NZ613457B2 - Systems and methods for sample use maximization - Google Patents

Systems and methods for sample use maximization Download PDF

Info

Publication number
NZ613457B2
NZ613457B2 NZ613457A NZ61345712A NZ613457B2 NZ 613457 B2 NZ613457 B2 NZ 613457B2 NZ 613457 A NZ613457 A NZ 613457A NZ 61345712 A NZ61345712 A NZ 61345712A NZ 613457 B2 NZ613457 B2 NZ 613457B2
Authority
NZ
New Zealand
Prior art keywords
sample
assay
tip
analyte
concentration
Prior art date
Application number
NZ613457A
Other versions
NZ613457A (en
Inventor
Sunny Balwani
Anthony Delacruz
Andrew Drake
Ian Gibbons
Elizabeth Holmes
Timothy Michael Kemp
Tony Nugent
Chinmay Pangarkar
Daniel Young
Original Assignee
Theranos Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Theranos Inc filed Critical Theranos Inc
Priority to NZ706352A priority Critical patent/NZ706352B2/en
Priority claimed from PCT/US2012/022130 external-priority patent/WO2012100235A2/en
Publication of NZ613457A publication Critical patent/NZ613457A/en
Publication of NZ613457B2 publication Critical patent/NZ613457B2/en

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/16—Surface properties and coatings
    • B01L2300/168—Specific optical properties, e.g. reflective coatings
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/02—Burettes; Pipettes
    • B01L3/0275—Interchangeable or disposable dispensing tips
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B04—CENTRIFUGAL APPARATUS OR MACHINES FOR CARRYING-OUT PHYSICAL OR CHEMICAL PROCESSES
    • B04B—CENTRIFUGES
    • B04B5/00—Other centrifuges
    • B04B5/04—Radial chamber apparatus for separating predominantly liquid mixtures, e.g. butyrometers
    • B04B5/0407—Radial chamber apparatus for separating predominantly liquid mixtures, e.g. butyrometers for liquids contained in receptacles
    • B04B5/0414—Radial chamber apparatus for separating predominantly liquid mixtures, e.g. butyrometers for liquids contained in receptacles comprising test tubes
    • B04B5/0421—Radial chamber apparatus for separating predominantly liquid mixtures, e.g. butyrometers for liquids contained in receptacles comprising test tubes pivotably mounted
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/52—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving transaminase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00—Sampling; Preparing specimens for investigation
    • G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
    • G01N1/40—Concentrating samples
    • G01N1/4077—Concentrating samples by other techniques involving separation of suspended solids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00—Sampling; Preparing specimens for investigation
    • G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
    • G01N1/40—Concentrating samples
    • G01N1/4077—Concentrating samples by other techniques involving separation of suspended solids
    • G01N2001/4083—Concentrating samples by other techniques involving separation of suspended solids sedimentation
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N2035/00465—Separating and mixing arrangements
    • G01N2035/00495—Centrifuges
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/10—Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices
    • G01N35/1009—Characterised by arrangements for controlling the aspiration or dispense of liquids
    • G01N35/1016—Control of the volume dispensed or introduced
    • G01N2035/1018—Detecting inhomogeneities, e.g. foam, bubbles, clots
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/01—Arrangements or apparatus for facilitating the optical investigation
    • G01N21/03—Cuvette constructions
    • G01N21/0303—Optical path conditioning in cuvettes, e.g. windows; adapted optical elements or systems; path modifying or adjustment
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/01—Arrangements or apparatus for facilitating the optical investigation
    • G01N21/03—Cuvette constructions
    • G01N21/05—Flow-through cuvettes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/47—Scattering, i.e. diffuse reflection
    • G01N21/49—Scattering, i.e. diffuse reflection within a body or fluid
    • G01N21/51—Scattering, i.e. diffuse reflection within a body or fluid inside a container, e.g. in an ampoule
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/59—Transmissivity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/575—Hormones
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/575—Hormones
    • G01N2333/62—Insulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/91188—Transferases (2.) transferring nitrogenous groups (2.6)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433—Serine endopeptidases (3.4.21)
    • G01N2333/96441—Serine endopeptidases (3.4.21) with definite EC number
    • G01N2333/96463—Blood coagulation factors not provided for in a preceding group or according to more than one of the proceeding groups
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54326—Magnetic particles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54393—Improving reaction conditions or stability, e.g. by coating or irradiation of surface, by reduction of non-specific binding, by promotion of specific binding
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • G01N33/56972—White blood cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G01N33/743—Steroid hormones
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/80—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood groups or blood types or red blood cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/82—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving vitamins or their receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/10—Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices
    • G—PHYSICS
    • G06—COMPUTING; CALCULATING OR COUNTING
    • G06T—IMAGE DATA PROCESSING OR GENERATION, IN GENERAL
    • G06T2207/00—Indexing scheme for image analysis or image enhancement
    • G06T2207/30—Subject of image; Context of image processing
    • G06T2207/30004—Biomedical image processing
    • G—PHYSICS
    • G06—COMPUTING; CALCULATING OR COUNTING
    • G06T—IMAGE DATA PROCESSING OR GENERATION, IN GENERAL
    • G06T2207/00—Indexing scheme for image analysis or image enhancement
    • G06T2207/30—Subject of image; Context of image processing
    • G06T2207/30168—Image quality inspection
    • G—PHYSICS
    • G06—COMPUTING; CALCULATING OR COUNTING
    • G06T—IMAGE DATA PROCESSING OR GENERATION, IN GENERAL
    • G06T3/00—Geometric image transformations in the plane of the image
    • G06T3/40—Scaling of whole images or parts thereof, e.g. expanding or contracting
    • G06T3/4084—Scaling of whole images or parts thereof, e.g. expanding or contracting in the transform domain, e.g. fast Fourier transform [FFT] domain scaling
    • G—PHYSICS
    • G06—COMPUTING; CALCULATING OR COUNTING
    • G06T—IMAGE DATA PROCESSING OR GENERATION, IN GENERAL
    • G06T7/00—Image analysis
    • G06T7/0002—Inspection of images, e.g. flaw detection
    • G—PHYSICS
    • G06—COMPUTING; CALCULATING OR COUNTING
    • G06T—IMAGE DATA PROCESSING OR GENERATION, IN GENERAL
    • G06T7/00—Image analysis
    • G06T7/0002—Inspection of images, e.g. flaw detection
    • G06T7/0012—Biomedical image inspection
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16C—COMPUTATIONAL CHEMISTRY; CHEMOINFORMATICS; COMPUTATIONAL MATERIALS SCIENCE
    • G16C20/00—Chemoinformatics, i.e. ICT specially adapted for the handling of physicochemical or structural data of chemical particles, elements, compounds or mixtures
    • G16C20/20—Identification of molecular entities, parts thereof or of chemical compositions
    • H04N5/23222—

Abstract

Disclosed is a method of measuring an analyte concentration in a sample fluid. The method comprises providing the sample contained in a container dimensioned with a plurality of distinct widths to permit transmission of light along a plurality of varying path lengths that correspond to the plurality of distinct widths. The container is then illuminated along at least one of the plurality of path lengths. The container is illuminated to measure a first light intensity transmitted across said at least one of the plurality of path lengths, for the determination of the concentration of the analyte based on the measured first light intensity. of distinct widths. The container is then illuminated along at least one of the plurality of path lengths. The container is illuminated to measure a first light intensity transmitted across said at least one of the plurality of path lengths, for the determination of the concentration of the analyte based on the measured first light intensity.

Description

ation] eaa SYSTEMS AND METHODS FOR SAMPLE USE MAXIMIZATION CROSS-REFERENCE This application claims priority to US. Provisional Patent Application Serial No. 61/435,250, filed January 21, 201 l, which ation is entirely incorporated herein by nce.
BACKGROUND OF THE INVENTION The discovery of a vast number of disease kers, new therapies and the establishment of miniaturized medical systems have opened up new avenues for the prediction, diagnosis and monitoring of ent of diseases in a point-of-care or other buted test settings. Point-of-care systems can rapidly deliver test results to medical personnel, other medical professionals and patients. Early diagnosis of a e or disease progression and monitoring of therapy are often al for treatment of deadly conditions such as certain cancers and infectious diseases.
Diagnosis and treatment of diseases can take advantage of multiplexed biomarker measurements, which provide additional knowledge of the condition of a patient. For example, when monitoring the effects of a drug, three or more biomarkers can be measured in parallel. Typically, microtiter plates and other similar apparatuses have been used to perform multiplexed separation-based assays. A microtiter plate (for example, a 384 well microtiter plate) can perform a large number of assays in parallel.
In a Point-of-Care (POC) device, the number of assays that can be performed in parallel is often limited by the size of the deVice and the volume of the sample to be analyzed. In many POC devices, the number assays performed is about 1 to 10. A POC device capable of performing multiplexed assays on a small sample would be desirable.
A shortcoming ofmany multiplexed POC assay devices is the high cost of manufacturing the components of the device. If the device is disposable, the cost of the components can make the manufacturing of a POC deVice impractical. Further, for multiplexed POC devices that incorporate all of the ary reagents onboard of the deVice, if any one of those reagents exhibit instability, an entire manufactured lot of devices may have to be discarded even if all the other reagents are still usable.
When a customer is interested in customizing a POC device to a particular set of analytes, manufacturers of multiplexed POC assay systems are often confronted with the need to mix and match the assays and ts of the device. A multiplexed POC assay suitable to each customer can be very expensive, difficult to calibrate, and difficult to maintain quality control.
POC methods have proven to be very valuable in monitoring disease and y (for e, blood glucose systems in diabetes therapy, Prothrombin Time ement in anticoagulant therapy using Warfarin). By ing multiple markers, it is ed that x diseases (such as cancer) for which multi-drug therapies are required can be better monitored and controlled.
There exists the need to use multiple sources of information for monitoring the health status or disease condition of individuals as well as treatments of various diseases. Especially ant is the measurement of concentrations of several selected analytes (biomarkers, dies, gene expression levels, metabolites, therapeutic drug concentrations and the like) over time. To make this process convenient and [Annotation] eaa maximally ive, logies that enable measurement of any and all needed analytes (of whatever types) using a small blood sample (blood drop obtained by finger-stick) or other le sample are particularly valuable. Such technology will ideally be operable by non-technically trained users in distributed test settings, e. g., homes, s, doctor’s offices, pharmacies, and retail shops. The present invention addresses these issues and allows for one to be able to make such measurements routinely in patient’s home or other non-laboratory setting.
There also exists the need to make the greatest use of available samples, particularly in the ce where samples (e.g., blood samples) are limited by sample size. Blood s are used for the great ty of medical/clinical tests. Blood cells have to be separated from plasma (or serum) prior to most types of analysis since the presence of cells would compromise the assay chemistries. For example, glucose and cholesterol are often ed by forming chemistries which would be interfered with by the presence of formed ts, especially red cells, or hemoglobin (from lysed red cells).
Distributed test systems ideally require a small blood sample ed by fingerstick methods.
Such samples may be as small as 20 microliters (uL) (one drop) or less. Larger volume samples (say up to 200 uL) usually cannot be taken by fingerstick methods without repeated, inconvenient (“milking") of fingers.
Alternatively venous samples of several milliliters (mL) can be taken but this requires a medically trained tomist.
It is usually very difficult to perform more than a single assay using small blood sample with 20 uL or less. This is especially so when the blood sample has to be filtered to remove cells and the recovery of usable plasma from such small s is inefficient. Typically only about 5 uL or less of plasma can be recovered. Samples as large as 200 uL can be efficiently separated by automated POC systems (Abaxis, Biosite etc.) but this cannot be done routinely unless a technician is available to draw the .
SUMMARY OF THE ION In view of the limitations of current methods, there is a pressing need for improved methods of automatically separating plasma and/or other materials from blood cells. There is also a need for improved accuracy of these measurements on analyte concentration. In measurements of biomarkers and other components of blood for the purposes of monitoring therapy and diagnosis, it is important that the correct volume of sample be used. In a laboratory setting, this is achieved by ing complex automated ments and skilled professional staff members. In contrast in -of-care" settings such as homes, retail pharmacies and shops, and the like, the methods and equipment used must enable non-technically trained people reliably to obtain and process samples.
The present invention addresses the aforementioned needs and provides related advantages.
In some embodiments, the present invention relates to point-of-care and/or point-of-service devices. In some embodiments, the present invention relates to systems, devices, user interfaces, and methods for assaying samples using a point-of-care and/or point-of—service .
In one aspect, the devices and methods disclosed herein are designed to identify the sample type (blood versus plasma and etc.) to measure the volume of sample early enough in the assay procedure to ensure an appropriate sample is used is an intended assay. In another aspect, the present invention also allows for one to be able to correct for significant volume errors that occur in performing an assay.
[Annotation] eaa In yet another aspect, this invention allows for simultaneous measurements on several es of different types with high accuracy.
An aspect of the invention may be directed to an ted system for separating one or more components in a biological fluid. The automated system may comprise a pipette tip or closed tube adapted to engage with an tor wherein said pipette tip or tube comprises two opposing ends, at least one of which is closed or sealable; and a fuge configured to e said sealed pipette tip or closed tube to effect said separating of one or more components in a biological fluid. In an embodiment, the one or more ents are selected from the group consisting of blood plasma, blood serum, blood cells, and particulates. In another embodiment, when the pipette tip is engaged with the aspirator to effect a draw of the biological fluid. In another embodiment, the pipette tip has an open end that forms an ht seal with the aspirator. In another embodiment, the system further comprises an imaging device; and at least one other pipette tip ioned to allow sing of a liquid into the pipette tip or tube of (a) or to allow the aspiration of a liquid from the pipette tip or tube of (a). In another embodiment, the pipette tip or closed tube is oriented vertically when the centrifuge is at rest. In another embodiment, the pipette tip or closed tube is oriented ntally when the centrifuge is ng at a predetermined rotational velocity.
Another aspect of the ion may be a method for isolating components in a sample comprising one or more of the following steps: loading a sample into a pipette tip or a tube comprising two opposing ends, at least one of which is sealable or sealed; sealing the pipette tip on the at least one end of the pipette tip; fuging the sealed pipette tip, thereby forming an interfacial region that separates the sample into a atant and a pellet; imaging the centrifuged pipette tip to determine the location of the interfacial region; and automatically aspirating the supernatant based on the location of the interfacial region. In an ment, the method further comprises determining the location of the supernatant by said imaging step and automatically aspirating the supernatant based on the location of the supernatant. In another embodiment, the determination occurs with the aid of a processor, and said processor provides instructions to an aspirating device which performs the automated aspiration step. In another embodiment, the imaging occurs by use of a camera that is configured to capture the image of the side profile of the pipette tip or the tube. In another embodiment, the supernatant includes one or more of the following: blood plasma or blood serum. In another embodiment, the pellet includes one or more of the following: blood cells or particulates.
A computer-assisted method for characterizing an analyte suspected to be present in a sample may be provided in accordance with an additional aspect of the invention. The computer-assisted method may comprise obtaining a l image of the sample, wherein the digital image comprises at least a two- dimensional array of pixels, and wherein each pixel comprises a plurality of intensity values, each of which ponds to a distinct detection spectral region; correlating, with the aid of a mmable device, the obtained intensity values with a predetermined set of values that define a c range of each ion spectral region; and predicting the presence and/or ty of said analyte in the sample based on said correlating of the obtained intensity values with a predetermine set of values. In an embodiment, the ity of intensity values comprise intensity values for red, green, and blue detection spectral regions. In another embodiment, the method further comprises selecting an illumination wavelength, and illuminating the sample with the selected illumination wavelength prior to and/or concurrently with obtaining the digital image. In another embodiment, the method further comprises, subsequent to obtaining the digital image, (a) selecting [Annotation] eaa another illumination wavelength; (b) illuminating the sample with the other selected illumination wavelength; (c) ing another digital image of the sample, wherein the digital image comprises at least a two- dimensional array of pixels, and wherein each pixel comprises a plurality of intensity values, each of which ponds to a distinct detection spectral region; and (d) predicting the presence and/or quantity of said analyte in the sample based on the obtained intensity values from the digital image and said another digital image.
Also, an aspect of the invention may be directed to a method of measuring an analyte concentration in a sample fluid comprising providing the sample contained in a container dimensioned with a plurality of distinct widths to permit ission of light along a plurality of varying path lengths that correspond to the plurality of distinct widths; nating the container along at least one of the plurality of path lengths; and imaging the container to measure a first light intensity transmitted across said at least one of the plurality of path lengths, for the determination of the concentration of the analyte based on the measured first light intensity.
In accordance with another aspect of the invention, a method of detecting the presence or concentration of an analyte in a sample fluid ned in a container (e. g., cuvette) may comprise nating the container along a first region having a first path length to yield a first measurement of light ity itted across the first path length; moving the sample fluid to another region in the container having another path length if the first measurement falls outside a predetermined dynamic range of transmitted light intensity; illuminating the container along the another region to yield r measurement of light intensity transmitted across the r path length; and optionally repeating second and third steps until a measurement of light ity falls within the predetermined dynamic range, thereby detecting the presence or concentration of the analyte. In an embodiment, the method further comprises deconvoluting a line scan of the image, y detecting the presence or tration of an analyte. In another embodiment, the sample is moved from a first region of the container having a first path length to a second region of the container having another path length by aspirating the . In another embodiment, an end of the container is attached to a pipette which is configured to aspirate the sample. In another embodiment, the sample is moved up or down the length of the container. In another embodiment, the container is a pipette tip. In another embodiment, the container is conically shaped. In another embodiment, the container has two open ends. In another embodiment, a first open end has a greater diameter than a second open end. In r embodiment, the container has a plurality of distinct widths to permit transmission of light along a plurality of varying path lengths. In r embodiment, the container volume is less than 100 microliters. In another embodiment, a plurality of distinct path lengths are imaged simultaneously.
A method may be provided as an onal aspect of the ion. The method may be provided for characterizing an analyte suspected to be present in a sample of biological fluid, said method comprising: providing said sample of biological fluid; allowing said analyte to react with one or more reagents that specifically react with said analyte to generate an lly detectable signal; and measuring said optically detectable signal with a ity of detection spectral regions, n the presence of said optically detectable signal within a dynamic range of at least one detection spectral region is indicative of the concentration of said analyte in said sample of biological fluid. In an embodiment, the measuring is performed by an imaging device red to measure a plurality of detection spectral regions. In another embodiment, the imaging deVice is [Annotation] eaa configured to measure the plurality of ion spectral s simultaneously. In another embodiment, the imaging device is configured to measure the plurality of detection spectral regions sequentially.
An aspect of the invention provides a method for increasing the accuracy of an assay comprising imaging a sample in a first tip to ine the volume of the first sample; imaging one or more reagents in a second tip to determine the volume of the one or more reagents; mixing the sample and the one or more reagents to form a reaction mixture; g the reaction mixture; correcting a calibration based on said determined volumes of the sample and the one or more reagents; and calculating a concentration of an analyte using the ted calibration. In an embodiment, the method r comprises imaging the reaction mixture to determine the volume of the reaction mixture. In another embodiment, the imaging of the sample in the first tip is conducted using a camera configured to e a side profile of the first tip. In another embodiment, imaging of the one or more reagents in the second tip is ted using a camera configured to capture a side profile of the second tip. In another embodiment, the height of the sample and the one or more reagents is calculated based on the captured profiles. In another embodiment, determining the volume is based on the height of the sample and the one or more reagents and the known cross-sectional areas of the sample and the one or more reagents respectively. In r embodiment, the calibration is also based on the determined volume of the reaction mixture.
Another aspect of the ion provides a setup, comprising: a vessel configured to accept and confine a sample, wherein the vessel ses an interior surface, an exterior surface, an open end, and an opposing closed end; and a tip configured to extend into the vessel through the open end, wherein the tip comprises a first open end and second open end, wherein the second open end is inserted into the vessel, wherein the vessel or the tip further comprises a protruding surface feature that prevents the second open end of the tip from contacting the bottom of the interior e of the closed end of the vessel. In an embodiment, the surface feature is integrally formed on the bottom interior surface of the vessel. In r embodiment, the surface feature comprises a ity of bumps on the bottom interior surface of the . In r embodiment, the protruding surface feature is at or near the closed end.
Another aspect of the invention provides a sample processing apparatus comprising a sample preparation station, assay station, and/or ion station; a control unit having computer-executable commands for performing a point-of-service service at a designated location with the aid of at least one of said sample preparation n, assay station and detection station; and at least one centrifuge configured to perform centrifilgation of a sample from a fingerstick. In an embodiment, the centrifuge is ned within the sample preparation station and/or the assay station. In another embodiment, the computer-executable commands are configured to perform the point-of-service e at a site selected from the group consisting of a retailer site, the subject’s home, or a health assessment/treatment location.
Another aspect of the invention provides a method for dynamic feedback, said method comprising: taking an initial measurement of a sample within a container using a detection mechanism; based on said initial measurement, determining, using a processor, whether the sample concentration falls into a desired range, and determining, using a processor, (a) a degree of dilution to be performed if the sample concentration is higher than the desired range or (b) a degree of concentration to be performed if the sample concentration is lower than the desired range; and adjusting the sample tration according to the determined degree of dilution or the determined degree of concentration. In an embodiment, the method further ses taking a subsequent [Annotation] eaa measurement of the sample within the container. In another embodiment, the method further comprises, based on the subsequent measurement determining, using a processor, whether the sample concentration falls into a desired range. In another embodiment, the subsequent measurement is made using the detection mechanism. In another embodiment, the method further comprises determining a teristic of the sample based on the uent measurement. In another embodiment, the characteristic is selected from one or more of the ing: the ce or concentration of an analyte, the presence or concentration of a cell, and the morphology of the cell. In another embodiment, the subsequent measurement is made using a separate detection mechanism from the initial detection mechanism. In another embodiment, the initial measurement provides a crude cell concentration measurement of the sample. In another embodiment, the subsequent measurement provides a measurement of cell concentration of the sample of greater resolution than the initial measurement.
In another embodiment, the initial measurement is taken by g the . In another embodiment, the ing of the sample concentration permits detection of analyte that would otherwise fall outside the desired range. r aspect of the invention provides a method for providing quality control, said method comprising capturing an image of conditions under which a detection ism es a characteristic of a sample; and determining, using a processor, based on the image whether there are undesirable conditions under which the detection mechanism is operated. In an embodiment, the undesirable conditions es the presence of one or more undesirable materials. In another embodiment, the undesirable als includes one or more of the following: bubbles, particles, fibers, debris, and precipitates that interfere with the measurement of the characteristic of the sample. In another embodiment, the ion ism is a different mechanism from a mechanism used to capture the image. In another embodiment, the image is captured using a camera. In another embodiment, the method further comprises ing an alert if an rable condition is detected. In another embodiment, the method further comprises adjusting the sample if an undesirable condition is ed.
In another embodiment, the image includes an image of the sample. In another ment, the image includes an image of one or more of the following: the sample container or the detection mechanism.
Another aspect of the invention is an automated system for ting one or more components in a biological fluid comprising a centrifuge comprising one or more bucket configured to e a container to effect said separating of one or more components in a fluid sample; and the container, wherein the container es one or more shaped feature that is complementary to a shaped feature of the bucket. In an embodiment, the shaped feature of the bucket includes one or more shelf upon which a protruding portion of the container is ured to rest. In another embodiment, the bucket is configured to be capable of accepting a plurality of containers having different configurations, and wherein the shaped feature of the bucket includes a plurality of shelves, wherein a first container having a first configuration is configured to rest upon a first shelf, and a second container having a second configuration is configured to rest upon a second shelf.
Another aspect of the invention provides an assay unit comprising a first end and a second end; an outer surface; and an inner surface comprising one or more selected patterns each of which is lized thereon or therein with a capture reagent capable of capturing an analyte suspected to be present in a biological sample, wherein the first end and the second end are of different dimensions.
[Annotation] eaa Another aspect of the ion provides an assay unit comprising an identifier that is used to determine (a) the one or more capture reagents immobilized on the inner surface; and (b) source of the biological sample if the assay unit contains said sample.
Another aspect of the invention provides an assay unit comprising a plurality of selected patterns, each pattern of said plurality comprises a distinct capturing agent.
Other goals and advantages of the invention will be further appreciated and understood when considered in conjunction with the following ption and accompanying drawings. While the ing description may contain specific details describing particular embodiments of the invention, this should not be construed as limitations to the scope of the invention but rather as an exemplification of preferable embodiments. For each aspect of the invention, many variations are le as suggested herein that are known to those of ordinary skill in the art. A variety of changes and modifications can be made within the scope of the invention without departing from the spirit thereof The various compounds/devices disclosed herein can be used separately or conjunctively in any combination, for any methods disclosed herein alone or in any combinations.
ORATION BY REFERENCE All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was ically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS The novel features of the invention are set forth with ularity in the appended claims. A better tanding of the features and advantages of the present invention will be ed by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawing(s) of which: Figure 1 shows a side view of a centrifuge.
Figure 2 shows a face on view of a centrifuge.
Figure 3 shows a perspective view of the back of a fuge.
Figure 4 shows a top view of a sample tip.
Figure 5 shows a side view of a sample tip.
Figure 6 shows a sectional view of a sample tip.
Figure 7 shows a diagram of a sample tip positioned in a sample above a /packed cell interface.
Figure 8 shows a graph of centrifugation time as a function of revolutions per minute.
Figure 9 shows a graph of centrifugation time as a function of the radius of the centrifuge rotor.
Figure 10 shows an empty capped sample tip.
Figure 11 shows a capped sample tip containing a sample of a bodily fluid, e.g., blood.
Figure 12 shows a capped sample tip ning a sample of about 23% hematocrit blood after centrifugation.
[Annotation] eaa Figure 13 shows a capped sample tip containing a sample of about 31% hematocrit blood after fugation.
Figure 14 shows a capped sample tip containing a sample of about 40% hematocrit blood after centrifugation.
Figure 15 shows a capped sample tip ning a sample of about 52% hematocrit blood after centrifugation.
Figure 16 shows a capped sample tip containing a sample of 68% hematocrit blood after centrifugation.
Figure 17 shows a comparison of hematocrit measured using by digitally imaging system a centrifuged sample (“hematocrit, % reported") and hematocrit ed by standard ematocrit apparatus (“hematocrit, % target") Figure 18 shows a diagram of a tip used for reactions and a tip used for blood/plasma (dimensions shown in mm).
Figure 19 shows a cylindrical capillary ning a sample.
Figure 20 shows angles and dimensions for calculating volumes within a conical container, e. g. a capillary.
Figure 21 shows angles and ions for calculating volumes within a conical container, e. g., a capillary.
Figure 22 shows angles and dimensions for calculating volume of a spherical cap.
Figure 23 shows dimensions for calculating the volume of a sample contained within a cylindrical tip, where the sample has a single meniscus.
Figure 24 shows dimensions for calculating the volume of a sample contained within a cylindrical tip, where the sample has two i.
Figure 25 shows dimensions for calculating the volume of a sample contained within and/or associated with a cylindrical tip, where the sample has two i and one of which is external to the cylindrical tip.
Figure 26 shows dimensions for calculating the volume of a sample ned within a cylindrical tip, where there is a bubble in the sample.
Figure 27 shows dimensions for calculating the volume of a sample contained within a cylindrical tip, where there is a bubble in the sample that spans the width of the cylindrical tip.
Figure 28 shows dimensions for calculating the volume of a sample contained within and/or associated with a cylindrical tip, where the sample includes a pendant droplet of sample outside the rical tip.
Figure 29 shows dimensions for calculating the volume of a residual sample contained within a cylindrical tip.
Figure 30 shows a blood sample within a tip prior to being mixed with a magnetic reagent.
Figure 31 shows a blood sample being mixed with a magnetic reagent.
Figure 32 shows a blood sample mixed with a magnetic reagent.
Figure 33 shows a blood sample mixed with a magnetic reagent contained within a tip.
[Annotation] eaa Figure 34 shows a blood sample mixed with a magnetic reagent moved to a selected position within a tip.
Figure 35 shows a magnetic force d by a magnet (M) to a blood sample mixed with a magnetic reagent.
Figure 36 shows a blood sample that has been separated into a red cell component and a plasma component using magnetic force.
Figure 37 shows a well positioned beneath a tip ning a blood sample that has been separated into a red cell component and a plasma component.
Figure 38 shows a depiction of blood plasma being transferred from a tip to a well.
Figure 39 shows a tip after dispensing of blood plasma to a well.
Figure 40 shows a high contrast image of a cylindrical tip ning a liquid with low absorbance.
Figure 41 shows an image of a conical tip containing a liquid with high absorbance.
Figure 42 shows a tip with a high absorbance liquid showing two menisci within the tip.
Figure 43 shows a tip with a sample liquid and large s that span the diameter of the tip.
Figure 44 shows a tip containing water showing a clear upper us in a transparent tip or capillary.
Figure 45 shows a graph of computed Protein-C concentration as a function of sample volume.
Figure 46 shows an image of a sample transfer device with a capillary, housing, plunger, groove, and raised feature. The raised feature may help locate the plunger in the housing.
Figure 47 shows a sample contained with the capillary of a sample transfer device.
Figure 48 shows a sample transfer device after a sample has been ejected by a plunger.
Figure 49 shows a sample transfer device after a sample has been incompletely ejected.
Figure 50 shows a conical tip containing a sample, with the position L3 ted by the arrow shown.
Figure 51 shows a graph of the ratio of the distance between L2 and L1 and the distance between L3 and L1 as a function of sample volume.
Figure 52 shows a schematic of a chemical reaction that es a colored product.
Figure 53 shows a tic of a chemical reaction that produces a colored product from cholesterol.
Figure 54 shows a schematic of a chemical reaction that uses reducing equivalents to produce a colored product.
Figure 55 shows an example of a compound that changes color upon being xed with a metal ion.
Figure 56 shows a series of images of tips with two-fold decreasing concentration of n from right to left, except for the left-most tip, which has no albumin.
Figure 57 shows a series of images of tips with two-fold decreasing concentration of cholesterol from right to left, except for the left-most tip, which has no cholesterol.
[Annotation] eaa Figure 58 shows a series of hemispherical wells machined from a block of white opaque plastic, which each well having two-fold decreasing concentration of analyte from right to left, except for the left-most well, which has no analyte. In some embodiments, the analyte may be calcium.
Figure 59 shows a series of hemispherical wells machined from a block of white opaque plastic, which each well having two-fold decreasing concentration of analyte from right to left, except for the left-most well, which has no analyte. In some embodiments, the analyte may be magnesium.
Figure 60 shows a series of hemispherical wells machined from a block of white opaque plastic, which each well having two-fold decreasing concentration of analyte from right to left, except for the left-most well, which has no analyte. In some embodiments, the analyte may be urea.
Figure 61 shows a series of tips containing bromophenol blue solutions.
Figure 62 is an illustration of tips having a plurality of distinct optical path lengths.
Figure 63 shows a light path through a rectangular e.
Figure 64 shows a light path through a iter well.
Figure 65 shows a light path through a conically shaped cuvette.
Figure 66 shows a graph of light intensity as a function of on as measured on tips containing samples with varying concentration of henol blue solutions for red, green, and blue color channels.
Figure 67 shows an image of the tips that were analyzed in Figure 66.
Figure 68 shows a graph of signal as a on of bromophenol blue concentration as measured by red, green, and blue color ls. The optical density may be measured at 589 nm.
Figure 69 shows a log scale graph of signal response as a function of bromophenol blue concentration as measured by blue (diamonds) and red es) color channels.
Figure 70 shows a graph of tration measured by color analysis of digital images as a function actual concentration.
Figure 71 shows a graph of signal response as measured by red (squares), green (diamonds), and blue (triangles) color ls as a function of albumin concentration.
Figure 72 shows three graphs of signal se as measured for green, red, and blue color channels for polystyrene latex particles.
Figure 73 shows tips that each separately n reagents NADH, WST-l, PMS, and two tips containing a mixture of the reagents.
] Figure 74 shows a digital image of tips containing two-fold sing concentration of lactate dehydrogenase (LDH) from left to right.
