NZ615861B2 - Monitoring recombinase polymerase amplification mixtures - Google Patents

Abstract

Disclosed is a process comprising: (a) providing a mixture comprising: (i) a first subset of particles comprising a recombinase, a single-stranded DNA binding protein (SSB) and a first oligonucleotide comprising a first detectable label; and (ii) a second subset of particles comprising a recombinase, a single-stranded DNA binding protein (SSB) and a second oligonucleotide comprising a second detectable label, wherein: -the first oligonucleotide and the second oligonucleotide are different; and -the first detectable label and the second detectable label are different; and (b) independently observing or determining the number or proportion of the first subset of particles and the second subset of particles in the mixture, wherein the particles comprise one or more of the recombinase, the single-stranded DNA binding protein (SSB) and at least one of the first oligonucleotide and the second oligonucleotide. Also disclosed is a process comprising: (a) providing a mixture comprising a recombinase, a single-stranded DNA binding protein and one or more oligonucleotides; and (b) detecting particles associated with nucleic acid amplification products in the mixture by observing particles or determining the number or proportion of particles associated with the nucleic acid amplification products in the mixture. ase, a single-stranded DNA binding protein (SSB) and a second oligonucleotide comprising a second detectable label, wherein: -the first oligonucleotide and the second oligonucleotide are different; and -the first detectable label and the second detectable label are different; and (b) independently observing or determining the number or proportion of the first subset of particles and the second subset of particles in the mixture, wherein the particles comprise one or more of the recombinase, the single-stranded DNA binding protein (SSB) and at least one of the first oligonucleotide and the second oligonucleotide. Also disclosed is a process comprising: (a) providing a mixture comprising a recombinase, a single-stranded DNA binding protein and one or more oligonucleotides; and (b) detecting particles associated with nucleic acid amplification products in the mixture by observing particles or determining the number or proportion of particles associated with the nucleic acid amplification products in the mixture.

Description

MONITQRlNG RECiilMBlNASE FOLYMERASE lCA'l‘lON MlX'l‘URES "l‘ECHNlCAL lll'lfllall This disclosure s to methods and compositions for nt “lei“, acid detection,a.4 amplification, and quantitation.

BACKGRGUl Tl} Certain isothermal ampliti cation methods are able to amplify template (target) nucleic acid in a speciiic manner from trace levels to very high and detectable levels within a matter of minutes. Such isothermal s, cg, Recontbinase Polymerase Amplification (RPA), can broaden the application of nucleic acid based diagnostic: into emerging areas such as of—care testing, and field and consumer testing. The isothermal nature and broad temperature range of the technologies can allow users to avoid the use of complex demanding instrumentation, SUB/EMARY This disclosure is based, at least in part, on the ation of particles within RPA mixtures. in some embodiments, these les can include c acids (e.g., oligonucleotides) and/or protein components of the Rl’A reaction. This discovery provides for new monitoring and detection methods relating to EPA. in one aspect, this disclosure features ses that include: (a) providing a mixmre that includes one or more oi‘(e.g., two or more of, or all of) a binase, a single—stranded DNA binding protein, and one or ,1 re c acids (e.g., oligonucleotides) {in any combination); and (l3) detecting particles in tlte reaction mixture. in some embodiments, the mixture includes a crowding agent, e.g., one or more of polyethylene glycol (cg, Phi-31450, l’EG3000, PEGSOOD, l’EGl0000, PEGlL’lOOO, MEG l5000, PEGZOOGO, PEGZSOOOQ, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between l5,000 and 29,009 daltons, or combinations thereoi), polyvinyl alcohol, dextran and iicoli. in some einbodi ients, the crowding agent is present in the reaction mixture at a concentration between l to l2% by weight or by volume of the reaction mixtu e, eg., between any two concentration values ed from 1.0%, 15%, 2.0%, 2.594;, 3.0%, 3.5%, 4.0%, 4.59/43, 50%, 5.5%, 6.09/6, 6.5%, 7.9%, 7.5%, 8.0%, 8.5%, 9.0%, , 10.0%, ll).5“/Ei, 10%, 1l.5%, and 12.0%. in some embodiments of all s, the recombinase includes a RecA or UvsX recombiriase. in some embodiments of all aspects, the single~strande£l DNA binding 0"! protein includes a prokaryotic SSE protein or a gp33 protein. in some embodiments of all aspects, at least one of the one or more nucleic acids (e.g., oligonucleotides) includes a detectable label. in some embodiments of all s, the particles include one or more (cg, two or more, or all) of a recombinase, a single ed g protein, and, at least one of the one or more nucleic acids (in any combination). in some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, thTPs, ATP, a primer, and a template nucleic acid. in some embodiments of all aspects, the e includes one or more (eg, two or more, three or more, four or more, live or more, six or more, seven or more, eight or more, or all) of a recombinase, a DNA polymerase, a single~strande£l binding protein, a recombinase loading protein, ATP, dNTPs or a mixture of lePs and, ddNTPs, a reducing agent, creatine kinase, a nuclease (cg, an exonuclease ill or endonuclease lV), a eveise transcriptase, a nucleic acid probe, a nucleic acid , and a template nucleic acid tin any combination). in some embodiments of all s, the particles include a polymerase, , All), a primer, and a template nucleic acid. in some ments of all aspects, the particles include a recombinase, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. in some embodiments of all aspects, tne particles include a recombinase, a —stranded binding protein, a rase, dN'l'Ps, All), a primer, and a template nucleic acid. in some embodiments of all aspects, the particles include a polymerase, dNTPs, and ATP, and one or more (cg, two, three, four, live, or six) additional agents selected from the group of a probe, a primer, a single—stranded binding protein, ddN'l’l’s, a reducing agent, creatine ltinase, a se, and a ‘everse transcriptase. in some embodiments of all aspects, the particles include a recombinase, a polyr ierase, a 3G reverse transcriptase, thTPs, ATP, a primer, and a template nucleic acid.

