antisense oligonucleotides in Table 11 were designed as 33 MOE, deoxy, and cEt gapmers. The gapmers are 16 nucleotides in length, wherein the central gap segment comprises of ten 2’-deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising three nucleosides each. Each nucleoside in the 5’-wing segment has a 2’-MOE sugar modification. Each nucleoside in the 3’-wing segment has a cEt sugar modification. The internucleoside linkages throughout BIOL0142WO each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5’- methylcytosines. The chemistry column of Table 11 presents the sugar motif of each gapmer, wherein ‘e’ indicates a 2’-MOE nucleoside, ‘k’ indicates a constrained ethyl (cEt) nucleoside, and ‘d’ indicates a 2’- deoxynucleoside.

“Human Target start site” indicates the 5’-most nucleoside to which the gapmer is targeted in the human gene sequence. “Human Target stop site” indicates the 3’-most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in Table 11 is targeted to human STAT3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2).

Table 11 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Human Human ISIS % SEQ Start Stop Sequence Chemistry No inhibition ID NO Site Site 1 16 528170 CGCAGCTCCGGAAACC e-e-e-d -k-k-k 12 471 (10) 2 17 528171 CCGCAGCTCCGGAAAC e-e-e-d -k-k-k 11 472 (10) 4 19 528172 CGCCGCAGCTCCGGAA e-e-e-d -k-k-k 10 473 (10) 20 528173 CCGCCGCAGCTCCGGA e-e-e-d -k-k-k 22 (10) 32 47 528174 ACCCCCGGCTCCCCCT e-e-e-d -k-k-k 18 (10) 475 34 49 528175 GAACCCCCGGCTCCCC e-e-e-d -k-k-k 17 (10) 50 528176 GGAACCCCCGGCTCCC e-e-e-d -k-k-k 23 (10) 477 36 51 528177 CGGAACCCCCGGCTCC e-e-e-d -k-k-k 15 (10) 38 53 528178 GTCGGAACCCCCGGCT e-e-e-d -k-k-k 21 (10) 479 39 54 528179 CGTCGGAACCCCCGGC e-e-e-d -k-k-k 19 (10) 57 72 528180 TTGTTCCCTCGGCTGC e-e-e-d -k-k-k 40 (10) 481 58 73 528181 CTTGTTCCCTCGGCTG e-e-e-d -k-k-k 28 (10) 60 75 528182 GGCTTGTTCCCTCGGC e-e-e-d -k-k-k 25 (10) 483 61 76 528183 GGGCTTGTTCCCTCGG e-e-e-d -k-k-k 34 (10) 75 90 528184 CCAGGATCCGGTTGGG e-e-e-d -k-k-k 34 (10) 485 76 91 528185 TCCAGGATCCGGTTGG e-e-e-d -k-k-k 15 9 (10) 77 92 528186 GTCCAGGATCCGGTTG e-e-e-d -k-k-k 28 (10) 486 78 93 528187 TGTCCAGGATCCGGTT e-e-e-d -k-k-k 27 (10) 79 94 528188 CTGTCCAGGATCCGGT e-e-e-d -k-k-k 33 (10) 488 81 96 528189 GCCTGTCCAGGATCCG e-e-e-d -k-k-k 63 (10) 83 98 528190 GTGCCTGTCCAGGATC e-e-e-d -k-k-k 36 (10) 490 189 204 528191 AGAGGCCGAGAGGCCG e-e-e-d -k-k-k 2 (10) 210 225 528192 GGTCCCAACTGTTTCT e-e-e-d -k-k-k 11 (10) 492 232 247 528193 GGGCCATCCTGCTAAA e-e-e-d -k-k-k 14 (10) 233 248 528194 TGGGCCATCCTGCTAA e-e-e-d -k-k-k 16 (10) 494 234 249 528195 TTGGGCCATCCTGCTA e-e-e-d -k-k-k 9 (10) 236 251 528196 CATTGGGCCATCCTGC e-e-e-d -k-k-k 39 (10) 496 237 252 528197 CCATTGGGCCATCCTG e-e-e-d -k-k-k 38 (10) 239 254 528198 TTCCATTGGGCCATCC e-e-e-d -k-k-k 19 (10) 498 BIOL0142WO 240 255 528199 ATTCCATTGGGCCATC e-e-e-d -k-k-k 27 (10) 244 259 528200 GCTGATTCCATTGGGC e-e-e-d -k-k-k 18 (10) 500 245 260 528201 AGCTGATTCCATTGGG e-e-e-d -k-k-k 20 (10) 246 261 528202 TAGCTGATTCCATTGG e-e-e-d -k-k-k 41 (10) 502 247 262 528203 GTAGCTGATTCCATTG e-e-e-d -k-k-k 37 (10) 503 250 265 528204 GCTGTAGCTGATTCCA e-e-e-d -k-k-k 83 (10) 504 251 266 528205 TGCTGTAGCTGATTCC e-e-e-d -k-k-k 72 (10) 252 267 528206 CTGCTGTAGCTGATTC e-e-e-d -k-k-k 44 506 (10) 253 268 528207 GCTGCTGTAGCTGATT e-e-e-d -k-k-k 49 507 (10) 263 278 528208 CGTGTGTCAAGCTGCT e-e-e-d -k-k-k 73 508 (10) 264 279 528209 CCGTGTGTCAAGCTGC e-e-e-d -k-k-k 81 17 (10) 265 280 528210 ACCGTGTGTCAAGCTG e-e-e-d -k-k-k 78 (10) 509 266 281 528211 TACCGTGTGTCAAGCT e-e-e-d -k-k-k 72 (10) 267 282 528212 GTACCGTGTGTCAAGC e-e-e-d -k-k-k 81 (10) 511 268 283 528213 GGTACCGTGTGTCAAG e-e-e-d -k-k-k 46 (10) 270 285 528214 CAGGTACCGTGTGTCA e-e-e-d -k-k-k 80 (10) 513 271 286 528215 CCAGGTACCGTGTGTC e-e-e-d -k-k-k 69 (10) 514 272 287 528216 TCCAGGTACCGTGTGT e-e-e-d -k-k-k 41 (10) 515 273 288 528217 CTCCAGGTACCGTGTG e-e-e-d -k-k-k 44 (10) 274 289 528218 GCTCCAGGTACCGTGT e-e-e-d -k-k-k 32 (10) 517 275 290 528219 TGCTCCAGGTACCGTG e-e-e-d -k-k-k 50 (10) 291 306 528220 GTAGAGCTGATGGAGC e-e-e-d -k-k-k 12 (10) 519 292 307 528221 TGTAGAGCTGATGGAG e-e-e-d -k-k-k 0 (10) 520 295 310 528222 CACTGTAGAGCTGATG e-e-e-d -k-k-k 0 (10) 521 297 312 528223 GTCACTGTAGAGCTGA e-e-e-d -k-k-k 44 (10) 302 317 528224 AAGCTGTCACTGTAGA e-e-e-d -k-k-k 20 (10) 523 303 318 528225 GAAGCTGTCACTGTAG e-e-e-d -k-k-k 24 (10) 307 322 528226 TTGGGAAGCTGTCACT e-e-e-d -k-k-k 35 (10) 525 308 323 528227 ATTGGGAAGCTGTCAC e-e-e-d -k-k-k 29 (10) 526 310 325 528228 CCATTGGGAAGCTGTC e-e-e-d -k-k-k 33 527 (10) 322 337 519639 ACTGCCGCAGCTCCAT e-e-e-d -k-k-k 37 19 (10) 329 344 528229 GCCAGAAACTGCCGCA e-e-e-d -k-k-k 20 (10) 528 330 345 528230 GGCCAGAAACTGCCGC e-e-e-d -k-k-k 1 (10) 331 346 528231 GGGCCAGAAACTGCCG e-e-e-d -k-k-k 1 (10) 530 345 360 528232 ACTCTCAATCCAAGGG e-e-e-d -k-k-k 14 (10) 531 346 361 528233 GACTCTCAATCCAAGG e-e-e-d -k-k-k 10 21 (10) 347 362 528234 TGACTCTCAATCCAAG e-e-e-d -k-k-k 6 (10) 351 366 528235 ATCTTGACTCTCAATC e-e-e-d -k-k-k 38 (10) 533 353 368 528236 CAATCTTGACTCTCAA e-e-e-d -k-k-k 29 (10) 354 369 528237 CCAATCTTGACTCTCA e-e-e-d -k-k-k 60 (10) 535 355 370 528238 CCCAATCTTGACTCTC e-e-e-d -k-k-k 37 (10) 536 356 371 528239 GCCCAATCTTGACTCT e-e-e-d -k-k-k 48 (10) 537 357 372 528240 TGCCCAATCTTGACTC e-e-e-d -k-k-k 40 (10) 358 373 528241 ATGCCCAATCTTGACT e-e-e-d -k-k-k 21 (10) 539 359 374 528242 TATGCCCAATCTTGAC e-e-e-d -k-k-k 27 (10) BIOL0142WO 362 377 528243 GCATATGCCCAATCTT e-e-e-d -k-k-k 16 (10) 363 378 528244 CGCATATGCCCAATCT e-e-e-d -k-k-k 50 (10) 542 367 382 528245 TGGCCGCATATGCCCA e-e-e-d -k-k-k 67 (10) 368 383 528246 CTGGCCGCATATGCCC e-e-e-d -k-k-k 47 (10) 544 369 384 528247 GCTGGCCGCATATGCC e-e-e-d -k-k-k 54 (10) 545 370 385 528248 TGCTGGCCGCATATGC e-e-e-d -k-k-k 35 (10) 546 371 386 528249 TTGCTGGCCGCATATG e-e-e-d -k-k-k 22 (10) 372 387 528250 TTTGCTGGCCGCATAT e-e-e-d -k-k-k 19 (10) 548 373 388 528251 CTTTGCTGGCCGCATA e-e-e-d -k-k-k 27 (10) 374 389 528252 TCTTTGCTGGCCGCAT e-e-e-d -k-k-k 34 (10) 550 375 390 528253 TTCTTTGCTGGCCGCA e-e-e-d -k-k-k 59 (10) 23 376 391 528254 ATTCTTTGCTGGCCGC e-e-e-d -k-k-k 63 (10) 551 378 393 528255 TGATTCTTTGCTGGCC e-e-e-d -k-k-k 30 (10) 379 394 528256 GTGATTCTTTGCTGGC e-e-e-d -k-k-k 47 (10) 553 383 398 528257 GCATGTGATTCTTTGC e-e-e-d -k-k-k 43 (10) 384 399 528258 GGCATGTGATTCTTTG e-e-e-d -k-k-k 47 (10) 555 388 403 528259 AAGTGGCATGTGATTC e-e-e-d -k-k-k 43 (10) 556 391 406 528260 CCAAAGTGGCATGTGA e-e-e-d -k-k-k 46 (10) 557 393 408 528261 CACCAAAGTGGCATGT e-e-e-d -k-k-k 32 (10) 395 410 528262 AACACCAAAGTGGCAT e-e-e-d -k-k-k 41 (10) 559 397 412 528263 GAAACACCAAAGTGGC e-e-e-d -k-k-k 69 (10) 427 442 528264 ACTGCTGGTCAATCTC e-e-e-d -k-k-k 27 (10) 561 428 443 528265 TACTGCTGGTCAATCT e-e-e-d -k-k-k 32 (10) 562 430 445 528266 TATACTGCTGGTCAAT e-e-e-d -k-k-k 27 (10) 563 431 446 528267 CTATACTGCTGGTCAA e-e-e-d -k-k-k 38 (10) 432 447 528268 GCTATACTGCTGGTCA e-e-e-d -k-k-k 58 (10) 565 433 448 528269 GGCTATACTGCTGGTC e-e-e-d -k-k-k 69 (10) 434 449 528270 CGGCTATACTGCTGGT e-e-e-d -k-k-k 73 (10) 567 435 450 528271 GCGGCTATACTGCTGG e-e-e-d -k-k-k 71 (10) 568 436 451 528272 AGCGGCTATACTGCTG e-e-e-d -k-k-k 54 (10) 569 437 452 528273 AAGCGGCTATACTGCT e-e-e-d -k-k-k 36 (10) 439 454 528274 GGAAGCGGCTATACTG e-e-e-d -k-k-k 27 (10) 571 440 455 528275 AGGAAGCGGCTATACT e-e-e-d -k-k-k 21 (10) 441 456 528276 CAGGAAGCGGCTATAC e-e-e-d -k-k-k 12 (10) 573 442 457 528277 GCAGGAAGCGGCTATA e-e-e-d -k-k-k 14 (10) 574 443 458 528278 TGCAGGAAGCGGCTAT e-e-e-d -k-k-k 21 (10) 575 444 459 528279 TTGCAGGAAGCGGCTA e-e-e-d -k-k-k 31 (10) 445 460 528280 CTTGCAGGAAGCGGCT e-e-e-d -k-k-k 44 (10) 577 463 478 528281 GATAGAGAACATTCGA e-e-e-d -k-k-k 25 (10) 464 479 528282 TGATAGAGAACATTCG e-e-e-d -k-k-k 39 (10) 579 469 484 528283 TGTGCTGATAGAGAAC e-e-e-d -k-k-k 41 (10) 580 471 486 528284 ATTGTGCTGATAGAGA e-e-e-d -k-k-k 38 (10) 581 472 487 528285 GATTGTGCTGATAGAG e-e-e-d -k-k-k 50 (10) 473 488 528286 AGATTGTGCTGATAGA e-e-e-d -k-k-k 49 (10) 583 475 490 528287 GTAGATTGTGCTGATA e-e-e-d -k-k-k 14 (10) BIOL0142WO 476 491 528288 CGTAGATTGTGCTGAT e-e-e-d -k-k-k 8 (10) 490 505 528289 ACTGCTTGATTCTTCG e-e-e-d -k-k-k 9 (10) 33 511 526 528290 CAAGATACCTGCTCTG e-e-e-d -k-k-k 48 (10) 512 527 528291 TCAAGATACCTGCTCT e-e-e-d -k-k-k 34 (10) 586 513 528 528292 CTCAAGATACCTGCTC e-e-e-d -k-k-k 19 (10) 587 514 529 528293 TCTCAAGATACCTGCT e-e-e-d -k-k-k 31 (10) 588 517 532 528294 GCTTCTCAAGATACCT e-e-e-d -k-k-k 42 (10) 519 534 528295 TGGCTTCTCAAGATAC e-e-e-d -k-k-k 37 (10) 590 522 537 528296 CATTGGCTTCTCAAGA e-e-e-d -k-k-k 11 (10) 523 538 528297 CCATTGGCTTCTCAAG e-e-e-d -k-k-k 23 (10) 592 530 545 528298 GCAATCTCCATTGGCT e-e-e-d -k-k-k 46 (10) 593 531 546 528299 GGCAATCTCCATTGGC e-e-e-d -k-k-k 37 (10) 594 532 547 528300 GGGCAATCTCCATTGG e-e-e-d -k-k-k 24 (10) 533 548 528301 CGGGCAATCTCCATTG e-e-e-d -k-k-k 15 (10) 596 534 549 528302 CCGGGCAATCTCCATT e-e-e-d -k-k-k 30 (10) 535 550 528303 TCCGGGCAATCTCCAT e-e-e-d -k-k-k 29 (10) 598 536 551 528304 ATCCGGGCAATCTCCA e-e-e-d -k-k-k 32 (10) 599 537 552 528305 AATCCGGGCAATCTCC e-e-e-d -k-k-k 32 (10) 600 538 553 528306 CAATCCGGGCAATCTC e-e-e-d -k-k-k 24 (10) 539 554 528307 ACAATCCGGGCAATCT e-e-e-d -k-k-k 21 (10) 602 540 555 528308 CACAATCCGGGCAATC e-e-e-d -k-k-k 14 (10) 541 556 528309 CCACAATCCGGGCAAT e-e-e-d -k-k-k 13 (10) 604 543 558 528310 GGCCACAATCCGGGCA e-e-e-d -k-k-k 27 (10) 605 546 561 528311 CCGGGCCACAATCCGG e-e-e-d -k-k-k 27 (10) 606 547 562 528312 ACCGGGCCACAATCCG e-e-e-d -k-k-k 58 (10) 548 563 528313 CACCGGGCCACAATCC e-e-e-d -k-k-k 25 (10) 608 549 564 528314 GCACCGGGCCACAATC e-e-e-d -k-k-k 18 (10) 550 565 528315 GGCACCGGGCCACAAT e-e-e-d -k-k-k 33 (10) 610 551 566 528316 AGGCACCGGGCCACAA e-e-e-d -k-k-k 42 (10) 611 558 573 528317 TTCCCACAGGCACCGG e-e-e-d -k-k-k 47 (10) 612 586 601 528318 TGGCTGCAGTCTGTAG e-e-e-d -k-k-k 12 (10) 592 607 528319 CCGCAGTGGCTGCAGT e-e-e-d -k-k-k 10 (10) 614 599 614 528320 TGCTGGGCCGCAGTGG e-e-e-d -k-k-k 14 (10) 601 616 528321 CTTGCTGGGCCGCAGT e-e-e-d -k-k-k 0 (10) 616 603 618 528322 CCCTTGCTGGGCCGCA e-e-e-d -k-k-k 6 (10) 617 604 619 528323 CCCCTTGCTGGGCCGC e-e-e-d -k-k-k 21 (10) 618 605 620 528324 CCCCCTTGCTGGGCCG e-e-e-d -k-k-k 8 (10) 608 623 528325 TGGCCCCCTTGCTGGG e-e-e-d -k-k-k 0 (10) 620 615 630 528326 GTTGGCCTGGCCCCCT e-e-e-d -k-k-k 31 (10) 616 631 528327 GGTTGGCCTGGCCCCC e-e-e-d -k-k-k 47 (10) 622 617 632 528328 TGGTTGGCCTGGCCCC e-e-e-d -k-k-k 36 (10) 623 646 661 528329 GCTTCTCCGTCACCAC e-e-e-d -k-k-k 28 (10) 624 647 662 528330 TGCTTCTCCGTCACCA e-e-e-d -k-k-k 22 (10) 649 664 528331 GCTGCTTCTCCGTCAC e-e-e-d -k-k-k 35 (10) 626 667 682 528332 GGTGCTGCTCCAGCAT e-e-e-d -k-k-k 21 (10) BIOL0142WO 678 693 528333 GACATCCTGAAGGTGC e-e-e-d -k-k-k 0 (10) 682 697 528334 TCCGGACATCCTGAAG e-e-e-d -k-k-k 1 (10) 629 683 698 528335 TTCCGGACATCCTGAA e-e-e-d -k-k-k 0 (10) 684 699 528336 CTTCCGGACATCCTGA e-e-e-d -k-k-k 0 (10) 631 685 700 528337 TCTTCCGGACATCCTG e-e-e-d -k-k-k 0 (10) 632 686 701 528338 CTCTTCCGGACATCCT e-e-e-d -k-k-k 19 (10) 633 687 702 528339 TCTCTTCCGGACATCC e-e-e-d -k-k-k 21 (10) 688 703 528340 CTCTCTTCCGGACATC e-e-e-d -k-k-k 17 (10) 635 689 704 528341 ACTCTCTTCCGGACAT e-e-e-d -k-k-k 37 (10) 727 742 528342 GATTCTCTACCACTTT e-e-e-d -k-k-k 33 (10) 637 730 745 528343 GGAGATTCTCTACCAC e-e-e-d -k-k-k 40 (10) 53 731 746 528344 TGGAGATTCTCTACCA e-e-e-d -k-k-k 32 (10) 638 732 747 528345 CTGGAGATTCTCTACC e-e-e-d -k-k-k 18 (10) 733 748 528346 CCTGGAGATTCTCTAC e-e-e-d -k-k-k 12 (10) 640 738 753 528347 GTCATCCTGGAGATTC e-e-e-d -k-k-k 54 (10) 764 779 528348 TTGAGGGTTTTATAGT e-e-e-d -k-k-k 0 (10) 642 775 790 528349 CTCCTTGACTCTTGAG e-e-e-d -k-k-k 21 (10) 643 781 796 528350 GCATGTCTCCTTGACT e-e-e-d -k-k-k 29 (10) 644 782 797 528351 TGCATGTCTCCTTGAC e-e-e-d -k-k-k 30 (10) 783 798 528352 TTGCATGTCTCCTTGA e-e-e-d -k-k-k 17 (10) 646 787 802 528353 GATCTTGCATGTCTCC e-e-e-d -k-k-k 61 (10) 788 803 518346 AGATCTTGCATGTCTC e-e-e-d -k-k-k 36 (10) 57 790 805 528354 TCAGATCTTGCATGTC e-e-e-d -k-k-k 43 (10) 648 792 807 528355 ATTCAGATCTTGCATG e-e-e-d -k-k-k 9 (10) 649 794 809 528356 CCATTCAGATCTTGCA e-e-e-d -k-k-k 37 (10) 795 810 528357 TCCATTCAGATCTTGC e-e-e-d -k-k-k 55 (10) 651 796 811 528358 TTCCATTCAGATCTTG e-e-e-d -k-k-k 17 (10) 803 818 528359 TGGTTGTTTCCATTCA e-e-e-d -k-k-k 33 (10) 653 804 819 528360 CTGGTTGTTTCCATTC e-e-e-d -k-k-k 18 (10) 654 806 821 528361 GACTGGTTGTTTCCAT e-e-e-d -k-k-k 23 (10) 655 807 822 528362 TGACTGGTTGTTTCCA e-e-e-d -k-k-k 33 (10) 813 828 528363 GGTCACTGACTGGTTG e-e-e-d -k-k-k 43 (10) 657 814 829 528364 TGGTCACTGACTGGTT e-e-e-d -k-k-k 62 (10) 848 863 528365 GTGAGCATCTGTTCCA e-e-e-d -k-k-k 41 (10) 659 852 867 528366 CGCAGTGAGCATCTGT e-e-e-d -k-k-k 0 (10) 660 853 868 528367 GCGCAGTGAGCATCTG e-e-e-d -k-k-k 0 (10) 661 854 869 528368 AGCGCAGTGAGCATCT e-e-e-d -k-k-k 7 (10) 855 870 528369 CAGCGCAGTGAGCATC e-e-e-d -k-k-k 6 (10) 663 857 872 528370 TCCAGCGCAGTGAGCA e-e-e-d -k-k-k 12 (10) 858 873 528371 GTCCAGCGCAGTGAGC e-e-e-d -k-k-k 11 (10) 665 859 874 528372 GGTCCAGCGCAGTGAG e-e-e-d -k-k-k 8 (10) 666 860 875 528373 TGGTCCAGCGCAGTGA e-e-e-d -k-k-k 12 (10) 667 862 877 528374 TCTGGTCCAGCGCAGT e-e-e-d -k-k-k 9 (10) 863 878 528375 ATCTGGTCCAGCGCAG e-e-e-d -k-k-k 8 (10) 669 864 879 528376 CATCTGGTCCAGCGCA e-e-e-d -k-k-k 0 (10) BIOL0142WO 865 880 528377 GCATCTGGTCCAGCGC e-e-e-d -k-k-k 28 (10) 867 882 528378 CCGCATCTGGTCCAGC e-e-e-d -k-k-k 72 (10) 672 868 883 528379 TCCGCATCTGGTCCAG e-e-e-d -k-k-k 43 (10) 869 884 528380 CTCCGCATCTGGTCCA e-e-e-d -k-k-k 34 (10) 673 870 885 528381 TCTCCGCATCTGGTCC e-e-e-d -k-k-k 42 (10) 674 871 886 528382 TTCTCCGCATCTGGTC e-e-e-d -k-k-k 37 (10) 675 872 887 528383 CTTCTCCGCATCTGGT e-e-e-d -k-k-k 23 (10) 873 888 528384 GCTTCTCCGCATCTGG e-e-e-d -k-k-k 36 (10) 677 875 890 528385 ATGCTTCTCCGCATCT e-e-e-d -k-k-k 45 (10) 876 891 528386 GATGCTTCTCCGCATC e-e-e-d -k-k-k 14 (10) 679 877 892 528387 CGATGCTTCTCCGCAT e-e-e-d -k-k-k 25 (10) 680 878 893 528388 ACGATGCTTCTCCGCA e-e-e-d -k-k-k 39 (10) 681 879 894 528389 CACGATGCTTCTCCGC e-e-e-d -k-k-k 46 (10) 880 895 528390 TCACGATGCTTCTCCG e-e-e-d -k-k-k 17 (10) 683 881 896 528391 CTCACGATGCTTCTCC e-e-e-d -k-k-k 20 (10) 882 897 528392 ACTCACGATGCTTCTC e-e-e-d -k-k-k 16 (10) 685 883 898 528393 CACTCACGATGCTTCT e-e-e-d -k-k-k 39 (10) 686 885 900 528394 CTCACTCACGATGCTT e-e-e-d -k-k-k 45 (10) 687 886 901 528395 GCTCACTCACGATGCT e-e-e-d -k-k-k 37 (10) 888 903 528396 CAGCTCACTCACGATG e-e-e-d -k-k-k 24 (10) 689 889 904 528397 CCAGCTCACTCACGAT e-e-e-d -k-k-k 25 (10) 890 905 528398 GCCAGCTCACTCACGA e-e-e-d -k-k-k 18 (10) 691 891 906 528399 CGCCAGCTCACTCACG e-e-e-d -k-k-k 4 (10) 692 1068 1083 528477 AATTTGTTGACGGGTC e-e-e-d -k-k-k 37 (10) 693 1069 1084 528478 TAATTTGTTGACGGGT e-e-e-d -k-k-k 35 (10) 1070 1085 528479 TTAATTTGTTGACGGG e-e-e-d -k-k-k 40 (10) 695 1072 1087 528480 TCTTAATTTGTTGACG e-e-e-d -k-k-k 6 (10) 1087 1102 528481 GCAACTCCTCCAGTTT e-e-e-d -k-k-k 42 (10) 697 1088 1103 528482 TGCAACTCCTCCAGTT e-e-e-d -k-k-k 28 (10) 698 1094 1109 528483 TTTTGCTGCAACTCCT e-e-e-d -k-k-k 49 (10) 699 1095 1110 528484 TTTTTGCTGCAACTCC e-e-e-d -k-k-k 58 (10) 1114 1129 528485 GGTCCCCTTTGTAGGA e-e-e-d -k-k-k 35 (10) 701 1115 1130 528486 GGGTCCCCTTTGTAGG e-e-e-d -k-k-k 31 (10) 1129 1144 528487 GGTGCTGTACAATGGG e-e-e-d -k-k-k 61 (10) 703 1130 1145 528488 CGGTGCTGTACAATGG e-e-e-d -k-k-k 61 (10) 704 1131 1146 528489 CCGGTGCTGTACAATG e-e-e-d -k-k-k 37 (10) 705 1132 1147 528490 GCCGGTGCTGTACAAT e-e-e-d -k-k-k 33 (10) 1133 1148 528491 GGCCGGTGCTGTACAA e-e-e-d -k-k-k 39 (10) 707 1134 1149 528492 CGGCCGGTGCTGTACA e-e-e-d -k-k-k 38 (10) 1136 1151 528493 ATCGGCCGGTGCTGTA e-e-e-d -k-k-k 29 (10) 709 1137 1152 528494 CATCGGCCGGTGCTGT e-e-e-d -k-k-k 43 (10) 710 1138 1153 528495 GCATCGGCCGGTGCTG e-e-e-d -k-k-k 41 (10) 711 1139 1154 528496 AGCATCGGCCGGTGCT e-e-e-d -k-k-k 18 (10) 1140 1155 528497 CAGCATCGGCCGGTGC e-e-e-d -k-k-k 15 (10) 713 1141 1156 528498 CCAGCATCGGCCGGTG e-e-e-d -k-k-k 39 (10) BIOL0142WO 1142 1157 528499 TCCAGCATCGGCCGGT e-e-e-d -k-k-k 50 (10) 1144 1159 528500 CCTCCAGCATCGGCCG e-e-e-d -k-k-k 58 (10) 716 1146 1161 528501 CTCCTCCAGCATCGGC e-e-e-d -k-k-k 67 (10) 1147 1162 528502 TCTCCTCCAGCATCGG e-e-e-d -k-k-k 76 (10) 718 1153 1168 528503 CGATTCTCTCCTCCAG e-e-e-d -k-k-k 68 (10) 719 1154 1169 528504 ACGATTCTCTCCTCCA e-e-e-d -k-k-k 69 (10) 720 1155 1170 528505 CACGATTCTCTCCTCC e-e-e-d -k-k-k 68 (10) 1156 1171 528506 CCACGATTCTCTCCTC e-e-e-d -k-k-k 45 (10) 722 1157 1172 528507 TCCACGATTCTCTCCT e-e-e-d -k-k-k 42 (10) 1158 1173 528508 CTCCACGATTCTCTCC e-e-e-d -k-k-k 41 (10) 724 1159 1174 528509 GCTCCACGATTCTCTC e-e-e-d -k-k-k 32 (10) 725 1160 1175 528510 AGCTCCACGATTCTCT e-e-e-d -k-k-k 7 (10) 726 1161 1176 528511 CAGCTCCACGATTCTC e-e-e-d -k-k-k 5 (10) 1162 1177 528512 ACAGCTCCACGATTCT e-e-e-d -k-k-k 0 (10) 728 1163 1178 528513 AACAGCTCCACGATTC e-e-e-d -k-k-k 8 (10) 1184 1199 528514 GCACTTTTCATTAAGT e-e-e-d -k-k-k 14 (10) 730 1185 1200 528515 GGCACTTTTCATTAAG e-e-e-d -k-k-k 15 (10) 731 1199 1214 528516 CGCTCCACCACAAAGG e-e-e-d -k-k-k 46 (10) 732 1205 1220 528517 GGCTGCCGCTCCACCA e-e-e-d -k-k-k 55 (10) 1206 1221 528518 GGGCTGCCGCTCCACC e-e-e-d -k-k-k 80 (10) 734 1207 1222 528519 AGGGCTGCCGCTCCAC e-e-e-d -k-k-k 61 (10) 1208 1223 528520 CAGGGCTGCCGCTCCA e-e-e-d -k-k-k 63 (10) 736 1211 1226 528521 ATGCAGGGCTGCCGCT e-e-e-d -k-k-k 37 (10) 737 1212 1227 528522 CATGCAGGGCTGCCGC e-e-e-d -k-k-k 38 (10) 738 1221 1236 528523 ATGCATGGGCATGCAG e-e-e-d -k-k-k 26 (10) 1222 1237 528524 GATGCATGGGCATGCA e-e-e-d -k-k-k 42 (10) 740 1223 1238 528525 GGATGCATGGGCATGC e-e-e-d -k-k-k 43 (10) 1252 1267 528526 CGCCGGTCTTGATGAC e-e-e-d -k-k-k 11 (10) 742 1253 1268 528527 ACGCCGGTCTTGATGA e-e-e-d -k-k-k 0 (10) 743 1265 1280 528528 GTAGTGAACTGGACGC e-e-e-d -k-k-k 10 (10) 744 1284 1299 528529 GACCAGCAACCTGACT e-e-e-d -k-k-k 22 (10) 1285 1300 528530 TGACCAGCAACCTGAC e-e-e-d -k-k-k 31 (10) 746 1288 1303 528531 ATTTGACCAGCAACCT e-e-e-d -k-k-k 48 (10) 1289 1304 528532 AATTTGACCAGCAACC e-e-e-d -k-k-k 22 (10) 748 1290 1305 528533 GAATTTGACCAGCAAC e-e-e-d -k-k-k 11 (10) 749 1293 1308 528534 AGGGAATTTGACCAGC e-e-e-d -k-k-k 67 (10) 750 1294 1309 528535 CAGGGAATTTGACCAG e-e-e-d -k-k-k 50 (10) 1295 1310 528536 TCAGGGAATTTGACCA e-e-e-d -k-k-k 38 (10) 752 1296 1311 528537 CTCAGGGAATTTGACC e-e-e-d -k-k-k 17 (10) 1336 1351 528539 CTTTGTCAATGCACAC e-e-e-d -k-k-k 67 (10) 754 1338 1353 528540 GTCTTTGTCAATGCAC e-e-e-d -k-k-k 61 (10) 755 1339 1354 528541 AGTCTTTGTCAATGCA e-e-e-d -k-k-k 65 (10) 756 1343 1358 528542 CCAGAGTCTTTGTCAA e-e-e-d -k-k-k 10 (10) 1345 1360 528543 CCCCAGAGTCTTTGTC e-e-e-d -k-k-k 7 (10) 758 1371 1386 528544 CCGGGATCCTCTGAGA e-e-e-d -k-k-k 12 (10) BIOL0142WO 1372 1387 528545 TCCGGGATCCTCTGAG e-e-e-d -k-k-k 11 (10) 1373 1388 528546 TTCCGGGATCCTCTGA e-e-e-d -k-k-k 7 (10) 761 1374 1389 528547 TTTCCGGGATCCTCTG e-e-e-d -k-k-k 14 (10) 1375 1390 528548 ATTTCCGGGATCCTCT e-e-e-d -k-k-k 14 (10) 763 1376 1391 528549 AATTTCCGGGATCCTC e-e-e-d -k-k-k 19 (10) 764 1377 1392 528550 AAATTTCCGGGATCCT e-e-e-d -k-k-k 14 (10) 765 1379 1394 528551 TTAAATTTCCGGGATC e-e-e-d -k-k-k 1 (10) 1380 1395 528552 GTTAAATTTCCGGGAT e-e-e-d -k-k-k 9 (10) 767 1381 1396 528553 TGTTAAATTTCCGGGA e-e-e-d -k-k-k 0 (10) 1382 1397 528554 ATGTTAAATTTCCGGG e-e-e-d -k-k-k 12 (10) 769 1384 1399 528555 GAATGTTAAATTTCCG e-e-e-d -k-k-k 13 (10) 770 1392 1407 528556 TGTGCCCAGAATGTTA e-e-e-d -k-k-k 18 (10) 771 1435 1450 528557 GGCTGCCGTTGTTGGA e-e-e-d -k-k-k 48 (10) 1436 1451 528558 AGGCTGCCGTTGTTGG e-e-e-d -k-k-k 38 (10) 773 1437 1452 528559 GAGGCTGCCGTTGTTG e-e-e-d -k-k-k 24 98 (10) 1438 1453 528560 AGAGGCTGCCGTTGTT e-e-e-d -k-k-k 27 (10) 774 1439 1454 528561 GAGAGGCTGCCGTTGT e-e-e-d -k-k-k 10 (10) 775 1440 1455 528562 AGAGAGGCTGCCGTTG e-e-e-d -k-k-k 17 (10) 776 1441 1456 528563 CAGAGAGGCTGCCGTT e-e-e-d -k-k-k 27 (10) 1461 1476 528564 GGTCAAGTGTTTGAAT e-e-e-d -k-k-k 7 (10) 778 1471 1486 528565 GCTCCCTCAGGGTCAA e-e-e-d -k-k-k 48 (10) 1496 1511 528566 GCTCGGCCCCCATTCC e-e-e-d -k-k-k 42 (10) 780 1497 1512 528567 GGCTCGGCCCCCATTC e-e-e-d -k-k-k 45 (10) 781 1498 1513 528568 TGGCTCGGCCCCCATT e-e-e-d -k-k-k 34 (10) 782 1499 1514 528569 TTGGCTCGGCCCCCAT e-e-e-d -k-k-k 49 (10) 1517 1532 528570 ATCAGGGAAGCATCAC e-e-e-d -k-k-k 22 (10) 104 1519 1534 528571 CAATCAGGGAAGCATC e-e-e-d -k-k-k 13 (10) 1523 1538 528572 GTCACAATCAGGGAAG e-e-e-d -k-k-k 30 (10) 785 1525 1540 528573 CAGTCACAATCAGGGA e-e-e-d -k-k-k 27 (10) 786 1526 1541 528574 TCAGTCACAATCAGGG e-e-e-d -k-k-k 51 (10) 787 1529 1544 528575 TCCTCAGTCACAATCA e-e-e-d -k-k-k 14 (10) 1537 1552 528576 GGTGCAGCTCCTCAGT e-e-e-d -k-k-k 28 (10) 789 1543 1558 528577 TGATCAGGTGCAGCTC e-e-e-d -k-k-k 30 (10) 1544 1559 528578 GTGATCAGGTGCAGCT e-e-e-d -k-k-k 36 (10) 791 1545 1560 528579 GGTGATCAGGTGCAGC e-e-e-d -k-k-k 39 (10) 792 1576 1591 528580 TGAGGCCTTGGTGATA e-e-e-d -k-k-k 10 (10) 793 1578 1593 528581 CTTGAGGCCTTGGTGA e-e-e-d -k-k-k 5 (10) 1579 1594 528582 TCTTGAGGCCTTGGTG e-e-e-d -k-k-k 15 (10) 110 1580 1595 528583 ATCTTGAGGCCTTGGT e-e-e-d -k-k-k 5 (10) 1581 1596 528584 AATCTTGAGGCCTTGG e-e-e-d -k-k-k 15 (10) 796 1582 1597 528585 CAATCTTGAGGCCTTG e-e-e-d -k-k-k 7 (10) 797 1583 1598 528586 TCAATCTTGAGGCCTT e-e-e-d -k-k-k 9 (10) 798 1584 1599 528587 GTCAATCTTGAGGCCT e-e-e-d -k-k-k 25 (10) 1585 1600 528588 GGTCAATCTTGAGGCC e-e-e-d -k-k-k 26 (10) 800 1586 1601 528589 AGGTCAATCTTGAGGC e-e-e-d -k-k-k 31 (10) BIOL0142WO 1587 1602 528590 TAGGTCAATCTTGAGG e-e-e-d -k-k-k 27 (10) 1588 1603 528591 CTAGGTCAATCTTGAG e-e-e-d -k-k-k 24 (10) 803 1590 1605 528592 CTCTAGGTCAATCTTG e-e-e-d -k-k-k 33 (10) 1592 1607 528593 GTCTCTAGGTCAATCT e-e-e-d -k-k-k 30 (10) 805 1594 1609 528594 GGGTCTCTAGGTCAAT e-e-e-d -k-k-k 25 (10) 806 1595 1610 528595 TGGGTCTCTAGGTCAA e-e-e-d -k-k-k 28 (10) 807 1596 1611 528596 GTGGGTCTCTAGGTCA e-e-e-d -k-k-k 34 (10) 1597 1612 528597 AGTGGGTCTCTAGGTC e-e-e-d -k-k-k 19 (10) 809 1599 1614 528598 GGAGTGGGTCTCTAGG e-e-e-d -k-k-k 31 (10) 1600 1615 528599 AGGAGTGGGTCTCTAG e-e-e-d -k-k-k 10 (10) 810 1601 1616 528600 AAGGAGTGGGTCTCTA e-e-e-d -k-k-k 14 (10) 811 1602 1617 528601 CAAGGAGTGGGTCTCT e-e-e-d -k-k-k 11 (10) 812 1609 1624 528602 CAACTGGCAAGGAGTG e-e-e-d -k-k-k 17 (10) 1629 1644 528603 ACAGATGTTGGAGATC e-e-e-d -k-k-k 8 (10) 814 1632 1647 528604 CTGACAGATGTTGGAG e-e-e-d -k-k-k 11 (10) 1633 1648 528605 TCTGACAGATGTTGGA e-e-e-d -k-k-k 25 119 (10) 1650 1665 528606 CGCCCAGGCATTTGGC e-e-e-d -k-k-k 18 (10) 816 1651 1666 528607 ACGCCCAGGCATTTGG e-e-e-d -k-k-k 36 (10) 817 1677 1692 528608 GGTCAGCATGTTGTAC e-e-e-d -k-k-k 11 (10) 1678 1693 528609 TGGTCAGCATGTTGTA e-e-e-d -k-k-k 9 (10) 819 1680 1695 528610 GTTGGTCAGCATGTTG e-e-e-d -k-k-k 19 (10) 1682 1697 528611 TTGTTGGTCAGCATGT e-e-e-d -k-k-k 27 (10) 821 1711 1726 528612 GCTTGGTAAAAAAGTT e-e-e-d -k-k-k 0 (10) 822 1712 1727 528613 GGCTTGGTAAAAAAGT e-e-e-d -k-k-k 0 (10) 823 1713 1728 528614 GGGCTTGGTAAAAAAG e-e-e-d -k-k-k 0 (10) 1736 1751 528615 ACTTGATCCCAGGTTC e-e-e-d -k-k-k 26 (10) 825 1741 1756 528616 CGGCCACTTGATCCCA e-e-e-d -k-k-k 41 (10) 1742 1757 528617 TCGGCCACTTGATCCC e-e-e-d -k-k-k 40 (10) 827 1743 1758 528618 CTCGGCCACTTGATCC e-e-e-d -k-k-k 27 (10) 828 1744 1759 528619 CCTCGGCCACTTGATC e-e-e-d -k-k-k 10 (10) 829 1745 1760 528620 ACCTCGGCCACTTGAT e-e-e-d -k-k-k 16 (10) 1746 1761 528621 GACCTCGGCCACTTGA e-e-e-d -k-k-k 31 (10) 831 1747 1762 528622 GGACCTCGGCCACTTG e-e-e-d -k-k-k 59 (10) 1748 1763 528623 AGGACCTCGGCCACTT e-e-e-d -k-k-k 49 (10) 833 1749 1764 528624 CAGGACCTCGGCCACT e-e-e-d -k-k-k 32 (10) 834 1753 1768 528625 AGCTCAGGACCTCGGC e-e-e-d -k-k-k 28 (10) 835 1754 1769 528626 CAGCTCAGGACCTCGG e-e-e-d -k-k-k 58 (10) 1755 1770 528627 CCAGCTCAGGACCTCG e-e-e-d -k-k-k 56 (10) 837 1778 1793 528628 CGCTTGGTGGTGGAGG e-e-e-d -k-k-k 15 (10) 1779 1794 528629 TCGCTTGGTGGTGGAG e-e-e-d -k-k-k 9 (10) 839 1780 1795 528630 CTCGCTTGGTGGTGGA e-e-e-d -k-k-k 14 (10) 127 1781 1796 528631 CCTCGCTTGGTGGTGG e-e-e-d -k-k-k 26 (10) 840 1782 1797 528632 TCCTCGCTTGGTGGTG e-e-e-d -k-k-k 24 (10) 1783 1798 528633 GTCCTCGCTTGGTGGT e-e-e-d -k-k-k 40 (10) 842 1784 1799 528634 AGTCCTCGCTTGGTGG e-e-e-d -k-k-k 38 (10) BIOL0142WO 1785 1800 528635 CAGTCCTCGCTTGGTG e-e-e-d -k-k-k 20 (10) 1786 1801 528636 TCAGTCCTCGCTTGGT e-e-e-d -k-k-k 23 (10) 845 1787 1802 528637 CTCAGTCCTCGCTTGG e-e-e-d -k-k-k 33 (10) 1788 1803 528638 GCTCAGTCCTCGCTTG e-e-e-d -k-k-k 15 (10) 847 1789 1804 528639 TGCTCAGTCCTCGCTT e-e-e-d -k-k-k 15 (10) 848 1791 1806 528640 GATGCTCAGTCCTCGC e-e-e-d -k-k-k 43 (10) 849 1792 1807 528641 CGATGCTCAGTCCTCG e-e-e-d -k-k-k 46 (10) 1793 1808 528642 TCGATGCTCAGTCCTC e-e-e-d -k-k-k 39 (10) 851 1794 1809 528643 CTCGATGCTCAGTCCT e-e-e-d -k-k-k 32 (10) 1795 1810 528644 GCTCGATGCTCAGTCC e-e-e-d -k-k-k 43 (10) 129 1796 1811 528645 TGCTCGATGCTCAGTC e-e-e-d -k-k-k 22 (10) 853 1797 1812 528646 CTGCTCGATGCTCAGT e-e-e-d -k-k-k 38 (10) 854 1799 1814 528647 AGCTGCTCGATGCTCA e-e-e-d -k-k-k 40 (10) 1800 1815 528648 CAGCTGCTCGATGCTC e-e-e-d -k-k-k 39 (10) 856 1802 1817 528649 GTCAGCTGCTCGATGC e-e-e-d -k-k-k 32 (10) 1803 1818 528650 AGTCAGCTGCTCGATG e-e-e-d -k-k-k 10 (10) 858 1804 1819 528651 TAGTCAGCTGCTCGAT e-e-e-d -k-k-k 4 (10) 859 1805 1820 528652 GTAGTCAGCTGCTCGA e-e-e-d -k-k-k 17 (10) 860 1806 1821 528653 TGTAGTCAGCTGCTCG e-e-e-d -k-k-k 28 (10) 1807 1822 528654 GTGTAGTCAGCTGCTC e-e-e-d -k-k-k 31 (10) 862 1808 1823 528655 AGTGTAGTCAGCTGCT e-e-e-d -k-k-k 30 (10) 1809 1824 528656 CAGTGTAGTCAGCTGC e-e-e-d -k-k-k 30 (10) 864 1810 1825 528657 CCAGTGTAGTCAGCTG e-e-e-d -k-k-k 23 (10) 865 1811 1826 528658 GCCAGTGTAGTCAGCT e-e-e-d -k-k-k 30 (10) 866 1832 1847 528659 CCAGGTCCCAAGAGTT e-e-e-d -k-k-k 12 (10) 1852 1867 528660 GACACCCTGAATAATT e-e-e-d -k-k-k 10 (10) 868 1853 1868 528661 TGACACCCTGAATAAT e-e-e-d -k-k-k 10 (10) 1856 1871 528662 ATCTGACACCCTGAAT e-e-e-d -k-k-k 12 (10) 870 1857 1872 528663 GATCTGACACCCTGAA e-e-e-d -k-k-k 22 (10) 871 1859 1874 528664 GTGATCTGACACCCTG e-e-e-d -k-k-k 61 (10) 872 1861 1876 528665 ATGTGATCTGACACCC e-e-e-d -k-k-k 36 (10) 1865 1880 528666 GCCCATGTGATCTGAC e-e-e-d -k-k-k 46 (10) 874 1866 1881 528667 AGCCCATGTGATCTGA e-e-e-d -k-k-k 36 (10) 1867 1882 528668 TAGCCCATGTGATCTG e-e-e-d -k-k-k 44 (10) 875 1869 1884 528669 TTTAGCCCATGTGATC e-e-e-d -k-k-k 12 (10) 876 1907 1922 528670 AAGGAGAAGCCCTTGC e-e-e-d -k-k-k 35 (10) 877 1925 1940 528671 TTGTCCAGCCAGACCC e-e-e-d -k-k-k 40 (10) 1926 1941 528672 ATTGTCCAGCCAGACC e-e-e-d -k-k-k 36 (10) 879 1927 1942 528673 TATTGTCCAGCCAGAC e-e-e-d -k-k-k 23 (10) 1928 1943 528674 ATATTGTCCAGCCAGA e-e-e-d -k-k-k 24 (10) 881 1929 1944 528675 GATATTGTCCAGCCAG e-e-e-d -k-k-k 52 (10) 882 1931 1946 528676 ATGATATTGTCCAGCC e-e-e-d -k-k-k 41 (10) 883 1933 1948 528677 CAATGATATTGTCCAG e-e-e-d -k-k-k 23 (10) 1935 1950 528678 GTCAATGATATTGTCC e-e-e-d -k-k-k 32 (10) 885 1936 1951 528679 GGTCAATGATATTGTC e-e-e-d -k-k-k 26 (10) BIOL0142WO 1941 1956 528680 CACAAGGTCAATGATA e-e-e-d -k-k-k 5 (10) 1942 1957 528681 TCACAAGGTCAATGAT e-e-e-d -k-k-k 9 (10) 888 1948 1963 518340 ACTTTTTCACAAGGTC e-e-e-d -k-k-k 52 (10) 1950 1965 528682 GTACTTTTTCACAAGG e-e-e-d -k-k-k 21 (10) 889 1954 1969 528683 GGATGTACTTTTTCAC e-e-e-d -k-k-k 0 (10) 890 1958 1973 528684 GCCAGGATGTACTTTT e-e-e-d -k-k-k 0 (10) 891 1962 1977 528685 AAGGGCCAGGATGTAC e-e-e-d -k-k-k 0 (10) 1963 1978 528686 AAAGGGCCAGGATGTA e-e-e-d -k-k-k 0 (10) 893 2004 2019 528687 CCGCTCCTTACTGATA e-e-e-d -k-k-k 21 (10) 2010 2025 528688 CCGCTCCCGCTCCTTA e-e-e-d -k-k-k 32 (10) 895 2014 2029 528689 TGGCCCGCTCCCGCTC e-e-e-d -k-k-k 52 (10) 896 2015 2030 528690 ATGGCCCGCTCCCGCT e-e-e-d -k-k-k 41 (10) 897 2017 2032 528691 AGATGGCCCGCTCCCG e-e-e-d -k-k-k 51 (10) 2018 2033 528692 AAGATGGCCCGCTCCC e-e-e-d -k-k-k 45 (10) 899 2019 2034 528693 CAAGATGGCCCGCTCC e-e-e-d -k-k-k 46 (10) 2020 2035 528694 TCAAGATGGCCCGCTC e-e-e-d -k-k-k 27 (10) 901 2022 2037 528695 GCTCAAGATGGCCCGC e-e-e-d -k-k-k 54 (10) 902 2023 2038 528696 TGCTCAAGATGGCCCG e-e-e-d -k-k-k 46 (10) 903 2024 2039 528697 GTGCTCAAGATGGCCC e-e-e-d -k-k-k 60 (10) 2041 2056 528698 AGGTGCCTGGAGGCTT e-e-e-d -k-k-k 17 (10) 905 2093 2108 528699 CAAGTGAAAGTGACGC e-e-e-d -k-k-k 2 (10) 2094 2109 528700 CCAAGTGAAAGTGACG e-e-e-d -k-k-k 13 (10) 906 2095 2110 528701 CCCAAGTGAAAGTGAC e-e-e-d -k-k-k 14 (10) 907 2128 2143 528702 GGATCTGGGTCTTACC e-e-e-d -k-k-k 22 (10) 908 2129 2144 528703 TGGATCTGGGTCTTAC e-e-e-d -k-k-k 22 (10) 2131 2146 528704 ACTGGATCTGGGTCTT e-e-e-d -k-k-k 21 165 (10) 2133 2148 528705 GGACTGGATCTGGGTC e-e-e-d -k-k-k 38 (10) 2138 2153 528706 TCCACGGACTGGATCT e-e-e-d -k-k-k 13 (10) 911 2139 2154 528707 TTCCACGGACTGGATC e-e-e-d -k-k-k 19 (10) 912 2140 2155 528708 GTTCCACGGACTGGAT e-e-e-d -k-k-k 2 (10) 913 2141 2156 528709 GGTTCCACGGACTGGA e-e-e-d -k-k-k 42 (10) 2142 2157 528710 TGGTTCCACGGACTGG e-e-e-d -k-k-k 63 (10) 915 2143 2158 528711 ATGGTTCCACGGACTG e-e-e-d -k-k-k 62 (10) 2144 2159 528712 TATGGTTCCACGGACT e-e-e-d -k-k-k 35 (10) 917 2146 2161 528713 TGTATGGTTCCACGGA e-e-e-d -k-k-k 40 (10) 918 2147 2162 528714 GTGTATGGTTCCACGG e-e-e-d -k-k-k 48 (10) 919 2193 2208 528715 GCCCATGATGATTTCA e-e-e-d -k-k-k 36 (10) 2194 2209 528716 AGCCCATGATGATTTC e-e-e-d -k-k-k 25 (10) 921 2195 2210 528717 TAGCCCATGATGATTT e-e-e-d -k-k-k 27 (10) 2196 2211 528718 ATAGCCCATGATGATT e-e-e-d -k-k-k 19 (10) 923 2197 2212 528719 TATAGCCCATGATGAT e-e-e-d -k-k-k 14 (10) 924 2198 2213 528720 TTATAGCCCATGATGA e-e-e-d -k-k-k 14 (10) 925 2199 2214 528721 CTTATAGCCCATGATG e-e-e-d -k-k-k 21 (10) 2200 2215 528722 TCTTATAGCCCATGAT e-e-e-d -k-k-k 0 (10) 927 2201 2216 528723 ATCTTATAGCCCATGA e-e-e-d -k-k-k 17 (10) BIOL0142WO 2202 2217 528724 GATCTTATAGCCCATG e-e-e-d -k-k-k 35 (10) 2203 2218 528725 TGATCTTATAGCCCAT e-e-e-d -k-k-k 45 (10) 930 2204 2219 528726 ATGATCTTATAGCCCA e-e-e-d -k-k-k 67 (10) 2205 2220 528727 CATGATCTTATAGCCC e-e-e-d -k-k-k 45 (10) 932 2206 2221 528728 CCATGATCTTATAGCC e-e-e-d -k-k-k 38 175 (10) 2207 2222 528729 TCCATGATCTTATAGC e-e-e-d -k-k-k 0 (10) 933 2208 2223 528730 ATCCATGATCTTATAG e-e-e-d -k-k-k 12 (10) 2213 2228 528731 GTAGCATCCATGATCT e-e-e-d -k-k-k 14 (10) 935 2214 2229 528732 GGTAGCATCCATGATC e-e-e-d -k-k-k 25 (10) 2217 2232 528733 ATTGGTAGCATCCATG e-e-e-d -k-k-k 22 (10) 937 2218 2233 528734 TATTGGTAGCATCCAT e-e-e-d -k-k-k 15 (10) 938 2219 2234 528735 ATATTGGTAGCATCCA e-e-e-d -k-k-k 28 (10) 939 2264 2279 528736 TCCTTGGGAATGTCAG e-e-e-d -k-k-k 30 (10) 2266 2281 528737 CCTCCTTGGGAATGTC e-e-e-d -k-k-k 30 181 (10) 2275 2290 528738 CGAATGCCTCCTCCTT e-e-e-d -k-k-k 29 186 (10) 2277 2292 528739 TCCGAATGCCTCCTCC e-e-e-d -k-k-k 33 (10) 941 2278 2293 528740 TTCCGAATGCCTCCTC e-e-e-d -k-k-k 27 (10) 942 2279 2294 528741 TTTCCGAATGCCTCCT e-e-e-d -k-k-k 20 (10) 943 2280 2295 528742 CTTTCCGAATGCCTCC e-e-e-d -k-k-k 25 (10) 2281 2296 528743 ACTTTCCGAATGCCTC e-e-e-d -k-k-k 39 (10) 945 2283 2298 528744 ATACTTTCCGAATGCC e-e-e-d -k-k-k 44 (10) 2285 2300 528745 CAATACTTTCCGAATG e-e-e-d -k-k-k 0 (10) 947 2286 2301 528746 ACAATACTTTCCGAAT e-e-e-d -k-k-k 0 (10) 948 2288 2303 528747 CGACAATACTTTCCGA e-e-e-d -k-k-k 11 (10) 949 2289 2304 528748 CCGACAATACTTTCCG e-e-e-d -k-k-k 31 (10) 2290 2305 528749 GCCGACAATACTTTCC e-e-e-d -k-k-k 18 (10) 951 2291 2306 528750 GGCCGACAATACTTTC e-e-e-d -k-k-k 16 (10) 2293 2308 528751 CTGGCCGACAATACTT e-e-e-d -k-k-k 18 (10) 953 2294 2309 528752 TCTGGCCGACAATACT e-e-e-d -k-k-k 8 (10) 954 2295 2310 528753 CTCTGGCCGACAATAC e-e-e-d -k-k-k 0 (10) 955 2296 2311 528754 TCTCTGGCCGACAATA e-e-e-d -k-k-k 6 188 (10) 2297 2312 528755 CTCTCTGGCCGACAAT e-e-e-d -k-k-k 18 (10) 956 2298 2313 528756 GCTCTCTGGCCGACAA e-e-e-d -k-k-k 35 (10) 2299 2314 528757 GGCTCTCTGGCCGACA e-e-e-d -k-k-k 57 (10) 958 2300 2315 528758 TGGCTCTCTGGCCGAC e-e-e-d -k-k-k 64 (10) 959 2301 2316 528759 CTGGCTCTCTGGCCGA e-e-e-d -k-k-k 12 (10) 960 2326 2341 528760 TACCTGGGTCAGCTTC e-e-e-d -k-k-k 21 (10) 2328 2343 528761 GCTACCTGGGTCAGCT e-e-e-d -k-k-k 18 (10) 962 2329 2344 528762 CGCTACCTGGGTCAGC e-e-e-d -k-k-k 28 (10) 2330 2345 528763 GCGCTACCTGGGTCAG e-e-e-d -k-k-k 26 (10) 964 2349 2364 528764 GGTCTTCAGGTATGGG e-e-e-d -k-k-k 38 (10) 965 2350 2365 528765 TGGTCTTCAGGTATGG e-e-e-d -k-k-k 12 (10) 966 2352 2367 528766 CTTGGTCTTCAGGTAT e-e-e-d -k-k-k 0 (10) 2353 2368 528767 ACTTGGTCTTCAGGTA e-e-e-d -k-k-k 10 190 (10) 2358 2373 528768 GATAAACTTGGTCTTC e-e-e-d -k-k-k 9 (10) BIOL0142WO 2360 2375 528769 CAGATAAACTTGGTCT e-e-e-d -k-k-k 15 (10) 2361 2376 528770 ACAGATAAACTTGGTC e-e-e-d -k-k-k 7 (10) 970 2369 2384 528771 GGTGTCACACAGATAA e-e-e-d -k-k-k 35 (10) 2373 2388 528772 CGTTGGTGTCACACAG e-e-e-d -k-k-k 52 (10) 972 2387 2402 528773 GTATTGCTGCAGGTCG e-e-e-d -k-k-k 49 194 (10) 2388 2403 528774 GGTATTGCTGCAGGTC e-e-e-d -k-k-k 48 (10) 973 2389 2404 528775 TGGTATTGCTGCAGGT e-e-e-d -k-k-k 35 (10) 2390 2405 528776 ATGGTATTGCTGCAGG e-e-e-d -k-k-k 20 (10) 975 2392 2407 528777 CAATGGTATTGCTGCA e-e-e-d -k-k-k 24 (10) 2393 2408 528778 TCAATGGTATTGCTGC e-e-e-d -k-k-k 15 (10) 977 2394 2409 528779 GTCAATGGTATTGCTG e-e-e-d -k-k-k 16 (10) 978 2395 2410 528780 GGTCAATGGTATTGCT e-e-e-d -k-k-k 34 196 (10) 2396 2411 528781 AGGTCAATGGTATTGC e-e-e-d -k-k-k 26 (10) 2397 2412 528782 CAGGTCAATGGTATTG e-e-e-d -k-k-k 16 (10) 980 2398 2413 528783 GCAGGTCAATGGTATT e-e-e-d -k-k-k 10 (10) 2399 2414 528784 GGCAGGTCAATGGTAT e-e-e-d -k-k-k 32 (10) 982 2400 2415 528785 CGGCAGGTCAATGGTA e-e-e-d -k-k-k 39 (10) 983 2401 2416 528786 TCGGCAGGTCAATGGT e-e-e-d -k-k-k 51 (10) 984 2403 2418 528787 CATCGGCAGGTCAATG e-e-e-d -k-k-k 26 198 (10) 2404 2419 528788 ACATCGGCAGGTCAAT e-e-e-d -k-k-k 20 (10) 985 2405 2420 528789 GACATCGGCAGGTCAA e-e-e-d -k-k-k 42 (10) 2406 2421 528790 GGACATCGGCAGGTCA e-e-e-d -k-k-k 58 (10) 987 2407 2422 528791 GGGACATCGGCAGGTC e-e-e-d -k-k-k 68 (10) 988 2423 2438 528792 GAATCTAAAGTGCGGG e-e-e-d -k-k-k 46 200 (10) 2424 2439 528793 TGAATCTAAAGTGCGG e-e-e-d -k-k-k 43 (10) 2427 2442 528794 CAATGAATCTAAAGTG e-e-e-d -k-k-k 20 (10) 990 2462 2477 528795 GGTTCAGCACCTTCAC e-e-e-d -k-k-k 13 (10) 2463 2478 528796 GGGTTCAGCACCTTCA e-e-e-d -k-k-k 24 (10) 992 2464 2479 528797 AGGGTTCAGCACCTTC e-e-e-d -k-k-k 23 (10) 993 2465 2480 528798 GAGGGTTCAGCACCTT e-e-e-d -k-k-k 18 (10) 994 2466 2481 528799 TGAGGGTTCAGCACCT e-e-e-d -k-k-k 24 (10) 2490 2505 528800 GAGGGACTCAAACTGC e-e-e-d -k-k-k 28 (10) 996 2492 2507 528801 GTGAGGGACTCAAACT e-e-e-d -k-k-k 22 (10) 2493 2508 528802 GGTGAGGGACTCAAAC e-e-e-d -k-k-k 20 (10) 998 2494 2509 528803 AGGTGAGGGACTCAAA e-e-e-d -k-k-k 13 (10) 999 2495 2510 528804 AAGGTGAGGGACTCAA e-e-e-d -k-k-k 20 (10) 1000 2497 2512 528805 CAAAGGTGAGGGACTC e-e-e-d -k-k-k 20 1001 (10) 2498 2513 528806 TCAAAGGTGAGGGACT e-e-e-d -k-k-k 18 (10) 1002 2506 2521 528807 ACTCCATGTCAAAGGT e-e-e-d -k-k-k 54 1003 (10) 2510 2525 528808 GTCAACTCCATGTCAA e-e-e-d -k-k-k 39 (10) 1004 2511 2526 528809 GGTCAACTCCATGTCA e-e-e-d -k-k-k 56 (10) 1005 2513 2528 528810 GAGGTCAACTCCATGT e-e-e-d -k-k-k 41 (10) 1006 2514 2529 528811 CGAGGTCAACTCCATG e-e-e-d -k-k-k 45 1007 (10) 2515 2530 528812 CCGAGGTCAACTCCAT e-e-e-d -k-k-k 45 (10) 1008 2517 2532 528813 CTCCGAGGTCAACTCC e-e-e-d -k-k-k 58 1009 (10) BIOL0142WO 2518 2533 528814 ACTCCGAGGTCAACTC e-e-e-d -k-k-k 40 1010 (10) 2519 2534 528815 CACTCCGAGGTCAACT e-e-e-d -k-k-k 30 (10) 1011 2551 2566 528816 CGTTCTCAGCTCCTCA e-e-e-d -k-k-k 54 1012 (10) 2554 2569 528817 TTCCGTTCTCAGCTCC e-e-e-d -k-k-k 53 (10) 1013 2555 2570 528818 CTTCCGTTCTCAGCTC e-e-e-d -k-k-k 27 (10) 1014 2556 2571 528819 GCTTCCGTTCTCAGCT e-e-e-d -k-k-k 35 (10) 1015 2557 2572 528820 AGCTTCCGTTCTCAGC e-e-e-d -k-k-k 38 1016 (10) 2558 2573 528821 CAGCTTCCGTTCTCAG e-e-e-d -k-k-k 53 (10) 1017 2559 2574 528822 GCAGCTTCCGTTCTCA e-e-e-d -k-k-k 66 1018 (10) 2614 2629 528823 TTTGGCTGTGTGAGGG e-e-e-d -k-k-k 62 (10) 1019 2615 2630 528824 GTTTGGCTGTGTGAGG e-e-e-d -k-k-k 50 (10) 1020 2616 2631 528825 GGTTTGGCTGTGTGAG e-e-e-d -k-k-k 15 (10) 1021 2641 2656 528826 AAGTTAGTAGTTTCAG e-e-e-d -k-k-k 20 1022 (10) 2677 2692 528827 GCAGAAGTAGGAGATT e-e-e-d -k-k-k 28 (10) 1023 2690 2705 528828 TTGCTCAAAGATAGCA e-e-e-d -k-k-k 39 1024 (10) 2691 2706 528829 ATTGCTCAAAGATAGC e-e-e-d -k-k-k 37 (10) 1025 2692 2707 528830 GATTGCTCAAAGATAG e-e-e-d -k-k-k 22 (10) 1026 2694 2709 528831 CAGATTGCTCAAAGAT e-e-e-d -k-k-k 26 (10) 1027 2695 2710 528832 CCAGATTGCTCAAAGA e-e-e-d -k-k-k 41 1028 (10) 2699 2714 528833 GTGCCCAGATTGCTCA e-e-e-d -k-k-k 77 (10) 1029 2738 2753 528834 GCAGATCACCCACATT e-e-e-d -k-k-k 49 1030 (10) 2743 2758 528835 TAAAAGCAGATCACCC e-e-e-d -k-k-k 40 (10) 1031 2809 2824 528836 CTAGCCACCCCCCGCC e-e-e-d -k-k-k 19 (10) 1032 2810 2825 528837 TCTAGCCACCCCCCGC e-e-e-d -k-k-k 9 (10) 1033 2811 2826 528838 CTCTAGCCACCCCCCG e-e-e-d -k-k-k 16 1034 (10) 2908 2923 528839 GGAGGCACTTGTCTAA e-e-e-d -k-k-k 56 235 (10) 2909 2924 528840 AGGAGGCACTTGTCTA e-e-e-d -k-k-k 62 1036 (10) 2910 2925 528841 CAGGAGGCACTTGTCT e-e-e-d -k-k-k 52 (10) 1037 2911 2926 528842 CCAGGAGGCACTTGTC e-e-e-d -k-k-k 59 (10) 1038 2932 2947 528843 GGCAGAAGGATGCCGC e-e-e-d -k-k-k 35 (10) 1039 2945 2960 528844 GCTTACAGAAACAGGC e-e-e-d -k-k-k 62 1040 (10) 2980 2995 528845 CAGGAGTATGTAGCTA e-e-e-d -k-k-k 65 (10) 1041 2981 2996 528846 CCAGGAGTATGTAGCT e-e-e-d -k-k-k 80 1042 (10) 2982 2997 528847 GCCAGGAGTATGTAGC e-e-e-d -k-k-k 72 (10) 1043 2983 2998 528848 TGCCAGGAGTATGTAG e-e-e-d -k-k-k 46 (10) 1044 2984 2999 528849 ATGCCAGGAGTATGTA e-e-e-d -k-k-k 59 241 (10) 3001 3016 528850 CAAGGTTAAAAAGTGC e-e-e-d -k-k-k 10 243 (10) 3008 3023 528851 ATGTCAGCAAGGTTAA e-e-e-d -k-k-k 61 (10) 1045 3010 3025 528852 GGATGTCAGCAAGGTT e-e-e-d -k-k-k 88 1046 (10) 3012 3027 528853 TTGGATGTCAGCAAGG e-e-e-d -k-k-k 91 (10) 1047 3016 3031 518349 CTATTTGGATGTCAGC e-e-e-d -k-k-k 85 245 (10) 3030 3045 528854 GATAGTCCTATCTTCT e-e-e-d -k-k-k 42 (10) 1048 3091 3106 528855 ACAGTGTTTTTTGCCC e-e-e-d -k-k-k 59 1049 (10) 3108 3123 528856 AGAAAGGCTATGCTGA e-e-e-d -k-k-k 56 (10) 1050 3452 3467 528857 GAGGCTGTTAACTGAA e-e-e-d -k-k-k 40 1051 (10) BIOL0142WO 3458 3473 528858 ACCAAGGAGGCTGTTA e-e-e-d -k-k-k 26 1052 (10) 3474 3489 528859 GCTGAATGCTTAAAGC e-e-e-d -k-k-k 36 (10) 1053 4022 4037 518344 GCCACTGGATATCACC e-e-e-d -k-k-k 55 317 (10) Example 12: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from the study described in Example 11, above, exhibiting significant in vitro inhibition of STAT3 were tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 23.4375 nM, 93.75 nM, 375.0 nM, and 1,500.0 nM concentrations of antisense oligonucleotide, as specified in Table 12. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 12 and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of STAT3 mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of STAT3 mRNA expression was achieved compared to the control. As illustrated in Table 12, STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 12 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells 23.4375 93.75 375.0 1500.0 IC ISIS No nM nM nM nM (μM) 518340 0 8 28 63 1.0 518349 13 30 68 90 0.2 528189 8 13 43 71 0.5 528204 4 24 53 79 0.3 528205 0 9 59 80 0.4 528208 0 19 56 84 0.3 528209 0 28 58 90 0.3 528210 0 16 49 87 0.3 528211 0 10 47 86 0.4 528212 0 16 42 83 0.4 528214 0 25 55 88 0.3 528215 3 16 53 82 0.3 528237 13 19 33 73 0.6 528245 3 16 53 78 0.4 528263 0 3 32 76 0.6 528264 9 0 19 50 >1.5 BIOL0142WO 528268 0 7 25 63 1.0 528269 0 11 39 77 0.5 528270 5 9 48 79 0.4 528271 0 14 37 81 0.5 528327 0 0 26 72 0.8 528347 0 2 25 69 0.9 528357 0 17 36 69 0.6 528389 0 3 19 82 0.7 528501 0 17 40 69 0.6 528502 0 10 35 76 0.6 528503 3 1 38 70 0.7 528504 0 19 45 72 0.5 528505 0 7 41 73 0.6 528518 0 24 51 81 0.3 528534 0 8 32 72 0.7 528539 0 7 39 73 0.6 528557 0 9 26 53 >1.5 528565 4 12 31 57 1.3 528567 8 13 25 54 >1.5 528569 9 19 37 60 0.8 528574 5 17 32 62 0.9 528622 10 4 29 68 0.9 528623 0 13 24 62 1.1 528626 1 0 34 68 0.8 528627 22 19 30 64 1.0 528664 0 14 37 74 0.5 528675 0 10 28 62 1.0 528689 0 16 33 65 0.7 528691 0 3 34 61 0.9 528695 1 4 36 66 0.8 528697 3 15 39 72 0.5 528710 13 16 28 63 1.0 528711 8 13 14 62 >1.5 528726 0 8 36 72 0.6 528757 4 10 29 76 0.6 528758 1 5 28 62 1.1 528772 0 2 21 63 1.2 528773 9 8 28 70 0.8 528791 4 9 41 69 0.6 528822 0 0 40 46 >1.5 528833 0 23 47 82 0.4 528846 10 19 49 85 0.3 528847 0 19 45 75 0.4 528852 5 33 66 93 0.2 528853 19 46 77 95 0.1 BIOL0142WO Example 13: Antisense inhibition of human STAT3 in HuVEC cells Antisense oligonucleotides were designed targeting a human STAT3 nucleic acid and were tested for their effect on human STAT3 mRNA expression in vitro. The chimeric antisense oligonucleotides in Tables 13 and 14 are gapmers16 or 17 nucleotides in length having various chemical modifications. Each gapmer comprises a central gap segment consisting of nine or ten 2’- deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising 1, 2, 3, 4, or 5 nucleotides each. Each of the nucleotides in the wings comprise a 2’-MOE sugar modification or a cEt sugar modification. Gapmer motifs include 33, 43, 24, 15, and 34. The chemistry column of Tables 13 and 14 provides the sugar motif of each gapmer, wherein ‘e’ indicates a 2’-MOE nucleoside, ‘k’ indicates a constrained ethyl (cEt) nucleoside, and ‘d’ indicates a 2’- deoxynucleoside.