Figure 75 shows a graph of optical density measured at 450 nm as a function of LDH.
Figure 76 shows solutions of potassium chloride added to potassium assay strips.
Figure 77 shows tips containing blood s mixed with blood typing reagents for , Anti- B, Anti-D, and Control (from left to right).
Figure 78 shows measured signals for signal as a function of position for red (left column), green (middle column), and blue (right column) for samples mixed with Anti-A, Anti B, Anti-D, and Control reagents.
Figure 79 shows normalized signal as a function of relative concentration measured for narrow and wide path lengths using red, green, and blue color channels.
[Annotation] eaa Figure 80 shows a graph of log of measured concentration as a function of actual concentration, illustrating the accuracy of the measurement algorithm.
Figure 81 shows a fluorescence image of assay ts in tubes.
Figure 82 shows an image of on products in tips.
Figure 83 shows an image of reaction products in tips.
Figure 84 shows an image of reaction products in tips.
Figure 85 shows an image of reaction products in tips.
Figure 86 shows an image of reaction products in tips.
Figure 87 shows an image of reaction products in tips.
Figure 88 shows a background color image obtained for calibration.
Figure 89 shows a fluorescence image of reaction products in tips.
Figure 90 shows red and blue color channel response and fluorescence response as a on of DNA copy number.
Figure 91 shows graph of transformed 3-color signal as a function of fluorescence signal.
Figure 92 shows a graph of green channel signal response as a function of pixel position.
Figure 93 shows an image of tips containing solutions of bromophenol blue and water.
Figure 94 shows an image of additional tips that may contain solutions of bromophenol blue and water.
] Figure 95 shows an schematic of a tip containing reaction mixtures to perform le assays.
Figure 96 shows an image of tips containing solutions of bromophenol blue and water.
Figure 97 shows a graph of signal response for sample, water, and control in multiple standards.
The samples may be aqueous calibrators containing known concentrations of analyte.
Figure 98 shows tips containing assays for both Ca2+ (upper region of the tip) and Mg2+ (lower region of the tip).
Figure 99 shows four tips with s types of serum samples: zed (reddish in color), lipemic (gray), icteric (yellow in , and normal (from left to .
Figure 100 shows a schematic of a camera and optical components.
Figure 101 shows a cross-sectional View of a camera and optical components ing a white light source, an aperture, and a .
Figure 102 shows a tic of an optical setup for measuring light signal using (A) a sensor that is positioned to detect light at a perpendicular angle to an tion beam, and (B) a sensor that is positioned in line with an tion beam.
Figure 103 shows images taken using (A) an excitation beam perpendicular to a sensor and (B) an excitation beam that is in line with a .
Figure 104 shows an array of printed dyes that can be used to calibrate the optical setup.
Figure 105 shows a graph of signal as a function of sample volume. Series 1-5 may correspond to different analyte concentrations, such as 0, 20, 40, 60, and 80 respectively.
Figure 106 shows a graph of signal as a function of sample volume. Series 1-5 may correspond to different analyte concentrations, such as 0, 20, 40, 60, and 80 respectively.
[Annotation] eaa Figure 107 shows a graph of signal as a function of sample volume. Series 1-5 may correspond to different e concentrations, such as 0, 20, 40, 60, and 80 respectively.
Figure 108 shows a graph of measured analyte concentration as a function of actual analyte concentration.
Figure 109 shows a graph of ed analyte concentration as a function of actual analyte concentration.
Figure 110 schematically illustrates an exemplary method for an ELISA assay.
Figure 111 shows an example of a rotor at rest with buckets vertical.
Figure 112 shows an example of a rotor at a speed with buckets at a small angle to horizontal.
Figure 113 shows an example of a bucket configuration.
Figure 114 shows an example of a centrifugation vessel mated with the bucket.
Figure 115 shows an example of another centrifugation vessel that can be mated with the bucket.
Figure 116 shows an example of a centrifugation vessel.
Figure 117 shows an example of an extraction tip.
Figure 118 provides an example ofhow the centrifugation vessel and extraction tip may mate.
] Figure 119 is an image that was taken of the original reaction e prior to centrifugation.
Figure 120 is another image that was taken of the original reaction mixture prior to centrifugation Figure 121 is an additional image that was taken of the original reaction mixture prior to centrifugation Figure 122 shows results as distance of the interface from the plasma meniscus.
Figure 123 es an example of a fluorescence micrograph showing labeled leukocytes.
Figure 124 provides an example of intracellular patterns using eld images.
Figure 125 provides an example of multi-parameter acquisition of data from labeled cell samples.
Figure 126 provides an example of field images of human whole blood.
Figure 127 provides an example of quantitative multi-parametric data acquisition and analysis.
Figure 128 shows ion in light distribution.
Figure 129 shows data from five assays.
Figure 130 shows a parameter plotted against tration of the e, as well as graphs relating to accuracy, precision, and ted concentration.
Figure 131 shows images collected by a l camera.
Figure 132 illustrates examples of images taken of reaction product.
Figure 133 provides examples of images that were analyzed before spinning in the centrifuge, and after spinning in the centrifuge.
Figure 134 illustrates examples of images taken of reaction product.
Figure 135 illustrates spectra of several serum samples.
Figure 136 illustrates an example detection process of the invention using an array.
Figure 137 rates an example detection process of the invention using beads.
Figure 138 illustrates an example ion process of the ion using tagged aptamers. ation] eaa Figure 139 illustrates detection of aptamer binding to a complementary probe.
Figure 140 illustrates e of binding n aptamer and a non-complementary probe.
] Figure 141 illustrates binding city of aptamers on an array.
Figure 142 shows a more detailed view of analyte detection on an array.
Figure 143 shows an example array.
Figure 144 shows a plot of chemiluminescence against concentration for a vitamin D assay.
Figure 145 shows a plot of chemiluminescence against concentration for an estradiol assay.
Figure 146 shows a spectrophotometric measurement ofWBC concentration.
Figure 147 shows plots of turbidity as a function of time.
Figure 148 is a plot of inflection points for three experiments at 800 copies/uL and 80 copies/uL.
Figure 149 is a plot of an e in which magnetic beads are used for the analysis of ns and small molecules via ELISA assays.
Figure 150 is a plot of an example in which magnetic beads are used for the analysis of proteins and small molecules via ELISA assays.
DETAILED PTION OF THE INVENTION While preferable embodiments of the invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein can be employed in practicing the ion.
] The invention es mobile applications for system and methods for sample use maximization.
Various aspects of the invention described herein may be applied to any of the ular applications set forth below or for any other types of diagnostic or therapeutic applications. The ion may be applied as a standalone system or method, or as part of an integrated pre-clinical, clinical, laboratory or medical application.
It shall be understood that different aspects of the invention can be appreciated individually, tively, or in combination with each other.
The devices and systems herein can provide an effective means for real-time detection of analytes present in a bodily fluid from a subject. The detection methods may be used in a wide y of circumstances including identification and quantification of analytes that are associated with specific biological processes, physiological conditions, disorders or stages of disorders. As such, the systems have a broad spectrum of utility in, for example, drug screening, disease diagnosis, phylogenetic classification, parental and forensic identification, disease onset and recurrence, individual response to treatment versus population bases, and/or monitoring of therapy. The subject devices and systems are also particularly useful for advancing preclinical and clinical stage of development of therapeutics, improving patient compliance, monitoring ADRs associated with a prescribed drug, developing dualized medicine, outsourcing blood testing from the l laboratory to the home or on a prescription basis, and/or ring therapeutic agents following regulatory approval. The subject devices and system can be utilized by payors outsourcing blood tests from a l laboratory. The devices and systems can provide a flexible system for personalized medicine. Using the same system, a device can be changed or interchanged along with a protocol or instructions to a programmable processor of the [Annotation] eaa s to perform a wide y of assays as described. The systems and devices described herein, while being much smaller and/or portable, embody novel features and offer many functions of a laboratory instrument.
In an aspect, a system of the invention ses a device sing assay units and reagent units, which include reagents, e. g., both liquid and/or solid phase reagents. In some embodiments, at least one of the whole device, an assay unit, a reagent unit, or a combination thereof is disposable. In a system of the invention, the detection of an analyte with the subject device is typically automated. Such automation can be effected by a built-in protocol or a protocol provided to the system by the manufacturer.
The s and systems as described herein can offer many features that are not available in existing POC s or integrated is systems. For example, many POC cartridges rely on a closed fluidic system or loop to handle small volumes of liquid in an efficient manner. The fluidic devices such as cartridges described herein can have open fluid movement between units within a given cartridge. For example, a t can be stored in a unit, a sample stored in a sample collection unit, a diluent stored in a t unit, and the capture surface can be in an assay unit, where in one state of cartridge, none of the units are in fluid communication with any of the other units. The units can be movable relative to each other in order to bring some units into fluid communication using a fluid transfer device of the system. For example, a fluid transfer device can comprise a head that engages an assay unit and brings the assay unit in fluidic communication with a reagent unit. In some cases, the head is a pipette head that moves the assay unit (e.g., tip) in fluid ication with a reagent unit.
] Accordingly, in an embodiment, the present invention provides a method of detecting and /or measuring the concentration of an analyte in a bodily fluid or tissue sample, the method typically comprises the steps of providing a sample (e.g., blood, urine, saliva, tissue) to a device or system of the invention, allowing the sample to react within at least one assay unit of the device, and detecting the detectable signal generated from the analyte in the blood sample.
One aspect of the invention es for analyzing samples using a point-of-care device that is configured to maximize sample utilization. For example, more than about 15, 25, 50, 75, or 100 assays can be performed on a sample having a volume of less than about 1, 20, 50, 100, or 500 uL. The sample can be a blood sample taken from a finger prick. The sample can be collected in a sealable capillary or tip. The sample can be prepared for one or more assays by subjecting the sample to a separation (e. g., centrifugation) and/or on process. The one or more assays can be prepared by combining the sample, which may have been separated and diluted, with one or more reagents in a reaction chamber. The reaction chamber can be a pipette tip, vial, a sample transfer device, and/or a cuvette. The one or more assays can be configured such that an optical signal can be measured which is tive of the concentration of one or more analytes in the sample. The reaction chamber can contain a plurality of assays, which may be spatially separated. A plurality of optical s can be generated within a single reaction chamber from one assay, or from a plurality of spatially separated assays.
The one or more l signals can be measured by a digital imaging camera that can measure a plurality of detection spectral regions or detection bands, e. g., red, green and blue. The optical signal can be measured on the assay reaction product in the reaction chamber, which can be a pipette tip or other sample containers. The systems, devices, and methods can be fully automated or semi-automated by programmable logic.
Another aspect of the invention provides for s, devices, and methods for preparing s for analysis. Samples can be prepared for analysis by one or more separation devices. For example, a sample ation] eaa can be prepared for analysis by centrifugation within a centrifuge. Other separations based on charge, size, hydrophobicity/hydrophilicity, and/or volatility can also be implemented.
One aspect of the invention provides for sample and reaction product analysis using image-based analysis. The system can include a camera that can measure an optical signal using one or more detection spectrum regions. For example, a camera can measure an optical signal using red, green, and blue detection spectrum regions. The measured signal can include three measured values that can be interpreted using one or more thms described herein. The use of more than one detection spectrum region can increase the dynamic range of an assay and can increase the accuracy of a measurement as compared to measurements using a single detection spectrum region.
The invention also es for s, devices, and methods for performing optical measurements on samples and assay reaction products that are contained within reaction chambers, each with a plurality of distinct path lengths. The reaction rs can have a plurality of distinct path lengths such that a greater or lower amount of light absorbance is observed. The plurality of distinct path lengths (such as, for example, through the sample and/or reaction r) allows for an increase in the dynamic range of a selected assay protocol. The image of the reaction chamber can be ed as described herein to obtain information on the sample or the assay reaction products. The ation of utilizing the plurality of available path lengths within a single reaction r and the use of three channel detection spectrum regions y enhances the dynamic range of a given assay.
A system for performing sample preparation and analysis can include instrumentation, disposable components, and reagents. The system can accept samples and automatically performs a plurality of assays without user intervention. Where desired, the instrumentation can include a graphical user interface, a mechanism for ucing cartridges, which may be disposable, a motorized stage, which may have mobility in three dimensions, one or more -head liquid handling devices, one or more multi-head liquid handling devices, one or more devices for performing sample preparation, optical s, which can include a PMT and/or an imaging device, temperature controllers, and communication devices. The disposable ent can include a able cartridge that contains sample tips, tip seals, and reagents. In some embodiments, the disposable cartridge may also n neutralizing assemblies configured to absorb and lize liquid assay products.
] The instrumentation, disposable ents, and reagents can be housed within a closeable environment, such as a case or a cabinet. In some embodiments, the case has a cross-sectional area less than about 4 m2, 2 m2, 1 m2, 0.5 m2, 0.1 m2, 0.05 m2, or lower. The invention provides for a distributed test system, such as a point-of—care device, which can include one or more of the following aspects: 1. Efficient (centrifugal) separation of blood and recovery of the separated plasma 2. Dilution of the plasma sample to one or more levels (for example 1:10, 1:100, 1:1000) so that each assay can be performed at an optimal dilution 3. Optimized distribution of sample to several different assays which may involve several different methodologies 4. Optimal assay protocols 5. Use of open-ended ar section cuvettes for sample analysis, mixing with reagents, incubation and presentation to optical systems [Annotation] eaa 6. Analysis of assays using imaging technology (scanning and/or raphy, and/or copy) In one embodiment, the device of the invention is self-contained and comprises all ts, liquid- and solid-phase reagents, required to perform a plurality of assays in parallel. Where desired, the device is configured to perform at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 500, 1000 or more assays. One or more control assays can also be incorporated into the device to be performed in parallel if desired.
Calibrators can also be provided for assay system ation. Some examples of dried controls and calibrators useful for assay system calibration can include aqueous solutions of analytes, serum, or plasma samples with known levels of analytes, known quantities of such calibrators and controls can also be dried by lyophilization, vacuum drying, and other manufacturing processes (and dissolved during the assay).
By incorporating these components within a point-of-care system, a patient or user can have a plurality of analytes, for example more than about 10, 20, 30, 50, 75, 100, 150, or 200 analytes, quantified within less than about 0.5, l, 2, 3, 4, 5, 10, 20, 30, 60, 120, 180, 240, 480 or 600 minutes.
The subject s and systems can be utilized for conducting quantitative immunoassays, which can be ted in a short period of time. Other assay type can be performed with a device of the invention including, but not d to, measurements of c acid sequences and measurements of metabolite, such as cholesterol or electrolytes such as magnesium and chloride ions. In some embodiments, the assay is completed in no more than one hour, preferably less than 120, 60, 30, 15, 10, 5, 4, 3, 2, or 1 minute. In other embodiments, the assay is performed in less than 5 s. The duration of assay ion can be adjusted ingly to the type of assay that is to be d out with a device of the invention. For example, if needed for higher sensitivity, an assay can be incubated for more than one hour or up to more than one day. In some examples, assays that require a long duration may be more cal in other POC applications, such as home use, than in a clinical POC setting.
In other embodiments of the invention the reagent units of a subject device are configured to be a set of d-match ents. A reagent unit typically stores liquid or solid reagents necessary for conducting an assay that detect a given analyte. The assay units can mes (or optionally not always) comprise at least one capture surface capable of reacting with an analyte from the sample of bodily fluid. The assay unit may be a tubular tip with a capture surface within the tip. Examples of tips of the invention are described herein. Each individual assay and reagent unit can be configured for assay function independently. To assemble a device, the units can be assembled in a just-in-time fashion for use in an integrated device, which can take the format of cartridge.
A housing for a device of the invention can be made of a polymeric material, a metallic material or a composite material, such as, e.g., aluminum, yrene or other moldable or machinable plastic, and can have defined locations to place assay units and reagent units. The housing may include a metal or any other material. The housing may partially or entirely enclose the assay units and/or reagent units. The housing may support the weight of the assay units and/or reagent units. In an embodiment, the housing has means for blotting tips or assay units to remove excess liquid. The means for blotting can be a porous membrane, such as cellulose acetate, or a piece bibulous material such as filter paper.
In some embodiments, at least one of the ents of the device may be constructed of polymeric materials. Non-limiting examples of polymeric materials include polystyrene, polycarbonate, [Annotation] eaa polypropylene, polydimethysiloxanes (PDMS), polyurethane, polyvinylchloride (PVC), polysulfone, thylmethacrylate , acrylonitrile-butadiene-styrene (ABS), and glass.
The device or the subcomponents of the device may be ctured by variety of methods including, without tion, stamping, injection molding, embossing, casting, blow molding, machining, welding, ultrasonic welding, and thermal bonding. In an embodiment, a device in ctured by injection molding, thermal bonding, and ultrasonic welding. The subcomponents of the device can be affixed to each other by thermal bonding, ultrasonic welding, friction fitting (press fitting), adhesives or, in the case of certain substrates, for example, glass, or semi-rigid and non-rigid polymeric substrates, a natural adhesion between the two components.
] A system as described can run a y of assays, regardless of the analyte being detected from a bodily fluid sample. A protocol dependent on the identity of the device may be transferred from an al device where it can be stored to a reader assembly to enable the reader assembly to carry out the specific protocol on the device. In some embodiments, the device has an identifier (ID) that is detected or read by an identifier detector bed herein. The identifier can enable two-way communication between the device and a sensor or receiving system. The identifier or can communicate with a communication assembly via a controller which transmits the identifier to an external device. Where desired, the external device sends a ol stored on the external device to the communication assembly based on the identifier. The ol to be run on the system may comprise instructions to the controller of the system to perform the protocol, including but not limited to a particular assay to be run and a detection method to be performed. Once the assay is med by the system, a signal indicative of an analyte in the bodily fluid sample is generated and detected by a detection assembly of the . The detected signal may then be communicated to the communications assembly, where it can be itted to the external device for processing, including without limitation, calculation of the analyte concentration in the sample.
Systems, devices and methods for performing sample analysis using point-of-care devices and tips that can function as reaction chambers are described in US. Patent Publication No. 088336 and US.
Provisional Application No. 60/997,460, each of which is incorporated herein by reference in its entirety for all purposes.
Sample ng and Reaction Chambers Samples, reagents, and assembled assays described herein can be handled and contained by a variety of reaction chamber types. A sample handing device and a reaction r can be a well, a tube, or an open ended tip, which may also be a cuvette. As used herein, a tip can also referred to as a sample tip, a cuvette tip, a reaction chamber, a cuvette, a capillary, a sample handing device, or a sample transfer device. Samples may be ted from a source into a tip or a tube. The tips may be sealed. Such seals may be permanent or reversible. Diluted samples can be combined with one or more ts and mixed (as described in previous applications) within “assay elements" such as tips (open-ended cuvettes) or open or covered wells. Once the assay is ready for reading, the assay element can be presented to the optical system for image analysis or other types of reading. Alternatively, assay reaction es can be transferred from one type of element to another.
For example, assays incubated in tips can be blotted onto an absorbent or us medium or assays incubated in wells can be aspirated into tips. Many assays can be processed in parallel. Assay readout can be serial or [Annotation] eaa simultaneous ing on the assay protocol and/or incubation time. For assays involving measurement of a rate of change, the assay element can be presented to the optical system more than once at different times.
Fluid and Material Transfer Devices A fluid transfer device can be part of a system. The fluid transfer device can se a plurality of heads. Any number of heads as is necessary to detect a plurality of analytes in a sample is envisioned for a fluid transfer device of the invention. In an example, a fluid transfer device has about eight heads mounted in a line and separated by a distance. In an embodiment, the heads have a d nozzle that engages by press fitting with a variety of tips, such as assay unit or sample collection units as described . The tips can have a feature that enables them to be removed automatically by the instrument and disposed into in a housing of a device as described after use. In an embodiment, the assay tips are clear and transparent and can be similar to a cuvette within which an assay is run that can be ed by an optical detector such as a photomultiplier tube or camera sensor.
In an example, a programmable processor (e. g., central sing unit, CPU) of a system can comprise or be configured to accept (such as, e. g., from a memory location) instructions or commands and can operate a fluid transfer device according to the instructions to transfer liquid samples by either awing (for drawing liquid in) or extending (for expelling liquid) a piston into a closed air space. The processor can be configured to facilitate aspiration and/or dispensing. Both the volume of air moved and the speed of movement can be ely lled, for example, by the programmable processor.
Mixing of samples (or reagents) with diluents (or other reagents) can be achieved by ting components to be mixed into a common tube and then repeatedly aspirating a significant fraction of the combined liquid volume up and down into a tip. Dissolution of reagents dried into a tube can be done is similar fashion. tion of liquid s and reagents with a capture surface on which is bound a capture reagent (for example an antibody) can be achieved by drawing the appropriate liquid into the tip and holding it there for a predetermined time. Removal of samples and ts can be achieved by expelling the liquid into a reservoir or an absorbent pad in a device as described. Another reagent can then be drawn into the tip according to instructions or protocol from the programmable processor.
A system can comprise a holder or engager for moving the assay units or tips. An engager may comprise a vacuum assembly or an assembly designed to fit snugly into a boss of an assay unit tip. For example, a means for moving the tips can be moved in a manner similar to the fluid transfer device heads. The device can also be moved on a stage according to the on of an engager or holder.
In an embodiment, an ment for moving the tips is the same as an instrument for moving a volume of sample, such as a fluid transfer device as described herein. For example, a sample collection tip can be fit onto a pipette head according to the boss on the collection tip. The collection tip can then be used to distribute the liquid throughout the device and system. After the liquid has been distributed, the collection tip can be disposed, and the pipette head can be fit onto an assay unit according to the boss on the assay unit. The assay unit tip can then be moved from reagent unit to reagent unit, and reagents can be distributed to the assay unit according to the aspiration- or pipette-type action provided by the pipette head. The pipette head can also m mixing within a collection tip, assay unit, or reagent unit by aspiration- or syringe-type .
In another embodiment, tips containing liquids including assay reaction mixtures can be disconnected from the pipetting device and “parked" at ic ons within the instrument or within a [Annotation] eaa disposable unit. If needed, tips can be capped using a seal (as used in the centrifuge) to prevent liquids from draining out. In some embodiments, the seal can be a vinyl seal.
Exemplary Sample Tips A variety of ner shapes can be utilized as sample tips, reaction chambers, and cuvettes. For example, a cuvette can be circular, cylindrical, square, rectangular, l, conical, pyramidal, or any other shape capable of holding a sample of fluid. Rectangular cuvettes where a light beam es at right angles to the cuvette surfaces as shown in plan and section views in Figure 63 can be employed. In such rectangular cuvettes, the liquid sample that is illuminated is also gular and is defined by the cuvette. Cuvettes with circular cross-sections can also be used. For example, some types of microtiter plates where the illuminated sample volume is in part defined by the sample meniscus as shown below in plan and section view in Figure 64.
Variable pathlength cuvettes can be used to optimize and extend the assay response and minimize the volume of sample required to measure the assay. Cuvettes can be longer in relation to their cross-section in at least one region. In some cases, the pathlength of a cuvette can be selected based on cuvette geometry and/or al. Different cuvettes can be selected for ent .
] In the t invention, one preferred version of the assay cuvette has a circular cross-section in the direction of the light beam as shown in Figure 65. The use of a cuvette with a circular cross-section has several advantages, including, but not limited to the following: 1. The optical pathlength can be precisely d. Dimensional precision of ion-molded parts have been found to be better than 1-2 % CV. In conventional microtiter plates the unconstrained liquid meniscus can introduce imprecision in pathlength. 2. The open-ended ter and circular section of the tips confers excellent fluid handling characteristics, making aspiration of liquids very precise. 3. The optical image of the tips provides for the ability to identify the tip location and boundaries of the liquid column and to locate very precisely the center of the tip where the signal is maximal. 4. More than one liquid sample can be incubated and analyzed in the same tip. This is because in the narrow part of the tip, very little material transfer occurs (in the axial direction) between nt “slugs" of liquid.
An exemplary tip may have the following general features: Tip length: 0.5 i 4 cm Tip OD: 0.2 i 1.0 cm Tip ID: 0.1 i 0.5 cm Tip capacity for liquids: 5 i 50 uL Tip dimensional precision: generally better than 2% or +/- 0.001 cm Tip configuration: The tip will generally have a feature that engages with a pipette (cylindrical) so as to form a fluid tight seal. There is a region generally cylindrical or conical which is used for imaging. lly the optical part of the tip will have at least two ent sections with different pathlengths. The lower end of the tip will typically be narrow so as to aid in retention of vertical liquid columns under gravity Tip material: Clear or uniformly ar plastic (polystyrene, polypropylene etc.) (transmission of light in the visible > 80%) [Annotation] eaa For imaging purposes, the tip can generally be clear or translucent, but the tips do not have to be clear to work well as assay cuvettes when three-color analysis is used. Tip cuvettes which appear “cloudy" may on similarly to clear tips. The cloudy tips are made in injection molds with non-polished or textured surfaces or by adding some light scattering material to the plastic used to fabricate the tips. The light scattering intensity of such cloudy tips may be chosen to be not so great as to e the colored liquid to be measured.
In general, the impact of light scattering on transmitted light can be selected to be less than 10, (20, and 30 %) relative to the impact of the colored material. The light ring effect can be selected such that the light scattering of the cloudy tips is uniform.
The tips and reaction chambers described herein can be comprised of a rical (or conical) shaft about 2 cm in length and having an inner diameter of about 1-5 mm corresponding to a capacity of about 7 50 uL.
In one example, at the upper end of the cylinder is a truncated cylindrical “boss" fluidically connected to the er and adapted so as to be able to engage with the tapered feature of a pipetter. The lower end of the tip may be narrowed to provide a feature that enables the tip to hold its liquid contents when oriented vertically and not attached to the pipetter. The tip may be a pointed tip. The external shape of the lower end of the tip is typically also somewhat pointed with the diameter being reduced from the main part of the cylindrical shaft toward the end so as to be capable of being fluidically sealed with a e (vinyl) cap into which the tip end is press fit. Tips are usually made of molded plastic (polystyrene, polypropylene and the like). The tips can be clear or translucent such that information about the sample can be acquired by imaging.
Figure 4, Figure 5, and Figure 6 show an example of a tip. The tip is configured with (1) an upper feature that can engage to form an air tight seal with a pipette head, (2) a basically cylindrical (actually conical with a very slight draft angle) shaft and a narrow, d lower tip. This tip can form a liquid-tight seal with a cap. The pointed shape aids in getting good conformance with the cap under moderate force. The material used is injection-molded polystyrene. The overall ions are: 32 mm long, about 7.6 mm largest outer diameter, useful capacity about 20 uL. The dimensions of the tip can be scaled to a larger . For example, for a 50 uL , the IDs can be increased by about 1.6-fold.
Sealing can be achieved using a cap made of vinyl or other als which is easily press-fit to the narrow end of the sample containment means using force generated by motion of the instrument stage in the z- direction. A bubble of air can become trapped within the tip when the tip is capped. A centrifugation step can be used to drive the bubble to the top of the column of blood so as to eliminate the effects of the bubble. The dimensions of the tip and/or the dimensions of the tip holder in a centrifuge can be matched such that a tip can be secured for centrifugation.
] Sample ation The invention provides for systems, methods, and devices for the processing and analysis of samples can be collected from a variety of s. For example, the sample can be collected from patients, animals, or the environment. The sample can be a bodily fluid. Any bodily fluids suspected to contain an analyte of interest can be used in conjunction with the system or devices of the invention. Commonly employed bodily fluids include but are not limited to blood, serum, saliva, urine, gastric and digestive fluid, tears, stool, semen, vaginal fluid, titial fluids derived from tumorous tissue, and cerebrospinal fluid.
[Annotation] eaa In some embodiments, the bodily fluid is a blood sample from a human patient. The blood source can be collected from a finger prick and have a volume ofless than about 0.5, l, 5, 10, 20, 50, 100, 200, 300, 400, 500, or 1000 uL.
A bodily fluid may be drawn from a patient and ed to a device in a y of ways, including but not limited to, lancing, injection, or pipetting.
] As used herein, the terms “subject" and “patient" are used interchangeably herein, and refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.
In one embodiment, a lancet punctures the skin and withdraws a sample using, for example, gravity, capillary action, aspiration, or vacuum force. The lancet may be part of the device, or part of a system or a stand-alone ent. Where needed, the lancet may be activated by a variety of mechanical, electrical, electromechanical, or any other known activation mechanism or any combination of such methods. In r embodiment where no active mechanism is required, a patient can simply provide a bodily fluid to the , as for example, could occur with a saliva sample. The collected fluid can be placed in the sample collection unit within the . In yet another embodiment, the device comprises at least one microneedle which res the skin.
The volume of bodily fluid to be used with a device can be less than about 500 microliters, typically between about 1 to 100 microliters. Where desired, a sample of l to 50 microliters, l to 40 microliters, l to 30 microliters, l to 10 microliters or even 1 to 3 microliters can be used for detecting an analyte using the device. In an embodiment, the volume of bodily fluid used for detecting an e utilizing the subject s or systems is one drop of fluid. For example, one drop of blood from a pricked finger can provide the sample of bodily fluid to be analyzed with a device, system or method described .
A sample of bodily fluid can be collected from a subject directly into a tip of the described herein, or can be later transferred to a tip.
Sample Dilution In some ces, the configuration of the processor to direct fluid transfer effects a degree of dilution of the bodily fluid sample in the array of assay units to bring signals indicative of the plurality of analytes being detected within a detectable range, such that said plurality of analytes are detectable with said system. In an example, the bodily fluid sample comprises at least two analytes that are present at concentrations that differ by at least 1, 2, 5, 10, 15, 50, 100, 500, 1000, 10,000, 105, 106, 107, 108, 109, or 1010 fold. In an example the bodily fluid sample is a single drop of blood. In an embodiment, the concentrations of at least two analytes present in a sample differs by up to 10 orders of magnitude (for example, a first analyte is present at 01 pg/mL and a second analyte is present at 500 ug/mL). In another example, some protein analytes are found at concentrations of greater than 100 mg/mL, which can extend the range of interest to about twelve orders of ude. In the case of measurement of nucleic acid analytes such as DNA and RNA using exponential amplification methods such as rase reaction, the number of copies of analyte can be increased by a n fold prior to ement.
Where desired, a degree of dilution of the bodily fluid sample can bring the signals indicative of the at least two analytes within the detectable range.
[Annotation] eaa As described, the systems and s herein can enable many features of the flexibility of laboratory setting in a POC environment. For example, samples can be collected and manipulated automatically in a table top size or smaller device or system. A common issue in FCC devices is achieving different dilution ranges when conducting a plurality of assays, wherein the assays may have icantly different sensitivity or specificity. For example, there may be two analytes in a sample, but one analyte has a high tration in the sample and the other analyte has a very low concentration. As provided, the s and devices herein can dilute the sample to significantly different levels in order to detect both analytes. Alternatively, a sample may be split into two or more samples, which may enable individual analytes to be detected at various levels of dilution.
For example, if the analyte is in a high concentration, a sample can be serially d to the appropriate detection range and provided to a capture surface for detection. In the same system or device, a sample with an analyte in a low concentration may not need to be diluted. In this manner, the assay range of the FCC devices and systems provided herein can be expanded from many of the current POC devices.
In POC assay systems using disposable cartridges containing the t there is often a practical limit to the extent of dilution. For example, if a small blood sample is obtained by fingerstick (for example, about 20 microliters) is to be diluted and the maximum volume of diluent that can be placed in a tube is 250 microliters, the practical limit of dilution of the whole sample is about 10-fold. In an e herein, a system can aspirate a smaller volume of the sample (for example about 2 iters) making the maximum dilution factor about lOO-fold. For many assays, such dilution factors are acceptable but for an assay like that of CRP (as described in the examples herein) there is a need to dilute the sample much more. Separation-based ELISA assays can have an intrinsic limitation in the capacity of the capture e to bind the analyte (for example about a few hundred ng/ml for a typical protein analyte). Some analytes are present in blood at hundreds of micrograms/ml. Even when diluted by ld, the analyte concentration may be outside the range of calibration. In an exemplary embodiment of a system, device, and fluid transfer device herein, multiple dilutions can be ed by performing multiple fluid transfers of the diluent into an individual assay unit or sample tion unit. For example, if the concentration of an analyte is very high in a sample as described above, the sample can be diluted multiple times until the concentration of the analyte is within an able detection range. The systems and methods herein can provide te measurements or estimations of the dilutions in order to calculate the original concentration of the analyte.