WO 38989 in some embodiments of all aspects, the partic1es are about 115—213 ttm in size, (0g, between about any two sizes selected from 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, l0, 12 15, 13', and 20 um (eg, about 1—1 0 pm in size. in some embodiments of all s, approximately l00 501.10 particles/,hL (J1 eg. between any two numbers oi particles seleeted'trom 10, ZJ, 50 100, 200, 51.1), 1000, 2000, and 5000 particles per n.1,, are detected. in some embodiments of all aspects, detecting particles in the mixture includes the use of one or more oi" microscopy, a microiluidic , ll0\ ' cytometry, and a camera. ln some embodiments of all aspects, the particles are detected using charge-- coupled detection (CCU). in another aspect, the disc1osure features a process that includes: (a) providing a recombinase polymerase ication reaction mixture; (b) maintaining the reaction mixture under conditions that allow for the production of nucleic acid amplification products in the reaction mixture; and (c) ing particles associated with the nucleic acid amplification ts in the reaction mixture. in some embodiments, the detecting is pertoimed within 10 minutes (cg.,'VVithin 9, 8 7, 6,3,4, '3, 2,1.51‘1 minute) from when the maintaining begins. 1n some embodiments of all aspects, the reaction mixture includes a crowding agent, eg, one or tore of polyethylene glycol (eg, PEG‘1450, P1363000, P1368000, P15610000, 13131314000, 13133115000, 20000, PEG250000, 13121330000, 13121335000, 1313640000, 13136 compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereo1,) polV’V'inyl alcohol, dextran and ticol1 1n some ments, the on mixture contains polyethylene glycol as a crowding agent (cg.,any ofhe PEG compounds described hrein or knownin the art). ln some embodiments, the reaction mixture contains polyvinyl alconol as a crowding agent in some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1 to 12% by weight or by volume of the reaction mixture, e.g” btwee-i am two concentration valuessselected from 109/, 1.5 “/0, 2.1040,44.534.,L3.0%0, 3 590, 4.1%, 4.5'?/0,5- 090,5 .305 6.1.)”'13, e 5"/0, 7. 090,7.5 0,0811%, 85%, 9. 0V0, 9. 5/0, 10 1.1/'13, 10.5%, .5%, and 12t--- "’0 in some embodiments, the ng agent is present in the reaction mixture at a concentration thatts sufficie-it to se the amount or amplification in the reaction mixture. in some embodiments of all aspects, the particles e one or more {e.g., two or more or all) of the reconibinase, the single stranded binding protein, and at least one of the one or more mtcleic acids (in any combination). in some embodiments of all aspects, the reaction mixture includes one or more 0"! (eg, two or more, three or more, four or more, live or more, six or more, seven or more, eight or more, or all) of a DNA polymerase, a inase loading n, All), dNTP‘s or a e of dN'l'Ps and ddN'l'Ps, a reducing agent, creatine kiiiase, a nuclease (eg, an exonuclease ill or endonuclease lV), a single~stranded binding protein, a nucleic acid primer, a nucleic acid probe, reverse transeriptase, and a template nucleic acid {in any combination). in some ments of all aspects, the reaction mixture contains a reeombinase, a single-stranded binding protein, and one or more oligonucleotides. in some embodiments of all aspects, the reaction mixture includes a recombinase, a single—stranded g protein, a polymerase, dN'l"?s, ATP, a primer, and a template nucleic acid. in some embodiments of all s, the reaction mixture es a polymerase, dN'l'l’s, ATP, a primer, and a template nucleic acid, in some embodiments of all aspects, the reaction mixture includes a recombinase, a rase, dNTPs, All), a , and a template nucleic acid. in some embodiments ot‘all aspects, the reaction mixture includes a recombinase, a single—stranded binding protein, a polymerase, dNTPs, All), a primer, and a template nucleic acid. in some embodiments of all aspects, the reaction mixture includes a polymerase, dNTPs, and ATP, and one or more (eg, two, three, four, five, or six) onal agents selected from the group ot‘a probe, a primer, a single—stranded hinding protein, ddN'l‘l’s, a ng agent, creatine e, a nuclease, and a reverse transcriptase. in some embodiments of all aspects, the reaction mixture includes a recombinase, a polymerase, a reverse transcriptase, dNTPs, All), a primer, and a template nucleic acid. ln some embodiments of all aspects, the particles a‘e about (15-20 pm in size, e.g., between about any two sizes selected from 0.5, l, l5, 2, 2.5, 3, 4, 5, 6, .7, 8, 9, 10, l2, l5, l8, and 20 um (eg, about l—ll) pm in 3G size). 2012/032508 in some embodiments of all aspects, approximately l0 to 5000 particles/nL, eg, between any two numbers ol’pi rticles selected from it), 20., 50, 100., 200, 500, l000, 2000, and 5000 particles per nli, are ed. in some embodiments of all aspects, the detecting includes determining a 0"! number or proportion of particles associated with nucleic acid amplification products in the reaction mixture and, optionally, determining or estimating the concentration of template nucleic acid in the original mixture thereby. in some embodiments, the detecting includes detecting single particles associated with two or more distinct nucleic acid amplification products. in another aspect, the disclosure features compositions that include (a) a first population of particles that includes a first recombinase, a first single—stranded DNA binding n, and a first oligonucleotide; and (b) a second population of particles that includes a second reconibinase, a second ~stranded DNA binding protein, and a second oligonucleotide, n the first and second oligonucleotides are different. in some embodiments, at least one of the first and second ucleotides includes a detectable label. in some embodiments, the first and second oligonucleotides include tlte same or different able labels. The first and second single—stranded DNA binding protein can bet e same or different from each other. The first and second inase can be the same or different from each other. in some embodiments of all aspects, the particles are about 05—20 pm in size, e.g., n about any two sizes selected from 0.5, 1, LS, 2, 2.5, 3, 4, 5, a, 7, 8, 9, l0, l2, t5, l8, and 20 pin (eg, about l—l0 pin in size). in some embodiments ot‘all aspects, imately l0 to 5000 particles/nL, egg n any two s ofparticles selected from it), 20, 50, 100, 200, 500, l000, 2000, and 5000 particles per nL, are present in the compositions. in some embodiments of all aspects, the compositions include a crowding agent, cg, one or more of polyethylene glycol (erg, liltl, l’EG3000, l’EG8000, PEGl0000, l3l§iG l4000, PEG l5000, PEGZ0000, PEGZS0000, PEG30000, PEG35000, PEGL‘l0000, PEG compound with molecular weight between l5,000 and 20,000 daltons, or combinations thereoi), polyvinyl alcohol, dextran and iicoll. in some embodiments, tlte crowding agent is present in the composition at a concentration between l to l .% bV weivht or bv volume of the reaction mixtu e e t. between anv two concentration .4 C: a , 9 a, values selected from 1 9‘36, 1...1. .3 15., 2.0"6, 2.5% 3.9‘36,35.33,4 0‘76, 4.- ‘76, 3.13% u 5.5%, 0/6, 65%, 7. 1'3‘36 x.- 7.39/6, 8.0376, 3.5% 9.0%, 9. 5‘36, 30 0‘76, ll).- ‘36, 13.33%, ll 5 1d 32 3.36 3h some embodiments of all aspects, the itions farther include one or (71 more (e.g., two or more, three or more, four or more, live or more, six or more, seven or more, eight or more, or all) of a DNA polymerase, a recomliinase loading protein, A3? leP5 or a mixture s and ddN33‘“, a redoci111g agent, creatine kinase, a nuclease (eg, an exonuclease 333 or endonuelease 3V), a nucleic acid probe, and a template 1111-Cleic acid (in any combination). 3n some aspects, the disclosi-1er fat111escompositions that include one or more oligonucleotides describe l1e1ein and variants thereol. 3n some embodiments the oligonucleotides can be used as primers and/or detection probes in 1etliods ofnucleie acid amplifications (eg rmal rineleic acid amplifications such as RPA). The oligonueleotides described herein can include one or more detectable labels. Where an oligonucleotide is disclosed as including one or more detectable labels, alternative labels may he used at the same positions or at different positions within the oligonucleotide (e..,g at a position within 1,7 ..,’34, 5, 6, 7, 8, 9, 30, ll, 32, 33, 34, ii, 36, 37', 38, 39, 3,25, or 30 bases 5" or 3’ oft‘ne disclosed position). 3n some embodiments, the ucleotides can include one or more abasic site mimics. Where an oligonocleotide es one or ,1ore abasic site , alternative ahasic site mimics may he included at the same position or at different ons within the oligonucleotide (e.g., ataposition within 1, 2, 3, 4,336, 7, 8, 9, 19 ll, l2, 33, 34, l5, l6, l7, 3', ‘19920, in some , 25, 01 333 base-[1 613’ ofthe disclosed position). embodiments, a variant of an oligonucleotide descrihed harein has twelve oi fewer {e1egg, elesven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or few *1, six or fewer, five or fewer, four or fewer, three or fewer, two or few r, or one or fewer) insitions, deletions, s11hxt1t11t1ons o1 additionsompared to the disclosed oliaonucleotide sequence in some embodiments, a variant of an oligonocleotide deseiihed herein has a sequence at least.‘33‘36 (e. a 85‘36,90‘7’6, or 95%) identical to the ' ., 3G disclosed oligonocleotide sequence. 3n some embodiments, the particles are detected using fluorescence. horn the particles. in certain embodiments, the particles are detected Without using cence from the particles. in some emhodimen ts, the les are detected using fluorescence from the particles, phase contrast microscopy, luminescent detection, spectral (color) detection, 0"! magnetic detection, sotopic detection, and/or electrochemical detection. in some embodiments the particles can be ed using a combination of two of more (eg, two, three, or four) of fluorescence from the particles, phase contrast microscopy, luminescent detection, spectral ) detection, magnetic detection, radioisotopic detection, and electrochemical ion. in some embodiments, some of the particles are ed using fluorescence from those particles, and other of the particles are detected without using fluorescence from these other particles. For e, the particles include a first uhset ofpt rticles and a second subset of particles. The first subset of particles is ed using fluorescence from the first subset ofparticles, and the second subset of particles are detected without using fluorescence from the second subset of particles (eg, phase contrast microscopy, luminescent detection, spectral (color) detection, magnetic detection, radioisotopic ion, and/or electrochemical detection). in another aspect, the disclosure features a tion of particles that include: a recoinhinase, a single-stranded, DNA binding protein, and an oligonucleotide, wherein some of the particles are detected using fluorescence from those particles, and other of the particles are detected without, using fluorescence from these other particles.

Also provided are hits including a recombinase, a single—stranded DNA g protein, and an oligonucleotide for use in any of the methods described herein. Also provided are kits including any of the particles or compositions described herein and instructions for performing any of the methods described .

The processes and compositions disclosed herein can he used for the detection of nucleic ( cids, eg, bacterial nucleic acids, mammalian nucleic acids, Viral nucleic acids, fungal nucleic acids, or protozoan nucleic acids, and for the diagnosis of disorders or es associated with such nucleic acids. 3G As used herein the “size” of a particle refers to e largest cross-sectional dimension of the particle, As used herein, an “oligonucleotide” refers to a nucleic acid polymer containing at least 10 (eg, at least l2, l5, 20, 25, 30, 35, 40, 50, 6t), 70, 80, 90, or lOO) base units. ln some embodiments, the oligonucleotide contains a total oi" less than l kb, 9th base units, 800 base units, "'09 base units, 600 base units, 500 base units, 400 base units, 300 0"! base units, 201'} base units, or llll) base units. in some embodiments, an oligonucleotide can have 98 or fewer, 80 or fewer, 70 or fEWT, (it) or fewer, 50 or ewer, 40 or fewer, '30 or fewr, or 20 or fewer base units. in some embodiments, an oligonucleotide has at least lb, 12,, l4, l6, l8, or 29 base units.

As used herein, “cytometry” refers to methods and compositions for detecting, visualizing, and analyzing the properties ofparticles. The term as used herein does not denote the ce of cells. However, methods and compositions used for detecting, visualizing, and analyzing the properties ofeells can be applied to the particles described herein, As used herein, an “abasic site mimic” refers to a subunit position within a nucleic acid polymer in which a sugar or modified sugar moiety (eg, glucose or deoxyglu ose) is present, and the 1’ carbon of the sugar or modified sugar moiety is not covalently bonded to a cyclic base structure (eg, adenine, guanine, cytsosine, thymine, uracil, or modified versions thereof). ln some embodiments, the 1 a I carbon of the sugar or modified sugar moiety is covalently bonded to a hydrogen (cg, tetrahydro uran). in ’ carbon of the some embodiments, the l, sugar or modified sugar ,ioiety is ntly bonded to another carbon that is not present in a cyclic base structure. in some embodiments, the l’ carbon of the sugar or d sugar moiety is ntly bonded to a non-cyclic linker structure. in some ments, an abasic site mimic is recognized by an enzyme which ses and modifies abasic site mimics clue to ural similarity to an abasic site (ie lack of a bulky base group attached to the Although methods and als similar or equivalent to those described herein can he used in the p ‘actice or testing of the present invention, suitable methods and als are described below. All publications, patent applications, patents, and other 3B references mentioned herein are incorporated by nce in their entirety. in case of conflict, the present specification, including definitions, will control. in addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Definitions of specific embodiments of the invention as claimed herein follow.

According to a first embodiment of the invention, there is provided a process comprising: (a) providing a mixture comprising: (i) a first subset of particles comprising a recombinase, a single-stranded DNA binding n (SSB) and a first oligonucleotide comprising a first detectable label; (ii) a second subset of particles comprising a recombinase, a single-stranded DNA binding n (SSB) and a second oligonucleotide comprising a second able label, wherein: the first oligonucleotide and the second oligonucleotide are ent; and the first detectable label and the second detectable label are ent; and (b) independently observing or determining the number or proportion of the first subset of particles and the second subset of particles in the mixture, wherein the les comprise one or more of the recombinase, the single-stranded DNA binding protein (SSB) and at least one of the first oligonucleotide and the second oligonucleotide.

According to a second embodiment of the invention, there is provided a process sing: (a) providing a recombinase polymerase ication reaction mixture comprising: a recombinase; a single-stranded DNA binding protein (SSB); and one or more oligonucleotides; (b) contacting in a solution the recombinase rase amplification reaction mixture with a template nucleic acid; (c) maintaining the reaction mixture under conditions that allow for production of nucleic acid amplification products in the reaction mixture; and (d) detecting particles associated with the nucleic acid amplification products in the on mixture by observing particles or determining the number or proportion of particles associated with the nucleic acid amplification products in the reaction mixture.

According to a third embodiment of the invention, there is provided a s comprising: (a) providing a mixture comprising a recombinase, a single-stranded DNA g protein and one or more oligonucleotides; and (b) detecting particles associated with nucleic acid amplification ts in the mixture by observing particles or determining the number or proportion of particles associated with the nucleic acid amplification products in the mixture.

[Text continues on page 9] Other features and advantages of the invention will be nt from the following detailed description, and from the claims BRIEF EEESCRIEVHON 0i? BRAWiNGS lf’l'Gs. lA-l C are micrographs depicting a single field of a mixture including U! particles. The scale bar indicates lOO pm. 1 1 A, differential interference contrast (DlC). lB, fluorescence. lC, merge.

Fle. ZA—ZC are mierographs depicting a single field of a mixture including particles and a template nucleic acid. The scale bar tes lOO um. 2A, DlC. ZB, fluorescence. 2C, merge.

Ele. 3A~3lrl are fluorescence mierographs depicting mixtures including the indicated concentrations of polyethylene glycol (PEG).

Fle. 4A4? are micrographs depicting mixtures including particles. 4A and 4B are a standard mixture. 4C and 4D are the rd e ing UvsX. Alli and 45‘ are the standard mixture excluding 91032. 4A, 4C. 4E, DEC. 4-8, All). 4?, fluorescence.