The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5’-methylcytosines.

Potency of the chimeric antisense oligonucleotides was compared to ISIS 481464, ISIS 518344, and ISIS 518349 (described previously herein).

Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of STAT3, relative to untreated control cells.

“Human Target start site” indicates the 5’-most nucleoside to which the gapmer is targeted in the human gene sequence. “Human Target stop site” indicates the 3’-most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in Table 13 is targeted to human STAT3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each gapmer listed in Table 14 is targeted to human STAT3 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000).

Table 13 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Human Human ISIS % SEQ Start Stop Sequence Chemistry No inhibition ID NO Site Site 728 743 530423 AGATTCTCTACCACTT k-d(10)-k-e-k-e-e 70 1054 729 745 530053 GGAGATTCTCTACCACT e-e-k-d(10)-k-e-k-e 84 1055 729 744 530373 GAGATTCTCTACCACT e-k-d(10)-k-e-k-e 85 1056 730 745 530121 GGAGATTCTCTACCAC e-k-k-d(10)-k-k-e 77 53 BIOL0142WO 730 745 530168 GGAGATTCTCTACCAC e-e-k-d(10)-k-k-e 75 53 730 745 530218 GGAGATTCTCTACCAC e-d-k-d(10)-k-k-e 61 53 730 745 530268 GGAGATTCTCTACCAC e-d-d-k-d(9)-k-k-e 76 53 730 745 530318 GGAGATTCTCTACCAC e-e-e-e-d(9)-k-k-e 27 53 786 801 530424 ATCTTGCATGTCTCCT k-d(10)-k-e-k-e-e 42 1057 787 803 530058 AGATCTTGCATGTCTCC e-e-k-d(10)-k-e-k-e 73 1058 787 802 530374 GATCTTGCATGTCTCC e-k-d(10)-k-e-k-e 71 647 788 803 530122 AGATCTTGCATGTCTC e-k-k-d(10)-k-k-e 80 57 788 803 530169 AGATCTTGCATGTCTC e-e-k-d(10)-k-k-e 72 57 788 803 530219 AGATCTTGCATGTCTC e-d-k-d(10)-k-k-e 55 57 788 803 530269 AGATCTTGCATGTCTC e-d-d-k-d(9)-k-k-e 76 57 788 803 530319 AGATCTTGCATGTCTC e-e-e-e-d(9)-k-k-e 30 57 892 907 528400 CCGCCAGCTCACTCAC e-e-e-d(10)-k-k-k 57 66 893 908 528401 CCCGCCAGCTCACTCA e-e-e-d(10)-k-k-k 57 1059 894 909 528402 CCCCGCCAGCTCACTC e-e-e-d(10)-k-k-k 42 1060 897 912 528403 AAGCCCCGCCAGCTCA e-e-e-d(10)-k-k-k 72 1061 898 913 528404 AAAGCCCCGCCAGCTC e-e-e-d(10)-k-k-k 52 1062 899 914 528405 AAAAGCCCCGCCAGCT e-e-e-d(10)-k-k-k 27 1063 900 915 528406 CAAAAGCCCCGCCAGC e-e-e-d(10)-k-k-k 29 1064 901 916 528407 ACAAAAGCCCCGCCAG e-e-e-d(10)-k-k-k 9 1065 903 918 528408 TGACAAAAGCCCCGCC e-e-e-d(10)-k-k-k 10 1066 904 919 528409 CTGACAAAAGCCCCGC e-e-e-d(10)-k-k-k 31 1067 905 920 528410 GCTGACAAAAGCCCCG e-e-e-d(10)-k-k-k 39 1068 906 921 528411 CGCTGACAAAAGCCCC e-e-e-d(10)-k-k-k 49 1069 907 922 528412 TCGCTGACAAAAGCCC e-e-e-d(10)-k-k-k 39 1070 908 923 528413 ATCGCTGACAAAAGCC e-e-e-d(10)-k-k-k 20 1071 909 924 528414 CATCGCTGACAAAAGC e-e-e-d(10)-k-k-k 10 1072 911 926 528415 TCCATCGCTGACAAAA e-e-e-d(10)-k-k-k 11 1073 912 927 528416 CTCCATCGCTGACAAA e-e-e-d(10)-k-k-k 15 1074 913 928 528417 ACTCCATCGCTGACAA e-e-e-d(10)-k-k-k 22 1075 914 929 528418 TACTCCATCGCTGACA e-e-e-d(10)-k-k-k 19 1076 915 930 528419 GTACTCCATCGCTGAC e-e-e-d(10)-k-k-k 37 1077 916 931 528420 CGTACTCCATCGCTGA e-e-e-d(10)-k-k-k 35 1078 930 945 528421 GAGAGTTTTCTGCACG e-e-e-d(10)-k-k-k 36 1079 932 947 528422 GTGAGAGTTTTCTGCA e-e-e-d(10)-k-k-k 22 1080 951 966 528423 GTCAGCCAGCTCCTCG e-e-e-d(10)-k-k-k 49 1081 962 977 528424 CGCCTCTTCCAGTCAG e-e-e-d(10)-k-k-k 42 1082 964 979 528425 GCCGCCTCTTCCAGTC e-e-e-d(10)-k-k-k 44 1083 965 980 528426 TGCCGCCTCTTCCAGT e-e-e-d(10)-k-k-k 15 1084 970 985 528427 TCTGTTGCCGCCTCTT e-e-e-d(10)-k-k-k 9 1085 971 986 528428 ATCTGTTGCCGCCTCT e-e-e-d(10)-k-k-k 30 1086 972 987 528429 AATCTGTTGCCGCCTC e-e-e-d(10)-k-k-k 23 1087 973 988 528430 CAATCTGTTGCCGCCT e-e-e-d(10)-k-k-k 12 1088 974 989 528431 GCAATCTGTTGCCGCC e-e-e-d(10)-k-k-k 48 1089 975 990 528432 GGCAATCTGTTGCCGC e-e-e-d(10)-k-k-k 18 1090 BIOL0142WO 976 991 528433 AGGCAATCTGTTGCCG e-e-e-d(10)-k-k-k 0 1091 977 992 528434 CAGGCAATCTGTTGCC e-e-e-d(10)-k-k-k 8 1092 978 993 528435 GCAGGCAATCTGTTGC e-e-e-d(10)-k-k-k 13 1093 982 997 528436 CAATGCAGGCAATCTG e-e-e-d(10)-k-k-k 9 1094 983 998 528437 CCAATGCAGGCAATCT e-e-e-d(10)-k-k-k 26 1095 984 999 528438 TCCAATGCAGGCAATC e-e-e-d(10)-k-k-k 10 1096 985 1000 528439 CTCCAATGCAGGCAAT e-e-e-d(10)-k-k-k 2 1097 986 1001 528440 CCTCCAATGCAGGCAA e-e-e-d(10)-k-k-k 28 1098 1003 1018 528441 GGCAGATGTTGGGCGG e-e-e-d(10)-k-k-k 8 1099 1004 1019 528442 AGGCAGATGTTGGGCG e-e-e-d(10)-k-k-k 0 1100 1005 1020 528443 TAGGCAGATGTTGGGC e-e-e-d(10)-k-k-k 1 1101 1006 1021 528444 CTAGGCAGATGTTGGG e-e-e-d(10)-k-k-k 0 1102 1007 1022 528445 TCTAGGCAGATGTTGG e-e-e-d(10)-k-k-k 7 1103 1008 1023 528446 ATCTAGGCAGATGTTG e-e-e-d(10)-k-k-k 3 1104 1010 1025 528447 CGATCTAGGCAGATGT e-e-e-d(10)-k-k-k 9 72 1011 1026 528448 CCGATCTAGGCAGATG e-e-e-d(10)-k-k-k 13 1105 1013 1028 528449 AGCCGATCTAGGCAGA e-e-e-d(10)-k-k-k 4 1106 1014 1029 528450 TAGCCGATCTAGGCAG e-e-e-d(10)-k-k-k 11 1107 1015 1030 528451 CTAGCCGATCTAGGCA e-e-e-d(10)-k-k-k 5 1108 1016 1031 528452 TCTAGCCGATCTAGGC e-e-e-d(10)-k-k-k 5 1109 1017 1032 528453 TTCTAGCCGATCTAGG e-e-e-d(10)-k-k-k 24 1110 1018 1033 528454 TTTCTAGCCGATCTAG e-e-e-d(10)-k-k-k 29 1111 1019 1034 528455 TTTTCTAGCCGATCTA e-e-e-d(10)-k-k-k 28 1112 1020 1035 528456 GTTTTCTAGCCGATCT e-e-e-d(10)-k-k-k 42 1113 1022 1037 528457 CAGTTTTCTAGCCGAT e-e-e-d(10)-k-k-k 50 1114 1023 1038 528458 CCAGTTTTCTAGCCGA e-e-e-d(10)-k-k-k 70 1115 1024 1039 528459 TCCAGTTTTCTAGCCG e-e-e-d(10)-k-k-k 56 1116 1025 1040 528460 ATCCAGTTTTCTAGCC e-e-e-d(10)-k-k-k 42 1117 1029 1044 528461 CGTTATCCAGTTTTCT e-e-e-d(10)-k-k-k 47 1118 1043 1058 528462 GATTCTGCTAATGACG e-e-e-d(10)-k-k-k 42 1119 1044 1059 528463 AGATTCTGCTAATGAC e-e-e-d(10)-k-k-k 38 1120 1048 1063 528464 GTTGAGATTCTGCTAA e-e-e-d(10)-k-k-k 30 1121 1049 1064 528465 AGTTGAGATTCTGCTA e-e-e-d(10)-k-k-k 48 1122 1056 1071 528466 GGTCTGAAGTTGAGAT e-e-e-d(10)-k-k-k 27 1123 1058 1073 528467 CGGGTCTGAAGTTGAG e-e-e-d(10)-k-k-k 44 1124 1059 1074 528468 ACGGGTCTGAAGTTGA e-e-e-d(10)-k-k-k 41 1125 1060 1075 528469 GACGGGTCTGAAGTTG e-e-e-d(10)-k-k-k 45 1126 1061 1076 528470 TGACGGGTCTGAAGTT e-e-e-d(10)-k-k-k 34 1127 1062 1077 528471 TTGACGGGTCTGAAGT e-e-e-d(10)-k-k-k 19 1128 1063 1078 528472 GTTGACGGGTCTGAAG e-e-e-d(10)-k-k-k 21 1129 1064 1079 528473 TGTTGACGGGTCTGAA e-e-e-d(10)-k-k-k 37 1130 1065 1080 528474 TTGTTGACGGGTCTGA e-e-e-d(10)-k-k-k 55 1131 1066 1081 528475 TTTGTTGACGGGTCTG e-e-e-d(10)-k-k-k 63 1132 1067 1082 528476 ATTTGTTGACGGGTCT e-e-e-d(10)-k-k-k 65 1133 1899 1914 530425 GCCCTTGCCAGCCATG k-d(10)-k-e-k-e-e 73 1134 BIOL0142WO 1900 1916 530054 AAGCCCTTGCCAGCCAT e-e-k-d(10)-k-e-k-e 75 1135 1900 1915 530375 AGCCCTTGCCAGCCAT e-k-d(10)-k-e-k-e 77 1136 1901 1916 530123 AAGCCCTTGCCAGCCA e-k-k-d(10)-k-k-e 86 144 1901 1916 530170 AAGCCCTTGCCAGCCA e-e-k-d(10)-k-k-e 87 144 1901 1916 530220 AAGCCCTTGCCAGCCA e-d-k-d(10)-k-k-e 74 144 1901 1916 530270 AAGCCCTTGCCAGCCA e-d-d-k-d(9)-k-k-e 87 144 1901 1916 530320 AAGCCCTTGCCAGCCA e-e-e-e-d(9)-k-k-e 17 144 1946 1961 530426 TTTTTCACAAGGTCAA k-d(10)-k-e-k-e-e 55 1137 1947 1963 530059 ACTTTTTCACAAGGTCA e-e-k-d(10)-k-e-k-e 73 1138 1947 1962 530376 CTTTTTCACAAGGTCA e-k-d(10)-k-e-k-e 77 1139 1948 1963 530124 ACTTTTTCACAAGGTC e-k-k-d(10)-k-k-e 79 153 1948 1963 530171 ACTTTTTCACAAGGTC e-e-k-d(10)-k-k-e 69 153 1948 1963 530221 ACTTTTTCACAAGGTC e-d-k-d(10)-k-k-e 64 153 1948 1963 530271 ACTTTTTCACAAGGTC e-d-d-k-d(9)-k-k-e 73 153 1948 1963 530321 ACTTTTTCACAAGGTC e-e-e-e-d(9)-k-k-e 44 153 2204 2219 530427 ATGATCTTATAGCCCA k-d(10)-k-e-k-e-e 43 931 2205 2221 530060 CCATGATCTTATAGCCC e-e-k-d(10)-k-e-k-e 77 1140 2205 2220 530377 CATGATCTTATAGCCC e-k-d(10)-k-e-k-e 66 932 2206 2221 530125 CCATGATCTTATAGCC e-k-k-d(10)-k-k-e 65 175 2206 2221 530172 CCATGATCTTATAGCC e-e-k-d(10)-k-k-e 59 175 2206 2221 530222 CCATGATCTTATAGCC e-d-k-d(10)-k-k-e 48 175 2206 2221 530272 CCATGATCTTATAGCC e-d-d-k-d(9)-k-k-e 63 175 2206 2221 530322 CCATGATCTTATAGCC e-e-e-e-d(9)-k-k-e 55 175 2679 2694 530428 TAGCAGAAGTAGGAGA k-d(10)-k-e-k-e-e 49 1141 2680 2696 530061 GATAGCAGAAGTAGGAG e-e-k-d(10)-k-e-k-e 49 1142 2680 2695 530378 ATAGCAGAAGTAGGAG e-k-d(10)-k-e-k-e 48 1143 2681 2696 530126 GATAGCAGAAGTAGGA e-k-k-d(10)-k-k-e 70 223 2681 2696 530173 GATAGCAGAAGTAGGA e-e-k-d(10)-k-k-e 62 223 2681 2696 530223 GATAGCAGAAGTAGGA e-d-k-d(10)-k-k-e 44 223 2681 2696 530273 GATAGCAGAAGTAGGA e-d-d-k-d(9)-k-k-e 63 223 2681 2696 530323 GATAGCAGAAGTAGGA e-e-e-e-d(9)-k-k-e 63 223 3012 3027 530513 TTGGATGTCAGCAAGG k-d(10)-k-e-k-e-e 88 1047 3013 3028 530507 TTTGGATGTCAGCAAG e-k-d(10)-k-e-k-e 86 1144 3013 3028 530514 TTTGGATGTCAGCAAG k-d(10)-k-e-k-e-e 80 1144 3014 3029 530430 ATTTGGATGTCAGCAA k-d(10)-k-e-k-e-e 87 1145 3014 3029 530468 ATTTGGATGTCAGCAA e-k-k-d(10)-k-k-e 81 1145 3014 3029 530476 ATTTGGATGTCAGCAA e-e-k-d(10)-k-k-e 82 1145 3014 3029 530484 ATTTGGATGTCAGCAA e-d-k-d(10)-k-k-e 74 1145 3014 3029 530492 ATTTGGATGTCAGCAA e-d-d-k-d(9)-k-k-e 83 1145 3014 3029 530500 ATTTGGATGTCAGCAA e-e-e-e-d(9)-k-k-e 56 1145 3014 3029 530508 ATTTGGATGTCAGCAA e-k-d(10)-k-e-k-e 83 1145 3015 3031 530062 CTATTTGGATGTCAGCA e-e-k-d(10)-k-e-k-e 94 1146 3015 3030 530380 TATTTGGATGTCAGCA e-k-d(10)-k-e-k-e 94 1147 3015 3030 530469 TATTTGGATGTCAGCA e-k-k-d(10)-k-k-e 91 1147 3015 3030 530477 TATTTGGATGTCAGCA e-e-k-d(10)-k-k-e 87 1147 BIOL0142WO 3015 3030 530485 TATTTGGATGTCAGCA e-d-k-d(10)-k-k-e 87 1147 3015 3030 530493 TATTTGGATGTCAGCA e-d-d-k-d(9)-k-k-e 81 1147 3015 3030 530501 TATTTGGATGTCAGCA e-e-e-e-d(9)-k-k-e 74 1147 3015 3030 530515 TATTTGGATGTCAGCA k-d(10)-k-e-k-e-e 87 1147 3016 3031 481464 CTATTTGGATGTCAGC k-k-k-d(10)-k-k-k 93 245 3016 3031 518349 CTATTTGGATGTCAGC e-e-e-d(10)-k-k-k 58 245 3016 3031 519637 CTATTTGGATGTCAGC e-k-k-d(10)-k-k-e 96 245 3016 3031 530175 CTATTTGGATGTCAGC e-e-k-d(10)-k-k-e 93 245 3016 3031 530225 CTATTTGGATGTCAGC e-d-k-d(10)-k-k-e 85 245 3016 3031 530275 CTATTTGGATGTCAGC e-d-d-k-d(9)-k-k-e 91 245 3016 3031 530325 CTATTTGGATGTCAGC e-e-e-e-d(9)-k-k-e 91 245 3017 3032 530470 TCTATTTGGATGTCAG e-k-k-d(10)-k-k-e 91 1148 3017 3032 530478 TCTATTTGGATGTCAG e-e-k-d(10)-k-k-e 87 1148 3017 3032 530486 TCTATTTGGATGTCAG e-d-k-d(10)-k-k-e 84 1148 3017 3032 530494 TCTATTTGGATGTCAG e-d-d-k-d(9)-k-k-e 60 1148 3017 3032 530502 TCTATTTGGATGTCAG e-e-e-e-d(9)-k-k-e 64 1148 3017 3032 530509 TCTATTTGGATGTCAG e-k-d(10)-k-e-k-e 80 1148 3018 3033 530471 TTCTATTTGGATGTCA e-k-k-d(10)-k-k-e 83 1149 3018 3033 530479 TTCTATTTGGATGTCA e-e-k-d(10)-k-k-e 74 1149 3018 3033 530487 TTCTATTTGGATGTCA e-d-k-d(10)-k-k-e 71 1149 3018 3033 530495 TTCTATTTGGATGTCA e-d-d-k-d(9)-k-k-e 68 1149 3018 3033 530503 TTCTATTTGGATGTCA e-e-e-e-d(9)-k-k-e 53 1149 3459 3474 530431 CACCAAGGAGGCTGTT k-d(10)-k-e-k-e-e 44 1150 3460 3476 530055 AGCACCAAGGAGGCTGT e-e-k-d(10)-k-e-k-e 45 1151 3460 3475 530381 GCACCAAGGAGGCTGT e-k-d(10)-k-e-k-e 74 1152 3461 3476 530128 AGCACCAAGGAGGCTG e-k-k-d(10)-k-k-e 52 257 3461 3476 530176 AGCACCAAGGAGGCTG e-e-k-d(10)-k-k-e 66 257 3461 3476 530226 AGCACCAAGGAGGCTG e-d-k-d(10)-k-k-e 51 257 3461 3476 530276 AGCACCAAGGAGGCTG e-d-d-k-d(9)-k-k-e 70 257 3461 3476 530326 AGCACCAAGGAGGCTG e-e-e-e-d(9)-k-k-e 52 257 3527 3542 528860 GGTTTGACCTGAAGCC e-e-e-d(10)-k-k-k 58 1153 3528 3543 528861 GGGTTTGACCTGAAGC e-e-e-d(10)-k-k-k 42 1154 3529 3544 528862 AGGGTTTGACCTGAAG e-e-e-d(10)-k-k-k 57 1155 3530 3545 528863 AAGGGTTTGACCTGAA e-e-e-d(10)-k-k-k 43 1156 3531 3546 528864 TAAGGGTTTGACCTGA e-e-e-d(10)-k-k-k 50 1157 3532 3547 528865 TTAAGGGTTTGACCTG e-e-e-d(10)-k-k-k 32 1158 3547 3562 528866 GCAGCTTCAGATGTCT e-e-e-d(10)-k-k-k 60 1159 3548 3563 528867 TGCAGCTTCAGATGTC e-e-e-d(10)-k-k-k 47 1160 3583 3598 530388 CTTAAACCTTCCTATT k-d(10)-k-e-k-e-e 14 1161 3584 3599 530338 CCTTAAACCTTCCTAT e-k-d(10)-k-e-k-e 47 1162 3585 3600 530086 TCCTTAAACCTTCCTA e-k-k-d(10)-k-k-e 58 273 3585 3600 530133 TCCTTAAACCTTCCTA e-e-k-d(10)-k-k-e 53 273 3585 3600 530183 TCCTTAAACCTTCCTA e-d-k-d(10)-k-k-e 52 273 3585 3600 530233 TCCTTAAACCTTCCTA e-d-d-k-d(9)-k-k-e 29 273 3585 3600 530283 TCCTTAAACCTTCCTA e-e-e-e-d(9)-k-k-e 32 273 BIOL0142WO 3590 3605 528868 GATTCTCCTTAAACCT e-e-e-d(10)-k-k-k 45 1163 3591 3606 530389 AGATTCTCCTTAAACC k-d(10)-k-e-k-e-e 44 1164 3592 3607 530339 TAGATTCTCCTTAAAC e-k-d(10)-k-e-k-e 41 1165 3593 3608 530087 TTAGATTCTCCTTAAA e-k-k-d(10)-k-k-e 43 1166 3593 3608 530134 TTAGATTCTCCTTAAA e-e-k-d(10)-k-k-e 28 1166 3593 3608 530184 TTAGATTCTCCTTAAA e-d-k-d(10)-k-k-e 13 1166 3593 3608 530234 TTAGATTCTCCTTAAA e-d-d-k-d(9)-k-k-e 15 1166 3593 3608 530284 TTAGATTCTCCTTAAA e-e-e-e-d(9)-k-k-e 14 1166 3595 3610 530390 GCTTAGATTCTCCTTA k-d(10)-k-e-k-e-e 83 1167 3596 3611 530340 TGCTTAGATTCTCCTT e-k-d(10)-k-e-k-e 89 1168 3597 3612 528869 ATGCTTAGATTCTCCT e-e-e-d(10)-k-k-k 83 1169 3597 3612 530088 ATGCTTAGATTCTCCT e-k-k-d(10)-k-k-e 90 1169 3597 3612 530135 ATGCTTAGATTCTCCT e-e-k-d(10)-k-k-e 91 1169 3597 3612 530185 ATGCTTAGATTCTCCT e-d-k-d(10)-k-k-e 85 1169 3597 3612 530235 ATGCTTAGATTCTCCT e-d-d-k-d(9)-k-k-e 28 1169 3597 3612 530285 ATGCTTAGATTCTCCT e-e-e-e-d(9)-k-k-e 86 1169 3597 3612 530391 ATGCTTAGATTCTCCT k-d(10)-k-e-k-e-e 79 1169 3598 3614 530021 AAATGCTTAGATTCTCC e-e-k-d(10)-k-e-k-e 87 1170 3598 3613 530341 AATGCTTAGATTCTCC e-k-d(10)-k-e-k-e 88 1171 3599 3614 530089 AAATGCTTAGATTCTC e-k-k-d(10)-k-k-e 71 1172 3599 3614 530136 AAATGCTTAGATTCTC e-e-k-d(10)-k-k-e 66 1172 3599 3614 530186 AAATGCTTAGATTCTC e-d-k-d(10)-k-k-e 51 1172 3599 3614 530236 AAATGCTTAGATTCTC e-d-d-k-d(9)-k-k-e 74 1172 3599 3614 530286 AAATGCTTAGATTCTC e-e-e-e-d(9)-k-k-e 56 1172 3682 3697 528870 GTAAGCACCCTCTGCC e-e-e-d(10)-k-k-k 26 1173 3684 3699 528871 TTGTAAGCACCCTCTG e-e-e-d(10)-k-k-k 14 1174 3686 3701 528872 GGTTGTAAGCACCCTC e-e-e-d(10)-k-k-k 47 1175 3687 3702 528873 AGGTTGTAAGCACCCT e-e-e-d(10)-k-k-k 40 1176 3688 3703 528874 AAGGTTGTAAGCACCC e-e-e-d(10)-k-k-k 54 1177 3690 3705 528875 TCAAGGTTGTAAGCAC e-e-e-d(10)-k-k-k 15 1178 3691 3706 528876 GTCAAGGTTGTAAGCA e-e-e-d(10)-k-k-k 28 1179 3692 3707 528877 AGTCAAGGTTGTAAGC e-e-e-d(10)-k-k-k 28 1180 3694 3709 528878 GGAGTCAAGGTTGTAA e-e-e-d(10)-k-k-k 6 1181 3695 3710 528879 GGGAGTCAAGGTTGTA e-e-e-d(10)-k-k-k 22 1182 3714 3729 530392 GATCAAGTCCAGGGAG k-d(10)-k-e-k-e-e 47 1183 3715 3731 530022 CAGATCAAGTCCAGGGA e-e-k-d(10)-k-e-k-e 80 1184 3715 3730 530342 AGATCAAGTCCAGGGA e-k-d(10)-k-e-k-e 70 1185 3715 3730 530393 AGATCAAGTCCAGGGA k-d(10)-k-e-k-e-e 46 1185 3716 3732 530023 GCAGATCAAGTCCAGGG e-e-k-d(10)-k-e-k-e 74 1186 3716 3731 530090 CAGATCAAGTCCAGGG e-k-k-d(10)-k-k-e 78 1187 3716 3731 530137 CAGATCAAGTCCAGGG e-e-k-d(10)-k-k-e 76 1187 3716 3731 530187 CAGATCAAGTCCAGGG e-d-k-d(10)-k-k-e 68 1187 3716 3731 530237 CAGATCAAGTCCAGGG e-d-d-k-d(9)-k-k-e 36 1187 3716 3731 530287 CAGATCAAGTCCAGGG e-e-e-e-d(9)-k-k-e 56 1187 3716 3731 530343 CAGATCAAGTCCAGGG e-k-d(10)-k-e-k-e 68 1187 BIOL0142WO 3716 3731 530394 CAGATCAAGTCCAGGG k-d(10)-k-e-k-e-e 49 1187 3717 3732 518343 GCAGATCAAGTCCAGG e-e-e-d(10)-k-k-k 5 1188 3717 3733 530024 AGCAGATCAAGTCCAGG e-e-k-d(10)-k-e-k-e 79 1189 3717 3732 530091 GCAGATCAAGTCCAGG e-k-k-d(10)-k-k-e 81 1188 3717 3732 530138 GCAGATCAAGTCCAGG e-e-k-d(10)-k-k-e 81 1188 3717 3732 530188 GCAGATCAAGTCCAGG e-d-k-d(10)-k-k-e 78 1188 3717 3732 530238 GCAGATCAAGTCCAGG e-d-d-k-d(9)-k-k-e 29 1188 3717 3732 530288 GCAGATCAAGTCCAGG e-e-e-e-d(9)-k-k-e 69 1188 3717 3732 530344 GCAGATCAAGTCCAGG e-k-d(10)-k-e-k-e 85 1188 3718 3733 530092 AGCAGATCAAGTCCAG e-k-k-d(10)-k-k-e 85 1190 3718 3733 530139 AGCAGATCAAGTCCAG e-e-k-d(10)-k-k-e 79 1190 3718 3733 530189 AGCAGATCAAGTCCAG e-d-k-d(10)-k-k-e 77 1190 3718 3733 530239 AGCAGATCAAGTCCAG e-d-d-k-d(9)-k-k-e 61 1190 3718 3733 530289 AGCAGATCAAGTCCAG e-e-e-e-d(9)-k-k-e 75 1190 3720 3735 528880 ACAGCAGATCAAGTCC e-e-e-d(10)-k-k-k 65 1191 3721 3736 528881 AACAGCAGATCAAGTC e-e-e-d(10)-k-k-k 44 1192 3737 3752 528882 ACAACCTAGCCTCTGA e-e-e-d(10)-k-k-k 39 1193 3738 3753 528883 AACAACCTAGCCTCTG e-e-e-d(10)-k-k-k 46 1194 3740 3755 528884 GAAACAACCTAGCCTC e-e-e-d(10)-k-k-k 37 1195 3741 3756 528885 AGAAACAACCTAGCCT e-e-e-d(10)-k-k-k 20 1196 3742 3757 528886 CAGAAACAACCTAGCC e-e-e-d(10)-k-k-k 21 1197 3755 3770 528887 GATAAGGCACCCACAG e-e-e-d(10)-k-k-k 25 1198 3756 3771 528888 TGATAAGGCACCCACA e-e-e-d(10)-k-k-k 12 1199 3757 3772 528889 CTGATAAGGCACCCAC e-e-e-d(10)-k-k-k 25 1200 3759 3774 528890 CCCTGATAAGGCACCC e-e-e-d(10)-k-k-k 42 1201 3760 3775 528891 GCCCTGATAAGGCACC e-e-e-d(10)-k-k-k 49 1202 3765 3780 528892 TCCCAGCCCTGATAAG e-e-e-d(10)-k-k-k 0 1203 3767 3782 528893 TATCCCAGCCCTGATA e-e-e-d(10)-k-k-k 0 1204 3770 3785 528894 AAGTATCCCAGCCCTG e-e-e-d(10)-k-k-k 25 1205 3771 3786 528895 GAAGTATCCCAGCCCT e-e-e-d(10)-k-k-k 39 1206 3772 3787 528896 AGAAGTATCCCAGCCC e-e-e-d(10)-k-k-k 22 1207 3773 3788 528897 CAGAAGTATCCCAGCC e-e-e-d(10)-k-k-k 36 1208 3892 3907 528898 TGAGACCAGGATTCCT e-e-e-d(10)-k-k-k 41 1209 3896 3911 528899 GTCCTGAGACCAGGAT e-e-e-d(10)-k-k-k 19 1210 3977 3992 528900 AGCTCAACCAGACACG e-e-e-d(10)-k-k-k 54 3979 3994 528901 TGAGCTCAACCAGACA e-e-e-d(10)-k-k-k 40 1211 3984 3999 528902 TTCCCTGAGCTCAACC e-e-e-d(10)-k-k-k 32 1212 3992 4007 528903 GAACCATATTCCCTGA e-e-e-d(10)-k-k-k 30 313 3995 4010 528904 TAAGAACCATATTCCC e-e-e-d(10)-k-k-k 27 1213 4022 4037 518344 GCCACTGGATATCACC e-e-e-d(10)-k-k-k 89 317 4067 4082 528905 TAAGCCTTTGCCCTGC e-e-e-d(10)-k-k-k 64 1214 4068 4083 528906 GTAAGCCTTTGCCCTG e-e-e-d(10)-k-k-k 53 1215 4069 4084 528907 AGTAAGCCTTTGCCCT e-e-e-d(10)-k-k-k 45 1216 4070 4085 528908 CAGTAAGCCTTTGCCC e-e-e-d(10)-k-k-k 40 1217 4072 4087 528909 ATCAGTAAGCCTTTGC e-e-e-d(10)-k-k-k 53 1218 BIOL0142WO 4073 4088 528910 TATCAGTAAGCCTTTG e-e-e-d(10)-k-k-k 47 1219 4077 4092 528911 AGTTTATCAGTAAGCC e-e-e-d(10)-k-k-k 58 1220 4083 4098 528912 GACTCAAGTTTATCAG e-e-e-d(10)-k-k-k 37 1221 4085 4100 528913 CAGACTCAAGTTTATC e-e-e-d(10)-k-k-k 39 1222 4086 4101 528914 GCAGACTCAAGTTTAT e-e-e-d(10)-k-k-k 0 1223 4087 4102 528915 GGCAGACTCAAGTTTA e-e-e-d(10)-k-k-k 1 1224 4088 4103 528916 GGGCAGACTCAAGTTT e-e-e-d(10)-k-k-k 0 1225 4089 4104 528917 AGGGCAGACTCAAGTT e-e-e-d(10)-k-k-k 9 1226 4091 4106 528918 CGAGGGCAGACTCAAG e-e-e-d(10)-k-k-k 2 1227 4093 4108 528919 TACGAGGGCAGACTCA e-e-e-d(10)-k-k-k 20 324 4094 4109 528920 ATACGAGGGCAGACTC e-e-e-d(10)-k-k-k 14 1228 4095 4110 528921 CATACGAGGGCAGACT e-e-e-d(10)-k-k-k 0 1229 4096 4111 528922 TCATACGAGGGCAGAC e-e-e-d(10)-k-k-k 8 1230 4098 4113 528923 CCTCATACGAGGGCAG e-e-e-d(10)-k-k-k 2 1231 4099 4114 528924 CCCTCATACGAGGGCA e-e-e-d(10)-k-k-k 2 1232 4100 4115 528925 ACCCTCATACGAGGGC e-e-e-d(10)-k-k-k 0 1233 4225 4240 528926 TACGCACAGGAGAGGC e-e-e-d(10)-k-k-k 20 1233 4226 4241 528927 ATACGCACAGGAGAGG e-e-e-d(10)-k-k-k 0 1234 4227 4242 528928 CATACGCACAGGAGAG e-e-e-d(10)-k-k-k 6 1235 4228 4243 528929 CCATACGCACAGGAGA e-e-e-d(10)-k-k-k 4 1236 4229 4244 528930 CCCATACGCACAGGAG e-e-e-d(10)-k-k-k 36 1237 4230 4245 528931 TCCCATACGCACAGGA e-e-e-d(10)-k-k-k 22 1238 4231 4246 528932 TTCCCATACGCACAGG e-e-e-d(10)-k-k-k 32 1239 4232 4247 528933 GTTCCCATACGCACAG e-e-e-d(10)-k-k-k 45 1240 4233 4248 528934 TGTTCCCATACGCACA e-e-e-d(10)-k-k-k 36 1241 4234 4249 528935 GTGTTCCCATACGCAC e-e-e-d(10)-k-k-k 20 1242 4234 4249 530395 GTGTTCCCATACGCAC k-d(10)-k-e-k-e-e 71 1242 4235 4250 528936 GGTGTTCCCATACGCA e-e-e-d(10)-k-k-k 71 1243 4235 4251 530025 AGGTGTTCCCATACGCA e-e-k-d(10)-k-e-k-e 90 1244 4235 4250 530345 GGTGTTCCCATACGCA e-k-d(10)-k-e-k-e 93 1243 4235 4250 530396 GGTGTTCCCATACGCA k-d(10)-k-e-k-e-e 71 1243 4236 4251 528937 AGGTGTTCCCATACGC e-e-e-d(10)-k-k-k 73 1245 4236 4252 530026 TAGGTGTTCCCATACGC e-e-k-d(10)-k-e-k-e 87 1246 4236 4251 530093 AGGTGTTCCCATACGC e-k-k-d(10)-k-k-e 95 1245 4236 4251 530140 AGGTGTTCCCATACGC e-e-k-d(10)-k-k-e 89 1245 4236 4251 530190 AGGTGTTCCCATACGC e-d-k-d(10)-k-k-e 82 1245 4236 4251 530240 AGGTGTTCCCATACGC e-d-d-k-d(9)-k-k-e 50 1245 4236 4251 530290 AGGTGTTCCCATACGC e-e-e-e-d(9)-k-k-e 69 1245 4236 4251 530346 AGGTGTTCCCATACGC e-k-d(10)-k-e-k-e 89 1245 4237 4252 528938 TAGGTGTTCCCATACG e-e-e-d(10)-k-k-k 72 336 4237 4252 530094 TAGGTGTTCCCATACG e-k-k-d(10)-k-k-e 88 336 4237 4252 530141 TAGGTGTTCCCATACG e-e-k-d(10)-k-k-e 80 336 4237 4252 530191 TAGGTGTTCCCATACG e-d-k-d(10)-k-k-e 74 336 4237 4252 530241 TAGGTGTTCCCATACG e-d-d-k-d(9)-k-k-e 53 336 4237 4252 530291 TAGGTGTTCCCATACG e-e-e-e-d(9)-k-k-e 68 336 BIOL0142WO 4238 4253 528939 CTAGGTGTTCCCATAC e-e-e-d(10)-k-k-k 39 1247 4239 4254 528940 GCTAGGTGTTCCCATA e-e-e-d(10)-k-k-k 62 1248 4240 4255 528941 TGCTAGGTGTTCCCAT e-e-e-d(10)-k-k-k 49 1249 4242 4257 528942 CGTGCTAGGTGTTCCC e-e-e-d(10)-k-k-k 77 1250 4304 4319 528943 CAAGGTGGTTTTGAGT e-e-e-d(10)-k-k-k 25 1251 4305 4320 528944 GCAAGGTGGTTTTGAG e-e-e-d(10)-k-k-k 28 344 4320 4335 528945 CTCTGATCAGCTGAGG e-e-e-d(10)-k-k-k 74 1252 4321 4336 528946 ACTCTGATCAGCTGAG e-e-e-d(10)-k-k-k 56 1253 4362 4377 528947 GAGACCAGCTAATTTG e-e-e-d(10)-k-k-k 36 1254 4395 4410 528948 CATCTTAGAGAAGGTC e-e-e-d(10)-k-k-k 59 1255 4435 4450 528949 TCAACTGTCTCCAGGC e-e-e-d(10)-k-k-k 67 1256 4435 4450 530397 TCAACTGTCTCCAGGC k-d(10)-k-e-k-e-e 60 1256 4436 4451 528950 ATCAACTGTCTCCAGG e-e-e-d(10)-k-k-k 57 1257 4436 4452 530027 CATCAACTGTCTCCAGG e-e-k-d(10)-k-e-k-e 56 1258 4436 4451 530347 ATCAACTGTCTCCAGG e-k-d(10)-k-e-k-e 49 1257 4437 4452 530095 CATCAACTGTCTCCAG e-k-k-d(10)-k-k-e 40 354 4437 4452 530142 CATCAACTGTCTCCAG e-e-k-d(10)-k-k-e 43 354 4437 4452 530192 CATCAACTGTCTCCAG e-d-k-d(10)-k-k-e 42 354 4437 4452 530242 CATCAACTGTCTCCAG e-d-d-k-d(9)-k-k-e 0 354 4437 4452 530292 CATCAACTGTCTCCAG e-e-e-e-d(9)-k-k-e 36 354 4437 4452 530398 CATCAACTGTCTCCAG k-d(10)-k-e-k-e-e 28 354 4438 4454 530028 CACATCAACTGTCTCCA e-e-k-d(10)-k-e-k-e 57 1259 4438 4453 530348 ACATCAACTGTCTCCA e-k-d(10)-k-e-k-e 58 1260 4439 4454 530096 CACATCAACTGTCTCC e-k-k-d(10)-k-k-e 72 356 4439 4454 530143 CACATCAACTGTCTCC e-e-k-d(10)-k-k-e 74 356 4439 4454 530193 CACATCAACTGTCTCC e-d-k-d(10)-k-k-e 62 356 4439 4454 530243 CACATCAACTGTCTCC e-d-d-k-d(9)-k-k-e 34 356 4439 4454 530293 CACATCAACTGTCTCC e-e-e-e-d(9)-k-k-e 59 356 4441 4456 528951 GACACATCAACTGTCT e-e-e-d(10)-k-k-k 16 1261 4475 4490 528952 GAAGAGTGTTGCTGGA e-e-e-d(10)-k-k-k 57 1262 4477 4492 528953 CTGAAGAGTGTTGCTG e-e-e-d(10)-k-k-k 46 1263 4479 4494 528954 TACTGAAGAGTGTTGC e-e-e-d(10)-k-k-k 42 1264 4485 4500 530510 ATTATGTACTGAAGAG k-d(10)-k-e-k-e-e 53 1265 4486 4501 530504 TATTATGTACTGAAGA e-k-d(10)-k-e-k-e 25 1266 4486 4501 530511 TATTATGTACTGAAGA k-d(10)-k-e-k-e-e 31 1266 4487 4502 530432 TTATTATGTACTGAAG k-d(10)-k-e-k-e-e 15 1267 4487 4502 530463 TTATTATGTACTGAAG e-k-k-d(10)-k-k-e 20 1267 4487 4502 530472 TTATTATGTACTGAAG e-e-k-d(10)-k-k-e 17 1267 4487 4502 530480 TTATTATGTACTGAAG e-d-k-d(10)-k-k-e 4 1267 4487 4502 530488 TTATTATGTACTGAAG e-d-d-k-d(9)-k-k-e 13 1267 4487 4502 530496 TTATTATGTACTGAAG e-e-e-e-d(9)-k-k-e 0 1267 4487 4502 530505 TTATTATGTACTGAAG e-k-d(10)-k-e-k-e 37 1267 4488 4504 530063 GCTTATTATGTACTGAA e-e-k-d(10)-k-e-k-e 74 1268 4488 4503 530382 CTTATTATGTACTGAA e-k-d(10)-k-e-k-e 17 1269 4488 4503 530465 CTTATTATGTACTGAA e-k-k-d(10)-k-k-e 63 1269 BIOL0142WO 4488 4503 530473 CTTATTATGTACTGAA e-e-k-d(10)-k-k-e 45 1269 4488 4503 530481 CTTATTATGTACTGAA e-d-k-d(10)-k-k-e 14 1269 4488 4503 530489 CTTATTATGTACTGAA e-d-d-k-d(9)-k-k-e 13 1269 4488 4503 530497 CTTATTATGTACTGAA e-e-e-e-d(9)-k-k-e 7 1269 4488 4503 530512 CTTATTATGTACTGAA k-d(10)-k-e-k-e-e 21 1269 4489 4504 519638 GCTTATTATGTACTGA e-k-k-d(10)-k-k-e 86 362 4489 4504 530177 GCTTATTATGTACTGA e-e-k-d(10)-k-k-e 71 362 4489 4504 530227 GCTTATTATGTACTGA e-d-k-d(10)-k-k-e 51 362 4489 4504 530277 GCTTATTATGTACTGA e-d-d-k-d(9)-k-k-e 70 362 4489 4504 530327 GCTTATTATGTACTGA e-e-e-e-d(9)-k-k-e 61 362 4490 4505 530466 AGCTTATTATGTACTG e-k-k-d(10)-k-k-e 82 1270 4490 4505 530474 AGCTTATTATGTACTG e-e-k-d(10)-k-k-e 62 1270 4490 4505 530482 AGCTTATTATGTACTG e-d-k-d(10)-k-k-e 53 1270 4490 4505 530490 AGCTTATTATGTACTG e-d-d-k-d(9)-k-k-e 42 1270 4490 4505 530498 AGCTTATTATGTACTG e-e-e-e-d(9)-k-k-e 45 1270 4490 4505 530506 AGCTTATTATGTACTG e-k-d(10)-k-e-k-e 70 1270 4491 4506 530467 AAGCTTATTATGTACT e-k-k-d(10)-k-k-e 50 1271 4491 4506 530475 AAGCTTATTATGTACT e-e-k-d(10)-k-k-e 26 1271 4491 4506 530483 AAGCTTATTATGTACT e-d-k-d(10)-k-k-e 19 1271 4491 4506 530491 AAGCTTATTATGTACT e-d-d-k-d(9)-k-k-e 13 1271 4491 4506 530499 AAGCTTATTATGTACT e-e-e-e-d(9)-k-k-e 15 1271 4492 4507 528955 TAAGCTTATTATGTAC e-e-e-d(10)-k-k-k 0 1272 4499 4514 528956 TATCAGTTAAGCTTAT e-e-e-d(10)-k-k-k 0 1273 4502 4517 528957 GTTTATCAGTTAAGCT e-e-e-d(10)-k-k-k 31 1274 4539 4554 530433 CAATGGTAAGCCCAAG k-d(10)-k-e-k-e-e 62 1275 4540 4555 528958 CCAATGGTAAGCCCAA e-e-e-d(10)-k-k-k 66 1276 4540 4556 530056 CCCAATGGTAAGCCCAA e-e-k-d(10)-k-e-k-e 73 1277 4540 4555 530383 CCAATGGTAAGCCCAA e-k-d(10)-k-e-k-e 64 1276 4541 4556 518345 CCCAATGGTAAGCCCA e-e-e-d(10)-k-k-k 80 366 4541 4556 519636 CCCAATGGTAAGCCCA e-k-k-d(10)-k-k-e 90 366 4541 4556 530178 CCCAATGGTAAGCCCA e-e-k-d(10)-k-k-e 86 366 4541 4556 530228 CCCAATGGTAAGCCCA e-d-k-d(10)-k-k-e 77 366 4541 4556 530278 CCCAATGGTAAGCCCA e-d-d-k-d(9)-k-k-e 86 366 4541 4556 530328 CCCAATGGTAAGCCCA e-e-e-e-d(9)-k-k-e 80 366 4542 4557 528959 ACCCAATGGTAAGCCC e-e-e-d(10)-k-k-k 73 1277 4544 4559 528960 AAACCCAATGGTAAGC e-e-e-d(10)-k-k-k 43 1278 4545 4560 528961 TAAACCCAATGGTAAG e-e-e-d(10)-k-k-k 18 1279 4546 4561 528962 TTAAACCCAATGGTAA e-e-e-d(10)-k-k-k 13 1280 4547 4562 528963 TTTAAACCCAATGGTA e-e-e-d(10)-k-k-k 2 1281 4554 4569 528964 CCTATGATTTAAACCC e-e-e-d(10)-k-k-k 17 1282 4558 4573 528965 GGTCCCTATGATTTAA e-e-e-d(10)-k-k-k 31 1283 4559 4574 528966 AGGTCCCTATGATTTA e-e-e-d(10)-k-k-k 22 1284 4615 4630 528967 CCTAAGGCCATGAACT e-e-e-d(10)-k-k-k 19 374 4616 4631 528968 ACCTAAGGCCATGAAC e-e-e-d(10)-k-k-k 25 1285 4617 4632 528969 TACCTAAGGCCATGAA e-e-e-d(10)-k-k-k 41 1286 BIOL0142WO 4618 4633 528970 CTACCTAAGGCCATGA e-e-e-d(10)-k-k-k 55 1287 4619 4634 528971 GCTACCTAAGGCCATG e-e-e-d(10)-k-k-k 66 1288 4620 4635 528972 TGCTACCTAAGGCCAT e-e-e-d(10)-k-k-k 56 1289 4621 4636 528973 ATGCTACCTAAGGCCA e-e-e-d(10)-k-k-k 71 1290 4622 4637 528974 CATGCTACCTAAGGCC e-e-e-d(10)-k-k-k 58 1291 4623 4638 528975 ACATGCTACCTAAGGC e-e-e-d(10)-k-k-k 34 1292 4636 4651 528976 GTTAAGACCAGATACA e-e-e-d(10)-k-k-k 45 1293 4637 4652 528977 AGTTAAGACCAGATAC e-e-e-d(10)-k-k-k 40 1294 4638 4653 528978 GAGTTAAGACCAGATA e-e-e-d(10)-k-k-k 40 1295 4639 4654 528979 AGAGTTAAGACCAGAT e-e-e-d(10)-k-k-k 62 1296 4644 4659 530399 CAATCAGAGTTAAGAC k-d(10)-k-e-k-e-e 36 1297 4645 4661 530029 TACAATCAGAGTTAAGA e-e-k-d(10)-k-e-k-e 29 1298 4645 4660 530349 ACAATCAGAGTTAAGA e-k-d(10)-k-e-k-e 33 1299 4646 4661 528980 TACAATCAGAGTTAAG e-e-e-d(10)-k-k-k 0 378 4646 4661 530097 TACAATCAGAGTTAAG e-k-k-d(10)-k-k-e 41 378 4646 4661 530144 TACAATCAGAGTTAAG e-e-k-d(10)-k-k-e 16 378 4646 4661 530194 TACAATCAGAGTTAAG e-d-k-d(10)-k-k-e 28 378 4646 4661 530244 TACAATCAGAGTTAAG e-d-d-k-d(9)-k-k-e 0 378 4646 4661 530294 TACAATCAGAGTTAAG e-e-e-e-d(9)-k-k-e 7 378 4648 4663 528981 GCTACAATCAGAGTTA e-e-e-d(10)-k-k-k 52 1300 4649 4664 528982 TGCTACAATCAGAGTT e-e-e-d(10)-k-k-k 47 1301 4650 4665 528983 TTGCTACAATCAGAGT e-e-e-d(10)-k-k-k 44 1302 4662 4677 530400 CTCTCAGAACTTTTGC k-d(10)-k-e-k-e-e 65 1303 4663 4679 530030 TCCTCTCAGAACTTTTG e-e-k-d(10)-k-e-k-e 47 1304 4663 4678 530350 CCTCTCAGAACTTTTG e-k-d(10)-k-e-k-e 54 1305 4664 4679 530098 TCCTCTCAGAACTTTT e-k-k-d(10)-k-k-e 42 380 4664 4679 530145 TCCTCTCAGAACTTTT e-e-k-d(10)-k-k-e 38 380 4664 4679 530195 TCCTCTCAGAACTTTT e-d-k-d(10)-k-k-e 43 380 4664 4679 530245 TCCTCTCAGAACTTTT e-d-d-k-d(9)-k-k-e 28 380 4664 4679 530295 TCCTCTCAGAACTTTT e-e-e-e-d(9)-k-k-e 39 380 4770 4785 528984 CCCACGGGATTCCCTC e-e-e-d(10)-k-k-k 39 1306 4771 4786 528985 ACCCACGGGATTCCCT e-e-e-d(10)-k-k-k 36 1307 4772 4787 528986 AACCCACGGGATTCCC e-e-e-d(10)-k-k-k 47 1308 4773 4788 528987 CAACCCACGGGATTCC e-e-e-d(10)-k-k-k 39 1309 4774 4789 528988 GCAACCCACGGGATTC e-e-e-d(10)-k-k-k 48 1310 4775 4790 528989 AGCAACCCACGGGATT e-e-e-d(10)-k-k-k 40 1311 4777 4792 528990 TAAGCAACCCACGGGA e-e-e-d(10)-k-k-k 27 1312 4778 4793 528991 GTAAGCAACCCACGGG e-e-e-d(10)-k-k-k 47 1313 4779 4794 528992 GGTAAGCAACCCACGG e-e-e-d(10)-k-k-k 42 1314 4780 4795 528993 AGGTAAGCAACCCACG e-e-e-d(10)-k-k-k 54 1315 4780 4795 530434 AGGTAAGCAACCCACG k-d(10)-k-e-k-e-e 51 1315 4781 4796 528994 TAGGTAAGCAACCCAC e-e-e-d(10)-k-k-k 53 1316 4781 4797 530064 GTAGGTAAGCAACCCAC e-e-k-d(10)-k-e-k-e 53 1317 4781 4796 530384 TAGGTAAGCAACCCAC e-k-d(10)-k-e-k-e 48 1316 4782 4797 528995 GTAGGTAAGCAACCCA e-e-e-d(10)-k-k-k 64 388 BIOL0142WO 4782 4797 530129 GTAGGTAAGCAACCCA e-k-k-d(10)-k-k-e 79 388 4782 4797 530179 GTAGGTAAGCAACCCA e-e-k-d(10)-k-k-e 74 388 4782 4797 530229 GTAGGTAAGCAACCCA e-d-k-d(10)-k-k-e 64 388 4782 4797 530279 GTAGGTAAGCAACCCA e-d-d-k-d(9)-k-k-e 55 388 4782 4797 530329 GTAGGTAAGCAACCCA e-e-e-e-d(9)-k-k-e 61 388 4784 4799 528996 AGGTAGGTAAGCAACC e-e-e-d(10)-k-k-k 21 1318 4788 4803 528997 TTATAGGTAGGTAAGC e-e-e-d(10)-k-k-k 10 1319 4792 4807 528998 CACCTTATAGGTAGGT e-e-e-d(10)-k-k-k 22 1320 4794 4809 528999 ACCACCTTATAGGTAG e-e-e-d(10)-k-k-k 15 1321 4797 4812 529000 TAAACCACCTTATAGG e-e-e-d(10)-k-k-k 0 1322 4798 4813 529001 ATAAACCACCTTATAG e-e-e-d(10)-k-k-k 7 1323 4810 4825 529002 GGACAGCAGCTTATAA e-e-e-d(10)-k-k-k 12 1324 4811 4826 529003 AGGACAGCAGCTTATA e-e-e-d(10)-k-k-k 40 1325 4811 4826 530401 AGGACAGCAGCTTATA k-d(10)-k-e-k-e-e 41 1325 4812 4827 529004 CAGGACAGCAGCTTAT e-e-e-d(10)-k-k-k 38 1326 4812 4828 530031 CCAGGACAGCAGCTTAT e-e-k-d(10)-k-e-k-e 58 1327 4812 4827 530351 CAGGACAGCAGCTTAT e-k-d(10)-k-e-k-e 58 1326 4812 4827 530402 CAGGACAGCAGCTTAT k-d(10)-k-e-k-e-e 60 1326 4813 4829 530032 GCCAGGACAGCAGCTTA e-e-k-d(10)-k-e-k-e 74 1328 4813 4828 530099 CCAGGACAGCAGCTTA e-k-k-d(10)-k-k-e 73 1329 4813 4828 530146 CCAGGACAGCAGCTTA e-e-k-d(10)-k-k-e 70 1329 4813 4828 530196 CCAGGACAGCAGCTTA e-d-k-d(10)-k-k-e 67 1329 4813 4828 530246 CCAGGACAGCAGCTTA e-d-d-k-d(9)-k-k-e 39 1329 4813 4828 530296 CCAGGACAGCAGCTTA e-e-e-e-d(9)-k-k-e 67 1329 4813 4828 530352 CCAGGACAGCAGCTTA e-k-d(10)-k-e-k-e 67 1329 4814 4829 530100 GCCAGGACAGCAGCTT e-k-k-d(10)-k-k-e 77 1330 4814 4829 530147 GCCAGGACAGCAGCTT e-e-k-d(10)-k-k-e 84 1330 4814 4829 530197 GCCAGGACAGCAGCTT e-d-k-d(10)-k-k-e 71 1330 4814 4829 530247 GCCAGGACAGCAGCTT e-d-d-k-d(9)-k-k-e 53 1330 4814 4829 530297 GCCAGGACAGCAGCTT e-e-e-e-d(9)-k-k-e 75 1330 4814 4829 530403 GCCAGGACAGCAGCTT k-d(10)-k-e-k-e-e 77 1330 4815 4831 530033 TGGCCAGGACAGCAGCT e-e-k-d(10)-k-e-k-e 65 1331 4815 4830 530353 GGCCAGGACAGCAGCT e-k-d(10)-k-e-k-e 83 1332 4816 4831 530101 TGGCCAGGACAGCAGC e-k-k-d(10)-k-k-e 59 1333 4816 4831 530148 TGGCCAGGACAGCAGC e-e-k-d(10)-k-k-e 79 1333 4816 4831 530198 TGGCCAGGACAGCAGC e-d-k-d(10)-k-k-e 54 1333 4816 4831 530248 TGGCCAGGACAGCAGC e-d-d-k-d(9)-k-k-e 32 1333 4816 4831 530298 TGGCCAGGACAGCAGC e-e-e-e-d(9)-k-k-e 73 1333 4827 4842 530404 TTTGAATGCAGTGGCC k-d(10)-k-e-k-e-e 67 1334 4828 4844 530034 AATTTGAATGCAGTGGC e-e-k-d(10)-k-e-k-e 69 1335 4828 4843 530354 ATTTGAATGCAGTGGC e-k-d(10)-k-e-k-e 85 1336 4828 4843 530405 ATTTGAATGCAGTGGC k-d(10)-k-e-k-e-e 55 1336 4829 4845 530035 GAATTTGAATGCAGTGG e-e-k-d(10)-k-e-k-e 69 1337 4829 4844 530102 AATTTGAATGCAGTGG e-k-k-d(10)-k-k-e 71 1338 4829 4844 530149 AATTTGAATGCAGTGG e-e-k-d(10)-k-k-e 70 1338 BIOL0142WO 4829 4844 530199 AATTTGAATGCAGTGG e-d-k-d(10)-k-k-e 58 1338 4829 4844 530249 AATTTGAATGCAGTGG e-d-d-k-d(9)-k-k-e 47 1338 4829 4844 530299 AATTTGAATGCAGTGG e-e-e-e-d(9)-k-k-e 47 1338 4829 4844 530355 AATTTGAATGCAGTGG e-k-d(10)-k-e-k-e 72 1338 4830 4845 530103 GAATTTGAATGCAGTG e-k-k-d(10)-k-k-e 77 390 4830 4845 530150 GAATTTGAATGCAGTG e-e-k-d(10)-k-k-e 73 390 4830 4845 530200 GAATTTGAATGCAGTG e-d-k-d(10)-k-k-e 63 390 4830 4845 530250 GAATTTGAATGCAGTG e-d-d-k-d(9)-k-k-e 59 390 4830 4845 530300 GAATTTGAATGCAGTG e-e-e-e-d(9)-k-k-e 65 390 4842 4857 530435 AAGTACACATTGGAAT k-d(10)-k-e-k-e-e 62 1339 4843 4859 530057 TGAAGTACACATTGGAA e-e-k-d(10)-k-e-k-e 69 1340 4843 4858 530385 GAAGTACACATTGGAA e-k-d(10)-k-e-k-e 70 1341 4844 4859 529005 TGAAGTACACATTGGA e-e-e-d(10)-k-k-k 64 392 4844 4859 530130 TGAAGTACACATTGGA e-k-k-d(10)-k-k-e 85 392 4844 4859 530180 TGAAGTACACATTGGA e-e-k-d(10)-k-k-e 82 392 4844 4859 530230 TGAAGTACACATTGGA e-d-k-d(10)-k-k-e 65 392 4844 4859 530280 TGAAGTACACATTGGA e-d-d-k-d(9)-k-k-e 75 392 4844 4859 530330 TGAAGTACACATTGGA e-e-e-e-d(9)-k-k-e 52 392 4852 4867 529006 TTACACTATGAAGTAC e-e-e-d(10)-k-k-k 16 1342 4929 4944 529007 AGTTAAAGTAGATACA e-e-e-d(10)-k-k-k 0 1343 4934 4949 529008 CTGGAAGTTAAAGTAG e-e-e-d(10)-k-k-k 30 397 4943 4958 529009 CGTTTATTTCTGGAAG e-e-e-d(10)-k-k-k 52 1344 4957 4972 529010 CGGTTCCTATATAACG e-e-e-d(10)-k-k-k 21 1345 4958 4973 529011 ACGGTTCCTATATAAC e-e-e-d(10)-k-k-k 10 1346 Table 14 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 Human Human SEQ Start Stop ISIS No Sequence Chemistry ID inhibition Site Site NO 1359 1374 529012 GTCATCCCGAAGAGTC e-e-e-d(10)-k-k-k 34 1347 1386 1401 529013 CCCGAGTCCCTTCCGA e-e-e-d(10)-k-k-k 18 1348 1390 1405 529014 GCGCCCCGAGTCCCTT e-e-e-d(10)-k-k-k 53 1349 1412 1427 529015 CGAAGAACGAAACTTC e-e-e-d(10)-k-k-k 8 1350 1418 1433 529016 TTTCTCCGAAGAACGA e-e-e-d(10)-k-k-k 31 1351 1461 1476 529017 CGAGTGCGCCCTCGCC e-e-e-d(10)-k-k-k 52 1352 1548 1563 529018 GTGACAGTCGCTCCGG e-e-e-d(10)-k-k-k 30 1353 1549 1564 529019 CGTGACAGTCGCTCCG e-e-e-d(10)-k-k-k 31 1354 1590 1605 529020 GCGCTTTCCGACCCCC e-e-e-d(10)-k-k-k 45 1355 1790 1805 529021 GTACCGGTCTGTCAAT e-e-e-d(10)-k-k-k 23 1356 e-e-e-d(10)-k-k-k 1794 1809 529022 AAGAGTACCGGTCTGT 69 1357 e-e-e-d(10)-k-k-k 1796 1811 529023 GAAAGAGTACCGGTCT 72 1358 e-e-e-d(10)-k-k-k 1906 1921 529024 CTGGCTTGACGGGTTG 64 1359 e-e-e-d(10)-k-k-k 1907 1922 529025 GCTGGCTTGACGGGTT 73 1360 e-e-e-d(10)-k-k-k 1966 1981 529026 CCGACTTTACCAGGTA 78 1361 BIOL0142WO e-e-e-d(10)-k-k-k 1968 1983 529027 GGCCGACTTTACCAGG 92 1362 e-e-e-d(10)-k-k-k 1972 1987 529028 TTCTGGCCGACTTTAC 13 1363 e-e-e-d(10)-k-k-k 2031 2046 529029 CGTCCTATGCAATTAA 24 1364 e-e-e-d(10)-k-k-k 2039 2054 529030 GTTCATTCCGTCCTAT 41 1365 e-e-e-d(10)-k-k-k 2198 2213 529031 GACGGTTTGAATCTTG 40 1366 e-e-e-d(10)-k-k-k 2201 2216 529032 GGCGACGGTTTGAATC 37 1367 e-e-e-d(10)-k-k-k 2204 2219 529033 TTGGGCGACGGTTTGA 31 1368 e-e-e-d(10)-k-k-k 2207 2222 529034 AACTTGGGCGACGGTT 54 1369 e-e-e-d(10)-k-k-k 2253 2268 529035 CGACCTGATATGGCAC 56 1370 2255 2270 529036 AACGACCTGATATGGC e-e-e-d(10)-k-k-k 52 1371 2257 2272 529037 ACAACGACCTGATATG e-e-e-d(10)-k-k-k 24 1372 2338 2353 530406 ATACAGTAAGACCAGC k-d(10)-k-e-k-e-e 65 1373 2339 2355 530036 ACATACAGTAAGACCAG e-e-k-d(10)-k-e-k-e 58 1374 2339 2354 530356 CATACAGTAAGACCAG e-k-d(10)-k-e-k-e 65 1375 2340 2355 530104 ACATACAGTAAGACCA e-k-k-d(10)-k-k-e 67 1376 2340 2355 530151 ACATACAGTAAGACCA e-e-k-d(10)-k-k-e 64 1376 2340 2355 530201 ACATACAGTAAGACCA e-d-k-d(10)-k-k-e 42 1376 2340 2355 530251 ACATACAGTAAGACCA e-d-d-k-d(9)-k-k-e 58 1376 2340 2355 530301 ACATACAGTAAGACCA e-e-e-e-d(9)-k-k-e 56 1376 2383 2398 530407 AAAATTTACAACCCAT k-d(10)-k-e-k-e-e 9 1377 2384 2400 530037 CAAAAATTTACAACCCA e-e-k-d(10)-k-e-k-e 42 1378 2384 2399 530357 AAAAATTTACAACCCA e-k-d(10)-k-e-k-e 34 1379 2385 2400 530105 CAAAAATTTACAACCC e-k-k-d(10)-k-k-e 40 1380 2385 2400 530152 CAAAAATTTACAACCC e-e-k-d(10)-k-k-e 33 1380 2385 2400 530202 CAAAAATTTACAACCC e-d-k-d(10)-k-k-e 10 1380 2385 2400 530252 CAAAAATTTACAACCC e-d-d-k-d(9)-k-k-e 29 1380 2385 2400 530302 CAAAAATTTACAACCC e-e-e-e-d(9)-k-k-e 14 1380 2408 2423 530408 AATGCTTTATCAGCAC k-d(10)-k-e-k-e-e 36 1381 2409 2425 530038 CCAATGCTTTATCAGCA e-e-k-d(10)-k-e-k-e 71 1382 2409 2424 530358 CAATGCTTTATCAGCA e-k-d(10)-k-e-k-e 46 1383 2410 2425 530106 CCAATGCTTTATCAGC e-k-k-d(10)-k-k-e 70 1384 2410 2425 530153 CCAATGCTTTATCAGC e-e-k-d(10)-k-k-e 50 1384 2410 2425 530203 CCAATGCTTTATCAGC e-d-k-d(10)-k-k-e 43 1384 2410 2425 530253 CCAATGCTTTATCAGC e-d-d-k-d(9)-k-k-e 33 1384 2410 2425 530303 CCAATGCTTTATCAGC e-e-e-e-d(9)-k-k-e 40 1384 2669 2684 530409 ACTAAAATCAAGGCTC k-d(10)-k-e-k-e-e 42 1385 2670 2686 530039 AGACTAAAATCAAGGCT e-e-k-d(10)-k-e-k-e 73 1386 2670 2685 530359 GACTAAAATCAAGGCT e-k-d(10)-k-e-k-e 82 1387 2671 2686 530107 AGACTAAAATCAAGGC e-k-k-d(10)-k-k-e 77 1388 2671 2686 530154 AGACTAAAATCAAGGC e-e-k-d(10)-k-k-e 57 1388 2671 2686 530204 AGACTAAAATCAAGGC e-d-k-d(10)-k-k-e 28 1388 2671 2686 530254 AGACTAAAATCAAGGC e-d-d-k-d(9)-k-k-e 3 1388 2671 2686 530304 AGACTAAAATCAAGGC e-e-e-e-d(9)-k-k-e 22 1388 2703 2718 530429 AATGGTTCTTTGTGAT k-d(10)-k-e-k-e-e 60 1389 2704 2720 530065 CTAATGGTTCTTTGTGA e-e-k-d(10)-k-e-k-e 70 1390 BIOL0142WO 2704 2719 530379 TAATGGTTCTTTGTGA e-k-d(10)-k-e-k-e 54 1391 2705 2720 530127 CTAATGGTTCTTTGTG e-k-k-d(10)-k-k-e 80 411 2705 2720 530174 CTAATGGTTCTTTGTG e-e-k-d(10)-k-k-e 69 411 2705 2720 530224 CTAATGGTTCTTTGTG e-d-k-d(10)-k-k-e 32 411 2705 2720 530274 CTAATGGTTCTTTGTG e-d-d-k-d(9)-k-k-e 38 411 2705 2720 530324 CTAATGGTTCTTTGTG e-e-e-e-d(9)-k-k-e 32 411 5000 5015 530410 CTGAAATTCCTTGGTC k-d(10)-k-e-k-e-e 53 1392 5001 5017 530040 AACTGAAATTCCTTGGT e-e-k-d(10)-k-e-k-e 67 1393 5001 5016 530360 ACTGAAATTCCTTGGT e-k-d(10)-k-e-k-e 70 1394 5002 5017 530108 AACTGAAATTCCTTGG e-k-k-d(10)-k-k-e 70 1395 5002 5017 530155 AACTGAAATTCCTTGG e-e-k-d(10)-k-k-e 53 1395 5002 5017 530205 AACTGAAATTCCTTGG e-d-k-d(10)-k-k-e 44 1395 5002 5017 530255 AACTGAAATTCCTTGG e-d-d-k-d(9)-k-k-e 33 1395 5002 5017 530305 AACTGAAATTCCTTGG e-e-e-e-d(9)-k-k-e 22 1395 5699 5714 530411 ACTCTTTCAGTGGTTT k-d(10)-k-e-k-e-e 91 1396 5700 5716 530041 GTACTCTTTCAGTGGTT e-e-k-d(10)-k-e-k-e 89 1397 5700 5715 530361 TACTCTTTCAGTGGTT e-k-d(10)-k-e-k-e 88 1398 5701 5716 530109 GTACTCTTTCAGTGGT e-k-k-d(10)-k-k-e 89 1399 5701 5716 530156 GTACTCTTTCAGTGGT e-e-k-d(10)-k-k-e 91 1399 5701 5716 530206 GTACTCTTTCAGTGGT e-d-k-d(10)-k-k-e 89 1399 5701 5716 530256 GTACTCTTTCAGTGGT e-d-d-k-d(9)-k-k-e 33 1399 5701 5716 530306 GTACTCTTTCAGTGGT e-e-e-e-d(9)-k-k-e 83 1399 5883 5898 529038 CTACACTTTACGCTTA e-e-e-d(10)-k-k-k 9 1400 6474 6489 530436 AATTCATTCTTCCATA k-d(10)-k-e-k-e-e 49 1401 6475 6491 530066 GAAATTCATTCTTCCAT e-e-k-d(10)-k-e-k-e 82 1402 6475 6490 530386 AAATTCATTCTTCCAT e-k-d(10)-k-e-k-e 53 1403 6476 6491 530131 GAAATTCATTCTTCCA e-k-k-d(10)-k-k-e 97 413 6476 6491 530181 GAAATTCATTCTTCCA e-e-k-d(10)-k-k-e 82 413 6476 6491 530231 GAAATTCATTCTTCCA e-d-k-d(10)-k-k-e 75 413 6476 6491 530281 GAAATTCATTCTTCCA e-d-d-k-d(9)-k-k-e 69 413 6476 6491 530331 GAAATTCATTCTTCCA e-e-e-e-d(9)-k-k-e 53 413 6846 6861 529039 TTAAAGAGTTGCGGTA e-e-e-d(10)-k-k-k 31 1404 6847 6862 529040 ATTAAAGAGTTGCGGT e-e-e-d(10)-k-k-k 34 1405 8078 8093 530412 AGATTTACCTTCCTTA k-d(10)-k-e-k-e-e 50 1406 8079 8095 530042 GCAGATTTACCTTCCTT e-e-k-d(10)-k-e-k-e 78 1407 8079 8094 530362 CAGATTTACCTTCCTT e-k-d(10)-k-e-k-e 76 1408 8080 8095 530110 GCAGATTTACCTTCCT e-k-k-d(10)-k-k-e 84 1409 8080 8095 530157 GCAGATTTACCTTCCT e-e-k-d(10)-k-k-e 69 1409 8080 8095 530207 GCAGATTTACCTTCCT e-d-k-d(10)-k-k-e 55 1409 8080 8095 530257 GCAGATTTACCTTCCT e-d-d-k-d(9)-k-k-e 39 1409 8080 8095 530307 GCAGATTTACCTTCCT e-e-e-e-d(9)-k-k-e 77 1409 9123 9138 530413 GCCCCTATGTATAAGC k-d(10)-k-e-k-e-e 73 1410 9124 9140 530043 CTGCCCCTATGTATAAG e-e-k-d(10)-k-e-k-e 42 1411 9124 9139 530363 TGCCCCTATGTATAAG e-k-d(10)-k-e-k-e 25 1412 9125 9140 530111 CTGCCCCTATGTATAA e-k-k-d(10)-k-k-e 35 1413 BIOL0142WO 9125 9140 530158 CTGCCCCTATGTATAA e-e-k-d(10)-k-k-e 36 1413 9125 9140 530208 CTGCCCCTATGTATAA e-d-k-d(10)-k-k-e 14 1413 9125 9140 530258 CTGCCCCTATGTATAA e-d-d-k-d(9)-k-k-e 5 1413 9125 9140 530308 CTGCCCCTATGTATAA e-e-e-e-d(9)-k-k-e 25 1413 9862 9877 530414 TTCTTCCTGAGACACA k-d(10)-k-e-k-e-e 61 1414 9863 9879 530044 GCTTCTTCCTGAGACAC e-e-k-d(10)-k-e-k-e 78 1415 9863 9878 530364 CTTCTTCCTGAGACAC e-k-d(10)-k-e-k-e 59 1416 9864 9879 530112 GCTTCTTCCTGAGACA e-k-k-d(10)-k-k-e 84 1417 9864 9879 530159 GCTTCTTCCTGAGACA e-e-k-d(10)-k-k-e 69 1417 9864 9879 530209 GCTTCTTCCTGAGACA e-d-k-d(10)-k-k-e 54 1417 9864 9879 530259 GCTTCTTCCTGAGACA e-d-d-k-d(9)-k-k-e 57 1417 9864 9879 530309 GCTTCTTCCTGAGACA e-e-e-e-d(9)-k-k-e 46 1417 9864 9879 530415 GCTTCTTCCTGAGACA k-d(10)-k-e-k-e-e 51 1417 9865 9881 530045 TGGCTTCTTCCTGAGAC e-e-k-d(10)-k-e-k-e 73 1418 9865 9880 530365 GGCTTCTTCCTGAGAC e-k-d(10)-k-e-k-e 78 1419 9866 9881 530113 TGGCTTCTTCCTGAGA e-k-k-d(10)-k-k-e 60 1420 9866 9881 530160 TGGCTTCTTCCTGAGA e-e-k-d(10)-k-k-e 54 1420 9866 9881 530210 TGGCTTCTTCCTGAGA e-d-k-d(10)-k-k-e 28 1420 9866 9881 530260 TGGCTTCTTCCTGAGA e-d-d-k-d(9)-k-k-e 0 1420 9866 9881 530310 TGGCTTCTTCCTGAGA e-e-e-e-d(9)-k-k-e 26 1420 9873 9888 530416 CTCCTGTTGGCTTCTT k-d(10)-k-e-k-e-e 57 1421 9874 9890 530046 TCCTCCTGTTGGCTTCT e-e-k-d(10)-k-e-k-e 76 1422 9874 9889 530366 CCTCCTGTTGGCTTCT e-k-d(10)-k-e-k-e 75 1423 9874 9889 530417 CCTCCTGTTGGCTTCT k-d(10)-k-e-k-e-e 66 1423 9875 9891 530047 TTCCTCCTGTTGGCTTC e-e-k-d(10)-k-e-k-e 75 1424 9875 9890 530114 TCCTCCTGTTGGCTTC e-k-k-d(10)-k-k-e 80 1425 9875 9890 530161 TCCTCCTGTTGGCTTC e-e-k-d(10)-k-k-e 81 1425 9875 9890 530211 TCCTCCTGTTGGCTTC e-d-k-d(10)-k-k-e 73 1425 9875 9890 530261 TCCTCCTGTTGGCTTC e-d-d-k-d(9)-k-k-e 78 1425 9875 9890 530311 TCCTCCTGTTGGCTTC e-e-e-e-d(9)-k-k-e 82 1425 9875 9890 530367 TCCTCCTGTTGGCTTC e-k-d(10)-k-e-k-e 80 1425 9876 9891 530115 TTCCTCCTGTTGGCTT e-k-k-d(10)-k-k-e 74 1426 9876 9891 530162 TTCCTCCTGTTGGCTT e-e-k-d(10)-k-k-e 68 1426 9876 9891 530212 TTCCTCCTGTTGGCTT e-d-k-d(10)-k-k-e 58 1426 9876 9891 530262 TTCCTCCTGTTGGCTT e-d-d-k-d(9)-k-k-e 23 1426 9876 9891 530312 TTCCTCCTGTTGGCTT e-e-e-e-d(9)-k-k-e 52 1426 9876 9891 530418 TTCCTCCTGTTGGCTT k-d(10)-k-e-k-e-e 59 1426 9877 9893 530048 GGTTCCTCCTGTTGGCT e-e-k-d(10)-k-e-k-e 82 1427 9877 9892 530368 GTTCCTCCTGTTGGCT e-k-d(10)-k-e-k-e 85 1428 9878 9893 530116 GGTTCCTCCTGTTGGC e-k-k-d(10)-k-k-e 90 1429 9878 9893 530163 GGTTCCTCCTGTTGGC e-e-k-d(10)-k-k-e 79 1429 9878 9893 530213 GGTTCCTCCTGTTGGC e-d-k-d(10)-k-k-e 72 1429 9878 9893 530263 GGTTCCTCCTGTTGGC e-d-d-k-d(9)-k-k-e 73 1429 9878 9893 530313 GGTTCCTCCTGTTGGC e-e-e-e-d(9)-k-k-e 61 1429 9964 9979 529041 GTAATGTGCAGCAATC e-e-e-d(10)-k-k-k 