Sample Separation In some embodiments of the invention, a sample can be ed for analysis by an initial separation step. For example, if the assay is to analyze DNA, a DNA separation step can be employed to ate or reduce contaminants or unwanted source material. The separation step can utilize chromatography, centrifugation, liquid-liquid extraction, solid-liquid extraction, affinity binding, or any other mechanisms known to one skilled in the art.
In some embodiments, a blood sample to be analyzed is first sed by separating the plasma ent from the blood sample. This step can be performed using a variety of techniques, such as filtration, centrifugation, and affinity binding. Centrifugation can be an efficient method for separation of blood sample components, and can be ed in the present invention.
Plasma separation [Annotation] eaa Blood can be introduced into a close ended or sealable tip in a variety of ways, for example samples can be provided in a tube and a sealable tip can receive the sample from the tube via capillary action or via pneumatic force. One preferred means of introduction is the use of capillary action. Alternatively, container used to hold the sample for centrifugal separation can be configured with only one opening as in a conventional centrifuge.
The tip, once filled with blood, can be moved automatically to a location in a disposable cartridge where there is a sealing element. The sealing element can be a small “cup" made of a able t) material (vinyl, silicone or the like) conformed to fit on the lower end of the tip and to seal it. The tip is pressed into the seal by the instrument thus g a liquid-tight junction. The sealed tip is then moved to a small centrifuge (typically located in and forming part of the instrument) and press-fit into a positioning e in the centrifuge rotor such that the lower (sealed) end of the tip butts up to a rigid shelf that will support the tip during the centrifugation step.
The centrifuge rotor can be ar having about 10 cm in er. The mass of the blood- containing tip is either (1) small relative to the rotor or (2), where desired, balanced by a counter weight located on the opposite part of the rotor such that any vibration during the centrifugation step is minimized. One exemplary orientation of the centrifuge rotor is vertical (axis of rotation horizontal). The rotor is mounted in a drive shaft with is driven by an electric motor.
Centrifugation can be achieved by spinning the rotor at about 15,000 rpm for 5 minutes. During this process, the particular elements in the blood (red cells and white cells) sediment to the sealed end of the tip and form a closely packed column with cell free plasma ted at the part of the tip distal from the seal.
The tip containing the separated sample can then be placed vertically in a on accessible to a fluid handling device comprised of a narrow pipette tip (“sample acquisition tip") mounted on a pipetting device in turn mounted on an x-y-z stage.
] Plasma can now be efficiently recovered from the centrifuged sample. This is achieved by moving the sample acquisition tip vertically along the axis of the centrifuge tip so that it comes into fluid t with the plasma and can draw the plasma upwards using, e.g., pneumatic means.
Optionally, this operation can be monitored using a camera or other imaging device which can be used both to measure the sample hematocrit and to provide information as to the location of the plasma/red cell boundary to the stage/pipetter controller. With the aid of imaging the separated blood, a narrow pipette tip fitted to a pipette is slowly moved vertically down, such that the tip is directed axially down the sample containment means until it contacts the plasma. The tip is then moved further until it is close (within less than about 3, 2, l, 0.5, or 0.1 mm) of the packed cell interface. At the same time, plasma is aspirated into the narrow pipette tip under er control. The plasma can be aspirated simultaneously while moving the narrow pipette tip into the plasma column so that the plasma does not become ced into the upper part of the sample nment means. The aspiration can be controlled to avoid air being aspirated during the plasma removal step.
] In general, a pipette tip with a very narrow end, such as those used to apply samples to an electrophoresis system, can be used to te the plasma from the centrifuged sample tip. The narrow tip is typically conical or tapered and has dimensions 1 , 3 x 0.1 , 0.5 cm (length x er) and made of any of a variety of materials (polypropylene, polystyrene etc.). The material can be clear or translucent in the visible.
One end of the tip engages with a pipetting device. The other is very narrow (0.05 , 0.5 mm OD) such that it [Annotation] eaa can move into the sample tip without touching the inner e of the sample tip. Even if there is contact n the plasma aspiration tip and the sample tip, plasma aspiration is not hindered.
A schematic of the plasma aspiration process at the stage where the plasma aspiration tip is d just above the plasma-packed cell interface during the aspiration step is shown in Figure 7.
In this way we have found that almost all of the plasma can be removed leaving as little as e.g. l uL in the centrifuged sample tip. This corresponds to about 11 uL of plasma (90% recovery) from 20 uL of blood with a 40% hematocrit. Additionally the quality of the plasma sample (with t to hemolysis, lipemia and icteria) can be determined from an image of the centrifuged sample.
The aspirated plasma can be moved to other locations for dilution and mixing with assay reagents so that assays for analytes ry but not limited to metabolites, electrolytes, protein biomarkers, drugs and nucleic acids may be performed.
Separation ofwhz'te blood cells A further use of the invention is to isolate and concentrate the white cells from blood. In one aspect of the invention, the blood sample is first subject to a process which lyses the red cells (and optionally fixes the white cells) by adding a reagent (For example, BD PharmlyseTM 555899 or BD FACSTM Lysing Solution 349202)_to the blood and mixing. Following a brief incubation, the lysed sample is subject to centrifugation as described above such that the white cells are trated at the sealed end of the blood tip.
The lysed red cell solution can then be removed by aspiration. Recovery of the white cells is achieved by either (1) addition of a small amount of a buffer solution and repeated up and down aspiration to re-suspend the cells followed by displacement into a receptacle or (2) removal of the seal and downward displacement of the packed cells into a receptacle using air pressure.
] An ate scheme allows recovery of white cells without lysis of the red cells. After centrifugation of blood (as is well known) the white cells form a layer on top of the packed red cells known as the Buffy Coat. Following removal of most of the plasma (as above) the white cells can be efficiently recovered by (l) optionally adding a small volume (e. g. about 5 uL) of isotonic buffer, or (2) using the residual plasma and re-suspending the white cells by repeated aspiration and/or mechanical stirring using the sample acquisition tip.
Once suspended, the resulting mixture of white cells er with a small tion of red cells also re- suspended can be acquired by aspiration for analysis of the white cells. In this way most of the white cells (typically all) can be recovered with only a small (contaminating) quantity of red cells (typically less than 5% of the original). fuges Figure 1, Figure 2, and Figure 3 show scale perspectives of a centrifuge (Figure l - side view, Figure 2 - front face view, Figure 3 - rear view) that can be integrated into the . The centrifuge may contain an electric motor capable of turning the rotor at 15,000 rpm. One type of centrifuge rotor is shaped somewhat like a fan blade is mounted on the motor spindle in a vertical plane. Affixed to the rotor is an element which holds the sample g means (tip) and provides a ledge or shelf on which the end of the tip distal to the motor axis rests and which provides t during the centrifugation so that the sample cannot escape. The tip may be r supported at its proximal end by a mechanical stop in the rotor. This can be ed so that the force generated during centrifugation does not cause the tip to cut through the soft vinyl cap. The tip can be inserted and removed by standard pick and place mechanisms but preferably by a pipette. The rotor is a single [Annotation] eaa piece of acrylic (or other material) shaped to ze Vibration and noise during operation of the centrifuge.
The rotor is (optionally) shaped so that when it is ed in particular angles to the vertical, other movable components in the instrument can move past the fuge. The sample holding means are centrifugally balanced by counter masses on the opposite side of the rotor such that the center of rotational inertia is axial relative to the motor. The centrifuge motor may provide positional data to a computer which can then control the rest position of the rotor ally vertical before and after centrifugation).
As may be seen from the two graphs in Figure 8 and Figure 9, to minimize centrifugation time (without generating too much ical stress during centrifugation) according to hed standards (DIN 58933-1; for the US. the CLSI standard H07-A3 “Procedure for Determining Packed Cell Volume by the Microhematocrit Method"; Approved rd - Third Edition) convenient dimensions for the rotor are in the range of about 5 , 10 cm spinning at abouth - 20 thousand rpm giVing a time to pack the red cells of about 5 min.
An exemplary equation for calculating centrifugation force is shown below: i ' ] 3? Where: gis earth's gravitational acceleration, ] ‘Y‘is the rotational radius, imirIS the rotational speed, measured in revolutions per unit of time.
Where: Teams the rotational radius measured in centimeters (cm), Aliphilis rotational speed measured in revolutions per minute (RPM). , ,5.
REF 3 1 .1. 15: >< 19—5 gm. ; gem In some ments, a centrifuge may be a horizontally oriented centrifuge with a swinging bucket design. In some preferable embodiments, the axis of rotation of the centrifuge is vertical. In alternate embodiments, the axis of rotation can be horizontal or at any angle. The centrifuge may be capable of aneously spinning two or more vessels and may be designed to be fully ated into an automated system employing computer-controlled pipettes. In some embodiments, the vessels may be close-bottomed.
The swinging bucket design may permit the centrifugation vessels to be ely oriented in a vertical position when stopped, and spin out to a fixed angle when spinning. In some embodiments, the swinging buckets may permit the centrifugation vessels to spin out to a horizontal orientation. Alternatively they may spin out to any angle between a vertical and horizontal position (e.g., about 15, 30, 45, 60, or 75 degrees from vertical. The centrifuge with swinging bucket design may meet the positional accuracy and repeatability requirements of a robotic system a number of positioning s are employed.
A computer-based control system may use position information from an optical encoder in order to spin the rotor at controlled slow speeds. Because an appropriate motor could be designed for high-speed mance, accurate static positions need not be held using position feedback alone. In some embodiments, a cam in ation with a solenoid-actuated lever may be employed to achieve very accurate and stable [Annotation] eaa stopping at a fixed number of positions. Using a separate control system and feedback from Hall-Effect sensors built into the motor, the velocity of the rotor can be very tely controlled at high speeds.
Because a number of sensitive instruments must function simultaneously within the assay instrument system, the design of the centrifuge preferably minimizes or reduces vibration. The rotor may be namically designed with a smooth exterior , fully enclosing the buckets when they are in their horizontal position. Also, vibration dampening can be employed in multiple locations in the design of the case.
Rotor A centrifuge rotor can be a component of the system which may hold and spin the centrifugation vessel(s). The axis of on can be vertical, and thus the rotor itself can be positioned ntally. However, in alternate embodiments, different axes of rotation and rotor positions can be employed. There are two components known as buckets positioned symmetrically on either side of the rotor which hold the centrifugation vessels. Alternative configurations are possible in which s are oriented with radial symmetry, for example three s oriented at 120 degrees. Any number of buckets may be provided, including but not limited to l, 2, 3, 4, 5, 6, 7, 8, or more buckets. The buckets can be evenly spaced from one another. For example, if n buckets are provided where n is a whole number, then the buckets may be spaced about 360/n degrees apart from one another. In other embodiments, the buckets need not be spaced evenly around one another or with radial symmetry.
When the rotor is stationary, these buckets, influenced by gravity, may passively fall such as to position the vessels vertically and to make them accessible to the pipette. Figure 111 shows an example of a rotor at rest with buckets vertical. In some embodiments, the buckets may passively fall to a predetermined angle that may or may not be al. When the rotor spins, the s are forced into a nearly horizontal position or to a predetermined angle by fugal forces. Figure 112 shows an example of a rotor at a speed with buckets at a small angle to horizontal. There can be physical hard stops for both the vertical and ntal positions acting to enforce their accuracy and positional repeatability.
The rotor may be aerodynamically designed with a disk shape, and as few physical features as possible in order to minimize vibration caused by air turbulence. To achieve this, the outer geometry of the bucket may exactly match that of the rotor such that when the rotor is ng and the bucket can be forced horizontal the bucket and rotor can be tly aligned.
To facilitate plasma extraction, the rotor may be angled down toward the ground relative to the horizon. e the angle of the bucket can be matched to that of the rotor, this may enforce a fixed spinning angle for the bucket. The resulting pellet from such a configuration could be angled ve to the vessel when placed upright. A narrow extraction tip may be used to aspirate plasma from the top of the centrifugation vessel.
By placing the extraction tip near the bottom of the slope d by the angle , the final volume of plasma can be more efficiently extracted without disturbing the sensitive buffy coat.
A variety of tubes designs can be odated in the buckets of the device. In some embodiments, the s tube designs may be closed ended. Some are shaped like conventional centrifuge tubes with conical bottoms. Other tube designs may be cylindrical. Tubes with a low ratio of height to cross- sectional area may be favored for cell processing. Tubes with a large ratio (>10: 1) may be suitable for accurate measurement of hematocrit and other imaging requirements. However, any height to cross-sectional area ratio may be employed. The buckets can be made of any of several plastics (polystyrene, polypropylene), or any [Annotation] eaa other material discussed ere herein. s have capacities ranging from a few microliters to about a milliliter. The tubes may be inserted into and removed from the centrifuge using a “pick and place" mechanism.
Control System Due to the spinning and positioning requirements of the centrifuge deVice, a dual control system approach may be used. To index the rotor to specific rotational orientations, a position based control system may be implemented. In some embodiments, the control system may employ a PID (Proportional Integral Derivative) l system. Other feedback control systems known in the art can be employed. Positional feedback for the position controller may be provided by a high-resolution optical encoder. For operating the centrifuge at low to high speeds, a ty controller may be implemented, while employing a PID l system tuned for velocity control. Rotational rate feedback for the velocity controller may be provided by a set of simple Hall-Effect sensors placed on the motor shaft. Each sensor may generate a square wave at one cycle per motor shaft rotation. ng Mechanism To consistently and firmly position the rotor in a particular position, a physical stopping ism may be employed. In one embodiment, the stopping mechanism may use a cam, coupled to the rotor, along with a solenoid-actuated lever. The cam may be shaped like a circular disk with a number of “C" shaped notches machined around the perimeter. To position the centrifuge rotor, its onal velocity may first be lowered to, at most, 30RPM. In other embodiments, the rotational velocity may be lowered to any other , including but not d to about 5 rpm, 10 rpm, 15 rpm, 20 rpm, 25 rpm, 35 rpm, 40 rpm, or 50 rpm.
Once the speed is iently slow, the lever may be actuated. At the end of the lever is a cam follower which may glide along the perimeter of the cam with minimal friction. Once the cam follower reaches the center of a particular notch in the cam, the force of the solenoid-actuated lever can overcome that of the motor and the rotor may be brought to a halt. At that point the motor may be electronically braked, and, in combination with the stopping mechanism a rotational position can be very accurately and firmly held indefinitely.
Centrifuge buckets The centrifuge swing-out buckets may be ured to accommodate different type of centrifuge tubes. In preferable embodiments, the various tube types may have a collar or flange at their upper (open) end.
This collar or flange feature may rests on the upper end of the bucket and support the tube during centrifugation.
As shown in Figures 113, 114, and 115, conical and cylindrical tubes of various lengths and volumes can be accommodated. Figures 113, 114, and 115 provide examples of buckets and other bucket designs may be ed. For example, Figure 113, shows an example of a bucket configuration. The bucket may have side portions that mate with the fuge and allow the bucket to swing freely. The bucket may have a closed bottom and an opening at the top. Figure 114 shows an example of a fugation vessel mated with the bucket. As previously mentioned, the bucket may be shaped to accept various configurations of centrifugation vessels. The centrifugation vessel may have one or more protruding member that may rest upon the .
The centrifugation vessel may be shaped with one or more feature that may mate with the centrifugation bucket.
The feature may be a shaped feature of the vessel or one or more protrusion. Figure 115 shows an example of another centrifugation vessel that can be mated with the bucket. As previously described, the bucket can have one or more shaped e that may allow different configurations of centrifugation vessels to mate with the bucket.
[Annotation] eaa Centrifuge tubes and sample extraction means: ] The centrifuge tube and extraction tip may be provided individually and can be mated together for tion of al following centrifugation. The centrifugation tube and extraction tip may be ed to deal with complex processes in an automated system. Figure 116 shows an example of a centrifugation vessel.
Figure 117 shows an example of an extraction tip. Figure 118 provides an example ofhow the centrifugation vessel and extraction tip may mate. Any dimensions are provided by way of example only, and other dimensions of the same or differing proportions may be ed.
The system can enable one or more of the ing: 1. Rapid processing of small blood s (typically 5 — 50 uL) 9‘95”!“ Accurate and precise measurement of hematocrit Efficient l of plasma Efficient re-suspension of formed elements (red and white blood cells) Concentration of white cells (following labeling with fluorescent antibodies and fixation plus lysis of red cells) 6. Optical confirmation of red cell lysis and recovery of white cells fugation Vessel and Extraction Tip Overview A custom vessel and tip may be used for the operation of the centrifuge in order to satisfy the variety of constraints placed on the system. The centrifugation vessel may be a closed bottom tube designed to be spun in the centrifuge. In some embodiments, the centrifugation vessel may be the vessel illustrated in Figure 116 or may have one or more features illustrated in Figure 116. It may have a number of unique features enabling the wide range of required functionality including hematocrit measurement, RBC lysing, pellet resuspension and efficient plasma extraction. The extraction tip may be designed to be inserted into the centrifugation vessel for precise fluid extraction, and pellet re-suspension. In some embodiments, the extraction tip may be the tip illustrated in Figure 117 or may have one or more es rated in Figure 117.
Exemplary specifications for each tip are discussed herein.
Centrifugation Vessel The centrifugation vessel may be designed to handle two separate usage scenarios, each associated with a different anti-coagulant and whole blood volume.
A first usage scenario may e that 40uL of whole blood with Heparin be pelleted, the m volume of plasma be recovered, and the hematocrit measured using computer vision. In the case of 60% hematocrit or below the volume of plasma required or preferable may be about 40uL*40%=16uL.
In some ments, it will not be possible to r 100% of the plasma because the buffy coat must not be bed, thus a minimum distance must be maintained between the bottom of the tip and the top of the pellet. This minimum distance can be determined mentally but the volume (V) sacrificed as a function of the required safety distance (d) can be estimated using: V(d) = d*n1.25mm2. For example, for a required safety distance of 0.25 mm, the sacrificed volume could be 1.23uL for the 60% hematocrit case. This volume can be decreased by decreasing the internal radius of the hematocrit portion of the centrifugation vessel.
However, because in some embodiments, that narrow portion must fully accommodate the outer radius of the extraction tip which can be no smaller than 1.5 mm, the existing dimensions of the centrifugation vessel may be close to the minimum. ation] eaa Along with plasma extraction, in some embodiments it may also be ed that the hematocrit be measured using computer vision. In order to facilitate this process the total height for a given volume of hematocrit may be maximized by minimizing the internal diameter of the narrow portion of the vessel. By maximizing the height, the relationship between changes in hematocrit volume and physical change in column height may be optimized, thus increasing the number of pixels that can be used for the measurement. The height of the narrow portion of the vessel may also be long enough to accommodate the worst-case scenario of 80% hematocrit while still leaving a small portion of plasma at the top of the column to allow for efficient extraction.
Thus, 40uL*80% = 32uL may be the required volume capacity for accurate measurement of the hematocrit. The volume of the narrow n of the tip as designed may be about 35.3uL which may allow for some volume of plasma to remain, even in the worst case.
A second usage scenario is much more involved, and may e one, more, or all of the following: 0 whole bloodpelleted 0 plasma extracted 0 pellet re-suspended in lysing bufler and stain 0 remaining white blood cells (WBCs) pelleted 0 supernatant removed 0 WECs re-suspended 0 WEC suspensionfully extracted In order to fully re-suspend a packed , ments have shown one can physically disturb the pellet with a tip capable of completely reaching the bottom of the vessel containing the pellet. A preferable geometry of the bottom of the vessel using for re-suspension seems to be a hemispherical shape r to standard commercial PCR tubes. In other embodiments, other vessel bottom shapes may be used. The centrifugation , along with the extraction tip, may be designed to facilitate the re-suspension s by adhering to these geometrical requirements while also allowing the extraction tip to physically contact the bottom.
During manual re-suspension experiments it was noticed that physical contact between the bottom of the vessel, and the bottom of the tip may create a seal that its fluid movement. A te spacing may be used in order to both fully disturb the pellet, while allowing fluid flow. In order to facilitate this process in a robotic , a physical feature may be added to the bottom of the fugation vessel. In some embodiments, this feature may comprise four small hemispherical nubs placed around the perimeter of the bottom portion of the . When the extraction tip is fully inserted into the vessel and allowed to make physical contact, the end of the tip may rest on the nubs, and fluid is allowed to freely flow between the nubs.
This may result in a small amount of volume (~.25uL) lost in the gaps.
During the lysing process, in some implementations, the maximum expected fluid volume is 60uL, which, along with 25uL displaced by the extraction tip may demand a total volume capacity of 85uL. A design with a current maximum volume of 100uL may exceed this requirement. Other aspects of the second usage io require similar or already discussed tip characteristics.
The upper geometry of the centrifugation vessel may be designed to mate with a e nozzle.
Any pipette nozzle described elsewhere herein or known in the art may be used. The external geometry of the [Annotation] eaa upper portion of the vessel may exactly match that of a reaction tip which both the current nozzle and dge may be designed around. In some ments, a small ridge may circumscribe the internal surface of the upper portion. This ridge may be a visual marker of the maximum fluid height, meant to facilitate automatic error ion using computer vision system.
In some embodiments, the distance from the bottom of the fully mated nozzle to the top of the maximum fluid line is 2.5mm. This distance is 1.5mm less than the 4mm recommended distance adhered to by the extraction tip. This decreased ce may be driven by the need to ze the length of the tion tip while adhering to minimum volume requirements. The justification for this decreased distance stems from the particular use of the vessel. e, in some implementations, fluid may be ged with the vessel from the top only, the m fluid it will ever have while mated with the nozzle is the maximum amount of whole blood expected at any given time (40uL). The height of this fluid may be well below the bottom of the nozzle. Another concern is that at other times the volume of fluid in the vessel may be much greater than this and wet the walls of up to the height of the nozzle. In some embodiments, it will be up to those using the vessel to ensure that the meniscus of any fluids contained within the vessel do not exceed the max fluid height, even if the total volume is less than the maximum specified. In other embodiments, other features may be provided to keep the fluid contained within the vessel.
Any dimensions, sizes, volumes, or distances provided herein are provided by way of example only. Any other dimension, size, volume or distance may be utilized which may or may not be proportional to the amounts mentioned herein.
The centrifugation vessel can be subjected to a number of forces during the process of exchanging fluids and rapidly inserting and removing tips. If the vessel is not constrained, it is possible that these forces will be strong enough to lift or otherwise ge the vessel from the centrifuge . In order to prevent movement, the vessel should be secured in some way. To accomplish this, a small ring circumscribing the bottom exterior of the vessel was added. This ring can easily be mated with a compliant mechanical feature on the bucket. As long as the retaining force of the nub is greater than the forces experienced during fluid manipulations, but less than the friction force when mated with the nozzle then the problem is solved.
Extraction Tip The Extraction Tip may be designed to interface with the centrifugation vessel, efficiently extracting , and re-suspending pelleted cells. Where desired, its total length (e.g., 34.5 mm) may exactly match that of another blood tip including but not limited to those described in US. Serial No. 12/244,723 (incorporated herein by reference) but may be long enough to physically touch the bottom of the centrifugation vessel. The ability to touch the bottom of the vessel may be required in some embodiments, both for the re- suspension s, and for complete recovery of the white cell suspension.
The required volume of the extraction tip may be determined by the maximum volume it is expected to aspirate from the centrifugation vessel at any given time. In some embodiments, this volume may be approximately 60uL, which may be less than the maximum capacity of the tip which is 85uL. In some embodiments, a tip of r volume than required volume may be provided. As with the centrifugation vessel, an internal feature circumscribing the interior of the upper portion of the tip may be used to mark the height of this m volume. The distance between the maximum volume line and the top of the mated nozzle may [Annotation] eaa be 4.5mm, which may be considered a safe distance to prevent nozzle ination. Any sufficient distance to prevent nozzle contamination may be used.
The fuge may be used to sediment precipitated LDL-cholesterol. Imaging may be used to verify that the supernatant is clear, indicating complete removal of the precipitate.
In one example, plasma may be diluted (e. g., 1:10) into a mixture of dextran sulfate (25mg/dL) and magnesium sulfate (100mM), and may be then incubated for 1 minute to precipitate LDL-cholesterol. The reaction product may be aspirated into the tube of the centrifuge, capped then and spun at 3000 rpm for three minutes. Figures 119, 120, and 121 are images that were taken of the original reaction mixture prior to centrifugation (showing the white itate), following centrifugation ng a clear atant) and of the LDL-cholesterol pellet (after removal of the cap), tively.
Other examples of centrifuges that can be employed in the present invention are described in US.
Patent Nos. 5,693,233, 5,578,269, 6,599,476 and US. Patent ation Nos. 2004/0230400, 2009/0305392, and 2010/0047790, which are incorporated by reference in their entirety for all purposes.
Example protocols Many variations of protocol may be used for centrifugation and processing. For example, a typical protocol for use of the fuge to process and concentrate white cells for cytometry may include one or more of the following steps. The steps below may be ed in varying orders or other steps may be substituted for any of the steps below: 1. e 10 uL blood anti-coagulated with EDTA (pipette injects the blood into the bottom of the centrifuge bucket) 2. Sediment the red and white cells by centrifugation (< 5 min x 10,000 g). 3. Measure hematocrit by imaging 4. Remove plasma slowly by aspiration into the pipette (4 uL corresponding to the worst case scenario [60 % hematocrit]) t disturbing the cell pellet.
. Re-suspend the pellet after adding 20 uL of an appropriate cocktail of up to five fluorescently d antibodies1 dissolved in buffered saline + BSA (1 mg/mL) (total reaction volume about 26 uLZ). 6. Incubate for 15 minutes at 37C. 7. Prepare lysing/fixative reagent by mixing red cell lysing solution (ammonium chloride/potassium bicarbonate) with white cell fixative reagent (formaldehyde). 8. Add 30 uL lysing/fixative reagent (total on volume about 60 uL). 9. Incubate 15 minutes at 37C . Sediment the white cells by fugation (5 min, 10,000 g). 11. Remove the supernatant sate (about 57 uL). 12. Re-suspend the white cells by adding 8 uL buffer (isotonic buffered saline). 13. Measure the volume accurately. 14. Deliver sample (c 10 uL) t0 cytometry.
The steps may include receiving a sample. The sample may be a bodily fluid, such as blood, or any other sample described elsewhere herein. The sample may be a small volume, such as any of the volume measurements described elsewhere herein. In some instances, the sample may have an anti-coagulant. 1 Concentration will be adjusted appropriately to deal with the different volume ratio relative to standard laboratory method (specifically about 5 x lower) 2 If ary, this volume can be bigger to have optimal staining but not more than 50 uL.
[Annotation] eaa A separation step may occur. For example, a density-based separation may occur. Such separation may occur via centrifugation, magnetic separation, lysis, or any other separation que known in the art. In some embodiments, the sample may be blood, and the red and white blood cells may be separated.
] A measurement may be made. In some instances, the measurement may be made via imaging, or any other detection mechanism described elsewhere . For example, the crit of a ted blood sample may be made by imaging. Imaging may occur via a digital camera or any other image capture device described herein.
One or more component of a sample may be removed. For example, if the sample is separated into solid and liquid components, the liquid component may be moved. The plasma of a blood sample may be removed. In some instances, the liquid component, such as plasma, may be removed via a e. The liquid component may be removed without disturbing the solid component. The imaging may aid in the removal of the liquid component, or any other selected component of the sample. For example, the imaging may be used to determine where the plasma is located and may aid in the ent of the pipette to remove the plasma.
In some embodiments, a reagent or other al may be added to the sample. For example, the solid portion of the sample may be resuspended. A material may be added with a label. One or more incubation step may occur. In some instances, a lysing and/or fixative t may be added. Additional separation and/or resuspending steps may occur. As needed, dilution and/or concentration steps may occur.
The volume of the sample may be measured. In some instances, the volume of the sample may be measured in a precise and/or accurate fashion. The volume of the sample may be measured in a system with a low coefficient of ion, such as coefficient of variation values described elsewhere herein. In some instances, the volume of the sample may be measured using imaging. An image of the sample may be captured and the volume of the sample may be calculated from the image.
The sample may be delivered to a desired process. For example, the sample may be delivered for cytometry.
In another e, a typical protocol that may or may not make use of the centrifuge for nucleic acid purification may include one or more of the following steps. The system may enable DNA/RNA extraction to deliver nucleic acid template to exponential amplification reactions for detection. The process may be designed to extract nucleic acids from a variety of s including, but not limited to whole blood, serum, viral transfer medium, human and animal tissue samples, food samples, and bacterial cultures. The process may be completely automated and may extract DNA/RNA in a consistent and quantitative manner. The steps below may be provided in varying orders or other steps may be substituted for any of the steps below: 1. Sample Lysis. Cells in the sample may be lysed using a chaotropic-salt buffer. The chaotropic- salt buffer may include one or more of the ing: chaotropic salt such as, but not limited to, 3-6 M guanidine hydrochloride or guanidinium anate; sodium dodecyl sulfate (SDS) at a typical concentration of 0.1-5% v/v; nediaminetetraacetic acid (EDTA) at a typical concentration of l-SmM; lysozyme at a typical concentration of 1 mg/mL; proteinase-K at a typical concentration of 1 mg/mL; and pH may be set at 7-7.5 using a buffer such as HEPES. In some embodiments, the sample may be incubated in the buffer at typical ature of 20-95 °C for 0-30 minutes. Isopropanol (50%-100% v/v) may be added to the mixture after lysis. 2. e Loading. Lysed sample may be exposed to a functionalized surface (often in the form of a packed bed of beads) such as, but not limited to, a resin-support packed in a chromatography style column, [Annotation] eaa magnetic beads mixed with the sample in a batch style manner, sample pumped through a suspended resin in a fluidized-bed mode, and sample pumped through a closed l in a tangential flow manner over the surface.
The surface may be functionalized so as to bind nucleic acids (e.g. DNA, RNA, DNA/RNA hybrid) in the ce of the lysis buffer. Surface types may include silica, and ion-exchange functional groups such as diethylaminoethanol (DEAE). The lysed mixture may be exposed to the surface and nucleic acids bind. ] 3. Wash. The solid surface is washed with a salt solution such as 0-2 M sodium chloride and ethanol (20-80% v/v) at pH 7.0 - 7.5. The g may be done in the same manner as loading. 4. Elation. Nucleic acids may be eluted from the surface by exposing the e to water or buffer at pH 7-9. Elution may be performed in the same manner as loading.
Many variations of these protocols or other protocols may be employed by the system. Such protocols may be used in combination or in the place of any protocols or s bed herein.
In some embodiments, it is important to be able to recover the cells packed and concentrated by centrifugation for cytometry. In some ments, this may be achieved by use of the pipetting device.
Liquids (typically isotonic buffered saline, a lysing agent, a mixture of a lysing agent and a fixative or a cocktail of labeled antibodies in buffer) may be dispensed into the centrifuge bucket and repeatedly ted and re- dispensed. The tip of the pipette may be forced into the packed cells to facilitate the process. Image analysis aids the process by objectively verifying that all the cells have been re-suspended.
] Use offhe pipette and centrifuge to process samples prior to is: In accordance with an embodiment of the invention, the system may have pipetting, pick-and-place and centrifugal capabilities. Such capabilities may enable almost any type of sample pretreatment and complex assay procedures to be performed efficiently with very small volumes of sample.
Specifically, the system may enables separation of formed ts (red and white cells) from plasma. The system may also enable re-suspension of formed elements. In some embodiments, the system may enable concentration of white cells from fixed and hemolysed blood. The system may also enable lysis of cells to release nucleic acids. In some embodiments, purification and concentration of nucleic acids by filtration h tips packed with (typically beaded) solid phase reagents (e.g. silica) may be enabled by the system. The system may also permit elution of purified nucleic acids following solid phase extraction. Removal and collection of precipitates (for example LDL-cholesterol precipitated using polyethylene glycol) may also be enabled by the system.