Fle. SA—Sll are micrographs depicting mixtures ing particles. 5A and SB are the standard mixture as in 4A and 4B, but excluding Ust. 56 and 5D are the standard mixture excluding polymerase. 5E and fill are the rd mixture excluding creatine irinase. 5G and 5H are the standard mixture excluding exonuclease lll. 5A, 5C, 5E, 56. DEC. SB, 51), 5E, Slit, fluorescence.

Fle. (SA—6C are sets oi‘micrographs depicting mixtures. (3A, two fields showing complete mixture. 68, two fields showing complete mixture ing gp32 and UVSY. 6C, two fields g complete mixture excluding gp32, Ust, and Emix (50mM Phosphoereaiine, 2.5mM ATP). for each set: top, DlC; bottom, cence. lf’l'Gs. 7A-7lf" are micrographs depicting a mixture including particles prepared with two laheled oiigonucleotides. 7A, Texas red fluorescence. 7B, merge DEC and Texas red. 7C, PAM fluorescence. 7D, merge DEC and HAM. 7E, DEC. 7F, merge Texas red and FAM. llle. Sit—8F a e micrograplis depicting a mixture including two sets ofparticles with two laheled oligonucleotides prepared independently and then mixed. 8A, Texas red fluorescence. 8B, merge DEC and Texas red. 8C. FAM fluorescence. 8D, merge BIG and BALM. 8E, DEC. 8E. merge Texas red and PAM. is a time course of mi crngraphs depicting particles during an amplification on. 0"! is a time course of inicregraphs depicting particies during an anipiification reaction. i710. it is a time course cfmicrngraphs depicting particles during an amplification reaction, Visualized by DEC/TAM and xas Red.

FTGs. 12A-viZD are sets nt‘micrographs depicting es including particies at 20X magnification. 12A, mixture inciuding T6 H668 Ust and Ust. lZB, mixture including T6 H668 UvsX without UVSY. lEC, mixture inciuding T6 UvsX and Uvs‘r’. 12D, mixture ing T6 UVSX without Ust. For each set: top, DEC; , fluorescence.

ETGs. l3A—t 313 are sets of micrographs depicting mixtures inciuding particies at 49x magnification. 13A, mixture including T6 H668 UvsX and Uvs‘r’. l3B, mixture including T6 B668 UVSX without Ust. 136, mixture ineiuding T6 UvsX and, Ust. 139? mixture including T6 UvsX withcut iist. For each set: top. DEC; bettninc fluorescence.

FIGS. i4B are line graphs depicting amplification reactions in es including T6 8665i Lt'vsX and Uvs‘r’ (std LivsX + Uvs‘r’), T6 H668 UvsX without Uvs‘r’ (std UvsX — Uvs‘i’"), T6 UvsX and Uvs‘i’ (T6 UvsX + Ust), and T6 UVSX without Ust (T6 UvsX ~Ust). 14A, 50!} copies template. MB, 50 copies niitempiate.

FTG. 15 is a line graph depicting ampiiiicatinn reactions in mixtures ineiuding T6 H668 UvsX and Ust (std UvsX + L‘ivs‘i’)v T6 H668 UVSX without Uvs‘i’ (std UvsX —UVSY), T6 UvsX and UVSY (T6 UvsX + Uvs‘r"), and T6 UvsX without UVSY (T6 UVSX .

EiGs. l6A—‘t 6B are line graphs depicting amplification reactions in es inciuding T6 T1668 UVSX and Ust (std UVSX + Ust), T6 H668 UVSX Without Ust (std UvsX Ust), T6 UvsX and Ust (T6 UvsX + Uvs‘r’), and T6 UvsX without 36 Uvs‘r' (T6 UVSX Ust).

DETAELED BESCRKPTION On microscopic observation, ures with the appearance of particles were observed wi thin RPA mixtures. During the ss of the R9A nucleic acid amplification on, the particles are associated with loci ot‘active amplification. 0"! The particles observed were typically in the range of 1- l0 am in size, and were present at approximately l00~500 particles/nil. lhe particles were found to contain oligonucleotides present in the mixtures. Formation of the particles did not require the presence of magnesium. However, particles thrrned in the e of a recoinhinase or a single-stranded DNA binding protein had an altered morphology. Formation of the particles in the absence of other agents, such as recom'hinase loading protein, DNA polymerase, creatine kinase, or exonttcleases, did not significantly allect particle morphology. Additionally, particle formation was more efficient in the presence of ng agents, The particles were ed to he relatively stable in solution. te populations of particles could be mixed and remain distinct for a period of time following mixing.

Recornhinase Polymerase Ant alilication RPA is a method for cation (e.g., isothermal amplification) of nucleic acids. in general, in a first step of RPA, a recontlainase is contacted with a first and a second nucleic acid primer to form first and second nucleoprotein primers. In general, in a second step the first and second nucleoprotein primers are contacted to a douhle strand ed template nucleic acid to form a first double stranded structure at a first n of the first strand of the template nucleic ' cid, and a second double stranded structure at a second portion ofthe second strand of the template nucleic acid, suc that the 3’ ends of the first nucleic acid printer and the second nucleic acid printer are oriented towards each other on a given DNA le. in t eneral, in a third step the 3” end of the 4 and the second nucleoprotein primers are extended by DNA polymerases to te first and second double stranded nucleic acids, and first and second displaced strands of 3G nucleic acid. Generally, the second, and third steps can be repeated until a desired deqree of am ation is reached.

M k-.A As bed herein, RPA employs enzyr ies, known as inases, that are capable of pairing oligonacleotide primers with homologous sequences in template double—stranded DNA. In this way, DNA synthesis is directed to defined points in a template double-stranded DNA. Using two or more sequence—specific (egg, gene— 0"! specific) printers, an exponential amplification on is initiated it‘tlie template nucleic acid is present. “the on progresses rapidly and results in specific antplili cation of a sequence p ‘esent within the template —st‘anded DNA from just a few copies of the template DNA to detectable levels of the amplified products within minutes. RPA methods are disclosed, e.g., in US 7,270,98‘; US 599; US 7,666,598; US 7,435,56‘: ; US 2009/0029421; and , all of which are incorporated herein by reference.

RPA reactions contain a blend of proteins and other factors that support botli the activity of the recombination element of the system, as well as those which support DNA synthesis front the 3" ends on ucleotides paired to complementary substrates. in some ments, the RPA reaction contains a mixture ot‘a reconi‘oinase, a single-stranded binding protein, a polymerase, dNTl’s, ATP, a primer, and a te , iplate nucleic acid. in some embodiments, a REA reaction can include one or more oftbe following (in any combination): at least one recombinase; at least one -stranded DNA binding protein; at least one DNA rase; dNTPs or a mixture of dN’l‘Ps and dle‘Ps; a crowding agent; a buffer; a reducing agent; ATP or AT? analog; at least one recombinase loading protein; a first primer and optionally a second printer; a probe; a e transcriptase; and a template nucleic acid molecule, e.g., a -stranded leg, RNA) or double stranded nucleic acid. in so ie embodiments, the EPA reactions can contain, e.g, a reverse transcriptase. Additional non—limiting examples of RPA reaction mixtures are described herein. in some embodiments, the RPA reactions can contain a UysX protein, a gp32 protein, and a Ust protein, Any of the processes, compositions or particles described herein can contain, in part, e.t; a l.lvsX protein, a g} '32 protein, and a Ust protein.

For example, any of the ses, compositions, or particles described herein can 3B contain, in part, Tolloés UvsX, Rb69 gp32, and Rh69 Ust. in some embodiments, the EPA reactions can n a UVSX protein and a gp32 protein. For example, any oft‘ne processes, compositions, or particles described herein can contain, in part, e.g., a UvsX n and a gp32 protein.

One protein component of an RPA reaction is a recombinase, which may 0"! originate from prokaryotic, Viral or eukaryotic origin. ary recombinases include RecA and UVSX (ega a RecA protein or UvsX protein obtained from any s), and nts or mutants thereof, and combinations thereof. The RecA and UvsX proteins can be obtained ii'om any s. RecA and UVSX fragments or mutant proteins can also be produced using the available ReeA and UvsS protein and nucleic acids sequences, and molecular biology techniques (see, en, the mutant forms of UvsX described in US. Patent No. 308). Exemplary UvsX proteins include those derived from myoviridae phages, st ch as T4, T2, T6, Rbo9, Aeh‘i, lfl,v.4 Acinetobaeter phage l33, nas phage 65, cyanophage P—SSMZ, cyanophage PSSlV’l4, cyanophage S—Plvl2, Rhléi, RhSZ, Aeromonas phage 25, Vihrio phage nt—l , phi~l 3 l, phage 44RR2.8t, Rb49, phage Rb3, and phage L22.

, Rhlo, Rh43, Phage Additional exemplary reeomhinase proteins include archaehacterial RADA and RADB proteins and eukaryotic (eg, plant, mammal, and fungal) Radfi l proteins (eg, RADfi l, RADS l B, RADS 1C, RADSlD, DMC‘: XRC “,3, and recA) (see, eg, Lin et , XRCCZ, at, Proc. Natl. Acad. Sci. USA lfi3:l0328--l0333, 2006). in any process of this disclosure, the reeornhinase (eg, UVSX) may he a mutant or hybrid recomhinase. in some embodiments, the mutant UysX is an Rb69 i.lvsX that includes at least one mutation in the Rb69 UvsX amino acid sequence, wherein the n utation is selected from the group consisting of (a) an amino acid which is not histidine at position (54., a serine at position (54., the addition of one or more glutamic acid residues at the C-terminus, the on of one or more aspartic acid residues at the C~termirius, and a combination thereof. in other embodiments, the mutant UvsX is a T6 UVsX having at least one mutation in the To UvsX amino acid sequence, wherein the mutation is selected from the group consisting of (a) an amino acid which is not histidine at position 66; (b) a serine at position 66; (c) the on of one or more 3G glutamic acid residues at the C-terminus; (d) the addition of one or more aspartic acid residues at the C~terminus; and (e) a combination thereof. Where a hybrid recombinase protein is used, the hybrid protein may, for e, he a UvsX protein that includes at 2012/032508 least one region that includes an amino acid sequence derived trom a ent UysX species. The region may be, for example, the DNA-binding loop-2 region ol‘UvsX.

Additionally, one or more single—stranded DNA hinding proteins can he ttsed to stabilize nucleic acids during the various exchange reactions that are ongoing in the 0"! reaction. The one or more single— stranded DNA binding proteins can be derived or obtained from any species, eg., from a ryotie, Viral or eukaryotie species. Non— limiting exemplary single—stranded DNA binding proteins include E coli SSE and those derived from niyoviridae phages, such as T4, T2, T6, Rh69, Aehl, K‘s/Till], Acinetobacter phage l33, Aeromonas phage 65, hage PK-SSMZ, eyanophage PSSM4, cyanophage SAPMZ, Rh} 4, Rh32, Aeromonas phage 25, 'V'ihrio phage nt—l, phi—l, Rhlo, Rh43, Phage 3 l and phage L22. , phage 44RR28t, 93049, phage Rb}, Additional examples ofsingle-stranded DNA binding ns include A. cloning/235mm Alide_2©47, Burkholderia {harlot/idealism Bthal3_3395 l, Freyoteli'ii: paliens llMPREFQl44_Ol 24, and eukaryotic single—stranded DNA binding protein replication protein A.