53 1430 BIOL0142WO 9991 10006 530711 ATGTGAGGGCACATTT e-e-e-d(10)-k-k-k 25 1431 10286 10301 529042 CCAAGCCGTTTATTTC e-e-e-d(10)-k-k-k 44 1432 10291 10306 529043 GGAAGCCAAGCCGTTT e-e-e-d(10)-k-k-k 39 1433 11261 11276 530413 GCCCCTATGTATAAGC k-d(10)-k-e-k-e-e 73 1410 11262 11278 530043 CTGCCCCTATGTATAAG e-e-k-d(10)-k-e-k-e 42 1411 11262 11277 530363 TGCCCCTATGTATAAG e-k-d(10)-k-e-k-e 25 1412 11263 11278 530111 CTGCCCCTATGTATAA e-k-k-d(10)-k-k-e 35 1413 11263 11278 530158 CTGCCCCTATGTATAA e-e-k-d(10)-k-k-e 36 1413 11263 11278 530208 CTGCCCCTATGTATAA e-d-k-d(10)-k-k-e 14 1413 11263 11278 530258 CTGCCCCTATGTATAA e-d-d-k-d(9)-k-k-e 5 1413 11263 11278 530308 CTGCCCCTATGTATAA e-e-e-e-d(9)-k-k-e 25 1413 12345 12360 530414 TTCTTCCTGAGACACA k-d(10)-k-e-k-e-e 61 1414 12346 12362 530044 GCTTCTTCCTGAGACAC e-e-k-d(10)-k-e-k-e 78 1415 12346 12361 530364 CTTCTTCCTGAGACAC e-k-d(10)-k-e-k-e 59 1416 12347 12362 530112 GCTTCTTCCTGAGACA e-k-k-d(10)-k-k-e 84 1417 12347 12362 530159 GCTTCTTCCTGAGACA e-e-k-d(10)-k-k-e 69 1417 12347 12362 530209 GCTTCTTCCTGAGACA e-d-k-d(10)-k-k-e 54 1417 12347 12362 530259 GCTTCTTCCTGAGACA e-d-d-k-d(9)-k-k-e 57 1417 12347 12362 530309 GCTTCTTCCTGAGACA e-e-e-e-d(9)-k-k-e 46 1417 12347 12362 530415 GCTTCTTCCTGAGACA k-d(10)-k-e-k-e-e 51 1417 12348 12364 530045 TGGCTTCTTCCTGAGAC e-e-k-d(10)-k-e-k-e 73 1418 12348 12363 530365 GGCTTCTTCCTGAGAC e-k-d(10)-k-e-k-e 78 1419 12349 12364 530113 TGGCTTCTTCCTGAGA e-k-k-d(10)-k-k-e 60 1420 12349 12364 530160 TGGCTTCTTCCTGAGA e-e-k-d(10)-k-k-e 54 1420 12349 12364 530210 TGGCTTCTTCCTGAGA e-d-k-d(10)-k-k-e 28 1420 12349 12364 530260 TGGCTTCTTCCTGAGA e-d-d-k-d(9)-k-k-e 0 1420 12349 12364 530310 TGGCTTCTTCCTGAGA e-e-e-e-d(9)-k-k-e 26 1420 12356 12371 530416 CTCCTGTTGGCTTCTT k-d(10)-k-e-k-e-e 57 1421 12357 12373 530046 TCCTCCTGTTGGCTTCT e-e-k-d(10)-k-e-k-e 76 1422 12357 12372 530366 CCTCCTGTTGGCTTCT e-k-d(10)-k-e-k-e 75 1423 12357 12372 530417 CCTCCTGTTGGCTTCT k-d(10)-k-e-k-e-e 66 1423 12358 12374 530047 TTCCTCCTGTTGGCTTC e-e-k-d(10)-k-e-k-e 75 1424 12358 12373 530114 TCCTCCTGTTGGCTTC e-k-k-d(10)-k-k-e 80 1425 12358 12373 530161 TCCTCCTGTTGGCTTC e-e-k-d(10)-k-k-e 81 1425 12358 12373 530211 TCCTCCTGTTGGCTTC e-d-k-d(10)-k-k-e 73 1425 12358 12373 530261 TCCTCCTGTTGGCTTC e-d-d-k-d(9)-k-k-e 78 1425 12358 12373 530311 TCCTCCTGTTGGCTTC e-e-e-e-d(9)-k-k-e 82 1425 12358 12373 530367 TCCTCCTGTTGGCTTC e-k-d(10)-k-e-k-e 80 1425 12359 12374 530115 TTCCTCCTGTTGGCTT e-k-k-d(10)-k-k-e 74 1426 12359 12374 530162 TTCCTCCTGTTGGCTT e-e-k-d(10)-k-k-e 68 1426 12359 12374 530212 TTCCTCCTGTTGGCTT e-d-k-d(10)-k-k-e 58 1426 12359 12374 530262 TTCCTCCTGTTGGCTT e-d-d-k-d(9)-k-k-e 23 1426 12359 12374 530312 TTCCTCCTGTTGGCTT e-e-e-e-d(9)-k-k-e 52 1426 12359 12374 530418 TTCCTCCTGTTGGCTT k-d(10)-k-e-k-e-e 59 1426 12360 12376 530048 GGTTCCTCCTGTTGGCT e-e-k-d(10)-k-e-k-e 82 1427 BIOL0142WO 12360 12375 530368 GTTCCTCCTGTTGGCT e-k-d(10)-k-e-k-e 85 1428 12361 12376 530116 GGTTCCTCCTGTTGGC e-k-k-d(10)-k-k-e 90 1429 12361 12376 530163 GGTTCCTCCTGTTGGC e-e-k-d(10)-k-k-e 79 1429 12361 12376 530213 GGTTCCTCCTGTTGGC e-d-k-d(10)-k-k-e 72 1429 12361 12376 530263 GGTTCCTCCTGTTGGC e-d-d-k-d(9)-k-k-e 73 1429 12361 12376 530313 GGTTCCTCCTGTTGGC e-e-e-e-d(9)-k-k-e 61 1429 12586 12601 530710 TACAATTCCTGCCTGT e-e-e-d(10)-k-k-k 18 1434 15467 15482 530437 AGCTTTTCTATGAAAA k-d(10)-k-e-k-e-e 5 1435 15468 15484 530067 CAAGCTTTTCTATGAAA e-e-k-d(10)-k-e-k-e 53 1436 15468 15483 530387 AAGCTTTTCTATGAAA e-k-d(10)-k-e-k-e 24 1437 15469 15484 530132 CAAGCTTTTCTATGAA e-k-k-d(10)-k-k-e 74 423 15469 15484 530182 CAAGCTTTTCTATGAA e-e-k-d(10)-k-k-e 48 423 15469 15484 530232 CAAGCTTTTCTATGAA e-d-k-d(10)-k-k-e 21 423 15469 15484 530282 CAAGCTTTTCTATGAA e-d-d-k-d(9)-k-k-e 19 423 15469 15484 530332 CAAGCTTTTCTATGAA e-e-e-e-d(9)-k-k-e 20 423 16863 16878 530419 TAATTGTGTACTGGCA k-d(10)-k-e-k-e-e 75 1438 16864 16880 530049 TATAATTGTGTACTGGC e-e-k-d(10)-k-e-k-e 88 1439 16864 16879 530369 ATAATTGTGTACTGGC e-k-d(10)-k-e-k-e 92 1440 16865 16880 530117 TATAATTGTGTACTGG e-k-k-d(10)-k-k-e 73 1441 16865 16880 530164 TATAATTGTGTACTGG e-e-k-d(10)-k-k-e 65 1441 16865 16880 530214 TATAATTGTGTACTGG e-d-k-d(10)-k-k-e 37 1441 16865 16880 530264 TATAATTGTGTACTGG e-d-d-k-d(9)-k-k-e 48 1441 16865 16880 530314 TATAATTGTGTACTGG e-e-e-e-d(9)-k-k-e 42 1441 17385 17400 530709 TGGAGTAACAGGAACT e-e-e-d(10)-k-k-k 25 1442 21456 21471 530720 AAAGTTTCCCAATAGA e-e-e-d(10)-k-k-k 17 1443 22061 22076 529044 AGTCCTACCACGGCCC e-e-e-d(10)-k-k-k 27 1444 24514 24529 529045 TGACGATGCTTGGATA e-e-e-d(10)-k-k-k 37 1445 24515 24530 529046 CTGACGATGCTTGGAT e-e-e-d(10)-k-k-k 8 1446 24579 24594 529047 TCACTTTCCCTATACG e-e-e-d(10)-k-k-k 18 1447 25105 25120 530717 GTAGGTTGAGCAAGCA e-e-e-d(10)-k-k-k 77 1448 26061 26076 530420 ACTTTAGCCCCTTCCA k-d(10)-k-e-k-e-e 44 1449 26062 26078 530050 CAACTTTAGCCCCTTCC e-e-k-d(10)-k-e-k-e 64 1450 26062 26077 530370 AACTTTAGCCCCTTCC e-k-d(10)-k-e-k-e 55 1451 26063 26078 530118 CAACTTTAGCCCCTTC e-k-k-d(10)-k-k-e 58 1452 26063 26078 530165 CAACTTTAGCCCCTTC e-e-k-d(10)-k-k-e 38 1452 26063 26078 530215 CAACTTTAGCCCCTTC e-d-k-d(10)-k-k-e 29 1452 26063 26078 530265 CAACTTTAGCCCCTTC e-d-d-k-d(9)-k-k-e 3 1452 26063 26078 530315 CAACTTTAGCCCCTTC e-e-e-e-d(9)-k-k-e 30 1452 26767 26782 529048 AATTCATCGAGCTAAT e-e-e-d(10)-k-k-k 0 1453 37758 37773 529049 TGCCCCAATTAGGCCA e-e-e-d(10)-k-k-k 32 1454 37759 37774 529050 TTGCCCCAATTAGGCC e-e-e-d(10)-k-k-k 21 1455 41484 41499 530714 CCCTGTGGCTCCTTCC e-e-e-d(10)-k-k-k 27 1456 41760 41775 529051 TACTGTCCTCGAGACA e-e-e-d(10)-k-k-k 2 1457 42754 42769 530719 AGGAAAAGGAAGAATG e-e-e-d(10)-k-k-k 2 1458 42766 42781 529052 CGCATATGCCCTAGGA e-e-e-d(10)-k-k-k 7 1459 BIOL0142WO e-e-e-d(10)-k-k-k 42768 42783 529053 GCCGCATATGCCCTAG 41 1460 e-e-e-d(10)-k-k-k 42769 42784 529054 GGCCGCATATGCCCTA 51 1461 e-e-e-d(10)-k-k-k 43072 43087 529055 CGGGTAAGTATACAGA 18 1462 e-e-e-d(10)-k-k-k 43074 43089 529056 CACGGGTAAGTATACA 4 1463 e-e-e-d(10)-k-k-k 43075 43090 529057 TCACGGGTAAGTATAC 5 1464 e-e-e-d(10)-k-k-k 43077 43092 529058 GCTCACGGGTAAGTAT 15 1465 e-e-e-d(10)-k-k-k 45633 45648 529059 GTATACAATGGCCTTT 59 1466 46633 46648 529060 CGACCCAATCAGATGC e-e-e-d(10)-k-k-k 34 1467 47430 47445 530708 GGATAAAATACAAAGG e-e-e-d(10)-k-k-k 14 1468 e-e-e-d(10)-k-k-k 47617 47632 529061 GTTCCGAAAAAACCTC 59 1469 e-e-e-d(10)-k-k-k 47619 47634 529062 GGGTTCCGAAAAAACC 16 1470 47752 47767 530712 TGCAAACTTTTTCTCT e-e-e-d(10)-k-k-k 21 1471 48092 48107 529063 ACCCGCTATCCACTCA e-e-e-d(10)-k-k-k 20 1472 48402 48417 530421 CACTTTCCATTCTAGT k-d(10)-k-e-k-e-e 20 1473 48403 48419 530051 CACACTTTCCATTCTAG e-e-k-d(10)-k-e-k-e 48 1474 48403 48418 530371 ACACTTTCCATTCTAG e-k-d(10)-k-e-k-e 36 1475 48404 48419 530119 CACACTTTCCATTCTA e-k-k-d(10)-k-k-e 47 1476 48404 48419 530166 CACACTTTCCATTCTA e-e-k-d(10)-k-k-e 53 1476 48404 48419 530216 CACACTTTCCATTCTA e-d-k-d(10)-k-k-e 34 1476 48404 48419 530266 CACACTTTCCATTCTA e-d-d-k-d(9)-k-k-e 31 1476 48404 48419 530316 CACACTTTCCATTCTA e-e-e-e-d(9)-k-k-e 34 1476 e-e-e-d(10)-k-k-k 48429 48444 529064 AGCCCCTATGGTTACC 32 1477 e-e-e-d(10)-k-k-k 48567 48582 529065 GTCTAGAGGCCTATCC 14 1478 e-e-e-d(10)-k-k-k 48568 48583 529066 GGTCTAGAGGCCTATC 17 1479 49762 49777 530718 AGATGTTGGATGTCTA e-e-e-d(10)-k-k-k 46 1480 50692 50707 530423 AGATTCTCTACCACTT k-d(10)-k-e-k-e-e 70 1054 50693 50709 530053 GGAGATTCTCTACCACT e-e-k-d(10)-k-e-k-e 84 1055 50693 50708 530373 GAGATTCTCTACCACT e-k-d(10)-k-e-k-e 85 1056 50694 50709 530121 GGAGATTCTCTACCAC e-k-k-d(10)-k-k-e 77 53 50694 50709 530168 GGAGATTCTCTACCAC e-e-k-d(10)-k-k-e 75 53 50694 50709 530218 GGAGATTCTCTACCAC e-d-k-d(10)-k-k-e 61 53 50694 50709 530268 GGAGATTCTCTACCAC e-d-d-k-d(9)-k-k-e 76 53 50694 50709 530318 GGAGATTCTCTACCAC e-e-e-e-d(9)-k-k-e 73 53 e-e-e-d(10)-k-k-k 50838 50853 529067 CCGCCTTAAGATCTAA 5 1481 e-e-e-d(10)-k-k-k 51714 51729 529068 CCCTTACTCTCCGCAT 15 1482 e-e-e-d(10)-k-k-k 51734 51749 529069 GGGAAGTGGTCCGACC 22 1483 e-e-e-d(10)-k-k-k 51757 51772 529070 CCGCAAGTGAGCGAGA 6 1484 e-e-e-d(10)-k-k-k 51760 51775 529071 ATCCCGCAAGTGAGCG 11 1485 e-e-e-d(10)-k-k-k 51763 51778 529072 GAAATCCCGCAAGTGA 0 1486 51905 51920 528400 CCGCCAGCTCACTCAC e-e-e-d(10)-k-k-k 57 66 51906 51921 528401 CCCGCCAGCTCACTCA e-e-e-d(10)-k-k-k 57 1059 51907 51922 528402 CCCCGCCAGCTCACTC e-e-e-d(10)-k-k-k 42 1060 51910 51925 528403 AAGCCCCGCCAGCTCA e-e-e-d(10)-k-k-k 72 1060 51911 51926 528404 AAAGCCCCGCCAGCTC e-e-e-d(10)-k-k-k 52 1062 51912 51927 528405 AAAAGCCCCGCCAGCT e-e-e-d(10)-k-k-k 27 1063 BIOL0142WO 51913 51928 528406 CAAAAGCCCCGCCAGC e-e-e-d(10)-k-k-k 29 1064 51914 51929 528407 ACAAAAGCCCCGCCAG e-e-e-d(10)-k-k-k 9 1065 51916 51931 528408 TGACAAAAGCCCCGCC e-e-e-d(10)-k-k-k 10 1066 51917 51932 528409 CTGACAAAAGCCCCGC e-e-e-d(10)-k-k-k 31 1067 51918 51933 528410 GCTGACAAAAGCCCCG e-e-e-d(10)-k-k-k 39 1068 51919 51934 528411 CGCTGACAAAAGCCCC e-e-e-d(10)-k-k-k 49 1069 51920 51935 528412 TCGCTGACAAAAGCCC e-e-e-d(10)-k-k-k 39 1070 51921 51936 528413 ATCGCTGACAAAAGCC e-e-e-d(10)-k-k-k 20 1071 51922 51937 528414 CATCGCTGACAAAAGC e-e-e-d(10)-k-k-k 10 1072 51924 51939 528415 TCCATCGCTGACAAAA e-e-e-d(10)-k-k-k 11 1073 51925 51940 528416 CTCCATCGCTGACAAA e-e-e-d(10)-k-k-k 15 1074 51926 51941 528417 ACTCCATCGCTGACAA e-e-e-d(10)-k-k-k 22 1075 51927 51942 528418 TACTCCATCGCTGACA e-e-e-d(10)-k-k-k 19 1076 51928 51943 528419 GTACTCCATCGCTGAC e-e-e-d(10)-k-k-k 37 1077 51929 51944 528420 CGTACTCCATCGCTGA e-e-e-d(10)-k-k-k 35 1078 51943 51958 528421 GAGAGTTTTCTGCACG e-e-e-d(10)-k-k-k 36 1079 51945 51960 528422 GTGAGAGTTTTCTGCA e-e-e-d(10)-k-k-k 22 1080 51964 51979 528423 GTCAGCCAGCTCCTCG e-e-e-d(10)-k-k-k 49 1081 51975 51990 528424 CGCCTCTTCCAGTCAG e-e-e-d(10)-k-k-k 42 1082 51977 51992 528425 GCCGCCTCTTCCAGTC e-e-e-d(10)-k-k-k 44 1083 51978 51993 528426 TGCCGCCTCTTCCAGT e-e-e-d(10)-k-k-k 15 1084 51983 51998 528427 TCTGTTGCCGCCTCTT e-e-e-d(10)-k-k-k 9 1085 51984 51999 528428 ATCTGTTGCCGCCTCT e-e-e-d(10)-k-k-k 30 1086 51985 52000 528429 AATCTGTTGCCGCCTC e-e-e-d(10)-k-k-k 23 1087 51986 52001 528430 CAATCTGTTGCCGCCT e-e-e-d(10)-k-k-k 12 1088 51987 52002 528431 GCAATCTGTTGCCGCC e-e-e-d(10)-k-k-k 48 1089 51988 52003 528432 GGCAATCTGTTGCCGC e-e-e-d(10)-k-k-k 18 1090 51989 52004 528433 AGGCAATCTGTTGCCG e-e-e-d(10)-k-k-k 0 1091 51990 52005 528434 CAGGCAATCTGTTGCC e-e-e-d(10)-k-k-k 8 1092 51991 52006 528435 GCAGGCAATCTGTTGC e-e-e-d(10)-k-k-k 13 1093 51995 52010 528436 CAATGCAGGCAATCTG e-e-e-d(10)-k-k-k 9 1094 51996 52011 528437 CCAATGCAGGCAATCT e-e-e-d(10)-k-k-k 26 1095 51997 52012 528438 TCCAATGCAGGCAATC e-e-e-d(10)-k-k-k 10 1096 51998 52013 528439 CTCCAATGCAGGCAAT e-e-e-d(10)-k-k-k 2 1097 51999 52014 528440 CCTCCAATGCAGGCAA e-e-e-d(10)-k-k-k 28 1098 52016 52031 528441 GGCAGATGTTGGGCGG e-e-e-d(10)-k-k-k 8 1099 52017 52032 528442 AGGCAGATGTTGGGCG e-e-e-d(10)-k-k-k 0 1100 52018 52033 528443 TAGGCAGATGTTGGGC e-e-e-d(10)-k-k-k 1 1101 52019 52034 528444 CTAGGCAGATGTTGGG e-e-e-d(10)-k-k-k 0 1102 52020 52035 528445 TCTAGGCAGATGTTGG e-e-e-d(10)-k-k-k 7 1103 52021 52036 528446 ATCTAGGCAGATGTTG e-e-e-d(10)-k-k-k 3 1104 52023 52038 528447 CGATCTAGGCAGATGT e-e-e-d(10)-k-k-k 9 72 52024 52039 528448 CCGATCTAGGCAGATG e-e-e-d(10)-k-k-k 13 1105 52026 52041 528449 AGCCGATCTAGGCAGA e-e-e-d(10)-k-k-k 4 1106 52027 52042 528450 TAGCCGATCTAGGCAG e-e-e-d(10)-k-k-k 11 1107 BIOL0142WO 52028 52043 528451 CTAGCCGATCTAGGCA e-e-e-d(10)-k-k-k 5 1108 52029 52044 528452 TCTAGCCGATCTAGGC e-e-e-d(10)-k-k-k 5 1109 52030 52045 528453 TTCTAGCCGATCTAGG e-e-e-d(10)-k-k-k 24 1110 52031 52046 528454 TTTCTAGCCGATCTAG e-e-e-d(10)-k-k-k 29 1111 52032 52047 528455 TTTTCTAGCCGATCTA e-e-e-d(10)-k-k-k 28 1112 52033 52048 528456 GTTTTCTAGCCGATCT e-e-e-d(10)-k-k-k 42 1113 52035 52050 528457 CAGTTTTCTAGCCGAT e-e-e-d(10)-k-k-k 50 1114 52036 52051 528458 CCAGTTTTCTAGCCGA e-e-e-d(10)-k-k-k 70 1115 e-e-e-d(10)-k-k-k 52083 52098 529073 TCAATCTAGCTTTCGA 33 1487 e-e-e-d(10)-k-k-k 52084 52099 529074 TTCAATCTAGCTTTCG 36 1488 e-e-e-d(10)-k-k-k 52119 52134 529075 GTACCAATTCTGTGGG 33 1489 55441 55456 528462 GATTCTGCTAATGACG e-e-e-d(10)-k-k-k 42 1119 55442 55457 528463 AGATTCTGCTAATGAC e-e-e-d(10)-k-k-k 38 1120 55446 55461 528464 GTTGAGATTCTGCTAA e-e-e-d(10)-k-k-k 30 1121 55447 55462 528465 AGTTGAGATTCTGCTA e-e-e-d(10)-k-k-k 48 1122 55454 55469 528466 GGTCTGAAGTTGAGAT e-e-e-d(10)-k-k-k 27 1123 55456 55471 528467 CGGGTCTGAAGTTGAG e-e-e-d(10)-k-k-k 44 1124 55457 55472 528468 ACGGGTCTGAAGTTGA e-e-e-d(10)-k-k-k 41 1125 55458 55473 528469 GACGGGTCTGAAGTTG e-e-e-d(10)-k-k-k 45 1126 55459 55474 528470 TGACGGGTCTGAAGTT e-e-e-d(10)-k-k-k 34 1127 55460 55475 528471 TTGACGGGTCTGAAGT e-e-e-d(10)-k-k-k 19 1128 55461 55476 528472 GTTGACGGGTCTGAAG e-e-e-d(10)-k-k-k 21 1129 55462 55477 528473 TGTTGACGGGTCTGAA e-e-e-d(10)-k-k-k 37 1130 55463 55478 528474 TTGTTGACGGGTCTGA e-e-e-d(10)-k-k-k 55 1131 55464 55479 528475 TTTGTTGACGGGTCTG e-e-e-d(10)-k-k-k 63 1132 55465 55480 528476 ATTTGTTGACGGGTCT e-e-e-d(10)-k-k-k 65 1133 56208 56223 529076 GTAACACCTCACCCTA e-e-e-d(10)-k-k-k 14 1490 58396 58411 530715 TCTGCCACCCAGGTTT e-e-e-d(10)-k-k-k 31 1491 e-e-e-d(10)-k-k-k 59836 59851 529077 TAAATTTCCGGGATCT 13 1492 e-e-e-d(10)-k-k-k 64187 64202 529078 CCGGTCCCTTGTAAAA 12 1493 e-e-e-d(10)-k-k-k 64289 64304 529079 GCCAACTCTAGGCGAG 16 1494 e-e-e-d(10)-k-k-k 64551 64566 529080 CGCAAGAGATCCCGGG 0 1495 e-e-e-d(10)-k-k-k 64552 64567 529081 TCGCAAGAGATCCCGG 16 1496 e-e-e-d(10)-k-k-k 64959 64974 529082 TGATCACCTCGACTGA 20 1497 66136 66151 530425 GCCCTTGCCAGCCATG k-d(10)-k-e-k-e-e 73 1134 66137 66153 530054 AAGCCCTTGCCAGCCAT e-e-k-d(10)-k-e-k-e 75 1135 66137 66152 530375 AGCCCTTGCCAGCCAT e-k-d(10)-k-e-k-e 77 1136 66138 66153 530123 AAGCCCTTGCCAGCCA e-k-k-d(10)-k-k-e 86 144 66138 66153 530170 AAGCCCTTGCCAGCCA e-e-k-d(10)-k-k-e 87 144 66138 66153 530220 AAGCCCTTGCCAGCCA e-d-k-d(10)-k-k-e 74 144 66138 66153 530270 AAGCCCTTGCCAGCCA e-d-d-k-d(9)-k-k-e 87 144 66138 66153 530320 AAGCCCTTGCCAGCCA e-e-e-e-d(9)-k-k-e 83 144 66183 66198 530426 TTTTTCACAAGGTCAA k-d(10)-k-e-k-e-e 55 1137 66184 66200 530059 ACTTTTTCACAAGGTCA e-e-k-d(10)-k-e-k-e 73 1138 66184 66199 530376 CTTTTTCACAAGGTCA e-k-d(10)-k-e-k-e 77 1139 BIOL0142WO 66185 66200 530124 ACTTTTTCACAAGGTC e-k-k-d(10)-k-k-e 79 153 66185 66200 530171 ACTTTTTCACAAGGTC e-e-k-d(10)-k-k-e 69 153 66185 66200 530221 ACTTTTTCACAAGGTC e-d-k-d(10)-k-k-e 64 153 66185 66200 530271 ACTTTTTCACAAGGTC e-d-d-k-d(9)-k-k-e 73 153 66185 66200 530321 ACTTTTTCACAAGGTC e-e-e-e-d(9)-k-k-e 56 153 66875 66890 529083 GCCACCCTAGTGTTGA e-e-e-d(10)-k-k-k 27 1498 67066 67081 530427 ATGATCTTATAGCCCA k-d(10)-k-e-k-e-e 43 931 67067 67083 530060 CCATGATCTTATAGCCC e-e-k-d(10)-k-e-k-e 77 1140 67067 67082 530377 CATGATCTTATAGCCC e-k-d(10)-k-e-k-e 66 932 67068 67083 530125 CCATGATCTTATAGCC e-k-k-d(10)-k-k-e 65 175 67068 67083 530172 CCATGATCTTATAGCC e-e-k-d(10)-k-k-e 59 175 67068 67083 530222 CCATGATCTTATAGCC e-d-k-d(10)-k-k-e 48 175 67068 67083 530272 CCATGATCTTATAGCC e-d-d-k-d(9)-k-k-e 63 175 67068 67083 530322 CCATGATCTTATAGCC e-e-e-e-d(9)-k-k-e 45 175 67270 67285 530716 TTTGCCTATCTATCCT e-e-e-d(10)-k-k-k 11 1499 e-e-e-d(10)-k-k-k 67346 67361 529084 CGGTCACCCCAACAAA 33 1500 e-e-e-d(10)-k-k-k 69470 69485 529085 AAGGGCGATGGTAATG 4 1501 71614 71629 530422 GTACAATTGCTTCAAC k-d(10)-k-e-k-e-e 46 1502 71615 71631 530052 CAGTACAATTGCTTCAA e-e-k-d(10)-k-e-k-e 51 1503 71615 71630 530372 AGTACAATTGCTTCAA e-k-d(10)-k-e-k-e 51 1504 71616 71631 530120 CAGTACAATTGCTTCA e-k-k-d(10)-k-k-e 78 1505 71616 71631 530167 CAGTACAATTGCTTCA e-e-k-d(10)-k-k-e 69 1505 71616 71631 530217 CAGTACAATTGCTTCA e-d-k-d(10)-k-k-e 47 1505 71616 71631 530267 CAGTACAATTGCTTCA e-d-d-k-d(9)-k-k-e 64 1505 71616 71631 530317 CAGTACAATTGCTTCA e-e-e-e-d(9)-k-k-e 60 1505 72138 72153 530713 CTCATGCCAAGATTGT e-e-e-d(10)-k-k-k 26 1506 e-e-e-d(10)-k-k-k 72299 72314 529086 AAGCCACTTACGGTGT 0 1507 e-e-e-d(10)-k-k-k 72874 72889 529087 CGTCTATTTCCAGTGT 22 1508 73648 73663 529088 ACTAGTTCAGTTGTCC e-e-e-d(10)-k-k-k 0 1509 73866 73881 530428 TAGCAGAAGTAGGAGA k-d(10)-k-e-k-e-e 49 1141 73867 73883 530061 GATAGCAGAAGTAGGAG e-e-k-d(10)-k-e-k-e 49 1142 73867 73882 530378 ATAGCAGAAGTAGGAG e-k-d(10)-k-e-k-e 48 1143 73868 73883 530126 GATAGCAGAAGTAGGA e-k-k-d(10)-k-k-e 70 223 73868 73883 530173 GATAGCAGAAGTAGGA e-e-k-d(10)-k-k-e 62 223 73868 73883 530223 GATAGCAGAAGTAGGA e-d-k-d(10)-k-k-e 44 223 73868 73883 530273 GATAGCAGAAGTAGGA e-d-d-k-d(9)-k-k-e 63 223 73868 73883 530323 GATAGCAGAAGTAGGA e-e-e-e-d(9)-k-k-e 37 223 74199 74214 530513 TTGGATGTCAGCAAGG k-d(10)-k-e-k-e-e 88 1047 74200 74215 530507 TTTGGATGTCAGCAAG e-k-d(10)-k-e-k-e 86 1144 74200 74215 530514 TTTGGATGTCAGCAAG k-d(10)-k-e-k-e-e 80 1144 74201 74216 530430 ATTTGGATGTCAGCAA k-d(10)-k-e-k-e-e 87 1145 74201 74216 530468 ATTTGGATGTCAGCAA e-k-k-d(10)-k-k-e 81 1145 74201 74216 530476 ATTTGGATGTCAGCAA e-e-k-d(10)-k-k-e 82 1145 74201 74216 530484 ATTTGGATGTCAGCAA e-d-k-d(10)-k-k-e 74 1145 74201 74216 530492 ATTTGGATGTCAGCAA e-d-d-k-d(9)-k-k-e 83 1145 BIOL0142WO 74201 74216 530500 ATTTGGATGTCAGCAA e-e-e-e-d(9)-k-k-e 56 1145 74201 74216 530508 ATTTGGATGTCAGCAA e-k-d(10)-k-e-k-e 83 1145 74202 74218 530062 CTATTTGGATGTCAGCA e-e-k-d(10)-k-e-k-e 94 1146 74202 74217 530380 TATTTGGATGTCAGCA e-k-d(10)-k-e-k-e 94 1147 74202 74217 530469 TATTTGGATGTCAGCA e-k-k-d(10)-k-k-e 91 1147 74202 74217 530477 TATTTGGATGTCAGCA e-e-k-d(10)-k-k-e 87 1147 74202 74217 530485 TATTTGGATGTCAGCA e-d-k-d(10)-k-k-e 87 1147 74202 74217 530493 TATTTGGATGTCAGCA e-d-d-k-d(9)-k-k-e 81 1147 74202 74217 530501 TATTTGGATGTCAGCA e-e-e-e-d(9)-k-k-e 74 1147 74202 74217 530515 TATTTGGATGTCAGCA k-d(10)-k-e-k-e-e 87 1147 74203 74218 481464 CTATTTGGATGTCAGC k-k-k-d(10)-k-k-k 93 245 74203 74218 518349 CTATTTGGATGTCAGC e-e-e-d(10)-k-k-k 58 245 74203 74218 519637 CTATTTGGATGTCAGC e-k-k-d(10)-k-k-e 96 245 74203 74218 530175 CTATTTGGATGTCAGC e-e-k-d(10)-k-k-e 93 245 74203 74218 530225 CTATTTGGATGTCAGC e-d-k-d(10)-k-k-e 85 245 74203 74218 530275 CTATTTGGATGTCAGC e-d-d-k-d(9)-k-k-e 91 245 74203 74218 530325 CTATTTGGATGTCAGC e-e-e-e-d(9)-k-k-e 91 245 74204 74219 530470 TCTATTTGGATGTCAG e-k-k-d(10)-k-k-e 91 1148 74204 74219 530478 TCTATTTGGATGTCAG e-e-k-d(10)-k-k-e 87 1148 74204 74219 530486 TCTATTTGGATGTCAG e-d-k-d(10)-k-k-e 84 1148 74204 74219 530494 TCTATTTGGATGTCAG e-d-d-k-d(9)-k-k-e 60 1148 74204 74219 530502 TCTATTTGGATGTCAG e-e-e-e-d(9)-k-k-e 64 1148 74204 74219 530509 TCTATTTGGATGTCAG e-k-d(10)-k-e-k-e 80 1148 74205 74220 530471 TTCTATTTGGATGTCA e-k-k-d(10)-k-k-e 83 1149 74205 74220 530479 TTCTATTTGGATGTCA e-e-k-d(10)-k-k-e 74 1149 74205 74220 530487 TTCTATTTGGATGTCA e-d-k-d(10)-k-k-e 71 1149 74205 74220 530495 TTCTATTTGGATGTCA e-d-d-k-d(9)-k-k-e 68 1149 74205 74220 530503 TTCTATTTGGATGTCA e-e-e-e-d(9)-k-k-e 53 1149 74646 74661 530431 CACCAAGGAGGCTGTT k-d(10)-k-e-k-e-e 44 1150 74647 74663 530055 AGCACCAAGGAGGCTGT e-e-k-d(10)-k-e-k-e 45 1151 74647 74662 530381 GCACCAAGGAGGCTGT e-k-d(10)-k-e-k-e 74 1152 74648 74663 530128 AGCACCAAGGAGGCTG e-k-k-d(10)-k-k-e 52 257 74648 74663 530176 AGCACCAAGGAGGCTG e-e-k-d(10)-k-k-e 66 257 74648 74663 530226 AGCACCAAGGAGGCTG e-d-k-d(10)-k-k-e 51 257 74648 74663 530276 AGCACCAAGGAGGCTG e-d-d-k-d(9)-k-k-e 70 257 74648 74663 530326 AGCACCAAGGAGGCTG e-e-e-e-d(9)-k-k-e 52 257 74714 74729 528860 GGTTTGACCTGAAGCC e-e-e-d(10)-k-k-k 58 1153 74715 74730 528861 GGGTTTGACCTGAAGC e-e-e-d(10)-k-k-k 42 1154 74716 74731 528862 AGGGTTTGACCTGAAG e-e-e-d(10)-k-k-k 57 1155 74717 74732 528863 AAGGGTTTGACCTGAA e-e-e-d(10)-k-k-k 43 1156 74718 74733 528864 TAAGGGTTTGACCTGA e-e-e-d(10)-k-k-k 50 1157 74719 74734 528865 TTAAGGGTTTGACCTG e-e-e-d(10)-k-k-k 32 1158 74734 74749 528866 GCAGCTTCAGATGTCT e-e-e-d(10)-k-k-k 60 1159 74735 74750 528867 TGCAGCTTCAGATGTC e-e-e-d(10)-k-k-k 47 1160 74770 74785 530388 CTTAAACCTTCCTATT k-d(10)-k-e-k-e-e 14 1161 BIOL0142WO 74771 74786 530338 CCTTAAACCTTCCTAT e-k-d(10)-k-e-k-e 47 1162 74772 74787 530086 TCCTTAAACCTTCCTA e-k-k-d(10)-k-k-e 58 273 74772 74787 530133 TCCTTAAACCTTCCTA e-e-k-d(10)-k-k-e 53 273 74772 74787 530183 TCCTTAAACCTTCCTA e-d-k-d(10)-k-k-e 52 273 74772 74787 530233 TCCTTAAACCTTCCTA e-d-d-k-d(9)-k-k-e 29 273 74772 74787 530283 TCCTTAAACCTTCCTA e-e-e-e-d(9)-k-k-e 32 273 74777 74792 528868 GATTCTCCTTAAACCT e-e-e-d(10)-k-k-k 45 1163 74778 74793 530389 AGATTCTCCTTAAACC k-d(10)-k-e-k-e-e 44 1164 74779 74794 530339 TAGATTCTCCTTAAAC e-k-d(10)-k-e-k-e 41 1165 74780 74795 530087 TTAGATTCTCCTTAAA e-k-k-d(10)-k-k-e 43 1166 74780 74795 530134 TTAGATTCTCCTTAAA e-e-k-d(10)-k-k-e 28 1166 74780 74795 530184 TTAGATTCTCCTTAAA e-d-k-d(10)-k-k-e 13 1166 74780 74795 530234 TTAGATTCTCCTTAAA e-d-d-k-d(9)-k-k-e 15 1166 74780 74795 530284 TTAGATTCTCCTTAAA e-e-e-e-d(9)-k-k-e 14 1166 74782 74797 530390 GCTTAGATTCTCCTTA k-d(10)-k-e-k-e-e 83 1167 74783 74798 530340 TGCTTAGATTCTCCTT e-k-d(10)-k-e-k-e 89 1168 74784 74799 528869 ATGCTTAGATTCTCCT e-e-e-d(10)-k-k-k 83 1169 74784 74799 530088 ATGCTTAGATTCTCCT e-k-k-d(10)-k-k-e 90 1169 74784 74799 530135 ATGCTTAGATTCTCCT e-e-k-d(10)-k-k-e 91 1169 74784 74799 530185 ATGCTTAGATTCTCCT e-d-k-d(10)-k-k-e 85 1169 74784 74799 530235 ATGCTTAGATTCTCCT e-d-d-k-d(9)-k-k-e 28 1169 74784 74799 530285 ATGCTTAGATTCTCCT e-e-e-e-d(9)-k-k-e 86 1169 74784 74799 530391 ATGCTTAGATTCTCCT k-d(10)-k-e-k-e-e 79 1169 74785 74801 530021 AAATGCTTAGATTCTCC e-e-k-d(10)-k-e-k-e 87 1170 74785 74800 530341 AATGCTTAGATTCTCC e-k-d(10)-k-e-k-e 88 1171 74786 74801 530089 AAATGCTTAGATTCTC e-k-k-d(10)-k-k-e 71 1172 74786 74801 530136 AAATGCTTAGATTCTC e-e-k-d(10)-k-k-e 66 1172 74786 74801 530186 AAATGCTTAGATTCTC e-d-k-d(10)-k-k-e 51 1172 74786 74801 530236 AAATGCTTAGATTCTC e-d-d-k-d(9)-k-k-e 74 1172 74786 74801 530286 AAATGCTTAGATTCTC e-e-e-e-d(9)-k-k-e 56 1172 74869 74884 528870 GTAAGCACCCTCTGCC e-e-e-d(10)-k-k-k 26 1173 74871 74886 528871 TTGTAAGCACCCTCTG e-e-e-d(10)-k-k-k 14 1174 74873 74888 528872 GGTTGTAAGCACCCTC e-e-e-d(10)-k-k-k 47 1175 74874 74889 528873 AGGTTGTAAGCACCCT e-e-e-d(10)-k-k-k 40 1176 74875 74890 528874 AAGGTTGTAAGCACCC e-e-e-d(10)-k-k-k 54 1177 74877 74892 528875 TCAAGGTTGTAAGCAC e-e-e-d(10)-k-k-k 15 1178 74878 74893 528876 GTCAAGGTTGTAAGCA e-e-e-d(10)-k-k-k 28 1179 74879 74894 528877 AGTCAAGGTTGTAAGC e-e-e-d(10)-k-k-k 28 1180 74881 74896 528878 GGAGTCAAGGTTGTAA e-e-e-d(10)-k-k-k 6 1181 74882 74897 528879 GGGAGTCAAGGTTGTA e-e-e-d(10)-k-k-k 22 1182 74901 74916 530392 GATCAAGTCCAGGGAG k-d(10)-k-e-k-e-e 47 1183 74902 74918 530022 CAGATCAAGTCCAGGGA e-e-k-d(10)-k-e-k-e 80 1184 74902 74917 530342 AGATCAAGTCCAGGGA e-k-d(10)-k-e-k-e 70 1185 74902 74917 530393 AGATCAAGTCCAGGGA k-d(10)-k-e-k-e-e 46 1185 74903 74919 530023 GCAGATCAAGTCCAGGG e-e-k-d(10)-k-e-k-e 74 1186 BIOL0142WO 74903 74918 530090 CAGATCAAGTCCAGGG e-k-k-d(10)-k-k-e 78 1187 74903 74918 530137 CAGATCAAGTCCAGGG e-e-k-d(10)-k-k-e 76 1187 74903 74918 530187 CAGATCAAGTCCAGGG e-d-k-d(10)-k-k-e 68 1187 74903 74918 530237 CAGATCAAGTCCAGGG e-d-d-k-d(9)-k-k-e 36 1187 74903 74918 530287 CAGATCAAGTCCAGGG e-e-e-e-d(9)-k-k-e 56 1187 74903 74918 530343 CAGATCAAGTCCAGGG e-k-d(10)-k-e-k-e 68 1187 74903 74918 530394 CAGATCAAGTCCAGGG k-d(10)-k-e-k-e-e 49 1187 74904 74919 518343 GCAGATCAAGTCCAGG e-e-e-d(10)-k-k-k 5 1188 74904 74920 530024 AGCAGATCAAGTCCAGG e-e-k-d(10)-k-e-k-e 79 1189 74904 74919 530091 GCAGATCAAGTCCAGG e-k-k-d(10)-k-k-e 81 1188 74904 74919 530138 GCAGATCAAGTCCAGG e-e-k-d(10)-k-k-e 81 1188 74904 74919 530188 GCAGATCAAGTCCAGG e-d-k-d(10)-k-k-e 78 1188 74904 74919 530238 GCAGATCAAGTCCAGG e-d-d-k-d(9)-k-k-e 29 1188 74904 74919 530288 GCAGATCAAGTCCAGG e-e-e-e-d(9)-k-k-e 69 1188 74904 74919 530344 GCAGATCAAGTCCAGG e-k-d(10)-k-e-k-e 85 1188 74905 74920 530092 AGCAGATCAAGTCCAG e-k-k-d(10)-k-k-e 85 1190 74905 74920 530139 AGCAGATCAAGTCCAG e-e-k-d(10)-k-k-e 79 1190 74905 74920 530189 AGCAGATCAAGTCCAG e-d-k-d(10)-k-k-e 77 1190 74905 74920 530239 AGCAGATCAAGTCCAG e-d-d-k-d(9)-k-k-e 61 1190 74905 74920 530289 AGCAGATCAAGTCCAG e-e-e-e-d(9)-k-k-e 75 1190 74907 74922 528880 ACAGCAGATCAAGTCC e-e-e-d(10)-k-k-k 65 1191 74908 74923 528881 AACAGCAGATCAAGTC e-e-e-d(10)-k-k-k 44 1192 74924 74939 528882 ACAACCTAGCCTCTGA e-e-e-d(10)-k-k-k 39 1193 74925 74940 528883 AACAACCTAGCCTCTG e-e-e-d(10)-k-k-k 46 1194 74927 74942 528884 GAAACAACCTAGCCTC e-e-e-d(10)-k-k-k 37 1195 74928 74943 528885 AGAAACAACCTAGCCT e-e-e-d(10)-k-k-k 20 1196 74929 74944 528886 CAGAAACAACCTAGCC e-e-e-d(10)-k-k-k 21 1197 74942 74957 528887 GATAAGGCACCCACAG e-e-e-d(10)-k-k-k 25 1198 74943 74958 528888 TGATAAGGCACCCACA e-e-e-d(10)-k-k-k 12 1199 74944 74959 528889 CTGATAAGGCACCCAC e-e-e-d(10)-k-k-k 25 1200 74946 74961 528890 CCCTGATAAGGCACCC e-e-e-d(10)-k-k-k 42 1201 74947 74962 528891 GCCCTGATAAGGCACC e-e-e-d(10)-k-k-k 49 1202 74952 74967 528892 TCCCAGCCCTGATAAG e-e-e-d(10)-k-k-k 0 1203 74954 74969 528893 TATCCCAGCCCTGATA e-e-e-d(10)-k-k-k 0 1204 74957 74972 528894 AAGTATCCCAGCCCTG e-e-e-d(10)-k-k-k 25 1205 74958 74973 528895 GAAGTATCCCAGCCCT e-e-e-d(10)-k-k-k 39 1206 74959 74974 528896 AGAAGTATCCCAGCCC e-e-e-d(10)-k-k-k 22 1207 74960 74975 528897 CAGAAGTATCCCAGCC e-e-e-d(10)-k-k-k 36 1208 75079 75094 528898 TGAGACCAGGATTCCT e-e-e-d(10)-k-k-k 41 1209 75083 75098 528899 GTCCTGAGACCAGGAT e-e-e-d(10)-k-k-k 19 1210 75164 75179 528900 AGCTCAACCAGACACG e-e-e-d(10)-k-k-k 54 311 75166 75181 528901 TGAGCTCAACCAGACA e-e-e-d(10)-k-k-k 40 1211 75171 75186 528902 TTCCCTGAGCTCAACC e-e-e-d(10)-k-k-k 32 1212 75179 75194 528903 GAACCATATTCCCTGA e-e-e-d(10)-k-k-k 30 313 75182 75197 528904 TAAGAACCATATTCCC e-e-e-d(10)-k-k-k 27 1213 BIOL0142WO 75209 75224 518344 GCCACTGGATATCACC e-e-e-d(10)-k-k-k 89 317 75254 75269 528905 TAAGCCTTTGCCCTGC e-e-e-d(10)-k-k-k 64 1214 75255 75270 528906 GTAAGCCTTTGCCCTG e-e-e-d(10)-k-k-k 53 1215 75256 75271 528907 AGTAAGCCTTTGCCCT e-e-e-d(10)-k-k-k 45 1216 75257 75272 528908 CAGTAAGCCTTTGCCC e-e-e-d(10)-k-k-k 40 1217 75259 75274 528909 ATCAGTAAGCCTTTGC e-e-e-d(10)-k-k-k 53 1218 75260 75275 528910 TATCAGTAAGCCTTTG e-e-e-d(10)-k-k-k 47 1219 75264 75279 528911 AGTTTATCAGTAAGCC e-e-e-d(10)-k-k-k 58 1220 75270 75285 528912 GACTCAAGTTTATCAG e-e-e-d(10)-k-k-k 37 1221 75272 75287 528913 CAGACTCAAGTTTATC e-e-e-d(10)-k-k-k 39 1222 75273 75288 528914 GCAGACTCAAGTTTAT e-e-e-d(10)-k-k-k 0 1223 75274 75289 528915 GGCAGACTCAAGTTTA e-e-e-d(10)-k-k-k 1 1224 75275 75290 528916 GGGCAGACTCAAGTTT e-e-e-d(10)-k-k-k 0 1225 75276 75291 528917 AGGGCAGACTCAAGTT e-e-e-d(10)-k-k-k 9 1226 75278 75293 528918 CGAGGGCAGACTCAAG e-e-e-d(10)-k-k-k 2 1227 75280 75295 528919 TACGAGGGCAGACTCA e-e-e-d(10)-k-k-k 20 324 75281 75296 528920 ATACGAGGGCAGACTC e-e-e-d(10)-k-k-k 14 1228 75282 75297 528921 CATACGAGGGCAGACT e-e-e-d(10)-k-k-k 0 1229 75283 75298 528922 TCATACGAGGGCAGAC e-e-e-d(10)-k-k-k 8 1230 75285 75300 528923 CCTCATACGAGGGCAG e-e-e-d(10)-k-k-k 2 1231 75286 75301 528924 CCCTCATACGAGGGCA e-e-e-d(10)-k-k-k 2 1232 75287 75302 528925 ACCCTCATACGAGGGC e-e-e-d(10)-k-k-k 0 1233 75412 75427 528926 TACGCACAGGAGAGGC e-e-e-d(10)-k-k-k 20 1233 75413 75428 528927 ATACGCACAGGAGAGG e-e-e-d(10)-k-k-k 0 1234 75414 75429 528928 CATACGCACAGGAGAG e-e-e-d(10)-k-k-k 6 1235 75415 75430 528929 CCATACGCACAGGAGA e-e-e-d(10)-k-k-k 4 1236 75416 75431 528930 CCCATACGCACAGGAG e-e-e-d(10)-k-k-k 36 1237 75417 75432 528931 TCCCATACGCACAGGA e-e-e-d(10)-k-k-k 22 1238 75418 75433 528932 TTCCCATACGCACAGG e-e-e-d(10)-k-k-k 32 1239 75419 75434 528933 GTTCCCATACGCACAG e-e-e-d(10)-k-k-k 45 1240 75420 75435 528934 TGTTCCCATACGCACA e-e-e-d(10)-k-k-k 36 1241 75421 75436 528935 GTGTTCCCATACGCAC e-e-e-d(10)-k-k-k 20 1242 75421 75436 530395 GTGTTCCCATACGCAC k-d(10)-k-e-k-e-e 71 1242 75422 75437 528936 GGTGTTCCCATACGCA e-e-e-d(10)-k-k-k 71 1243 75422 75438 530025 AGGTGTTCCCATACGCA e-e-k-d(10)-k-e-k-e 90 1244 75422 75437 530345 GGTGTTCCCATACGCA e-k-d(10)-k-e-k-e 93 1243 75422 75437 530396 GGTGTTCCCATACGCA k-d(10)-k-e-k-e-e 71 1243 75423 75438 528937 AGGTGTTCCCATACGC e-e-e-d(10)-k-k-k 73 1245 75423 75439 530026 TAGGTGTTCCCATACGC e-e-k-d(10)-k-e-k-e 87 1246 75423 75438 530093 AGGTGTTCCCATACGC e-k-k-d(10)-k-k-e 95 1245 75423 75438 530140 AGGTGTTCCCATACGC e-e-k-d(10)-k-k-e 89 1245 75423 75438 530190 AGGTGTTCCCATACGC e-d-k-d(10)-k-k-e 82 1245 75423 75438 530240 AGGTGTTCCCATACGC e-d-d-k-d(9)-k-k-e 50 1245 75423 75438 530290 AGGTGTTCCCATACGC e-e-e-e-d(9)-k-k-e 69 1245 75423 75438 530346 AGGTGTTCCCATACGC e-k-d(10)-k-e-k-e 89 1245 BIOL0142WO 75424 75439 528938 TAGGTGTTCCCATACG e-e-e-d(10)-k-k-k 72 336 75424 75439 530094 TAGGTGTTCCCATACG e-k-k-d(10)-k-k-e 88 336 75424 75439 530141 TAGGTGTTCCCATACG e-e-k-d(10)-k-k-e 80 336 75424 75439 530191 TAGGTGTTCCCATACG e-d-k-d(10)-k-k-e 74 336 75424 75439 530241 TAGGTGTTCCCATACG e-d-d-k-d(9)-k-k-e 53 336 75424 75439 530291 TAGGTGTTCCCATACG e-e-e-e-d(9)-k-k-e 68 336 75425 75440 528939 CTAGGTGTTCCCATAC e-e-e-d(10)-k-k-k 39 1247 75426 75441 528940 GCTAGGTGTTCCCATA e-e-e-d(10)-k-k-k 62 1248 75427 75442 528941 TGCTAGGTGTTCCCAT e-e-e-d(10)-k-k-k 49 1249 75429 75444 528942 CGTGCTAGGTGTTCCC e-e-e-d(10)-k-k-k 77 1250 75491 75506 528943 CAAGGTGGTTTTGAGT e-e-e-d(10)-k-k-k 25 1251 75492 75507 528944 GCAAGGTGGTTTTGAG e-e-e-d(10)-k-k-k 28 344 75507 75522 528945 CTCTGATCAGCTGAGG e-e-e-d(10)-k-k-k 74 1252 75508 75523 528946 ACTCTGATCAGCTGAG e-e-e-d(10)-k-k-k 56 1253 75549 75564 528947 GAGACCAGCTAATTTG e-e-e-d(10)-k-k-k 36 1254 75582 75597 528948 CATCTTAGAGAAGGTC e-e-e-d(10)-k-k-k 59 1255 75622 75637 528949 TCAACTGTCTCCAGGC e-e-e-d(10)-k-k-k 67 1256 75622 75637 530397 TCAACTGTCTCCAGGC k-d(10)-k-e-k-e-e 60 1256 75623 75638 528950 ATCAACTGTCTCCAGG e-e-e-d(10)-k-k-k 57 1257 75623 75639 530027 CATCAACTGTCTCCAGG e-e-k-d(10)-k-e-k-e 56 1258 75623 75638 530347 ATCAACTGTCTCCAGG e-k-d(10)-k-e-k-e 49 1257 75624 75639 530095 CATCAACTGTCTCCAG e-k-k-d(10)-k-k-e 40 354 75624 75639 530142 CATCAACTGTCTCCAG e-e-k-d(10)-k-k-e 43 354 75624 75639 530192 CATCAACTGTCTCCAG e-d-k-d(10)-k-k-e 42 354 75624 75639 530242 CATCAACTGTCTCCAG e-d-d-k-d(9)-k-k-e 0 354 75624 75639 530292 CATCAACTGTCTCCAG e-e-e-e-d(9)-k-k-e 36 354 75624 75639 530398 CATCAACTGTCTCCAG k-d(10)-k-e-k-e-e 28 354 75625 75641 530028 CACATCAACTGTCTCCA e-e-k-d(10)-k-e-k-e 57 1259 75625 75640 530348 ACATCAACTGTCTCCA e-k-d(10)-k-e-k-e 58 1260 75626 75641 530096 CACATCAACTGTCTCC e-k-k-d(10)-k-k-e 72 356 75626 75641 530143 CACATCAACTGTCTCC e-e-k-d(10)-k-k-e 74 356 75626 75641 530193 CACATCAACTGTCTCC e-d-k-d(10)-k-k-e 62 356 75626 75641 530243 CACATCAACTGTCTCC e-d-d-k-d(9)-k-k-e 34 356 75626 75641 530293 CACATCAACTGTCTCC e-e-e-e-d(9)-k-k-e 59 356 75628 75643 528951 GACACATCAACTGTCT e-e-e-d(10)-k-k-k 16 1261 75662 75677 528952 GAAGAGTGTTGCTGGA e-e-e-d(10)-k-k-k 57 1262 75664 75679 528953 CTGAAGAGTGTTGCTG e-e-e-d(10)-k-k-k 46 1263 75666 75681 528954 TACTGAAGAGTGTTGC e-e-e-d(10)-k-k-k 42 1264 75672 75687 530510 ATTATGTACTGAAGAG k-d(10)-k-e-k-e-e 53 1265 75673 75688 530504 TATTATGTACTGAAGA e-k-d(10)-k-e-k-e 25 1266 75673 75688 530511 TATTATGTACTGAAGA k-d(10)-k-e-k-e-e 31 1266 75674 75689 530432 TTATTATGTACTGAAG k-d(10)-k-e-k-e-e 15 1267 75674 75689 530463 TTATTATGTACTGAAG e-k-k-d(10)-k-k-e 20 1267 75674 75689 530472 TTATTATGTACTGAAG e-e-k-d(10)-k-k-e 17 1267 75674 75689 530480 TTATTATGTACTGAAG e-d-k-d(10)-k-k-e 4 1267 BIOL0142WO 75674 75689 530488 TTATTATGTACTGAAG e-d-d-k-d(9)-k-k-e 13 1267 75674 75689 530496 TTATTATGTACTGAAG e-e-e-e-d(9)-k-k-e 0 1267 75674 75689 530505 TTATTATGTACTGAAG e-k-d(10)-k-e-k-e 37 1267 75675 75691 530063 GCTTATTATGTACTGAA e-e-k-d(10)-k-e-k-e 74 1268 75675 75690 530382 CTTATTATGTACTGAA e-k-d(10)-k-e-k-e 17 1269 75675 75690 530465 CTTATTATGTACTGAA e-k-k-d(10)-k-k-e 63 1269 75675 75690 530473 CTTATTATGTACTGAA e-e-k-d(10)-k-k-e 45 1269 75675 75690 530481 CTTATTATGTACTGAA e-d-k-d(10)-k-k-e 14 1269 75675 75690 530489 CTTATTATGTACTGAA e-d-d-k-d(9)-k-k-e 13 1269 75675 75690 530497 CTTATTATGTACTGAA e-e-e-e-d(9)-k-k-e 7 1269 75675 75690 530512 CTTATTATGTACTGAA k-d(10)-k-e-k-e-e 21 1269 75676 75691 519638 GCTTATTATGTACTGA e-k-k-d(10)-k-k-e 86 362 75676 75691 530177 GCTTATTATGTACTGA e-e-k-d(10)-k-k-e 71 362 75676 75691 530227 GCTTATTATGTACTGA e-d-k-d(10)-k-k-e 51 362 75676 75691 530277 GCTTATTATGTACTGA e-d-d-k-d(9)-k-k-e 70 362 75676 75691 530327 GCTTATTATGTACTGA e-e-e-e-d(9)-k-k-e 61 362 75677 75692 530466 AGCTTATTATGTACTG e-k-k-d(10)-k-k-e 82 1270 75677 75692 530474 AGCTTATTATGTACTG e-e-k-d(10)-k-k-e 62 1270 75677 75692 530482 AGCTTATTATGTACTG e-d-k-d(10)-k-k-e 53 1270 75677 75692 530490 AGCTTATTATGTACTG e-d-d-k-d(9)-k-k-e 42 1270 75677 75692 530498 AGCTTATTATGTACTG e-e-e-e-d(9)-k-k-e 45 1270 75677 75692 530506 AGCTTATTATGTACTG e-k-d(10)-k-e-k-e 70 1270 75678 75693 530467 AAGCTTATTATGTACT e-k-k-d(10)-k-k-e 50 1271 75678 75693 530475 AAGCTTATTATGTACT e-e-k-d(10)-k-k-e 26 1271 75678 75693 530483 AAGCTTATTATGTACT e-d-k-d(10)-k-k-e 19 1271 75678 75693 530491 AAGCTTATTATGTACT e-d-d-k-d(9)-k-k-e 13 1271 75678 75693 530499 AAGCTTATTATGTACT e-e-e-e-d(9)-k-k-e 15 1271 75679 75694 528955 TAAGCTTATTATGTAC e-e-e-d(10)-k-k-k 0 1272 75686 75701 528956 TATCAGTTAAGCTTAT e-e-e-d(10)-k-k-k 0 1273 75689 75704 528957 GTTTATCAGTTAAGCT e-e-e-d(10)-k-k-k 31 1274 75726 75741 530433 CAATGGTAAGCCCAAG k-d(10)-k-e-k-e-e 62 1275 75727 75742 528958 CCAATGGTAAGCCCAA e-e-e-d(10)-k-k-k 66 1276 75727 75743 530056 CCCAATGGTAAGCCCAA e-e-k-d(10)-k-e-k-e 73 1277 75727 75742 530383 CCAATGGTAAGCCCAA e-k-d(10)-k-e-k-e 64 1276 75728 75743 518345 CCCAATGGTAAGCCCA e-e-e-d(10)-k-k-k 80 366 75728 75743 519636 CCCAATGGTAAGCCCA e-k-k-d(10)-k-k-e 90 366 75728 75743 530178 CCCAATGGTAAGCCCA e-e-k-d(10)-k-k-e 86 366 75728 75743 530228 CCCAATGGTAAGCCCA e-d-k-d(10)-k-k-e 77 366 75728 75743 530278 CCCAATGGTAAGCCCA e-d-d-k-d(9)-k-k-e 86 366 75728 75743 530328 CCCAATGGTAAGCCCA e-e-e-e-d(9)-k-k-e 80 366 75729 75744 528959 ACCCAATGGTAAGCCC e-e-e-d(10)-k-k-k 73 1277 75731 75746 528960 AAACCCAATGGTAAGC e-e-e-d(10)-k-k-k 43 1278 75732 75747 528961 TAAACCCAATGGTAAG e-e-e-d(10)-k-k-k 18 1279 75733 75748 528962 TTAAACCCAATGGTAA e-e-e-d(10)-k-k-k 13 1280 75734 75749 528963 TTTAAACCCAATGGTA e-e-e-d(10)-k-k-k 2 1281 BIOL0142WO 75741 75756 528964 CCTATGATTTAAACCC e-e-e-d(10)-k-k-k 17 1282 75745 75760 528965 GGTCCCTATGATTTAA e-e-e-d(10)-k-k-k 31 1283 75746 75761 528966 AGGTCCCTATGATTTA e-e-e-d(10)-k-k-k 22 1284 75802 75817 528967 CCTAAGGCCATGAACT e-e-e-d(10)-k-k-k 19 374 75803 75818 528968 ACCTAAGGCCATGAAC e-e-e-d(10)-k-k-k 25 1285 75804 75819 528969 TACCTAAGGCCATGAA e-e-e-d(10)-k-k-k 41 1286 75805 75820 528970 CTACCTAAGGCCATGA e-e-e-d(10)-k-k-k 55 1287 75806 75821 528971 GCTACCTAAGGCCATG e-e-e-d(10)-k-k-k 66 1288 75807 75822 528972 TGCTACCTAAGGCCAT e-e-e-d(10)-k-k-k 56 1289 75808 75823 528973 ATGCTACCTAAGGCCA e-e-e-d(10)-k-k-k 71 1290 75809 75824 528974 CATGCTACCTAAGGCC e-e-e-d(10)-k-k-k 58 1291 75810 75825 528975 ACATGCTACCTAAGGC e-e-e-d(10)-k-k-k 34 1292 75823 75838 528976 GTTAAGACCAGATACA e-e-e-d(10)-k-k-k 45 1293 75824 75839 528977 AGTTAAGACCAGATAC e-e-e-d(10)-k-k-k 40 1294 75825 75840 528978 GAGTTAAGACCAGATA e-e-e-d(10)-k-k-k 40 1295 75826 75841 528979 AGAGTTAAGACCAGAT e-e-e-d(10)-k-k-k 62 1296 75831 75846 530399 CAATCAGAGTTAAGAC k-d(10)-k-e-k-e-e 36 1297 75832 75848 530029 TACAATCAGAGTTAAGA e-e-k-d(10)-k-e-k-e 29 1298 75832 75847 530349 ACAATCAGAGTTAAGA e-k-d(10)-k-e-k-e 33 1299 75833 75848 528980 TACAATCAGAGTTAAG e-e-e-d(10)-k-k-k 0 378 75833 75848 530097 TACAATCAGAGTTAAG e-k-k-d(10)-k-k-e 41 378 75833 75848 530144 TACAATCAGAGTTAAG e-e-k-d(10)-k-k-e 16 378 75833 75848 530194 TACAATCAGAGTTAAG e-d-k-d(10)-k-k-e 28 378 75833 75848 530244 TACAATCAGAGTTAAG e-d-d-k-d(9)-k-k-e 0 378 75833 75848 530294 TACAATCAGAGTTAAG e-e-e-e-d(9)-k-k-e 7 378 75835 75850 528981 GCTACAATCAGAGTTA e-e-e-d(10)-k-k-k 52 1300 75836 75851 528982 TGCTACAATCAGAGTT e-e-e-d(10)-k-k-k 47 1301 75837 75852 528983 TTGCTACAATCAGAGT e-e-e-d(10)-k-k-k 44 1302 75849 75864 530400 CTCTCAGAACTTTTGC k-d(10)-k-e-k-e-e 65 1303 75850 75866 530030 TCCTCTCAGAACTTTTG e-e-k-d(10)-k-e-k-e 47 1304 75850 75865 530350 CCTCTCAGAACTTTTG e-k-d(10)-k-e-k-e 54 1305 75851 75866 530098 TCCTCTCAGAACTTTT e-k-k-d(10)-k-k-e 42 380 75851 75866 530145 TCCTCTCAGAACTTTT e-e-k-d(10)-k-k-e 38 380 75851 75866 530195 TCCTCTCAGAACTTTT e-d-k-d(10)-k-k-e 43 380 75851 75866 530245 TCCTCTCAGAACTTTT e-d-d-k-d(9)-k-k-e 28 380 75851 75866 530295 TCCTCTCAGAACTTTT e-e-e-e-d(9)-k-k-e 39 380 75957 75972 528984 CCCACGGGATTCCCTC e-e-e-d(10)-k-k-k 39 1306 75958 75973 528985 ACCCACGGGATTCCCT e-e-e-d(10)-k-k-k 36 1307 75959 75974 528986 AACCCACGGGATTCCC e-e-e-d(10)-k-k-k 47 1308 75960 75975 528987 CAACCCACGGGATTCC e-e-e-d(10)-k-k-k 39 1309 75961 75976 528988 GCAACCCACGGGATTC e-e-e-d(10)-k-k-k 48 1310 75962 75977 528989 AGCAACCCACGGGATT e-e-e-d(10)-k-k-k 40 1311 75964 75979 528990 TAAGCAACCCACGGGA e-e-e-d(10)-k-k-k 27 1312 75965 75980 528991 GTAAGCAACCCACGGG e-e-e-d(10)-k-k-k 47 1313 75966 75981 528992 GGTAAGCAACCCACGG e-e-e-d(10)-k-k-k 42 1314 BIOL0142WO 75967 75982 528993 AGGTAAGCAACCCACG e-e-e-d(10)-k-k-k 54 1315 75967 75982 530434 AGGTAAGCAACCCACG k-d(10)-k-e-k-e-e 51 1315 75968 75983 528994 TAGGTAAGCAACCCAC e-e-e-d(10)-k-k-k 53 1316 75968 75984 530064 GTAGGTAAGCAACCCAC e-e-k-d(10)-k-e-k-e 53 1317 75968 75983 530384 TAGGTAAGCAACCCAC e-k-d(10)-k-e-k-e 48 1316 75969 75984 528995 GTAGGTAAGCAACCCA e-e-e-d(10)-k-k-k 64 388 75969 75984 530129 GTAGGTAAGCAACCCA e-k-k-d(10)-k-k-e 79 388 75969 75984 530179 GTAGGTAAGCAACCCA e-e-k-d(10)-k-k-e 74 388 75969 75984 530229 GTAGGTAAGCAACCCA e-d-k-d(10)-k-k-e 64 388 75969 75984 530279 GTAGGTAAGCAACCCA e-d-d-k-d(9)-k-k-e 55 388 75969 75984 530329 GTAGGTAAGCAACCCA e-e-e-e-d(9)-k-k-e 61 388 75971 75986 528996 AGGTAGGTAAGCAACC e-e-e-d(10)-k-k-k 21 1318 75975 75990 528997 TTATAGGTAGGTAAGC e-e-e-d(10)-k-k-k 10 1319 75979 75994 528998 CACCTTATAGGTAGGT e-e-e-d(10)-k-k-k 22 1320 75981 75996 528999 ACCACCTTATAGGTAG e-e-e-d(10)-k-k-k 15 1321 75984 75999 529000 TAAACCACCTTATAGG e-e-e-d(10)-k-k-k 0 1322 75985 76000 529001 ATAAACCACCTTATAG e-e-e-d(10)-k-k-k 7 1323 75997 76012 529002 GGACAGCAGCTTATAA e-e-e-d(10)-k-k-k 12 1324 75998 76013 529003 AGGACAGCAGCTTATA e-e-e-d(10)-k-k-k 40 1325 75998 76013 530401 AGGACAGCAGCTTATA k-d(10)-k-e-k-e-e 41 1325 75999 76014 529004 CAGGACAGCAGCTTAT e-e-e-d(10)-k-k-k 38 1326 75999 76015 530031 CCAGGACAGCAGCTTAT e-e-k-d(10)-k-e-k-e 58 1327 75999 76014 530351 CAGGACAGCAGCTTAT e-k-d(10)-k-e-k-e 58 1326 75999 76014 530402 CAGGACAGCAGCTTAT k-d(10)-k-e-k-e-e 60 1326 76000 76016 530032 GCCAGGACAGCAGCTTA e-e-k-d(10)-k-e-k-e 74 1328 76000 76015 530099 CCAGGACAGCAGCTTA e-k-k-d(10)-k-k-e 73 1329 76000 76015 530146 CCAGGACAGCAGCTTA e-e-k-d(10)-k-k-e 70 1329 76000 76015 530196 CCAGGACAGCAGCTTA e-d-k-d(10)-k-k-e 67 1329 76000 76015 530246 CCAGGACAGCAGCTTA e-d-d-k-d(9)-k-k-e 39 1329 76000 76015 530296 CCAGGACAGCAGCTTA e-e-e-e-d(9)-k-k-e 67 1329 76000 76015 530352 CCAGGACAGCAGCTTA e-k-d(10)-k-e-k-e 67 1329 76001 76016 530100 GCCAGGACAGCAGCTT e-k-k-d(10)-k-k-e 77 1330 76001 76016 530147 GCCAGGACAGCAGCTT e-e-k-d(10)-k-k-e 84 1330 76001 76016 530197 GCCAGGACAGCAGCTT e-d-k-d(10)-k-k-e 71 1330 76001 76016 530247 GCCAGGACAGCAGCTT e-d-d-k-d(9)-k-k-e 53 1330 76001 76016 530297 GCCAGGACAGCAGCTT e-e-e-e-d(9)-k-k-e 75 1330 76001 76016 530403 GCCAGGACAGCAGCTT k-d(10)-k-e-k-e-e 77 1330 76002 76018 530033 TGGCCAGGACAGCAGCT e-e-k-d(10)-k-e-k-e 65 1331 76002 76017 530353 GGCCAGGACAGCAGCT e-k-d(10)-k-e-k-e 83 1332 76003 76018 530101 TGGCCAGGACAGCAGC e-k-k-d(10)-k-k-e 59 1333 76003 76018 530148 TGGCCAGGACAGCAGC e-e-k-d(10)-k-k-e 79 1333 76003 76018 530198 TGGCCAGGACAGCAGC e-d-k-d(10)-k-k-e 54 1333 76003 76018 530248 TGGCCAGGACAGCAGC e-d-d-k-d(9)-k-k-e 32 1333 76003 76018 530298 TGGCCAGGACAGCAGC e-e-e-e-d(9)-k-k-e 73 1333 76014 76029 530404 TTTGAATGCAGTGGCC k-d(10)-k-e-k-e-e 67 1334 BIOL0142WO 76015 76031 530034 AATTTGAATGCAGTGGC e-e-k-d(10)-k-e-k-e 69 1335 76015 76030 530354 ATTTGAATGCAGTGGC e-k-d(10)-k-e-k-e 85 1336 76015 76030 530405 ATTTGAATGCAGTGGC k-d(10)-k-e-k-e-e 55 1336 76016 76032 530035 GAATTTGAATGCAGTGG e-e-k-d(10)-k-e-k-e 69 1337 76016 76031 530102 AATTTGAATGCAGTGG e-k-k-d(10)-k-k-e 71 1338 76016 76031 530149 AATTTGAATGCAGTGG e-e-k-d(10)-k-k-e 70 1338 76016 76031 530199 AATTTGAATGCAGTGG e-d-k-d(10)-k-k-e 58 1338 76016 76031 530249 AATTTGAATGCAGTGG e-d-d-k-d(9)-k-k-e 47 1338 76016 76031 530299 AATTTGAATGCAGTGG e-e-e-e-d(9)-k-k-e 47 1338 76016 76031 530355 AATTTGAATGCAGTGG e-k-d(10)-k-e-k-e 72 1338 76017 76032 530103 GAATTTGAATGCAGTG e-k-k-d(10)-k-k-e 77 390 76017 76032 530150 GAATTTGAATGCAGTG e-e-k-d(10)-k-k-e 73 390 76017 76032 530200 GAATTTGAATGCAGTG e-d-k-d(10)-k-k-e 63 390 76017 76032 530250 GAATTTGAATGCAGTG e-d-d-k-d(9)-k-k-e 59 390 76017 76032 530300 GAATTTGAATGCAGTG e-e-e-e-d(9)-k-k-e 65 390 76029 76044 530435 AAGTACACATTGGAAT k-d(10)-k-e-k-e-e 62 1339 76030 76046 530057 TGAAGTACACATTGGAA e-e-k-d(10)-k-e-k-e 69 1340 76030 76045 530385 GAAGTACACATTGGAA e-k-d(10)-k-e-k-e 70 1341 76031 76046 529005 TGAAGTACACATTGGA e-e-e-d(10)-k-k-k 64 392 76031 76046 530130 TGAAGTACACATTGGA e-k-k-d(10)-k-k-e 85 392 76031 76046 530180 TGAAGTACACATTGGA e-e-k-d(10)-k-k-e 82 392 76031 76046 530230 TGAAGTACACATTGGA e-d-k-d(10)-k-k-e 65 392 76031 76046 530280 TGAAGTACACATTGGA e-d-d-k-d(9)-k-k-e 75 392 76031 76046 530330 TGAAGTACACATTGGA e-e-e-e-d(9)-k-k-e 52 392 76039 76054 529006 TTACACTATGAAGTAC e-e-e-d(10)-k-k-k 16 1342 76116 76131 529007 AGTTAAAGTAGATACA e-e-e-d(10)-k-k-k 0 1343 76121 76136 529008 CTGGAAGTTAAAGTAG e-e-e-d(10)-k-k-k 30 397 76130 76145 529009 CGTTTATTTCTGGAAG e-e-e-d(10)-k-k-k 52 1344 76144 76159 529010 CGGTTCCTATATAACG e-e-e-d(10)-k-k-k 21 1345 76145 76160 529011 ACGGTTCCTATATAAC e-e-e-d(10)-k-k-k 10 1346 Example 14: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from the study described in Example 13 exhibiting significant in vitro inhibition of STAT3 were tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 39.1 nM, 156.3 nM, 625.0 nM, and 2,500.0 nM concentrations of antisense oligonucleotide, as specified in Table 15. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