In some embodiments, the system may enable ty purification. Small molecules such as vitamin-D and serotonin may be adsorbed onto beaded (particulate) hydrophobic substrates, then eluted using organic solvents. Antigens may be provided onto antibody-coated substrates and eluted with acid. The same methods can be used to concentrate analytes found at low concentrations such as thromboxane-BZ and 6-keto- glandin F l a. Antigens may be ed onto dy or aptamer-coated substrates and then eluted.
In some ents, the system may enable chemical modification of analytes prior to assay. To assay nin (5-Hydroxytryptamine) for example, it may be ed to convert the analyte to a derivative (such as an acetylated form) using a reagent (such as acetic anhydride). This may be done to produce a form of the analyte that can be recognized by an antibody.
] Liquids can be moved using the pipette (vacuum aspiration and pumping). The pipette may be limited to relatively low positive and negative pressures (approximately 0.1 , 2.0 atmospheres). A centrifuge [Annotation] eaa can be used to generate much higher pressures when needed to force liquids through beaded solid phase media.
For example, using a rotor with a radius of 5 cm at a speed of 10,000 rpm, forces of about 5,000 X g (about 7 atmospheres) may be generated, sufficient to force liquids through resistive media such as packed beds. Any of the centrifuge designs and configurations discussed elsewhere herein or known in the art may be used.
Measurement of hematocrit with very small volumes of blood may occur. For example, inexpensive digital cameras are capable of making good images of small s even when the contrast is poor.
Making use of this capability, the system of the present invention may enable ted measurement of hematocrit with a very small volume of blood.
For e, 1 uL of blood may be drawn into a microcap glass capillary. The capillary may then be sealed with a curable adhesive and then subject to centrifugation at 10,000 x g for 5 minutes. The packed cell volume may be easily measured and the plasma meniscus (indicated by an arrow) may also be visible so hematocrit can be accurately measured. This may enable the system to not waste a relatively large volume of blood to make this measurement. In some embodiments, the camera may be used “as is" without operation with a microscope to make a larger image. In other embodiments, a microscope or other optical techniques may be used to magnify the image. In one implementation, the hematocrit was determined using the digital camera without additional optical interference, and the hematocrit measured was cal to that determined by a conventional microhematocrit laboratory method requiring many microliters of sample. In some embodiments, the length of the sample column and of that of the column of packed red cells can be measured very precisely (+/- < 0.05 mm). Given that the blood sample column may be about 10 - 20 mm, the standard deviation of hematocrit may be much better than 1 % matching that obtained by standard laboratory methods.
The system may enable measurement of erythrocyte sedimentation rate (ESR). The y of digital cameras to measure very small distances and rates of change of distances may be ted to measure ESR. In one example, three blood samples (15 uL) were aspirated into “reaction tips". Images were captured over one hour at two-minute intervals. Image analysis was used to measure the movement of the interface between red cells and plasma. Figure 122 shows results as distance of the interface from the plasma meniscus.
The precision of the measurement may be estimated by fitting the data to a polynomial function and calculating the standard deviation of the difference between the data and the fitted curve (for all samples).
In the e, this was ined to be 0.038 mm or < 2 % CV when related to the distance moved over one hour. Accordingly, ESR can be measured ely by this method. Another method for determination of ESR is to measure the maximum slope of the distance versus time relationship.
] Assay Preparation In some embodiments, tips can be designed to accommodate a plurality of reactions or assays.
Simultaneous measurement of l different assay mixtures and one or more controls or one or more calibrators can be made within one tip of the present invention. In doing this we exploit the y to sample l liquid sources by tial aspiration of liquids into the same tip. Effective tation and separation of the liquids is greatly improved by aspirating in sequence a small volume of air and a small volume of a wash solution which cleans the surface of the tips prior to aspiration of the next liquid of interest.
As described above, tips can have conical shapes. In some embodiments, an assay can e oxygen as a reactant. In such reactions, sing availability of oxygen within a reaction can be achieved by moving the sample and/or assay mixture to a wide part of tip to increase surface area to volume ratio.
[Annotation] eaa In Figure 93 and Figure 94, solutions of bromphenol blue were aspirated into tips. The uppermost segments (aspirated first) 6 uL are from a ld dilution series (highest concentration (0.0781 mg/mL) to the right of the image, with the exception of the left-most tip which is a water blank). Then air (2 uL), wash on (2 uL) respectively were ted followed by a 6 uL volume of a fixed concentration control solution (0.625 mg/mL).
Using this approach several alternative assay configurations can be ed, for example: 1. Simultaneous measurement of reagent and/or sample blank and assay 2. Simultaneous measurement of sample, blank and control 3. Within-tip calibration of assay The table below illustrates some “multiplex types" in which preferred combinations of , controls and calibrators are led within a tip. ——-- —----“mm —--—---- —-—---—---- _----I------ Case 2 is shown in Figure 95.
] Serial measurements of blank solutions, sample, controls and calibrators can also be made with single tips. In this scenario, the tip is filled with the first solution, read then emptied. The tip can then be re- filled and read with other samples etc. in sequence. The impact of “carry-over" of colored product from one sample to the next is minimized by either or both: ] 1. Reading the liquid column in the middle portion well away from that part that first comes into contact with the preceding sample 2. Washing the tip between samples.
In order to measure the extent of ‘carry-over" from one liquid segment to the next, the following procedure was be performed. A small amount (e. g. 6 uL) of a high concentration of bromphenol blue (e. g. 0.625 mg/mL) was aspirated into tips, followed by 2 uL of air and 2 uL of wash solution. Finally 6 uL of serial two-fold dilutions of enol blue is aspirated with the ing results (highest concentration (0.0781 mg/mL) to the right; left most tip is a water blank).
As can be seen from the images shown in Figure 96 and the 3-color analysis shown in Figure 97, able amounts of the high concentration solution is transferred into the wash solution.
Average carry-over (from high concentration control to the water wash) is calculated at 1.4 %.
Since, in effect, the leading zone (proximal to the earlier slug) of a later slug of liquid acts as second wash step and the color reading is taken at a location remote from this leading zone (typically at a central zone of the slug), the effective carryover from one slug to the next is typically much less than 1 % and ore generally insignificant. When the dilution series is measured using only dilution series samples to fill the tips, results are identical with those obtained above. The above represents a s test" designed to evaluate the extent of carry-over. ation] eaa Figure 98 shows a tip containing reaction products for two commercially ble assays for ionized calcium, Ca2+ (upper segment) and ium Mg2+ (lower segment) that were aspirated into tips for measurement. Ca2+ concentrations used in this experiment are 0, 2.5, 5, 10, 20, and 40 mg/dL; Mg2+ concentrations are 0, 1.25, 2.5, 5, 10, 20 mg/dL. Assay reaction mixtures (6 uL [Ca2+] and 4 uL [Mg2+]) are well separated using 2 uL of air, 3 uL of wash and a r 4 uL of air. Results for each assay read in this way are essentially identical to those measured having only one assay reaction e per tip.
As noted above, the present invention allows for simultaneous evaluation of a plurality of .
Images can be made ofmany assay cuvettes in the same field of view. Specifically, simultaneous evaluation of assays and controls in the same assay cuvette can be med. Simultaneous evaluation of several assays in the same assay e can be also performed.
Reaction Environment A system can comprise a heating block for heating the assay or assay unit and/or for control of the assay temperature. Heat can be used in the incubation step of an assay reaction to promote the reaction and shorten the on necessary for the incubation step. A system can comprise a heating block configured to receive an assay unit of the invention. The heating block can be configured to receive a plurality of assay units from a device of the invention. For e, if 8 assays are desired to be run on a device, the heating block can be configured to receive 8 assay units. In some embodiments, assay units can be moved into thermal contact with a heating block using the means for moving the assay units. The heating can be performed by a heating means known in the art.
Protocol Optimization Assay protocols for analyzing samples can be optimized in a variety of manners. When multiple assays are to be run on a sample, all ols can be optimized to the most stringent reaction conditions, or each assay protocol can be optimized based on the desired performance of a particular assay.
In some embodiments, a single protocol that can be designed to meet the test requirements under all possible use cases. For example, on a multiplex cartridge, a single protocol may be specified based on the case when all tests on the cartridge are to be performed (i.e., the limiting case). This protocol can be designed to meet the l test requirements, such as the precision and dynamic range for each test on the cartridge.
However, this ch can be suboptimal for alternate use cases, for example, when only a subset of tests on the dge is to be performed. In these cases, by using more sample, some assays can achieve improved performance in terms of sensitivity and precision. There can be a trade-off between how much sample is allocated to an assay and assay sensitivity. For example, an assay which has a sensitivity of 1 unit/mL when the sample is diluted 1:100 may be able to detect 0.1 unit/mL if the on factor is increased to 1:10. One downside of using a lower dilution factor in a multiplexed assay system with restricted sample volume can be that the fraction of the sample required for this assay is increased by 10-fold even when using the minimal volume to perform the assay. se, assay precision may be improved by using a higher sample tration. For example, an assay which results in a signal of (say) 0.1 absorbance +/- 0.02 (20 % signal imprecision) at its limit of detection can be improved by use of 10 times the sample concentration such that the signal produced is 10 times greater giving a signal of 0.1 +/1 0.02 OD at an analyte concentration ten times lower and at signal of 1.0, +/- 0.02 the imprecision is now only 2 %. The reason this is the case is that typically assay signal (at the lower range of analyte concentrations) is directly proportional to the analyte concentration [Annotation] eaa (and therefore to the sample concentration) s the signal imprecision can be typically related to the square root of the signal and so increases as the square root of e concentration (and sample concentration). Thus, the coefficient of ion (CV) of the signal can be inversely proportional to the square root of the signal; such that a 10-fold increase in signal corresponds to approximately three-fold decrease in signal CV. Since concentration CV is typically directly related to signal CV, the concentration CV will decrease with increased sample concentration (decreased dilution).
Protocols can be zed to specific use cases rather than the typical one-size fits all approach described above. For example, the ol may be optimized to enhance the precision of each test being performed in the multiplex device. Moreover, some tests may be prioritized relative to other tests for optimization. ol optimization can be pre-computed for use cases that are known a priori. Protocol optimization can also be performed in real-time for new use cases not known a priori. System validation can be performed to span the suite of use cases.
] One example of protocol optimization is described below comparing two uses cases. For both use cases, 8 uL of ted sample is available to run the required tests. In this example, the multiplex cartridge has 20 tests on board, where 5 of the tests require 1:5 on and 15 of the tests require 1:25 dilution.
In the first use case, all tests are required to be run on the sample. The protocol in this use case (Use-case B) is as follows: ] 1) Prepare 1:5 dilution (8 uL sample + 32 uL diluent) 2) Prepare 1:25 on (15uL 1:5 sample + 60 uL diluent) 3) For each test (n = 20), mix 5 uL of riately diluted sample with 10 uL of the reagent This protocol results in concentration imprecision of 10% CV for all 20 tests, meeting the minimal requirements.
The sample usage is 1 uL for each 1:5 dilution assay and 0.2 uL for each 1:25 on assay (for a total of 5*1 + *0.2 = 8 uL, using all the available sample).
In the second use case (Use-case “B") with the same cartridge type, only 10 tests are required to be run for the sample, not all 20. Moreover, all these 10 tests would be performed at the 1:25 dilution level in use- case A. The protocol is zed for this use case to maximize precision for all the tests by using a lower dilution (1:5). The optimized protocol for this specific use case is as follows: 1) Prepare 1:5 dilution (8 uL sample + 32 uL diluent) 2) For each test (n = 10), mix 4 uL of diluted sample with 11 uL of reagent Sample usage is 0.8 uL undiluted sample per assay for a total of 8 uL. Since the sample concentration in the assay is increased by 5-fold relative to that for use-case A, the assay sensitivity is improved by a factor of 5 and the assay imprecision is reduced by about 2.4 (5A0.5) fold to about 4.5 %.
By re-optimizing the protocol, in use case B employs s as much original sample for each test, thereby improving l performance. Note that the above discussion does not account for any imprecision due to errors in metering of volumes but only addresses errors due to imprecision in measurement of optical signal. Use-case B would have a lower imprecision due to imprecision in volumes since it uses fewer pipetting steps. For example if the volume imprecision introduces 5 % imprecision in the reported analyte concentration in both use cases there would be a total analyte imprecision of 11.2 % (10A2 + 5A2)A0.5 in use- case A compared with 6.5 % (4.5A2+5A2)A0.5 in use-case B (assuming, as is generally true, that s causing imprecision in assays aggregate as the square root of the sum of squares of each source of imprecision).
[Annotation] eaa The effects illustrated above can more easily be seen in the case of luminescence-based assays where the assay signal is expressed as a number of photons emitted per unit time. As is the case for counting of radioactive emissions in for e radioimmunoassay, the signal imprecision is equal to the square root of the signal and thus the signal CV is 100/ (square root of signal). For example, a signal of 10,000 counts will have a CV of 1 %. In many assays which produce photons (for example chemiluminescence immunoassays, the signal is almost exactly proportional to analyte concentration, at least at the lower concentration range). Thus the measured analyte imprecision scales with 1/ (square root of ) for concentrations significantly above the limit of detection. In assays which utilize dilution of the sample, the measured analyte imprecision will therefore scale as 1/ (sample dilution). For example, an assay using a 1:100 dilution of sample will have signal and concentration CVs about 3.2 fold (10A0.5) higher than an assay using a on 1: 10 (and will also have a sensitivity about es higher).
Reaction Chemistries A variety of assays may be performed on a fluidic device according to the present invention to detect an e of interest in a sample. Where a label is utilized in the assay, one may choose from a wide diversity of labels is available in the art that can be employed for conducting the subject assays. In some embodiments labels are detectable by spectroscopic, hemical, biochemical, electrochemical, chemical, or other chemical means. For example, useful nucleic acid labels include the, fluorescent dyes, electron-dense ts, and enzymes. A wide variety of labels le for labeling biological components are known and are ed extensively in both the scientific and patent literature, and are generally applicable to the present invention for the labeling of biological components. Suitable labels e, enzymes, fluorescent moieties, chemiluminescent moieties, bioluminescent labels, or colored labels. Reagents defining assay specificity optionally include, for example, monoclonal antibodies, polyclonal antibodies, aptamers, proteins, nucleic acid probes or other polymers such as affinity matrices, carbohydrates or lipids. Detection can proceed by any of a y of known methods, including spectrophotometric or optical tracking of fluorescent, or luminescent markers, or other methods which track a molecule based upon size, charge or ty. A detectable moiety can be of any material having a detectable physical or chemical property. Such detectable labels have been well-developed in the field of gel electrophoresis, column chromatography, solid substrates, spectroscopic techniques, and the like, and in general, labels useful in such methods can be applied to the present invention.
Thus, a label includes without limitation any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, nucleic acid probe-based, electrical, optical thermal, or other chemical means.
] In some embodiments the label (such as a colored compound, fluor or ) is coupled directly or indirectly to a molecule to be detected, according to methods well known in the art. In other embodiments, the label is attached to a receptor for the e (such as an dy, nucleic acid probe, aptamer etc.). As ted above, a wide variety of labels are used, with the choice of label depending on the sensitivity required, ease of conjugation of the compound, stability requirements, available mentation, and disposal provisions.
Non-radioactive labels are often attached by indirect means. Generally, a receptor specific to the e is linked to a signal-generating moiety. mes the analyte receptor is linked to an adaptor molecule (such as biotin or ) and the assay t set includes a binding moiety (such as a biotinylated reagent or avidin) that binds to the adaptor and to the analyte. The analyte binds to a specific receptor on the reaction site. A labeled reagent can form a sandwich complex in which the analyte is in the center. The reagent can also [Annotation] eaa e with the analyte for receptors on the reaction site or bind to vacant receptors on the reaction site not occupied by analyte. The label is either inherently detectable or bound to a signal system, such as a detectable enzyme, a fluorescent compound, a chemiluminescent compound, or a chemiluminogenic entity such as an enzyme with a luminogenic ate. A number of ligands and anti-ligands can be used. Where a ligand has a natural anti-ligand, for example, biotin, thyroxine, digoxigenin, and ol, it can be used in conjunction with labeled, anti-ligands. Alternatively, any haptenic or antigenic compound can be used in ation with an antibody. s of interest as labels will primarily be ases, particularly phosphatases, esterases and glycosidases, or oxidoreductases, particularly peroxidases. Fluorescent compounds include fluorescein and its derivatives, ine and its derivatives, dansyl , and umbelliferone. Chemiluminescent compounds include dioxetanes, acridinium esters, luciferin, and 2,3-dihydrophthalazinediones, such as luminol.
Methods of detecting labels are well known to those of skilled in the art. Thus, for example, where the label is fluorescent, it may be ed by exciting the fluorochrome with light of an appropriate wavelength and detecting the resulting fluorescence by, for example, microscopy, visual tion, via photographic film, by the use of onic detectors such as digital cameras, charge coupled devices (CCDs) or photomultipliers and phototubes, or other detection devices. Similarly, enzymatic labels are detected by providing appropriate substrates for the enzyme and detecting the resulting reaction t spectroscopically or by digital imaging (the subject of the present invention). Finally, simple colorimetric labels are often detected simply by observing the color associated with the label. For example, colloidal gold sols often appear pink, while s beads doped with dyes are strongly colored.
In some embodiments the detectable signal may be ed by luminescence sources. scence is the term commonly used to refer to the emission of light from a substance for any reason other than a rise in its temperature. In general, atoms or molecules emit photons of electromagnetic energy (e. g., light) when they transition from an excited state to a lower energy state ly the ground state). If the exciting agent is a photon, the luminescence process is referred to as photoluminescence or fluorescence. If the exciting cause is an electron, the luminescence process can be referred to as electroluminescence. More specifically, electroluminescence results from the direct injection and l of electrons to form an electron-hole pair, and subsequent recombination of the electron-hole pair to emit a photon. Luminescence which results from a chemical reaction is usually referred to as chemiluminescence. Luminescence produced by a living organism is y referred to as bioluminescence. If photoluminescence is the result of a spin allowed transition (e. g., a single-singlet transition, triplet-triplet transition), the photoluminescence process is usually referred to as fluorescence. Typically, fluorescence emissions do not persist after the ng cause is removed as a result of short-lived excited states which may rapidly relax through such spin d transitions. If uminescence is the result of a spin forbidden transition (e. g., a triplet-singlet transition), the uminescence process is usually referred to as phosphorescence. Typically, phosphorescence emissions persist long after the exciting cause is removed as a result of long-lived excited states which may relax only through such spin-forbidden transitions. A luminescent label may have any one of the above-described properties.
Suitable chemiluminescent sources include a compound which becomes electronically excited by a chemical reaction and may then emit light which serves as the detectible signal or donates energy to a fluorescent acceptor. A diverse number of families of nds have been found to provide [Annotation] eaa chemiluminescence under a variety of conditions. One family of compounds is 2,3-dihydro-l,4- phthalazinedione. A frequently used compound is luminol, which is a 5-amino compound. Other s of the family include the 5-amino-6, 7, 8-trimethoxy- and the dimethylamino[ca]benz analog. These compounds can be made to luminesce with alkaline hydrogen de or calcium hypochlorite and base. Another family of compounds is the 2,4,5-triphenylimidazoles, with lophine as the common name for the parent t.
Chemiluminescent analogs include para-dimethylamino and -methoxy substituents. Chemiluminescence may also be obtained with oxalates, usually oxalyl active esters, for example, p-nitrophenyl and a de such as en peroxide, under basic ions. Other useful chemiluminescent compounds that are also known e -N-alkyl acridinum esters and dioxetanes. Alternatively, luciferins may be used in conjunction with luciferase or lucigenins to e bioluminescence. Especially preferred chemiluminescent sources are “luminogenic" enzyme substrates such as dioxetane-phosphate esters. These are not luminescent but produce luminescent products when acted on by phosphatases such as alkaline phosphatase. The use of luminogenic substrates for enzymes is particularly red because the enzyme acts as an amplifier capable of converting thousands of substrate molecules per second to product. Luminescence methods are also preferred because the signal (light) can be detected both very sensitively and over a huge dynamic range using PMTs.
The term analytes as used herein includes without limitation drugs, prodrugs, pharmaceutical agents, drug metabolites, biomarkers such as expressed proteins and cell s, antibodies, serum proteins, cholesterol and other metabolites, electrolytes, metal ions, polysaccharides, c acids, biological analytes, biomarkers, genes, proteins, hormones, or any combination thereof Analytes can be combinations of polypeptides, roteins, ccharides, , and nucleic acids.
The system can be used to detect and/or quantify a variety of analytes. For example, analytes that can be detected and/or quantified include Albumin, Alkaline Phosphatase, ALT, AST, Bilirubin (Direct), Bilirubin (Total), Blood Urea Nitrogen (BUN), Calcium, Chloride, Cholesterol, Carbon Dioxide (COZ), Creatinine, Gamma-glutamyl-transpeptidase (GGT), Globulin, Glucose, HDL-cholesterol, Hemoglobin, Homocysteine, Iron, Lactate Dehydrogenase, Magnesium, Phosphorous, Potassium, , Total Protein, cerides, and Uric Acid. The detection and/or quantification of these analytes can be med using optical, electrical, or any other type of ements.
] Of particular interest are biomarkers which are associated with a particular disease or with a specific e stage. Such analytes e but are not limited to those associated with autoimmune diseases, obesity, hypertension, diabetes, al and/or muscular degenerative diseases, cardiac diseases, endocrine disorders, metabolic disorders, inflammation, vascular diseases, sepsis, angiogenesis, cancers, Alzheimer’s disease, athletic complications, and any combinations thereof.
Of also interest are biomarkers that are present in varying abundance in one or more of the body tissues including heart, liver, prostate, lung, , bone marrow, blood, skin, bladder, brain, muscles, nerves, and selected tissues that are affected by various disease, such as different types of cancer (malignant or non- metastatic), autoimmune diseases, inflammatory or degenerative diseases.
Also of interest are analytes that are indicative of a microorganism, virus, or Chlamydiaceae.
Exemplary microorganisms include but are not limited to bacteria, viruses, fungi and protozoa. Analytes that can be ed by the subject method also include blood-bom pathogens selected from a non-limiting group that consists of Staphylococcus epidermidis, Escherichia coli, methicillin-resistant Staphylococcus aureus [Annotation] eaa (MSRA), Staphylococcus aureus, Staphylococcus hominis, Enterococcusfaecalis, Pseudomonas nosa, Staphylococcus s, Staphylococcus warneri, Klebsiella pneumoniae, Haemophilus influenzae, Staphylococcus simulans, Streptococcus pneumoniae and Candida albicans.
Analytes that can be ed by the subject method also encompass a variety of sexually transmitted diseases selected from the following: gonorrhea (Neisseria gonorrhoeae), is (Treponena pallidum), clamydia (Clamyda tracomitis), nongonococcal urethritis (Ureaplasm urealyticum), yeast infection (Candida albicans), chancroid (Haemophilus ducreyi), trichomoniasis (Trichomonas vaginalis), genital herpes (HSV type I & II), HIV I, HIV II and hepatitis A, B, C, G, as well as tis caused by TTV.
Additional analytes that can be ed by the subject methods encompass a diversity of respiratory ens including but not limited to Pseudomonas aeruginosa, methicilliniresistant Staphlococccus aureus (MSRA), Klebsiella pneumoniae, Haemophilis influenzae, Staphlococcus aureus, Stenotrophomonas maltophilia, Haemophilis parainfluenzae, Escherichia coli, Enterococcusfaecalis, Serratia marcescens, Haemophilis parahaemolyticus, Enterococcus cloacae, Candida albicans, Moraxiella catarrhalis, Streptococcus pneumoniae, Citrobacterfreundii, Enterococcusfaecium, Klebsella oxytoca, Pseudomonas fluorscens, Neiseria meningitidis, Streptococcus pyogenes, Pneumocystis carinii, lla pneumoniae Legionella pneumophila, Mycoplasma pneumoniae, and Mycobacterium ulosis.
Listed below are additional exemplary markers according to the present invention: Theophylline, CRP, CKMB, PSA, bin, CA125, Progesterone, TxBZ, -PGF-l-alpha, and Theophylline, Estradiol , Lutenizing e, Triglycerides, Tryptase, Low density lipoprotein Cholesterol, High density lipoprotein Cholesterol, Cholesterol, IGFR.
] Exemplary liver markers include without limitation LDH, (LD5), Alanine-aminotransferase (ALT), Arginase 1 (liver type), Alpha-fetoprotein (AFP), Alkaline phosphatase, Lactate ogenase, and bin.
Exemplary kidney markers include without tion TNFa or, Cystatin C, Lipocalin-type urinary prostaglandin D, synthatase (LPGDS), Hepatocyte growth factor receptor, Polycystin 2, Polycystin l, Fibrocystin, Uromodulin, Alanine, aminopeptidase, N-acetyl-B-D-glucosaminidase, Albumin, and Retinolbinding protein (RBP).
Exemplary heart markers include t limitation Troponin I (TnI), Troponin T (TnT), Creatine dinase (CK), CKMB, bin, Fatty acid binding protein (FABP), C-reactive protein (CRP), Fibrinogen D- dimer, S-100 protein, Brain natriuretic peptide (BNP), NT-proBNP, PAPP-A, Myeloperoxidase (MPO), Glycogen phosphorylase isoenzyme BB (GPBB), Thrombin Activatable Fibrinolysis Inhibitor (TAFI), Fibrinogen, Ischemia modified n (IMA), Cardiotrophin-l, and MLC-I (Myosin Light Chain-I).
Exemplary pancrease markers include without limitation Amylase, Pancreatitis-Associated protein (PAP-l), and Regeneratein proteins (REG).
Exemplary muscle tissue markers include without limitation Myostatin.
Exemplary blood markers e without limitation Erythopoeitin (EPO).
] Exemplary bone s include without limitation, linked N-telopeptides of bone type I en (NTx), Carboxyterminal cross-linking telopeptide of bone collagen, Lysyl-pyridinoline (deoxypyridinoline), Pyridinoline, Tartrate-resistant acid phosphatase, Procollagen type I C propeptide, Procollagen type IN propeptide, Osteocalcin (bone gla-protein), Alkaline phosphatase, Cathepsin K, COMP [Annotation] eaa llage eric Matrix Protein), Osteocrin, Osteoprotegerin (OPG), RANKL, sRANK TRAP 5 (TRACP ), last Specific Factor 1 (OSF-1, Pleiotrophin), Soluble cell adhesion les, sTfR, sCD4, sCD8, sCD44, and last Specific Factor 2 (OSF-2, Periostin).
In some embodiments markers according to the present ion are disease specific. Exemplary cancer markers include Without tion PSA (total prostate specific antigen), Creatinine, Prostatic acid phosphatase, PSA complexes, Prostrate-specific gene-1, CA 12-5, Carcinoembryonic Antigen (CEA), Alpha feto n (AFP) hCG (Human chorionic gonadotropin), Inhibin, CAA Ovarian C1824, CA 27.29, CA 15-3, CAA Breast C1924, Her-2, atic, CA 19-9, CAA pancreatic, Neuron-specific enolase, Angiostatin DcR3 (Soluble decoy receptor 3), Endostatin, Ep-CAM (MK-1), Free Immunoglobulin Light Chain Kappa, Free Immunoglobulin Light Chain Lambda, Herstatin, Chromogranin A, Adrenomedullin, Integrin, Epidermal growth factor receptor, Epidermal grth factor or-Tyrosine kinase, Pro-adrenomedullin N-terminal 20 peptide, Vascular endothelial growth factor, Vascular endothelial grth factor receptor, Stem cell factor receptor, c-kit/KDR, KDR, and Midkine.
Exemplary infectious disease conditions include Without tion: Viremia, Bacteremia, Sepsis, and markers: PMN Elastase, PMN elastase/ (11-PI complex, Surfactant Protein D (SP-D), HBVc antigen, HBVs antigen, Anti-HBVc, Anti-HIV, T-supressor cell antigen, T-cell antigen ratio, T-helper cell antigen, Anti-HCV, Pyrogens, p24 antigen, l-dipeptide.
Exemplary diabetes markers include Without limitation C-Peptide, Hemoglobin A1c, ed n, Advanced glycosylation end products (AGEs), 1,5-anhydroglucitol, Gastric Inhibitory Polypeptide, Glucose, Hemoglobin A1c, ANGPTL3 and 4.
Exemplary inflammation s include Without limitation Rheumatoid factor (RF), Antinuclear Antibody (ANA), tive protein (CRP), Clara Cell Protein (Uteroglobin).
Exemplary allergy markers include Without limitation Total IgE and Specific IgE.
Exemplary autism markers include Without limitation Ceruloplasmin, Metalothioneine, Zinc, Copper, B6, B12, Glutathione, Alkaline phosphatase, and Activation of apo-alkaline phosphatase.
Exemplary coagulation disorders markers e Without limitation b-Thromboglobulin, Platelet factor 4, Von Willebrand .
In some embodiments a marker may be y specific. Markers indicative of the action of COX inhibitors include Without limitation TxB2 (Cox-1), 6-keto-PGFalpha (Cox 2), 11-Dehydro-TxB-1a (Cox-1).
Other markers of the present invention e Without limitation Leptin, Leptin receptor, and Procalcitonin, Brain S100 protein, Substance P, 8-Iso-PGF-2a.
Exemplary geriatric markers include Without limitation, Neuron-specific enolase, GFAP, and S 100B.
Exemplary s of nutritional status include Without limitation Prealbumin, Albumin, l- g protein (RBP), Transferrin, Acylation-Stimulating n (ASP), Adiponectin, Agouti-Related Protein (AgRP), Angiopoietin-like Protein 4 (ANGPTL4, FIAF), C-peptide, AFABP (Adipocyte Fatty Acid Binding Protein, FABP4), Acylation-Stimulating Protein (ASP), EFABP (Epidermal Fatty Acid Binding Protein, FABP5), Glicentin, Glucagon, Glucagon-Like Peptide-1, Glucagon-Like Peptide-2, n, Insulin, Leptin, Leptin Receptor, PYY, RELMs, Resistin, amd sTfR (soluble Transferrin Receptor). ation] eaa ary markers of Lipid metabolism e without limitation Apo-lipoproteins (several), Apo-Al, Apo-B, Apo-C-CII, Apo-D, Apo-E.
Exemplary coagulation status markers include t limitation Factor I: Fibrinogen, Factor 11: ombin, Factor III: Tissue factor, Factor IV: Calcium, Factor V: Proaccelerin, Factor VI, Factor VII: Proconvertin, Factor VIII:, Anti-hemolytic factor, Factor IX: Christmas factor, Factor X: Stuart-Prower factor, Factor XI: Plasma thromboplastin antecedent, Factor XII: Hageman factor, Factor XIII: Fibrin-stabilizing factor, Prekallikrein, High-molecular-weight kininogen, Protein C, Protein S, r, Tissue plasminogen activator, Plasminogen, iplasmin, Plasminogen tor inhibitor 1 (PAIl).
Exemplary monoclonal antibodies include those for EGFR, ErbB2, and IGFlR.
Exemplary tyrosine kinase inhibitors include without limitation Abl, Kit, PDGFR, Src, ErbB2, ErbB 4, EGFR, EphB, VEGFR1-4, PDGFRb, FLt3, FGFR, PKC, Met, Tie2, RAF, and TrkA.
Exemplary Serine/Threonine Kinase Inhibitors include without limitation AKT, Aurora A/B/B, CDK, CDK (pan), CDK1-2, VEGFRZ, PDGFRb, CDK4/6, MEK1-2, mTOR, and ta.
GPCR targets include without limitation Histamine Receptors, Serotonin Receptors, Angiotensin Receptors, Adrenoreceptors, Muscarinic Acetylcholine Receptors, GnRH Receptors, Dopamine Receptors, Prostaglandin Receptors, and ADP Receptors.