The DNA polymerase may be a otic or yotic rase.

Examples of eukaryotie polymerases include pol-alpha, pol—heta, pol—delta, pol—epsilon, and mutants or fragments thereof, or combinations thereof. Examples of prokaryotie polymerase include E. coil DNA polymerase l (e.g., Klenow fragment), baeteriophage T4 gp43 DNA polymerase, Bacillus Stearothermop‘zit’MS polymerase l large fragment, Phi—29 DNA polymerase, "l“? DNA rase, Bacillus 3111?)?!le Pol l, i tcniizyt’ococcus omens Pol l, E. coil DNA polymerase I, E. coil DNA rase ll, E. coli DNA polymerase lll, E. coli DNA polymerase lV, E. 60/72" DNA polymerase V, andi iitants or fragments thereof, or combinations thereof, in some embodiments, the DNA polymerase lacks 3’4)“ exonuclease activity. in some embodiments, the DNA polymerase has strand~displaeing properties, e.g large nts ot‘prolraryotic polymerases of e ass l or pol V.

Any of the process of this disclosure may be performed in the presence of a crowding agent. in some ments, the ng agent may include one or more 3G of hylene glycol, polyethylene oxide, polyvinyl alcohol, polystyrene, Ficoll, dextran, pol,y(vinylpyrrolidone) (l’VP), and albumin. in some embodiments, the ng agent has a molecular weight ofless than 200,000 daltons. li‘urt'ner, the crowding agent may he present, eg, in an amount of about 0.5% to ahout 115% weight to volume tw/V). li a recombinase loading protein is used, the recomhinase loading protein may he of yotic, Viral or eukaryotic origin. Exemplary recomhinase g ns 0"! include E. coil ReeO, E. cola” Rec/R, Ust, and mutants or fragments thereol, or ations thereof. Exemplary Uvs‘r’ proteins include those derived f:om myoviridae phages, such as T4, T2, re, Rh69, Aehl ohacter phage l 33, , KVP40, Aeromonas phage05,cyanophage PC:lSlVl2, haCTePSSM4, cyaiiopaaoeR‘s/l2, Rhl4, Rh32, Aeromonas phage 25, Vihrio phage nt— 1, phi-l, Rhlo, Rh43, Phage 31, phage 44RR2.8t, R'h49, phage Rh3, and phage LZZ. in any of the processes of this disclosure, the recomhinase loading agent may be derived lrom a myoviridae phage.

The'4myoviridae phage may betor e, T4, T2, re, £33369,Aehl RVP40 Acinetohaeter phage 133, ,Aeromonas phage €35, cyanophage P—SSMZ, cyanophage PSSM4, cyanophage S—Pi‘vl2, Rhl4, R1332, Aeromonas phage 25, Vihrio phage nt—l, phi~l 3 l, phage 44RR2.8t, Rh49, phage Rh3, or phage L22.

, Rhld, Rh43, Phage r any of the processes oft'his disclosure may he performed with a hlocked primer. A blocked primer is a primer which does not allow elongation with a polymerase. 3 there a hlocked primer is used, an unhioching agent can he used to unblock the primer to allow elongation. The ‘unhlocleing agent may be an endo uelease or exonuelease which can cleave the ng group from the prime Exemplary unhlocleing agents include E. coli exomtclease ill and E, coli endon uclease TV. in some embodiments, the processes ofthis disclosure can include: contacting a reeomhinase with a first and a second, nucleic acid pri ier and a third extension d primer which contains one or more noncomplementary or modified internal residue to form a lirst, second, and third nucleoprotein primer; contacting the first and second nucleoprotein primers to the double stranded target nucleic acid to form a lirst double stranded strueture hetween the first nucleoprotein primer and the firrst strand ofDNA at a first portion of the first strand (forming a l) loop) and a second douhle stranded structure n the second nucleoprotein primer and the second strand of DNA at a 3G second portion of the second strand (lorming a D loop), such that the 3' ends of the first nucleoprotein primer and the second nncleoprotei-i primer are ori4nte4d toward each other on the same atrgetnucleic acid molecule with a third portion of target nucleic acid 11:3 present between the 5’ ends of the first and second ; and extending the 3 end ofI the first nucleoprotein primer and second nucleoprotein primer with one or more rases and dN'l‘Ps to generate a first amplified target c acid; ting the frst amplified target nucleic acid to the third nucleoprotein primer to form a third 0"! double stranded structure in the first amplified target nucleic acid (forming a D loop) in the presence of a nuclease, wherein the nuclease cally cleave. the noncomplementary internal residue only after the formation of the third double— ed structure to form a third 5’ primer and a third 3* extension blocked printer; and extending the 3' end of the third 5‘ primer with one or more polymerase and dNTf’ to generate a second double—stranded amplified nucleic acid. in some ments, the processes include a first and second primer to amplify a first portion present Within a (l, uhle-stranded target nucleic acid to generate a first amplified product, and at least one additional primer that can he used to amplify a contiguous sequence present within the first amplified product (e55, an additional third primer that can he used in combination with, ee the first or the second primer, to amplify a contiguous sequence present Within the first amplified product). in some embodiments, the precesses include a first and second primer to amplify a first portion present within a double—stranded target nucleic acid to te a first amplified product, and a third and fourth primer that, can he used to alllplil'y a conti uous sequence present within the first amplified produc . in some embodiments, the processes can include, eg, a d primer and a reverse primer in some embodiments, the processes can include at least one blocked primer which comprises one or more noncomplementary or modified al es (eg one or more noncomplementary or modified internal residues that can he recognized and cleaved by a nuclease, e.g., DNA glycosylase, AP endonuclease, fpg, Nth, MutY, lVltttS, Mutlvl, E coli. MUG, human MUG, human Oggl a vertebrate Nei— like (Neil) glyeosylase, NtoV exonuelease ltlv or uracil glycosylase) Additional non— limiting examples of c acids (e.g., primers and probes) that can be included in a process are described herein. 3G in some embodiments, the ses can include a primer or probe that is nuclease resistant, egt, a primer or probe that contains at least one (e.g., at least two, three, four, five, six, seven, or eight) phosphorothioate linkages.

Any of the processes of this disclosure may be med in the presence of heparin. Heparin may serve as an agent to reduce the level -specitic primer noise, and to increase the ability of E. coii exonuclease ill or E. coir? entlonuclease lV to rapidly polish 3' blocking groups or terminal residues from recombination 0"! intermediates.

Based on the ular type or" on, the e can also contain one or mo e of buffers, salts, and mtcleo ti ties. The reaction mixture can be maintained at a specific temperature or temperature range appropriate to the reaction. in some embodiments, the temperature is maintainetl at or below 80 "C, e.g., at or below 70 "C, at or below 60 "C, at or below 50 "C, at or below 40 "C, at or below 37 "C, at or below "C, or at or below room temperature. in some embodiments, the temperature is maintained at or above 4 "C, t t or above it) "C, at or above l5 "C, at or above 20 "C, at or above room temperature, at or above 25 "C, at or above 30 "C, at or above U 7 "C, at or above 40 "C, at or above 50 "C, at or above 60 "C, or at or above 70 "C. in some embodiments, the reaction mixture is maintained at room or ambient temperature. in some embodiments, the Celsius-scale temperature of the mixture is varied by less than % (eg, less than ‘Zt 0/0, less than l5%, less than 10%, or less than 5%) throughout the reaction time r the temperature of the mixture is varied by less than l5 "C (e.g., less than ll) "C, less than 5 "C, less than 2 "C, or less than 1 "Cl throughout the reaction time.

Detection of amplification, cg, in real time, may be performed by any method known in the art. in some embodiments, one or more primers or probes (eg, mole ular beacon probes) are labeled with one or more detectable labels. Exemplary detectable labels e enzymes, enzyme substrates, coenzymes, enzyme inhibitors, fluorescent s, quenchers, cliromophores, magnetic particles or beads, redox sensitive moieties (egg, electrochemically active moieties), luminescent markers, radioisotopes (including radionucleotides), and s of binding pairs. More specmc examples include cein, phycohiliprotein, tetraethyl rhodamine, and beta— galactosidase. Binding pairs may include biotin/avitlin, hiotin/strepavidin, 3G antigen/antibody, ligand/receptor, and analogs and, mutants of the binning pairs. it should he noted that a fluorescence quencher is also considered a detectable label. For example, the l uorescence er may be contacted to a fluorescent dye and the amount of ing is detected. 0"! Particle Detection Detection and monitoring of the particles can he performed using any suitable method. Exemplary methods include microscopy, light scattering, flow cytometry, and inici'olluidic r iethods. in some ments, the particles can be detected using microscopy, e.g., differential interference contrast or fluorescence microscopy, to directly observe the particles at high magnification. With the aid of a computer, cope images can be automatically obtained and analyzed. Additionally, microscopy can allow for continual or fret uent monitoring of at least a portion of a mixture containing particles. in some embodiments, the particles can he detected using flow cytometry. ln llow cytonietry, one or more heanis oflight, e.g., each of a single wavelength, are directed onto a liydroclynamically--t‘ocuses:l stream oi‘tluid. Suspended particles passing through the beams scatter the light, and fluorescent chemicals found in the particle or ed to the particle may he excited. The scattered and/or fluorescent light is picked up by detectors within the device, from which information about particle size and fluorescence can be determined. Modern flow cytometers can analyze several thousand particles every second, in “real time,” and can actively separate and isolate les having specified properties. in some embodiments, the particles can be detected using cytometry s, devices, and systems as sed in US 2009/0079963, US Cloth/(3179068, and WO 2009/] l2594. ln some embodiments, the les can be detected using niicrolluielic methods, devices, and systems. For example, the particles can he detec ed using a lab—on—a~chip device or system, 01‘ the like. See e.a US. Patent Application Publication Nos. 2009/0326903 and 200910297733 3G in some embodiments, the les can be detected using a device or system suitable for point~of—care, field, or consumer use. For example, a device (cg, a lap~on— a—chip ) can e a i‘ecomhinase, a polymerase, it single—stranded binding n, ATP, dNTPs, and a primer or probe. in some embodiments, a device can he provided that contains a binase, a polymerase, a single-stranded binding protein, All), dN'l‘Ps, and a primer or probe, Where one of the recombinase, the polymerase, the primer or probe, or reeombinase is covalently ed or non~covalently bound {e.g., 0"! through useor an ailinitv-tag) to a surface. in some embodiments, partieles can be placed in multiple single wellsin a multiVvell plate in any of the sed s, Where desired the particles may be fixed prior to detection. For example, the particles can be fixed by treatment with an aldehyde (eg, formaldehyde, paraiormaldehyde, or glutaraldehyde) to cross-link proteins and nucleic. acids in the sample, effectively stopping the progress of reactions in the mixture and allowingLoi observation mthe particlesin the state at which the reaction was stopped. By fixing the mixtures, the les may be detected at a later point in time, iotentiallv sim :ilifvinrTE! rocessimT and detection .1 . .3 Oligonueleotides Oligonueleotioles as sed herein may serve as amplifieation primers and/oi detection probes. in some embodiments, the oligonueleotides are provided as a set of two or more (e.g., two, three, tour, or mo‘e) oligonucleotides.Lg, toriise in an amplification method (eg, as described herein).