BIOL0142WO The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 15. As illustrated in Table 15, STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 15 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells 39.1 625.0 2500.0 ISIS No 156.3nM nM nM nM (μM) 481464 6 51 84 94 0.2 518345 0 9 56 84 0.6 518349 16 3 47 83 0.6 519636 16 41 75 89 0.2 519637 24 43 84 94 0.2 519638 6 34 70 92 0.3 528403 0 4 39 77 0.9 528458 0 15 46 81 0.7 528475 1 10 51 76 0.7 528476 0 11 42 80 0.7 528869 25 19 67 86 0.3 528880 0 3 45 76 0.8 528937 0 1 49 82 0.8 528938 0 9 50 82 0.7 528942 0 20 59 88 0.5 528959 0 4 55 79 0.7 529022 0 0 52 81 0.8 529023 0 0 53 90 0.6 529024 0 0 47 80 0.8 529025 0 11 50 90 0.6 529026 0 31 73 96 0.4 529027 0 7 36 80 0.9 530021 6 30 69 92 0.3 530025 10 33 73 92 0.3 530026 3 18 52 80 0.6 530041 0 28 72 91 0.4 530048 0 22 53 83 0.5 530049 2 16 69 92 0.4 530053 0 16 66 90 0.5 530062 4 56 85 94 0.2 530066 0 12 46 84 0.7 530088 2 39 77 93 0.3 530091 3 12 59 84 0.5 530092 7 27 65 85 0.4 530093 7 46 79 96 0.2 530094 0 17 63 89 0.5 530109 9 30 72 94 0.3 BIOL0142WO 530110 0 23 61 83 0.5 530112 0 13 42 90 0.6 530114 0 21 62 79 0.6 530116 22 40 71 92 0.2 530123 8 19 72 93 0.3 530130 0 33 64 89 0.4 530131 4 34 81 93 0.3 530135 22 38 79 94 0.2 530138 6 23 57 86 0.4 530140 4 22 62 91 0.4 530147 0 15 51 83 0.6 530156 7 41 81 96 0.2 530161 0 20 46 78 0.7 530170 0 29 67 90 0.4 530175 37 52 84 95 0.1 530178 8 24 70 86 0.4 530180 0 0 61 82 0.6 530181 0 27 52 86 0.5 530185 0 22 54 86 0.5 530190 17 17 60 87 0.4 530206 8 29 73 93 0.3 530225 0 27 67 91 0.4 530228 11 16 64 86 0.4 530261 5 25 57 91 0.4 530270 7 11 62 91 0.4 530275 14 34 73 91 0.3 530278 1 27 60 85 0.4 530285 5 20 61 82 0.5 530306 3 14 66 85 0.5 530311 6 27 59 86 0.4 530320 3 17 56 85 0.5 530325 5 35 70 92 0.3 530328 4 34 61 87 0.4 530340 8 34 74 90 0.3 530341 2 23 77 89 0.4 530344 16 20 64 89 0.4 530345 15 35 77 94 0.2 530346 5 24 66 92 0.4 530353 7 25 57 83 0.5 530354 2 24 60 81 0.5 530359 0 4 44 89 0.7 530361 13 30 59 92 0.3 530365 0 0 45 88 0.7 530367 0 15 49 88 0.5 530368 0 27 64 89 0.4 BIOL0142WO 530369 10 28 78 95 0.3 530373 13 29 64 92 0.3 530375 0 14 53 90 0.5 530380 8 40 80 94 0.2 530390 11 21 66 90 0.4 530391 20 7 49 86 0.5 530411 5 19 81 95 0.3 530430 0 8 53 91 0.6 530466 0 4 53 87 0.6 530468 4 17 65 90 0.4 530469 8 38 86 94 0.2 530470 5 39 78 91 0.3 530471 0 21 69 91 0.4 530476 7 9 32 89 0.7 530477 0 12 64 87 0.5 530478 0 14 59 90 0.5 530485 0 10 61 85 0.5 530486 0 17 64 80 0.5 530492 0 25 71 89 0.4 530493 4 23 58 88 0.4 530507 5 17 65 82 0.5 530508 0 14 56 89 0.5 530509 0 17 54 86 0.5 530513 6 24 74 91 0.3 530514 1 7 52 78 0.7 530515 0 19 73 89 0.4 Example 15: Antisense inhibition of human STAT3 in HuVEC cells Additional antisense oligonucleotides were designed targeting a STAT3 nucleic acid and were tested for their effects on STAT3 mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The chimeric antisense oligonucleotides in Table 16 are 33 deoxy, MOE and cEt gapmers or 34 deoxy, MOE and cEt gapmers. The 33 gapmers are 16 nucleosides in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising 3 nucleosides each. The 34 gapmers are 17 nucleosides in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked on the 5’ directions by a wing comprising 3 nucleosides and on the 3’ direction by a wing comprising 4 nucleosides. The BIOL0142WO internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5’-methylcytosines. The chemistry column of Table 16 presents the sugar motif of each gapmer, where ‘e’ indicates a 2’-MOE nucleoside, ‘k’ indicates a constrained ethyl (cEt) nucleoside, and ‘d’ indicates a 2’- deoxynucleoside.

“Human Target start site” indicates the 5’-most nucleoside to which the gapmer is targeted in the human gene sequence. “Human Target stop site” indicates the 3’-most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in Table 16 is targeted to human STAT3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each gapmer listed in Table 17 is targeted to human STAT3 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000).