Cholesterol ement of metabolites can be performed by production of a d product using es (such as cholesterol oxidase) (to make H202) and radish peroxidase plus a chromogen (such as N-Ethyl- N-(2-hydroxy-3 -sulfopropyl)-3,5-dimethoxyaniline, sodium salt [“DAOS" plus amino anti-pyrene] to form a colored product such as a Trinder dye). One e of such chemistry is shown in Figure 52 and Figure 53.
NADH 0r NADPH Production or consumption ofNADH or NADPH are frequently used in clinical assays. This is because these coenzymes are common substrates for enzymes. For example, measurement of s of clinical interest such as lactate dehydogenase (LDH) can be measured by the rate of production ofNADH.
Since NADH absorbs light maximally at 340 nm and (l) polystyrene and other plastics transmit light poorly in the near UV, (2) White light sources produce little light in the near UV and (3) camera and scanner sensors have low sensitivity to near UV light, it is not practical to measure NADH by three color image analysis. To deal with this issue NADH can be ted to a colored product using tetrazolium salts such as Water Soluble Tetrazolium (e.g.WST-l (Dojindo Molecular Technologies) plus an “electron mediator" such as l- Methoxyphenazine methosulfate (PMS).
In some embodiments, assays that produce or consume NADH or NADPH can be paired with other reactions that allow for colorimetric measurement. For example, NADH or NADPH can be used to reduce compounds such as 2-(4-Iodophenyl)-3 -(4-nitrophenyl)(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt (WST-l) to a colored formezan dye as shown below with the use of phenazine methosulfate as an electron mediator, as shown in Figure 54.
] As shown in Figure 73, when NADH, WST-l and PMS are combined at millimolar trations, a yellow product (shown in tips indicated as Mixture) is formed.
Using this chemistry, an assay for LDH was setup. Lactate (mM), NAD (mM) and LDH were ed and incubated at 37C for 10 s before addition of WST-l and PMS. A good dose-response to [Annotation] eaa LDH was obtained as shown in Figure 74 for two-fold serial dilutions of LDH (1000 IU/L) (left to right) ponding to the OD 450 nm values shown in the graph in Figure 75.
Alkaline Phosphatase In other embodiments, assays utilizing s such as alkaline phosphatase can be measured using a genic substrate such as p-nitrophenyl phosphate. The enzymatic reaction can make p- nitrophenol which is yellow in alkaline conditions.
Metal ions Measurements can also be performed on assays that form colored complex, such as between a metal ion a chelating dye which changes color on binding. For example, o-Cresolphthalein Complexone (shown in Figure 55) forms a complex with calcium, which has a different color than the reagent. The general scheme of such assays is: Chelating dye (color 1) + MN+ <-> Chelating dye: MN+:(Color 2) Optical signals can also be measured for metal ion assays using metal-dependant enzymes. For example, sodium ions can be determined enzymatically via sodium dependent B-galactosidase activity with onitro-phenyl oside (ONPG) as the substrate. The absorbance at 405 nm of the product o-nitrophenol is proportional to the sodium tration.
ELISAs Assays can be performed for analytes by color-forming ELISAs. Many ELISA methods are known which generate color using enzymes such as horseradish dase, ne phosphatase and [3- galactosidase with chromogenic substrates such as o-phenylene diamine, p-nitrophenyl phosphate, and onitrophenyl galactoside respectively. Such assays can be readily performed and read by the subject invention.
Luminogenic immunoassays Luminogenic immunoassays can also be med. Assays can utilize chemiluminogenic entities such as an enzyme with a luminogenic substrate. For example, chemiluminescent compounds include dioxetanes, acridinium esters, luciferin, and 2,3-dihydrophthalazinediones, such as luminol.
Furthermore, suitable chemiluminescent sources include a compound which becomes electronically excited by a chemical reaction and may then emit light which serves as the detectible signal or donates energy to a fluorescent acceptor. A diverse number of families of compounds have been found to provide uminescence under a variety of conditions. One family of nds is 2,3-dihydro-l,4- phthalazinedione. A frequently used compound is luminol, which is a 5-amino compound. Other members of the family include the o-6, 7, 8-trimethoxy- and the dimethylamino[ca]benz analog. These compounds can be made to luminesce with alkaline hydrogen peroxide or calcium hypochlorite and base. Another family of compounds is the 2,4,5-triphenylimidazoles, with e as the common name for the parent product.
Chemiluminescent analogs e imethylamino and -methoxy substituents. uminescence may also be obtained with oxalates, usually oxalyl active esters, for e, p-nitrophenyl and a peroxide such as hydrogen peroxide, under basic conditions. Other useful chemiluminescent compounds that are also known include N-alkyl acridinum esters and dioxetanes. Alternatively, luciferins may be used in conjunction with rase or lucigenins to provide bioluminescence.
Nucleic Acid Amplification ] Assays that can be performed also include nucleic acid amplification. Among these assays, isothermal ication and Loop-Mediated Isothermal Amplification Assays (LAMP) are examples. Nucleic [Annotation] eaa acid amplification can be used to produce visibly turbid, fluorescent or colored assay reaction products for es such as nucleic acid targets (genes etc.). Nucleic acid amplification technology can be used for rmal cation of specific DNA and RNA targets. Additional information on isothermal nucleic acid cation is described in Goto et al., “Colorimetric detection of ediated isothermal amplification reaction by using y naphthol blue", BioTechniques, Vol. 46, No. 3, March 2009, 167-172.
Nucleic acid amplification can be used to measure DNA and, coupled with the use of reverse transcriptase, RNA. Once the reaction has occurred, the amplified product can be ed optically using intercalating dyes or chromogenic reagents that react with released pyrophosphate generated as a side product of the amplification.
The reaction can be visualized by changes (increases) in color, fluorescence or turbidity. Very small copy numbers of DNA can be ed in less than one hour. This technology can advantageously be read out in the present invention using three-color image analysis. As shown below, images of isothermal nucleic acid amplification assay reaction products can be ed by (1) back lit-illumination (transmission optics) ing absorbance of light, (2) images captured by a digital camera of light transmitted through a reaction product or (3) fluorescent light images generated by illumination of reaction products with a UV source (or any other riate light source) captured by a digital .
The nucleic acid amplification assay is generally performed in a “one-pot" format where sample and reagents are combined in a sealed tube and incubated at elevated temperature. In some formats, the reaction can be monitored in real time by changes in l properties. In other assay formats the reaction is stopped and reaction products visualized after adding a chromogenic or fluorogenic reagent. The present invention allows for the reading of nucleic acid amplification assay products directly in the reaction vessel or after aspiration into the tips described herein.
Turbidity The invention also provides for optical turbidimetric assays. For example, assays can be set up by measurement of the ination of small latex particles (50 - 300 nm). In these assays the particles can be coated with an antigen and/or antibody and agglutination occurs when a binding counterpart in the sample such as antibody or antigen is added. Assays can be set up as direct (e. g. antibody on the particle reacting with a multi-epitope protein or ker) or the competitive mode (e.g. drug hapten on particle reacts with rug antibody in competition with free drug in the ). The dispersion of latex becomes more turbid and the turbidity can be measured as decreased transmission of light using 3-color optics.
Similarly, assays based on the agglutination of large latex particles (diameter about 1 um) or red blood cells can be measured. Assay configuration is similar to turbidimetric assays as disclosed above, but the measurement can be by image analysis er or camera measurement) using re to interpret the number and size of the agglutinates.
Reagents for ming reaction chemistries can be included in the cartridges described here, such as in pipette tips. The reagents can be stored as liquids or in dried, lyophilized, or glassy forms.
] Localized Reagents In some embodiments, the location and configuration of a reaction site is an important element in an assay device. Most, if not all, disposable immunoassay devices have been configured with their capture surface as an integral part of the device.
[Annotation] eaa In one embodiment, a molded plastic assay unit is either commercially available or can be made by injection molding with precise shapes and sizes. For example, the characteristic dimension can be a diameter of 0.05 i 3 mm or can be a length of 3 to 30 mm. The units can be coated with capture reagents using method similar to those used to coat microtiter plates but with the advantage that they can be processed in bulk by placing them in a large vessel, adding coating reagents and processing using sieves, holders, and the like to recover the pieces and wash them as needed.
The assay unit (e.g. encompassing the tip disclosed herein, tips, vessels, or any other containers) can offer a rigid t on which a reactant can be immobilized. The assay unit is also chosen to provide appropriate characteristics with respect to interactions with light. For example, the assay unit can be made of a material, such as onalized glass, Si, Ge, GaAs, GaP, SiOZ, SiN4, modified silicon, or any one of a wide y of gels or polymers such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene, polycarbonate, polypropylene, polymethylmethacrylate (PMMA), acrylonitrile-butadiene-styrene (ABS), or ations thereof. In an embodiment, an assay unit comprises polystyrene. In some embodiments, the assay unit may be formed from a homogeneous material, heterogeneous material, clad al, coated material, impregnated material, and/or embedded material. Other riate materials may be used in accordance with the present invention. A transparent reaction site may be advantageous. In on, in the case where there is an optically transmissive window permitting light to reach an optical detector, the surface may be advantageously opaque and/or preferentially light scattering. In some embodiments, the assay unit may be formed from a transparent material. Alternatively, a portion of the assay unit may be formed from a transparent material.
The assay unit may have a reagent coated thereon and/or impregnated therein. In some embodiments, the reagent may be a capture reagent capable of immobilizing a reactant on a e surface.
The nt may be a cell and/or analyte, or any other reactant described elsewhere herein. In some embodiments, the reagent may be a molecule that may be a cell capture agent. A cell capture agent may anchor to the e of desired cells during fluid transport. In some embodiments, the capture reagents may be an antibody, peptide, organic le (e.g., which may have a lipid chain, lipophilic molecule), polymer matrix, n, n composite, rotein, that may interact with the cell membrane. Capture reagents may be molecules, cross-linked les, nanoparticles, nanostructures, and/or scaffolds. In some embodiments, microstructures may be provided that may become an analysis mechanism in a . Capture reagents (which may include capture ures formed by the assay unit material) may allow cells to be tethered, bound, and/or trapped.
The capture reagents may immobilize a reactant, such as a cell, during processing. Capture techniques may be chemical, physical, electrical, magnetic, mechanical, size-related, density-related, or any combination thereof. In some embodiments, the capture reagents may be used to trate reactants, such as cells, at a desired location. For example, an assay unit may be coated with the capture reagents, which may cause cells to be ed at the assay unit surface, thus concentrating the cells on the captured surface. The capture reagents may keep the captured reactant immobilized on the cell surface. This may aid in keeping the reactants (e. g., cells, es) stationary during g.
Immobilizing the reactants may be useful for applications where there may be long acquisition times for reactions and/or detection. For example, a number of imaging applications may require extended exposure times (~l min) or imaging of small objects (<lum) which may have significant Brownian motion.
[Annotation] eaa In some embodiments, the capture reagents may be formed from materials that may provide little or no background for imaging. In some instances, the material of the assay unit may provide little or no background for imaging. The capture reagents may be selected so that they do not interfere with, or only have a small interference with, imaging and/or ion.
A reactant immobilized at the capture surface can be anything useful for detecting an analyte of interest in a sample of bodily fluid. For instance, such reactants e, without limitation, nucleic acid probes, antibodies, cell membrane ors, monoclonal antibodies, ra, and aptamers reactive with a specific analyte. Various cially available reactants such as a host of polyclonal and monoclonal antibodies specifically developed for specific analytes can be used.
One skilled in the art will appreciate that there are many ways of immobilizing various reactants onto a support where reaction can take place. The immobilization may be covalent or noncovalent, via a linker moiety, or tethering them to an immobilized moiety. Non-limiting ary binding moieties for attaching either nucleic acids or proteinaceous molecules such as antibodies to a solid support e streptavidin or avidin/biotin linkages, carbamate linkages, ester linkages, amide, thiolester, (N)-functionalized thiourea, functionalized maleimide, amino, disulfide, amide, hydrazone linkages, and among others. In addition, a silyl moiety can be attached to a nucleic acid directly to a substrate such as glass using methods known in the art.
Surface immobilization can also be achieved via a Poly-L Lysine tether, which provides a charge-charge coupling to the surface.
The assay units can be dried following the last step of incorporating a capture e. For example, drying can be performed by passive exposure to a dry atmosphere or via the use of a vacuum ld and/or application of clean dry air through a ld or by lyophilization.
A capture surface may be applied to an assay unit using any technique. For example, the capture surface may be painted on, printed on, electrosprayed on, ed in the material, impregnating the material, or any other technique. The capture reagents may be coated to the assay unit material, incorporated in the material, co-penetrate the al, or may be formed from the al. For example, a t, such as a capture reagent may be embedded in a polymer matrix that can be used as a sensor. In some embodiments, one or more small particles, such as a nanoparticle, a microparticle, and/or a bead, may be coated and/or impregnated with reagents. In some embodiments, the capture reagents may be part of the assay unit material itself, or may be something that is added to the al.
In many embodiments, an assay unit is designed to enable the unit to be manufactured in a high volume, rapid manufacturing processes. For example, tips can be mounted in large-scale arrays for batch g of the capture surface into or onto the tip. In another e, tips can be placed into a moving belt or rotating table for serial processing. In yet another e, a large array of tips can be connected to vacuum and/or pressure manifolds for simple processing.
A capture reagent may be applied to an assay unit during any point in the process. For example, the capture reagent may be applied to the assay unit during manufacturing. The capture reagent may be applied to the assay unit prior to shipping the assay unit to a ation. Alternatively, the capture reagent may be applied to the assay unit after the assay unit has been shipped. In some ces, the capture reagent may be applied to the assay unit at a point of use, such as a point of service location.
[Annotation] eaa In some embodiments, the capture t may cover an entire surface or region of the assay unit.
The capture t may be provided on an inner surface of the assay unit. In some embodiments, the capture reagent may cover portions or ns of an assay unit surface. The capture reagent may be provided on a surface in a pattern. A unit may have portions of the surface that have a capture reagent d thereon, and portions of the surface that do not have a capture reagent applied thereon. For example, there may be coated and non-coated regions. A capture t may be applied in a surface in accordance with a geometric choice of how the capture t is to be applied. For example, the capture reagent may be applied in dots, rows, columns, arrays, regions, circles, rings, or any other shape or pattern. The capture reagents may be applied at desired ons on the surface.
A plurality of e reagents may optionally be applied to an assay unit. In some embodiments, the plurality of capture reagents may be applied so that the different capture reagents do not overlap (e. g., the different capture reagents are not applied to the same region or area). Alternatively, they may overlap (e.g., the different capture reagents may be applied to the same region or area). Space without any capture reagents may or may not be provided between regions with different e reagents. The different capture reagents may be used to immobilize different nts. For example, different capture reagents may be used to immobilize different cells and/or analytes on the capture surface. By using a plurality of capture reagents patterned in selected regions, a plurality of reactants may be detected from the same assay unit. In some embodiments, two or more, three or more, four or more, five or more, seven or more, ten or more, fifteen or more, twenty or more, thirty or more, forty or more, fifty or more, seventy or more, 100 or more, 150 or more, 200 or more, or 300 or more different capture reagents may be applied to a surface of an assay unit. The ent capture reagents may be applied in any pattern or shape. For example, different capture reagents may be applied as an array or series of rings on an inner surface of an assay unit. For example, different capture reagents may be applied on an inner surface of a tip, vessel, container, e, or any other container described elsewhere herein.
The location of the different capture reagents on the assay unit may be known prior to detection of the captured reactants. In some embodiments, the assay unit may have an identifier that may indicate the type of assay unit and/or the pattern of capture agents therein. Alternatively the location of the ent e reagents of the assay unit may not be known prior to detection of the captured reactants. The location of the ent capture reagents may be determined based on detected patterns of captured reactants.
The capture reagents may be d using any technique, such as those described elsewhere herein. In some instances, masking or raphic ques may be used to apply different capture reagents.
Any description herein of a capture t and/or coating applied to an assay unit may apply to any other units or containers bed elsewhere herein, including but not limited to tips, vessels, cuvettes, or reagent units.
Reagent lies In many embodiments of the invention the reagent units are modular. The reagent unit can be designed to enable the unit to be manufactured in a high volume, rapid manufacturing processes. For example, many t units can be filled and sealed in a large-scale process simultaneously. The reagent units can be filled according to the type of assay or assays to be run by the device. For e, if one user desires different assays than another user, the reagent units can be manufactured accordingly to the preference of each user, [Annotation] eaa without the need to manufacture an entire device. In another example, reagent units can be placed into a moving belt or rotating table for serial processing.
In another embodiment, the reagent units are accommodated directly into cavities in the housing of a device. In this embodiment, a seal can be made onto areas of housing surrounding the units.
Reagents according to the present invention include without limitation wash buffers, enzyme substrates, dilution buffers, conjugates, enzyme-labeled conjugates, DNA amplifiers, sample diluents, wash ons, sample eatment reagents ing additives such as detergents, polymers, chelating agents, albumin-binding reagents, enzyme inhibitors, enzymes, anticoagulants, red-cell agglutinating agents, antibodies, or other materials necessary to run an assay on a device. An enzyme-labeled conjugate can be either a polyclonal antibody or monoclonal dy d with an enzyme that can yield a detectable signal upon reaction with an appropriate substrate. Non-limiting examples of such s are alkaline phosphatase and horseradish peroxidase. In some embodiments, the reagents comprise immunoassay reagents. In general, reagents, ally those that are relatively unstable when mixed with liquid, are confined separately in a defined region (for example, a reagent unit) within the device.
In some embodiments, a reagent unit contains approximately about 5 microliters to about 1 milliliter of liquid. In some embodiments, the unit may contain about 20-200 microliters of liquid. In a further embodiment, the reagent unit contains 100 microliters of fluid. In an embodiment, a reagent unit contains about 40 microliters of fluid. The volume of liquid in a reagent unit may vary depending on the type of assay being run or the sample of bodily fluid ed. In an embodiment, the volumes of the reagents do not have to predetermined, but must be more than a known minimum. In some embodiments, the reagents are initially stored dry and dissolved upon initiation of the assay being run on the device.
In an embodiment, the reagent units can be filled using a siphon, a funnel, a pipette, a syringe, a needle, or a ation thereof. The reagent units may be filled with liquid using a fill l and a vacuum draw l. The reagent units can be filled individually or as part of a bulk manufacturing process.
In an embodiment, an individual reagent unit comprises a ent t as a means of isolating reagents from each other. The reagent units may also be used to contain a wash solution or a substrate. In addition, the reagent units may be used to contain a luminogenic substrate. In another ment, a plurality of reagents are contained within a reagent unit.
] In some instances, the setup of the device enables the capability of pre-calibration of assay units and the reagent units prior to assembly of disposables of the subject device.
Aptamer binding assays ] The subject invention enables a variety of assay methods based on the use of binding elements that specifically bind to one or more analytes in a sample. In general, a binding element is one member of a binding pair capable of specifically and selectively binding to the other member of the binding pair in the presence of a plurality of different molecules. es of binding elements include, but are not limited to, antibodies, antigens, metal-binding ligands, nucleic acid probes and primers, receptors and nts as described herein, and aptamers. In some embodiments, a binding t used to detect an analyte is an aptamer. The term “aptamer" is used to refer to a peptide, nucleic acid, or a combination thereof that is selected for the ability to specifically bind one or more target analytes. e rs are affinity agents that generally comprise one or more variable loop s displayed on the surface of a scaffold n. A nucleic acid aptamer is a specific [Annotation] eaa binding oligonucleotide, which is an oligonucleotide that is capable of selectively forming a complex with an intended target analyte. The complexation is target-specific in the sense that other materials, such as other analytes that may accompany the target analyte, do not complex to the aptamer with as great an affinity. It is recognized that complexation and affinity are a matter of ; however, in this context, “target-specific" means that the aptamer binds to target with a much higher degree of affinity than it binds to contaminating materials. The g of specificity in this context is thus similar to the meaning of specificity as applied to antibodies, for example. The aptamer may be prepared by any known method, including synthetic, recombinant, and purification s. Further, the term er" also includes “secondary aptamers" containing a consensus sequence derived from comparing two or more known aptamers to a given target.
In general, nucleic acid aptamers are about 9 to about 35 nucleotides in length. In some embodiments, a nucleic acid aptamer is at least 4, 5, 6, 7, 8, 9, 10, ll, 12, l3, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90, 100, or more es in length. Although the oligonucleotides of the aptamers generally are single-stranded or double-stranded, it is contemplated that aptamers may sometimes assume -stranded or quadruple-stranded structures. In some embodiments, a nucleic acid aptamer is circular, such as in 0176940. The specific g oligonucleotides of the aptamers should contain the sequence-conferring specificity, but may be extended with flanking regions and otherwise tized or modified. The aptamers found to bind to a target analyte may be isolated, sequenced, and then re-synthesized as conventional DNA or RNA moieties, or may be modified oligomers. These modifications include, but are not limited to incorporation of: (1) d or analogous forms of sugars (e. g. ribose and deoxyribose); (2) ative linking groups; or (3) ous forms of purine and pyrimidine bases.
Nucleic acid aptamers can comprise DNA, RNA, onalized or modified nucleic acid bases, nucleic acid analogues, modified or alternative backbone tries, or combinations thereof The oligonucleotides of the aptamers may contain the conventional bases e, e, cytosine, and thymine or uridine. Included within the term aptamers are synthetic aptamers that incorporate ous forms of purines and pyrimidines. gous" forms of purines and pyrimidines are those generally known in the art, many of which are used as chemotherapeutic agents. Non-limiting examples of analogous forms of purines and pyrimidines (i.e. base analogues) include aziridinylcytosine, 4-acetylcytosine, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethylthiouracil, 5-carboxymethyl-aminomethyluracil, inosine, N6-isopentenyladenine, l-methyladenine, ylpseudouracil, l-methylguanine, l-methylinosine, 2,2-dimethylguanine, 2- adenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5- methylaminomethyl-uracil, 5-methoxyaminomethylthiouracil, beta-D-mannosquueosine, 5-methoxyuracil, 2-methyl-thio-N6-isopentenyladenine, uraciloxyacetic acid methylester, pseudouracil, queosine, 2- thiocytosine, 5-methylthiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5 -oxyacetic acid, 5- pentynyl-uracil, and 2,6-diaminopurine. The use of uracil as a substitute base for thymine in deoxyribonucleic acid (hereinafter referred to as “dU”) is considered to be an “analogous" form of pyrimidine in this invention.
Aptamer oligonucleotides may contain analogous forms of ribose or deoxyribose sugars that are known in the art, including but not limited to 2' substituted sugars such as 2'-O-methyl-, llyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, alpha-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, locked nucleic acids (LNA), peptide nucleic acid (PNA), acyclic analogs and abasic side analogs such as methyl riboside.
[Annotation] eaa Aptamers may also include intermediates in their synthesis. For example, any of the hydroxyl groups ordinarily present may be replaced by phosphonate , phosphate groups, protected by a standard protecting group, or ted to prepare additional linkages to additional nucleotides or substrates. The 5' terminal OH is conventionally free but may be phosphorylated; OH substituents at the 3' terminus may also be phosphorylated. The hydroxyls may also be derivatized to standard ting groups. One or more phosphodiester linkages may be replaced by ative linking groups. These alternative linking groups e, but are not limited to embodiments wherein P(O)O is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), P(O)NR 2 (“amidate”), P(O)R, P(O)OR', CO or CH 2 (“formacetal”), wherein each R or R' is independently H or substituted or tituted alkyl (1-20C.) ally ning an ether (70*) linkage, aryl, alkenyl, lkyl, cycloalkenyl or aralkyl.
One particular embodiment of aptamers that are useful in the present invention is based on RNA aptamers as disclosed in US. Pat. Nos. 5,270,163 and 5,475,096, which are incorporated herein by reference.
The aforementioned patents disclose the SELEX method, which involves selection from a mixture of candidate oligonucleotides and stepwise iterations of binding, partitioning and amplification, using the same general selection , to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with a target, such as a target analyte, under conditions ble for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, iating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid s to the target molecule. In some embodiments, negative screening is employed in which a plurality of aptamers are exposed to analytes or other materials likely to be found together with target es in a sample to be analyzed, and only aptamers that do not bind are retained.
The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications e chemical tutions at the ribose and/or phosphate and/or base positions. In some ments, two or more aptamers are joined to form a single, multivalent aptamer le. Multivalent aptamer molecules can comprise multiple copies of an aptamer, each copy targeting the same analyte, two or more ent aptamers targeting different analytes, or ations of these.
Aptamers can be used as diagnostic and stic reagents, as reagents for the discovery of novel therapeutics, as reagents for monitoring drug se in individuals, and as reagents for the ery of novel therapeutic targets. rs can be used to detect, modify the function of, or interfere with or inhibit the function of one or more target analytes. The term “analytes" as used herein includes without limitation drugs, prodrugs, pharmaceutical agents, drug metabolites, biomarkers such as expressed proteins and cell markers, antibodies, serum proteins, cholesterol and other lites, electrolytes, metal ions, polysaccharides, nucleic acids, biological analytes, biomarkers, genes, proteins, hormones, or any combination thereof Analytes can be combinations of polypeptides, glycoproteins, polysaccharides, lipids, and nucleic acids. Aptamers can t the function of gene products by any one of, but not limited to only, the following mechanisms: (i) modulating [Annotation] eaa the affinity of a protein-protein interaction; (ii) ting the expression of a protein on a transcriptional level; (iii) ting the expression of a protein on a post-transcriptional level; (iv) modulating the activity of a protein; and (v) modulating the location of a protein. The precise mechanism of action of peptide aptamers can be determined by biochemical and c means to ain their specific function in the context of their interaction with other genes, and gene products. rs can be used to detect an analyte in any of the detection schemes described herein. In one embodiment, apatamers are covalently or non-covalently coupled to a substrate. miting examples of substrates to which aptamers may be coupled include microarrays, microbeads, pipette tips, sample transfer devices, es, capillary or other tubes, reaction chambers, or any other suitable format ible with the subject detection system. Biochip microarray production can employ various semiconductor fabrication techniques, such as solid phase chemistry, combinatorial chemistry, molecular biology, and robotics. One s typically used is a photolithographic manufacturing process for producing microarrays with millions of probes on a single chip. Alternatively, if the probes are pre-synthesized, they can be attached to an array surface using techniques such as channel pumping, et" spotting, template-stamping, or photocrosslinking.
An exemplary ithographic process begins by coating a quartz wafer with a light-sensitive chemical compound to prevent coupling between the quartz wafer and the first nucleotide of the DNA probe being d. A lithographic mask is used to either inhibit or permit the transmission of light onto specific ons of the wafer surface. The surface is then contacted with a solution which may contain adenine, thymine, cytosine, or guanine, and coupling occurs only in those regions on the glass that have been deprotected through illumination. The coupled nucleotide bears a light-sensitive protecting group, allowing the cycle can be repeated. In this manner, the microarray is created as the probes are synthesized via repeated cycles of deprotection and coupling. The process may be repeated until the probes reach their full length. Commercially available arrays are typically manufactured at a y of over 1.3 million unique features per array. ing on the demands of the experiment and the number of probes required per array, each wafer, can be cut into tens or hundreds of individual arrays.
Other methods may be used to produce the biochip. The biochip may be a Langmuir-Bodgett film, onalized glass, germanium, silicon, PTFE, polystyrene, gallium arsenide, gold, , membrane, nylon, PVP, or any other material known in the art that is capable of having functional groups such as amino, carboxyl, Alder reactants, thiol or hydroxyl incorporated on its surface. These groups may then be covalently attached to crosslinking agents, so that the subsequent attachment of the nucleic acid ligands and their interaction with target molecules will occur in solution without hindrance from the biochip. Typical crosslinking groups include ethylene glycol oligomer, diamines, and amino acids. Alternatively, aptamers may be coupled to an array using enzymatic procedures, such as described in U820100240544.
In some embodiments, aptamers are coupled to the surface of a microbead. eads useful in coupling to oligonucleotides are known in the art, and include magnetic, magnetizable, and non-magnetic beads.
Microbeads can be labeled with l, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more dyes to facilitate coding of the beads and identification of an aptamer joined thereto. Coding of microbeads can be used to guish at least 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 5000, or more different microbeads in a single assay, each microbead corresponding to a ent aptamer with specificity for a different analyte.
[Annotation] eaa In some embodiments, reagents are coupled to the surface of a reaction chamber, such as a tip. For example, the interior surface of a tip may be coated with an aptamer specific for a single analyte. Alternatively, the interior surface of a tip may be coated with two or more different aptamers specific for different analytes.
When two or more different aptamers are coupled to the same interior tip surface, each of the different aptamers may be coupled at different known ons, such as forming distinct ordered rings or bands at ent positions along the axis of a tip. In this case, multiple different analytes may be analyzed in the same sample by drawing a sample up a tip and ng analytes contained in the sample to bind with the aptamers coated at successive positions along the tip. Binding events can then be visualized as described herein, with the location of each band in a banding pattern corresponding to a specific known analyte.
In some embodiments, binding of one or more aptamers to one or more target analytes is detected using an optical feature. In some embodiments, the optical feature is fluorescence. In some ments, a sample containing es to be analyzed is treated with a labeling compound to ate the analytes with a fluorescent tag. Binding can then be measured by fluorescence to detect ce and optionally ty of one or more analytes, such as illustrated in Figure 136 in combination with aptamers d to an array, and in Figure 137 in combination with aptamers coupled to coded beads. In some embodiments, the sample is treated with a labeling compound to conjugate the analytes with a linker. Upon binding the linker is functionalized with a fluorescent tag and the positive event is measured by fluorescence. In some ments, the analyte binding domain of an aptamer is partially hybridized to a complentary probe that is fluorescently labeled. Upon binding to the analyte, the complementary probe is ed, which s in an optically measurable decrease in fluorescent signal. In some embodiments, an aptamer is fluorescently labeled and is partially hybridized to a complementary probe labeled with a quencher that is in proximity to the fluorescent label. Upon binding to the analyte, the mentary probe is released resulting in a measurable increase in fluorescence of the label conjugated to the aptamer. In some embodiments, the aptamer is partially hybridized to a complementary probe, which ization occludes a domain containing a secondary structure. Upon binding to the analyte, the complementary probe is released, and the secondary structure is made ble to an intercalating dye used to produce a measurable signal. Labels useful in the detection of binding between an apatamer and an analyte in a binding pair can include, for example, fluorescein, tetramethylrhodamine, Texas Red, or any other fluorescent le known in the art. The level of label detected at each address on the biochip will then vary with the amount of target analyte in the mixture being d.
In some embodiments, the displaced complementary probe is conjugated to one member of an affinity pair, such as biotin. A detectable molecule is then conjugated to the other member of the affinity pair, for example avidin. After the test mixture is applied to the biochip, the conjugated able molecule is added.
The amount of detectable molecule at each site on the biochip will vary inversely with the amount of target molecule present in the test mixture. In another embodiment, the displaced complementary probe will be biotin labeled, and can be detected by addition of fluorescently d avidin; the avidin itself will then be linked to another fluorescently labeled, -conjugated compound. The biotin group on the displaced oligonucleotide can also be used to bind an avidin-linked reporter enzyme; the enzyme will then catalyze a reaction leading to the deposition of a detectable compound. Alternatively, the er enzyme will catalyze the tion of an insoluble product that will locally quench the cence of an intrinsically-fluorescent biochip. In another embodiment of the displacement assay, the displaced complementary probe will be labeled with an [Annotation] eaa immunologically-detectable probe, such as digoxigenin. The displaced complementary probe will then be bound by a first set of antibodies that specifically recognize the probe. These first antibodies will then be recognized and bound by a second set of antibodies that are fluorescently labeled or ated to a reporter enzyme. Many variations on these examples are known or will now occur to those skilled in the art. Assays analogous to “double-sandwich" ELISAs can also be set up using combinations of antibodies and aptamers as receptors. For example, a capture e can be onalized with an aptamer and the detection reagent can be an enzyme-labeled antibody. Conversely, the antibody can be on the capture surface and the detection reagent a labeled aptamer.