Oligonucleotides can be synthesized according to standard phosphoroamidate chemistry, or otherwise. Modified bases and/or linker backbone ohemistries may be desirable and tunctional in some eases and can beimorporated during s Additionally oligo ucleotides may be modified with gr ups that serve various urposes e g. fluorescent groups, querieliers, protecting (blocking) groups (reversible or not), ic tags, ns etc. in some embodiments the olio'ionieleotide used herein can contain a 'LontirfLious sequence (e.g., at least 10 base units) thatis at least 900/0 identical (ewg at least 91%, "5%. 94%,, .95%,96“/o. 97%, 0/, or lt‘ltl‘3/o) to a contiguous sequence present within a target c acid. The percent identity or homology between two 39 sequences can be ined using a mathematieal algorithm. A non-limiting example of a mathematical algorithm utilized for the comparison oftwo sequences is the algorithm of Karim and Altschul {1990) Proc. Natl. Acad. Sci. USA, 872264—68, modified as in Karlin and ul { l 993) Proc. Natl. Acad. Sci. USA, 90:5 .73—77.

Such an algorithm is incorporated into the NBLAST program ot‘Altschui, et al, (1990); l. lvlol. Biol. 26:403—le 0. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al, @997) c Acids 0"! Res. 253389-3402. en utilizing BLAST and Gapped BLAST programs, the t parameters of the NBLAST program can be used. See online at nobinlmhihgoy’.

The oligonucleotides may include one or more detectable labels. The detectable label may be a lluorophore, an enzyme, a quench r, an enzyme inhibitor, a radioactive label, a redox sensitive moiety (e.g., an electrochemically active moiety) one member of a binding pair and a combination thereof. ln some embodiments, the oligonucleotides can e both a tluorophore and a quencher. The quencher may be close to the lluorophnre to suppress the fluorescence of the tluorophore. For example, the separation between the iluorophore and the quencher may be 0 to 2 bases, 0 to 5 bases, 0 to 8 bases, 0 to it) bases, 3 to 5 bases, 6 to 8 bases, and 8 to it) bases. lbe lluoropbore and quencher may be any fluorophore and quencher known to worlt together including, but not limited to, the iluorophore and quenchers any of the tluorophores described in this disclosure. Where the detectable label, is a fluorophore or a quencher, it may be attached to the ucleotide by a iluorophore—d'l‘ e residue or quencherudl amidite residue respectively. Other attacl tents are possible and widely known. in another aspect, either the fluorophore or the quencher may be attached to a modified internal residue and the lluorophore and quencher can be separated following cleavage of the d internal residue by the nuclease, While any phore may function for the methods of the invention, fluorescein, FAM, 'l'AMRA, and Texas Red are exemplary tli.ti)rtitiliores. Exemplary quenchers include a darl»: quencher which may be, for e, Dark Quencher l, Dark Quencher 2, Black Hole Quencher l or Black Hole Quencher 3’ in some embodiments, the oligonucleotides can include a modified internal residue. The modified internal residue may be any al structure (residue) that 3G cannot form a Watson-Crick base pairing structure with its corresponding base in a double stranded nucleic acid ure. The term "modified internal residue,” also includes, at least, any residue not normally found in DNAa—that is any residue which is not an "A", "G", "C“ or "T" such as, for example uracil or inosine. in some embodiments, the modified internal residue is inosine, uracil, guanine, thymine glycol, or an ahasic site mimic. Preferred abasic site mimics e a tetrahydrofitran residue or D—spacer (which can be produced as a product of employing a 9—0— 0"! Diinethoxytrityl-v l ',2'—-Dideoxyribose~3 ’-- [(Z-vcyanoethyl) -(MN --diisopropyl)] -- phosphoramidite during oligonucleotide synthesis. in some embodiments, the oligonucleotides are extension blocked. An extension blocked oligonucleotide is blocked at its 3' end so that it cannot normally be elongated by polymerase and dNTl’ even in the presence ol‘a complimentary template.

Methods of blocking an oligonucleotide are well known and include, at least, the inclusion of a blocked 3' nucleotide. The blocked 3' nucleotide may contain, for example, a bloclcing group that prevents polymerase extension. lly, the bloclcing groups are attached to the 3' or ‘2‘ site of the 3‘ sugar residue but other locations of attachments are possible. One of the most common 3' blocking methods is to place a dideoxy sugar at the 3' end of an oligonucleotide. T‘ne blocking group may be, for example, a detectable label. in some embodiments, the tcleotides disclosed herein may be modified by oration of one or more able labels, modified residues (e.g., modified al residues), and blocking groups. When the oligonucleotide disclosed herein includes one or more detectable labels, modified residues (cg, modified internal residues), and blocking groups, the oligonucleotide Without such modifications or with additional modifications is also included in the disclosure. Additionally, an oligonucleotide as sed herein that es one or more detectable labels, modified residues (eg, modified internal residues), and blocking groups may have such a moiety replaced by another detectable label, modified residue (eg, ed internal residue), or blocking group, est, a detectable label, modified residue (e.g., modified internal residue), or blocking group as sed herein.

Ag'iplications 3G The s and compositions sed herein can be used, for example, to detect the number of copies of a target c acid and to monitor amplification of a :equen ce present within a target nucleic acid. in some embodiments of the present ’3 A, k-.A 2012/032508 methods, the target nucleic acids can be detected at low copy numbers and in relatively c ude samples. in some embodiments, the ed ucleic acid is a bacterial nucleic acid, e.g., from a bacterium ed from Chlamydia trachomaz‘is, Neisseria gonorrhea, Group A Streptococcus, Group B Streptococcus, Closrria’ium riifiicit’e, 0"! Escherichia coil, Alycebacterizmi nibermilosis, Helicobacler pylori, Gardnerelin vaginaiis, il/l'ycoplosma itomim’s, ,Mobii’zmcus spp., Prevotelfa spp., and Pmpizyromonas spp, or from another bacterium described herein or known in the art. in some embodiments, the detected nucleic acid is a mammalian nucleic acid, e.g., a c acid is associated with tumor cells. in some embodiments, the detected nucleic acid is a viral nucleic acid, eg., front lllV, influenza virus, or dengue virus, or from another virus. ln some embodinien ,..s, the detected nucleic acid is a fungal nucleic acid, eg, from Candida albicam or r lungus. in some embodiments, the ed nucleic acid is a protozoan nucleic acid, e.g., from fl‘richonionas or another protozoan. The methods and compositions disclosed herein can be used in the diagnosis of a disorder or state associated with a detected nucleic acid, eg, a bacterial nucleic acid, r ianimalian nucleic acid, viral nucleic acid, fungal nucleic acid, or protozoan nucleic acid (eg, as disc osed herein), For example, the methods and compositions provided herein can be used to diagnose a bacterial infection, a viral infection, a fungal it fection, or a parasitic infection. in some embodiments, the detected nucleic acid is a nucleic acid from: influenza A or a t thereof, influenza B or a variant thereof, niethicillin—resistant Siaphlococcm nitrous (MRSA), C. difficile, M tuberculosis, dia species (eg, Chlamydia omatis), N. gonozr'rhoeae, lhponema pailia’um, human papilloma virus (HPV) (eg, lell’V variants type l6 and type 18), hepatitis virus (egg, hepatitis A, B, and, C), or a circulating cancer cell. in some embodiments, the methods and compositions provided herein can he used to se MESA infection, C. difiicile infection, tuberculosis, dia infection, gonorrhea, syphilis, HPV infection, hepatitis viral infection, or HPV infection,'l'he methods and compositions sed herein can be used in quantification of nucleic acids. “Digitaliza’tion” of nucleic acid aniplifi cation/detection reactions is a recent approach to allow for accurate counting of 3G template molecules (see, e.g., Vogelstein, l999, Proc. Natl, Acad. Sci. USA, 969236).

Typical ly in these s, spatial separation of the reaction mixture into the ed niicroacompartnien ts ally in the nanoliter range) is achieved by physically splitting an amplification reaction, eg by pressing it under pressure into suitable 'luidic cassettes or by dispersing it in a suitable emulsion. Without g to be bound by theory, it" the particles disclosed herein are active centers of amplification, thenthe presence of the particles constitutes an inherent compartinentalizati on of the 0"! reaction mixture that may be used in quantification. For example, by ng the number of “active” REA particles (eg. those ated with the generation of a. fluorescent signal) one can measure or estimate the number of template nucleic acid molecules present in the reaction mixture.

The methods can also be used to cletect 1 -+ l (,lie al linkage ot‘two or more c acids. ln many molecular biology applications the detection of physical linkage of two different genetic markers present in a given sample is important. For e, the mere presence of a bacterial species marker and an antibiotick-resistance marker in a given sample does not deliver information, about whether both markers are present in the same bacteria (eg, on the same nucleic acid), or whether the markers are present in separate onizing ia species. tr- ting that the two markers are linked on a single piece of genomic DNA associates the antibiotic ance with a particular pathogen The co~localization of the two markers can deliver vital diagnostic information in this scenario.

The methods and, compositions described herein can be used to demonstrate that the sites or locations of two amplification events for two nucleic acids are pping ing ation about the physical linkage oi" the nucleic acids. ln contrast, ble amplili cation events can indicate the presence otihotl'i nucleic acids, but on separate seg tents ot‘DNA (egg in two co-—eolonizing species of bacteria). in some embodiments? the linkage of two nucleic acid sequences can be detected by observing active amplification products ofhotli localized to a single particle in a reaction mixture. ln other embodiments, the linkage of two nucleic acid sequences on a single segment of DNA can be detected by observing “tethering” a of two particles, each amplifying one of the nucleic acids, by the DNA segment. in some eirihodiments, observation of the particles disclosed herein can be used 3G in methods of quality control. For example, a relationship between particle appearance (number; size? density) and RPA performance can be used to generate an analytical parameter to predict RPA reaction quality prior to amplification. lhis coultl he used for general quality con mi purposes (eg, to check what type/n uiriher of les ar present 111 a given on mixture), or to monitor the effect of changes in production pr0“edures (e55, stabilization processes) or in storagecconditions etc in some enihodinienEs the 111eEl1ods and itions sedherein can he (J1 usedto obtain results oiamplification1eactions Within minutes (eg.Within 8, 7, 6, 5, 4, 5 2,‘= 5, oi 1 minute) from the start of the reaction lypically, ,1onitoring amplification reactions by detecting the accumulation of flictorsc.ence signal is performed “in bulk”, i.e. the s generated by individual template molecules is integrated over the entire given reaction volume, producing a detectable fluorescence response in 58 minutes in contrast, observing the fluorescence signal generated at RPA particles may also in principle be used Eo shorten the time to result in a reaction.