Table 16 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Human Human % SEQ Start Stop ISIS No Sequence Chemistry inhibition ID NO Site Site 730 745 530011 GGAGATTCTCTACCAC k-k-k-d(10)-e-e-e 73 53 1901 1916 529974 AAGCCCTTGCCAGCCA e-e-e-d(10)-k-k-k 83 144 1901 1916 530012 AAGCCCTTGCCAGCCA k-k-k-d(10)-e-e-e 73 144 2206 2221 530015 CCATGATCTTATAGCC k-k-k-d(10)-e-e-e 38 175 3016 3031 481464 CTATTTGGATGTCAGC k-k-k-d(10)-k-k-k 94 245 3461 3476 529975 AGCACCAAGGAGGCTG e-e-e-d(10)-k-k-k 54 257 3461 3476 530013 AGCACCAAGGAGGCTG k-k-k-d(10)-e-e-e 58 257 3584 3600 530018 TCCTTAAACCTTCCTAT e-e-k-d(10)-k-e-k-e 46 1510 3585 3600 529944 TCCTTAAACCTTCCTA e-e-e-d(10)-k-k-k 44 273 3585 3600 529977 TCCTTAAACCTTCCTA k-k-k-d(10)-e-e-e 66 273 3592 3608 530019 TTAGATTCTCCTTAAAC e-e-k-d(10)-k-e-k-e 43 1511 3593 3608 529945 TTAGATTCTCCTTAAA e-e-e-d(10)-k-k-k 22 1166 3593 3608 529978 TTAGATTCTCCTTAAA k-k-k-d(10)-e-e-e 49 1166 3596 3612 530020 ATGCTTAGATTCTCCTT e-e-k-d(10)-k-e-k-e 85 1512 3597 3612 529979 ATGCTTAGATTCTCCT k-k-k-d(10)-e-e-e 86 1169 3599 3614 529946 AAATGCTTAGATTCTC e-e-e-d(10)-k-k-k 46 1172 3599 3614 529980 AAATGCTTAGATTCTC k-k-k-d(10)-e-e-e 25 1172 3716 3731 529947 CAGATCAAGTCCAGGG e-e-e-d(10)-k-k-k 68 1187 3716 3731 529981 CAGATCAAGTCCAGGG k-k-k-d(10)-e-e-e 83 1187 3718 3733 529948 AGCAGATCAAGTCCAG e-e-e-d(10)-k-k-k 75 1190 3718 3733 529982 AGCAGATCAAGTCCAG k-k-k-d(10)-e-e-e 84 1190 4236 4251 529983 AGGTGTTCCCATACGC k-k-k-d(10)-e-e-e 96 1245 4237 4252 529984 TAGGTGTTCCCATACG k-k-k-d(10)-e-e-e 91 336 4437 4452 529949 CATCAACTGTCTCCAG e-e-e-d(10)-k-k-k 48 354 4437 4452 529985 CATCAACTGTCTCCAG k-k-k-d(10)-e-e-e 37 354 4439 4454 529950 CACATCAACTGTCTCC e-e-e-d(10)-k-k-k 58 356 BIOL0142WO 4439 4454 529986 CACATCAACTGTCTCC k-k-k-d(10)-e-e-e 72 356 4646 4661 529987 TACAATCAGAGTTAAG k-k-k-d(10)-e-e-e 0 378 4664 4679 529951 TCCTCTCAGAACTTTT e-e-e-d(10)-k-k-k 38 380 4664 4679 529988 TCCTCTCAGAACTTTT k-k-k-d(10)-e-e-e 40 380 4782 4797 530016 GTAGGTAAGCAACCCA k-k-k-d(10)-e-e-e 60 388 4813 4828 529952 CCAGGACAGCAGCTTA e-e-e-d(10)-k-k-k 65 1329 4813 4828 529989 CCAGGACAGCAGCTTA k-k-k-d(10)-e-e-e 63 1329 4814 4829 529953 GCCAGGACAGCAGCTT e-e-e-d(10)-k-k-k 65 1330 4814 4829 529990 GCCAGGACAGCAGCTT k-k-k-d(10)-e-e-e 75 1330 4816 4831 529954 TGGCCAGGACAGCAGC e-e-e-d(10)-k-k-k 79 1333 4816 4831 529991 TGGCCAGGACAGCAGC k-k-k-d(10)-e-e-e 52 1333 4829 4844 529955 AATTTGAATGCAGTGG e-e-e-d(10)-k-k-k 52 1338 4829 4844 529992 AATTTGAATGCAGTGG k-k-k-d(10)-e-e-e 23 1338 4830 4845 529956 GAATTTGAATGCAGTG e-e-e-d(10)-k-k-k 60 390 4830 4845 529993 GAATTTGAATGCAGTG k-k-k-d(10)-e-e-e 51 390 4844 4859 530014 TGAAGTACACATTGGA k-k-k-d(10)-e-e-e 67 392 Table 17 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 Human Human % SEQ ID Start Stop ISIS No Sequence Chemistry inhibition NO Site Site 74203 74218 CTATTTGGATGTCAGC 481464 k-k-k-d(10)-k-k-k 94 245 74772 74787 TCCTTAAACCTTCCTA 529944 e-e-e-d(10)-k-k-k 44 273 74780 74795 TTAGATTCTCCTTAAA 529945 e-e-e-d(10)-k-k-k 22 1166 74786 74801 AAATGCTTAGATTCTC 529946 e-e-e-d(10)-k-k-k 46 1172 74903 74918 CAGATCAAGTCCAGGG 529947 e-e-e-d(10)-k-k-k 68 1187 74905 74920 AGCAGATCAAGTCCAG 529948 e-e-e-d(10)-k-k-k 75 1190 75624 75639 CATCAACTGTCTCCAG 529949 e-e-e-d(10)-k-k-k 48 354 75626 75641 CACATCAACTGTCTCC 529950 e-e-e-d(10)-k-k-k 58 356 75851 75866 TCCTCTCAGAACTTTT 529951 e-e-e-d(10)-k-k-k 38 380 76000 76015 CCAGGACAGCAGCTTA 529952 e-e-e-d(10)-k-k-k 65 1329 76001 76016 GCCAGGACAGCAGCTT 529953 e-e-e-d(10)-k-k-k 65 1330 76003 76018 TGGCCAGGACAGCAGC 529954 e-e-e-d(10)-k-k-k 79 1333 76016 76031 AATTTGAATGCAGTGG 529955 e-e-e-d(10)-k-k-k 52 1338 76017 76032 GAATTTGAATGCAGTG 529956 e-e-e-d(10)-k-k-k 60 390 2340 2355 ACATACAGTAAGACCA 529957 e-e-e-d(10)-k-k-k 21 1376 2385 2400 CAAAAATTTACAACCC 529958 e-e-e-d(10)-k-k-k 10 1380 2410 2425 CCAATGCTTTATCAGC 529959 e-e-e-d(10)-k-k-k 51 1384 2671 2686 AGACTAAAATCAAGGC 529960 e-e-e-d(10)-k-k-k 30 1388 5002 5017 AACTGAAATTCCTTGG 529961 e-e-e-d(10)-k-k-k 52 1395 5701 5716 GTACTCTTTCAGTGGT 529962 e-e-e-d(10)-k-k-k 91 1399 8080 8095 GCAGATTTACCTTCCT 529963 e-e-e-d(10)-k-k-k 55 1409 9125 9140 CTGCCCCTATGTATAA 529964 e-e-e-d(10)-k-k-k 18 1413 11263 11278 CTGCCCCTATGTATAA 529964 e-e-e-d(10)-k-k-k 18 1413 BIOL0142WO 9864 9879 GCTTCTTCCTGAGACA 529965 e-e-e-d(10)-k-k-k 52 1417 12347 12362 GCTTCTTCCTGAGACA 529965 e-e-e-d(10)-k-k-k 52 1417 9866 9881 TGGCTTCTTCCTGAGA 529966 e-e-e-d(10)-k-k-k 51 1420 12349 12364 TGGCTTCTTCCTGAGA 529966 e-e-e-d(10)-k-k-k 51 1420 9875 9890 TCCTCCTGTTGGCTTC 529967 e-e-e-d(10)-k-k-k 80 1425 12358 12373 TCCTCCTGTTGGCTTC 529967 e-e-e-d(10)-k-k-k 80 1425 9876 9891 TTCCTCCTGTTGGCTT 529968 e-e-e-d(10)-k-k-k 56 1426 12359 12374 TTCCTCCTGTTGGCTT 529968 e-e-e-d(10)-k-k-k 56 1426 9878 9893 GGTTCCTCCTGTTGGC 529969 e-e-e-d(10)-k-k-k 69 1429 12361 12376 GGTTCCTCCTGTTGGC 529969 e-e-e-d(10)-k-k-k 69 1429 16865 16880 TATAATTGTGTACTGG 529970 e-e-e-d(10)-k-k-k 41 1441 26063 26078 CAACTTTAGCCCCTTC 529971 e-e-e-d(10)-k-k-k 32 1452 48404 48419 CACACTTTCCATTCTA 529972 e-e-e-d(10)-k-k-k 30 1476 71616 71631 CAGTACAATTGCTTCA 529973 e-e-e-d(10)-k-k-k 49 1505 66138 66153 AAGCCCTTGCCAGCCA 529974 e-e-e-d(10)-k-k-k 83 144 74648 74663 AGCACCAAGGAGGCTG 529975 e-e-e-d(10)-k-k-k 54 257 2705 2720 CTAATGGTTCTTTGTG 529976 e-e-e-d(10)-k-k-k 25 411 74772 74787 TCCTTAAACCTTCCTA 529977 k-k-k-d(10)-e-e-e 66 273 74780 74795 TTAGATTCTCCTTAAA 529978 k-k-k-d(10)-e-e-e 49 1166 74784 74799 ATGCTTAGATTCTCCT 529979 k-k-k-d(10)-e-e-e 86 1169 74786 74801 AAATGCTTAGATTCTC 529980 k-k-k-d(10)-e-e-e 25 1172 74903 74918 CAGATCAAGTCCAGGG 529981 k-k-k-d(10)-e-e-e 83 1187 74905 74920 AGCAGATCAAGTCCAG 529982 k-k-k-d(10)-e-e-e 84 1190 75423 75438 AGGTGTTCCCATACGC 529983 k-k-k-d(10)-e-e-e 96 1245 75424 75439 TAGGTGTTCCCATACG 529984 k-k-k-d(10)-e-e-e 91 336 75624 75639 CATCAACTGTCTCCAG 529985 k-k-k-d(10)-e-e-e 37 354 75626 75641 CACATCAACTGTCTCC 529986 k-k-k-d(10)-e-e-e 72 356 75833 75848 TACAATCAGAGTTAAG 529987 k-k-k-d(10)-e-e-e 0 378 75851 75866 TCCTCTCAGAACTTTT 529988 k-k-k-d(10)-e-e-e 40 380 76000 76015 CCAGGACAGCAGCTTA 529989 k-k-k-d(10)-e-e-e 63 1329 76001 76016 GCCAGGACAGCAGCTT 529990 k-k-k-d(10)-e-e-e 75 1330 76003 76018 TGGCCAGGACAGCAGC 529991 k-k-k-d(10)-e-e-e 52 1333 76016 76031 AATTTGAATGCAGTGG 529992 k-k-k-d(10)-e-e-e 23 1338 76017 76032 GAATTTGAATGCAGTG 529993 k-k-k-d(10)-e-e-e 51 390 2340 2355 ACATACAGTAAGACCA 529994 k-k-k-d(10)-e-e-e 44 1376 2385 2400 CAAAAATTTACAACCC 529995 k-k-k-d(10)-e-e-e 0 1380 2410 2425 CCAATGCTTTATCAGC 529996 k-k-k-d(10)-e-e-e 65 1384 2671 2686 AGACTAAAATCAAGGC 529997 k-k-k-d(10)-e-e-e 44 1388 5002 5017 AACTGAAATTCCTTGG 529998 k-k-k-d(10)-e-e-e 35 1395 5701 5716 GTACTCTTTCAGTGGT 529999 k-k-k-d(10)-e-e-e 91 1399 8080 8095 GCAGATTTACCTTCCT 530000 k-k-k-d(10)-e-e-e 80 1409 9125 9140 CTGCCCCTATGTATAA 530001 k-k-k-d(10)-e-e-e 21 1413 11263 11278 CTGCCCCTATGTATAA 530001 k-k-k-d(10)-e-e-e 21 1413 9864 9879 GCTTCTTCCTGAGACA 530002 k-k-k-d(10)-e-e-e 74 1417 12347 12362 GCTTCTTCCTGAGACA 530002 k-k-k-d(10)-e-e-e 74 1417 BIOL0142WO 9866 9881 TGGCTTCTTCCTGAGA 530003 k-k-k-d(10)-e-e-e 67 1420 12349 12364 TGGCTTCTTCCTGAGA 530003 k-k-k-d(10)-e-e-e 67 1420 9875 9890 TCCTCCTGTTGGCTTC 530004 k-k-k-d(10)-e-e-e 83 1425 12358 12373 TCCTCCTGTTGGCTTC 530004 k-k-k-d(10)-e-e-e 83 1425 9876 9891 TTCCTCCTGTTGGCTT 530005 k-k-k-d(10)-e-e-e 77 1426 12359 12374 TTCCTCCTGTTGGCTT 530005 k-k-k-d(10)-e-e-e 77 1426 9878 9893 GGTTCCTCCTGTTGGC 530006 k-k-k-d(10)-e-e-e 89 1427 12361 12376 GGTTCCTCCTGTTGGC 530006 k-k-k-d(10)-e-e-e 89 1427 16865 16880 TATAATTGTGTACTGG 530007 k-k-k-d(10)-e-e-e 21 1441 26063 26078 CAACTTTAGCCCCTTC 530008 k-k-k-d(10)-e-e-e 58 1452 48404 48419 CACACTTTCCATTCTA 530009 k-k-k-d(10)-e-e-e 59 1476 71616 71631 CAGTACAATTGCTTCA 530010 k-k-k-d(10)-e-e-e 75 1505 50694 50709 GGAGATTCTCTACCAC 530011 k-k-k-d(10)-e-e-e 73 53 66138 66153 AAGCCCTTGCCAGCCA 530012 k-k-k-d(10)-e-e-e 73 144 74648 74663 AGCACCAAGGAGGCTG 530013 k-k-k-d(10)-e-e-e 58 257 76031 76046 TGAAGTACACATTGGA 530014 k-k-k-d(10)-e-e-e 67 392 67068 67083 CCATGATCTTATAGCC 530015 k-k-k-d(10)-e-e-e 38 175 75969 75984 GTAGGTAAGCAACCCA 530016 k-k-k-d(10)-e-e-e 60 388 2705 2720 CTAATGGTTCTTTGTG 530017 k-k-k-d(10)-e-e-e 46 411 74771 74787 TCCTTAAACCTTCCTAT 530018 e-e-k-d(10)-k-e-k-e 46 1510 74779 74795 TTAGATTCTCCTTAAAC 530019 e-e-k-d(10)-k-e-k-e 43 1511 74783 74799 ATGCTTAGATTCTCCTT 530020 e-e-k-d(10)-k-e-k-e 85 1512 Example 16: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from the study described in Example 15 exhibiting significant in vitro inhibition of STAT3 were tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 39.1 nM, 156.3 nM, 625.0 nM, and 2,500.0 nM concentrations of antisense oligonucleotide, as specified in Table 18. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 18. As illustrated in Table 18, STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 18 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells 39.1 156.3 625.0 2500.0 IC ISIS No nM nM nM nM (μM) BIOL0142WO 481464 41 78 92 91 0.04 529962 30 51 86 95 0.12 529979 0 43 81 95 0.27 529982 0 0 70 90 0.56 529983 31 67 87 94 0.08 529984 17 44 83 97 0.19 529999 29 51 83 96 0.13 530006 18 38 77 94 0.22 530020 2 39 75 92 0.28 Example 17: Effect of ISIS antisense oligonucleotides targeting STAT3 in the treatment of an MDA-MB-231 human breast cancer xenograft model BALB/c nude mice inoculated with human breast cancer cells MDA-MB-231 were treated with ISIS 481464 and ISIS 481549. ISIS 481549 is cross-reactive with the mouse sequence (i.e, hybridizes to the mouse sequence). Tumor growth and tolerability of oligonucleotides in the mice was evaluated.

Treatment The study was conducted at Pharmaron Inc (Beijing, P.R. China). The BALB/c nude mice were obtained from Beijing HFK Bio-Technology Co., Ltd. MDA-MB-231 human breast cancer cells were maintained in vitro as a monolayer culture in Leibovitz’s L-15 medium supplemented with 10% heat- inactivated fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine. The cells were maintained at 37 C in an atmosphere of 5% CO in air. The tumor cells were routinely sub- cultured twice weekly with trypsin-EDTA treatment. Cells growing at exponential growth phase were harvested and counted for tumor inoculation.

Three groups of eight randomly assigned 6-8 week-old female BALB/c nude mice each were inoculated in the right flank with the MDA-MB-231 tumor fragments (3 mm x 2 mm x 2 mm, which were generated from tumor inoculation passage) for tumor development. Antisense oligonucleotide treatment started at day 11 after tumor inoculation when the mean tumor size reached approximately 100 mm .

Two of the groups were injected intraperitoneally twice a week for 3 weeks with 25 mg/kg of ISIS 481464 or ISIS 481549. A control group of mice was injected intraperitoneally twice a week for 3 weeks with PBS.

All procedures related to animal handling, care, and treatment, were performed according to the guidelines approved by the Institutional Animal Care and Use Committee (IACUC). Animals were routinely checked for any effects of tumor growth on normal behavior, such as mobility, food consumption, body weight changes, and any other abnormal effect.

RNA analysis BIOL0142WO RNA was extracted from tumor tissue for real-time PCR analysis of human STAT3 mRNA levels using primer probe set RTS199, described hereinabove. Murine STAT3 mRNA levels were also measured using primer probe set mSTAT3_LTS00664 (forward sequence CGACAGCTTCCCCATGGA, designated herein as SEQ ID NO: 1513; reverse sequence ATGCCCAGTCTTGACTCTCAATC, designated herein as SEQ ID NO: 1514; probe sequence CTGCGGCAGTTCCTGGCACCTT, designated herein as SEQ ID NO: 1515). Results are presented as percent inhibition of STAT3, relative to PBS control, normalized to cyclophilin. As shown in Table 19, treatment with ISIS antisense oligonucleotides resulted in reduction of both human and murine STAT3 mRNA in comparison to the PBS control.

Table 19 Percent inhibition of STAT3 mRNA in the treatment groups relative to the PBS control in the MDA-MB- 231 xenograft model human murine ISIS No STAT3 STAT3 481464 25 16 481549 22 44 Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper. Tumor volumes were calculated using the formula: V = 0.536 x a x b , where a and b are the long and short diameters of the tumor, respectively. The tumor size was utilized for calculations of the T-C and T /C values. T-C was calculated with T as the median time (in days) required for the tumors in the treatment groups to reach a pre-determined size (900 mm ) , and C as the median time (in days) for the tumors in the control group to reach the same size. The T /C value (expressed as percentage) is an indication of the anti-tumor effectiveness of the ISIS oligonucleotides, where T and C were the mean volume of the treated and control groups, respectively, on a given day (day 32).

The results are presented in Tables 20 and 21. The data indicates that treatment with ISIS 481464 and ISIS 481549 significantly impeded tumor growth.

Table 20 Effect of antisense inhibition of STAT3 on tumor growth in the MDA-MB-231 xenograft model Day PBS ISIS 481464 ISIS 481549 11 103 104 104 185 142 158 18 292 200 205 22 519 305 326 745 430 436 29 1,332 643 688 32 1,741 921 984 BIOL0142WO Table 21 Effect of antisense inhibition of STAT3 on tumor growth inhibition in the MDA-MB-231 xenograft model Tumor Size (mm ) T /C T-C Treatment at day 32 (%) at 900 mm PBS 1,741 - - ISIS 481464 921 53 ISIS 481549 984 57 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured on a regular basis during the treatment period. The data is presented in Table 22 and indicate that treatment with either ISIS 481464 or ISIS 481549 does not cause significant weight gain or loss.

Table 22 Body weight measurements of mice in the MDA-MB-231 xenograft model Day 11 Day 15 Day 18 Day 22 Day 25 Day 29 Day 32 PBS 21.8 22.2 22.5 22.5 22.9 23.4 24.0 ISIS 481464 22.3 22.8 23.0 23.2 23.8 23.9 24.9 ISIS 481549 22.2 22.5 23.0 23.3 23.7 23.7 24.6 Example 18: Effect of ISIS antisense oligonucleotides targeting STAT3 in the treatment of an A431 human epidermoid carcinoma xenograft model BALB/c nude mice inoculated with human epidermoid cancer cells A431 were treated with ISIS 481464 and ISIS 481549. ISIS 481549 is cross-reactive with the mouse sequence (i.e, hybridizes to the mouse sequence). The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Treatment The study was conducted at Pharmaron Inc (Beijing, P.R. China). The BALB/c nude mice were obtained from Beijing HFK Bio-Technology Co., Ltd. A431 human epidermoid carcinoma cells were maintained in vitro as a monolayer culture in DMEM medium supplemented with 10% heat-inactivated fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine. The cells were maintained at 37 C in an atmosphere of 5% CO in air. The tumor cells were routinely sub-cultured twice weekly with trypsin-EDTA treatment. Cells growing in an exponential growth phase were harvested and counted for tumor inoculation.

Three groups of eight randomly assigned 6-8 week-old female BALB/c nude mice each were inoculated subcutaneously with 5 x 10 A431 tumor cells for tumor development. Antisense oligonucleotide treatment started at day 8 after tumor inoculation when the mean tumor size reached BIOL0142WO approximately 95 mm . Two of the groups were injected intraperitoneally twice a week for 4 weeks with mg/kg of ISIS 481464 or ISIS 481549. A control group of mice was injected intraperitoneally twice a week for 4 weeks with PBS.

All procedures related to animal handling, care, and treatment, were performed according to the guidelines approved by the Institutional Animal Care and Use Committee (IACUC). At the time of routine monitoring, the animals were checked for any effects of tumor growth on normal behavior, such as mobility, food consumption, body weight changes and any other abnormal effect.

RNA analysis RNA was extracted from tumor tissue for real-time PCR analysis of human STAT3 mRNA levels using primer probe set RTS199, described hereinabove. Murine STAT3 mRNA levels were also measured using primer probe set mSTAT3_LTS00664, described hereinabove. Results are presented as percent inhibition of STAT3, relative to PBS control, normalized to cyclophilin. As shown in Table 23, treatment with ISIS antisense oligonucleotides resulted in reduction of both human and murine STAT3 mRNA in comparison to the PBS control.

Table 23 Inhibition of STAT3 mRNA in the treatment groups relative to the PBS control in the A431 xenograft model human murine ISIS No STAT3 STAT3 481464 63 26 481549 29 38 Protein analysis Protein was extracted from tumor lysates for western analysis of human STAT3 protein levels with STAT3 monoclonal antibody (Cell Signaling Technology, Cat #9135). Results are presented as percent inhibition of STAT3, relative to PBS control, normalized to the house-keeping protein, COX-II.

As shown in Table 24, treatment with ISIS antisense oligonucleotides resulted in reduction of STAT3 protein levels in comparison to the PBS control.

Table 24 Inhibition of STAT3 protein levels in the treatment groups relative to the PBS control in the A431 xenograft model ISIS No % reduction 481464 99 481549 22 BIOL0142WO Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper, and tumor volumes were calculated using the formula: V = 0.5 x a x b , where a and b are the long and short diameters of the tumor, respectively. The tumor size was utilized for calculations of the T-C and T /C values. T-C was calculated with T as the median time (in days) required for the tumors in the treatment groups to reach a pre-determined size (800 mm ), and C as the median time (in days) for the tumors in the control group to /C value (expressed as percentage) is an indication of the anti-tumor reach the same size. The T effectiveness of the ISIS oligonucleotides, where T and C were the mean volume of the treated and control groups, respectively, on a given day (day 33).

The results are presented in Tables 25 and 26. The data indicates that treatment with either ISIS 481464 or ISIS 481549 significantly impeded tumor growth.

Table 25 Effect of antisense inhibition of STAT3 on tumor growth in the A431 xenograft model Days PBS ISIS 481464 ISIS 481549 8 94 95 95 14 178 157 132 17 308 261 202 21 528 412 304 24 682 552 426 28 875 698 555 31 1,071 898 716 33 1,210 1,030 858 Table 26 Effect of antisense inhibition of STAT3 on tumor growth inhibition in the A431 xenograft model Tumor Size (mm ) T /C T-C Treatment at day 33 (%) at 800 mm PBS 1,210 - - ISIS 481464 1,030 85 ISIS 481549 858 71 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured on a regular basis during the treatment period. The data is presented in Table 27 and indicate that treatment with either ISIS 481464 or ISIS 481549 does not affect the overall health of the mice.

Table 27 Body weight measurements of mice in the A431 xenograft model Day 8 Day 14 Day 17 Day 21 Day 24 Day 28 Day 31 Day 33 PBS 20 20 20 21 21 21 22 22 ISIS 481464 20 21 21 21 21 22 22 23 BIOL0142WO ISIS 481549 20 20 21 21 21 22 22 22 Example 19: Effect of ISIS antisense oligonucleotides targeting STAT3 in the treatment of an NCI- H460 human non-small cell lung cancer (NSCLC) xenograft model BALB/c nude mice inoculated with human NCI-H460 human NSCLC were treated with ISIS 491464, which targets human STAT3, and ISIS 481549, which targets both human and murine STAT3.

The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Treatment The study was conducted at Pharmaron Inc (Beijing, P.R. China). The BALB/c nude mice were obtained from Beijing HFK Bio-Technology Co., Ltd. NCI-H460 human NSCLC cells were maintained in vitro as a monolayer culture in RPMI-1640 medium supplemented with 10% heat-inactivated fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine. The cells were maintained at 37 C in an atmosphere of 5% CO in air. The tumor cells were routinely sub-cultured twice weekly with trypsin-EDTA treatment. Cells growing in an exponential growth phase were harvested and counted for tumor inoculation.

Three groups of eight randomly assigned 6-8 week-old female BALB/c nude mice each were inoculated subcutaneously with 2 x 10 NCI-H460 tumor cells for tumor development. Antisense oligonucleotide treatment started at day 6 after tumor inoculation when the mean tumor size reached approximately 100 mm . Two of the groups were injected intraperitoneally twice a week for 3 weeks with 25 mg/kg of ISIS 481464 or ISIS 481549. The third group of mice was injected intraperitoneally twice a week for 3 weeks with PBS, and served as the control group.

RNA analysis RNA was extracted from tumor tissue for real-time PCR analysis of human STAT3 mRNA levels using primer probe set RTS199, described hereinabove. Murine STAT3 mRNA levels were also measured using primer probe set mSTAT3_LTS00664, described hereinabove. Results are presented as percent inhibition of STAT3, relative to PBS control, normalized to cyclophilin. As shown in Table 28, treatment with ISIS antisense oligonucleotides resulted in reduction of both human and murine STAT3 mRNA in comparison to the PBS control.

BIOL0142WO Table 28 Inhibition of STAT3 mRNA in the treatment groups relative to the PBS control in the NCI-H460 xenograft model human murine ISIS No STAT3 STAT3 481464 34 0 481549 20 35 Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper, and tumor volumes were calculated using the formula: V = 0.5 x a x b , where a and b are the long and short diameters of the /C values. T-C was tumor, respectively. The tumor size was utilized for calculations of the T-C and T calculated with T as the median time (in days) required for the tumors in the treatment groups to reach a pre-determined size (1,500 mm ), and C as the median time (in days) for the tumors in the control group to reach the same size. The T /C value (expressed as percentage) is an indication of the anti-tumor effectiveness of the ISIS oligonucleotides, where T and C were the mean volume of the treated and control groups, respectively, on a given day (day 20).

The results are presented in Tables 29 and 30. The data indicates that treatment with either ISIS 481464 or ISIS 481549 significantly impeded tumor growth.

Table 29 Effect of antisense inhibition of STAT3 on tumor growth in the NCI-H460 xenograft model Days PBS ISIS 481464 ISIS 481549 6 104 104 103 8 303 197 197 11 746 498 443 13 1,175 676 654 1,642 982 954 18 2,277 1,571 1,577 2,859 1,996 2,093 22 - 2,609 2,679 Table 30 Effect of antisense inhibition of STAT3 on tumor growth inhibition in the NCI-H460 xenograft model Tumor Size (mm ) T /C T-C Treatment at day 20 (%) at 1,500 mm PBS 1,210 - - ISIS 481464 1,030 85 ISIS 481549 858 71 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured on a regular basis during the treatment period. The data is presented in Table 31 and BIOL0142WO indicate that treatment with either ISIS 481464 or ISIS 481549 does not affect the overall health of the mice.

Table 31 Body weight measurements of mice in the NCI-H460 xenograft model Day 6 Day 8 Day 11 Day 13 Day 15 Day 18 Day 20 Day 22 PBS 20 20 20 20 20 20 21 - ISIS 481464 20 20 20 20 19 19 20 20 ISIS 481549 20 20 20 20 20 19 20 20 Example 20: Effect of antisense inhibition of human STAT3 in a human glioblastoma orthotopic mouse model NU/J mice orthotopically implanted with human glioblastoma cells were treated with ISIS 455291, a 55 MOE gapmer having a sequence of CAGCAGATCAAGTCCAGGGA (SEQ ID NO: 1590). The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Treatment Thirty NU/J mice were stereotactically implanted in the right frontal lobe with 5 x 10 U-87 MG- luc2 cells. On day 15 after tumor cell implantation, 15 of these mice were dosed intracranially with a bolus injection at the site of tumor implantation with 100 μg of ISIS 455291, which was dissolved in 2 μL of PBS. The remaining 15 mice were dosed intracranially with a bolus injection at the site of tumor implantation with 2 μL of PBS. The second group of mice served as the control group.

Analysis On day 18 after tumor transplantation, five mice from each group were euthanized by CO inhalation and brain samples were collected for RNA analysis. RNA was extracted from tumor tissue for real-time PCR analysis of human STAT3 mRNA levels using primer probe set RTS199, described hereinabove. Treatment with ISIS 455291 resulted in 27% reduction of human STAT3 mRNA in the tumor tissue in comparison to the PBS control.

The remaining mice in each group were monitored regularly up to 2 weeks for survival analysis.

The median survival for the PBS control group was 30.5 days. The medial survival for the ISIS oligonucleotide-treated mice was 35 days. The P value was 0.2088.

Example 21: Effect of treatment with ISIS 481549 in APC/Min mice The effect of treatment with ISIS 481549 on STAT3 mRNA levels and intestinal adenoma numbers in the APC/Min mouse model was evaluated. The APC/Min mice strain is predisposed to BIOL0142WO spontaneous intestinal adenoma formation throughout the entire intestinal tract at an early age (Moser A.R. et al., Science 1990. 247: 322-324).

Treatment Two groups of 4 male nine-week-old APC/Min+ mice were injected subcutaneously with 5 mg/kg or 25 mg/kg of ISIS 481549 administered five times a week (total weekly doses of 25 mg/kg and 125 mg/kg, respectively) for 4 weeks. A group of 4 male nine-week-old APC/Min+ mice were injected subcutaneously with 50 mg/kg of control oligonucleotide, ISIS 141923, administered five times a week (total weekly dose of 250 mg/kg) for 4 weeks. A control group of 4 male nine-week-old APC/Min+ mice were injected subcutaneously with PBS administered five times a week for 4 weeks. Mice were euthanized with isoflurance followed by cervical dislocation 48 hrs after the final injection.

Colons and intestines were removed, separated from each other and cleaned. Approximately 5 cm of the upper intestinal tract was excised and homogenized in 2.5 mL RLT buffer (Qiagen) with 1% of 2- mercaptoethanol (RLT-BMe) and placed in dry ice. The colon was cut in half and the proximal half of the tissue was homogenized in 2.5 mL RLT-BMe and placed in dry ice. A small piece of the liver (0.2 g) was excised and homogenized in RLT-BMe and placed in dry ice.

RNA analysis RNA was isolated from the tissues using PureLink Total RNA Purification kit (Invitrogen; #12173-011A), according to the manufacturer’s protocol. RT-PCR was performed using the StepOnePlus system (Applied Biosystems), according to the manufacturer’s protocol. Murine primer probe set mSTAT3_LTS000664 (forward primer CGACAGCTTCCCCATGGA, designated herein as SEQ ID NO: 1513; reverse primer ATGCCCAGTCTTGACTCTCAATC, designated herein as SEQ ID NO: 1514; probe CTGCGGCAGTTCCTGGCACCTT, designated herein as SEQ ID NO: 1515) was used for measuring STAT3 mRNA levels. The mRNA level of the housekeeping gene, Cyclophilin, was measured with the primer probe set mcyclo_24 (forward primer TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 1516; reverse primer ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 1517; probe CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 1518) and was used to normalize STAT3 mRNA levels.

Treatment with ISIS 481549 resulted in statistically significant reduction in STAT3 mRNA expression in liver at 25 mg/kg/wk and 125 mg/kg/wk dosing in liver, small intestine and colon (Table 32) compared to the PBS control. Significant differences between the treatment and the control groups were determined using the Student’s two-tailed t test (p<0.05).

Table 32 Percent inhibition of STAT3 mRNA expression levels in APC/Min+ mice Treatment Small Liver Colon (mg/kg/week) intestine ISIS 141923 (250) 0 0 0 ISIS 481549 (125) 98 73 82 ISIS 481549 (25) 79 41 32 BIOL0142WO Adenoma number analysis Histological analysis of the small intestine was performed to microscopically evaluate adenoma numbers. Treatment with ISIS 481549 at 125 mg/kg/week resulted in a statistically significant decrease in tumor number compared to the PBS control (Table 33). Significant differences between the treatment and the control groups were determined using the Student’s two-tailed t test (p<0.05).

Table 33 Adenoma counts in APC/Min+ mice Treatment Colon (mg/kg/week) count ISIS 141923 (250) 5 ISIS 481549 (125) 1 ISIS 481549 (25) 5 PBS 6 Example 22: Effect of antisense oligonucleotides targeting STAT3 in the treatment of a PC-9 NSCLC xenograft model BALB/c nude mice (Charles River) inoculated with the human non-small cell lung cancer cell line, PC-9, were treated with ISIS 481549 and ISIS 481464. Tumor growth and STAT3 target reduction in the mice were evaluated.

Treatment Six- to eight-week old female BALB/c nude mice were inoculated subcutaneously with 7 x 10 PC-9 human NSCLC cells. Mice that displayed a mean tumor volume of 150-200 mm were selected and randomized into different treatment groups. Two groups of 7 mice were injected subcutaneously with 25 mg/kg of ISIS 481549 or ISIS 481464 administered five times a week (total weekly doses of 125 mg/kg) for 6 weeks. A group of 7 mice were injected subcutaneously with 25 mg/kg of ISIS 347526 (TCTTATGTTTCCGAACCGTT, no known murine or human target, designated herein as SEQ ID NO: 1519) administered five times a week (total weekly doses of 125 mg/kg) for 6 weeks. A final dose of antisense oligonucleotide was given 24 hrs before the mice were euthanized.

RNA analysis Tumors were harvested and RNA was isolated using Qiagen RNAeasy Mini Kit (#74106), according to the manufacturer’s protocol. STAT3 mRNA levels were measured using an ABI StepOnePlus RT-PCR instrument with human STAT3 primer probe set RTS2033 (forward primer GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse primer TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522). The mRNA levels of the housekeeping gene, GAPDH, was measured with the human primer probe set (forward primer GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 1523; reverse primer BIOL0142WO GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 1524; probe CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 1525) and was used to normalize RNA levels. The results are presented in Table 34 and indicate that the antisense oligonucleotides reduced STAT3 mRNA levels.

Table 34 Percent inhibition of STAT3 mRNA expression levels in the NSCLC xenograft model compared to the ASO control Treatment (mg/kg) % inhibition ISIS 481464 (25) 40 ISIS 481549 (25) 22 Tumor growth analysis Tumors were measured regularly throughout the study period. Tumor growth inhibition (TGI) was calculated using the formula TGI = [1-(X of STAT3 ASO group (final))-X of STAT3 ASO group (day1))/(X of control ASO group (final)-X of control ASO group (day1))] x 100%, where X = mean tumor volume.

The difference of the treatment group from the control group was evaluated using the ANOVA statistical test. The results are presented in Table 35. The data indicates that tumor growth was significantly inhibited by ISIS 481464 with TGI of 97% by day 52. Treatment by ISIS 481549 inhibited PC-9 tumor growth by 78%.

Table 35 Tumor growth measurements in the NSCLC xenograft model Day 10 13 18 20 25 28 31 34 38 42 45 48 52 ISIS 481464 233 241 267 240 229 201 201 254 218 222 221 236 255 ISIS 481549 233 217 239 188 237 299 326 318 328 410 341 389 398 ISIS 347526 240 279 295 344 295 354 383 407 540 573 655 890 940 Body weight analysis Body weights were measured regularly throughout the study period. The results are presented in Table 36 and indicate that there were no significant changes in body weight of the treatment groups compared to the control groups.

Table 36 Body weight measurements in the NSCLC xenograft model Day 10 13 18 20 25 28 31 34 38 42 45 48 52 ISIS 481464 18.65 19.44 18.98 19.66 19.40 19.45 19.89 20.26 19.86 20.31 20.13 20.03 20.11 ISIS 481549 18.13 19.06 18.65 19.30 19.31 19.36 19.23 19.18 18.28 17.21 16.49 15.48 15.01 ISIS 347526 18.34 19.29 19.05 19.65 19.63 19.98 20.08 20.69 19.90 20.19 20.25 20.09 20.19 BIOL0142WO Example 23: Effect of ISIS 481464 in the treatment of an LG-476 NSCLC xenograft model scid tm1Wjl NOD.Cg-Prkdc Il2rg /SzJ mice (NSG; JAX #5557), which are immunodeficient, were inoculated with the human non-small cell lung cancer cell line, LG-476 (Jackson Laboratory) and treated with ISIS 481464. Tumor growth and STAT3 target reduction in the mice was evaluated.

Treatment Four- to six-week old female NSG mice were inoculated subcutaneously with LG-476 human NSCLC cells and monitored three times weekly for clinical observations, body weights and tumor volume. Once tumors reached 1,000 mm , the tumors were harvested and fragmented. Tumor fragments measuring 3-5 mm were implanted subcutaneously into the right hind flank of 30 NSG mice. The mice were monitored three times a week. When individual tumors reached a volume of 200-250 mm , the mice were randomly assigned to 2 groups and were injected with 25 mg/kg of ISIS 481464 or PBS administered 5 times a week (weekly doses of 125 mg/kg) for 3 weeks. Tumors were harvested 24 hrs after the last dose.

RNA analysis Lysates from tumors were prepared using an ABI StepOnePlus RT-PCR instrument with a human-specific primer probe set RTS2033. The mRNA levels of the housekeeping gene, Cyclophilin, was measured with a human-specific primer probe set (forward primer GACGGCGAGCCCTTGG, designated herein as SEQ ID NO: 1526; reverse primer TGCTGTCTTTGGGACCTTGTC, designated herein as SEQ ID NO: 1527; probe CCGCGTCTCCTTTGAGCTGTTTGC, designated herein as SEQ ID NO: 1528). Significant differences between the treatment and the control groups were determined using the Student’s two-tailed t test (p<0.05).

Treatment with ISIS 481464 resulted in 43% reduction of STAT3 mRNA levels in the tumor mass compared to the PBS control (Figure 8), which is statistically significant.

Protein analysis Total cell lysates were prepared by homogenizing tumor in ice-cold radio-immunoprecipitation assay (RIPA) buffer containing protease inhibitor cocktail. The lysates were analyzed by western blotting using STAT3 antibody (Abcam Antibodies, #ab32500). The house-keeping proteins, cytochrome oxidase II (COXII; #ab79393) and survivin (#ab76424) were also probed. STAT3 levels were normalized to either COXII protein or survivin protein and quantified using ImageJ software.

Treatment with ISIS 481464 resulted in 50% reduction in STAT3 protein levels in the tumor mass compared to the PBS control, which is statistically significant.

Tumor growth analysis Tumors were measured regularly throughout the study period. Treatment with ISIS 481464 resulted in decrease in tumor volume of approximately 39% compared to the PBS control.

Example 24: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in PC9 cells BIOL0142WO ISIS 481464, from the studies described above, was further tested at different doses in PC9 cells, a non small cell lung carcinoma cell line. Cells were plated at a density of 3,000 cells per well. Cells were incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 37. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells. ) of each oligonucleotide is also presented in The half maximal inhibitory concentration (IC Table 37. As illustrated in Table 37, ISIS 481464 was able to penetrate the cell membrane.

Table 37 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by PC9 cells 0.02 10.0 ISIS No 0.1 μM 0.5 μM 2.5 μM IC (μM) μM μM 481464 20 51 84 94 96 0.19 Example 25: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in C42B cells ISIS 481464, from the studies described above, was further tested at different doses in C42B cells, a prostate cancer cell line. Cells were plated at a density of 3,000 cells per well. Cells were incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 38. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence BIOL0142WO GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 38. As illustrated in Table 38, ISIS 481464 was able to penetrate the cell membrane.

Table 38 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by C42B cells 0.02 10.0 ISIS No 0.1 μM 0.5 μM 2.5 μM IC (μM) μM μM 481464 21 38 75 87 96 0.45 Example 26: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in Colo201 cells ISIS 481464, from the studies described above, was further tested at different doses in Colo201 cells, a colorectal cancer cell line. Cells were plated at a density of 3,000 cells per well. Cells were incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 39. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 39. As illustrated in Table 39, ISIS 481464 was able to penetrate the cell membrane.

Table 39 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by Colo201 cells 0.02 10.0 ISIS No 0.1 μM 0.5 μM 2.5 μM IC (μM) μM μM 481464 36 53 81 93 96 0.09 BIOL0142WO Example 27: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in BT474M1 cells ISIS 481464, from the studies described above, was further tested at different doses in BT474M1 cells, a breast cancer cell line. Cells were plated at a density of 3,000 cells per well. Cells were incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 40. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels.

STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 40. As illustrated in Table 40, ISIS 481464 was able to penetrate the cell membrane.

Table 40 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by BT474M1 cells 0.02 10.0 ISIS No 0.1 μM 0.5 μM 2.5 μM IC (μM) μM μM 481464 13 25 74 94 95 0.24 Example 28: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in H929 cells ISIS 481464, from the studies described above, was further tested at different doses in H929 cells, a multiple myeloma cell line. Cells were plated at a density of 10,000-12,000 cells per well. Cells were incubated with 0.01 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 41. After approximately 72 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels.

STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated BIOL0142WO herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 41. As illustrated in Table 41, ISIS 481464 was able to penetrate the cell membrane.

Table 41 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by H929 cells .0 ISIS No 0.1 μM 0.5 μM 2.5 μM IC (μM) 481464 91 95 95 95 0.04 Example 29: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in MM1R cells ISIS 481464, from the studies described above, was further tested at different doses in MM1R cells, a multiple myeloma cell line. Cells were plated at a density of 10,000-12,000 cells per well. Cells were incubated with 0.01 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 42. After approximately 72 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 42. As illustrated in Table 42, ISIS 481464 was able to penetrate the cell membrane.

Table 42 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by MM1R cells .0 ISIS No 0.1 μM 0.5 μM 2.5 μM IC (μM) 481464 91 96 95 95 0.04 BIOL0142WO Example 30: Effect of antisense oligonucleotides targeting STAT3 in the treatment of an SK-OV3 ovarian cancer xenograft model BALB/c nude mice were inoculated with the human ovarian cancer cell line, SK-OV3 and treated with ISIS 481464 or ISIS 481549. ISIS 481549 is cross-reactive with the mouse sequence (i.e., hybridizes to the mouse sequence).

Study 1 Human ovarian cancer SK-OV3 cells (approximately 100mm ) were intraperitoneally injected into nude mice. Ten days later, the mice were inoculated subcutaneously with 25 mg/kg of ISIS 481464 or ISIS 481549, administered twice a week for 11 weeks. The mice were euthanized 24 hrs after the final dose.

RNA analysis Lysates were prepared by using the RNA extraction kit (Invitrogen) in for RT-PCR analysis of STAT3 mRNA levels, using human primer probe set (RTS2033) and mouse primer probe set (mSTAT3- LTS0664). The results are presented in Table 43. The results are presented as percent inhibition of STAT3, relative to the PBS control. The data indicates that treatment with ISIS antisense oligonucleotides resulted in reduction of both human and murine STAT3 mRNA in comparison to the PBS control.

Table 43 Percent inhibition of STAT3 mRNA in the treatment groups relative to the PBS control in the SK-OV3 xenograft model human murine ISIS No STAT3 STAT3 481464 63 0 481549 21 61 Protein analysis Lysates were prepared with RIPA buffer for western blot analysis of STAT3 protein levels, using an antibody against phosphorylated STAT3 (Cell Signaling). The results are presented in Figure 1. The data indicates that treatment with ISIS 481549 resulted in reduction of phosphorylated STAT3 protein in comparison to the PBS control.

IL-6 level analysis Lysates were prepared by using the RNA extraction kit (Invitrogen) for RT-PCR analysis of IL-6 mRNA levels, using mouse primer probe set mIL6-LTS00629. The results are presented in Table 44. The results are presented as percent inhibition of IL-6, relative to the PBS control. The data indicates that treatment with ISIS 481549 resulted in significant reduction of both IL-6 mRNA in comparison to the PBS control.

Table 44 Percent inhibition of IL-6 mRNA in the treatment groups relative to the PBS control in the SK-OV3 xenograft model Murine ISIS No IL-6 (%) BIOL0142WO 481464 8 481549 54 Tumor weight analysis Tumors were harvested. Tumor weights were measured and the results are presented in Table 45.

The results are presented as percent of the PBS control tumor weight. The data indicates that treatment with ISIS 481549 resulted in significant reduction of tumor weight in comparison to the PBS control.

Table 45 Percent decrease of tumor weight in the treatment groups relative to the PBS control in the SK-OV3 xenograft model Weight ISIS No 481464 58 481549 89 Study 2 Human ovarian cancer SK-OV3 cells (approximately 100mm ) were subcutaneously inoculated into nude mice. Ten days later, the mice were inoculated intraperitoneally with 50 mg/kg of either ISIS 481464 or 50 mg/kg of ISIS 481464 and ISIS 481549 in combination, administered five times a week for 6 weeks. The mice were euthanized 24 hrs after the final dose.

Tumor volume analysis Tumors were measured regularly using Vernier calipers and tumor volumes were calculated using the formula, tumor volume = ½ (length x width ). The results are presented in Figure 2. The data indicates that treatment of the mice with a combination of ISIS 481464 and ISIS 481549 resulted in significant inhibition of tumor growth.

Example 31: Tolerability study of ISIS 481464 in cynomolgus monkeys The efficacy and tolerability of ISIS 481464 in cynomolgus monkeys was evaluated.

Treatment Male and female naïve cynomolgus monkeys were assigned to five treatment groups. Three groups of 5 monkeys each received loading doses of 3 mg/kg, 10 mg/kg or 30 mg/kg every two days during the first week of the study (on Days 1, 3, 5 and 7) followed by once weekly administration thereafter (commencing on Day 14). A control group of 5 monkeys received PBS every two days during the first week of the study (on Days 1, 3, 5 and 7) as the loading dose, followed by once weekly administration thereafter (commencing on Day 14). These doses were administered via a one-hour intravenous (i.v.) infusion. A fifth group of 5 monkeys received loading doses of 30 mg/kg administered subcutaneously every two days during the first week of the study (on Days 1, 3, 5 and 7) followed by once weekly subcutaneous (s.c.) administration thereafter (commencing on Day 14).

For the i.v. infusions, the animals were restrained, without sedation, to a chair restraint. A catheter was placed in one of the cephalic veins and ISIS 481464 solution at the appropriate dose was BIOL0142WO infused at a constant rate over approximately 1 hour using a calibrated syringe pump (Stoelting Co, USA). The dosing site was rotated between right and left arms and the dosing time was recorded. The infusion rate was selected to deliver the calculated dose volume and the accuracy of the pumps was monitored and recorded for each dose. At the end of infusion period, the dosing solution was switched to PBS. In case of s.c. administration, the injections were performed in clock-wise rotation at 4 sites on the back. Injection sites were maintained by periodic shaving and permanently numbered by tattooing.

Three monkeys from each group were sacrificed on day 44, which was approximately 48 hrs following the last dose on day 42. The other 2 monkeys from each group are being observed for toxicological effects. Scheduled euthanasia of the animals was conducted by exsanguination after ketamine/xylazine-induced anesthesia and administration of sodium pentobarbital. The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).

RNA analysis Liver tissue was homogenized in 3 mL of RLT lysis buffer (Qiagen) supplemented with 1% of 2- mercaptoethanol (Sigma). RNA was purified from the resulting homogenate using Qiagen RNeasy 96- well plate for RNA purification, according to the manufacturer’s protocol. After purification, the RNA samples were subjected to RT-PCR analysis using Perkin-Elmer ABI Prism 7700 Sequence Detection System and STAT3 primer probe set RTS3235 (forward primer AAGTTTATCTGTGTGACACCAACGA, designated herein as SEQ ID NO: 1532; reverse primer CTTCACCATTATTTCCAAACTGCAT, designated herein as SEQ ID NO: 1533; probe TGCCGATGTCCCCCCGCA, designated herein as SEQ ID NO: 1534). STAT3 mRNA levels were normalized to monkey CyclophilinA, which was quantitated using primer probe set mk_cycloA_2 (forward primer TGCTGGACCCAACACAAATG, designated herein as SEQ ID NO: 1535; reverse primer TGCCATCCAACCACTCAGTC, designated herein as SEQ ID NO: 1536; probe TTCCCAGTTTTTCATCTGCACTGCCAX, designated herein as SEQ ID NO: 1537).

Treatment with ISIS 481464 at 30 mg/kg dose concentrations either via i.v. infusion or s.c. injection resulted in statistically significant reduction in STAT3 mRNA expression in liver (Table 46) compared to the PBS control. Significant differences between the treatment and the control groups were determined using the Student’s t test (p<0.05).

Table 46 Percent inhibition of STAT3 mRNA levels in cynomolgus monkeys Treatment % inhibition 3 mg i.v. 0 mg i.v. 7 mg i.v. 52 mg s.c. 51 BIOL0142WO Protein analysis Liver tissue was homogenized in 1 mL of ice-cold RIPA buffer (Sigma) containing inhibitor cocktails of both proteases and phosphatases (Roche). Total lysates were separated by Bis-Tris PAGE (Invitrogen), transferred to a PVDF membrane, and immunoblotted using primary antibodies for STAT3 (Cell Signaling, #9132) and GAPDH (Advanced Immunochemicals, #06G4-C5). Immunospecific bands were detected with the Enhanced Chemiluminescence Plus detection kit (Amersham Biosciences) after exposure to X-ray film. The intensity of the bands was then scanned and quantified using ImageJ software. Significant differences between the treatment and the control groups were determined using the Student’s t test (p<0.05).

There was a dose-dependent decrease in STAT3 protein levels, as shown in Table 47, with 33% and 82% reduction at 3 mg/kg/week and 10 mg/kg/week respectively. STAT3 protein was undetectable at mg/kg/week irrespective of the dosing route.

Table 47 Percent inhibition of STAT3 protein levels in cynomolgus monkeys Treatment % inhibition 3 mg i.v. 33 mg i.v. 82 mg i.v. 100 mg s.c. 100 Liver function To evaluate the effect of ISIS oligonucleotides on hepatic function, blood samples were collected from all the study groups. The blood samples were collected via femoral venipuncture on day 44, 48 hrs post-dosing. Blood samples (1mL) were collected in tubes without anticoagulant for serum separation.

The tubes were kept at room temperature for approximately 60 min and then centrifuged at 3,000 rpm for min to obtain serum. Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of ALT and AST were measured and the results are presented in Table 48, expressed in IU/L. Male and female monkey data is presented separately. The results indicate that treatment with ISIS 481464 had no effect on liver function outside the expected range for antisense oligonucleotides.

Table 48 Effect of antisense oligonucleotide treatment on liver function markers in cynomolgus monkey plasma Male Female Male Female ALT ALT AST AST (IU/L) (IU/L) (IU/L) (IU/L) PBS 59 69 83 69 3 mg/kg i.v. 47 56 50 47 mg/kg i.v. 56 89 70 60 BIOL0142WO mg/kg i.v. 74 75 60 73 mg/kg s.c. 62 78 61 92 Kidney function To evaluate the effect of ISIS oligonucleotides on kidney function, blood samples were collected from all the study groups. The blood samples were collected via femoral venipuncture on day 44, 48 hrs post-dosing. Blood samples (1mL) were collected in tubes without anticoagulant for serum separation.

The tubes were kept at room temperature for approximately 60 min and then centrifuged at 3,000 rpm for min to obtain serum. Levels of various kidney function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Results are presented in Table 49, expressed in mg/dL. The plasma chemistry data indicate that treatment with ISIS 481464 did not have any effect on the kidney function outside the expected range for antisense oligonucleotides.

Table 49 Effect of antisense oligonucleotide treatment on plasma BUN and creatinine levels (mg/dL) in cynomolgus monkeys Male Female Male Female BUN BUN Creatinine Creatinine PBS 19 30 0.68 0.88 3 mg/kg i.v. 23 28 0.85 0.86 mg/kg i.v. 26 27 0.89 0.94 mg/kg i.v. 25 26 0.91 0.86 mg/kg s.c. 27 28 0.97 0.85 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured and are presented in Tables 50 and 51. The results indicate that effect of treatment with ISIS 481464 on body weights was within the expected range for antisense oligonucleotides.

Table 50 Effect of antisense oligonucleotide treatment on body weights (g) in male cynomolgus monkeys Day 1 Day 7 Day 14 Day 21 Day 28 Day 35 Day 42 PBS 2523 2463 2484 2471 2509 2523 2551 3 mg/kg i.v. 2604 2564 2594 2572 2589 2654 2687 mg/kg i.v. 2603 2453 2581 2561 2591 2633 2655 mg/kg i.v. 2608 2583 2613 2644 2668 2713 2776 mg/kg s.c. 2533 2441 2470 2521 2554 2609 2619 Table 51 Effect of antisense oligonucleotide treatment on body weights (g) in female cynomolgus monkeys Day 1 Day 7 Day 14 Day 21 Day 28 Day 35 Day 42 PBS 2266 2252 2276 2237 2362 2365 2373 3 mg/kg i.v. 2253 2242 2283 2250 2346 2350 2377 mg/kg i.v. 2293 2277 2318 2254 2358 2387 2361 mg/kg i.v. 2259 2261 2289 2268 2368 2412 2406 BIOL0142WO mg/kg s.c. 2293 2275 2322 2281 2385 2389 2394 Example 32: Antisense inhibition of human STAT3 in HuVEC cells Antisense oligonucleotides were designed targeting a STAT3 nucleic acid and were tested for their effects on STAT3 mRNA in vitro. Cultured HuVEC cells at a density of 5,000 cells per well were transfected using LipofectAMINE 2000® reagent with 30 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 5; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 6; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 7) was used to measure mRNA levels.

STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®.

Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The chimeric antisense oligonucleotides in Tables 52 and 53 were designed as 55 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2’- deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising five nucleosides each. Each nucleoside in the 5’ wing segment and each nucleotide in the 3’ wing segment has a 2’-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5’-methylcytosines. “Human Target start site” indicates the 5’-most nucleoside to which the gapmer is targeted in the human gene sequence.

“Human Target stop site” indicates the 3’-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 52 is targeted to human STAT3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each gapmer listed in Table 53 is targeted to human STAT3 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000).

The potency of the gapmers was compared to ISIS 337332, ISIS 337333, and ISIS 345785, which are also 55 MOE gapmers targeting human STAT3, and which are further described in USPN 7,307,069, incorporated herein by reference.