In some embodiments, a sample containing an anlalyte to be analyzed is dispersed into a three- dimensional hydrogel matrix. The hydrogel matrix can be activated to covalenly trap proteins and small molecules. After a wash of the excess and unbound , fluorescently labeled aptamers can be introduced for the detection of the specific analytes present, such as illustrated in Figure 138. In some embodiments, the dimensional hydrogel matrix is divided in small subsets or microwells to which a single aptamer can be added to undergo a c analysis of the analyte present. In some embodiments, aptamers are labeled with a set of coded quantum dots or fluorescent tags corresponding to a unique signature. In some ments, labeled aptamers are added to the three-dimensional matrix simultaneously with the sample.
In some embodiments, an aptamer is used instead of an antibody in an ELISA assay. In general, a sample is exposed to a e and specifically or non-specifically coupled thereto. In a sandwich ELISA, an analyte is specifically coupled to a surface by binding to first antibody that is coupled to the surface. In a typical ELISA, the analyte, whether bound specifically or non-specifically, is then detected by binding to a second antibody carrying a label. In an aptamer ELISA, the first antibody, second antibody, or both are replaced with aptamers specific for an analyte.
Imaging Analysis of Samples and Assay Reaction Products ] In some embodiments of the invention, analysis of sample and the assay on products can be performed using l g. The assay cuvettes can be aligned for measurement and scanned or imaged in a single operation. In the instrumented system of the ion this is ed automatically by mechanical components. Assay cuvettes are located at defined locations in a cartridge and moved to the scanner maintaining the same orientation and spacing. The graph shown in Figure 92 corresponds to the green l response over the width of the cuvette. As shown, the edges of the cuvettes are well-defined, as is the location corresponding to the middle of the cuvette.
The images obtained by ng or imaging can be a two-dimensional array of pixels, where each pixel ses a plurality of intensity values corresponding to a distinct detection spectral region (e. g., red, blue, green). The images can be interpreted by line-scans, which may correspond to a horizontal portion of a tip. If the tip is circular-shaped, then an effective absorbance can be determined by deconvoluting the line-scan over an appropriate function. Example ons include parabolic functions, and functions for circles. In some embodiments, the images can be data-averaged over multiple images taken of a tip or a sample over a range of physical locations.
In an ment, a sensor is provided to locate an assay unit relative to a detector when an assay is detected.
[Annotation] eaa As shown in Figure 61 and Figure 62, bromophenol blue solutions were aspirated into a set of conical tips and imaged with front face illumination (light source and detector on the same side of the object).
Small volumes (5 uL) of serial dilutions of a 0.78 mg/mL on were used with the highest concentration at the top of the image. In Figure 61, tips on the left have the sample located at the widest location in the conical tip whereas tips on the right have the sample at the narrowest. The image in Figure 61 was taken using a scanning optical system.
Figure 62 shows tips that were imaged using a back-lit configuration (light source and detector on opposite sides of the imaged object). The back-lit configuration can be preferred because of the higher image quality.
As shown in Figure 61 and Figure 62, the effective optical path length of a colored solution can be varied by changing tip design. In ular, the pathlength can be varied within a single tip to increase sensitivity of measurement of light absorbance (long pathlength) or to se the dynamic range of the measurement. The ngth can be changed, for e, by changing the diameter of the tip.
An additional feature of the tip design can be that it enables assays to be read with a very small volume of assay reaction product ing a very small volume of sample. Typically, assay reaction mixtures are incubated in a narrow part of a tip which provides a high ratio of liquid/air surface area to volume, thus minimizing evaporation. The small volume can then be moved to a wide part of the tip for measurement of the colored product thus zing the optical pathlength available (and thereby increasing the absorbance of light) for a given reaction mixture volume.
For e in the table below, we compare g an assay reaction mixture of 10 uL in which a 1 uL sample is diluted 1:10. In the tips of the current invention, incubation of an assay mixture can be achieved in a 13 mm length of tip region having a diameter of 1 mm then be moved to a 3 mm diameter region for color measurement. In comparison with using a microtiter plate of standard dimensions (typical of 384-well plates) to incubate and read the same assay, the area of liquid surface exposed to air (allowing evaporation) is about 5 times less and the l pathlength is about twice as great.
Lengthofli uid column‘1 3 m Tip er 3.00-Pathlength for reading [Annotation] eaa Length of liquid column 1.41 Pathlength ] Optimizing opticalpath length Spectroscopic ements of colored solutes are traditionally measured by recording the fraction of light transmitted h a cuvette at the absorbance wavelength maximum. The data are then ormed to give Absorbance (A) or optical density (OD) values. According to Beer’s law, A(7tmax) = 8M*l*Concentration where SM is the molar extinction t (L/Mole.cm), l is the optical pathlength (cm) and Concentration is in molar units. OD = A for l = 1. This is done to provide a measure, A, which is directly tional to solute concentration.
There are two significant limitations of absorbance measurements for assaying solute concentrations. At low concentrations, the change in transmission is small and therefore imprecise because of variations in the background (or blank) transmission. At high trations transmission is very low (for example at A = 3, the transmitted light is l/1000 th of the input light. Any “stray" light or other forms of signal noise have a significant effect on the ement and the response to concentration becomes non-linear and imprecise. Typically, absorbance measurements are regarded as precise and accurate over a range from about 0.1 to about 2.0 (a 20-fold range).
The method of the present invention mes these problems to a significant degree by enabling facile measurements of color over a very wide dynamic range (up to lOOO-fold): 1. At different pathlengths: low concentrations can be measured at long pathlengths and high concentrations at short pathlengths. 2. In different color channels: low concentrations can be measured in the best matching color channel and high concentrations in color ls mismatched to the color.
This is illustrated by the data shown in Figure 79. Bromphenol blue solutions serially diluted from a 5 mg/mL stock were ed using the three-color method in tips at two locations, one with a maximum pathlength (also “path lengt " herein) of about 5 mm (“wide"), the other of about 1 mm (“narrow"). Signals in the three color ls were normalized to their highest and lowest levels as shown in the graph below. An algorithm to lly extract the concentration of the analyte (bromphenol blue) was set up as follows: 1. For normalized signals in the range 10% maximum < signal < 90% maximum, compute a value concentration = a + b*Log(signal) + c*(Log(signal))AZ where a b and c are arbitrary constants. This operation was performed for each color at both pathlengths. ] 2. Using a well-known optimization e (for example “Solver" in oft Excel), compute the best-fit values of a, b and c for all colors and pathlengths. 3. Average the computed concentration values for all colors and both pathlengths.
As shown in Figure 80, the method yielded accurate results across a 1000-fold concentration range. When the algorithm was used to compute concentration values for replicate measurements (N = 3), the average CV was 3.5 %.
[Annotation] eaa Measurements can be made at various pathlengths. In some cases, pathlengths are at least partially dependent on container (e. g., cuvette, tip, vial) geometry. The container geometry and/or features in the container, such as scattering features, may affect the optical path and path length in the container.
Mum-color analysis Scanners and cameras have detectors that can measure a plurality of different colors channel ion spectrum s (e. g., red, green, and blue). Because the al width of each of these channels is wide and color chemistries produce colored ts with wide band widths, colored reaction products can be ed using a plurality of channel detection spectrums. For e, Figure 71 shows the response of red (squares), green (diamonds), and blue (triangles) detection channel spectrums as a function of analyte concentration. The s produced by each detector correspond to light intensity within each detection spectrum and are typically expressed as a number from 0 to 255. When white light is transmitted through a circular section cuvette containing a colored solute as shown above, light is absorbed and the light intensity reduced so that the detector responses change.
For example, when henol blue dissolved in alkaline buffer at concentrations g from 0 to 5 mg/mL and scanned at the on ted “C3" in Figure 62, signals shown in Figure 66, which are the detector responses averaged over a zone corresponding to seven pixels along the length of the cuvette. The signals were ed on an Epson backlit scanner. Figure 66 shows the three color responses for a set of 11 es containing 2-fold serial dilutions of a 5 mg/mL bromophenol blue solution and a “blank" solution (arranged left to right on the . The image of the scanned tips is shown in Figure 67. The signal in each channel corresponding to the solution is reduced to an extent related to the optical path. Accordingly, the maximum change in signal is seen at the center of the cuvette. When signals in the central region of the cuvette were averaged (over the zone shown by the small rectangles for the fourth cuvette from the left) and plotted t the bromophenol blue concentration, the dose-responses shown Figure 68 were observed. In each color “channel" the signal declined smoothly with concentration. The green signal changed most and the blue signal least. Corresponding optical densities measured in an M5 spectrometer ular Devices) at the wavelength of maximal absorbance (e. g., 589 nm) are also shown. At the highest concentrations, the spectrophotometer response becomes not linear and changes very little with concentration. A similar effect was noted in the scanner green and red channel responses. The blue channel response in contrast, is very slight until the highest trations.
According to Beer’s law, absorbance of a solution is equal to 8M*Concentration*pathlength. ance is defined as LoglO(Transmission/Blank Transmission), where blank transmission is that corresponding to that for the solvent. Strictly Beer’s law s to a parallel beam of monochromatic light (in practice a band width of a few nm) passing normally through a rectangular cuvette. Spectrophotometers respond linearly to concentration up to Absorbance values about 1.5. At higher absorbance, instrument response becomes non-linear due to “stray light" and other effects. Optical density is defined as absorbance for a one cm optical pathlength.
When the color signal data from the above experiment was ormed according to an expression that linearizes optical transmission so as to obtain an absorbance value proportional to concentration in conventional spectrophotometry (-Log(signa1/blank ), the graph shown in Figure 69 was obtained for the green (squares) and red nds) channels.
[Annotation] eaa The green channel data followed Beer’s law but the red channel data did not reaching a plateau level at for a sample having about 2 mg/mL in a fashion similar to that of the OD response of the spectrophotometer.
Improved assay utilization by three-color analysis and optimization ofopticalpath length Assay results from on setups that would otherwise provide uninterpretable data can be salvaged using the present invention. The present invention allows for increased dynamic range and sensitivity of assays by the combination of optical pathlength optimization and color analysis. The ity to salvage data plagued by reduced c range is a major problem in assay management, especially in the context of samples being evaluated for diagnostic or therapy management es is that assays have a limited dynamic range or limited range of analyte values that can be reported with good confidence. There are two main s why an assay result may not be available fiom laboratory-based assay s or from distributed test situations. Namely the analyte value is too high or too low to be reported. This may in some circumstances be rectified in clinical laboratories by re-analyzing a n of a retained sample using a different dilution. In distributed g typically there is no recourse but to recall the patient, obtain a new sample and use a different (laboratory) method. This is because assay systems use fixed ols and fixed levels of sample on. In either situation, it is very inconvenient and expensive to rectify the problem. Moreover, valuable information pertinent to proper diagnosis and/or therapy management may be lost with resultant harm to the patient.
In the system of the present invention, these problems are eliminated by monitoring assays during their execution, recognizing any problem and modifying either the optical pathlength used to measure the assay product or making use of the different ivity levels of the three color channels to the assay color and in turn to the analyte sensitivity.
Specifically when the assay reaction product is ed if the measured signal is either too high or too low, the system can respond by: 1. making the measurement with a different pathlength (moving the optical cuvette relative to the optical system such that the pathlength is either bigger or smaller). This can be performed by (a) making a measurement at a standard, first on, (b) reporting the result to the software ng the assay (in instrument and/or on a remote server), (c) recognizing a m condition, and (d) modifying the read position and making a second measurement; and/or 2. izing a more or less sensitive color channel in signal analysis. This can be implemented automatically by le assay analysis algorithms.
Color Calibration The signal responses can be calibrated to allow for computation of the concentration of the colored species from imaging data. To obtain a data transform predictive of the concentration of the colored solute, the following procedure can be used. In other embodiments, other methods may also be used.
] I. For each channel for all concentrations, the transform -Log(signal/blank signal) was computed and designated “A". 2. For all concentrations, a further transform (“C") was computed as a*A + b*AA2 + c*AA3 (initially values for a, b and c were set at arbitrary values). 3. For all concentrations, C values for the three color channels were summed and designated Cestimate.
[Annotation] eaa 4. The sum of square differences between the target (known) tration and Cestimate was computed over all concentrations. 5. Values of a, b and c ters for all channels were derived by a well-known algorithm which minimized the sum of the square differences.
The results shown in Figure 70 trates accurate calibration of the r response over the entire concentration range.
] Other automated calibration thms have been developed and found to be equally effective.
For example, the following is an example of calibration for a terol assay performed in a reaction tip.
The ed signal is decomposed into Red (R), Green (G), and Blue (B) color channels.
Calibration equations are computed to optimize the accuracy, ion, and dynamic range according to assay design requirements.
In this assay example, only Red and Green channels are utilized to compute concentration. These two signals are transformed to compute an intermediate variable (F) as follows: umwm FEfifi+pr+pr2+ppR+pra where p,- are ation parameters.
Finally, the signal F is used to compute the concentration (C) via a linear transformation: [mam C=G¥p9/,p7 where C is the calculated concentration, and p6 and [17 are calibration parameters, in this case, representing the intercept and slope parameters of a linear relationship, respectively.
When the same approach was followed for a large set of assays for a variety of analytes which ed colored products ng the entire visible spectrum (kmax from 400 -700 nm), comparable results were obtained.
In conventional transmission spectrophotometric measurements, a “blank" value is used to normalize the measurement. Method (1) Blanks are lly constructed by measuring a sample that is equivalent to the sample but does not have any of the component to be measured. The measurement is typically made in the same cuvette as that which will be used for the sample or an optically equivalent cuvette. Thus in a spectrophotometric assay, one would combine all the reagents in the same concentrations using the same protocol substituting a zero analyte solution for the sample. Method (2) uses a two step process making measurements t an absolute reference such as air (which will never vary in absorbance) and measuring both sample and blank against the absolute reference. The sample absorbance is then calculated by subtraction of the blank value from that of the sample. Method (3) is to collect spectra of the sample or assay reaction product and reference the ed absorbance (or ission) at an optimal wavelength (usually that for maximum absorbance for the measured species) t the absorbance at a wavelength where the species to be measured is known to have zero absorbance. The absorbance is the difference between those recorded at the two wavelengths.
Digital imaging and three-color analysis can be employed, but in some embodiments can be modified according to the l (pixilated) character of the assay signal. Namely: [Annotation] eaa 1. For each pixel in the image and for each color a white standard is imaged and the intensities of the signal adjusted to a value corresponding to no absorbance. This can be done by the following exemplary procedure: a. ing the intensity of the light source b. adjusting the sensitivity of the detector (preferred), or c. software adjustment (not preferred by itself) A preferred approach is a combination of (b) and (c) above. First, adjust the detector in the analog realm, and then fine tune the result in the digital realm.
For the analog adjustment, the gain and offset of the iers between the light sensors and the -to-digital section are adjusted to ensure maximum resolution of the digitization. The lower end of the light range of interest will be set to zero and the high end of the range will be set to just below saturation of the sensor.
Subsequently, the images may be fine-tuned in the digital domain. A preferred approach, specifically, would be to use what is called the mage calibration" for an m x n image. The mechanism is to first collect a black image by blocking all light to the detector. We’ll call this image BLACK[m,n]. A second calibration image is recorded consisting of light at the maximum end of the sensitivity range. We’ll call this image WHITE[m,n]. Thus a corrected image a[m,n] could be constructed, pixel-wise, as: c[m, n] — BLA CK[m, 11] a[m, 11]=m Note that this l correction does not improve the dynamic range of the digitized data, but adjusts the values so that the full white and black references are consistent. 2. An image of a physical blank in a tip can be used as a by-pixel and color by color blank.
The blank can be: a. Air; b. Water; c. Blank assay reaction product (no analyte); d. Sample blank (no assay reagents); or e. Some combination of the above; ] 3. The signal from a color channel where there is a zero or weak response can be used to normalize signals from the other channels.
] A further method of controlling and normalizing the optics is to image a set of physical (stable) standards before or during an assay. For example, an array of d dyes (shown in Figure 104) can be made corresponding to a set of standard colors with standard intensities (similar to rd color “wheels" used to calibrate cameras and scanners).
] Such standards may be measured using reflectance from an opaque surface or (preferred) by transmission through a clear film.
Depending on the ity of the optics, calibration and normalization of the optics may be (1) a one-time exercise, (2) performed at regular intervals or (3) performed for each assay.
Calibrating a digital imager range [Annotation] eaa In some embodiments, methods may be provided for calibrating a digital imager used for imaging optical ies.
] In g the optical density of an analyte, it may be desirable to make use of as much of the dynamic range of the imager as possible. Under normal use, the setup may se a relatively homogenous illuminated white background, the imager and the analyte to be tested in a transparent cuvette between them.
Operationally, the test may comprise placing the cuvette between the imager and the white backlight source and measure the amount of light absorbed by the analyte in the cuvette. To maximize the full c range of the sensor, the background may be sensed as the maximum intensity measurable. It may be desirable to take care to not saturate the sensor because then information could be lost since when the sensor is saturated, and attenuation may not be tly measured. The system may be red to efficiently maximize the measured values of the backlight while minimizing number of saturated pixels.
The illuminated ound may emit white light of equal intensity over its entire surface. The light output may vary somewhat, producing a normal distribution of pixel intensities as detected by the imager.
This is illustrated by the curves shown in Figure 128. For this example, the sensor may return a value from 0 to 256 from each pixel as an tor of the amount of light it receives. Each pixel may saturate at a value of 256.
That is, regardless of further increasing of light intensity or sensor sensitivity, only a value of 256 may be recorded. Series 1 in Figure 128, the dotted line, shows where the light is too intense, cutting off the normal curve. Series 3, the dashed line, shows that all pixels are correctly reading intensity, but that the imager ivity is lower than it might be for maximum dynamic range. The majority of the pixels are at a value of less than 200. Series 2 represents the desired gs, where the mean of the distribution is as high as possible, but that a sufficiently small number of pixels are saturated.
In one embodiment, the ity of the backlight may be held constant while the imager’s settings may be adjusted. For the purpose of imager ivity, two controls may be used: exposure time and gain. re time may be the amount of time that the sensor pixels are permitted to collect photons before the value is read out. For a given amount of light, the readout value may be larger when the exposure time is made longer.
This control may be the “coarse" control for the application. Gain may be the control adjusting the amount of amplification applied to the sensor . Increasing gain may increase the value of the signal from the sensor.
Gain may be the “fine" control.
An exemplary procedure for setting the imager’s sensitivity parameters may include one or more of the following steps: 1. Set exposure time to value known to be below saturation. Set gain to highest usable value. 2. Binary search starting upwards adjust exposure time to find the setting where not all of the pixels in the region of interest of the image are saturated. This may be detected by observing the point at which the mean pixel value becomes less than 256. 3. Back gain down incrementally until there are sufficiently few pixels that are at the saturation limit. The number of pixels at an acceptable level will be ined by the shape of the distribution. Wide standard deviation will increase the number of pixels permitted to be saturated.
Next, the white balance may be corrected. There are three groups of sensors in a digital imager.
Members of each group collect light of a different wavelength, red, green or blue. When detecting white light, the sensors would preferably see equal values or red, green and blue. The white balance control adjusts the [Annotation] eaa relative gains of the red and blue channel. Since the light coming from the backlight is defined as white, the procedure would be to simply adjust the white balance until the channels read the same values. In ce, the green channel is typically left unadjusted, and the red and blue ls are changed in opposite directions to each other as the control is changed. However, in other embodiments, another channel, such as the red channel or blue channel may be left unadjusted while the other two channels may be changed.
Finally, the images may be uned in the digital domain. A preferable approach, specifically, would be to use what is called the mage calibration" for an m X n image, as previously described.
Assays making a variety of colored products have been analyzed in the subject invention. Colors from those with low wavelength absorption maxima (yellow) to high wavelength maxima (blue) have been successfully measured. Wavelength maxima for some representative assays were: 405, 450, 500, 510, 540, 570, 612 and 620 nm demonstrating the ability to read color over the entire visible spectrum.
Colors may be quantified using average data for many pixels (typically about 1000). A parameter (f) which produces a good fit (e. g., st R2) to the dose-response data may be selected. The parameter may be first fitted to the form a1 Ib1*R i c1"‘R2 i b2*G i c2"‘G2 Ib3 *B i c2"‘B2 where a, b, c are constants and R, G and B are color intensity values for red, green and blue channels tively. The parameter f may then be derived by forcing it to have a m value of 1 and a minimum value of 0. Parameter f is related to transmission of light through the colored reaction product. As would be expected, fmay be closely related to the parameter optical density (OD) used in spectrophotometry to quantify an absorbing species. When 1 - f ed by 3- color imaging is plotted t OD measured at the absorption maximum for the same assay on products in a microtiterplate in a spectrophotometer, it may be observed that 1 , f is ially ly related to OD. In Figure 129, such data for five assays is presented. OD may be normalized as “relative OD" = (OD , OD min)/(ODmax , OD min). In some cases, there is a somewhat curved relationship but the correlation coefficient (R) is usually > 0.99.
The parameter fmay be used to calibrate assays measured by r image is. When plotted against concentration of the analyte, a smooth calibration relationship may be shown in Figure 130 for a representative cholesterol assay. An equation of the form concentration = a + b*f + c"‘f2 (where a, b and c are constants) relating concentration to f is derived and as shown in Figure 130, the calculated concentration is essentially identical to that of the “nomina " (expected, desired) value ssion line slope close to 1.0, intercept close to 0.0 and R2 = 0.998. Also shown in Figure 130 are graphs of assay accuracy and precision.
Accuracy is close to 100 % (mean 100.2 %) and imprecision (represented by CV %) is low (less than 10 %, average CV 3.9 %).
Simultaneous imaging ys As shown in Figure 56, Figure 57, Figure 58, Figure 59, and Figure 60, several assay elements (tips, wells, blots) can be imaged in parallel. In general, the elements can be placed at known locations in a cartridge or mounted on a subsystem of the ment, so that a particular element can be associated with a particular assay. Even if the elements are not perfectly oriented or located, image is can be used to rectify any such miss-positioning by locating features of the assay elements.
Commercially available assays for albumin (Figure 56) and cholesterol (Figure 57) were used according to the cturer’s directions. A series of analyte concentrations in the range of clinical interest was measured using a series of calibrators in which the analyte concentration was reduced two-fold from the [Annotation] eaa highest concentration. In Figure 56 and Figure 57, analyte concentration was highest on the right and the furthest left tip corresponded to zero analyte. The volume of assay reaction mixture aspirated into the tips was uL.
Figure 58, Figure 59, and Figure 60 show wells that can be imaged in parallel. A set of shallow hemispherical wells was made by machining a block of white opaque plastic. Three commercially ble color forming assays were performed in these wells and reaction products imaged. As above, the wells to the far right have the highest analyte concentration and each adjacent well has a two-fold lower concentration except the left-most well which has zero analyte. Seven uL of assay reaction product were introduced into each well.
Reaction products can also be imaged after blotting them onto porous membranes or paper and imaging once the liquid has soaked into the medium. It is also possible to use any of a variety of assay chemistries impregnated into paper or membranes and to image the resulting reaction products ing addition of sample.
Analyzing ity Turbidimetry is performed by measuring the ion in the intensity of the incident light after it passes h the sample being measured. This technique is used where the result of the assay is a dispersed precipitate that increases the opacity of the liquid.
Turbidimetry can be measured in latex agglutination assays. As a model of latex agglutination assay responses, polystyrene latex particles (1 um diameter) were dispersed in buffer at the given (w/v) concentrations and subject to three-color image analysis. As can be seen in Figure 72, a good se was found in all three channels and could be used to measure the latex particle concentration and agglutination of latex.
Analyzing Agglutination Similarly to turbidity analysis, the system can be used to measure agglutination, lutination, and the inhibition thereof.
The system can be used to perform blood typing by red blood cell agglutination. Blood was diluted and mixed with blood typing reagents (anti-A, anti-B, anti-D) from a commercial typing kit. As shown below for a B+ blood, the appropriate ination responses can easily be seen when the mixtures are imaged. er, when the images shown in Figure 77 were scanned along the vertical axis of the tips, a tative measure of agglutination could be obtained by measuring the variance of the three-color s, as shown in Figure 78. Greater variance indicated agglutination and can be ed in each color channel. It is evident that the method can be used to measure the extent of such agglutination reactions.
Shape Recognition Images can be analyzed for shape recognition. Shape ition can be performed at normal magnification and at very high magnification. Under high magnification image analysis may be used to recognize the size and shape of cells. These techniques are commonly used in cell counting to determine relative concentrations of red blood cells, white blood cells and ets. Under normal ication, shape recognition is used to observe the state of the sample. Bubble and other defect recognition s are used to ensure that measured liquid s are aspirated and dispensed correctly.
Analyzing samples on solidplzase substrates [Annotation] eaa Digital imaging with face illumination can also be used to read out assay responses on solid phase substrates as shown in Figure 76. Solutions of potassium chloride (0, 2, 4 and 8 mM) were added to ReflotronTM potassium assay strips (Boehringer-Mannheim/Roche) designed for use in a reflectance assay system.
Analyzing sample quality Certain sample characteristics can render assay results invalid. For example, hemolysis causes ium ions to leak from red cells into plasma g the measured plasma or serum potassium ion concentrations to be falsely high. rly, icteria and lipemia can interfere with several color-forming chemistries by altering the measured absorbances. In the t invention, we can detect and fy such interfering substances using image analysis. Assays which would give false results can then be either (1) eliminated from the list of s delivered by the analytical system or (2) optical signals can be corrected to account for the measured level of interferent. An image of different types of serum samples is shown in Figure 99 (from left to right: Hemolyzed, Lipemic, Icteric (yellow) and “norma ").
Digital data analysis Conventional methods for data generation and calibration in assay methods which generate and/or change color typically measure an analog signal enting the change in absorbance characteristics of an assay mixture generated by mixing a sample with reagents. Some portion of the on mixture is illuminated and the light transmitted through or ted from that portion impinges on a detector and evaluated as an analog signal. The quality of the assay as determined by the volume and quality of the sample, sample sing, assembly of the assay into the assay mixture and of the physical element used to present the mixture to the optical system rely on an assumed quality of the physical system used.
In the present invention, we can image (1) the sample, (2) sample processing processes, and (3) the assay mixture and collect the data as a set of one or more digital images. Each pixel in the image of the assay mixture represents a very small fraction of the total but by averaging the 3-color signal from many pixels, we collect an assay signal at least as good as that obtained by conventional analog s. Where however, tional methods lose information by averaging, the present invention both aggregates the information and retains the detail lost by conventional methods. In this context, color-based assays include assays for: Metabolites, Electrolytes, Enzymes, Biomarkers (using immunoassay), Drugs (using immunoassay), and c acid targets (using “LAMP" technology). The same principles can be applied to assays using fluorescence and/or luminescence.
Volume confirmation and correction The volume of a sample, or any other material, such as a liquid or a solid, can be determined optically. This can be performed by imaging a ner whose internal dimensions are known and mathematically determining sample volume from observed segment of the container occupied. Solid measurements are primarily used to measure solids that are centrifuged down. The most common case is reading the volume of centrifuged red blood cells to determining hematocrit level. Examples 6-11 and 16 describe the use of imaging analysis to calculate sample volumes and other ements. This can allow for ed assay results. For example, if the target volume to be used is 10 uL and the technology of the invention ines that the actual volume is 8 uL, the assay system can correct the results for the volume (in [Annotation] eaa this example, the concentration of analytes calculated on the ption of a 10 uL sample would be multiplied by 10/8).
Knowledge of actual sample and reagent volumes can be performed by g the sample and reagents and can be used to correct the calculations used to detect and/or quantify analytes in the sample.
As shown in many examples above, the use of imaging allows samples and assay mixtures to be evaluated for quality and assay se. Additionally, imaging of ‘tips” used as reaction vessels and sample acquisition methods enables (l) the accurate and e measurement of sample and reagent volumes and (2) the use of such data to correct any inaccuracies and or imprecision in assay results due to volume errors. To achieve this, tips can have accurately and precisely known geometry (as is the case for tips made by injection molding). ate measurements of tips using imaging has demonstrated that their dimensions are precise to better than about 1 %. It is thus possible to measure the volume of liquid samples and reagents in such tips with corresponding precision. If the pipetting of samples and reagents is less te and precise, correction of results knowing the actual volumes (by image measurement) is possible.
For e, consider an assay in which the response is directly proportional to analyte concentration (as is true for many of the assays discussed herein). A sample volume error of 10 % would lead to an error of 10 % in the value reported by the analytical system. If however, the inaccurately dispensed sample volume is measured accurately (say to within 2 % of the actual value), the system se can be corrected so as to reduce the error from 10 % to 2 %. Corresponding corrections can be made for volume errors in reagent volumes. The correction thm can depend on the response of the assay system to volume or knowledge of each assay component (sample, reagents), but this information can easily be determined during assay development and validation.
Thus, the invention provides a variety of advantages over conventional techniques. In the generation of the “assay ", the present invention can detect physical defects in the assay cuvette, defects in the assay mixture (bubbles and the like). Once these defects are identified (image is) the assay result can be ed so that false results do not occur or (preferred) the effect of the defect can be ated and an accurate assay signal ed.
In the assembly of the assay mixture, any and all defects can be detected including: incorrect sample type (e. g. blood versus ), ect sample volume, for a blood sample, failure to separate plasma from formed elements (red and white cells), sample factors that may compromise the quality of the assay result (e. g., lipemia, icteria, hemolysis, presence of precipitates, or other unidentified in-homogeneities), defects in assembly of the assay mixture (e.g., presence of s, failure to mix tely (non-uniformity of color)), mechanisms for retrospective quality evaluation and preservation of detailed archival information, mechanisms for measuring sample and reagent volumes (and to correct for inaccuracies and/or imprecision in such volumes).
Assessing Therapeutic Agents In a separate embodiment, devices and s for monitoring more than one pharmacological parameter useful for assessing efficacy and/or toxicity of a eutic agent is provided. For example, a eutic agent can include any substances that have therapeutic utility and/or potential. Such substances e but are not limited to biological or chemical compounds such as simple or complex organic or inorganic molecules, peptides, proteins (e. g. antibodies) or a polynucleotides (e.g. anti-sense). A vast array of compounds can be sized, for example polymers, such as polypeptides and polynucleotides, and synthetic organic [Annotation] eaa nds based on various core structures, and these can also be included as therapeutic agents. In addition, various natural sources can provide compounds for screening, such as plant or animal extracts, and the like. It should be understood, gh not always itly stated that the agent is used alone or in combination with another agent, having the same or different biological activity as the agents identified by the inventive .
The agents and methods also are intended to be combined with other therapies. For example, small molecule drugs are often measured by mass-spectrometry which can be imprecise. ELISA (antibody-based) assays can be much more accurate and precise.
Physiological parameters according to the present invention include t limitation parameters such as temperature, heart rate/pulse, blood pressure, and respiratory rate. Pharmacodynamic parameters include concentrations of biomarkers such as proteins, nucleic acids, cells, and cell markers. Biomarkers could be indicative of disease or could be a result of the action of a drug. Pharmacokinetic (PK) parameters according to the t invention include without tion drug and drug metabolite concentration. Identifying and quantifying the PK parameters in real time from a sample volume is extremely desirable for proper safety and efficacy of drugs. If the drug and metabolite concentrations are outside a desired range and/or unexpected metabolites are generated due to an unexpected reaction to the drug, immediate action may be necessary to ensure the safety of the patient. Similarly, if any of the pharmacodynamic (PD) ters fall outside the desired range during a treatment regime, immediate action may have to be taken as well.
] Being able to monitor the rate of change of an e concentration or PD or PK parameters over a period of time in a single subject, or performing trend is on the concentration, PD, or PK parameters, whether they are concentrations of drugs or their lites, can help prevent potentially dangerous situations.
For example, if glucose were the analyte of interest, the concentration of glucose in a sample at a given time as well as the rate of change of the glucose concentration over a given period of time could be highly useful in predicting and avoiding, for example, hypoglycemic events. Such trend analysis has widespread beneficial ations in drug dosing regimen. When multiple drugs and their metabolites are ned, the y to spot a trend and take proactive measures is often desirable.