This result is due, at least in part, to higher sensitivity of detection under high maonttication ir1 deti-ted loci (eg' ”particles).

The fluorescence signal strength of standard RPA reactions, typically performed and monitored ‘in liullr’, does profit from mixing steps performed during the incubation. especially it very low amounts of starting template 111ate11al are used.

Observing amplification reactions ly at particles can reduce any variation introduced by mixing.

EXA‘MPLES Exam le :-‘.Part-icles111Recon1b1nase Polvmerase A111 slitication es This example describes the ohseri11-101 of particles containing oligonticleotides Within RPA mixtures. Freeze dried mixtures ofRPA reaction components including FAM labeled oligonucleotides were obtained by ing a mixture1:,ontaining 2.96 ugCreatine Kinase, l3l gRbéEl gp32,18 l 11g T6 H665 UVSXJ. 1113:3116?) Ust .38 ng Exonuciease ill and 5.0 1.1g DNA Polymerase (large fragment of S. omens polyirie1ase l)in till til 9 38 111M T11s Acetate pll 83,513 mM DTT,2.5/0 PEG, 3.75% lose, 3L3 111M pncsphocrt '1111111 1 56 niM ATP,’50 11M niX (lSS iil‘vl each of dATl’, , dC’l‘P and dGTP), 588 11M 81.137125 8E2 (GAGAGACACTCGACAAG TCCTCAA’TCAAACCTTG; SEQ ll) NO: l 3, 365 nM 31131258312 (CAG'AAATCCT TGATGAGTTGCGGJ» AGC1‘;T SEQ TD N0:2) and 75 11M Sp\«’1"-258e>10Pl (CCTTGTCCTACCTTATAGAACATAGAGAATQTE‘EFAACCGCACTCGCTAC; FiitFAM-dT, H'ZTHF c site mimic), Q'ZBHQm l «H, 3’ biock c35pacer; SEQ lD N93) and —drying the mixture in 0.2-nfi. tubes. The dried reagents were resuspended in 46.5 uL rehydration buffer (48 mM Tris acetate, 133.8 mM KOAc, 233/6 0"! PEG) + 3.5 uL water and vortexed. These mixtures did not contain c acid template or magnesium, Ten niicrotiters of the mixture was transferred to a microscope siide and imaged using differentiai interference contrast (DEC) and fluorescence microscopy at 40X magnification (Fle. lA~l C). Particles of about t~l 0 s in size were observed using DEC (EEG, 1A) or fluorescence (FIG. l8), and when the two images were merged {Flt}. EC). Approximateiy 100—500 les/n14 were observed (field of View at 40x magnification was equivalent to 1.55 nL of the mixture). in a separate experiment, mixtures were prepared as above but substituting 2.5 ul; water and 1 {AL of a Streptococcus pvogenes genomic DNA preparation (1 00 copies/til) for the 3.5 but“, water. The e was vortexed and imaged as above (13le ZA—ZC). Similar particles as above were observed using DEC (PEG. 2A) or fluorescence (HG. BB), and when the two images were merged ().

This example demonstrates that particies are formed in RPA mixtures, and that the particles are not dependent upon the inciusion of tempia'te or magnesium. firmmriwHerdingseemsStmuhtei’atrctcPmmanm To determine the effects of crowding agen ts on particie ion, fresh RPA mixtures were prepared containing 2.96 pg Creatine Kinase, t3.‘i pg Rb69 g 32, i8.8 pg To 366$ UVSX, 2.5 ug Rb69 Uvs‘r', 5.38 ttg Exonuciease ill and 5.0 rig DNA Potymerase in 50 mM Tris Acetate, pH 8.3, 100 mM KOAC, 5 mM D'l‘T, 1.2 mM dN’l‘? mix (300 uM each of dATP, d’l"l"P, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% tre‘naiose, i4 inM MgAc, 38 nM HIV pZLFtexas (Texas red—iabeied oligo AGrAATTACAAAAACAAATTACAAAAATTCASAA"ETTTCGGGT’I‘T; 3’ dA blocked, 5 Texas Red, StdSpacer; SEQ it) NO:4), 420 nM Spyl 258F2 (CACAGACACTCGACAAGTCCTCAATCAAACCTTG; SEQ ED N135), and 390 3G nM SpylZSSRZ (CAGAALATCCTTCVXTGAGTTGCGGAAI’XTTTGAGGT; SEQ lD NOzo). PEG was included in each mixture at 0%, 2%, 2.5%, 3%, 35%, 4%, 5.5%, or 8%. line es were mixed by pipette and it) till ofeach was transferred to a microscope slide. imaging was performed using differential interference contrast (DlC) and fluorescence microscopy at 40% magnification. The number ofparticles observed increased with increasing PEG concentration up to 5.5% (lfi'le. 3A-3G).

Fewer particles were observed at 8% PEG (FlG. 3B). 0"! This example demonstrates that PEG can enhance formation of particles in RPA mixtures.

Exam le 3. Contribution of Mixture Com onents to le Formation To determine the contribution of the EPA mixture components to particle ion, es were prepared as in Example 2 with 5.5% PEG, except that individual components were excluded in each reaction. The mixtures were imaged as above using DH: and fluorescence microscopy. When all the components were present, particles formed in the mixture as described above (ElGS. 4A—4B). Particles formed in the absence ovasX appeared different in size from those formed in the presence of UvsX and were not easily observable by DH) (Fle. 4043). Particles formed in the absence of gp33 appeared different in shape and size from those formed in the preset ce of gp32 (Ele. (iii—4E). ures formed in the absence of other EPA components (l.lvs‘a’, DNA rase, creatine kinase, or lease lll) appeared similar to those formed in a co iplete RPA reaction (FIGS. SA-SH). The absence ofUst did appear to lead to a slight decrease in the number of the particles and an increase in the particle size (lfi'le. SA—Sli).

Additional mixtures were ed excluding two or three reaction components.

A control EPA e was prepared containing 2.96 pg Creatine , l3.l pg Rho?) gp32, l8.8 pg To H668 UvsX, S.l 5 pg Uvs‘i’, 8.26 pg Exonuclease lit and 5.0 pg DNA Eolymerase in 50 mi‘vl Tris Acetate, pll 8.3, 100 ml‘vl KOAc, 5 ml‘vl DTT, 1.2 mM dNTP mix (300 pM each of dATl", dTTP, dCTl" and dGTP), 59 mM ocreatine, 2.5 mM All). 6% trebalose, l4 niM MgAc. 5.5% PEG, lZO nit/l MQintli‘Alt/l (EAM—labeled probe 5’—tcctcatatccattctg'lbgaatatcatcaaaagc—'3’; T : carboxflluoresceirwdT; SEQ 1D NO: l9), 4le nM each SpaFS 3G TGTl GATC l Tl GT1 GAAGl TATTl TGTTGC; SEQ 1D NO:7) and Spalllllfl (TIAAAGATGA’l‘CCAAGCCAAAG'l‘CCTAACG'l'l‘l'l‘A; SEQ ll) NO:8). Parallel mixtures were prepared that lacked (i) gp32 and l.lst; (ii) UvsX and Ust; (iii) UvsX and gp32; {iv) UvsX, Ust, and gp32; or (iv) gp32, Ust, and Eniix (phosphocreatine and ATP). No particles were observed in the mixtures lacking UvsX and at least one other ent. in the mixtures lacking ngZ and Ust, large, irregular fluorescent bodies were observed . era—6C). 0"! This example demonstrates that exclusion ovasX or gp32 has the largest effect on particle morphology, followed by an intermediate effect of exclusion of 'lJ’st, with no significant effect observed on exclusion of DNA polymerase, creatine l<inase, or lease lll. Exclusion of two or more components had increased effects.

Exani le 4. Se iarate Po ulations of Particles Remain Distinct When Mixed Two zedried mixtures were prepared as described in Example l, except that each e ed different oligonucleotides and l8.8 ug UvsX. Reagent Mix l contained 296 UlVl SpaE3 (SEQ ll) N017), 298 nM Spalllllfl (SEQ ll) N08) and l49 nl‘vl Spalhchel {CATCAGC'l""l"l""l‘GGAGC"l"l"GAGAGTCAT9 ASGoTTTTGAGCTTCAC; '3’ biotin, 6::BHQ~2 dT, SiridSpacer, QTTMR dT; SEQ lD N029). Reagent Mix '2 contained 299 anl MeeF9l-2 (CCCTCALL‘XACLLXGGTGAI’X TTAT'l‘A,GCACT’TGT; SEQ ll) N0:ltl), 300 nM Mecllla(_C’l’"’l‘G'l'TGAGCAGAGG T’l‘CT'l""l"l""l"l"ATC’l'TC; SEQ ll) N'Ozl l) and lSO nl‘vl Mecl’robel (ATGACG'l"C'l‘A’l" CCATTTATGTATGGCAEGHGQAACGAAGAATATA; 3’ hiotinTEG, QZBHQ-l d'l', ll: THE (abasic site mimic), E:EAlvl~dT; SEQ ll} NOzl2). Equal volumes of the two reagent mixtures were combined, and 80 lulu was dispensed into 0.2-ml. tubes and freeze—dried. The dried es were resuspended in 46.5 til rehydration buffer (see Example l), 1 hi water, and 2.5 uL 280 nil‘vl MgAe. The mixture was vortexed and it) pl. was transferred to a microscope slide for imaging using DlC and fluorescence. The particles observed contained both red (TMR) and green (EAM) fluorescence, indicating that both labeled oligonucleotides were present in the particles (Ele. '7A—7E). in another experiment, two separate freeze~dried es were prepared as above, one including only the ’l‘MR labeled Spa RPA probe (Reagent Mix l, above), and the other including only the beled MecA RPA probe (Reagent Mix 2, 39 above). following reconstimtion, the two reconstituted mixtures were combined and imaged using DTC and fluorescence. Distinct particles that contained predominantly one fluoropliore or the other were observed in the e (Ele. sA—sr). This "l"! a .I indicates that the particles including each probe can remain distinct from each other after mixing.