Table 52 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides having 55 MOE wings and deoxy gap targeted to SEQ ID NO: 1 Human Human ISIS % SEQ ID Start Stop Sequence NO inhibition NO Site Site 337332 1898 1917 GAAGCCCTTGCCAGCCATGT 91 1541 337333 1903 1922 AAGGAGAAGCCCTTGCCAGC 87 1542 345785 2267 2286 TGCCTCCTCCTTGGGAATGT 82 1543 BIOL0142WO 455860 2831 2850 ACACAAGACATTTCCTTTTT 64 1544 455246 3452 3471 CAAGGAGGCTGTTAACTGAA 84 1545 455247 3454 3473 ACCAAGGAGGCTGTTAACTG 78 1546 455248 3456 3475 GCACCAAGGAGGCTGTTAAC 69 1547 455249 3458 3477 AAGCACCAAGGAGGCTGTTA 83 1548 455250 3460 3479 TAAAGCACCAAGGAGGCTGT 77 1549 455251 3462 3481 CTTAAAGCACCAAGGAGGCT 78 1550 455252 3464 3483 TGCTTAAAGCACCAAGGAGG 80 1551 455253 3466 3485 AATGCTTAAAGCACCAAGGA 75 1552 455254 3468 3487 TGAATGCTTAAAGCACCAAG 80 1553 455255 3470 3489 GCTGAATGCTTAAAGCACCA 82 1554 455256 3472 3491 AAGCTGAATGCTTAAAGCAC 67 1555 455257 3474 3493 GGAAGCTGAATGCTTAAAGC 79 1556 455258 3476 3495 AAGGAAGCTGAATGCTTAAA 79 1557 455259 3478 3497 TGAAGGAAGCTGAATGCTTA 72 1558 455260 3480 3499 CCTGAAGGAAGCTGAATGCT 75 1559 455261 3527 3546 TAAGGGTTTGACCTGAAGCC 72 1560 455262 3577 3596 TAAACCTTCCTATTTCAACA 77 1561 455263 3579 3598 CTTAAACCTTCCTATTTCAA 64 1562 455264 3581 3600 TCCTTAAACCTTCCTATTTC 73 1563 455265 3583 3602 TCTCCTTAAACCTTCCTATT 87 1564 455266 3585 3604 ATTCTCCTTAAACCTTCCTA 80 1565 455267 3587 3606 AGATTCTCCTTAAACCTTCC 87 1566 455268 3589 3608 TTAGATTCTCCTTAAACCTT 84 1567 455269 3591 3610 GCTTAGATTCTCCTTAAACC 87 1568 455270 3593 3612 ATGCTTAGATTCTCCTTAAA 87 1569 455271 3595 3614 AAATGCTTAGATTCTCCTTA 89 1570 455272 3597 3616 TAAAATGCTTAGATTCTCCT 88 1571 455273 3639 3658 ATACATTACAAAGGAAAATA 12 1572 455274 3641 3660 CAATACATTACAAAGGAAAA 28 1573 455275 3673 3692 CACCCTCTGCCCAGCCTTAC 63 1574 455276 3675 3694 AGCACCCTCTGCCCAGCCTT 79 1575 455277 3677 3696 TAAGCACCCTCTGCCCAGCC 65 1576 455278 3679 3698 TGTAAGCACCCTCTGCCCAG 62 1577 455279 3681 3700 GTTGTAAGCACCCTCTGCCC 62 1578 455280 3683 3702 AGGTTGTAAGCACCCTCTGC 75 1579 455281 3685 3704 CAAGGTTGTAAGCACCCTCT 83 1580 455282 3687 3706 GTCAAGGTTGTAAGCACCCT 86 1581 455283 3689 3708 GAGTCAAGGTTGTAAGCACC 69 1582 455284 3691 3710 GGGAGTCAAGGTTGTAAGCA 37 1583 455285 3693 3712 AAGGGAGTCAAGGTTGTAAG 56 1584 455286 3695 3714 GAAAGGGAGTCAAGGTTGTA 61 1585 455287 3697 3716 GAGAAAGGGAGTCAAGGTTG 56 1586 455288 3709 3728 ATCAAGTCCAGGGAGAAAGG 55 1587 455289 3711 3730 AGATCAAGTCCAGGGAGAAA 69 1588 BIOL0142WO 455290 3713 3732 GCAGATCAAGTCCAGGGAGA 80 1589 455291 3715 3734 CAGCAGATCAAGTCCAGGGA 90 1590 455292 3717 3736 AACAGCAGATCAAGTCCAGG 77 1591 455293 3719 3738 GAAACAGCAGATCAAGTCCA 81 1592 455294 3721 3740 CTGAAACAGCAGATCAAGTC 75 1593 455295 3723 3742 CTCTGAAACAGCAGATCAAG 76 1594 455296 3725 3744 GCCTCTGAAACAGCAGATCA 74 1595 455297 3727 3746 TAGCCTCTGAAACAGCAGAT 75 1596 455298 3729 3748 CCTAGCCTCTGAAACAGCAG 76 1597 455299 3731 3750 AACCTAGCCTCTGAAACAGC 83 1598 455300 3733 3752 ACAACCTAGCCTCTGAAACA 57 1599 455301 3735 3754 AAACAACCTAGCCTCTGAAA 72 1600 455302 3737 3756 AGAAACAACCTAGCCTCTGA 78 1601 455303 3739 3758 ACAGAAACAACCTAGCCTCT 69 1602 455304 3741 3760 CCACAGAAACAACCTAGCCT 70 1603 455305 3743 3762 ACCCACAGAAACAACCTAGC 80 1604 455306 3745 3764 GCACCCACAGAAACAACCTA 70 1605 455307 3747 3766 AGGCACCCACAGAAACAACC 75 1606 455308 3749 3768 TAAGGCACCCACAGAAACAA 70 1607 455309 3751 3770 GATAAGGCACCCACAGAAAC 65 1608 455310 3753 3772 CTGATAAGGCACCCACAGAA 66 1609 455311 3755 3774 CCCTGATAAGGCACCCACAG 81 1610 455312 3757 3776 AGCCCTGATAAGGCACCCAC 79 1611 455313 3759 3778 CCAGCCCTGATAAGGCACCC 74 1612 455314 3761 3780 TCCCAGCCCTGATAAGGCAC 74 1613 455315 3763 3782 TATCCCAGCCCTGATAAGGC 66 1614 455316 3765 3784 AGTATCCCAGCCCTGATAAG 48 1615 455317 3767 3786 GAAGTATCCCAGCCCTGATA 63 1616 455318 3769 3788 CAGAAGTATCCCAGCCCTGA 82 1617 455319 3771 3790 ATCAGAAGTATCCCAGCCCT 80 1618 455320 3879 3898 GATTCCTAAAACAAACAGGA 37 1619 455321 3881 3900 AGGATTCCTAAAACAAACAG 42 1620 455322 3883 3902 CCAGGATTCCTAAAACAAAC 72 1621 455323 3885 3904 GACCAGGATTCCTAAAACAA 71 1622 455324 3887 3906 GAGACCAGGATTCCTAAAAC 43 1623 455325 3889 3908 CTGAGACCAGGATTCCTAAA 77 1624 455326 3891 3910 TCCTGAGACCAGGATTCCTA 76 1625 455327 3893 3912 GGTCCTGAGACCAGGATTCC 69 1626 455328 3895 3914 GAGGTCCTGAGACCAGGATT 76 1627 455329 3897 3916 ATGAGGTCCTGAGACCAGGA 81 1628 455330 3899 3918 CCATGAGGTCCTGAGACCAG 84 1629 455331 3901 3920 TTCCATGAGGTCCTGAGACC 75 1630 455332 3903 3922 TCTTCCATGAGGTCCTGAGA 75 1631 455333 3905 3924 CTTCTTCCATGAGGTCCTGA 79 1632 455334 3907 3926 CTCTTCTTCCATGAGGTCCT 83 1633 BIOL0142WO 455335 3909 3928 CCCTCTTCTTCCATGAGGTC 74 1634 455336 3911 3930 CCCCCTCTTCTTCCATGAGG 72 1635 455337 3913 3932 CTCCCCCTCTTCTTCCATGA 72 1636 455338 3977 3996 CCTGAGCTCAACCAGACACG 79 1637 455339 3979 3998 TCCCTGAGCTCAACCAGACA 73 1638 455340 3981 4000 ATTCCCTGAGCTCAACCAGA 75 1639 455341 3983 4002 ATATTCCCTGAGCTCAACCA 65 1640 455342 3985 4004 CCATATTCCCTGAGCTCAAC 78 1641 455343 3987 4006 AACCATATTCCCTGAGCTCA 81 1642 455344 3989 4008 AGAACCATATTCCCTGAGCT 77 1643 455345 3991 4010 TAAGAACCATATTCCCTGAG 73 1644 455346 3993 4012 GCTAAGAACCATATTCCCTG 81 1645 455347 4067 4086 TCAGTAAGCCTTTGCCCTGC 79 1646 455348 4069 4088 TATCAGTAAGCCTTTGCCCT 72 1647 455349 4071 4090 TTTATCAGTAAGCCTTTGCC 76 1648 455350 4073 4092 AGTTTATCAGTAAGCCTTTG 84 1649 455351 4075 4094 CAAGTTTATCAGTAAGCCTT 82 1650 455352 4077 4096 CTCAAGTTTATCAGTAAGCC 82 1651 455353 4079 4098 GACTCAAGTTTATCAGTAAG 70 1652 455354 4081 4100 CAGACTCAAGTTTATCAGTA 78 1653 455355 4083 4102 GGCAGACTCAAGTTTATCAG 67 1654 455356 4085 4104 AGGGCAGACTCAAGTTTATC 51 1655 455357 4087 4106 CGAGGGCAGACTCAAGTTTA 54 1656 455358 4089 4108 TACGAGGGCAGACTCAAGTT 56 1657 455359 4091 4110 CATACGAGGGCAGACTCAAG 59 1658 455360 4093 4112 CTCATACGAGGGCAGACTCA 74 1659 455361 4095 4114 CCCTCATACGAGGGCAGACT 67 1660 455362 4122 4141 CAGCCTCAGAGGGAGGCCAG 40 1661 455363 4124 4143 ACCAGCCTCAGAGGGAGGCC 34 1662 455364 4126 4145 TCACCAGCCTCAGAGGGAGG 49 1663 455365 4128 4147 AGTCACCAGCCTCAGAGGGA 50 1664 455366 4225 4244 CCCATACGCACAGGAGAGGC 81 1665 455367 4227 4246 TTCCCATACGCACAGGAGAG 72 1666 455368 4229 4248 TGTTCCCATACGCACAGGAG 80 1667 455369 4231 4250 GGTGTTCCCATACGCACAGG 76 1668 455370 4233 4252 TAGGTGTTCCCATACGCACA 87 1669 455371 4235 4254 GCTAGGTGTTCCCATACGCA 92 1670 455372 4237 4256 GTGCTAGGTGTTCCCATACG 81 1671 455373 4304 4323 GAGGCAAGGTGGTTTTGAGT 55 1672 455374 4306 4325 CTGAGGCAAGGTGGTTTTGA 74 1673 455375 4308 4327 AGCTGAGGCAAGGTGGTTTT 79 1674 455376 4310 4329 TCAGCTGAGGCAAGGTGGTT 80 1675 455377 4312 4331 GATCAGCTGAGGCAAGGTGG 77 1676 455378 4314 4333 CTGATCAGCTGAGGCAAGGT 60 1677 455379 4316 4335 CTCTGATCAGCTGAGGCAAG 74 1678 BIOL0142WO 455380 4318 4337 AACTCTGATCAGCTGAGGCA 77 1679 455381 4320 4339 GAAACTCTGATCAGCTGAGG 78 1680 455382 4322 4341 CAGAAACTCTGATCAGCTGA 78 1681 455383 4360 4379 CAGAGACCAGCTAATTTGAT 69 1682 455384 4362 4381 TTCAGAGACCAGCTAATTTG 78 1683 455385 4364 4383 AATTCAGAGACCAGCTAATT 77 1684 455386 4366 4385 TTAATTCAGAGACCAGCTAA 83 1685 455387 4423 4442 CTCCAGGCAGGAGGACTGGG 79 1686 455388 4425 4444 GTCTCCAGGCAGGAGGACTG 65 1687 455389 4427 4446 CTGTCTCCAGGCAGGAGGAC 57 1688 455390 4429 4448 AACTGTCTCCAGGCAGGAGG 75 1689 455391 4431 4450 TCAACTGTCTCCAGGCAGGA 86 1690 455392 4433 4452 CATCAACTGTCTCCAGGCAG 80 1691 455393 4435 4454 CACATCAACTGTCTCCAGGC 86 1692 455394 4437 4456 GACACATCAACTGTCTCCAG 85 1693 455395 4471 4490 GAAGAGTGTTGCTGGAGAAG 73 1694 455396 4473 4492 CTGAAGAGTGTTGCTGGAGA 78 1695 455397 4475 4494 TACTGAAGAGTGTTGCTGGA 83 1696 455398 4477 4496 TGTACTGAAGAGTGTTGCTG 86 1697 455399 4479 4498 TATGTACTGAAGAGTGTTGC 74 1698 455400 4481 4500 ATTATGTACTGAAGAGTGTT 74 1699 455401 4483 4502 TTATTATGTACTGAAGAGTG 84 1700 455402 4485 4504 GCTTATTATGTACTGAAGAG 84 1701 455403 4487 4506 AAGCTTATTATGTACTGAAG 77 1702 455404 4489 4508 TTAAGCTTATTATGTACTGA 75 1703 455405 4491 4510 AGTTAAGCTTATTATGTACT 81 1704 455406 4493 4512 TCAGTTAAGCTTATTATGTA 58 1705 455407 4495 4514 TATCAGTTAAGCTTATTATG 65 1706 455408 4497 4516 TTTATCAGTTAAGCTTATTA 46 1707 455409 4499 4518 TGTTTATCAGTTAAGCTTAT 68 1708 455410 4501 4520 TCTGTTTATCAGTTAAGCTT 83 1709 455411 4539 4558 AACCCAATGGTAAGCCCAAG 87 1710 455412 4541 4560 TAAACCCAATGGTAAGCCCA 87 1711 455413 4543 4562 TTTAAACCCAATGGTAAGCC 78 1712 455414 4545 4564 GATTTAAACCCAATGGTAAG 31 1713 455415 4547 4566 ATGATTTAAACCCAATGGTA 71 1714 455416 4549 4568 CTATGATTTAAACCCAATGG 67 1715 455417 4551 4570 CCCTATGATTTAAACCCAAT 70 1716 455418 4553 4572 GTCCCTATGATTTAAACCCA 83 1717 455419 4555 4574 AGGTCCCTATGATTTAAACC 64 1718 455420 4589 4608 TATCTGCTCCAGAGAAGCCC 76 1719 455421 4591 4610 AATATCTGCTCCAGAGAAGC 78 1720 455422 4614 4633 CTACCTAAGGCCATGAACTT 74 1721 455423 4616 4635 TGCTACCTAAGGCCATGAAC 82 1722 455424 4618 4637 CATGCTACCTAAGGCCATGA 84 1723 BIOL0142WO 455425 4636 4655 CAGAGTTAAGACCAGATACA 84 1724 455426 4638 4657 ATCAGAGTTAAGACCAGATA 83 1725 455427 4640 4659 CAATCAGAGTTAAGACCAGA 77 1726 455428 4642 4661 TACAATCAGAGTTAAGACCA 81 1727 455429 4644 4663 GCTACAATCAGAGTTAAGAC 86 1728 455430 4646 4665 TTGCTACAATCAGAGTTAAG 85 1729 455431 4648 4667 TTTTGCTACAATCAGAGTTA 85 1730 455432 4650 4669 ACTTTTGCTACAATCAGAGT 73 1731 455433 4652 4671 GAACTTTTGCTACAATCAGA 80 1732 455434 4654 4673 CAGAACTTTTGCTACAATCA 82 1733 455435 4656 4675 CTCAGAACTTTTGCTACAAT 79 1734 455436 4658 4677 CTCTCAGAACTTTTGCTACA 76 1735 455437 4660 4679 TCCTCTCAGAACTTTTGCTA 75 1736 455438 4662 4681 GCTCCTCTCAGAACTTTTGC 85 1737 455439 4664 4683 CAGCTCCTCTCAGAACTTTT 85 1738 455440 4666 4685 CTCAGCTCCTCTCAGAACTT 80 1739 455441 4668 4687 GGCTCAGCTCCTCTCAGAAC 75 1740 455442 4770 4789 GCAACCCACGGGATTCCCTC 82 1741 455443 4772 4791 AAGCAACCCACGGGATTCCC 77 1742 455444 4774 4793 GTAAGCAACCCACGGGATTC 74 1743 455445 4776 4795 AGGTAAGCAACCCACGGGAT 76 1744 455446 4778 4797 GTAGGTAAGCAACCCACGGG 82 1745 455447 4780 4799 AGGTAGGTAAGCAACCCACG 88 1746 455448 4782 4801 ATAGGTAGGTAAGCAACCCA 83 1747 455449 4784 4803 TTATAGGTAGGTAAGCAACC 59 1748 455450 4786 4805 CCTTATAGGTAGGTAAGCAA 65 1749 455451 4788 4807 CACCTTATAGGTAGGTAAGC 62 1750 455452 4790 4809 ACCACCTTATAGGTAGGTAA 57 1751 455453 4792 4811 AAACCACCTTATAGGTAGGT 75 1752 455454 4794 4813 ATAAACCACCTTATAGGTAG 35 1753 455455 4796 4815 TTATAAACCACCTTATAGGT 39 1754 455456 4798 4817 GCTTATAAACCACCTTATAG 58 1755 455457 4800 4819 CAGCTTATAAACCACCTTAT 86 1756 455458 4802 4821 AGCAGCTTATAAACCACCTT 86 1757 455459 4804 4823 ACAGCAGCTTATAAACCACC 80 1758 455460 4806 4825 GGACAGCAGCTTATAAACCA 69 1759 455461 4808 4827 CAGGACAGCAGCTTATAAAC 72 1760 455462 4810 4829 GCCAGGACAGCAGCTTATAA 76 1761 455463 4812 4831 TGGCCAGGACAGCAGCTTAT 89 1762 455464 4814 4833 AGTGGCCAGGACAGCAGCTT 80 1763 455465 4816 4835 GCAGTGGCCAGGACAGCAGC 78 1764 455466 4818 4837 ATGCAGTGGCCAGGACAGCA 85 1765 455467 4820 4839 GAATGCAGTGGCCAGGACAG 80 1766 455468 4822 4841 TTGAATGCAGTGGCCAGGAC 83 1767 455469 4824 4843 ATTTGAATGCAGTGGCCAGG 84 1768 BIOL0142WO 455470 4826 4845 GAATTTGAATGCAGTGGCCA 81 1769 455471 4828 4847 TGGAATTTGAATGCAGTGGC 85 1770 455472 4830 4849 ATTGGAATTTGAATGCAGTG 64 1771 455473 4832 4851 ACATTGGAATTTGAATGCAG 80 1772 455474 4834 4853 ACACATTGGAATTTGAATGC 73 1773 455475 4836 4855 GTACACATTGGAATTTGAAT 80 1774 455476 4838 4857 AAGTACACATTGGAATTTGA 77 1775 455477 4840 4859 TGAAGTACACATTGGAATTT 68 1776 455478 4842 4861 TATGAAGTACACATTGGAAT 66 1777 455479 4844 4863 ACTATGAAGTACACATTGGA 83 1778 455480 4846 4865 ACACTATGAAGTACACATTG 76 1779 455481 4848 4867 TTACACTATGAAGTACACAT 78 1780 455482 4850 4869 TTTTACACTATGAAGTACAC 76 1781 455483 4852 4871 ATTTTTACACTATGAAGTAC 60 1782 455484 4854 4873 AAATTTTTACACTATGAAGT 35 1783 455485 4856 4875 ATAAATTTTTACACTATGAA 9 1784 455486 4858 4877 ATATAAATTTTTACACTATG 0 1785 455487 4860 4879 TAATATAAATTTTTACACTA 21 1786 455488 4862 4881 AATAATATAAATTTTTACAC 10 1787 455489 4864 4883 ACAATAATATAAATTTTTAC 7 1788 455490 4925 4944 AGTTAAAGTAGATACAGCAA 71 1789 455491 4927 4946 GAAGTTAAAGTAGATACAGC 63 1790 455492 4929 4948 TGGAAGTTAAAGTAGATACA 69 1791 455493 4931 4950 TCTGGAAGTTAAAGTAGATA 65 1792 455494 4933 4952 TTTCTGGAAGTTAAAGTAGA 55 1793 455495 4935 4954 TATTTCTGGAAGTTAAAGTA 57 1794 455496 4937 4956 TTTATTTCTGGAAGTTAAAG 36 1795 455497 4939 4958 CGTTTATTTCTGGAAGTTAA 77 1796 Table 53 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides having 55 MOE wings and deoxy gap targeted to SEQ ID NO: 2 Human Human ISIS % SEQ ID Start Stop Sequence NO inhibition NO Site Site 455498 917 936 CACGCCGTCATGCATAATTC 0 1797 455499 919 938 GGCACGCCGTCATGCATAAT 0 1798 455500 940 959 GCCCAGCCCCAGCCTGGCCG 35 1799 455501 962 981 ACAGCCCCTTCAGCCAATCC 15 1800 455502 964 983 TTACAGCCCCTTCAGCCAAT 14 1801 455503 966 985 AATTACAGCCCCTTCAGCCA 28 1802 455504 968 987 TGAATTACAGCCCCTTCAGC 6 1803 455505 970 989 GCTGAATTACAGCCCCTTCA 15 1804 455506 972 991 CCGCTGAATTACAGCCCCTT 4 1805 455507 974 993 AACCGCTGAATTACAGCCCC 8 1806 455508 976 995 GAAACCGCTGAATTACAGCC 16 1807 BIOL0142WO 455509 978 997 CGGAAACCGCTGAATTACAG 24 1808 455510 980 999 TCCGGAAACCGCTGAATTAC 12 1809 455511 982 1001 GCTCCGGAAACCGCTGAATT 15 1810 455512 984 1003 CAGCTCCGGAAACCGCTGAA 23 1811 455513 986 1005 CGCAGCTCCGGAAACCGCTG 4 1812 455514 988 1007 GCCGCAGCTCCGGAAACCGC 13 1813 455515 1378 1397 AGTCCCTTCCGAGGCCCGCT 81 1814 455516 1408 1427 CGAAGAACGAAACTTCCCTC 68 1815 455517 1697 1716 CAGACACACCTATTCCTGCC 82 1816 455518 1748 1767 TTATGCAATAAAGCCTACCC 70 1817 455519 1795 1814 TTAGAAAGAGTACCGGTCTG 75 1818 455520 1987 2006 AATGGCTCAATTATTTATCT 59 1819 455521 2083 2102 TTTACCCAAGATCTTGGCTC 76 1820 455522 2175 2194 ACTTCAGTGCAACCACACCC 70 1821 455523 2205 2224 CCAACTTGGGCGACGGTTTG 67 1822 455524 2281 2300 CTAACCACTGATTTTGTCAC 56 1823 455525 2316 2335 GTACACACTATACACATTTT 85 1824 455526 2346 2365 CTTTAGTTGCACATACAGTA 80 1825 455527 2383 2402 GCCAAAAATTTACAACCCAT 86 1826 455528 2413 2432 TTCAAGCCCAATGCTTTATC 76 1827 455529 2561 2580 CTGGAACATGTAATAAGGAA 71 1828 455530 2669 2688 AGAGACTAAAATCAAGGCTC 87 1829 455531 2900 2919 TAGACTCTAGACCCAATTCC 77 1830 455532 3780 3799 GAAATGACCACTGATCAAGC 74 1831 455533 3867 3886 AAGTTGGTCACCACCTCTAC 81 1832 455534 4291 4310 AACTTATTCTTCATAGCAAC 58 1833 455535 4587 4606 TATTTGGGACCCAGTTGAAA 60 1834 455536 5000 5019 AGAACTGAAATTCCTTGGTC 88 1835 455537 5030 5049 AAGTTTTAAAAGCTTCCCCT 76 1836 455538 5554 5573 TCACCCAAAGTACCAAATCA 71 1837 455539 5667 5686 CAAAAGTTATGGTGAAATTT 44 1838 455540 5699 5718 AAGTACTCTTTCAGTGGTTT 88 1839 455541 6844 6863 AATTAAAGAGTTGCGGTAAT 68 1840 455542 6926 6945 GTTTCATGAAAACGGACAAT 78 1841 455543 7050 7069 AGGATTCAGTCCCAGATCTG 18 1842 455544 7282 7301 TCAATAATGATGACTTTCTC 72 1843 455545 7528 7547 TTAAACCCAATTATTAACAG 45 1844 455546 7624 7643 GTAAAACACACATTTTATAT 62 1845 455547 7682 7701 GTAAACAGAAAGGGCTGCAA 86 1846 455548 8078 8097 GGGCAGATTTACCTTCCTTA 89 1847 455549 8126 8145 GGGTAGCAGGAAGGAAAGCC 80 1848 455550 8214 8233 AATATAAGTTCTTTGGCTGA 60 1849 455551 8244 8263 TACAATAGCAATCACCTTAG 89 1850 455552 8284 8303 CCATGAAACCCTCAAACATA 75 1851 337332 66135 66154 GAAGCCCTTGCCAGCCATGT 91 1541 BIOL0142WO 337333 66140 66159 AAGGAGAAGCCCTTGCCAGC 87 1542 345785 67129 67148 TGCCTCCTCCTTGGGAATGT 82 1543 455246 74639 74658 CAAGGAGGCTGTTAACTGAA 84 1545 455247 74641 74660 ACCAAGGAGGCTGTTAACTG 78 1546 455248 74643 74662 GCACCAAGGAGGCTGTTAAC 69 1547 455249 74645 74664 AAGCACCAAGGAGGCTGTTA 83 1548 455250 74647 74666 TAAAGCACCAAGGAGGCTGT 77 1549 455251 74649 74668 CTTAAAGCACCAAGGAGGCT 78 1550 455252 74651 74670 TGCTTAAAGCACCAAGGAGG 80 1551 455253 74653 74672 AATGCTTAAAGCACCAAGGA 75 1552 455254 74655 74674 TGAATGCTTAAAGCACCAAG 80 1553 455255 74657 74676 GCTGAATGCTTAAAGCACCA 82 1554 455256 74659 74678 AAGCTGAATGCTTAAAGCAC 67 1555 455257 74661 74680 GGAAGCTGAATGCTTAAAGC 79 1556 455258 74663 74682 AAGGAAGCTGAATGCTTAAA 79 1557 455259 74665 74684 TGAAGGAAGCTGAATGCTTA 72 1558 455260 74667 74686 CCTGAAGGAAGCTGAATGCT 75 1559 455261 74714 74733 TAAGGGTTTGACCTGAAGCC 72 1560 455262 74764 74783 TAAACCTTCCTATTTCAACA 77 1561 455263 74766 74785 CTTAAACCTTCCTATTTCAA 64 1562 455264 74768 74787 TCCTTAAACCTTCCTATTTC 73 1563 455265 74770 74789 TCTCCTTAAACCTTCCTATT 87 1564 455266 74772 74791 ATTCTCCTTAAACCTTCCTA 80 1565 455267 74774 74793 AGATTCTCCTTAAACCTTCC 87 1566 455268 74776 74795 TTAGATTCTCCTTAAACCTT 84 1567 455269 74778 74797 GCTTAGATTCTCCTTAAACC 87 1568 455270 74780 74799 ATGCTTAGATTCTCCTTAAA 87 1569 455271 74782 74801 AAATGCTTAGATTCTCCTTA 89 1570 455272 74784 74803 TAAAATGCTTAGATTCTCCT 88 1571 455273 74826 74845 ATACATTACAAAGGAAAATA 12 1572 455274 74828 74847 CAATACATTACAAAGGAAAA 28 1573 455275 74860 74879 CACCCTCTGCCCAGCCTTAC 63 1574 455276 74862 74881 AGCACCCTCTGCCCAGCCTT 79 1575 455277 74864 74883 TAAGCACCCTCTGCCCAGCC 65 1576 455278 74866 74885 TGTAAGCACCCTCTGCCCAG 62 1577 455279 74868 74887 GTTGTAAGCACCCTCTGCCC 62 1578 455280 74870 74889 AGGTTGTAAGCACCCTCTGC 75 1579 455281 74872 74891 CAAGGTTGTAAGCACCCTCT 83 1580 455282 74874 74893 GTCAAGGTTGTAAGCACCCT 86 1581 455283 74876 74895 GAGTCAAGGTTGTAAGCACC 69 1582 455284 74878 74897 GGGAGTCAAGGTTGTAAGCA 37 1583 455285 74880 74899 AAGGGAGTCAAGGTTGTAAG 56 1584 455286 74882 74901 GAAAGGGAGTCAAGGTTGTA 61 1585 455287 74884 74903 GAGAAAGGGAGTCAAGGTTG 56 1586 455288 74896 74915 ATCAAGTCCAGGGAGAAAGG 55 1587 BIOL0142WO 455289 74898 74917 AGATCAAGTCCAGGGAGAAA 69 1588 455290 74900 74919 GCAGATCAAGTCCAGGGAGA 80 1589 455291 74902 74921 CAGCAGATCAAGTCCAGGGA 90 1590 455292 74904 74923 AACAGCAGATCAAGTCCAGG 77 1591 455293 74906 74925 GAAACAGCAGATCAAGTCCA 81 1592 455294 74908 74927 CTGAAACAGCAGATCAAGTC 75 1593 455295 74910 74929 CTCTGAAACAGCAGATCAAG 76 1594 455296 74912 74931 GCCTCTGAAACAGCAGATCA 74 1595 455297 74914 74933 TAGCCTCTGAAACAGCAGAT 75 1596 455298 74916 74935 CCTAGCCTCTGAAACAGCAG 76 1597 455299 74918 74937 AACCTAGCCTCTGAAACAGC 83 1598 455300 74920 74939 ACAACCTAGCCTCTGAAACA 57 1599 455301 74922 74941 AAACAACCTAGCCTCTGAAA 72 1600 455302 74924 74943 AGAAACAACCTAGCCTCTGA 78 1601 455303 74926 74945 ACAGAAACAACCTAGCCTCT 69 1602 455304 74928 74947 CCACAGAAACAACCTAGCCT 70 1603 455305 74930 74949 ACCCACAGAAACAACCTAGC 80 1604 455306 74932 74951 GCACCCACAGAAACAACCTA 70 1605 455307 74934 74953 AGGCACCCACAGAAACAACC 75 1606 455308 74936 74955 TAAGGCACCCACAGAAACAA 70 1607 455309 74938 74957 GATAAGGCACCCACAGAAAC 65 1608 455310 74940 74959 CTGATAAGGCACCCACAGAA 66 1609 455311 74942 74961 CCCTGATAAGGCACCCACAG 81 1610 455312 74944 74963 AGCCCTGATAAGGCACCCAC 79 1611 455313 74946 74965 CCAGCCCTGATAAGGCACCC 74 1612 455314 74948 74967 TCCCAGCCCTGATAAGGCAC 74 1613 455315 74950 74969 TATCCCAGCCCTGATAAGGC 66 1614 455316 74952 74971 AGTATCCCAGCCCTGATAAG 48 1615 455317 74954 74973 GAAGTATCCCAGCCCTGATA 63 1616 455318 74956 74975 CAGAAGTATCCCAGCCCTGA 82 1617 455319 74958 74977 ATCAGAAGTATCCCAGCCCT 80 1618 455320 75066 75085 GATTCCTAAAACAAACAGGA 37 1619 455321 75068 75087 AGGATTCCTAAAACAAACAG 42 1620 455322 75070 75089 CCAGGATTCCTAAAACAAAC 72 1621 455323 75072 75091 GACCAGGATTCCTAAAACAA 71 1622 455324 75074 75093 GAGACCAGGATTCCTAAAAC 43 1623 455325 75076 75095 CTGAGACCAGGATTCCTAAA 77 1624 455326 75078 75097 TCCTGAGACCAGGATTCCTA 76 1625 455327 75080 75099 GGTCCTGAGACCAGGATTCC 69 1626 455328 75082 75101 GAGGTCCTGAGACCAGGATT 76 1627 455329 75084 75103 ATGAGGTCCTGAGACCAGGA 81 1628 455330 75086 75105 CCATGAGGTCCTGAGACCAG 84 1629 455331 75088 75107 TTCCATGAGGTCCTGAGACC 75 1630 455332 75090 75109 TCTTCCATGAGGTCCTGAGA 75 1631 455333 75092 75111 CTTCTTCCATGAGGTCCTGA 79 1632 BIOL0142WO 455334 75094 75113 CTCTTCTTCCATGAGGTCCT 83 1633 455335 75096 75115 CCCTCTTCTTCCATGAGGTC 74 1634 455336 75098 75117 CCCCCTCTTCTTCCATGAGG 72 1635 455337 75100 75119 CTCCCCCTCTTCTTCCATGA 72 1636 455338 75164 75183 CCTGAGCTCAACCAGACACG 79 1637 455339 75166 75185 TCCCTGAGCTCAACCAGACA 73 1638 455340 75168 75187 ATTCCCTGAGCTCAACCAGA 75 1639 455341 75170 75189 ATATTCCCTGAGCTCAACCA 65 1640 455342 75172 75191 CCATATTCCCTGAGCTCAAC 78 1641 455343 75174 75193 AACCATATTCCCTGAGCTCA 81 1642 455344 75176 75195 AGAACCATATTCCCTGAGCT 77 1643 455345 75178 75197 TAAGAACCATATTCCCTGAG 73 1644 455346 75180 75199 GCTAAGAACCATATTCCCTG 81 1645 455347 75254 75273 TCAGTAAGCCTTTGCCCTGC 79 1646 455348 75256 75275 TATCAGTAAGCCTTTGCCCT 72 1647 455349 75258 75277 TTTATCAGTAAGCCTTTGCC 76 1648 455350 75260 75279 AGTTTATCAGTAAGCCTTTG 84 1649 455351 75262 75281 CAAGTTTATCAGTAAGCCTT 82 1650 455352 75264 75283 CTCAAGTTTATCAGTAAGCC 82 1651 455353 75266 75285 GACTCAAGTTTATCAGTAAG 70 1652 455354 75268 75287 CAGACTCAAGTTTATCAGTA 78 1653 455355 75270 75289 GGCAGACTCAAGTTTATCAG 67 1654 455356 75272 75291 AGGGCAGACTCAAGTTTATC 51 1655 455357 75274 75293 CGAGGGCAGACTCAAGTTTA 54 1656 455358 75276 75295 TACGAGGGCAGACTCAAGTT 56 1657 455359 75278 75297 CATACGAGGGCAGACTCAAG 59 1658 455360 75280 75299 CTCATACGAGGGCAGACTCA 74 1659 455361 75282 75301 CCCTCATACGAGGGCAGACT 67 1660 455362 75309 75328 CAGCCTCAGAGGGAGGCCAG 40 1661 455363 75311 75330 ACCAGCCTCAGAGGGAGGCC 34 1662 455364 75313 75332 TCACCAGCCTCAGAGGGAGG 49 1663 455365 75315 75334 AGTCACCAGCCTCAGAGGGA 50 1664 455366 75412 75431 CCCATACGCACAGGAGAGGC 81 1665 455367 75414 75433 TTCCCATACGCACAGGAGAG 72 1666 455368 75416 75435 TGTTCCCATACGCACAGGAG 80 1667 455369 75418 75437 GGTGTTCCCATACGCACAGG 76 1668 455370 75420 75439 TAGGTGTTCCCATACGCACA 87 1669 455371 75422 75441 GCTAGGTGTTCCCATACGCA 92 1670 455372 75424 75443 GTGCTAGGTGTTCCCATACG 81 1671 455373 75491 75510 GAGGCAAGGTGGTTTTGAGT 55 1672 455374 75493 75512 CTGAGGCAAGGTGGTTTTGA 74 1673 455375 75495 75514 AGCTGAGGCAAGGTGGTTTT 79 1674 455376 75497 75516 TCAGCTGAGGCAAGGTGGTT 80 1675 455377 75499 75518 GATCAGCTGAGGCAAGGTGG 77 1676 455378 75501 75520 CTGATCAGCTGAGGCAAGGT 60 1677 BIOL0142WO 455379 75503 75522 CTCTGATCAGCTGAGGCAAG 74 1678 455380 75505 75524 AACTCTGATCAGCTGAGGCA 77 1679 455381 75507 75526 GAAACTCTGATCAGCTGAGG 78 1680 455382 75509 75528 CAGAAACTCTGATCAGCTGA 78 1681 455383 75547 75566 CAGAGACCAGCTAATTTGAT 69 1682 455384 75549 75568 TTCAGAGACCAGCTAATTTG 78 1683 455385 75551 75570 AATTCAGAGACCAGCTAATT 77 1684 455386 75553 75572 TTAATTCAGAGACCAGCTAA 83 1685 455387 75610 75629 CTCCAGGCAGGAGGACTGGG 79 1686 455388 75612 75631 GTCTCCAGGCAGGAGGACTG 65 1687 455389 75614 75633 CTGTCTCCAGGCAGGAGGAC 57 1688 455390 75616 75635 AACTGTCTCCAGGCAGGAGG 75 1689 455391 75618 75637 TCAACTGTCTCCAGGCAGGA 86 1690 455392 75620 75639 CATCAACTGTCTCCAGGCAG 80 1691 455393 75622 75641 CACATCAACTGTCTCCAGGC 86 1692 455394 75624 75643 GACACATCAACTGTCTCCAG 85 1693 455395 75658 75677 GAAGAGTGTTGCTGGAGAAG 73 1694 455396 75660 75679 CTGAAGAGTGTTGCTGGAGA 78 1695 455397 75662 75681 TACTGAAGAGTGTTGCTGGA 83 1696 455398 75664 75683 TGTACTGAAGAGTGTTGCTG 86 1697 455399 75666 75685 TATGTACTGAAGAGTGTTGC 74 1698 455400 75668 75687 ATTATGTACTGAAGAGTGTT 74 1699 455401 75670 75689 TTATTATGTACTGAAGAGTG 84 1700 455402 75672 75691 GCTTATTATGTACTGAAGAG 84 1701 455403 75674 75693 AAGCTTATTATGTACTGAAG 77 1702 455404 75676 75695 TTAAGCTTATTATGTACTGA 75 1703 455405 75678 75697 AGTTAAGCTTATTATGTACT 81 1704 455406 75680 75699 TCAGTTAAGCTTATTATGTA 58 1705 455407 75682 75701 TATCAGTTAAGCTTATTATG 65 1706 455408 75684 75703 TTTATCAGTTAAGCTTATTA 46 1707 455409 75686 75705 TGTTTATCAGTTAAGCTTAT 68 1708 455410 75688 75707 TCTGTTTATCAGTTAAGCTT 83 1709 455411 75726 75745 AACCCAATGGTAAGCCCAAG 87 1710 455412 75728 75747 TAAACCCAATGGTAAGCCCA 87 1711 455413 75730 75749 TTTAAACCCAATGGTAAGCC 78 1712 455414 75732 75751 GATTTAAACCCAATGGTAAG 31 1713 455415 75734 75753 ATGATTTAAACCCAATGGTA 71 1714 455416 75736 75755 CTATGATTTAAACCCAATGG 67 1715 455417 75738 75757 CCCTATGATTTAAACCCAAT 70 1716 455418 75740 75759 GTCCCTATGATTTAAACCCA 83 1717 455419 75742 75761 AGGTCCCTATGATTTAAACC 64 1718 455420 75776 75795 TATCTGCTCCAGAGAAGCCC 76 1719 455421 75778 75797 AATATCTGCTCCAGAGAAGC 78 1720 455422 75801 75820 CTACCTAAGGCCATGAACTT 74 1721 455423 75803 75822 TGCTACCTAAGGCCATGAAC 82 1722 BIOL0142WO 455424 75805 75824 CATGCTACCTAAGGCCATGA 84 1723 455425 75823 75842 CAGAGTTAAGACCAGATACA 84 1724 455426 75825 75844 ATCAGAGTTAAGACCAGATA 83 1725 455427 75827 75846 CAATCAGAGTTAAGACCAGA 77 1726 455428 75829 75848 TACAATCAGAGTTAAGACCA 81 1727 455429 75831 75850 GCTACAATCAGAGTTAAGAC 86 1728 455430 75833 75852 TTGCTACAATCAGAGTTAAG 85 1729 455431 75835 75854 TTTTGCTACAATCAGAGTTA 85 1730 455432 75837 75856 ACTTTTGCTACAATCAGAGT 73 1731 455433 75839 75858 GAACTTTTGCTACAATCAGA 80 1732 455434 75841 75860 CAGAACTTTTGCTACAATCA 82 1733 455435 75843 75862 CTCAGAACTTTTGCTACAAT 79 1734 455436 75845 75864 CTCTCAGAACTTTTGCTACA 76 1735 455437 75847 75866 TCCTCTCAGAACTTTTGCTA 75 1736 455438 75849 75868 GCTCCTCTCAGAACTTTTGC 85 1737 455439 75851 75870 CAGCTCCTCTCAGAACTTTT 85 1738 455440 75853 75872 CTCAGCTCCTCTCAGAACTT 80 1739 455441 75855 75874 GGCTCAGCTCCTCTCAGAAC 75 1740 455442 75957 75976 GCAACCCACGGGATTCCCTC 82 1741 455443 75959 75978 AAGCAACCCACGGGATTCCC 77 1742 455444 75961 75980 GTAAGCAACCCACGGGATTC 74 1743 455445 75963 75982 AGGTAAGCAACCCACGGGAT 76 1744 455446 75965 75984 GTAGGTAAGCAACCCACGGG 82 1745 455447 75967 75986 AGGTAGGTAAGCAACCCACG 88 1746 455448 75969 75988 ATAGGTAGGTAAGCAACCCA 83 1747 455449 75971 75990 TTATAGGTAGGTAAGCAACC 59 1748 455450 75973 75992 CCTTATAGGTAGGTAAGCAA 65 1749 455451 75975 75994 CACCTTATAGGTAGGTAAGC 62 1750 455452 75977 75996 ACCACCTTATAGGTAGGTAA 57 1751 455453 75979 75998 AAACCACCTTATAGGTAGGT 75 1752 455454 75981 76000 ATAAACCACCTTATAGGTAG 35 1753 455455 75983 76002 TTATAAACCACCTTATAGGT 39 1754 455456 75985 76004 GCTTATAAACCACCTTATAG 58 1755 455457 75987 76006 CAGCTTATAAACCACCTTAT 86 1756 455458 75989 76008 AGCAGCTTATAAACCACCTT 86 1757 455459 75991 76010 ACAGCAGCTTATAAACCACC 80 1758 455460 75993 76012 GGACAGCAGCTTATAAACCA 69 1759 455461 75995 76014 CAGGACAGCAGCTTATAAAC 72 1760 455462 75997 76016 GCCAGGACAGCAGCTTATAA 76 1761 455463 75999 76018 TGGCCAGGACAGCAGCTTAT 89 1762 455464 76001 76020 AGTGGCCAGGACAGCAGCTT 80 1763 455465 76003 76022 GCAGTGGCCAGGACAGCAGC 78 1764 455466 76005 76024 ATGCAGTGGCCAGGACAGCA 85 1765 455467 76007 76026 GAATGCAGTGGCCAGGACAG 80 1766 455468 76009 76028 TTGAATGCAGTGGCCAGGAC 83 1767 BIOL0142WO 455469 76011 76030 ATTTGAATGCAGTGGCCAGG 84 1768 455470 76013 76032 GAATTTGAATGCAGTGGCCA 81 1769 455471 76015 76034 TGGAATTTGAATGCAGTGGC 85 1770 455472 76017 76036 ATTGGAATTTGAATGCAGTG 64 1771 455473 76019 76038 ACATTGGAATTTGAATGCAG 80 1772 455474 76021 76040 ACACATTGGAATTTGAATGC 73 1773 455475 76023 76042 GTACACATTGGAATTTGAAT 80 1774 455476 76025 76044 AAGTACACATTGGAATTTGA 77 1775 455477 76027 76046 TGAAGTACACATTGGAATTT 68 1776 455478 76029 76048 TATGAAGTACACATTGGAAT 66 1777 455479 76031 76050 ACTATGAAGTACACATTGGA 83 1778 455480 76033 76052 ACACTATGAAGTACACATTG 76 1779 455481 76035 76054 TTACACTATGAAGTACACAT 78 1780 455482 76037 76056 TTTTACACTATGAAGTACAC 76 1781 455483 76039 76058 ATTTTTACACTATGAAGTAC 60 1782 455484 76041 76060 AAATTTTTACACTATGAAGT 35 1783 455485 76043 76062 ATAAATTTTTACACTATGAA 9 1784 455486 76045 76064 ATATAAATTTTTACACTATG 0 1785 455487 76047 76066 TAATATAAATTTTTACACTA 21 1786 455488 76049 76068 AATAATATAAATTTTTACAC 10 1787 455489 76051 76070 ACAATAATATAAATTTTTAC 7 1788 455490 76112 76131 AGTTAAAGTAGATACAGCAA 71 1789 455491 76114 76133 GAAGTTAAAGTAGATACAGC 63 1790 455492 76116 76135 TGGAAGTTAAAGTAGATACA 69 1791 455493 76118 76137 TCTGGAAGTTAAAGTAGATA 65 1792 455494 76120 76139 TTTCTGGAAGTTAAAGTAGA 55 1793 455495 76122 76141 TATTTCTGGAAGTTAAAGTA 57 1794 455496 76124 76143 TTTATTTCTGGAAGTTAAAG 36 1795 455497 76126 76145 CGTTTATTTCTGGAAGTTAA 77 1796 9123 9142 455553 ACCTGCCCCTATGTATAAGC 89 1852 11261 11280 455554 9484 9503 TTTGTAATATCTAACAGATA 20 1853 455555 9630 9649 TATATGACAGCCTCAATTTC 68 1854 455556 9677 9696 GGCATTTGTGTAAACAGGAA 81 1855 455557 9746 9765 TGTTAAATATTACTTAAAAT 4 1856 455558 9776 9795 AATTCCTTGGGTGGTAATCC 81 1857 455559 10071 10090 GGAAAGTTACAGGACAGGAA 77 1858 455560 10352 10371 GAAATGGCTTCTACAAAAAC 47 1859 455561 10472 10491 GGTCAGAATACCACAAACTA 80 1860 455562 10634 10653 AGTCTAATGCTTTTAGATTC 59 1861 455563 11567 11586 CATTGGAAAACTTAGGGTAA 37 1862 455564 11597 11616 ATTCTCACTGGGTATAGAGG 72 1863 455565 11700 11719 TAGCATTAATCTTTCCTAGG 92 1864 9886 9905 455566 GACTCAAAATAAGGTTCCTC 86 1865 12369 12388 BIOL0142WO 455567 12430 12449 ACAGATTTATTCATATAAGC 62 1866 455568 14060 14079 AGATCCATAGATTCTTTCTT 80 1867 455569 14129 14148 ATCTGAATCAGAATATCTGC 88 1868 455570 14190 14209 GAAGACTTTATATTCTATGG 59 1869 455571 14355 14374 TATCCTTAATATTCAGGTAC 82 1870 455572 14501 14520 TTATTAAGACATCTGAAATA 31 1871 455573 14701 14720 TTAAGTGACTACACATGGAT 76 1872 455574 14761 14780 GATAATGTAACAACCCTATC 42 1873 455575 14828 14847 CTGAAGCATGAATTCACATT 83 1874 455576 15316 15335 AAATTCCACTACTCATGAAA 62 1875 455577 15370 15389 CTTCAGAGAATATCTCATTT 83 1876 455578 15400 15419 CACATCATAGTTTTGCATGA 70 1877 455579 15525 15544 TCTGACCCATAAAGTTTAAA 70 1878 455580 16568 16587 TTGGTTAATAATAATGTATC 44 1879 455581 16832 16851 TCACACATTTGTCAAAATCC 89 1880 455582 16863 16882 TATATAATTGTGTACTGGCA 93 1881 455583 16930 16949 TGCCAGTGGTTCAGCAGAGG 77 1882 455584 17215 17234 AATGTTTATAGCAGCTTTAT 56 1883 455585 17330 17349 GTCACTTTGAATATAGTTTG 79 1884 455586 17426 17445 GGCTAAAATCCAAAACACTG 65 1885 455587 18449 18468 AACAGTATTTGAGAAAACTT 21 1886 455588 19883 19902 GGGCTACAACTCAATAACAA 63 1887 455589 20512 20531 AAGTCCTTATCATTTAGCTC 69 1888 455590 21035 21054 GATATTCCCAAAGTGACAGG 75 1889 455591 21188 21207 ATAATGAGACTTTAGCACTC 86 1890 455592 21422 21441 AATCTAAACTTCCAGCCAGG 78 1891 455593 21493 21512 ACAATAATGCATGCAAATGT 67 1892 455594 21675 21694 CACTGCTATTTCCCCAGCAA 89 1893 455595 21710 21729 CTTAAGCCCCATAAGAACAA 65 1894 455596 21823 21842 ATCTAAAACAGCAACATCTC 57 1895 455597 23917 23936 TAGTGATTGAATGTAGACTT 81 1896 455598 23980 23999 TTAGGCCACTAAGTCTGAGC 83 1897 455599 24178 24197 CAGCTGAAATCAGCCTTTGA 69 1898 455600 24345 24364 AATCTAGCTAAGTCCATAAC 43 1899 455601 24504 24523 TGCTTGGATATATAGAAGTC 80 1900 455602 24578 24597 AGGTCACTTTCCCTATACGA 81 1901 455603 24608 24627 AGAAGGAAGATTCTTTTCTC 73 1902 455604 24924 24943 CTAAGAGAGGCAACTGAAAT 60 1903 455605 25063 25082 GGCTCGAGGGCCACTGAAGG 59 1904 455606 25093 25112 AGCAAGCACATTGTCATGTC 83 1905 455607 25132 25151 GGCTGCCAAACTTTTCAAAA 76 1906 455608 25626 25645 TTTGTTCTTGCCTAAAATGC 45 1907 455609 25688 25707 TTCCTTCAAGTCAACTTATC 69 1908 455610 26031 26050 CCAGCCTACAGATGACTTTC 78 1909 455611 26061 26080 GCCAACTTTAGCCCCTTCCA 85 1910 BIOL0142WO 455612 26104 26123 AATGCAAAATCTTTACCCTT 58 1911 455613 26139 26158 CCAGCTCAAAAACACACACT 80 1912 455614 26227 26246 GTTTGAAAAATTCAAGAATG 26 1913 455615 26388 26407 ATAGTGTCTGGCTCATAATA 48 1914 455616 26597 26616 TCAGGTCCTCAAAAACACCA 84 1915 455617 26648 26667 TGGCTGGTACCAGCTGGTGG 76 1916 455618 26766 26785 ACAAATTCATCGAGCTAATG 52 1917 455619 26908 26927 AGAATAGCATGGATTTGAAT 49 1918 455620 26999 27018 CACAAACTTGATCTTGCCAC 77 1919 455626 36534 36553 GAATGTAAAGTATCTTGTTC 47 1920 455627 36578 36597 TATAAAATACACACTGGATT 57 1921 455628 36614 36633 GAAATGTGGCTGCTTCAAAC 36 1922 455629 36649 36668 TGGAGTCACTAGCCACATGT 71 1923 455630 36691 36710 GCATACAAATTTACTGAAAC 58 1924 455631 36904 36923 CAAGTTAAAATCTGCCTCAC 62 1925 455632 36975 36994 GGCATGTATTGATTGCCCTC 68 1926 455633 37026 37045 AGTAAAAGCAGTGGCTGACG 60 1927 455634 37086 37105 CACCTGCCACAGGACAAATG 28 1928 455635 37755 37774 TTGCCCCAATTAGGCCAATA 76 1929 455636 37822 37841 AAGGGCTTAAATTCCACTGG 73 1930 455637 37873 37892 GTACTTTACATGTGCAGCAC 81 1931 455638 38268 38287 AATATATCCAAAATGTTATT 8 1932 455639 38694 38713 GCAGCATCCAACAGAAATAG 62 1933 455640 39294 39313 GAGACTGAACACACGCAAAC 65 1934 455641 39324 39343 GTTCTCTGGGATAGTGAGAA 49 1935 455642 39792 39811 GAGAAACCCAGCCAGCTAAT 69 1936 455643 39937 39956 GGAAGATCTGCCTGAGATTC 46 1937 455644 40132 40151 TACAGCATCCAGCTCAGTGC 63 1938 455645 40633 40652 CCCAGTTTAGAACAATACAA 65 1939 455646 40866 40885 GTAGCCATTGCCCAACACAG 63 1940 455647 40901 40920 CACCACAAGTCCCAGTAGGG 58 1941 455648 40923 40942 TAAACCAAAGTGTGCATATG 11 1942 455649 41087 41106 AAGGACTTACCAATCTTGAC 7 1943 455650 41114 41133 ACCTAACAATTTGGAGAGTC 44 1944 455651 41239 41258 TTACAAGACCAAAGGGTGCC 68 1945 455652 41329 41348 AAATCAACCTTCAAGACATC 13 1946 455653 41397 41416 AAAAATATGTCTACCACATC 52 1947 455654 41431 41450 AAGTTCTAGCTATGACAGAA 23 1948 455655 41575 41594 AGCCTGCAGAACTATGAGCC 48 1949 455656 41629 41648 ATTGGAAGCTTGCTGAGGCC 44 1950 455657 41644 41663 CTGCCTTCCGCCATGATTGG 48 1951 455658 41747 41766 CGAGACAGTGAGTTCTTGTG 64 1952 455659 42067 42086 CTGGCCCTTCACCAAATCAG 62 1953 455660 42139 42158 GGTCAGATTTATTAGTACAA 65 1954 455661 42904 42923 ATCATACCTGAAGAAACTGC 16 1955 BIOL0142WO 455662 43059 43078 ATACAGAGCTTTGAGAAAGG 38 1956 455663 43194 43213 TGTAACAGTGAGAGTCATCT 71 1957 455664 43284 43303 TCTGAGTCTTTACACAGTAT 72 1958 455665 43724 43743 TTCATCAAGGAAAGCATTTA 31 1959 455666 43765 43784 TGGAGATGTGGACTGAACTG 19 1960 455667 43908 43927 CCTGGGCCGCAGTGGCTGCA 63 1961 455668 43926 43945 GTTTTGTCTCAGGTCTCACC 75 1962 455669 43941 43960 CCAGACCAGGGATTTGTTTT 34 1963 455670 43974 43993 CTCATTATAAAGTTGTTTGA 55 1964 455671 44507 44526 TGTACTATGAAAGTTTGTCA 80 1965 455672 44525 44544 AATGATATTGGAATAATCTG 26 1966 455673 44540 44559 CTTTGGAAAAGTTTGAATGA 26 1967 455674 44583 44602 CAGCCTCATAAAATAAGCTG 19 1968 455675 45414 45433 TACTGAGAATAGTGTTTCAC 71 1969 455676 45440 45459 AAGACATCCTTATCTTTTGC 75 1970 455677 45512 45531 TTCCAATATTTGTACCCTCA 87 1971 455678 45626 45645 TACAATGGCCTTTCTAAACC 64 1972 455679 45712 45731 AGATCTTTACTTTCATTACA 54 1973 455680 46058 46077 TATGCAAATTGCATACATTT 59 1974 455681 46091 46110 TTTCCAGATATTTTCCCATA 88 1975 455682 46241 46260 GTGTATTTCACCACAATTTT 78 1976 455683 46571 46590 TGTCTTTGAACATGATCTTC 67 1977 455684 46676 46695 GCATGACTAATTAAAACATC 58 1978 455685 46759 46778 CAGAGCAAGTGGCAGGGCTG 69 1979 455686 46791 46810 CAGAGAGAGTAAAAATTGTT 49 1980 455687 46905 46924 CAGCAGAAAGCAGTTAAATT 56 1981 455688 46941 46960 CAGTAATGGTGAGGGTGATG 28 1982 455689 46956 46975 GGTCCCCATTTCCTACAGTA 67 1983 455690 47307 47326 ACACCTGAGCATATCAGTTT 67 1984 455691 47400 47419 CAGAAAATCCTAGTGCTGCC 62 1985 455692 47424 47443 ATAAAATACAAAGGTTTTCC 23 1986 455693 47467 47486 TCCAAATTGACTTAAACCAC 74 1987 455694 47528 47547 TTGAAAACATCCTTGGGATA 44 1988 455695 47579 47598 CAGGCTGGATTTGGGCCACG 76 1989 455696 47649 47668 GCCACAGATAATGCATAAAT 39 1990 455697 47795 47814 CTGGGTTGAGGCCACAAATA 78 1991 455698 47929 47948 GTTTGTGTACTTATAATCCC 75 1992 455699 47974 47993 GACAAAATGACACACATCCT 72 1993 455700 48188 48207 TTTCACACAATTGATAACTT 57 1994 455701 48208 48227 CAGGCCAACACAGAAAGCTG 70 1995 455702 48277 48296 AGAAACCCACCTCTAATACC 31 1996 455703 48402 48421 GCCACACTTTCCATTCTAGT 90 1997 455704 48417 48436 TGGTTACCAGCTCAAGCCAC 72 1998 455705 48566 48585 CAGGTCTAGAGGCCTATCCC 73 1999 455706 48665 48684 TCTTCAAAGAACCCAGCACC 63 2000 BIOL0142WO 455707 48697 48716 AGATGGAGAGAAAGACTCTG 61 2001 455708 48728 48747 CCCACAGTGACAGTGACTCA 89 2002 455709 48768 48787 CTTAGAAGTTTTGGGAAGGT 60 2003 455710 48802 48821 ATGGTCCCTATCCAAGCCCA 81 2004 455711 48828 48847 ATGGGCAACCATTCTCTTCC 80 2005 455712 49754 49773 GTTGGATGTCTACTTAAACG 63 2006 455713 49845 49864 GACCACATGTTCAGCTAAGA 68 2007 455714 49923 49942 AAACAGAGGCAGTGGTGCTG 62 2008 455715 50053 50072 CCAAAAAGGAGGTCAATGCA 30 2009 455716 50522 50541 GTATCCCCAAGAGAAGGCTC 59 2010 455717 50571 50590 TCAAATGAAGCCAAAACCTC 63 2011 455718 50774 50793 CACTTTCTAGAGATTTTAAC 1 2012 455719 51623 51642 TCAGATCTTGCATGTCTGCG 2 2013 455720 51753 51772 CCGCAAGTGAGCGAGACACA 49 2014 455721 51827 51846 CCACATTCTTTAGTCAACTC 59 2015 455722 51856 51875 CAGAAAACATTTCCTCAGAC 3 2016 455723 52033 52052 ACCAGTTTTCTAGCCGATCT 90 2017 455724 52056 52075 AGGAAAAGCTTCTTTCATCC 34 2018 455725 52071 52090 GCTTTCGAGAAAGAAAGGAA 44 2019 455726 53203 53222 TGGATGAAGGTAAAAGTGCA 42 2020 455727 53246 53265 TCACTATAGGGCCTTGCACA 53 2021 455728 53262 53281 AGCTGGTGCAACATGCTCAC 69 2022 455729 53329 53348 GCATTCTCATGTAGAGTTGC 0 2023 455730 53344 53363 GATATGAATAGACAGGCATT 63 2024 455731 53431 53450 ATTCCCAGAACTTAAGCTTC 40 2025 455732 53571 53590 ATTCCATCATTCTTTGATGG 47 2026 455733 53900 53919 TGCACAAGGAATAAGTGAAT 51 2027 455734 54378 54397 AGAAGGGCTTGAACTACATG 15 2028 455735 54577 54596 GAGCCCAGATATGCAGAACA 58 2029 455736 54592 54611 AAATGACAAGCATCTGAGCC 16 2030 455737 54632 54651 ATTTATACCACTAGGAGGCA 52 2031 455738 55241 55260 TTCAGTGACATTAAGAAAAG 28 2032 455739 55256 55275 ATCTTAAGTTTACAGTTCAG 64 2033 455740 55277 55296 GCATGAAATTTACAATTTTT 26 2034 455741 55418 55437 TCCTGCCAATAAATTAAGAA 0 2035 455742 55657 55676 GAAGTCAGCCCGCCTCTCAC 33 2036 455743 55841 55860 GTGTCCCTCAGTAAAATCTC 53 2037 455744 55877 55896 ATGACCCTGGCCACCAACTC 63 2038 455745 55961 55980 CAGAATCAGAGAGCAAGCAG 56 2039 455746 56125 56144 CCTTAAAATCCACAGGGAAG 5 2040 455747 56151 56170 TCCCCATCACTAAGCCTTAC 31 2041 455748 56203 56222 TAACACCTCACCCTACAGGC 56 2042 455749 56287 56306 ACACCATACTAAGTTTCTGA 68 2043 455750 57995 58014 CTTGTCAATGCACACTTTAA 80 2044 455751 58074 58093 TCTAGTTCAAATGATGTCTG 66 2045 BIOL0142WO 455752 58089 58108 AATAAAGACAGAGTCTCTAG 30 2046 455753 58106 58125 CAAAATGAAGATCTCTGAAT 23 2047 455754 58173 58192 AGCTTTGTGGCTTTGTTCAG 60 2048 455755 58259 58278 TGAATGACATGTACAAGTAA 52 2049 455756 58377 58396 TGTGTAAGGACTATATACTC 64 2050 455757 58471 58490 TTCAGCACAGTAACATACTG 41 2051 455758 58496 58515 AGATGTGTTACAATTGCCTA 76 2052 455759 58696 58715 TTTACATCCTGAAAGGTATT 51 2053 455760 59471 59490 ATATGTACTTATTAAACCTA 18 2054 455761 59748 59767 ACAAAAGGAAGCCTCTAGGC 0 2055 455762 59913 59932 CCAAGTGTTTGAATTCTGCA 83 2056 455763 60155 60174 CAGGTTGATGTTTCTAATTC 60 2057 455764 60170 60189 CTACAGCTGAAAGAACAGGT 76 2058 455765 60249 60268 ATGTTCCAAGCCAGAGAGCT 54 2059 455766 60323 60342 GGTGTGGAGAACAACTCAGC 72 2060 455767 60373 60392 GGGAATTTGGAAAGCCCCAG 0 2061 455768 60392 60411 CAGCCGCAGGAGCTGGATGG 42 2062 455769 60407 60426 GGAGCCAAGCAGGGTCAGCC 73 2063 455770 60433 60452 GGAGAGAAAAACAGGGCACT 69 2064 455771 60448 60467 TATCCCACCTCAGTGGGAGA 1 2065 455772 60602 60621 TCTGAATCAATGAAAAGCAG 79 2066 455773 60703 60722 CATCACAATTTTTAAAAATG 0 2067 455774 61216 61235 GTATTTTTAAAACACATATA 0 2068 455775 61251 61270 CTTAATATACATATGAATAC 14 2069 455786 61340 61359 CAAATATCACAGAGACAGTC 88 2070 455787 61758 61777 GTACAGCAACCTTATTTTAA 5 2071 455788 61853 61872 TTAAATCCTGGGAATGGCAC 83 2072 455789 61959 61978 CTAATGTTGATGGGTATTTA 60 2073 455790 62043 62062 CATGGTTATGTGTATCTGCA 89 2074 455791 62067 62086 TTCACTTGATGTGAAATGAA 18 2075 455792 62500 62519 TGCCAGGGACACAACTTGCT 82 2076 455793 62595 62614 ATGGCATTCAGTACTAACAG 59 2077 455794 62610 62629 TTTTCCTCAGAGAGAATGGC 67 2078 455795 63284 63303 AGTCACAATCAGGGAAGCCT 77 2079 455796 63449 63468 AGTAATCATTCCACCTTCTC 70 2080 455797 63464 63483 CAGTGTTAAGCAAACAGTAA 41 2081 455798 63554 63573 ATACACACATCTTCTAAGCA 48 2082 455799 63576 63595 TCAAGTTTGCTGAAAGCTGA 48 2083 455800 63591 63610 ATAGAGATTTTCATATCAAG 41 2084 455801 64070 64089 ACAGGGAGGTCTCAGGAATC 77 2085 455802 64122 64141 TTTAAGACCTTGGAGGCATT 36 2086 455803 64586 64605 AGGGATGGTGCTCATTGTCT 20 2087 455804 64810 64829 GCCGGATCCCTTTTCTGGGC 64 2088 455805 64955 64974 TGATCACCTCGACTGAAAAC 65 2089 455806 65058 65077 GTGCCACCTTCCAACACACA 74 2090 BIOL0142WO 455807 65530 65549 CAGACAGGTGTATTTGGTGG 65 2091 455808 65895 65914 ACTTTGCAAAATTTAGCCCA 77 2092 455809 65928 65947 TCCCATTCCCACGAGAATTT 76 2093 455810 65972 65991 GCCTTCAAGCCAGAGCCCTC 76 2094 455811 65987 66006 GACCAAGAGTTCAGGGCCTT 59 2095 455812 66099 66118 GTAATGGGAAAGCCAAGTCT 51 2096 455813 66128 66147 TTGCCAGCCATGTTTTCCTG 67 2097 455814 66283 66302 AGGGCATCCATCCCCTGCCA 7 2098 455815 66664 66683 TCACTGGAGCAAGCAAAACA 64 2099 455816 66775 66794 GGTCATAGAAAATAAACTTG 62 2100 455817 66863 66882 AGTGTTGAGACCCTGAACAC 53 2101 455818 66918 66937 AGAGAAAACTGCCCATTTTT 71 2102 455819 66948 66967 AGATCATGGAACCTACAGCT 18 2103 455820 66963 66982 GGACATGGGAAGGAAAGATC 27 2104 455821 67191 67210 CAACAACTACCTGGGTCAGC 51 2105 455822 67271 67290 AGGCATTTGCCTATCTATCC 58 2106 455823 67334 67353 CCAACAAAAGCACTCACTAC 56 2107 455824 67773 67792 TGAAATCTGGGCCTCAAACC 78 2108 455825 67843 67862 GAAACCCTTTCTTCAGACCA 79 2109 455826 68621 68640 TCAAAACAGCAAGTGCTGAA 60 2110 455827 69053 69072 AACCCTAAAGGATCACATTA 43 2111 455828 69357 69376 CAAAGAGCCGTGTGGCAGGG 65 2112 455829 69395 69414 GACCAGCCGTGGGACCCCAA 84 2113 455830 69473 69492 CCACAGGAAGGGCGATGGTA 58 2114 455831 69498 69517 GCAGGAAAGGACCTGGCCTC 45 2115 455832 70567 70586 TTAGGGAGCTGACACCCTAG 56 2116 455833 70645 70664 CAATTCAGTGCAGAATTCAA 80 2117 455834 70675 70694 TCTGAGTTTACTTTGGGCCA 75 2118 455835 70725 70744 CATGATGACCATGTGAAAGA 82 2119 455836 70890 70909 CTGAATGCTTACACCAAGAG 83 2120 455837 70973 70992 CCAATTTTCTATGAGCTTTG 85 2121 455838 71013 71032 CTTTTATGTATAAAATAAGA 6 2122 455839 71573 71592 CCAGGTACATCTTCAATAGC 75 2123 455840 71610 71629 GTACAATTGCTTCAACTAGA 87 2124 455841 71698 71717 ACATTTTTGGATGAGGGCAT 81 2125 455842 71750 71769 AAAGCCAAAGGTTATATCTC 77 2126 455843 71765 71784 AATGCTTGTGGTTCCAAAGC 79 2127 455844 71929 71948 TGTAAAAGTTTAACAGCCTC 70 2128 455845 71992 72011 CATAACCTTTTCCCACCTGA 79 2129 455846 72036 72055 CAGTTCTTTGCACAAAGCTG 76 2130 455847 72127 72146 CAAGATTGTCTGGAAAGCTC 76 2131 455848 72202 72221 TCGCATTCAGTAAGCAGAGC 47 2132 455849 72229 72248 AAACCAGTTTTCTTACTGAC 17 2133 455850 72285 72304 CGGTGTCACACAGATAAACT 73 2134 455851 72367 72386 TTAACTCTCACCCAGTGTCC 61 2135 BIOL0142WO 455852 72406 72425 GTACTAAACATAGCCCAGGG 78 2136 455853 72687 72706 AAATACTCACCAAACTGCCC 4 2137 455854 72768 72787 GTGACCAGCTCTCGGTGTGT 10 2138 455855 73340 73359 GATTTGGTTTGTCCAAACTG 49 2139 455856 73530 73549 GTCAGAAAAGCCAGATTTAC 46 2140 455857 73621 73640 GCAACTGGCAGGCCACGCCC 39 2141 455858 73636 73655 AGTTGTCCACCCTCTGCAAC 0 2142 455859 73683 73702 TGTCAAAGGTGAGGGACTCT 57 2143 455860 74018 74037 ACACAAGACATTTCCTTTTT 64 1544 Example 33: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from the study described in Example 32 exhibiting significant in vitro inhibition of STAT3 were tested at various doses in HuVEC cells. Cells were plated at a density of 5,000 cells per well and transfected using LipofectAMINE2000® reagent with 1.1 nM, 3.3 nM, 10.0 nM, and 30.0 nM concentrations of antisense oligonucleotide, as specified in Table 54. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199 (forward sequence ACATGCCACTTTGGTGTTTCATAA, designated herein as SEQ ID NO: 6; reverse sequence TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as SEQ ID NO: 7; probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA, designated herein as SEQ ID NO: 8) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 54 and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of STAT3 mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of STAT3 mRNA expression was achieved compared to the control. As illustrated in Table 54, STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 54 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells .0 30.0 IC ISIS No 1.1 nM 3.3 nM nM nM (nM) 337332 7 19 46 80 10.4 345785 8 22 46 74 11.3 455265 20 43 64 85 5.0 455267 16 30 62 79 6.7 455269 23 49 72 84 4.0 455270 3 28 60 79 8.1 455271 16 40 71 86 4.9 BIOL0142WO 455272 28 30 57 86 5.7 455282 18 28 55 80 7.4 455291 21 45 75 85 4.1 455370 6 23 53 78 9.0 455371 15 46 73 90 4.5 455391 10 30 54 75 8.5 455393 6 33 62 81 7.0 455394 5 33 63 85 6.7 455398 7 25 56 76 8.8 455411 10 21 58 82 7.9 455412 15 27 50 79 8.4 455429 17 43 67 81 5.2 455438 20 43 66 83 5.0 455439 10 41 67 84 5.7 455447 7 23 53 87 7.7 455457 9 24 52 79 8.8 455458 8 34 62 83 6.7 455463 6 37 63 85 6.3 455471 11 42 67 78 5.9 455525 0 9 42 72 13.4 455527 0 21 60 87 7.8 455530 11 26 62 83 7.1 455536 5 21 62 85 7.6 455540 8 28 65 87 6.5 455547 6 19 45 67 13.4 455548 0 41 68 90 5.8 455551 0 3 33 72 15.9 455553 0 29 64 87 7.2 455565 0 19 54 86 8.8 455566 13 28 45 76 9.6 455569 0 16 47 76 11.1 455581 0 19 62 85 8.6 455582 0 26 70 89 6.9 455591 7 17 47 68 12.8 455594 0 16 48 76 10.9 455611 14 43 68 81 5.4 455637 10 22 56 76 8.9 455677 0 18 46 72 11.9 455681 16 19 42 69 13.0 455703 9 40 72 92 5.1 455708 11 15 45 77 10.7 455723 3 9 33 68 17.0 455762 0 9 42 70 14.1 455786 21 32 50 79 7.4 455790 13 19 56 84 7.8 BIOL0142WO 455840 17 30 52 77 7.9 Example 34: Antisense inhibition of human STAT3 in HuVEC cells by oligonucleotides designed by microwalk Additional gapmers were designed based on the gapmers presented in Example 1 that demonstrated an inhibition of at least 50%. These gapmers were designed by creating gapmers shifted slightly upstream and downstream (i.e., “microwalk”) of the original gapmers. These gapmers were tested in vitro. ISIS 337332 was also included in the assay as a comparator. Cultured HuVEC cells at a density of 5,000 cells per well were transfected using LipofectAMINE 2000® reagent with 30 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS199, described hereinabove, was used to measure STAT3 mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells. The results are presented in Table 55.