In some ments, the present invention provides a business method of assisting a clinician in providing an dualized medical treatment. A business method can comprise post prescription monitoring of drug therapy by monitoring trends in biomarkers over time. The business method can comprise collecting at least one pharmacological parameter from an dual receiving a medication, said ting step is effected by subjecting a sample of bodily fluid to reactants contained in a fluidic device, which is provided to said individual to yield a detectable signal indicative of said at least one pharmacological parameter; and cross referencing with the aid of a computer medical records of said individual with the at least one pharmacological parameter of said individual, thereby assisting said clinician in providing individualized medical treatment.
The devices, systems, and methods herein allow for automatic quantification of a pharmacological parameter of a patient as well as automatic comparison of the parameter with, for example, the patient’s l records which may include a history of the monitored parameter, or medical records of another group of subjects. Coupling real-time analyte monitoring with an external device which can store data as well as perform any type of data processing or algorithm, for example, provides a device that can assist with typical patient care which can include, for e, comparing current patient data with past patient data. Therefore, also provided [Annotation] eaa herein is a business method which effectively performs at least part of the monitoring of a patient that is currently performed by medical personnel.
Optical Setup for Sample and on Product Imaging Sample and reaction product analysis can be med using an optical setup. The optical setup can includes a light source, an aperture, and a sensor or a detector. A schematic for an optical setup is shown in Figure 100 and Figure 101. In some embodiments, the camera can be a Logitech C600 Webcamera, the camera sensor can be a 1/3" 2.0 MP 1200) CMOS: (MISOC), the lens can be glass with a standard object distance webcam lens (Lens-to-Object distance: 35mm). The light source can be a Moritex White Edge Illuminator MEBL-Cw25 ) operating at 9.4 volts. Camera images can be taken in a sequence where l, 2, 3 4, or more tips are moved by an x-y-z stage into the optical path.
In an embodiment, the detector is a reader assembly housing a detection assembly for detecting a signal produced by at least one assay on the device. The detection assembly may be above the device or at a ent orientation in relation to the deVice based on, for example, the type of assay being med and the detection mechanism being employed. The detection assembly can be moved into communication with the assay unit or the assay unit can be moved into communication with the detection assembly.
] The sensors can be PMTs, wide range photo diodes, avalanche photodiodes, single frequency photo diodes, image sensors, CMOS chips, and CCDs. The illumination sources can be , single color LEDs, broad frequency light from fluorescent lamps or LEDs, LED arrays, mixtures of red, green, and blue light sources, phosphors activated by an LED, fluorescent tubes, incandescent lights, and arc sources, such as a flash tube.
In many instances, an l detector is provided and used as the ion device. Non-limiting examples include a iode, photomultiplier tube (PMT), photon counting detector, che photo diode, or charge-coupled device (CCD). In some embodiments a pin diode may be used. In some embodiments a pin diode can be coupled to an amplifier to create a detection device with a sensitivity comparable to a PMT. Some assays may generate scence as described herein. In some embodiments chemiluminescence is detected. In some embodiments a detection assembly could include a plurality of fiber optic cables connected as a bundle to a CCD detector or to a PMT array. The fiber optic bundle could be ucted of discrete fibers or of many small fibers fused together to form a solid bundle. Such solid bundles are commercially available and easily interfaced to CCD detectors.
A detector can also comprise a light source, such as a bulb or light emitting diode (LED). The light source can illuminate an assay in order to detect the results. For example, the assay can be a fluorescence assay or an absorbance assay, as are commonly used with nucleic acid assays. The detector can also comprise optics to deliver the light source to the assay, such as a lens or fiber optics.
In some embodiments, the detection system may se non-optical detectors or s for ing a particular parameter of a subject. Such sensors may include temperature, conductivity, potentiometric s, and amperometric signals, for compounds that are oxidized or reduced, for example, 02, H202, and 12, or oxidizable/reducible organic compounds.
The illumination can be back lit, front lit, and oblique (side) lit. Back lighting can be used in general chemistry for the purpose of detecting either light absorption (colorimetry) or scattering (turbidity). The arrangement takes two forms, a broad, evenly illuminated rear field, and a specifically shaped beam that is [Annotation] eaa interrupted by the subject. Front lit illumination can be used for reflectance and fluorescence excitation. In reflectance, a subject is lit from the front by a light source are ed by observing the light reflected from the subject. The colors absorbed produce the same information as a liquid illuminated by a back light. In reflectance, a t can also be illuminated using oblique lighting. The use of oblique (from the side) illumination gives the image a 3-dimensional appearance and can highlight otherwise inVisible features. A more recent technique based on this method is Hoffmann's modulation contrast, a system found on inverted microscopes for use in cell culture. Oblique illumination suffers from the same tions as bright field microscopy (low contrast of many biological samples; low apparent resolution due to out of focus objects), but may highlight otherwise invisible structures.
In fluorescence excitation, subjects can be illuminated from the front for the purpose of fluorescence illumination. These are usually single color lights, most commonly lasers. The Confocal Laser Scanning Microscope is a common ment of this. Oblique lighting can also be used in fluorescence excitation. In fluorescence cytometry, the subjects are often excited at an angle, usually 90 degrees, from which the decay photons will appear. This form of lighting enables scatter detection directly behind the subject (back lit) as well as the fluorescence ons exiting from the side.
In some embodiments, fluorescent light is imaged at 90 degrees to the excitation beam. In Figure 102A, a photon source (S), typically a high-intensity LED, passes through a beam er (D) and a shaping lens (Ll), producing a collimated or slowly diverging excitation beam. The excitation beam passes through a band-pass filter (F1) and illuminates the sample, ting of a vessel (tube, cuvette, or e tip) containing a solution with a fluorescently-labeled sample. Isotropically-emitted fluorescence is spectrally separated from excitation light with a long- or band-pass filter (F2) appropriate to pass Stokes-shifted fluorescence. Light is then imaged through a lens (L2) onto a digital camera (C) or other or. Fluorescence intensity is extracted from the resulting images Via image analysis.
Images taken using the optical setup shown in Figure 102A produces single-tube images (as shown in Figure 103A. Successive experiments show the difference in fluorescence ity from Negative and Positive LAMP experiments using intercalating dye.
In other embodiments, transmitted light is imaged after optical filtering to remove the light at the exciting wavelength. In Figure 102B, a photon source (S), typically a high-intensity LED, passes through a beam diffuser (D) and a shaping lens (Ll), producing slowly ent, elliptical excitation beam. The excitation beam passes through a band-pass filter (F1) and illuminates the samples, presented as an array of sample vessels (tube, cuvette, or pipette tip), each containing a solution with a fluorescently-labeled sample. pically-emitted fluorescence is spectrally separated from tion light with a long- or band-pass filter (F2) appropriate to pass -shifted fluorescence. Light is then imaged through a camera lens (L2) onto a digital camera (C). Fluorescence intensity is extracted from the resulting images Via image is. The optical setup shown in Figure 103 can be used to produces array images of le tubes simultaneously (as shown in Figure 103B).
For colorimetry, the red embodiment for sensing is backlighting the subject with white light with the result sensed by an imaging sensor. In this case the transmissive color absorption is measured.
[Annotation] eaa For Turbidimetry, the preferred embodiment for sensing is backlighting the subject with white light with the result sensed by an imaging sensor. For turbidimetry, the reduction of the intensity of the transmitted light is ed.
Luminometry utilizes no illumination method as the subject emits its own s. The emitted light can be weak and can be detecting using an extremely sensitive sensor such as a photomultiplier tube (PMT).
In some embodiments, imaging may occur using fluorescence, darkfield illumination, or brightfield illumination. Such imaging can be used for cytometry or other applications. Epi-fluorescence nation may be achieved by the use of three illumination sources of differing wavelengths. Further, two different sources can be used simultaneously, if required. Consequently, the imaging platform can be used to image a large variety of fluorescent dyes. The ation of illumination sources and emission optics can be configured to achieve a plurality of spectrally ndent channels of imaging.
Darkfield illumination may be achieved by the use of a ringlight (located either above or below the ), a eld abbe condenser, a darkfield condenser with a toroidal mirror, an epi-darkfield condenser built within a sleeve around the objective lens, or a combination of ringlight with a stage condenser equipped with a dark stop. Fundamentally, these Optical ents create a light cone of cal re (NA) greater than the NA of the ive being used. The choice of the illumination scheme depends upon a number of considerations such as magnification ed, mechanical design considerations, size of the imaging sensor etc. A ringlight based illumination scheme generally provides uniform darkfield illumination over a wider area while at the same time providing sufficient flexibility in mechanical design of the overall system.
Brightfield illumination may be achieved by the use of a white light source along with a stage- condenser to create Koehler illumination.
In some embodiments, an automatic filter wheel may be employed. The tic filter wheel allows control of the imaging optical path to enable imaging of multiple fluorophores on the same field of view.
In some embodiments, image based auto-focusing may take place. An image-based algorithm may be used to control the z-position (e. g., vertical position) of an objective (i.e., its distance from the ) to achieve auto-focusing. Briefly, a small image (for example, 128x128 pixels) is captured at a fast rate using darkfield illumination. This image may be ed to derive the auto-focus on which is measure of image sharpness. Based on a fast search algorithm the next z-location of the objective is calculated. The objective may be moved to the new z-location and another small image may be captured. This closed-loop system does not require the use of any other re for focusing. The microscope stage may be connected to computer- lled stepper motors to allow translation in the X and Y directions (e.g., horizontal directions). At every location, the desired number of images is captured and the stage is moved to the next XY position.
Imaging or other g may be performed with the aid of a detector. A detector can include a camera or other sensing apparatus configured to convert electromagnetic radiation to an electronic signal. In an example, a camera can be a charge-coupled (CCD) or electron-multiplying CCD (EMCCD) camera. A detector may be a sensor, such as an active pixel sensor or CMOS sensor. A detector may include a photo-multiplier tube for detecting a signal.
The detector can be in optical ication with a sample container (e. g., e, tip, vial). In some cases, the detector is in direct line of sight of the sample container. In other cases, the detector is in optical [Annotation] eaa communication with the sample ner with the aid of one or more optics, such as , mirrors collimators, or combinations thereof.
Cell counting can be med using imaging and cytometry. In situations where the subjects may be -field illuminated, the preferred ment is to illuminate the subjects from the front with a white light and to sense the cells with an g sensor. Subsequent digital processing will count the cells.
Where the cells are infrequent or are small, the red embodiment is to attach a fluorescent marker, and then illuminating the subject field with a laser. al scanning imaging is preferred. For flow cytometry, the subjects are marked with fluorescent markers and flowed past the sensing device. There are two types of sensors, one is position such that the subject is back lit, measuring beam scatter to determine presence of a cell.
The other sensor, aligned so that the illumination is from the side, measures the fluorescent light emitted from the marked subjects. Further description is provided below relating to imaging methodology for cytometry.
End-User Systems A device and system may, after manufacturing, be shipped to the end user, together or individually. The device or system of the ion can be packaged with a user manual or instructions for use.
In an embodiment, the system of the invention is generic to the type of assays run on ent devices. Because components of the device can be modular, a user may only need one system and a variety of devices or assay units or reagent units to run a multitude of assays in a point-of-care or other distributed testing environment. In this context, a system can be repeatedly used with multiple devices, and it may be necessary to have sensors on both the device and the system to detect such changes during shipping, for example. During shipping, pressure or temperature s can impact the performance of a number of components of the present system, and as such a sensor located on either the device or system can relay these s to, for example, the external device so that adjustments can be made during calibration or during data processing on the external device. For example, if the ature of a fluidic device is d to a n level during shipping, a sensor located on the device could detect this change and convey this information to the system when the device is inserted into the system by the user. There may be an additional detection device in the system to perform these tasks, or such a device may be incorporated into another system component. In some embodiments information may be wirelessly transmitted to either the system or the external device, such as a personal computer or a television.
Likewise, a sensor in the system can detect similar changes. In some embodiments, it may be desirable to have a sensor in the shipping packaging as well, either instead of in the system components or in addition thereto. For e, adverse conditions that would render an assay cartridge or system invalid that can be sensed can include exposure to a temperature higher than the maximum tolerable or breach of the cartridge integrity such that moisture penetration.
In an embodiment, the system comprises a communication assembly capable of transmitting and receiving information wirelessly from an external device. Such wireless communication may be Bluetooth or RTM technology. Various communication s can be utilized, such as a dial-up wired connection with a modem, a direct link such as a T1, ISDN, or cable line. In some embodiments, a wireless connection is established using exemplary ss networks such as cellular, satellite, or pager networks, GPRS, or a local data ort system such as Ethernet or token ring over a local area network. In some embodiments the information is encrypted before it is transmitted over a wireless network. In some embodiments the [Annotation] eaa communication assembly may n a wireless infrared communication component for sending and receiving information. The system may include integrated graphic cards to facilitate display of ation.
In some embodiments the communication assembly can have a memory or storage device, for example localized RAM, in which the ation collected can be stored. A storage device may be ed if information cannot be transmitted at a given time due to, for example, a temporary inability to wirelessly connect to a network. The information can be associated with the device identifier in the e device. In some embodiments the communication assembly can retry sending the stored information after a certain amount of time.
In some embodiments an external device communicates with the communication assembly within the reader assembly. An external device can wirelessly or physically communicate with a system, but can also communicate with a third party, including without limitation a patient, medical personnel, clinicians, laboratory personnel, or others in the health care ry.
In some embodiments the system can se an external device such as a computer system, server, or other electronic device capable of storing information or processing information. In some embodiments the external device es one or more computer s, servers, or other electronic devices capable of storing ation or processing ation. In some embodiments an external device may include a database of patient information, for example but not limited to, medical records or patient history, clinical trial records, or preclinical trial records. An external device can store protocols to be run on a system which can be transmitted to the communication assembly of a system when it has received an identifier indicating which device has been inserted in the system. In some embodiments a protocol can be dependent on a device identifier.
In some embodiments the external device stores more than one protocol for each device. In other ments patient information on the external device includes more than one protocol. In some instances, the external server stores mathematical algorithms to process a photon count sent from a communication assembly and in some embodiments to calculate the analyte concentration in a bodily fluid sample.
] In some embodiments, the external device can include one or more servers as are known in the art and commercially available. Such servers can provide load balancing, task management, and backup capacity in the event of failure of one or more of the servers or other components of the al , to improve the bility of the server. A server can also be implemented on a distributed network of storage and processor units, as known in the art, wherein the data processing according to the present invention reside on workstations such as computers, thereby eliminating the need for a server.
A server can includes a database and system processes. A database can reside within the server, or it can reside on another server system that is accessible to the server. As the information in a database may contain sensitive information, a security system can be implemented that ts unauthorized users from g access to the database.
One advantage of some of the features described herein is that information can be transmitted from the external device back to not only the reader assembly, but to other parties or other external devices, for e without tion, a PDA or cell phone. Such ication can be accomplished via a wireless network as disclosed . In some embodiments a calculated analyte concentration or other patient ation can be sent to, for example but not limited to, medical personnel or the patient.
[Annotation] eaa Accordingly, the data generated with the use of the subject devices and systems can be utilized for performing a trend analysis on the concentration of an analyte in a subject which changes over time. r age as described herein is that assay results can be ntially immediately communicated to any third party that may benefit from ing the results. For example, once the analyte concentration is determined at the external device, it can be itted to a patient or medical personnel who may need to take further action. The communication step to a third party can be performed wirelessly as described herein, and by transmitting the data to a third party’s hand held , the third party can be notified of the assay results virtually anytime and re. Thus, in a time-sensitive scenario, a patient may be contacted immediately anywhere if urgent medical action may be required.
As described elsewhere , imaging may be used for detection. Imaging can be used to detect one or more characteristic of a sample. For example, imaging may be used to detect the presence or absence of a sample. The imaging may be used to detect the location, placement, volume or concentration of a sample.
The imaging may be used to detect the presence, absence, and/or concentration of one or more analytes in the sample.
In some embodiments, a single measurement may be used to capture various information about a sample and/or analytes. For example, a single measurement may be used to capture information about the volume of a sample and the concentration of an analyte within the sample. A single measurement may be used to capture information about the presence and/or concentration of a plurality of es and/or types of analytes within the sample. A single image may be used to capture information relating to one, two, or more of the information or types of information described herein.
Such imaging and detection may provide more precise and accurate assays, which may be advantageous in situations with small sample volumes, such as those described elsewhere herein. Additional examples mes of sample may include 500 [LL or less, 250 [LL or less, 200 [LL or less, 175 [LL or less, 150 [LL or less, 100 [LL or less, 80 [LL or less, 70 [LL or less, 60 [LL or less, 50 [LL or less, 30 [LL or less, 20 [LL or less, 15 [LL or less, 10 [LL or less, 8 [LL or less, 5 [LL or less, 1 [LL or less, 500 nL or less, 300 nL or less, 100 nL or less, 50 nL or less, 10 nL or less, 1 nL or less, 500 pL or less, 250 pL or less, 100 pL or less, 50 pL or less, 10 pL or less, 5 pL or less, or 1 pL or less. In some embodiments, the sample volume may include less than or equal to about 3 drops from a fingerstick, less than or equal to about 2 drops from a fingerstick, or less than or equal to about 1 drop from a fingerstick. Such small volumes may be useful in point of service applications.
Such imaging and/or detection may yield assays with low coefficient of variation. A cient of variation may be the ratio n the standard deviation and an absolute value of the mean. In an embodiment, a reaction and/or assay may have a coefficient of variation (CV) (also “relative rd deviation" ) less than or equal to about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.3%, or 0.1%. A single reaction and/or assay, or a procedure with a plurality of reactions and/or assays may have a coefficient of variation ofless than or equal to about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.3%, or 0.1%. In some embodiments, an imaging and/or detection step, or a procedure with a plurality of imaging and/or detection steps may have a coefficient of variation of less than or equal to about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.3%, or 0.1%.
In some ments, the use of imaging with a device that may be placed at a point of service location may e the overall performance of the . The accuracy and/or precision may be improved ation] eaa and/or the cient of variation may be reduced. The mance of the device may be improved when handling small samples, such as those volumes described herein. The imaging may be used in combination with other detection systems, in combination with other processes, or as a standalone system. Improvement in mance may include a decrease in the coefficient of ion of about 15%, 12%, 10%, 9%, 8%, 7%, 6%, %54%53%52%51%505%5039@or01%.
Imaging may be useful for various detection types for one or more types of assays or sample ng ures. Examples of such assays or sample handling procedures may include centrifugation, separation, cytometry, immunoassay, ELISA, nucleic acid assay, enzymatic assay, colorimetry, or any other type of assay or reaction described elsewhere herein.
Imaging systems may provide multiple advantages over other methods for data collection, data processing, and results interpretation. Imaging systems may ze, or increase the efficiency of, the use of small samples and enhancing system-level performance. g systems may be used for detection as standalone systems or may be used in combination with other detection systems or mechanisms.
In some systems, sensors and systems may be used (such as photodiodes and photomultiplier tubes and associated optics/devices) that typically do not provide any spatial information about the sample being interrogated. Rather, these systems may collect ation about the sample after the information has been spatially integrated, typically losing l information related to the sample. While integrating the signal in space from the sample may augment the signal levels being detected by the sensor, advances in sensitivity of optical and other sensors may negate the need for such integration. g for detection may be used in the place of such sensors, or may be used in conjunction with such s.
Imaging systems may be used that may advantageously have one or more of the following features. Imaging sensors may have sensitivity and dynamic range that meet and/or exceed that of conventional non-imaging sensors. Imaging devices may maintain spatial aspects of the sample being interrogated, providing significant ability for post processing. Post processing can include QA/QC (e. g., quality control, such as automated error detection and/or review by pathologist), and/or image is to extract specific sample features. The imaging device can utilize 3D, 2D, 1D (line sensors), and/or point sensors with a means to translate the sample relative to the collection optics/sensor to enable the spatial reconstruction of the sample.
Data collected from the imaging device can be processed to extract very specific information, such as morphological features of the sample (such as cell counts), data from select regions of the image (peak fluorescence across a sample or in a cell within the . Data collected from the imaging device can be processed to improve the sensitivity and tion of the measurement. Data collected from the imaging device can enable the assessment of signal variation across the sample being imaged. The data may be post processed to calculate mean, standard deviation, maximum, minimum, and/or other applicable statistics across the sample or within any regions of interest identified in the sample images. Imaging devices enable the exploration of changes in the sample over time by collecting multiple images and ing changes in the images over time and space, such as would be evident in an aggregation processes (such as for an assay of prothrombin time) or other (e. g., al, physical, biologic, electrical, morphological) changes in the sample over time and space.
Imaging devices may enable more rapid data acquisition of , tissue sections, and other sample configurations.
[Annotation] eaa Cytometry Application In some embodiments, any of the embodiments described herein may be adapted to enable the system to perform cytometry. Cytometry (e. g., enumeration and function analysis of cells) in the system may be performed using image analysis. Blood can be processed using the pipette and centrifuge as described previously . Typically, a known measured volume of blood (1 i 50 uL) may first be centrifuged and the plasma fraction removed. The cell fraction may then be pended into buffer by use of the pipette repeatedly to dispense and aspirate. A cocktail of fluorescent antibodies may be directed to selected cell markers (such as CD45, CD4 etc.). Following a brief incubation, a t which may act as a fixative for the white cells and a lysing agent for red cells can be added. Following another incubation white cells may be collected by centrifugation and the atant hemolysate removed by aspiration. The stained white cells can be resuspended in a measured volume of buffer (typically less than the original blood volume (say 1 i 20 uL) and dispensed into transparent capillary channels for image analysis. Typically up to three or even five or more cell types can be imaged using antibodies having different fluorescent labels or and/or antibodies labeled with ent fluor/protein ratios. When more cell types have to be counted or analyzed, more than one reaction mixture can be used. In some embodiments, a reaction mixture can be used to count or analyze s s of cell types.
In some embodiments, the capillary channels are typically about 10 , 100 um deep, 0.5 , 2 mm wide and 0.5 , 5 cm long. The ary channels may have other dimensions, including but limited to other dimensions described elsewhere herein. The stained cell dispersion may fill the channel usually by capillary action and the cells may be allowed to settle on the lower channel surface. The channels can be illuminated with one or more lasers or other light s (e. g., LEDs). The optical train may have one or more optical elements, such as dichroic mirrors or lenses, and may or may not magnify the field of view. In some embodiments, the field of view may be magnified 2 , 100 fold. A series of images may be collected typically representing a field of view of about 1 mm x 0.5 mm and which ns 1 , 10,000 cells (ideally, 300 cells of interest) imaged onto a sensor having an area of about 1000 x 1000 pixels (1 million .
] A series of images representing nt sections of channel may be collected. A mechanical stage can be used to move the channels relative to the light source. In some cases, a servo-mechanism may move the stage in a vertical direction so as to focus the image. In some embodiments, the light source or one or more optical elements may move relative to the stage to focus the image. Images are usually made using one or more combinations of light sources and optical filters. The light s may be turned on and off and s moved into the light path as needed. Preferably up to 1000 cells of any given type may be d. In other embodiments, various numbers of cells of any given type may be counted, including but not limited to more than, less than, or equal to about 1 cell, 5 cells, 10 cells, 30 cells, 50 cells, 100 cells, 150 cells, 200 cells, 300 cells, 500 cells, 700 cells, 1000 cells, 1500 cells, 2000 cells, 3000 cells, 5000 cells. Cells may be counted using available counting algorithms. Cells can be recognized by their characteristic fluorescence, size and shape.
Pattern recognition algorithms may be employed to exclude stained cell debris and in most cases where there are cells which are aggregated these can either be excluded from the analysis or interpreted as aggregates.
A try platform may be an integrated automated microscopy device capable of the following tasks in a fully automated, controlled environment. One or more of the following tasks may occur in cytometry [Annotation] eaa applications. The following tasks may occur in the order they appear or in alternate orders or other tasks may be substitute as appropriate. 1. Isolation of blood cells of the desired type 2. Labeling of cells with fluorescent and/0r colored dyes and/0r beads 3. Confinement of cell suspension in an optically compatible cuvette 4. Imaging of cells using fluorescence microscopy, darkfield illumination, and/or brightfield nation . Automated analysis of images to extract desired cellular attributes 6. Automated analysis of extracted information using advanced statistical and classification s to derive clinically reportable information.
In the following sections, each of these tasks is discussed in greater detail; images and sketches are provided er deemed necessary. 1. Isolation ofblood cells ofthe desired type. Blood cells of a desired type may be isolated in accordance with one or more embodiments described elsewhere . For example, such isolation may occur as referred to in previous descriptions relating to the cytometry or the centrifuge. 2. ng ofcells withfluorescent and/or colored dyes and/or beads.
Specific fluorescent dyes may be employed. Cells of interest can be incubated with pre-aliquoted solutions of fluorescently labeled binders (e. g., antibodies, aptamers, etc.) which are specific to markers on these cells. A key consideration may be pairing t” or high extinction coefficient and high quantum yield fluors with s for which cells have a lower binding capacity; and Vice versa. For e, the marker CD22 may be expressed on B-lymphocytes at about one tenth the level as CD45. Given this relative expression, CD22 may be labeled with a “bright" dye and CD45 may be labeled with the r" dye. The markers to be d using this technique can be either intracellular or cell-surface markers. The sensitivity of detection and quantification can be improved by using a secondary labeling scheme for low expression s. Briefly, a primary binder may be conjugated with another molecule which can be specifically recognized by a secondary binder. A secondary binder labeled with a higher number of fluorophores can then bind the primary binder in situ and enhance fluorescence . One scheme for achieving this may be the use of biotin conjugated anti- CD22 antibody which may be in turn ized by an anti-biotin antibody that is labeled with fluorescein isothiocyanate (FITC). The use of can dramatically enhance fluorescence . Figure 123 provides an example of a fluorescence micrograph showing d leukocytes. The example rates a cence micrograph of Alexa-Fluor 647-anti-CD45 labeled human leukocytes in a fixed, lysed blood sample. The pseudocolor scheme is used to enhance perception of the different between 'bright' cells (with high CD45 expression) and 'dim' cells (with low CD45 expression).
Color stains of cell smears may also be ed within the system. For example, the manual procedure given in StainRITETM Wright-Giemsa Stain (Polysciences Inc.) can be automated and read in the devices of the t invention.
In some embodiments, non-specific fluorescent dyes can be used. For the purposes of differentiating leukocyte sub-populations, the platform can also use fluorescent dyes which may bind to nucleic acids (e.g., SYTO, Hoechst) or lipid membranes (e.g., Dil, DiD, FM64).
[Annotation] eaa 3. Confinement ofcell suspension in an optically compatible cuvette.
In some embodiments, cytometry es may be designed to confine a pre-labeled cell suspension of fixed volume into a ‘channel’ fabricated so as to provide an optically clear imaging al above and below the cells. Sample may be introduced into the channel via a sample entry port. At some distance from the sample entry port, an air vent may allow the release of air pressure and flow of sample into the channel.
The channel dimensions may be designed to hold a pre-defined known volume of fluid, regardless of the volume sed at the sample entry port. Each cuvette may have multiple channels of same and/or different volumes, each with at least one sample entry port and at least one air vent.
The concentration of cells of interest in the sample can be adjusted during sample preparation such that after ement in the cuvette, a desired number of cells per field of view in the imaging system can be achieved. One method for doing this may be to image a container with the cell dispersion and measure turbidity. Using a pre-established relationship between turbidity and cell count, the cell density can be calculated. lly, the cell dispersion will be made in a volume of buffer such that with the lowest likely cell count, and the cell concentration will be r than optimal for image-based cell ng. More buffer may then be added to bring the dispersion to the optimal level.
The g area of the cuvette may be designed so as to provide a sufficient number of cells for the application of interest. For example, counting the abundant RBCs may require counting of only 000 cells and hence a diluted sample and only a small imaging area in the cuvette. However, counting rare myeloblasts may require in some cases the ability to image more than 100,000 (total) cells. In such a scenario, the system may concentrate the cell sion so that 100,000 cells may be imaged with a reasonable number of fields of view. ore, the channel on the cuvette dedicated to RBC imaging will be smaller than the one dedicated to imaging myeloblasts.
] The cuvette may be designed to be picked up by a standard ing ism in an automated fashion to allow the transfer of the cuvette to the imaging platform. The pipetting mechanism’s tip ejector can eject the e from the pipetting mechanism onto the imaging platform. Registration of cuvette to imaging platform may take place in two steps. Upon transfer of the cuvette to the imaging platform, static registration features on the cuvette may interface with mating features on the imaging platform to align the cuvette parallel to the g platform’s optical axis (X,Y registration). ration may then be completed by a mechanism located on the imaging platform. This mechanism may bias the cuvette against a planar e perpendicular to the imaging platform’s optical axis (Z registration), y constraining the sample within the imaging platform’s focal range. 4. Imaging ofcells usingfluorescence, darkfield illumination, brightfield illumination. The method of imaging the cells may also be applied to other applications of the invention described elsewhere . The imaging techniques, as previously described, can be used for other imaging uses.
Illumination capabilities: The cytometry platform may be designed to have three types of illumination schemes: epi-fluorescence, darkf1eld and brightfield. The modular nature of the setup also allows integration of phase-contrast and differential-interference contrast (DIC).
Epi-fluorescence illumination may be achieved by the use of three laser lines (e.g., 488nm, 532nm and 640nm), but the modular nature of the system also allows for integration of other light sources, such as other laser sources, LEDs and standard mps (e. g. Xenon, Mercury and Halogen). Further, two different sources [Annotation] eaa can be used simultaneously, if required. uently, the cytometry platform can be used to image a large variety of fluorescent dyes. The combination of illumination sources and emission optics can be configured to achieve various numbers (e. g., 3-5) spectrally independent channels of imaging.
Darkfield illumination may be achieved by the use of a ght (located either above or below the sample), a ld abbe condenser, a darkfield condenser with a toroidal mirror, an epi-darkfield condenser built within a sleeve around the ive lens, or a combination of ringlight with a stage condenser equipped with a dark stop. Fundamentally, these optical components can create a light cone of numerical aperture (NA) greater than the NA of the objective being used. The choice of the illumination scheme depends upon a number of considerations such as magnification required, ical design considerations, or size of the imaging sensor. A ringlight based illumination scheme generally provides uniform darkfield illumination over a wider area while at the same time ing sufficient flexibility in mechanical design of the l system.
Figure 124 provides an example of intracellular patterns using darkfield images. The example shows different intracellular patterns in darkfield images of human leukocytes. (a) A strong scattering pattern due to presence of granules in eosinophils, (b) a rphonuclear neutrophil with characteristic nucleolar lobes and (c) cells that do not scatter light to a significant degree (lymphocytes or basophils) Brightfield illumination may be achieved by the use of a white light source along with a stage- condenser to create Koehler illumination. Figure 126 provides an example of brightfield images of human whole blood. The example shows brightfield images of a human whole blood smear stained with the Wright- Giemsa staining method. Characteristic patterns of staining of human leukocytes are apparent. The characteristically shaped red cells can also be identified in these images.
Automaticfilter wheel: An automatic filter wheel may allow control of the imaging optical path to enable imaging of multiple fluorophores on the same field of view.
Image based auto-focusing: The try platform may use an image-based thm to l the z-position (e. g., al position) of the objective (i.e., its distance from the sample) to achieve auto- focusing. Briefly, a small image (for example, 128x128 pixels) may be captured at a fast rate using darkfield illumination. This image may be analyzed to derive the auto-focus on which may be used to measure of image sharpness. Based on a fast search algorithm the next z-location of the objective may be calculated. The sample may be moved to the new z-location and another small image may be ed. In some embodiments, this closed-loop system does not require the use of any other hardware for ng.
Translation ofstage: The microscope stage may be connected to er-controlled stepper motors to allow translation in the X and Y directions (e. g., ntal directions). At every location, the desired number of images may be captured and the stage may be moved to the next XY position.