To determine the stability of mixed populations of les over time, two prir ter—ti'ee freeze—dried reactions were reconstituted in rehydration buffer with MgAc 0"! and oligonucleotides as below. One mixture included '30 11M lll‘v’ BLFtexas (Texas Red d), 4-20 nl‘vl Spyl 258F2 (SEQ ll) NO: l, unlabeled), and 390 nM Spyl 258R2 (SEQ ll) N02, unlabeled). The other mixture included 50 ni‘vl Milintli‘AM oligo (SEQ ll} ND: l 9, FAM labeled), 420 nM SpylZsSFZ (SEQ ll) NO: l, unlabeled), and 390 nM Spy1258R2 {SEQ ll) N012, unlabeled). Five microliters ot‘eacli mixture were pipetted onto a microscope slide and mixed, and the ation was imaged at 2, ‘7, and l3 minutes (. images of the mixture following the ute period are shown in Fit} 9. After l3 minutes, particles including predominantly Texas Red or PAM fluorescence were observable.

This example demonstrates that particles remain relatively stable in on and can be independently labeled. lhis observation can be useful in monitoring two or more EPA reactions simultaneously, occurring on different particle subsets.

Exam le 5. RPA Reactions Are Observed Localized to Particles Freeze dried, mixtures ot‘Rl’A reaction components including a PAM d oligonueleotide probe, as in Example l, were reconstituted with 46.5 at rehydration buffer, and an ication reaction was begun by addition of l ul. 50,000 copies/til.

S. pyogenes genomic DNA and 2.5 uL 280 mM MgAc. The reaction was mixed by pipetting and, transferred to a microscope slide for imaging by DlC and scence starting at about 2 minutes, 40 seconds after initiation and then at 8, 12, 14, l5, l6, l8, 20, and 22 s {Flt}. 10). An increase in fluorescence (indicating amplification) was observed, which was at least initially zed to individual particles. in another ment, freeze~dried primer—free mixtures oi‘reaetion components (prepared by mixing a 50 ul volume of 2.96 ug Creatine Kinase, 9.88 tag R1669 gp32, l8.8 ug T6 Hess UvsX, 5.38 ttg Ust, 5.38 ug Exonuclease ill and 5.34 ng DNA Polymerase in 25 mM Tris Acetate, pH 8.3, 5 mM DTT, 2.78% PEG, 5.7% trehalose, 50 mM phosphoereatine, 2.5 lel ATP, l200 tilt/l, der‘Pmix (300 tilt/l each of dA’l‘l), d’l‘l‘l‘, dCTP and dill? and heme drying in 0.2—mL tubes) were reconstituted 2012/032508 with 29.5 pl primer—tree rehydration buffer (4L7 mM Tris Acetate, N575 rnM Potassium Acetate, 5.4% PEG, pH 8.3), 3.5 pL ofé uM Spa E3 (SEQ lD N07), 3.5 ul. of 6 pix/i Spa R10+i (SEQ if) NO:8), 1 PAL ofti tilt/l 'i'hIlR—laheied Spa Probe l (SEQ lD N09), l ttL of 0.6 ttM MZintFAM oligo (SEQ lD N019, used as a 0"! fluorescent marker ofparticies and, not involved in the RPA reaction), and, 8 iii water.

The reaction, was initiated by addition of pi. 50,000 copies.«’uL Group A Streptococcus purified genomic template DNA and 2.5 till. 280 mM MgAc and mixing by pipette. Ten inicroiiters of the mixture were transferred to a cope slide, and imaging was begun about '3 minutes alter tion of the reaction. A time course of the reaction mixture at 3, 8, 15, £8, 22, and 26 minutes (lilG. 1 1) showed an increase in red fluorescence (indicating amplification), which was at least initially localized to individual particles.

This example demonstrates that c acid amplification ts can he observed colocalized with particles.

Exam ie 6. Etiects oi’UVSX ts To investigate the effects of different UVSX variants, mixtures were setup at room temperature containing 2.96 pg Creatine Kinase, 13.1 ng R3069 gp32, 8.26 pg Exonuclease lll, 5.0 pg Polymerase in 5&an Tris Acetate, pH 8.3. 190 mM liOAc, S mM DTT, 1.2 mM dNTP mix (3 (it) pM each of dATi’, dT'l‘P, dCTP and dGTP). 5t) mix/i phosphocreatine, 2.5 mM ATP, 6% trehalose, 14 mM Mgr/Ac, 5.5% PEG, l20 nM MZintFAM (SEQ ED N019), 420 nM each SpaF3 and -l (58 pl final volume).

Four d,iilereiit mixtures were prepared, containing either 18.8 pg T636638 UVSX or 17.6 pg T6 UVSX. and with or without 5.15 pg Rhfig Ust. ’l‘en microliters of each mixture were transferred to a microscope slide and imaged at 20X magnification about ~2O minutes after set-up (Fle. l2A~lZD) and also at 40X cation about 50—60 minutes after set-up (Fle. 13A—13D). in general, more particles were observed in the léés UVSX e than with T6 UVSX. Additionally the "ftii’ltiéS '[J'VsX particles were often different in shape than those with T6 UvsX, including more lil<e 3G shapes, whereas the re UvsX particles were more spherical. The Tenses UvsX mixtures lacking UVSY had has more diffuse particles and diffuse “halos” or “doughnuts” that lacked signal in the middle. With Th UvsX the opposite effect was a in otten observed. Without , the particles were bright small spheres, but with Ust they wire less bright and more smeary and, small.

The effect or" Ust on RPA reaction cs ttsing ’l'iSltliSéS UvsX and T6: UvsX was investigated. Reactions were prepared as above, with Tenses UvsX or T6 UvsX, 0"! and with or without Rh69 Uvs‘i’. Three separate experi rents were performed, using dif‘ereht primer sets and templates. in the first experiment, the primers were 420 nM FireAPAFNASt’)?’ (AACCTGG GACC’l‘T‘i‘GA’l"C'i""i‘GGGCsGGC’l‘A’l‘A’l‘G; SEQ it) N02l3) and FluAPARNAi 06 (ATGTGTTAG 1AAGGAGTTGAACCAAGAAGCATT; SEQ 1D NO: 14), with 120 hl‘v‘i probe FinAPAexoPZZ (GA'l‘C"i"i"CaGG GGGC’l‘A’l‘A’l‘GAA GCAA’IYGAGG AGFHCQ"PGA'i‘i'AA’l‘GA’l"; FiiiF‘AM—dT, HeiTl'lF (ahasie site mimic), QiiiBHQ—l—dT, 3’ block e3spaeer; SEQ 1D Nflilfi). Five hundred or 50 copies of influenza A ate RNA were ‘used in each reaction. RPA reaetions were assembled containing 2.96 pg Creatine Kiriase, 13.] pg Rbfi‘} gp32, 18.8 rig tenses UvsX or i’i’.6ug To UvsX, 8.26 pg iease iii, 5.0 pg Polymerase, 1.79 pg Reverse Transcriptase, 3'15 pg UVSY (when present) in 50 mM Tris Acetate: pH 8.3, 100 inM KOAe, 5 inM DTT, 0.2 units/pi Ri‘oolockTM RNAse inhibitor (Fermentas), l.‘?. inM clNl'i’ mix (3% pM each of dA'l‘P, Gilli). P and (it???) 50 inr‘vi phosphocreatine, 2.5 mM All), 6% trehalose, 5.5% PEG. The above ents were led in a 46.5 liL volume in a 02-min, tube, and reactions were started by addition of 2.5 iii. of 280 mM MgOAe and 1 iii. of 50C) or 50 copies/til. influenza A temptate RNA. Reactions were vortexed, y centrifuged and transferred to a Twista ment (ESE) and the fluorescence monitored every 28 seconds for 20 minutes at 40 CC with a mixing step (vortex and brief centrifuge) at 5 minutes. inclusion ofUst with tenses UvsX led to a deiay in amplification relative to the reaction without Uvs‘i’, and the opposite was seen for T6; UvsX (FiGs. i4A-l 48).

When only 50 copies of the template were present, the reactions lacking Ust generated less signai overall 6?le l4A— 148). A similar effect on reaction kinetics was observed in a second experiment using as primers 42G nr‘vi SpaFS and SpaRi 0, with i20 riM SpaProbel .2 and i000 copies of group A streptococcus purified c 3G template DNA {Flt}. 15). in the second experiment, the primers used were 4-20 n‘i‘vi PluBNSE‘l 007 {CATCGOATCCTCAACTCAC'l"C'i""i‘CG AGCGT; SEQ ll) N0: i 6) and FiuBNSR’iOS AATTGGGATAAGACTCCCACCGCAGTTTC; SEQ TD NO: l7), with l20 nM probe E'luBNSexoPl (CATCGGATCCTCIMXYTCACTCTTCGAGCGFllTQAA TGAAGGACA’TTC; litl‘AhIl—dl‘, ltlf'i‘lili‘ (abasic site , QflffiliQ— l ~d'l", 3" = block cSSpacer; SEQ TD NO: l 8:}. Five hundred copies ot‘PCR—amplitied intluenza B 0"! template DNA were used, in each reaction. in these reactions, no amplification was observed with Tonnes UvsX lacking Uvs‘i’ (FiGs. MBA—loll). The opposite effect was observed with To UvsX (T7105. loA—l 61%).

This example demonstrates that ditterent UvsX variants can have different requirements for Ust with regard to le morphology and amplification reaction kinetics. Additionally, patticle morphology appears to be correlated to the kinetics and/or progress of the amplification reaction. tmmrl7QuantiticamnoleirAud~ The methods disclosed herein can be used for the quantification of nucleic acids. in one experiment, dilutions ot‘a template nucleic acid are combined with an RPA reaction mixture as disclosed in Example 5. The number oi‘particles in a specified volume of the reaction that are associated with sites of nucleic acid amplification is determined at each dilution. Within a rantie the number of particles associated with sites of nucleic acid amplification varies with the concentration of te nucleic acid in the reaction. For example, the number of particles associated with nucleic acid ampliti cation can be proportional to the concentration of template nucleic acid, or the number ot‘particles associated with c acid ication can be equivalent to the number plate nucleic acid molecules in the same volume. Using this information regarding the ation between number of active particle and template c acid concentration, the tration of template nucleic acid in an mental sample can be determined.

QTHER MENTS A number of embodiments of the invention have been described. Nevertheless, it will he understood that various modifications may he made without departing from 3O the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

Claims (66)

What we claim is:

1. A process sing: (a) providing a mixture comprising: (i) a first subset of particles comprising a recombinase, a single-stranded DNA binding protein (SSB) and a first oligonucleotide comprising a first detectable label; and (ii) a second subset of les comprising a recombinase, a single-stranded DNA g protein (SSB) and a second oligonucleotide comprising a second detectable label, wherein: the first oligonucleotide and the second oligonucleotide are different; and the first detectable label and the second detectable label are different; and (b) ndently observing or determining the number or tion of the first subset of particles and the second subset of particles in the mixture, wherein the les comprise one or more of the recombinase, the single-stranded DNA binding protein (SSB) and at least one of the first oligonucleotide and the second oligonucleotide.