The chimeric antisense oligonucleotides in Table 55 were designed as 55 MOE gapmers.

The gapmers designated with an asterisk (*) in Table 55 are the original gapmers from which gapmers, ISIS 465226-466744, were designed via microwalk. The 55 gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2’-deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising five nucleosides each. Each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a 2’-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5’-methylcytosines. “Target start site” indicates the 5’-most nucleoside to which the gapmer is targeted. “Target stop site” indicates the 3’-most nucleoside to which the gapmer is targeted.

Each gapmer listed in Table 55 is targeted to the target region spanning nucleobases 2313-76017 of SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_010755.14 truncated from nucleotides 4185000 to 4264000).

Table 55 Inhibition of human STAT3 mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 Start Stop % SEQ ID ISIS No Sequence Site Site inhibition NO 466646 2313 2332 CACACTATACACATTTTTAA 3 2144 466647 2314 2333 ACACACTATACACATTTTTA 11 2145 466648 2315 2334 TACACACTATACACATTTTT 8 2146 455525* 2316 2335 GTACACACTATACACATTTT 47 1824 466649 2317 2336 GGTACACACTATACACATTT 46 2147 466650 2318 2337 AGGTACACACTATACACATT 46 2148 466651 2319 2338 CAGGTACACACTATACACAT 54 2149 466652 2320 2339 GCAGGTACACACTATACACA 68 2150 BIOL0142WO 466653 2321 2340 AGCAGGTACACACTATACAC 43 2151 466654 2322 2341 CAGCAGGTACACACTATACA 56 2152 466655 2323 2342 CCAGCAGGTACACACTATAC 72 2153 466656 2324 2343 ACCAGCAGGTACACACTATA 52 2154 466657 2325 2344 GACCAGCAGGTACACACTAT 69 2155 466658 2326 2345 AGACCAGCAGGTACACACTA 15 2156 466659 2327 2346 AAGACCAGCAGGTACACACT 49 2157 466660 2328 2347 TAAGACCAGCAGGTACACAC 59 2158 466661 2329 2348 GTAAGACCAGCAGGTACACA 73 2159 466662 2330 2349 AGTAAGACCAGCAGGTACAC 65 2160 466663 2331 2350 CAGTAAGACCAGCAGGTACA 64 2161 466664 2332 2351 ACAGTAAGACCAGCAGGTAC 53 2162 466665 2333 2352 TACAGTAAGACCAGCAGGTA 67 2163 466666 2334 2353 ATACAGTAAGACCAGCAGGT 75 2164 466667 2335 2354 CATACAGTAAGACCAGCAGG 66 2165 466668 2336 2355 ACATACAGTAAGACCAGCAG 55 2166 466669 2337 2356 CACATACAGTAAGACCAGCA 71 2167 466670 2338 2357 GCACATACAGTAAGACCAGC 83 2168 466671 2339 2358 TGCACATACAGTAAGACCAG 28 2169 466672 2340 2359 TTGCACATACAGTAAGACCA 70 2170 466673 2341 2360 GTTGCACATACAGTAAGACC 39 2171 466674 2342 2361 AGTTGCACATACAGTAAGAC 53 2172 466675 2343 2362 TAGTTGCACATACAGTAAGA 43 2173 455527* 2383 2402 GCCAAAAATTTACAACCCAT 48 1826 465806 2384 2403 AGCCAAAAATTTACAACCCA 29 2174 465807 2385 2404 CAGCCAAAAATTTACAACCC 7 2175 465808 2386 2405 CCAGCCAAAAATTTACAACC 35 2176 465809 2387 2406 GCCAGCCAAAAATTTACAAC 10 2177 465810 2388 2407 AGCCAGCCAAAAATTTACAA 37 2178 465811 2389 2408 CAGCCAGCCAAAAATTTACA 29 2179 465812 2390 2409 ACAGCCAGCCAAAAATTTAC 3 2180 465813 2391 2410 CACAGCCAGCCAAAAATTTA 6 2181 465814 2392 2411 GCACAGCCAGCCAAAAATTT 35 2182 465815 2393 2412 AGCACAGCCAGCCAAAAATT 22 2183 465816 2394 2413 CAGCACAGCCAGCCAAAAAT 23 2184 465817 2395 2414 TCAGCACAGCCAGCCAAAAA 33 2185 465818 2396 2415 ATCAGCACAGCCAGCCAAAA 32 2186 465819 2397 2416 TATCAGCACAGCCAGCCAAA 48 2187 465820 2398 2417 TTATCAGCACAGCCAGCCAA 32 2188 465821 2399 2418 TTTATCAGCACAGCCAGCCA 0 2189 465822 2400 2419 CTTTATCAGCACAGCCAGCC 49 2190 465823 2401 2420 GCTTTATCAGCACAGCCAGC 69 2191 465824 2402 2421 TGCTTTATCAGCACAGCCAG 48 2192 465825 2403 2422 ATGCTTTATCAGCACAGCCA 74 2193 465826 2404 2423 AATGCTTTATCAGCACAGCC 62 2194 BIOL0142WO 465827 2405 2424 CAATGCTTTATCAGCACAGC 67 2195 465828 2406 2425 CCAATGCTTTATCAGCACAG 71 2196 465829 2407 2426 CCCAATGCTTTATCAGCACA 47 2197 465830 2408 2427 GCCCAATGCTTTATCAGCAC 81 2198 465831 2409 2428 AGCCCAATGCTTTATCAGCA 75 2199 465832 2410 2429 AAGCCCAATGCTTTATCAGC 57 2200 465349 2655 2674 AGGCTCCAACCTCTAAAACA 41 2201 465350 2656 2675 AAGGCTCCAACCTCTAAAAC 34 2202 465351 2657 2676 CAAGGCTCCAACCTCTAAAA 43 2203 465352 2658 2677 TCAAGGCTCCAACCTCTAAA 51 2204 465353 2659 2678 ATCAAGGCTCCAACCTCTAA 38 2205 465354 2660 2679 AATCAAGGCTCCAACCTCTA 29 2206 465355 2661 2680 AAATCAAGGCTCCAACCTCT 56 2207 465356 2662 2681 AAAATCAAGGCTCCAACCTC 24 2208 465357 2663 2682 TAAAATCAAGGCTCCAACCT 46 2209 465358 2664 2683 CTAAAATCAAGGCTCCAACC 45 2210 465359 2665 2684 ACTAAAATCAAGGCTCCAAC 50 2211 465366 2666 2685 GACTAAAATCAAGGCTCCAA 51 2212 465367 2667 2686 AGACTAAAATCAAGGCTCCA 64 2213 465368 2668 2687 GAGACTAAAATCAAGGCTCC 76 2214 455530* 2669 2688 AGAGACTAAAATCAAGGCTC 74 1829 455536* 5000 5019 AGAACTGAAATTCCTTGGTC 52 1835 465833 5001 5020 CAGAACTGAAATTCCTTGGT 81 2215 465834 5002 5021 ACAGAACTGAAATTCCTTGG 81 2216 465835 5003 5022 AACAGAACTGAAATTCCTTG 48 2217 465836 5004 5023 GAACAGAACTGAAATTCCTT 46 2218 465837 5005 5024 AGAACAGAACTGAAATTCCT 39 2219 465838 5006 5025 AAGAACAGAACTGAAATTCC 22 2220 465839 5007 5026 AAAGAACAGAACTGAAATTC 3 2221 465840 5008 5027 AAAAGAACAGAACTGAAATT 0 2222 465841 5009 5028 CAAAAGAACAGAACTGAAAT 0 2223 465842 5010 5029 ACAAAAGAACAGAACTGAAA 0 2224 465843 5011 5030 TACAAAAGAACAGAACTGAA 3 2225 465844 5012 5031 CTACAAAAGAACAGAACTGA 0 2226 465845 5013 5032 CCTACAAAAGAACAGAACTG 13 2227 465846 5014 5033 CCCTACAAAAGAACAGAACT 0 2228 465847 5015 5034 CCCCTACAAAAGAACAGAAC 7 2229 465848 5016 5035 TCCCCTACAAAAGAACAGAA 33 2230 465849 5017 5036 TTCCCCTACAAAAGAACAGA 18 2231 465850 5018 5037 CTTCCCCTACAAAAGAACAG 0 2232 465851 5019 5038 GCTTCCCCTACAAAAGAACA 43 2233 465852 5020 5039 AGCTTCCCCTACAAAAGAAC 32 2234 465853 5021 5040 AAGCTTCCCCTACAAAAGAA 0 2235 465854 5022 5041 AAAGCTTCCCCTACAAAAGA 15 2236 465855 5023 5042 AAAAGCTTCCCCTACAAAAG 14 2237 BIOL0142WO 465856 5024 5043 TAAAAGCTTCCCCTACAAAA 4 2238 465857 5025 5044 TTAAAAGCTTCCCCTACAAA 0 2239 465858 5026 5045 TTTAAAAGCTTCCCCTACAA 11 2240 465859 5027 5046 TTTTAAAAGCTTCCCCTACA 11 2241 465860 5688 5707 CAGTGGTTTTTATAAATGAC 29 2242 465861 5689 5708 TCAGTGGTTTTTATAAATGA 19 2243 465862 5690 5709 TTCAGTGGTTTTTATAAATG 4 2244 465863 5691 5710 TTTCAGTGGTTTTTATAAAT 0 2245 465864 5692 5711 CTTTCAGTGGTTTTTATAAA 0 2246 465865 5693 5712 TCTTTCAGTGGTTTTTATAA 0 2247 465866 5694 5713 CTCTTTCAGTGGTTTTTATA 35 2248 465867 5695 5714 ACTCTTTCAGTGGTTTTTAT 67 2249 465868 5696 5715 TACTCTTTCAGTGGTTTTTA 60 2250 465886 5697 5716 GTACTCTTTCAGTGGTTTTT 85 2251 465887 5698 5717 AGTACTCTTTCAGTGGTTTT 62 2252 455540* 5699 5718 AAGTACTCTTTCAGTGGTTT 76 1839 465888 5700 5719 CAAGTACTCTTTCAGTGGTT 80 2253 465906 5701 5720 TCAAGTACTCTTTCAGTGGT 74 2254 465926 5702 5721 CTCAAGTACTCTTTCAGTGG 80 2255 465927 5703 5722 CCTCAAGTACTCTTTCAGTG 71 2256 465928 5704 5723 CCCTCAAGTACTCTTTCAGT 54 2257 465929 5705 5724 TCCCTCAAGTACTCTTTCAG 33 2258 465930 5706 5725 GTCCCTCAAGTACTCTTTCA 56 2259 465931 5707 5726 TGTCCCTCAAGTACTCTTTC 43 2260 465932 5708 5727 ATGTCCCTCAAGTACTCTTT 33 2261 465486 7674 7693 AAAGGGCTGCAAAAAATCTG 39 2262 465487 7675 7694 GAAAGGGCTGCAAAAAATCT 11 2263 465488 7676 7695 AGAAAGGGCTGCAAAAAATC 28 2264 465489 7677 7696 CAGAAAGGGCTGCAAAAAAT 39 2265 465490 7678 7697 ACAGAAAGGGCTGCAAAAAA 29 2266 465506 7679 7698 AACAGAAAGGGCTGCAAAAA 36 2267 465507 7680 7699 AAACAGAAAGGGCTGCAAAA 35 2268 465508 7681 7700 TAAACAGAAAGGGCTGCAAA 47 2269 455547* 7682 7701 GTAAACAGAAAGGGCTGCAA 72 1846 465509 7683 7702 GGTAAACAGAAAGGGCTGCA 70 2270 465510 7684 7703 TGGTAAACAGAAAGGGCTGC 63 2271 465511 7685 7704 CTGGTAAACAGAAAGGGCTG 60 2272 465526 7686 7705 CCTGGTAAACAGAAAGGGCT 65 2273 465527 7687 7706 ACCTGGTAAACAGAAAGGGC 26 2274 465528 7688 7707 AACCTGGTAAACAGAAAGGG 53 2275 465529 7689 7708 TAACCTGGTAAACAGAAAGG 35 2276 465530 7690 7709 ATAACCTGGTAAACAGAAAG 3 2277 465531 7691 7710 GATAACCTGGTAAACAGAAA 17 2278 465532 7692 7711 AGATAACCTGGTAAACAGAA 14 2279 465533 7693 7712 AAGATAACCTGGTAAACAGA 26 2280 BIOL0142WO 455548* 8078 8097 GGGCAGATTTACCTTCCTTA 77 1847 466722 8241 8260 AATAGCAATCACCTTAGGAA 53 2281 466723 8242 8261 CAATAGCAATCACCTTAGGA 62 2282 466724 8243 8262 ACAATAGCAATCACCTTAGG 48 2283 455551* 8244 8263 TACAATAGCAATCACCTTAG 65 1850 466725 8245 8264 CTACAATAGCAATCACCTTA 15 2284 466726 8246 8265 ACTACAATAGCAATCACCTT 45 2285 466727 8247 8266 AACTACAATAGCAATCACCT 42 2286 466728 8248 8267 AAACTACAATAGCAATCACC 26 2287 466729 8249 8268 AAAACTACAATAGCAATCAC 14 2288 466730 8250 8269 CAAAACTACAATAGCAATCA 0 2289 466731 8251 8270 TCAAAACTACAATAGCAATC 29 2290 466732 8252 8271 TTCAAAACTACAATAGCAAT 20 2291 466733 8253 8272 TTTCAAAACTACAATAGCAA 14 2292 466734 8254 8273 GTTTCAAAACTACAATAGCA 58 2293 466735 8255 8274 TGTTTCAAAACTACAATAGC 28 2294 466736 8256 8275 GTGTTTCAAAACTACAATAG 42 2295 466737 8257 8276 AGTGTTTCAAAACTACAATA 13 2296 466738 8258 8277 AAGTGTTTCAAAACTACAAT 18 2297 466739 8259 8278 CAAGTGTTTCAAAACTACAA 30 2298 466740 8260 8279 CCAAGTGTTTCAAAACTACA 49 2299 466741 8261 8280 ACCAAGTGTTTCAAAACTAC 46 2300 466742 8262 8281 AACCAAGTGTTTCAAAACTA 41 2301 466743 8263 8282 CAACCAAGTGTTTCAAAACT 13 2302 9123 9142 455553* ACCTGCCCCTATGTATAAGC 75 1852 11261 11280 9124 9143 466744 CACCTGCCCCTATGTATAAG 67 2303 11262 11281 9125 9144 466745 CCACCTGCCCCTATGTATAA 69 2304 11263 11282 9126 9145 466746 TCCACCTGCCCCTATGTATA 68 2305 11264 11283 9127 9146 466747 TTCCACCTGCCCCTATGTAT 69 2306 11265 11284 9128 9147 466748 ATTCCACCTGCCCCTATGTA 58 2307 11266 11285 9129 9148 466749 TATTCCACCTGCCCCTATGT 38 2308 11267 11286 9130 9149 466750 TTATTCCACCTGCCCCTATG 47 309 11268 11287 466751 9131 9150 TTTATTCCACCTGCCCCTAT 54 2310 466752 9132 9151 TTTTATTCCACCTGCCCCTA 50 2311 466753 9133 9152 GTTTTATTCCACCTGCCCCT 58 2312 466754 9134 9153 TGTTTTATTCCACCTGCCCC 53 2313 466755 9135 9154 ATGTTTTATTCCACCTGCCC 69 2314 BIOL0142WO 466756 9136 9155 TATGTTTTATTCCACCTGCC 3 2315 466757 9137 9156 TTATGTTTTATTCCACCTGC 48 2316 466758 9138 9157 ATTATGTTTTATTCCACCTG 53 2317 466759 9139 9158 AATTATGTTTTATTCCACCT 24 2318 466760 9140 9159 TAATTATGTTTTATTCCACC 10 2319 466761 9141 9160 CTAATTATGTTTTATTCCAC 13 2320 466762 9142 9161 CCTAATTATGTTTTATTCCA 23 2321 466763 9143 9162 TCCTAATTATGTTTTATTCC 27 2322 466764 9144 9163 CTCCTAATTATGTTTTATTC 21 2323 466765 9145 9164 CCTCCTAATTATGTTTTATT 30 2324 9862 9881 465740 TGGCTTCTTCCTGAGACACA 81 2325 12345 12364 9863 9882 465741 TTGGCTTCTTCCTGAGACAC 68 2326 12346 12365 9864 9883 465742 GTTGGCTTCTTCCTGAGACA 81 2327 12347 12366 9865 9884 465743 TGTTGGCTTCTTCCTGAGAC 68 2328 12348 12367 9866 9885 465744 CTGTTGGCTTCTTCCTGAGA 44 2329 12349 12368 9867 9886 465745 CCTGTTGGCTTCTTCCTGAG 73 2330 12350 12369 9868 9887 465746 TCCTGTTGGCTTCTTCCTGA 61 2331 12351 12370 9869 9888 465747 CTCCTGTTGGCTTCTTCCTG 53 2332 12352 12371 9870 9889 465748 CCTCCTGTTGGCTTCTTCCT 78 2333 12353 12372 9871 9890 465749 TCCTCCTGTTGGCTTCTTCC 73 2334 12354 12373 9872 9891 465750 TTCCTCCTGTTGGCTTCTTC 70 2335 12355 12374 9873 9892 465751 GTTCCTCCTGTTGGCTTCTT 89 2336 12356 12375 9874 9893 465752 GGTTCCTCCTGTTGGCTTCT 86 2337 12357 12376 9875 9894 465753 AGGTTCCTCCTGTTGGCTTC 73 2338 12358 12377 9876 9895 465754 AAGGTTCCTCCTGTTGGCTT 85 2339 12359 12378 9877 9896 465755 TAAGGTTCCTCCTGTTGGCT 82 2340 12360 12379 9878 9897 465756 ATAAGGTTCCTCCTGTTGGC 72 2341 12361 12380 465757 9879 9898 AATAAGGTTCCTCCTGTTGG 61 2342 BIOL0142WO 12362 12381 9880 9899 465758 AAATAAGGTTCCTCCTGTTG 40 2343 12363 12382 9881 9900 465759 AAAATAAGGTTCCTCCTGTT 41 2344 12364 12383 9882 9901 465760 CAAAATAAGGTTCCTCCTGT 20 2345 12365 12384 9883 9902 465761 TCAAAATAAGGTTCCTCCTG 57 2346 12366 12385 9884 9903 465762 CTCAAAATAAGGTTCCTCCT 48 2347 12367 12386 9885 9904 465763 ACTCAAAATAAGGTTCCTCC 52 2348 12368 12387 9886 9905 455566* GACTCAAAATAAGGTTCCTC 59 1855 12369 12388 9887 9906 465764 TGACTCAAAATAAGGTTCCT 54 2349 12370 12389 9888 9907 465765 CTGACTCAAAATAAGGTTCC 47 2350 12371 12390 9889 9908 465766 CCTGACTCAAAATAAGGTTC 55 2351 12372 12391 9890 9909 465767 ACCTGACTCAAAATAAGGTT 48 2352 12373 12382 9123 9142 455553* ACCTGCCCCTATGTATAAGC 75 1852 11261 11280 9124 9143 466744 CACCTGCCCCTATGTATAAG 67 2303 11262 11281 9125 9144 466745 CCACCTGCCCCTATGTATAA 69 2304 11263 11282 9126 9145 466746 TCCACCTGCCCCTATGTATA 68 2305 11264 11283 9127 9146 466747 TTCCACCTGCCCCTATGTAT 69 2306 11265 11284 9128 9147 466748 ATTCCACCTGCCCCTATGTA 58 2307 11266 11285 9129 9148 466749 TATTCCACCTGCCCCTATGT 38 2308 11267 11286 9130 9149 466750 TTATTCCACCTGCCCCTATG 47 2309 11268 11287 465726 11695 11714 TTAATCTTTCCTAGGCAAAG 19 2353 465727 11696 11715 ATTAATCTTTCCTAGGCAAA 22 2354 465728 11697 11716 CATTAATCTTTCCTAGGCAA 43 2355 465729 11698 11717 GCATTAATCTTTCCTAGGCA 68 2356 465730 11699 11718 AGCATTAATCTTTCCTAGGC 80 2357 455565* 11700 11719 TAGCATTAATCTTTCCTAGG 74 1864 BIOL0142WO 465731 11701 11720 TTAGCATTAATCTTTCCTAG 42 2358 465732 11702 11721 ATTAGCATTAATCTTTCCTA 22 2359 465733 11703 11722 GATTAGCATTAATCTTTCCT 40 2360 465734 11704 11723 AGATTAGCATTAATCTTTCC 0 2361 465735 11705 11724 AAGATTAGCATTAATCTTTC 10 2362 465736 11706 11725 TAAGATTAGCATTAATCTTT 3 2363 465737 12342 12361 CTTCTTCCTGAGACACAGCC 71 2364 465738 12343 12362 GCTTCTTCCTGAGACACAGC 74 2365 465739 12344 12363 GGCTTCTTCCTGAGACACAG 83 2366 9862 9881 465740 TGGCTTCTTCCTGAGACACA 81 2325 12345 12364 9863 9882 465741 TTGGCTTCTTCCTGAGACAC 68 2326 12346 12365 9864 9883 465742 GTTGGCTTCTTCCTGAGACA 81 2327 12347 12366 9865 9884 465743 TGTTGGCTTCTTCCTGAGAC 68 2328 12348 12367 9866 9885 465744 CTGTTGGCTTCTTCCTGAGA 44 2329 12349 12368 9867 9886 465745 CCTGTTGGCTTCTTCCTGAG 73 2330 12350 12369 9868 9887 465746 TCCTGTTGGCTTCTTCCTGA 61 2331 12351 12370 9869 9888 465747 CTCCTGTTGGCTTCTTCCTG 53 2332 12352 12371 9870 9889 465748 CCTCCTGTTGGCTTCTTCCT 78 2333 12353 12372 9871 9890 465749 TCCTCCTGTTGGCTTCTTCC 73 2334 12354 12373 9872 9891 465750 TTCCTCCTGTTGGCTTCTTC 70 2335 12355 12374 9873 9892 465751 GTTCCTCCTGTTGGCTTCTT 89 2336 12356 12375 9874 9893 465752 GGTTCCTCCTGTTGGCTTCT 86 2337 12357 12376 9875 9894 465753 AGGTTCCTCCTGTTGGCTTC 73 2338 12358 12377 9876 9895 465754 AAGGTTCCTCCTGTTGGCTT 85 2339 12359 12378 9877 9896 465755 TAAGGTTCCTCCTGTTGGCT 82 2340 12360 12379 9878 9897 465756 ATAAGGTTCCTCCTGTTGGC 72 2341 12361 12380 9879 9898 465757 AATAAGGTTCCTCCTGTTGG 61 2342 12362 12381 BIOL0142WO 9880 9899 465758 AAATAAGGTTCCTCCTGTTG 40 2343 12363 12382 9881 9900 465759 AAAATAAGGTTCCTCCTGTT 41 2344 12364 12383 9882 9901 465760 CAAAATAAGGTTCCTCCTGT 20 2345 12365 12384 9883 9902 465761 TCAAAATAAGGTTCCTCCTG 57 2346 12366 12385 9884 9903 465762 CTCAAAATAAGGTTCCTCCT 48 2347 12367 12386 9885 9904 465763 ACTCAAAATAAGGTTCCTCC 52 2348 12368 12387 9886 9905 455566* GACTCAAAATAAGGTTCCTC 59 1865 12369 12388 9887 9906 465764 TGACTCAAAATAAGGTTCCT 54 2349 12370 12389 9888 9907 465765 CTGACTCAAAATAAGGTTCC 47 2350 12371 12390 9889 9908 465766 CCTGACTCAAAATAAGGTTC 55 2351 12372 12391 9890 9909 465767 ACCTGACTCAAAATAAGGTT 48 2352 12373 12392 465369 14101 14120 TGAGGATGACCCCAGATAAA 64 2367 465370 14102 14121 GTGAGGATGACCCCAGATAA 60 2368 465371 14103 14122 TGTGAGGATGACCCCAGATA 47 2369 465372 14104 14123 CTGTGAGGATGACCCCAGAT 68 2370 465373 14105 14124 CCTGTGAGGATGACCCCAGA 67 2371 465374 14106 14125 GCCTGTGAGGATGACCCCAG 70 2372 465375 14107 14126 TGCCTGTGAGGATGACCCCA 75 2373 465376 14108 14127 ATGCCTGTGAGGATGACCCC 72 2374 465377 14109 14128 TATGCCTGTGAGGATGACCC 58 2375 465378 14110 14129 CTATGCCTGTGAGGATGACC 56 2376 465379 14111 14130 GCTATGCCTGTGAGGATGAC 65 2377 465380 14112 14131 TGCTATGCCTGTGAGGATGA 23 2378 465386 14113 14132 CTGCTATGCCTGTGAGGATG 64 2379 465387 14114 14133 TCTGCTATGCCTGTGAGGAT 66 2380 465388 14115 14134 ATCTGCTATGCCTGTGAGGA 69 2381 465389 14116 14135 TATCTGCTATGCCTGTGAGG 59 2382 465390 14117 14136 ATATCTGCTATGCCTGTGAG 51 2383 465391 14118 14137 AATATCTGCTATGCCTGTGA 57 2384 465392 14119 14138 GAATATCTGCTATGCCTGTG 60 2385 465393 14120 14139 AGAATATCTGCTATGCCTGT 53 2386 465394 14121 14140 CAGAATATCTGCTATGCCTG 55 2387 465395 14122 14141 TCAGAATATCTGCTATGCCT 64 2388 465396 14123 14142 ATCAGAATATCTGCTATGCC 43 2389 BIOL0142WO 465397 14124 14143 AATCAGAATATCTGCTATGC 37 2390 465398 14125 14144 GAATCAGAATATCTGCTATG 22 2391 465399 14126 14145 TGAATCAGAATATCTGCTAT 33 2392 465400 14127 14146 CTGAATCAGAATATCTGCTA 58 2393 465401 14128 14147 TCTGAATCAGAATATCTGCT 77 2394 455569* 14129 14148 ATCTGAATCAGAATATCTGC 67 1868 465406 14130 14149 CATCTGAATCAGAATATCTG 45 2395 465407 14131 14150 CCATCTGAATCAGAATATCT 47 2396 465408 14132 14151 ACCATCTGAATCAGAATATC 55 2397 465409 14133 14152 GACCATCTGAATCAGAATAT 72 2398 465410 14134 14153 GGACCATCTGAATCAGAATA 70 2399 465411 14135 14154 AGGACCATCTGAATCAGAAT 67 2400 465426 14136 14155 AAGGACCATCTGAATCAGAA 71 2401 465427 14137 14156 CAAGGACCATCTGAATCAGA 73 2402 465428 14138 14157 CCAAGGACCATCTGAATCAG 64 2403 465429 14139 14158 ACCAAGGACCATCTGAATCA 54 2404 465446 14140 14159 GACCAAGGACCATCTGAATC 65 2405 465447 14141 14160 GGACCAAGGACCATCTGAAT 72 2406 465448 14142 14161 AGGACCAAGGACCATCTGAA 68 2407 465449 14143 14162 AAGGACCAAGGACCATCTGA 78 2408 465450 14144 14163 TAAGGACCAAGGACCATCTG 37 2409 465451 14145 14164 CTAAGGACCAAGGACCATCT 73 2410 465452 14146 14165 ACTAAGGACCAAGGACCATC 65 2411 465453 14147 14166 AACTAAGGACCAAGGACCAT 54 2412 465454 14148 14167 AAACTAAGGACCAAGGACCA 49 2413 465455 14149 14168 CAAACTAAGGACCAAGGACC 61 2414 465456 14150 14169 TCAAACTAAGGACCAAGGAC 53 2415 465457 14151 14170 CTCAAACTAAGGACCAAGGA 59 2416 465534 16802 16821 CAACAGAGTGAAATGTAATG 16 2417 465535 16803 16822 TCAACAGAGTGAAATGTAAT 12 2418 465536 16804 16823 CTCAACAGAGTGAAATGTAA 52 2419 465537 16805 16824 GCTCAACAGAGTGAAATGTA 74 2420 465538 16806 16825 TGCTCAACAGAGTGAAATGT 17 2421 465539 16807 16826 ATGCTCAACAGAGTGAAATG 37 2422 465540 16808 16827 AATGCTCAACAGAGTGAAAT 14 2423 465541 16809 16828 GAATGCTCAACAGAGTGAAA 30 2424 465542 16810 16829 AGAATGCTCAACAGAGTGAA 23 2425 465543 16811 16830 TAGAATGCTCAACAGAGTGA 43 2426 465544 16812 16831 ATAGAATGCTCAACAGAGTG 38 2427 465545 16813 16832 CATAGAATGCTCAACAGAGT 38 2428 465546 16814 16833 CCATAGAATGCTCAACAGAG 56 2429 465547 16815 16834 TCCATAGAATGCTCAACAGA 37 2430 465548 16816 16835 ATCCATAGAATGCTCAACAG 48 2431 465549 16817 16836 AATCCATAGAATGCTCAACA 24 2432 465550 16818 16837 AAATCCATAGAATGCTCAAC 34 2433 BIOL0142WO 465551 16819 16838 AAAATCCATAGAATGCTCAA 30 2434 465552 16820 16839 CAAAATCCATAGAATGCTCA 32 2435 465553 16821 16840 TCAAAATCCATAGAATGCTC 46 2436 465554 16822 16841 GTCAAAATCCATAGAATGCT 57 2437 465555 16823 16842 TGTCAAAATCCATAGAATGC 32 2438 465556 16824 16843 TTGTCAAAATCCATAGAATG 5 2439 465557 16825 16844 TTTGTCAAAATCCATAGAAT 2 2440 465558 16826 16845 ATTTGTCAAAATCCATAGAA 17 2441 465559 16827 16846 CATTTGTCAAAATCCATAGA 17 2442 465560 16828 16847 ACATTTGTCAAAATCCATAG 31 2443 465561 16829 16848 CACATTTGTCAAAATCCATA 43 2444 465562 16830 16849 ACACATTTGTCAAAATCCAT 42 2445 465563 16831 16850 CACACATTTGTCAAAATCCA 56 2446 455581* 16832 16851 TCACACATTTGTCAAAATCC 55 1880 465564 16833 16852 ATCACACATTTGTCAAAATC 34 2447 465565 16834 16853 CATCACACATTTGTCAAAAT 40 2448 465566 16835 16854 TCATCACACATTTGTCAAAA 41 2449 465567 16836 16855 ATCATCACACATTTGTCAAA 37 2450 465568 16837 16856 CATCATCACACATTTGTCAA 44 2451 465569 16838 16857 ACATCATCACACATTTGTCA 60 2452 465570 16839 16858 TACATCATCACACATTTGTC 9 2453 465571 16840 16859 ATACATCATCACACATTTGT 48 2454 465572 16841 16860 TATACATCATCACACATTTG 46 2455 465573 16842 16861 ATATACATCATCACACATTT 28 2456 455582* 16863 16882 TATATAATTGTGTACTGGCA 79 1881 465458 16864 16883 TTATATAATTGTGTACTGGC 83 2457 465459 16865 16884 TTTATATAATTGTGTACTGG 22 2458 465460 16866 16885 TTTTATATAATTGTGTACTG 8 2459 465461 16867 16886 ATTTTATATAATTGTGTACT 0 2460 465462 16868 16887 TATTTTATATAATTGTGTAC 1 2461 465463 16869 16888 CTATTTTATATAATTGTGTA 9 2462 465464 16870 16889 ACTATTTTATATAATTGTGT 0 2463 465465 16871 16890 AACTATTTTATATAATTGTG 7 2464 465466 16872 16891 AAACTATTTTATATAATTGT 13 2465 465606 21187 21206 TAATGAGACTTTAGCACTCT 67 2466 455591* 21188 21207 ATAATGAGACTTTAGCACTC 62 1890 465607 21189 21208 AATAATGAGACTTTAGCACT 41 2467 465608 21190 21209 CAATAATGAGACTTTAGCAC 54 2468 465609 21191 21210 GCAATAATGAGACTTTAGCA 6 2469 465610 21193 21212 CTGCAATAATGAGACTTTAG 77 2470 465611 21194 21213 ACTGCAATAATGAGACTTTA 53 2471 465612 21195 21214 AACTGCAATAATGAGACTTT 39 2472 465266 21638 21657 ATTTGAATAAATGAATGAAA 0 2473 465267 21639 21658 TATTTGAATAAATGAATGAA 0 2474 465268 21640 21659 ATATTTGAATAAATGAATGA 0 2475 BIOL0142WO 465269 21641 21660 AATATTTGAATAAATGAATG 0 2476 465270 21642 21661 AAATATTTGAATAAATGAAT 0 2477 465271 21643 21662 CAAATATTTGAATAAATGAA 0 2478 465272 21644 21663 TCAAATATTTGAATAAATGA 0 2479 465273 21645 21664 CTCAAATATTTGAATAAATG 0 2480 465274 21646 21665 GCTCAAATATTTGAATAAAT 0 2481 465275 21647 21666 TGCTCAAATATTTGAATAAA 6 2482 465276 21648 21667 ATGCTCAAATATTTGAATAA 0 2483 465277 21649 21668 AATGCTCAAATATTTGAATA 0 2484 465278 21650 21669 GAATGCTCAAATATTTGAAT 19 2485 465279 21651 21670 AGAATGCTCAAATATTTGAA 0 2486 465280 21652 21671 CAGAATGCTCAAATATTTGA 5 2487 465281 21653 21672 ACAGAATGCTCAAATATTTG 9 2488 465282 21654 21673 TACAGAATGCTCAAATATTT 1 2489 465283 21655 21674 CTACAGAATGCTCAAATATT 0 2490 465284 21656 21675 ACTACAGAATGCTCAAATAT 0 2491 465285 21657 21676 AACTACAGAATGCTCAAATA 2 2492 465286 21658 21677 CAACTACAGAATGCTCAAAT 12 2493 465287 21659 21678 GCAACTACAGAATGCTCAAA 26 2494 465288 21660 21679 AGCAACTACAGAATGCTCAA 39 2495 465289 21661 21680 CAGCAACTACAGAATGCTCA 53 2496 465290 21662 21681 CCAGCAACTACAGAATGCTC 26 2497 465291 21663 21682 CCCAGCAACTACAGAATGCT 42 2498 465292 21664 21683 CCCCAGCAACTACAGAATGC 40 2499 465293 21665 21684 TCCCCAGCAACTACAGAATG 13 2500 465294 21666 21685 TTCCCCAGCAACTACAGAAT 30 2501 465295 21667 21686 TTTCCCCAGCAACTACAGAA 16 2502 465296 21668 21687 ATTTCCCCAGCAACTACAGA 5 2503 465297 21669 21688 TATTTCCCCAGCAACTACAG 7 2504 465298 21670 21689 CTATTTCCCCAGCAACTACA 20 2505 465299 21671 21690 GCTATTTCCCCAGCAACTAC 7 2506 465300 21672 21691 TGCTATTTCCCCAGCAACTA 25 2507 465301 21673 21692 CTGCTATTTCCCCAGCAACT 31 2508 465302 21674 21693 ACTGCTATTTCCCCAGCAAC 14 2509 455594* 21675 21694 CACTGCTATTTCCCCAGCAA 43 1893 465303 21676 21695 TCACTGCTATTTCCCCAGCA 23 2510 465304 21677 21696 TTCACTGCTATTTCCCCAGC 45 2511 465305 21678 21697 GTTCACTGCTATTTCCCCAG 11 2512 465306 21679 21698 AGTTCACTGCTATTTCCCCA 62 2513 465307 21680 21699 CAGTTCACTGCTATTTCCCC 52 2514 465308 21681 21700 TCAGTTCACTGCTATTTCCC 40 2515 465309 21682 21701 TTCAGTTCACTGCTATTTCC 29 2516 465310 21683 21702 CTTCAGTTCACTGCTATTTC 40 2517 465311 21684 21703 TCTTCAGTTCACTGCTATTT 25 2518 465312 21685 21704 TTCTTCAGTTCACTGCTATT 18 2519 BIOL0142WO 465313 21686 21705 ATTCTTCAGTTCACTGCTAT 7 2520 465314 21687 21706 CATTCTTCAGTTCACTGCTA 33 2521 465315 21688 21707 ACATTCTTCAGTTCACTGCT 39 2522 465316 21689 21708 GACATTCTTCAGTTCACTGC 49 2523 465317 21690 21709 AGACATTCTTCAGTTCACTG 50 2524 465318 21691 21710 AAGACATTCTTCAGTTCACT 37 2525 465319 21692 21711 AAAGACATTCTTCAGTTCAC 26 2526 465320 21693 21712 CAAAGACATTCTTCAGTTCA 13 2527 465321 21694 21713 ACAAAGACATTCTTCAGTTC 0 2528 465322 21695 21714 AACAAAGACATTCTTCAGTT 11 2529 465323 21696 21715 GAACAAAGACATTCTTCAGT 10 2530 465324 21697 21716 AGAACAAAGACATTCTTCAG 14 2531 465325 21698 21717 AAGAACAAAGACATTCTTCA 7 2532 465326 21699 21718 TAAGAACAAAGACATTCTTC 13 2533 465327 21700 21719 ATAAGAACAAAGACATTCTT 1 2534 465328 21701 21720 CATAAGAACAAAGACATTCT 16 2535 465329 21702 21721 CCATAAGAACAAAGACATTC 38 2536 465330 21703 21722 CCCATAAGAACAAAGACATT 11 2537 465331 21704 21723 CCCCATAAGAACAAAGACAT 0 2538 465332 21705 21724 GCCCCATAAGAACAAAGACA 30 2539 465333 21706 21725 AGCCCCATAAGAACAAAGAC 22 2540 465334 21707 21726 AAGCCCCATAAGAACAAAGA 21 2541 465613 26034 26053 TCTCCAGCCTACAGATGACT 32 2542 465614 26035 26054 CTCTCCAGCCTACAGATGAC 31 2543 465615 26036 26055 TCTCTCCAGCCTACAGATGA 29 2544 465616 26037 26056 CTCTCTCCAGCCTACAGATG 22 2545 465617 26038 26057 CCTCTCTCCAGCCTACAGAT 44 2546 465618 26039 26058 TCCTCTCTCCAGCCTACAGA 41 2547 465619 26040 26059 TTCCTCTCTCCAGCCTACAG 32 2548 465620 26041 26060 GTTCCTCTCTCCAGCCTACA 0 2549 465621 26042 26061 AGTTCCTCTCTCCAGCCTAC 44 2550 465622 26043 26062 CAGTTCCTCTCTCCAGCCTA 39 2551 465623 26044 26063 CCAGTTCCTCTCTCCAGCCT 47 2552 465624 26045 26064 TCCAGTTCCTCTCTCCAGCC 49 2553 465625 26046 26065 TTCCAGTTCCTCTCTCCAGC 46 2554 465626 26047 26066 CTTCCAGTTCCTCTCTCCAG 47 2555 465627 26048 26067 CCTTCCAGTTCCTCTCTCCA 28 2556 465628 26049 26068 CCCTTCCAGTTCCTCTCTCC 28 2557 465629 26050 26069 CCCCTTCCAGTTCCTCTCTC 21 2558 465630 26051 26070 GCCCCTTCCAGTTCCTCTCT 65 2559 465631 26052 26071 AGCCCCTTCCAGTTCCTCTC 60 2560 465632 26053 26072 TAGCCCCTTCCAGTTCCTCT 56 2561 465633 26054 26073 TTAGCCCCTTCCAGTTCCTC 52 2562 465634 26055 26074 TTTAGCCCCTTCCAGTTCCT 53 2563 465635 26056 26075 CTTTAGCCCCTTCCAGTTCC 39 2564 BIOL0142WO 465636 26057 26076 ACTTTAGCCCCTTCCAGTTC 31 2565 465637 26058 26077 AACTTTAGCCCCTTCCAGTT 46 2566 465638 26059 26078 CAACTTTAGCCCCTTCCAGT 37 2567 465639 26060 26079 CCAACTTTAGCCCCTTCCAG 48 2568 455611* 26061 26080 GCCAACTTTAGCCCCTTCCA 62 1870 465640 26062 26081 AGCCAACTTTAGCCCCTTCC 71 2569 465641 26063 26082 CAGCCAACTTTAGCCCCTTC 70 2570 465642 26064 26083 TCAGCCAACTTTAGCCCCTT 66 2571 465643 26065 26084 CTCAGCCAACTTTAGCCCCT 35 2572 465644 26066 26085 ACTCAGCCAACTTTAGCCCC 49 2573 465645 26067 26086 TACTCAGCCAACTTTAGCCC 33 2574 465646 26068 26087 CTACTCAGCCAACTTTAGCC 28 2575 465647 26069 26088 ACTACTCAGCCAACTTTAGC 12 2576 465648 26070 26089 AACTACTCAGCCAACTTTAG 34 2577 465649 26071 26090 TAACTACTCAGCCAACTTTA 26 2578 455637* 37873 37892 GTACTTTACATGTGCAGCAC 78 1931 465650 37874 37893 TGTACTTTACATGTGCAGCA 71 2579 465651 37875 37894 GTGTACTTTACATGTGCAGC 75 2580 465652 37876 37895 TGTGTACTTTACATGTGCAG 65 2581 465653 37877 37896 CTGTGTACTTTACATGTGCA 65 2582 465654 37878 37897 CCTGTGTACTTTACATGTGC 60 2583 465655 37879 37898 TCCTGTGTACTTTACATGTG 51 2584 465656 37880 37899 CTCCTGTGTACTTTACATGT 48 2585 465657 37881 37900 TCTCCTGTGTACTTTACATG 25 2586 465658 37882 37901 ATCTCCTGTGTACTTTACAT 33 2587 465659 37883 37902 AATCTCCTGTGTACTTTACA 23 2588 465660 37884 37903 AAATCTCCTGTGTACTTTAC 24 2589 465661 37885 37904 TAAATCTCCTGTGTACTTTA 26 2590 465666 37886 37905 CTAAATCTCCTGTGTACTTT 16 2591 465667 37887 37906 TCTAAATCTCCTGTGTACTT 27 2592 465668 37888 37907 TTCTAAATCTCCTGTGTACT 30 2593 465669 37889 37908 TTTCTAAATCTCCTGTGTAC 30 2594 465670 37890 37909 TTTTCTAAATCTCCTGTGTA 11 2595 465671 37891 37910 GTTTTCTAAATCTCCTGTGT 37 2596 465672 37892 37911 AGTTTTCTAAATCTCCTGTG 49 2597 465686 37893 37912 AAGTTTTCTAAATCTCCTGT 19 2598 465687 37894 37913 GAAGTTTTCTAAATCTCCTG 46 2599 465688 37895 37914 CGAAGTTTTCTAAATCTCCT 53 2600 465689 37896 37915 ACGAAGTTTTCTAAATCTCC 45 2601 465690 37897 37916 TACGAAGTTTTCTAAATCTC 9 2602 465706 37898 37917 CTACGAAGTTTTCTAAATCT 14 2603 465707 37899 37918 GCTACGAAGTTTTCTAAATC 32 2604 455677* 45512 45531 TTCCAATATTTGTACCCTCA 49 1971 465574 45513 45532 TTTCCAATATTTGTACCCTC 43 2605 465575 45514 45533 CTTTCCAATATTTGTACCCT 50 2606 BIOL0142WO 465576 45515 45534 GCTTTCCAATATTTGTACCC 58 2607 465577 45516 45535 TGCTTTCCAATATTTGTACC 35 2608 465578 45517 45536 TTGCTTTCCAATATTTGTAC 31 2609 465579 45518 45537 CTTGCTTTCCAATATTTGTA 29 2610 465580 45519 45538 CCTTGCTTTCCAATATTTGT 35 2611 465581 45520 45539 CCCTTGCTTTCCAATATTTG 26 2612 465582 45521 45540 TCCCTTGCTTTCCAATATTT 34 2613 465583 45522 45541 GTCCCTTGCTTTCCAATATT 39 2614 465584 45523 45542 TGTCCCTTGCTTTCCAATAT 44 2615 465585 45524 45543 CTGTCCCTTGCTTTCCAATA 60 2616 465586 45525 45544 TCTGTCCCTTGCTTTCCAAT 59 2617 465587 45526 45545 TTCTGTCCCTTGCTTTCCAA 47 2618 455681* 46091 46110 TTTCCAGATATTTTCCCATA 48 1975 465335 46092 46111 GTTTCCAGATATTTTCCCAT 71 2619 465336 46093 46112 TGTTTCCAGATATTTTCCCA 53 2620 466676 48396 48415 CTTTCCATTCTAGTTTTACC 1 2621 466677 48397 48416 ACTTTCCATTCTAGTTTTAC 19 2622 466678 48398 48417 CACTTTCCATTCTAGTTTTA 23 2623 466679 48399 48418 ACACTTTCCATTCTAGTTTT 9 2624 466680 48400 48419 CACACTTTCCATTCTAGTTT 31 2625 466681 48401 48420 CCACACTTTCCATTCTAGTT 64 2626 455703* 48402 48421 GCCACACTTTCCATTCTAGT 75 1997 466682 48403 48422 AGCCACACTTTCCATTCTAG 56 2627 466683 48404 48423 AAGCCACACTTTCCATTCTA 40 2628 466684 48405 48424 CAAGCCACACTTTCCATTCT 24 2629 466685 48406 48425 TCAAGCCACACTTTCCATTC 39 2630 466686 48407 48426 CTCAAGCCACACTTTCCATT 38 2631 466687 48408 48427 GCTCAAGCCACACTTTCCAT 53 2632 466688 48409 48428 AGCTCAAGCCACACTTTCCA 59 2633 466689 48410 48429 CAGCTCAAGCCACACTTTCC 51 2634 466690 48411 48430 CCAGCTCAAGCCACACTTTC 43 2635 466691 48412 48431 ACCAGCTCAAGCCACACTTT 30 2636 466692 48413 48432 TACCAGCTCAAGCCACACTT 35 2637 466693 48414 48433 TTACCAGCTCAAGCCACACT 32 2638 466694 48415 48434 GTTACCAGCTCAAGCCACAC 53 2639 466695 48416 48435 GGTTACCAGCTCAAGCCACA 54 2640 455704* 48417 48436 TGGTTACCAGCTCAAGCCAC 61 1998 455708* 48728 48747 CCCACAGTGACAGTGACTCA 58 2002 465708 48729 48748 TCCCACAGTGACAGTGACTC 61 2641 465709 48730 48749 TTCCCACAGTGACAGTGACT 60 2642 465710 48731 48750 CTTCCCACAGTGACAGTGAC 55 2643 455723* 52033 52052 ACCAGTTTTCTAGCCGATCT 24 2017 466696 52034 52053 TACCAGTTTTCTAGCCGATC 54 2644 466697 52035 52054 TTACCAGTTTTCTAGCCGAT 41 2645 466698 52036 52055 TTTACCAGTTTTCTAGCCGA 37 2646 BIOL0142WO 466699 52037 52056 CTTTACCAGTTTTCTAGCCG 17 2647 466700 52038 52057 CCTTTACCAGTTTTCTAGCC 11 2648 466701 52039 52058 TCCTTTACCAGTTTTCTAGC 24 2649 466702 52040 52059 ATCCTTTACCAGTTTTCTAG 1 2650 466703 52041 52060 CATCCTTTACCAGTTTTCTA 7 2651 466704 52042 52061 TCATCCTTTACCAGTTTTCT 0 2652 466705 52043 52062 TTCATCCTTTACCAGTTTTC 15 2653 466706 52044 52063 TTTCATCCTTTACCAGTTTT 0 2654 466707 52045 52064 CTTTCATCCTTTACCAGTTT 9 2655 466708 52046 52065 TCTTTCATCCTTTACCAGTT 0 2656 466709 52047 52066 TTCTTTCATCCTTTACCAGT 8 2657 466710 52048 52067 CTTCTTTCATCCTTTACCAG 11 2658 466711 52049 52068 GCTTCTTTCATCCTTTACCA 8 2659 466712 52050 52069 AGCTTCTTTCATCCTTTACC 6 2660 466713 52051 52070 AAGCTTCTTTCATCCTTTAC 0 2661 466714 52052 52071 AAAGCTTCTTTCATCCTTTA 18 2662 466715 52053 52072 AAAAGCTTCTTTCATCCTTT 2 2663 466716 52054 52073 GAAAAGCTTCTTTCATCCTT 9 2664 466717 52055 52074 GGAAAAGCTTCTTTCATCCT 1 2665 455724* 52056 52075 AGGAAAAGCTTCTTTCATCC 0 2018 455762* 59913 59932 CCAAGTGTTTGAATTCTGCA 36 2056 466766 59914 59933 ACCAAGTGTTTGAATTCTGC 58 2666 466767 59915 59934 TACCAAGTGTTTGAATTCTG 32 2667 466768 59916 59935 ATACCAAGTGTTTGAATTCT 21 2668 466769 59917 59936 CATACCAAGTGTTTGAATTC 9 2669 466770 59918 59937 ACATACCAAGTGTTTGAATT 14 2670 466771 59919 59938 CACATACCAAGTGTTTGAAT 26 2671 466772 59920 59939 CCACATACCAAGTGTTTGAA 8 2672 466773 59921 59940 CCCACATACCAAGTGTTTGA 19 2673 466774 59922 59941 TCCCACATACCAAGTGTTTG 5 2674 466775 59923 59942 CTCCCACATACCAAGTGTTT 25 2675 466776 59924 59943 CCTCCCACATACCAAGTGTT 32 2676 466777 59925 59944 TCCTCCCACATACCAAGTGT 12 2677 466778 59926 59945 CTCCTCCCACATACCAAGTG 10 2678 466779 59927 59946 GCTCCTCCCACATACCAAGT 15 2679 466780 59928 59947 AGCTCCTCCCACATACCAAG 5 2680 466781 59929 59948 GAGCTCCTCCCACATACCAA 23 2681 465768 61325 61344 CAGTCTAGAATAGCCATGGA 71 2682 465769 61326 61345 ACAGTCTAGAATAGCCATGG 72 2683 465770 61327 61346 GACAGTCTAGAATAGCCATG 78 2684 465771 61328 61347 AGACAGTCTAGAATAGCCAT 74 2685 465772 61329 61348 GAGACAGTCTAGAATAGCCA 70 2686 465773 61330 61349 AGAGACAGTCTAGAATAGCC 70 2687 465774 61331 61350 CAGAGACAGTCTAGAATAGC 63 2688 465775 61332 61351 ACAGAGACAGTCTAGAATAG 55 2689 BIOL0142WO 465776 61333 61352 CACAGAGACAGTCTAGAATA 64 2690 465777 61334 61353 TCACAGAGACAGTCTAGAAT 71 2691 465778 61335 61354 ATCACAGAGACAGTCTAGAA 79 2692 465779 61336 61355 TATCACAGAGACAGTCTAGA 66 2693 465780 61337 61356 ATATCACAGAGACAGTCTAG 64 2694 465781 61338 61357 AATATCACAGAGACAGTCTA 48 2695 465782 61339 61358 AAATATCACAGAGACAGTCT 65 2696 455786* 61340 61359 CAAATATCACAGAGACAGTC 63 2070 465783 61341 61360 GCAAATATCACAGAGACAGT 69 2697 465786 61342 61361 TGCAAATATCACAGAGACAG 78 2698 465787 61343 61362 ATGCAAATATCACAGAGACA 72 2699 465788 61344 61363 AATGCAAATATCACAGAGAC 59 2700 465789 61345 61364 AAATGCAAATATCACAGAGA 23 2701 465790 61346 61365 AAAATGCAAATATCACAGAG 28 2702 465791 61347 61366 TAAAATGCAAATATCACAGA 0 2703 465792 61348 61367 TTAAAATGCAAATATCACAG 12 2704 465793 61349 61368 TTTAAAATGCAAATATCACA 3 2705 465794 61350 61369 GTTTAAAATGCAAATATCAC 2 2706 465795 61351 61370 AGTTTAAAATGCAAATATCA 0 2707 465796 61352 61371 CAGTTTAAAATGCAAATATC 13 2708 465797 61353 61372 TCAGTTTAAAATGCAAATAT 0 2709 465798 61354 61373 TTCAGTTTAAAATGCAAATA 0 2710 465799 61355 61374 ATTCAGTTTAAAATGCAAAT 1 2711 465800 61356 61375 TATTCAGTTTAAAATGCAAA 0 2712 465801 61357 61376 ATATTCAGTTTAAAATGCAA 0 2713 455790* 62043 62062 CATGGTTATGTGTATCTGCA 69 2074 465337 62044 62063 ACATGGTTATGTGTATCTGC 69 2714 465338 62045 62064 CACATGGTTATGTGTATCTG 40 2715 465339 62046 62065 CCACATGGTTATGTGTATCT 32 2716 337332 66135 66154 GAAGCCCTTGCCAGCCATGT 79 1541 455840* 71610 71629 GTACAATTGCTTCAACTAGA 81 2124 466782 71611 71630 AGTACAATTGCTTCAACTAG 54 2717 466783 71612 71631 CAGTACAATTGCTTCAACTA 68 2718 466784 71613 71632 GCAGTACAATTGCTTCAACT 72 2719 465588 71614 71633 GGCAGTACAATTGCTTCAAC 69 2720 455264* 74768 74787 TCCTTAAACCTTCCTATTTC 26 1563 465226 74769 74788 CTCCTTAAACCTTCCTATTT 45 2721 455265* 74770 74789 TCTCCTTAAACCTTCCTATT 57 1564 465227 74771 74790 TTCTCCTTAAACCTTCCTAT 54 2722 455266* 74772 74791 ATTCTCCTTAAACCTTCCTA 52 1565 465228 74773 74792 GATTCTCCTTAAACCTTCCT 64 2723 455267* 74774 74793 AGATTCTCCTTAAACCTTCC 60 1566 465229 74775 74794 TAGATTCTCCTTAAACCTTC 22 2724 455268* 74776 74795 TTAGATTCTCCTTAAACCTT 55 1567 465230 74777 74796 CTTAGATTCTCCTTAAACCT 69 2725 BIOL0142WO 455269* 74778 74797 GCTTAGATTCTCCTTAAACC 84 1568 465231 74779 74798 TGCTTAGATTCTCCTTAAAC 64 2726 455270* 74780 74799 ATGCTTAGATTCTCCTTAAA 50 1569 465232 74781 74800 AATGCTTAGATTCTCCTTAA 71 2727 455271* 74782 74801 AAATGCTTAGATTCTCCTTA 69 1570 465233 74783 74802 AAAATGCTTAGATTCTCCTT 69 2728 455272* 74784 74803 TAAAATGCTTAGATTCTCCT 56 1571 455281* 74872 74891 CAAGGTTGTAAGCACCCTCT 63 1580 465234 74873 74892 TCAAGGTTGTAAGCACCCTC 54 2729 455282* 74874 74893 GTCAAGGTTGTAAGCACCCT 8 1581 465235 74875 74894 AGTCAAGGTTGTAAGCACCC 65 2730 455283* 74876 74895 GAGTCAAGGTTGTAAGCACC 48 1582 455290* 74900 74919 GCAGATCAAGTCCAGGGAGA 77 1589 465236 74901 74920 AGCAGATCAAGTCCAGGGAG 80 2731 455291* 74902 74921 CAGCAGATCAAGTCCAGGGA 82 1590 465237 74903 74922 ACAGCAGATCAAGTCCAGGG 82 2732 455292* 74904 74923 AACAGCAGATCAAGTCCAGG 69 1591 455369* 75418 75437 GGTGTTCCCATACGCACAGG 75 1668 465238 75419 75438 AGGTGTTCCCATACGCACAG 68 2733 455370* 75420 75439 TAGGTGTTCCCATACGCACA 67 1669 465239 75421 75440 CTAGGTGTTCCCATACGCAC 82 2734 455371* 75422 75441 GCTAGGTGTTCCCATACGCA 85 1670 465240 75423 75442 TGCTAGGTGTTCCCATACGC 77 2735 455372* 75424 75443 GTGCTAGGTGTTCCCATACG 72 1671 455390* 75616 75635 AACTGTCTCCAGGCAGGAGG 65 1689 465241 75617 75636 CAACTGTCTCCAGGCAGGAG 51 2736 455391* 75618 75637 TCAACTGTCTCCAGGCAGGA 52 1690 465242 75619 75638 ATCAACTGTCTCCAGGCAGG 76 2737 455392* 75620 75639 CATCAACTGTCTCCAGGCAG 63 1691 465243 75621 75640 ACATCAACTGTCTCCAGGCA 70 2738 455393* 75622 75641 CACATCAACTGTCTCCAGGC 75 1692 465244 75623 75642 ACACATCAACTGTCTCCAGG 61 2739 455394* 75624 75643 GACACATCAACTGTCTCCAG 69 1693 455397* 75662 75681 TACTGAAGAGTGTTGCTGGA 77 1696 465245 75663 75682 GTACTGAAGAGTGTTGCTGG 84 2740 455398* 75664 75683 TGTACTGAAGAGTGTTGCTG 76 1697 465246 75665 75684 ATGTACTGAAGAGTGTTGCT 72 2741 455399* 75666 75685 TATGTACTGAAGAGTGTTGC 70 1698 455411* 75726 75745 AACCCAATGGTAAGCCCAAG 77 1710 465247 75727 75746 AAACCCAATGGTAAGCCCAA 61 2742 455412* 75728 75747 TAAACCCAATGGTAAGCCCA 72 1711 465248 75729 75748 TTAAACCCAATGGTAAGCCC 69 2743 455413* 75730 75749 TTTAAACCCAATGGTAAGCC 38 1712 455428* 75829 75848 TACAATCAGAGTTAAGACCA 58 1727 465249 75830 75849 CTACAATCAGAGTTAAGACC 58 2744 BIOL0142WO 455429* 75831 75850 GCTACAATCAGAGTTAAGAC 71 1728 465250 75832 75851 TGCTACAATCAGAGTTAAGA 59 2745 455430* 75833 75852 TTGCTACAATCAGAGTTAAG 47 1729 455437* 75847 75866 TCCTCTCAGAACTTTTGCTA 36 1736 465251 75848 75867 CTCCTCTCAGAACTTTTGCT 47 2746 455438* 75849 75868 GCTCCTCTCAGAACTTTTGC 75 1737 465252 75850 75869 AGCTCCTCTCAGAACTTTTG 71 2747 455439* 75851 75870 CAGCTCCTCTCAGAACTTTT 68 1738 465253 75852 75871 TCAGCTCCTCTCAGAACTTT 62 2748 455440* 75853 75872 CTCAGCTCCTCTCAGAACTT 58 1739 455446* 75965 75984 GTAGGTAAGCAACCCACGGG 69 1745 465254 75966 75985 GGTAGGTAAGCAACCCACGG 79 2749 455447* 75967 75986 AGGTAGGTAAGCAACCCACG 80 1476 465255 75968 75987 TAGGTAGGTAAGCAACCCAC 84 2750 455448* 75969 75988 ATAGGTAGGTAAGCAACCCA 71 1474 455456* 75985 76004 GCTTATAAACCACCTTATAG 37 1755 465256 75986 76005 AGCTTATAAACCACCTTATA 43 2751 455457* 75987 76006 CAGCTTATAAACCACCTTAT 57 1756 465257 75988 76007 GCAGCTTATAAACCACCTTA 73 2752 455458* 75989 76008 AGCAGCTTATAAACCACCTT 75 1757 465258 75990 76009 CAGCAGCTTATAAACCACCT 65 2753 455459* 75991 76010 ACAGCAGCTTATAAACCACC 46 1758 455462* 75997 76016 GCCAGGACAGCAGCTTATAA 70 1761 466718 75998 76017 GGCCAGGACAGCAGCTTATA 87 2754 455463* 75999 76018 TGGCCAGGACAGCAGCTTAT 83 1762 466719 76000 76019 GTGGCCAGGACAGCAGCTTA 76 2755 455464* 76001 76020 AGTGGCCAGGACAGCAGCTT 82 1763 455470* 76013 76032 GAATTTGAATGCAGTGGCCA 75 1769 466720 76014 76033 GGAATTTGAATGCAGTGGCC 87 2756 455471* 76015 76034 TGGAATTTGAATGCAGTGGC 75 1770 466721 76016 76035 TTGGAATTTGAATGCAGTGG 72 2757 455472* 76017 76036 ATTGGAATTTGAATGCAGTG 60 1771 Example 35: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from the study described in Example 3 exhibiting significant in vitro inhibition of STAT3 were tested at various doses in HuVEC cells. Cells were plated at a density of 5,000 cells per well and transfected using LipofectAMINE2000® reagent with 8.8 nM, 17.5 nM, 35.0 nM, and 70.0 nM concentrations of antisense oligonucleotide, as specified in Table 56. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as BIOL0142WO measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

As illustrated in Table 56, STAT3 mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 56 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells using LipofectAMINE 2000® reagent ISIS No 8.8 nM 17.5 nM 35.0 nM 70.0 nM 337332 50 71 81 88 455269 62 69 79 82 455291 72 81 87 88 455371 71 83 88 90 455447 53 70 81 79 455463 68 79 84 87 455464 69 78 84 86 455471 62 82 88 90 455547 43 64 75 87 455565 41 73 83 92 455582 50 67 81 87 455637 50 65 79 85 455703 45 65 81 85 455840 58 70 80 85 465236 62 76 81 85 465237 67 81 86 90 465239 64 77 85 92 465240 50 66 76 83 465245 70 81 87 87 465254 54 75 81 86 465255 63 74 84 85 465335 46 62 74 80 465449 49 71 84 84 465458 54 73 84 88 465509 66 80 86 83 465510 48 66 76 82 465511 56 68 75 79 465526 53 68 76 76 465537 41 60 77 85 465588 52 73 76 79 465610 35 57 71 79 465730 51 75 85 87 465739 72 81 88 90 465740 70 81 86 89 465742 63 76 87 88 465748 48 62 67 74 BIOL0142WO 465751 70 81 87 87 465752 76 82 88 89 465754 70 83 86 87 465755 70 81 85 89 465770 52 69 77 77 465771 40 55 64 75 465778 40 69 75 77 465786 56 71 76 83 465830 66 77 83 82 465833 50 67 79 86 465834 42 67 77 81 465886 58 73 83 87 465888 49 68 82 12 465926 43 64 76 82 466661 47 63 80 84 466666 39 66 80 86 466670 73 83 89 90 466718 73 78 84 85 466719 63 73 83 83 466720 80 87 86 86 Example 36: Dose-dependent antisense inhibition of human STAT3 in HuVEC cells Gapmers from the study described in Example 3 were further tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 187.5 nM, 375.0 nM, 750.0 nM, 1,500.0 nM, 3,000.0 nM, and 6,000.0 nM concentrations of antisense oligonucleotide, as specified in Table 57. After a treatment period of approximately 16 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

As illustrated in Table 57, STAT3 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 57 Dose-dependent antisense inhibition of human STAT3 in HuVEC cells using electroporation 187.5 375.0 750.0 1500.0 3000.0 6000.0 ISIS No nM nM nM nM nM nM (μM) 337332 35 51 73 84 97 98 0.3 455269 64 76 87 89 92 90 <0.2 455291 63 79 88 90 90 93 <0.2 455371 50 81 90 94 96 95 <0.2 455447 37 49 61 91 94 96 0.3 BIOL0142WO 455463 57 78 89 93 95 94 <0.2 455464 57 67 78 80 79 87 <0.2 455471 50 73 81 86 91 92 <0.2 455547 19 49 63 82 92 94 0.5 455582 42 62 82 92 97 97 0.2 455637 44 60 63 87 91 92 0.2 455840 39 58 75 81 88 89 0.2 465236 56 67 71 83 91 92 <0.2 465237 56 75 87 92 94 93 <0.2 465239 60 78 88 95 99 99 <0.2 465240 49 67 80 85 94 95 0.1 465245 54 67 81 86 90 90 <0.2 465254 28 50 63 76 91 92 0.4 465255 46 55 78 89 92 94 0.2 465335 25 52 65 89 95 95 0.4 465449 28 56 78 72 96 96 0.3 465458 19 68 84 91 96 97 0.3 465509 42 68 77 84 88 88 0.1 465510 15 43 60 73 85 88 0.6 465511 19 39 47 68 79 86 0.8 465526 15 39 54 64 82 84 0.8 465537 44 65 82 90 95 90 0.1 465565 12 45 62 80 93 97 0.6 465588 44 66 82 85 85 87 0.1 465610 33 56 72 89 96 97 0.3 465730 48 51 72 91 94 91 0.2 465739 42 78 85 93 96 92 0.9 465740 54 69 80 96 98 98 <0.2 465742 67 55 91 93 87 93 <0.2 465748 49 67 88 96 98 99 0.1 465751 56 63 82 91 98 98 0.1 465752 62 79 84 93 96 90 <0.2 465754 41 69 84 63 94 93 <0.2 465755 47 56 67 83 93 97 0.2 465770 52 54 70 85 88 83 0.2 465771 38 62 76 83 84 86 0.2 465778 40 58 79 84 96 96 0.2 465786 41 68 88 94 95 93 0.1 465830 50 73 89 93 88 92 <0.2 465833 27 44 76 89 88 97 0.4 465834 8 27 57 80 93 97 0.7 465886 58 79 90 97 98 96 <0.2 465888 39 60 65 90 94 97 0.3 465926 23 50 41 85 93 94 0.5 466661 31 58 76 90 95 96 0.3 BIOL0142WO 466666 44 55 79 92 96 97 0.2 466670 50 54 82 96 96 96 0.2 466718 55 79 90 93 95 96 <0.2 466719 44 52 73 65 87 91 0.3 466720 48 78 90 90 90 90 <0.2 Example 37: Tolerability of antisense oligonucleotides targeting human STAT3 in CD1 mice Thirty-nine antisense oligonucleotides exhibiting a high level of potency were further tested for in vivo tolerability.

Groups of eight male CD1 mice were injected subcutaneously twice a week for 6 weeks with 50 mg/kg of ISIS antisense oligonucleotides. One group of eight male CD1 mice was injected subcutaneously twice a week for 6 weeks with PBS. This group served as the control group. Three days after the last dose mice were euthanized and organs and plasma were harvested for further analysis.

Liver, spleen, and kidney weights were measured at the end of the study and were compared to PBS treated mice.

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured.

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY).

Blood obtained from all mice groups were sent to Antech Diagnostics for hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) measurements and analyses, as well as measurements of the differential blood cell counts, such as that of WBC, RBC, and total hemoglobin content.

Among the 39 antisense oligonucleotides tested, certain antisense oligonucleotides, including ISIS 455265, ISIS 455269, ISIS 455271, ISIS 455272, ISIS 455291, ISIS 455371, ISIS 455394, ISIS 455703, ISIS 455429, ISIS 455471, ISIS 455527, ISIS 455530, ISIS 455536, ISIS 455548, ISIS 455611, ISIS 465236, ISIS 465237, ISIS 465588, ISIS 465740, ISIS 465754, ISIS 465830, ISIS 466670, and ISIS 466720 met tolerability thresholds for organ weight, ALT, AST, BUN, and hematological parameters.

Example 38: Measurement of half-life of antisense oligonucleotide in CD1 mouse liver CD1 mice were treated with ISIS antisense oligonucleotides described and the oligonucleotide half-life in the liver was evaluated.

Treatment BIOL0142WO Groups of twelve CD1 mice each were injected subcutaneously twice per week for 2 weeks with 50 mg/kg of ISIS 455265, ISIS 455269, ISIS 455271, ISIS 455272, ISIS 455291, ISIS 455371, ISIS 455393, ISIS 455553, ISIS 455582, ISIS 455703, ISIS 455394, ISIS 455429, ISIS 455438, ISIS 455471, ISIS 455527, ISIS 455530, ISIS 455536, ISIS 455540, ISIS 455548, ISIS 455611, ISIS 455429, ISIS 455463, ISIS 455464, ISIS 455471, ISIS 455527, ISIS 455611, ISIS 465236, ISIS 465237, ISIS 465239, ISIS 465588, ISIS 465740, ISIS 465742, ISIS 465751, ISIS 465752, ISIS 465754, ISIS 465830, ISIS 466670, ISIS 466718, and ISIS 466720. Four mice from each group were sacrificed 3 days, 28 days, and 56 days following the final dose. Livers were harvested for analysis.

Measurement of oligonucleotide concentration The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999), which includes a phenol- chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2’-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 2758) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 µg/g. Half-lives were then calculated using WinNonlin software (PHARSIGHT).

The half-life of each oligonucleotide is presented in Table 58. Antisense oligonucleotides with half-lives within 11-34 days were chosen for further studies.

Table 58 Half-life of ISIS oligonucleotides in the liver of CD1 mice ISIS No Half-life (days) 455265 12 455269 48 455271 16 455272 16 455291 19 455371 28 455394 17 455703 27 455429 15 455471 15 455527 13 455530 12 455536 20 BIOL0142WO 455548 13 455611 37 465236 22 465237 17 465588 14 465740 15 465754 23 465830 23 466670 11 466720 17 Example 39: Tolerability of antisense oligonucleotides targeting human STAT3 in Sprague-Dawley rats Twenty-three antisense oligonucleotides exhibiting a high level of potency were further tested for in vivo tolerability.

Groups of four Sprague-Dawley rats were injected subcutaneously twice a week for 6 weeks with 50 mg/kg of ISIS antisense oligonucleotides. One group of rats was injected subcutaneously twice a week for 6 weeks with PBS. This group served as the control group. Three days after the last dose rats were euthanized and organs and plasma were harvested for further analysis. Liver, spleen, and kidney weights were measured at the end of the study and were compared to PBS treated rats To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of AST (aspartate transaminase) and total bilirubin were measured.

To evaluate the effect of ISIS oligonucleotides on kidney function, BUN, total urine protein, and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY).

Among the 23 antisense oligonucleotides tested, certain antisense oligonucleotides, including ISIS 455269, ISIS 455291, ISIS 455371, ISIS 455703, ISIS 455429, ISIS 465236, ISIS 465237, ISIS 465754, ISIS 465830, and ISIS 466670 met tolerability thresholds for organ weight, AST, bilirubin, BUN, total urine protein, and creatinine.

Example 40: Measurement of half-life of antisense oligonucleotide in Sprague-Dawley rat liver and kidney Sprague Dawley rats were treated with ISIS antisense oligonucleotides and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver and kidney was evaluated.

BIOL0142WO Treatment Groups of four Sprague Dawley rats each were injected subcutaneously twice a week for 2 weeks with 20 mg/kg of ISIS 455265, ISIS 455269, ISIS 455271, ISIS 455272, ISIS 455291, ISIS 455371, ISIS 455394, ISIS 455703, ISIS 455429, ISIS 455471, ISIS 455527, ISIS 455530, ISIS 455536, ISIS 455548, ISIS 455611, ISIS 465236, ISIS 465237, ISIS 465588, ISIS 465740, ISIS 465754, ISIS 465830, ISIS 466670, and ISIS 466720. Three days after the last dose, the rats were sacrificed and livers and kidneys were collected for analysis.

Measurement of oligonucleotide concentration The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999), which includes a phenol- chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2’-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 2758) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 µg/g. The kidney to liver ratio of the full-length oligonucleotide concentration, as well as that for the total oligonucleotide concentration were calculated.

The results are presented in Table 59.

Table 59 Kidney to liver ratio of full-length and total oligonucleotide concentrations in Sprague-Dawley rats Full ISIS No Total length 455265 3.6 3.8 455269 2.1 2.4 455271 3.1 3.0 455272 2.9 3.1 455291 2.7 3.3 455371 2.2 2.4 455394 1.8 2.2 455703 2.3 2.8 455429 3.8 3.9 455471 2.7 2.9 455527 5.0 3.9 455530 3.9 2.9 455536 3.5 3.6 455548 2.5 2.9 455611 2.3 2.3 465236 2.3 3.3 465237 2.4 2.7 BIOL0142WO 465588 2.8 2.6 465740 2.4 2.6 465754 1.6 1.8 465830 5.1 2.6 466670 3.1 4.4 466720 2.3 2.6 Example 41: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in SK-BR-3 cells Gapmers from the rodent tolerability studies described in Examples 6-9 were tested at various doses in SK-BR-3 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated without any transfection reagent with 0.02 μM, 0.10 μM, 0.50 μM, 1.00 μΜ. 2.50 μΜ, and 10.00 μM concentrations of antisense oligonucleotide, as specified in Table 60. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR.

Human STAT3 primer probe set RTS199, as described hereinabove, was used to measure mRNA levels.

STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN .

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 60.

Table 60 Dose-dependent antisense inhibition of human STAT3 by free-uptake of ISIS oligonucleotide by SK-BR- 3 cells ISIS No 0.02 μM 0.1 μM 0.5 μM 1 μM 2.5 μM 10 μM IC (μM) 455265 22 14 25 19 30 37 >10.0 455269 17 17 21 45 64 67 1.3 455271 0 0 0 11 16 53 9.0 455272 0 0 0 5 12 51 9.6 455291 9 15 31 45 58 76 1.2 455371 16 20 34 37 54 70 1.7 455394 0 2 14 6 30 55 8.3 455429 0 0 0 12 29 57 7.9 455471 0 16 28 24 42 58 2.9 455527 5 15 14 21 35 45 >10.0 455530 0 14 12 14 28 36 >10.0 455536 0 0 0 1 8 26 >10.0 455548 16 14 17 17 20 44 >10.0 455611 19 1 3 21 35 38 >10.0 455703 0 0 0 0 3 33 >10.0 465236 0 7 15 19 37 60 3.8 465237 2 13 22 29 50 67 2.3 465588 5 3 21 18 42 44 >10.0 BIOL0142WO 465740 1 14 0 19 14 39 >10.0 465754 0 0 4 15 39 55 7.7 465830 6 18 23 17 42 67 3.0 466670 21 19 33 35 58 71 1.6 466720 0 0 11 13 27 53 8.7 Example 42: Measurement of viscosity of ISIS antisense oligonucleotides targeting human STAT3 The viscosity of antisense oligonucleotides selected from the studies described in Examples 6-10 was measured with the aim of screening out antisense oligonucleotides which have a viscosity more than 40 cP. Oligonucleotides having a viscosity greater than 40 cP would be too viscous to be administered to any subject.

ISIS oligonucleotides (32-35 mg) were weighed into a glass vial, 120 μL of water was added and the antisense oligonucleotide was dissolved into solution by heating the vial at 50 C. Part of (75 μL) the pre-heated sample was pipetted to a micro-viscometer (Cambridge). The temperature of the micro- viscometter was set to 25 C and the viscosity of the sample was measured. Another part (20 μL) of the pre-heated sample was pipetted into 10 mL of water for UV reading at 260 nM at 85 C (Cary UV instrument). The results are presented in Table 61 and indicate that all the antisense oligonucleotides solutions are optimal in their viscosity under the criterion stated above.

Table 61 Viscosity of ISIS antisense oligonucleotides targeting human STAT3 ISIS No Viscosity 455269 6.1 455291 13.6 466371 7.2 455703 17.6 455429 9.3 465237 26.2 465754 19.7 465830 8.1 466670 15.9 Example 43: Effect of ISIS antisense oligonucleotides targeting human STAT3 in cynomolgus monkeys Nine antisense oligonucleotides exhibiting a high level of potency were further tested for in cynomolgus monkeys. Antisense oligonucleotide tolerability and pharmacokinetic profile in the liver and kidney was evaluated.

The study was conducted at the Korea Institute of Toxicology, Republic of Korea. Prior to the study, the monkeys were kept in quarantine for a 30-day time period, during which standard panels of BIOL0142WO serum chemistry and hematology, examination of fecal samples for ova and parasites, and a tuberculosis test, were conducted to screen out abnormal or ailing monkeys. Nine groups of four randomly assigned male cynomolgus monkeys each were injected subcutaneously thrice per week for the first week, and subsequently twice a week for the next 7 weeks, with 25 mg/kg of ISIS antisense oligonucleotides. A control group of 4 cynomolgus monkeys was injected with PBS subcutaneously thrice per week for the first week, and subsequently twice a week for the next 7 weeks. Terminal sacrifices of all groups were conducted on day 55, which was 48 hours after the last dose.

During the study period, the monkeys were observed daily for signs of illness or distress. Any animal showing adverse effects to the treatment was removed and referred to the veterinarian and Study Director.

To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, spleen heart, kidney, liver, and gall bladder weights were measured at day 55. Organ weights were measured and treatment group weights were compared to the corresponding PBS control weights To evaluate the effect of ISIS oligonucleotides on hepatic and kidney function, blood samples were collected from all the study groups. The monkeys were fasted overnight prior to blood collection.

Approximately, 1 mL each of blood samples was collected in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Concentrations of transaminases were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma concentrations of ALT (alanine transaminase), AST (aspartate transaminase), and BUN were measured on day 55. C-reactive protein (CRP), which is synthesized in the liver and which serves as a marker of inflammation, was also similarly measured on day 55.

To evaluate the effect of ISIS oligonucleotides on factors involved in inflammation, blood was collected on day 55 from all animals for analyses of complement C3 levels, MIP-1β cytokine levels, and platelet number.

For complement C3 analysis, approximately 0.5 mL each of blood sample was collected in tubes without anticoagulant for serum separation. For cytokine level analyses, approximately 2 mL each of blood sample was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Complement C3 was measured using an automatic analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co., Japan). Serum was utilized for cytokine analysis using a nine-panel Searchlight Multiplex Array.

For platelet count, approximately 0.5 mL each of blood samples was collected in tubes containing potassium salt of EDTA. Samples were analyzed for platelet count using an ADVIA120 hematology analyzer (Bayer, USA).

BIOL0142WO The concentration of oligonucleotide was measured in the liver and kidney on day 55. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999), which includes a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2’-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 2758) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 µg/g.

Among the 9 antisense oligonucleotides tested, certain antisense oligonucleotides, including ISIS 455269, ISIS 455371, ISIS 455429, and ISIS 455670 met tolerability thresholds for organ weight, ALT, AST, BUN, and hematological parameters.

Example 44: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in MDA-MB-231 cells ISIS oligonucleotides from the study described in Example 12 were further tested at different doses in MDA-MB-231 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated without any transfection reagent with 0.02 μM, 0.20 μM, 1.00 μM, 5.00 μΜ, and 10.00 μM concentrations of antisense oligonucleotide, as specified in Table 62. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR.

Results are presented as percent inhibition of STAT3, relative to untreated control cells. The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 62.

Table 62 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by MDA-MB-231 cells 0.02 0.20 1.00 5.00 10.00 IC ISIS No μM μM μM μM μM (μM) 455269 0 3 30 47 59 6.4 455291 1 3 13 41 47 8.3 455371 5 0 10 34 43 >10.0 455429 0 0 22 31 43 >10.0 455703 0 5 13 28 39 >10.0 465237 0 0 22 39 41 >10.0 465754 5 1 22 30 46 >10.0 465830 0 0 17 43 52 7.5 466670 4 7 18 49 56 6.5 Example 45: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in U251-MG cells BIOL0142WO ISIS oligonucleotides from the study described in Example 12 were further tested at different doses in U251-MG cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated without any transfection reagent with 0.1 μM, 1.0 μM, 5.0 μM, 10.0 μΜ, and 20.0 μM concentrations of antisense oligonucleotide, as specified in Table 63. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, as described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells. The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 63.

Table 63 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by U251-MG cells .0 20.0 IC ISIS No 0.1 μM 1.0 μM 5.0 μM μM μM (μM) 455269 3 16 31 47 56 11.9 455291 0 11 29 42 51 14.1 455371 3 0 25 33 39 >20.0 455429 6 0 25 33 39 >20.0 455703 5 2 13 33 36 >20.0 465237 2 0 7 2 6 >20.0 465754 0 0 8 16 4 >20.0 465830 0 0 18 2 10 >20.0 466670 0 0 18 25 37 >20.0 Example 46: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in A431 cells ISIS oligonucleotides from the study described in Example 12 were further tested at different doses in A431 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated without any transfection reagent with 0.02 μM, 0.2 μM, 1.0 μM, 5.0 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 64. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, as described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 64. As illustrated in Table 64, the ISIS oligonucleotides were able to penetrate the cell membrane and significantly reduce STAT3 mRNA levels in a dose-dependent manner.

Table 64 BIOL0142WO Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by A431 cells ISIS No 0.02 μM 0.2 μM 1.0 μM 5.0 μM 10.0 μM IC (μM) 41 64 86 86 89 0.15 455269 61 83 85 86 0.17 455291 65 82 88 92 0.15 455371 73 84 87 88 0.19 455429 12 55 72 82 82 0.13 455703 23 72 82 86 87 0.13 465237 0 67 73 79 83 0.15 465754 0 50 67 71 78 0.21 465830 36 79 88 93 94 0.03 466670 Example 47: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in H460 cells ISIS oligonucleotides from the study described in Example 12 were further tested at different doses in H460 cells. Cells were plated at a density of 4,000 cells per well. Cells were incubated without any transfection reagent with 0.02 μM, 0.20 μM, 1.00 μM, 5.00 μΜ, and 10.00 μM concentrations of antisense oligonucleotide, as specified in Table 65. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS199, as described hereinabove, was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 65. As illustrated in Table 65, the ISIS oligonucleotides were able to penetrate the cell membrane and significantly reduce STAT3 mRNA levels in a dose-dependent manner.

Table 65 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by H460 cells 0.02 0.20 1.00 5.00 10.00 IC ISIS No μM μM μM μM μM (μM) 455269 3 69 81 92 94 0.1 455291 0 29 79 88 92 0.3 455371 0 20 63 85 89 0.8 455429 3 37 75 87 88 0.6 455703 4 24 69 87 92 0.3 465237 0 20 72 87 89 0.6 465754 10 45 80 91 92 0.2 465830 10 28 65 82 89 0.7 BIOL0142WO 466670 15 32 71 90 93 0.3 Example 48: Effect of ISIS oligonucleotides targeting STAT3 in the treatment of U251 human glioma cancer xenograft model BALB/c nude mice inoculated with human U251 glioma tumor cells were treated with ISIS oligonucleotides from the study described in Example 12. The effect of the treatment on tumor growth in the mice was evaluated.

Treatment BALB/c nude mice were subcutaneously implanted with 1 x 10 tumor cells. On day 4 of the implantation, groups of 4 mice each were administered 50 mg/kg injected intraperitoneally five times a week for 3 and a half weeks of ISIS 455269, ISIS 455291, ISIS 455371, ISIS 455703, ISIS 455429, ISIS 465237, ISIS 465754, ISIS 465830, or ISIS 466670. One group of mice was administered 50 mg/kg injected intraperitoneally five times a week for 3 and a half weeks of the control oligonucleotide, ISIS 141923. One group of mice was administered PBS injected intraperitoneally five times a week for 3 and a half weeks.

Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper, and tumor volumes were calculated using the formula: V = 0.5 x a x b , where a and b are the long and short diameters of the tumor, respectively. The results are presented in Table 66. The data indicates that treatment with ISIS oligonucleotides significantly impeded tumor growth. ‘n/a’ indicates that the data points for that time point are not available.

Table 66 Effect of antisense inhibition of STAT3 on tumor growth in the U251 xenograft model Day 10 Day 14 Day 17 Day 21 Day 23 Day 29 Day 32 Day 35 PBS 205 216 285 381 519 771 937 1,141 ISIS 141923 175 178 296 404 544 719 923 1,027 ISIS 455269 157 151 227 307 349 418 486 542 ISIS 455291 149 169 193 238 297 429 635 610 ISIS 455371 141 169 253 379 375 598 838 912 ISIS 455429 180 160 251 337 427 546 807 897 ISIS 455703 156 161 246 342 414 615 872 991 ISIS 465237 149 166 245 326 350 551 703 744 ISIS 465830 173 205 287 346 383 696 844 825 ISIS 466670 112 172 208 254 274 492 462 669 BIOL0142WO Example 49: Effect of ISIS 455291 targeting STAT3 in the treatment of an MDA-MB-231 human breast cancer xenograft model BALB/c nude mice inoculated with human breast cancer cells MDA-MB-231 were treated with ISIS 455291. The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Treatment The study was conducted at Pharmaron Inc (Beijing, P.R. China). The BALB/c nude mice were obtained from Beijing HFK Bio-Technology Co., Ltd. MDA-MB-231 human breast cancer cells were maintained in vitro as a monolayer culture in Leibovitz’s L-15 medium supplemented with 10% heat- inactivated fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine. The cells were maintained at 37 C in an atmosphere of 5% CO in air. The tumor cells were routinely sub- cultured twice weekly with trypsin-EDTA treatment. Cells growing an exponential growth phase were harvested and counted for tumor inoculation.

Two groups of eight randomly assigned 6-8 week-old female BALB/c nude mice each were inoculated at the right flank with the MDA-MB-231 tumor fragments (3 mm x 2 mm x 2 mm, which were generated from tumor inoculation passage) for tumor development. Antisense oligonucleotide treatment started at day 11 after tumor inoculation when the mean tumor size reached approximately 100 mm . One of the groups was injected intraperitoneally twice a week for 3 weeks with 50 mg/kg of ISIS 455291. The other group of mice was injected intraperitoneally twice a week for 3 weeks with PBS, and served as the control group.

RNA analysis RNA was extracted from tumor tissue for real-time PCR analysis of human STAT3 mRNA levels using primer probe set RTS199, described hereinabove. Murine STAT3 mRNA levels were also measured using primer probe set mSTAT3_LTS00664 (forward sequence CGACAGCTTCCCCATGGA, designated herein as SEQ ID NO: 1513; reverse sequence ATGCCCAGTCTTGACTCTCAATC, designated herein as SEQ ID NO: 1514; probe sequence CTGCGGCAGTTCCTGGCACCTT, designated herein as SEQ ID NO: 1515). Results are presented as percent inhibition of STAT3, relative to PBS control, normalized to cyclophilin. As shown in Table 67, treatment with ISIS 455291 resulted in reduction of both human and murine STAT3 mRNA in comparison to the PBS control.

Table 67 Inhibition of STAT3 mRNA in the treatment groups relative to the PBS control in the MDA-MB-231 xenograft model BIOL0142WO % inhibition Human STAT3 91 Murine STAT3 94 Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper, and tumor volumes were calculated using the formula: V = 0.536 x a x b , where a and b are the long and short diameters of /C values. T-C the tumor, respectively. The tumor size was utilized for calculations of the T-C and T was calculated with T as the median time (in days) required for the tumors in the treatment groups to reach a pre-determined size (900 mm ), and C as the median time (in days) for the tumors in the control /C value (expressed as percentage) is an indication of the anti- group to reach the same size. The T tumor effectiveness of the ISIS oligonucleotides, where T and C were the mean volume of the treated and control groups, respectively, on a given day (day 32).

The results are presented in Tables 68 and 69. The data indicates that inhibition of STAT3 mRNA significantly impeded tumor growth.

Table 68 Effect of antisense inhibition of STAT3 on tumor growth in the MDA-MB-231 xenograft model Days PBS ISIS 455291 11 103 103 185 156 18 292 205 22 519 320 745 437 29 1,332 792 32 1,741 1,075 Table 69 Effect of antisense inhibition of STAT3 on tumor growth inhibition in the MDA-MB-231 xenograft model Tumor Size (mm ) T /C T-C Treatment at day 32 (%) at 900 mm PBS 1,741 ISIS 455291 1,075 62 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured on a regular basis during the treatment period. The data is presented in Table 70 and indicate that treatment with ISIS 455291 does not affect the overall body weight of the mice.

Table 70 Body weight measurements of mice in the MDA-MB-231 xenograft model Day 11 Day 15 Day 18 Day 22 Day 25 Day 29 Day 32 BIOL0142WO PBS 22 22 23 23 23 23 24 ISIS 455291 22 22 23 23 24 24 25 Example 50: Effect of ISIS 455291 targeting STAT3 in the treatment of an A431 human epidermoid carcinoma xenograft model BALB/c nude mice inoculated with human epidermoid cancer cells A431 were treated with ISIS 455291. The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Two groups of eight randomly assigned 6-8 week-old female BALB/c nude mice each were inoculated subcutaneously with 5 x 10 A431 tumor cells for tumor development. Antisense oligonucleotide treatment started at day 8 after tumor inoculation when the mean tumor size reached approximately 95 mm . One of the groups was injected intraperitoneally twice a week for 4 weeks with 50 mg/kg of ISIS 455291. The other group of mice was injected intraperitoneally twice a week for 3 weeks with PBS, and served as the control group.

RNA analysis RNA was extracted from tumor tissue for real-time PCR analysis of human STAT3 mRNA levels using primer probe set RTS199, described hereinabove. Murine STAT3 mRNA levels were also measured using primer probe set mSTAT3_LTS00664. Results are presented as percent inhibition of STAT3, relative to PBS control, normalized to cyclophilin. As shown in Table 71, treatment with ISIS 455291 resulted in reduction of both human and murine STAT3 mRNA in comparison to the PBS control.

Table 71 Inhibition of STAT3 mRNA in the treatment groups relative to the PBS control in the A431 xenograft model % inhibition Human STAT3 67 BIOL0142WO Murine STAT3 92 Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper, and tumor volumes were calculated using the formula: V = 0.5 x a x b , where a and b are the long and short diameters of the tumor, respectively. The tumor size was utilized for calculations of the T-C and T /C values. T-C was calculated with T as the median time (in days) required for the tumors in the treatment groups to reach a pre-determined size (800 mm ), and C as the median time (in days) for the tumors in the control group to reach the same size. The T /C value (expressed as percentage) is an indication of the anti-tumor effectiveness of the ISIS oligonucleotides, where T and C were the mean volume of the treated and control groups, respectively, on a given day (day 33).

The results are presented in Tables 72 and 73. The data indicates that inhibition of STAT3 mRNA impeded tumor growth.

Table 72 Effect of antisense inhibition of STAT3 on tumor growth in the A431 xenograft model Days PBS ISIS 455291 8 94 95 14 178 173 17 308 242 21 528 393 24 682 572 28 875 759 31 1,071 984 33 1,210 1,112 Table 73 Effect of antisense inhibition of STAT3 on tumor growth inhibition in the A431 xenograft model Tumor Size (mm ) T /C T-C Treatment at day 33 (%) at 800 mm PBS 1,210 - - ISIS 455291 1,112 92 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured on a regular basis during the treatment period. The data is presented in Table 74 and indicate that treatment with ISIS 455291 does not affect the overall body weight of the mice.

Table 74 Body weight measurements of mice in the A431 xenograft model Day 8 Day 14 Day 17 Day 21 Day 24 Day 28 Day 31 Day 33 PBS 20 20 20 21 21 21 22 22 ISIS 455291 20 21 21 22 22 22 23 23 BIOL0142WO Example 51: Effect of ISIS 455291 targeting STAT3 in the treatment of an NCI-H460 human non- small cell lung cancer (NSCLC) xenograft model BALB/c nude mice inoculated with human NCI-H460 human NSCLC were treated with ISIS 455291. The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Two groups of eight randomly assigned 6-8 week-old female BALB/c nude mice each were NCI-H460 tumor cells for tumor development. Antisense inoculated subcutaneously with 2 x 10 oligonucleotide treatment started at day 6 after tumor inoculation when the mean tumor size reached approximately 100 mm . One of the groups was injected intraperitoneally twice a week for 3 weeks with 50 mg/kg of ISIS 455291. The other group of mice was injected intraperitoneally twice a week for 3 weeks with PBS, and served as the control group.

Effect on tumor growth Tumor size was measured twice weekly in two dimensions using a caliper, and tumor volumes were calculated using the formula: V = 0.5 x a x b , where a and b are the long and short diameters of the tumor, respectively. The tumor size was utilized for calculations of the T-C and T /C values. T-C was calculated with T as the median time (in days) required for the tumors in the treatment groups to reach a pre-determined size (1,500 mm ), and C as the median time (in days) for the tumors in the control group to reach the same size. The T /C value (expressed as percentage) is an indication of the anti-tumor effectiveness of the ISIS oligonucleotides, where T and C were the mean volume of the treated and control groups, respectively, on a given day (day 20).

The results are presented in Tables 75 and 76. The data indicates that inhibition of STAT3 significantly impeded tumor growth.

BIOL0142WO Table 75 Effect of antisense inhibition of STAT3 on tumor growth in the NCI-H460 xenograft model Days PBS ISIS 455291 6 104 104 8 303 180 11 746 408 13 1,175 620 1,642 819 18 2,277 1,320 2,859 1,812 22 - 2,330 Table 76 Effect of antisense inhibition of STAT3 on tumor growth inhibition in the NCI-H460 xenograft model Tumor Size (mm ) T /C T-C Treatment at day 20 (%) at 800 mm PBS 1,210 ISIS 455291 1,812 63 Body weight measurements To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body weights were measured on a regular basis during the treatment period. The data is presented in Table 77 and indicate that treatment with ISIS 455291 does not affect the overall body weight of the mice.

Table 77 Body weight measurements of mice in the NCI-H460 xenograft model Day 6 Day 8 Day 11 Day 13 Day 15 Day 18 Day 20 Day 22 PBS 20 20 20 20 20 20 21 - ISIS 455291 20 20 20 20 20 19 20 20 Example 52: Effect of antisense inhibition of human STAT3 in a human glioblastoma orthotopic mouse model NU/J mice orthotopically implanted with human glioblastoma cells were treated with ISIS 455291, a 55 MOE gapmer having a sequence of CAGCAGATCAAGTCCAGGGA (SEQ ID NO: 1590. The effect of the treatment on tumor growth and tolerability in the mice was evaluated.

Treatment Thirty NU/J mice were stereotactically implanted in the right frontal lobe with 5 x 10 U- 87 MG-luc2 cells. On day 15 after tumor cell implantation, 15 of these mice were dosed intracranially with a bolus injection at the site of tumor implantation with 100 μg of ISIS BIOL0142WO 455291, which was dissolved in 2 μL of PBS. The remaining 15 mice were dosed intracranially with a bolus injection at the site of tumor implantation with 2 μL of PBS. The second group of mice served as the control group.

The remaining mice in each group were monitored regularly up to 2 weeks for survival analysis. The median survival for the PBS control group was 30.5 days. The medial survival for the ISIS oligonucleotide-treated mice was 35 days. The P value was 0.2088.

Example 53: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in PC9 cells ISIS 455703 and ISIS 455291, from the studies described above, were further tested at different doses in PC9 cells, a non small cell lung carcinoma cell line. Cells were plated at a density of 3,000 cells per well. Cells were incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 78. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 78. As illustrated in Table 78, ISIS 455703 and ISIS 455291were able to penetrate the cell membrane.

BIOL0142WO Table 78 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by PC9 cells 0.02 10.0 IC ISIS No 0.1 μM 0.5 μM 2.5 μM μM μM (μM) 455703 6 5 17 50 49 9.0 455291 0 0 42 67 75 1.2 Example 54: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in C42B cells ISIS 455291, from the studies described above, was further tested at different doses in C42B cells, a prostate cancer cell line. Cells were plated at a density of 3,000 cells per well. Cells were incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 79. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

As illustrated in Table 79, ISIS 455291 was able to penetrate the cell membrane.

Table 79 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by C42B cells 0.02 10.0 ISIS No 0.1 μM 0.5 μM 2.5 μM μM μM 455291 0 0 17 10 41 Example 55: Dose-dependent antisense inhibition of STAT3 following free uptake of antisense oligonucleotide in Colo201 cells ISIS 455291, from the studies described above, was further tested at different doses in Colo201 cells, a colorectal cancer cell line. Cells were plated at a density of 3,000 cells per well. Cells were BIOL0142WO incubated with 0.02μM, 0.1 μM, 0.5 μM, 2.5 μΜ, and 10.0 μM concentrations of antisense oligonucleotide, as specified in Table 80. After approximately 24 hours, RNA was isolated from the cells and STAT3 mRNA levels were measured by quantitative real-time PCR. Human STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to measure mRNA levels. STAT3 mRNA levels were adjusted according to content of beta-actin, a housekeeping gene, as measured by human primer probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO: 1531). Results are presented as percent inhibition of STAT3, relative to untreated control cells.

The half maximal inhibitory concentration (IC ) of each oligonucleotide is also presented in Table 80. As illustrated in Table 29, ISIS 455291 was able to penetrate the cell membrane.

Table 80 Dose-dependent antisense inhibition of STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by Colo201 cells 0.02 10.0 IC ISIS No 0.1 μM 0.5 μM 2.5 μM μM μM (μM) 455291 21 18 34 52 81 1.2 BIOL0142WO

Claims

CLAIMS 5 1. A single stranded modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 3008 to 3033 of SEQ ID NO: 1, wherein the nucleobase sequence is complementary to SEQ ID NO: 1. 10 2. The single stranded modified oligonucleotide of claim 1, wherein the nucleobase sequence of the modified oligonucleotide comprises the sequence of SEQ ID NO: 245 or SEQ ID NO: 1045. 3. The single stranded modified oligonucleotide of claim 1 or 2, wherein the nucleobase sequence of the modified oligonucleotide consists of the sequence of SEQ ID NO: 245. 4. The single stranded modified oligonucleotide of any of claims1-3, wherein at least one internucleoside linkage is a modified internucleoside linkage. 5. The single stranded modified oligonucleotide of any of the preceding claims, wherein each 20 internucleoside linkage is a phosphorothioate internucleoside linkage. 6. The single stranded modified oligonucleotide of any of the preceding claims, wherein at least one nucleoside comprises a modified sugar. 25 7. The single stranded modified oligonucleotide of claim 6, wherein at least one modified sugar is a bicyclic sugar. 8. The single stranded modified oligonucleotide of claim 7, wherein the bicyclic sugar comprises a 4’- CH -O-2’ bridge or a 4’-CH(CH )-O-2’ bridge. 9. The single stranded modified oligonucleotide of claim 6, wherein the modified sugar comprises a 2’-O(CH ) -OCH group or a 2’-O-CH group. 2 2 3 3 10. The single stranded modified oligonucleotide of any of the preceding claims, wherein at least 35 one nucleoside comprises a modified nucleobase. BIOL0142WO 11. The single stranded modified oligonucleotide of claim 10, wherein the modified nucleobase is a 5’-methylcytosine. 12. The single stranded modified oligonucleotide of any of the preceding claims, wherein the 5 modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or one 10 2’-substituted nucleoside. 13. The single stranded modified oligonucleotide of any of the preceding claims, wherein the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; 15 a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; and wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside and at least one 2’-substituted nucleoside. 20 14. The single stranded modified oligonucleotide of any of the preceding claims, wherein the modified oligonucleotide comprises: a 5’-wing consisting of 3 linked nucleosides; a 3’-wing consisting of 3 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 10 linked 2’-deoxynucleosides; 25 wherein each nucleoside of each of the 5’-wing and the 3’-wing comprises a constrained ethyl nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5’-methylcytosine. 30 15. A single-stranded modified oligonucleotide consisting of 12 to 22 linked nucleosides, wherein the modified oligonucleotide comprises: a 5’-wing consisting of 1 to 5 linked nucleosides; a 3’-wing consisting of 1 to 5 linked nucleosides; a gap between the 5’-wing and the 3’-wing consisting of 8 to 12 linked 2’-deoxynucleosides; 35 wherein at least one of the 5’-wing and the 3’-wing comprises at least one bicyclic nucleoside or a 2’- substituted nucleoside; BIOL0142WO wherein the nucleobase sequence of the modified oligonucleotide is complementary to an equal length portion of nucleobases 3016 to 3031 of the nucleobase sequence of SEQ ID NO: 1; and wherein the compound inhibits expression of STAT3 mRNA expression. 5 16. The single stranded modified oligonucleotide of any of claims 12 - 15, wherein at least one of the 5’-wing and the 3’-wing comprises at least one 2’-deoxynucleoside. 17. The single stranded modified oligonucleotide of any of claims 12 - 16, comprising at least one bicyclic nucleoside. 18. The single stranded modified oligonucleotide of claim 17, wherein at least one bicyclic nucleoside comprises a 4’-CH(CH )-O-2’ bridge or a 4’- CH -O-2’ bridge. 19. The single stranded modified oligonucleotide of claim 18, wherein each bicyclic nucleoside 15 comprises a 4’-CH(CH )-O-2’ bridge or a 4’- CH -O-2’ bridge. 20. The single stranded modified oligonucleotide of any of claims 12 - 19, wherein at least one internucleoside linkage is a modified internucleoside linkage. 20 21. The single stranded modified oligonucleotide of claim 20, wherein each modified internucleoside linkage is a phosphorothioate linkage. 22. The single stranded modified oligonucleotide of any of claims 12 - 21, wherein at least one nucleoside comprises a modified nucleobase. 23. The single stranded modified oligonucleotide of claim 22, wherein the modified nucleobase is a 5’-methylcytosine. 24. A single-stranded modified oligonucleotide consisting of 12 to 30 linked nucleosides and 30 having a nucleobase sequence comprising at least 12 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 245 or SEQ ID NO: 1045. 25. A single stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 245, or a pharmaceutically acceptable 35 salt thereof, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleotides; a 5’-wing segment consisting of three linked nucleosides; and a 3’-wing segment consisting of three linked nucleosides; wherein the gap BIOL0142WO segment is positioned between the 5’-wing segment and the 3’-wing segment; wherein each nucleotide of each wing segment comprises a constrained ethyl nucleoside; wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage; and wherein each cytosine of the modified oligonucleotide is a 5’-methylcytosine. 26. A pharmaceutical composition comprising the single stranded modified oligonucleotide of any of the preceding claims, and a pharmaceutically acceptable diluent or carrier. 27. Use of the single stranded modified oligonucleotide or composition of any one of claims 1 to 10 25 in the manufacture of a medicament for treating cancer. 28. The single stranded oligonucleotide of any one of claims 1 to 25 substantially as herein described with reference to any example thereof.