2. The process of claim 1, wherein the mixture comprises a crowding agent.

3. The process of claim 2, wherein the crowding agent comprises polyethylene glycol, polyvinyl l, dextran and/or Ficoll.

4. The process of claim 2 or claim 3, wherein the crowding agent comprises polyethylene glycol.

5. The process of claim 3 or claim 4, wherein the polyethylene glycol is ed from the group consisting of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG25000, PEG30000, PEG35000, 00, a PEG compound with a molecular weight between 15,000 and 20,000 daltons and any combination thereof.

6. The process of any one of claims 2 to 5, wherein the ng agent is present in the mixture at a concentration of between 1 to 12% by weight or by volume of the mixture.

7. The process of any one of claims 1 to 6, wherein the recombinase comprises a RecA or UvsX protein.

8. The process of any one of claims 1 to 7, wherein the single-stranded DNA binding protein (SSB) comprises a prokaryotic SSB protein or a gp32 protein.

9. The process of any one of claims 1 to 8, wherein the mixture further comprises one or more of: a DNA polymerase, a recombinase loading protein, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, ne kinase, a nuclease, a nucleic acid probe, a e transcriptase and a template nucleic acid.

10. The process of any one of claims 1 to 9, wherein the particles are about 0.5-20 µm in size.

11. The process of any one of claims 1 to 10, wherein said observing or determining the number or proportion of particles in the mixture comprises the use of microscopy.

12. The process of any one of claims 1 to 10, wherein said observing or ining the number or proportion of particles in the e comprises the use of a microfluidic device.

13. The process of any one of claims 1 to 10, wherein said observing or determining the number or tion of les in the mixture comprises the use of flow cytometry.

14. The process of any one of claims 1 to 10, wherein the particles are about 1-10 µm in size.

15. The process of any one of claims 1 to 14, wherein said ing or determining the number or proportion of particles is performed using fluorescence from the particles.

16. The process of any one of claims 1 to 14, wherein said observing or determining the number or proportion of particles is performed without using fluorescence from the particles.

17. The process of any one of claims 1 to 14, wherein the number or proportion of the first subset of particles is observed or determined using fluorescence from the first subset of particles, and the number or proportion of the second subset of particles is observed or determined without using fluorescence from the second subset of les.

18. A process comprising: (a) providing a recombinase rase ication reaction mixture comprising: a recombinase; a single-stranded DNA g protein (SSB); and one or more oligonucleotides; (b) contacting in a solution the recombinase polymerase amplification reaction mixture with a template c acid; (c) ining the reaction mixture under ions that allow for production of nucleic acid amplification products in the reaction mixture; and (d) detecting particles associated with the nucleic acid ication products in the reaction mixture by observing particles or determining the number or proportion of particles associated with the nucleic acid amplification ts in the reaction mixture.

19. The process of claim 18, wherein the detecting of step (d) is performed within 10 minutes of when the maintaining of step (c) .

20. The process of claim 18 or claim 19, wherein the reaction mixture comprises a ng agent.

21. The process of any one of claims 18 to 20, wherein the detecting of step (d) comprises detecting single les associated with two or more distinct nucleic acid amplification products.

22. The process of any one of claims 18 to 21, wherein the particles are about 0.5-20 µm in size.

23. The process of any one of claims 18 to 22, wherein the particles are detected using fluorescence from the particles.

24. The s of any one of claims 18 to 22, wherein the particles are detected without using fluorescence from the particles.

25. The process of any one of claims 18 to 22, wherein the particles comprise a first subset of particles and a second subset of particles, wherein the first subset of particles is detected using fluorescence from the first subset of particles, and the second subset of particles are detected without using fluorescence from the second subset of particles.

26. The process of claim 20, wherein the ng agent comprises polyethylene glycol, polyvinyl alcohol, dextran and/or Ficoll.

27. The process of claim 20 or claim 26, wherein the crowding agent comprises polyethylene glycol.

28. The process of claim 26 or claim 27, wherein the polyethylene glycol is selected from the group consisting of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, 00, 00, PEG25000, PEG30000, PEG35000, 00 and any combination thereof.

29. The process of any one of claims 20 and 26 to 28, wherein the crowding agent is present in the mixture at a concentration of between 1 to 12% by weight or by volume of the e.

30. The process of any one of claims 18 to 29, wherein the recombinase comprises a RecA or UvsX protein.

31. The process of any one of claims 18 to 30, wherein the single-stranded DNA binding protein (SSB) comprises a prokaryotic SSB protein or a SSB protein derived from myoviridae phage.

32. The process of any one of claims 18 to 31, wherein at least one of the one or more oligonucleotides comprises a detectable label.

33. The process of any one of claims 18 to 32, wherein the particles se one or more of the recombinase, the single-stranded DNA binding protein (SSB) and at least one of the one or more oligonucleotides.

34. The process of any one of claims 18 to 33, wherein the mixture further comprises one or more of: a DNA polymerase, a recombinase loading protein, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, ne kinase, a se, a nucleic acid probe, and a reverse transcriptase.

35. The process of any one of claims 18 to 34, wherein the particles are about 1-10 µm in size.

36. The process of any one of claims 18 to 35, wherein said detecting particles in the mixture comprises the use of microscopy.

37. The process of any one of claims 18 to 35, wherein said detecting les in the e comprises the use of flow cytometry.

38. The process of any one of claims 18 to 37, wherein the les comprise one or more of the recombinase, the single-stranded DNA binding protein (SSB), at least one of the one or more oligonucleotides, and a template nucleic acid.

39. The process of any one of claims 18 to 38, wherein said detecting further comprises determining a number or proportion of particles which are not associated with the nucleic acid amplification ts.

40. The process of claim 36, further comprising the use of a camera.

41. The process of claim 37, further comprising the use of a camera.

42. The process of claim 18, wherein detecting particles comprises the use of a camera.

43. The process of any one of claims 20 and 26 to 29, wherein the crowding agent is present at a concentration of between 2% and 8%.

44. The process of any one of claims 20, 26 to 29 and 43, n the crowding agent is present at a concentration of between 4% and 5.5%.

45. The process of claim 31, wherein the single-stranded DNA g protein (SSB) ses a T4 gp32 protein or a Rb69 gp32 protein.

46. The process of claim 31, wherein the single-stranded DNA binding protein (SSB) comprises an E. coli SSB.

47. The process of claim 27, wherein the polyethylene glycol is a PEG compound with a molecular weight of n 15,000 and 20,000 daltons.

48. A process comprising: (a) providing a mixture comprising a recombinase, a single-stranded DNA binding protein and one or more ucleotides; and (b) detecting les associated with nucleic acid amplification products in the mixture by ing particles or determining the number or tion of particles associated with the nucleic acid amplification products in the mixture.

49. The process of claim 48, wherein the mixture comprises a crowding agent.

50. The process of claim 49, wherein the crowding agent comprises polyethylene glycol, polyvinyl alcohol, dextran and/or ficoll.

51. The process of claim 49 or claim 50, wherein the crowding agent comprises polyethylene glycol.

52. The process of claim 50 or claim 51, wherein the polyethylene glycol is selected from the group consisting of PEG1450, 0, PEG8000, PEG10000, PEG14000, 00, PEG20000, PEG250000, PEG30000, 00, PEG40000, a PEG compound with a molecular weight between 15,000 and 20,000 daltons and any combination thereof.

53. The process of any one of claims 49 to 52, wherein the crowding agent is present in the mixture at a concentration between 1 to 12% by weight or by volume of the mixture.

54. The process of any one of claims 48 to 53, wherein the recombinase comprises a RecA or UvsX protein.

55. The process of any one of claims 48 to 54, wherein the single-stranded DNA binding protein comprises a prokaryotic SSB protein or a gp32 protein.

56. The process of any one of claims 48 to 55, wherein at least one of the one or more oligonucleotides ses a detectable label.

57. The s of any one of claims 48 to 55, n the particles comprise one or more of the inase, the single-stranded DNA binding n and at least one of the one or more oligonucleotides.

58. The process of any one of claims 48 to 57, wherein the mixture further comprises one or more of: a DNA polymerase; a recombinase loading protein; dNTPs or a mixture of dNTPs and ddNTPs; a reducing agent; creatine ; a nuclease; a nucleic acid probe; a reverse transcriptase; and a template nucleic acid.

59. The process of any one of claims 48 to 58, wherein said detecting particles in the mixture comprises the use of microscopy.

60. The process of any one of claims 48 to 58, wherein said detecting particles in the e comprises the use of a microfluidic device.

61. The process of any one of claims 48 to 58, wherein said detecting les in the mixture comprises the use of flow cytometry.

62. The process of any one of claims 48 to 61, wherein the particles are about 0.5-20 µm in size.

63. The process of any one of claims 48 to 62, wherein the les are about 1-10 µm in size.

64. The process of any one of claims 48 to 63, wherein the particles are detected using fluorescence from the particles.

65. The process of any one of claims 48 to 63, wherein the particles are detected without using fluorescence from the particles.

66. The process of any one of claims 48 to 63, wherein the particles se a first subset of particles and a second subset of particles, the first subset of particles is detected using fluorescence from the first subset of les, and the second subset of particles are detected without using fluorescence from the second subset of particles. Alere San Diego, Inc. by the patent attorneys for the applicant CULLENS 000000000000000000000000 / v. /// '/ / //4?”/ /7// /////'K////////W/ /// meW/A,2-/ /// /WW/ W////)’/////7///// /W‘:”1/M46? // \ ./ \ It/ \ ”/IWW J z4,WW \ // \ \ \ \ \ \ ’4”fl/WA \ \ \ \ \ \\\\\\ 'WW/k\flZV Ig; . . .4 h z \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\‘ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\‘\\ §\\\\\\\\\\\\\\\\‘s\Wmmm\\x\ .\ \\\\\\\\\\\\\\\\\\\\\\ \\N\ N\\\N \ \V VV VV VV VV V\§ VV\\:‘ \ \\\\\\\\\\\\\\\\\\\\\\\\\¥ \\\\\\\\\\..\\\\\\\\\\\\\V \\\\\\\\\\\\\\\\\\\\\\ Q\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\t\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\W// \ \\\\\\\\\\\\\\§\\\\\\\\\\\\\\\\\ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\§\N \\\\\\\\\\\\\\\\\\\\\\\\\\.\\\\\\\\\\\\.\ \\\\\\\\\\\\§\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\\\\\\\\\\\\\\\\\\\\\\\.\\\\\.\\\§§\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\\Q\ \\\\\\\\\m\\ \ \ \ \\\\\\\\\ \\\\\\\\\\\ \\\\\\\\\\\\\ xx“1 \\ \\\\\\\\“ \W‘\\\\\\\\\\\\\\\\\ \VW“ \\ \\\\\\\\\\\\\\\\‘ \\\\\\\\\\\\\‘ . . N PEG. 2