Imaging sensor: A camera with a CCD, EMCCD, CMOS or in some cases a photo-multiplier tube can be used to detect the signal. 5. Analysis ofimages to extract desired ar attributes.
The cytometry platform may use ent illumination techniques to acquire images that reveal diverse properties and es of the cells. Labeling with cell-marker specific binders may reveal the degree of expression of that particular marker on the cell e or in the cell. Darkfield image may reveal the light scattering properties of the cell. The internal and external es of the cell which scatter more light appear brighter and the features which scatter lesser amounts of light appear darker in a darkfield image. Cells such as [Annotation] eaa granulocytes have internal es of size range (100-500nm) which can scatter significant amount of light and generally appear brighter in darkf1eld images. Furthermore, the outer boundary of any cell may scatter light and may appear as a ring of bright light. The diameter of this ring may ly give the size of the cell. Brightfield images of cells can reveal cell size, phase-dense material within the cells and colored features in the cell if the cells have been usly stained.
An image sing library may extract one or more of the following information for each cell (but is not d to the following): 1. Cell size 2. Quantitative measure of cell granularity (also rly called side scatter, based on flow cytometry 3. Quantitative measure of fluorescence in the each spectral channel of g, after compensating for cross-talk between spectral channels 4. Shape of the cell, as quantified by standard and custom shape attributes such as aspect ratio, Feret diameters, Kurtosis, moment of inertia, circularity, solidity etc.
. Color, color distribution and shape of the cell, in cases where the cells have been stained with dyes (not attached to dies or other types of receptor). 6. Intracellular patterns of staining or scattering or color that are defined as quantitative s of a biological feature, for example density of granules within cells in a darkfield image, or the number and size of nucleolar lobes in a Giemsa-Wright stained image of polymorphonuclear neutrophils etc. 7. Co-localization of features of the cell revealed in separate images The image processing thms utilized in this step may use combinations of image filtering, edge detection, template ng, automatic thresholding, morphological operations and shape analysis of objects. 6. is ofextracted information using advanced statistical and classification methods to derive clinically reportable information.
Any number of measured attributed may be extracted from images of cells. For example, measured attributes of each cell extracted from the images can range from 7-15, thus creating a 7 to 15 dimensional space within which each cell is a point. If n measured attributes are ted from the images, an n dimensional space may be provided, within which each cell is a point.
Based on data acquired for a large number of cells (e.g., 100-100,000 cells) a complex n- dimensional scattered data set may be ted.
Statistical s may be used for clustering cells into individual separate populations in this ndimensional space. These methods may also use state-of-the-art knowledge from cell biology and hematology to aid in clustering and cell population identification.
Figure 125 provides an example of multi-parameter acquisition of data from labeled cell samples.
Human leukocytes were labeled with the pan-leukocyte marker anti-CD45-Alexa Fluor 700 (shown here in green) and the B-cell marker anti-CD22-APC (shown here in red). The dual channels show different patterns of CD45, CD22 expression and side scatter. Cells which are positive for CD22 and CD45 (B- lymphocytes) show the characteristically low side scatter. On the other hand cells such as neutrophils and eosinophils which have high side scatter do not show labeling for CD22.
Figure 127 provides an e of quantitative multi-parametric data ition and analysis.
For example, a histrogram may be provided which may show distribution of CD45 intensity on human leukocytes. Any other graphical data distribution techniques may be employed to shows the distribution. In [Annotation] eaa some embodiments, a scatter plot of side r may be provided. The side scatter may be determined by dark- field image analysis versus CD45 fluorescence intensity for a human leukocyte sample. The side r plot may show two main populations of granulocytes (top left) and lymphocytes (bottom right).
Foregoing sections describe the main components and lities of the try platform and applications. Based on these capabilities, a wide gamut of cell-based assays can be designed to work on this platform. For example, an assay for performing a 5-part leukocyte differential may be provided. The reportables in this case may be number of cells per iter of blood for the following types of leukocytes: tes, lymphocytes, neutrophils, basophils and eosinophils. The basic strategy for development of this assay on the try platform may be to convert this into a problem where some utes of leukocytes are measured such as side scatter, CD45 fluorescence intensity, or CD20 fluorescence intensity so that leukocytes can be segregated into (e.g., 5) different populations in this n-dimensional space. The regions made around a cluster of cells can be positioned on a scatter plot in 2-dimensional space are called “gates" after flow cytometry parlance.
An example labeling and “gating" strategy is as follows: CD2/CRTH2/CDl9/CD3 cocktail PE-Cy7 Identification of lymphocytes, labeling of basophils and eosinophils CD45 Alexa-Fluor 647 Pan-leukocyte marker to label all leukocytes CDl4/CD36 cocktail FITC Identification of monocytes ] The cytometry platform and analysis system described herein may advantageously permit automated sample preparation and execution based on ordered . The s and methods described may also enable specific identification of cells as opposed to VCS (volume, conductivity and scatter), which can increase confidence in identification and reduce ces for confirmatory testing. The image analysis described herein may also permit preservation of cell images for later confirmation, analysis as required. There may also advantageously be availability of logical features of the cell. In some embodiments, dynamic ment of sample prep and imaging parameters to deal with cell samples of wide range of concentrations may be provided.
In some embodiments, the centrifuge may be used to prepare and concentrate cell populations. A method may include the use of the centrifuge for cell preparation and the imaging and analysis system described elsewhere herein.
[Annotation] eaa In some embodiments, a combination of dark-field imaging and imaging of cells stained with multiple fluorescent antibodies may be used. Such a ation may give the equivalent of FACS analysis in a much simpler and less expensive device than other techniques.
] In ance with some embodiments of the invention, the systems and methods described herein may enable one or more of the following features. Such features may be advantageous for various applications.
In some embodiments, ted sample inspection and processing may be enabled. Such sample inspection and processing may include one or more of the following: sample quality, sample volume measurement, dilution (and measurement of dilution factors), and separation of red and white cells from plasma.
An automated chemical/assay related process may also be employed. This may include precipitation, mixing or ntation.
In some embodiments, there may be automated measurement of any and all assays that produce luminescence or change light (e.g., color chemistry). These may include one or more of the following: spectrophotometry, fluorimetry, luminometry, turbidimetry, nephelometry, refractometry, 3-color image analysis, polarimetry, measurement of agglutination, image analysis (which may employ one or more of the following: camera, digital camera, scanner, lens-less photography, 3-D photography, video photography), or copy.
Automated quality control and/or calibration of assays may also be provided within the systems and methods described herein.
In some embodiments, y communication may be ed. Such communication may enable record keeping of all assay steps. The y communication may also enable changes in assay protocols to optimize or increase completion of multiple assays.
Quality Control/Complementary Applications In some ments, imaging may be used in conjunction with one or more other measurements or ion steps. The imaging may be complementary to other techniques, procedures, reactions, and/or assays. For example, imaging may be used to perform one or more quality control check or step for any other action, such as a sample preparation, assay, or detection step. Imaging may be used for the facilitation of other detections. Imaging may be used to improve the accuracy and/or precision of collected data. The imaging may be a quality control aspect to verify data, results, and/or any measurements. The g may be a control mechanism or improvement mechanism. Imaging may be used to detect one or more condition that may affect collected data and/or the accuracy and/or precision of the data. Thus, imaging may improve sample preparation, assay, and/or detection procedures. This may be particularly advantageous in situations where there are small sample volumes, such as volumes described elsewhere herein.
In an e, a detection step may occur to determine the ce and/or tration of an analyte. ion may occur of one or more signal that may be representative of data that may be useful for subsequent qualitative and/or quantitative evaluation. ion may or may not include the detection of visible light. Detection may include the measurement of energy from anywhere along the electromagnetic spectrum (e. g., infra-red, microwave, ultraviolet, gamma ray, x-ray, visible light). Detection may occur using any type of sensor, which may include an l sensor, temperature sensor, motion sensor, pressure sensor, icity sensor, acoustic sensor, chemical sensor, spectrometer, or any other sensor described elsewhere herein, or any [Annotation] eaa combination thereof. In some embodiments, detection may or may not e a spatial distribution of light and/or energy. In some instances, detection may or may not include an energy density distribution.
Imaging may be capable of detecting one or more condition under which the detection takes place.
Imaging may be used to detect the condition of a sample, reagent, container, portion of the device that may be used in the detection. In some embodiments, the g may be visible imaging. For example, imaging may include capturing a snapshot, photo, and/or picture. Imaging may include capturing a spatial distribution of energy along the electromagnetic um. The energy along the electromagnetic spectrum may include visible light, or may include other ranges (e.g., infra-red, ultraviolet, or any other described ). For example, a spatial distribution of visible light may include a two-dimensional image. In some embodiments, imaging may include the use of an image capture , which is described in greater detail elsewhere herein. Some examples of image capture devices may include a camera, such as a lens-less (computational) camera (e.g., Frankencamera) or open-source . An image capture device may be capable of capturing signals that may be capable of ting a one-dimensional, two-dimensional, or three-dimensional representation of the item that is imaged. In some cases, an image e device may be a motion-sensing input device configured to provide a three-dimensional or pseudo three-dimensional representation of an object.
The imaging technique may be the same or may be different from the detection mechanism utilized. In some instances, different types of detection mechanisms are used between the detection step and the quality control imaging step. In some instances, detection may include an energy band assessment or energy density bution, such as from a spectrometer, while y control imaging may e a spatial distribution of visible light, such as from a camera.
Sensitive detection may be achieved by imaging. For example, an imaging device may be able to capture an image to within 1 mm, 500 micrometer (um), 200 um, 100 um, 75 um, 50 um, 25 um, 15 um, 10 um, 7 um, 5 um, I um, 800 nanometer (nm), 700 nm, 500 nm, 300 nm, 100 nm, 50 nm, 30 nm, 10 nm, 5 nm, 1 nm, 500 picometer (pm), 300 pm, or 100 pm. In an example, the imaging may be achieved by a camera which may have a resolution of greater than or equal to about 2 xels, 4 megapixels, 6 megapixels, 8 megapixels, 10 megapixels, 12 megapixels, 15 megapixels, 20 xels, 25 xels, 30 megapixels, 40 xels, or 50 megapixels, or more.
Imaging may be used to detect an error or other fault state. Imaging may be used to ine a condition that may increase the likelihood of an error and/or result in inaccuracies and/or ision. For example, g may be used to determine the presence and/or absence of one or more undesirable materials.
Examples of undesirable materials may include bubbles, particles, fibers, particulates, debris, precipitates, or other material that may affect a measurement. In another example imaging may be used to ine if a volume of sample, reagent, or other material falls within a desired range, or whether a sample, reagent, or other material is located in a desired location. The imaging may be used to determine the concentration of a sample, reagent or other material, or whether the sample, reagent, or other material falls into a desired concentration range.
In one example, an enzymatic assay may be performed on a small volume of . Examples of volume values may be provided elsewhere herein. A spectrometer or other detection method or ism described herein may be used to perform a detection step for the enzymatic assay. An imaging step may occur to ine the conditions under which the detection is occurring. For e, the imaging step may [Annotation] eaa determine whether there are undesired particulates, such as bubbles, or any other undesired ions. The imaging step may verify whether the assay is operating as it . The imaging step may confirm whether the operating conditions under which the assay is occurring and/or detection is being performed falls within desired tolerances or optimized conditions. In some examples, the imaging may include taking a snapshot of a reaction occurring in a container. The captured image may be analyzed for any rable and/or desirable conditions.
In some instances, the captured image may be analyzed tically in a computer assisted method. One or more processor may aid with the analysis of the captured image, in some cases using one or more routines implemented by way of machine-executable code stored in a memory location. The imaging may be used for quality control without requiring the intervention of a human.
The imaging may provide igence for a system. The imaging step may provide intelligence on the conditions under which sample preparation, assay, and/or detection occurs. The detection s may provide more reliable, te, and/or precise measurements from a point of service device or component of the device, when utilizing the imaging in a quality control procedure. The quality control may be beneficial when small volumes are utilized.
Dynamic Feedback In some ments, dynamic feedback may be provided during a sample processing step. For example, dynamic feedback may occur during a sample preparation step, assay step, and/or detection step. In some embodiments, dynamic feedback may be provided via imaging. Alternatively, dynamic feedback may occur via any other detection mechanism, such as those described elsewhere herein. In some embodiments, a dynamic feedback mechanism may utilize optical detection, electromechanics, impedance, electrochemistry, microfluidics, or any other mechanism or combination thereof Dynamic feedback may ally utilize imaging or other detection mechanisms. The dynamic feedback may be involved in automated decision making for a . For example, an image may be captured, and data may be captured that may be considered in the determination of a step. A sensor, such as an imaging sensor, may e physical information which may be utilized in the determination of a uent step or ure. Such subsequent steps or procedures may be determined on the fly in an automated fashion.
In an example, dynamic dilution may occur. A container, such as a cuvette or any other container described herein, may have a sample therein. A dynamic feedback mechanism (e.g., imaging, spectrophotometer, or other ion mechanism) may determine the concentration of a sample. In some embodiments, the determination may be a rough or crude determination. The initial determination may be a ballpark determination that may provide feedback that may put the sample into a condition for more precise or fine-tuned ion and/or analysis. In an example, the c ck mechanism may be an imaging method that may use an initial fluorescence detection to do the initial estimate for concentration.
The dynamic feedback mechanism may determine whether the sample concentration falls within an able range. In one example, the concentration may be a cell concentration. A rough cell count may be performed to determine cell tration. One or more signal from the dynamic feedback ism may be used for the cell count. In some embodiments, cells may be provided in a wide range of concentrations. In some instances, the concentrations may vary on over 1, 2, 3, 4, 5, 6, 7 or more orders of magnitude. In some ments, depending on the cell or analyte to be measured and/or analyzed, different concentrations may be provided within the same sample. Based on the determined concentration, the sample may be diluted or [Annotation] eaa concentrated and/or ed. For example, if the tration is higher than a desired range, the sample may be diluted. If the concentration is lower than a desired range, the sample may be concentrated and/or amplified.
The degree of dilution and/or concentration/amplification may be ined on the fly, based on the estimated concentration.
] The degree of dilution and/or concentration/amplification may be determined in an automated fashion. Dynamic feedback may be automated. The dynamic ck mechanism (e.g., imaging or other detection mechanism) may e data which may be analyzed to determine an operational condition. For example, a sample concentration may be determined based on the dynamic feedback mechanism. A processor may be provided, capable of receiving and/or processing one or more signals from the dynamic feedback mechanism. Based on the received signals the processor may ine the tration and whether the concentration falls within a desired range. If the concentration falls within the desired range, the processor may determine that no further dilution or concentration/amplif1cation is . If the concentration is higher than the desired range, the processor may determine that dilution is needed. The processor may determine the degree of dilution needed based on how far the concentration falls outside the desired range. If the concentration is lower than the desired range, the processor may determine that concentration (or amplification) is needed. The processor may determine the degree of ication needed based on how far the concentration falls below the desired range. Such determinations may be based on tangible computer readable media which may e code, logic, or instructions for ming one or more steps. Such determinations may be automated and thus made without requiring the intervention of a human. This may apply to any ional condition, and need not be limited to sample concentration, such as cell concentration.
In some embodiments, after an initial feedback measurement and dilution or concentration/amplification step, a more precise measurement may be taken. For example, a more precise ement of cell counting may occur after the sample is determined to be in a desirable range. In some embodiments, a sample may reach a desirable range after a single dilution and/or concentration/amplif1cation step. In other embodiments, additional feedback steps may occur and additional dilution and/or concentration/amplification steps may be provided, as necessary. For example, if an initial determination yields that a sample has a high tration, a dilution step may occur. Following the dilution step, an additional feedback step may optionally occur. If the sample concentration does not fall into the desired (or otherwise predetermined) range, an additional dilution or tration/amplification step may occur, depending on whether the measured concentration is above or below the desired range, respectively. This may be repeated as many times as necessary for the sample to fall into the desired range. Alternatively, feedback steps may or may not be ed, or may be repeated a fixed number of times. In some embodiments, each ck step may occur with a greater degree of precision. Alternatively, the same degree of precision may be utilized in each of the feedback steps.
In some ments, when a sample concentration (e.g., cell concentration, analyte concentration) falls into a desired range, the sample may be analyzed effectively. For example, the sample cell concentration may have a desired range that may be beneficial for imaging. A desired number of cells per field of view may be provided.
Cell quantification and enumeration by imaging can ed by controlling the cells density during imaging, thus limiting crowding and clustering of cells. Consequently the range of analyte concentration [Annotation] eaa over which the assay is linear can be maximized or increased. In order to extend the assay linear range, the dynamic system may perform a prior, non-destructive measurement on the sample using a method which has a high dynamic range to provide determine a rough cell concentration in the sample. An algorithm may then calculate the dilution ratio required to bring the cell concentration in the acceptable range for the main measurement. Dilution and/or tration/amplification may be ed accordingly, thereby providing dynamic dilution and/or concentration.
Such dynamic feedback, such as dynamic dilution, may be advantageous in systems utilizing small volumes. In some embodiments, a total sample volume may include any of the volumes described elsewhere herein. In some instances, the volumes for a ular portion of a sample to be analyzed may have any of the volumes described elsewhere . Dynamic dilution may assist with ing low coefficient of variation.
For example, a coefficient of variation for a sample preparation, assay, and/or ion step may have a coefficient of variation value as described elsewhere herein. This may be advantageous in point of service devices, which may utilize small volumes, and/or have low coefficients of variation.
Dynamic feedback may advantageously permit structive testing of a sample. This may be advantageous in systems using small volumes. The same sample may be used for the initial feedback detection and for subsequent detections. The same sample may under initial feedback detection and subsequent detections within the same container (e.g., cuvette, vial, tip). A vessel may be provided with a sample that is outside a desired and/or able range in its initial state. For example, a concentration of one or more analytes and/or cells may fall outside a desired and/or detectable concentration range initially. The same sample may be measured within the range in the same vessel. In some embodiments, the concentration of the one or more analytes and/or cells may later fall within a desired and/or detectable range in the same vessel. In some embodiments, one or more intervening steps, such as on and/or concentration/amplification may be med on the sample in order to get the sample into the desired and/or detectable range. Such intervening steps may be med in an automated n.
In some embodiments, dilution may be provided to the sample in an automated fashion. For example, a diluent may be dispensed into a container holding the sample and mixed with the sample to effect a new sample volume. In some cases, the diluent includes a single diluent. In other cases, the diluent includes a plurality of diluents. The diluent can be dispensed into the container with the aid of a pumping system, valves and/or fluid flow channels for facilitating the flow, such as a uidic system having one or more microfluidic channels and/or one or more microfluidic pumps. The microfluidic system may e one or more ical and/or electromechanical ents, such as a mechanical pumping system having one or more actuated (e. g., pneumatically actuated) valves for facilitating the flow of a fluid. The pumping system in some cases includes a ical pump configured to facilitate fluid flow. The pumping system can include one or more sensors for measuring and relaying operating ters, such as fluid flow rate, concentration, temperature and/or pressure, to a control system. In an example, the diluent is dispensed into the container with the aid of a microfluidic system having a mechanical pump coupled to a microfluidic channel bringing the container in fluid communication with a diluent reservoir.
In some cases, a pumping system is provided to release a diluent based on a measured sample dilution. The sample dilution can be measured with the aid of a , such as, for example, a light sensor. In an example, the light sensor is d with a light source for directing a beam of light through the sample, and [Annotation] eaa subsequently measuring sample dilution based at least in part on the scattering of light through the sample. If the measured sample (e.g., cell, tissue) concentration is above a predetermined limit (or threshold), then the pumping system directs a diluent (e.g., water) from a diluent oir to a container holding the sample.
] In some embodiments, dynamic dilution is electronically ted with the aid of a fluid flow system having a pump (e. g., microfluidic pump) in fluid communication with a fluid flow channel (e. g., microfluidic channel), and further including one or more valves for regulating fluid flow. The automation of dilution can be used to test and/or adjust calibration settings, such as preset dilution fluid s used to effect a d concentration.
In some situations, the pump ses one or more valves, such as pneumatically-actuated valves. The pump, fluid flow channel and one or more valves bring a diluent reservoir in fluid communication with a container configured to hold a sample. The one or more valves and/or the pump can be in electrical communication with a control system having a processor for ting the flow of diluent from the diluent reservoir to the to regulate the concentration of the sample.
Dynamic feedback advantageously enables the ted regulation of sample concentration while minimizing, if not eliminating, user involvement. In some cases, the concentration of a sample is automatically ted (e.g., d or amplified) without any user involvement. Such minimal user involvement can provide low coefficient of variation in imaging and overall system use, as described elsewhere In an example, dynamic feedback system is used to regulate the concentration of cells in a fluid sample using imaging. With the sample provided in a sample container, such as cuvette, the imaging is used to measure the concentration of cells in the fluid sample. The measured concentration can be a rough (or ballpark) ement of concentration. The dynamic feedback system then dilutes the fluid sample by providing a diluent into the sample container. This may minimize, if not eliminate, any disturbance to (or destruction of) the cells upon dilution. An optional ement of the tration of cells in the fluid sample can then be made to measure the concentration following dilution. In some ions, following dilution a reaction can take place in the same sample container that was used to dilute the sample. In some situations, the reaction may take place in cases in which the dilution is not optimal.
In some cases, during dynamic feedback a rough measurement of sample tration is made with the aid of a spectrometer, and a more precise measurement of sample concentration is made with the aid of an imaging device. The imaging device can include a light source (e.g., coherent light, such as a laser, or incoherent light) and a camera, such as a charge-coupled device (CCD) camera. In an example, following the rough ement, the dynamic feedback system coarse adjusts the concentration of the sample by providing the diluent, and subsequently makes the more precise measurement. The sample tration can be further adjusted by providing smaller volumes of a t (i.e., fine adjustment) in relation to the volume of the diluent provided during coarse adjustment. Alternatively, the rough measurement of sample concentration is made with the aid of an imaging device, and the more precise measurement is made with the aid of a spectrometer. Coarse and fine adjustment c feedback systems provided herein can be configured to concentrate/amplify (i.e., increase the concentration of) a sample, such as cells in a fluid sample. In some cases, this is accomplished with the aid of centrifugation or induced separation (e. g., electric field separation, magnetic separation). ation] eaa In some situations, the concentration of a sample is made using an imaging device, with the location of the imaging device selected to select a desired path length and/or focal point. In some cases, the on of one or more optics associated with the imaging device are adjusted to provide a desired path length and/or focal point. In some cases, a lens-less camera is used for image capture, which can computationally provide image analysis and various focal points. c dilution can be performed on various sample volumes. In some cases, if a sample volume is above a predetermined limit, the sample can be distributed in multiple sample ners (e. g., cuvettes) for sequential or parallel processing and/or imaging.
Self-Learning The c feedback ism may result in self-learning by the system. For example, for a dynamic dilution/concentration system, an initial feedback measurement may be made. Based on the feedback measurement, the sample may have no action, may be d, or may be concentrated/amplified. Subsequent measurements and/or detection may occur. The subsequent measurements and/or detection may or may not be additional feedback measurements. Based on the subsequent measurements, a determination may be made whether the action taken (e.g., no action, dilution, concentration/amplification) was correct and/or whether the t degree of action was taken (e. g., enough dilution or concentration/amplification). For example, an initial ck mechanism may determine that the sample concentration is high and needs to be diluted. The sample may be diluted by a ular . A subsequent measurement may be taken (e.g., image of the sample may be taken). If the degree of dilution does not bring the sample into the desired range (e. g., dilution was too much or too little), the system may receive an indication that for subsequent dynamic dilutions/concentrations with the same or similar initial feedback mechanisms, a different degree of dilution may be used. If the degree of dilution does bring the sample into the desired range, the system may receive a mation that the amount of on should be used for subsequent dilutions for the same or similar type of initial feedback measurement.
Data points may be gathered based on initial conditions and uent actions, which may assist with determining appropriate actions to take in subsequent dynamic feedback situations. This may cause the system to self-learn over time on steps to take in particular dynamic situations. The self-learning may apply to individualized situations. For example, the self-learning system may learn that a ular individual from whom the sample is drawn, may require different degrees of dilution/concentration than another individual. The self-learning may apply to groups of individuals having one or more characteristic. For example, the self- learning system may learn that an individual using a particular type of drug may require different degrees of dilution/concentration than another individual. The self-learning system may also be generalized. For example, the system may become aware of a pattern that people of a particular demographic or having particular characteristics may or may not required different degrees of dilution and/or concentration. The system may draw on past data points, individuals’ records, other duals’ records, l health information, public information, medical data and statistics, insurance ation, or other information. Some of the information may be publicly available on the Internet (e. g., web sites, articles, journals, databases, medical statistics). The system may optionally crawl web sites or databases for updates to information. In some embodiments, self- learning may occur on the device, the cloud or an external device. As additional data is ed, it may be uploaded to the cloud or external device, and may be accessible by the earning system.
[Annotation] eaa Image capture and/or manipulation devices In some embodiments, sample preparation, sing and/or analysis is performed with the aid of image capture and/or manipulation devices, including electromagnetic radiation (or light) capture and/or manipulation devices, such as imaging devices or spectrometers. In some cases, an imaging device can be used in ation with a ometer. A ometer can be used to measure properties of light over a select portion of the electromagnetic spectrum, which may be used for oscopic analysis, such as materials analysis. An imaging (or image capture) device can be used to measure sample concentration, composition, temperature, turbidity, flow rate, and/or viscosity.
] In an example, an image capture device may be a digital camera. Image capture devices may also include charge coupled devices (CCDs) or photomultipliers and phototubes, or photodetector or other detection device such as a scanning microscope, whether back-lit or d-lit. In some instances, cameras may use CCDs, CMOS, may be ess (computational) cameras (e.g., Frankencamera), open-source cameras, or may use any other visual detection technology known in the art. In some instances, an imaging device may include an optical t that may be a lens. For e, the optical element is a lens which captures light from the focal plane of a lens on the detector. Cameras may include one or more optical elements that may focus light during use, or may capture images that can be later focused. In some embodiments, imaging devices may employ 2-d imaging, 3-d imaging, and/or 4-d imaging (incorporating changes over time). Imaging devices may capture static images or dynamic images (e. g., video). The static images may be captured at one or more points in time. The imaging devices may also capture video and/or dynamic images. The video images may be captured continuously over one or more periods of time.
] In some cases, an image capture device is a computational camera that is used to measure the tration of a ity of s within a vely short period of time, such as at once. In some embodiments, the computational camera may have an optical which may be different from a lens. In an example, the computation cameral is a lens-less camera that takes a photograph of a plurality of samples in staggered sample containers (e. g., cuvettes). The concentration of a sample in a particular sample container can then be calculated by, for example, mathematically rendering the image to select a focal point at or adjacent to a portion of the image having the particular sample container, and deriving the sample concentration from the rendered image. Such mathematical manipulation of an image, as may be acquired with the aid of a lens-less camera, can e other information at various points in space within the field of view of the lens-less camera, which may include points in space that may be extrapolated from scattered light. In some embodiments, the final signal may be analyzed by complex thms. One example of such a setup is a computational camera with optical elements which may produce a Fourier-transformed image on the detector. The resulting “image" can be analyzed to extract required information. Such a detector would enable one to obtain rich information from the imaged subject. ing ent features from the image, for example, information at a different focal length could be done purely through software, simplifying the g hardware and providing more rapid and informative data acquisition.
Electromagnetic radiation capture and/or manipulation devices can be used in various applications provided herein, such as measuring sample concentration, including dynamic dilution. In an example, a light capture and/or manipulation device includes a light source, such as a nt light source (e.g., laser), coupled with a light sensor, such as a CCD camera, for capturing scattered light, as may emanate from a sample upon the ation] eaa light source being directed through the sample. This can be used to measure the concentration of the sample.
The light sensor can be configured to capture (or sense) various wavelengths of light, such as red, green and blue, or other color ations, such as combinations of red, orange, yellow, green, blue, indigo and violet, to name a few examples. In some situations, the light sensor is configured to sense light having ngths at or greater than infrared or near ed, or less than or equal to ultraviolet, in addition to the visible spectrum of light.
Light e and/or manipulation devices can be used to collect information at particular points in time, or at s points in time, which may be used to uct videos having a plurality of still images and/or sound (or other data, such as textual data) associated with the images.
Light capture and/or manipulation devices, including computational (or lens-less) cameras, can be used to capture two-dimensional images or three-dimensional (or pseudo three-dimensional) images and/or video.
In some embodiments, an image capture and/or manipulation device perturbs an object and measures a response in view of the perturbation. The perturbation can be by way of light (e. g., x-rays, ultraviolet light), sound, an electromagnetic field, an electrostatic field, or combinations thereof For example, perturbation by sound can be used in acoustic imaging. Acoustic imaging may use similar principles to diagnostic ultrasound used in medicine. Acoustic imaging may function similarly to a regular microscope but may use acoustic waves. A source of ultrasound may e waves that can travel through the sample and get reflected/scattered due to heterogeneities in the elastic properties of the . The reflected waves may be “imaged" by a sensor. A variant of this method may include “photo-acoustic imaging" where the acoustic waves ing through the sample may cause local compression and extension of the . This compression/extension may cause a change in the refractive index of the sample material which can be detected by measuring/imaging the reflection of a laser beam by the sample.
In some situations, an imaging device can be used to measuring the volume of a cell. In an example, the combination of a light source and CCD camera is used to capture a still image of a cell. A computer system digitizes the still image and draws a line across the cell, such as through the center of the cell.
The computer system then measures the distance between the points at which the line intersects the boundaries of the cell (or cell wall or ne) to provide an estimate of the diameter of the cell, which may be used to estimate the volume of the cell.
The imaging device may utilize line scanning microscopy to enable sample illumination with a thin line or spot of nt laser light, so that power from the source can be concentrated in a small area giving high power densities. The detector geometry may be matched with the line or spot. Then the line/spot may be scanned across the sample so that different parts of it can be imaged. Each d line can then be concatenated to form the whole image (e. g., in a similar manner like a document r). This method may be advantageous as an analytical/imaging method for one or more of the following reasons: (1) high power y of illumination, (2) relatively high speeds can be obtained from line scanning as opposed to spot scanning, (though both may be slower than full-frame or classical g), (3) high precision and/or accuracy of analytical measurements on the sample such as cence, absorbance, luminescence, (4) combination with spectral or hyper-spectral imaging such that a complete spectrum of the sample can be acquired for each pixel, [Annotation] eaa (5) on-the-fly adjustment of resolution, (i.e. without changing any elements, a sample can be d at low or high lateral resolution as desired), or (6) can provide high depth of field to allow imaging of tissue samples.
In some embodiments, an imaging device is configured to detect light emanating from an ionization scence or luminescence) event, such as via llation. In an example, a scintillator is coated on or embedded in a material comprising a sample container. Upon a sample g to (or ise interacting with the scintillator), the scintillator emanates light (e.g., fluorescent light) that is detected by a detector of the g device. This may be used to e the radioactive decay (e.g., alpha and/or beta decay) of certain samples.
In some situations, an imaging device is a field effect transistor for detecting charged particles, such as ions. Alternatively, the imaging device may be a thermal detector for measuring a heat change, which may be used to construct a heat map, for example.
In some situations, a sample container comprises one or more wells for lizing a sample.
The sample ner may be coupled with an imaging device for imaging a sample immobilized in the one or more wells. Sample immobilization can be facilitated with the aid of beads having surface g agents (e. g., antibodies) or e binding agents, which may be disposed, for example, at bottom portions of wells. The wells can have diameters on the order of nanometers to micrometers or r.
In some embodiments, sample detection and/or analysis is facilitated with the aid of image ement species, such as dyes. A dye may bind to a sample provide an optical, electrical or optoelectronic signal that can be ed by a detector of an imaging device. In an example, a dye binds to a cell and fluoresces, which is recorded by a detector. By measuring fluorescence, the spatial distribution and/or tration of cells can be measured. Image enhancement species can aid in achieving improved signal-to- noise during image acquisition (or capture). A dye can bind to a cell with the aid of surface receptors and/or antibodies.
In some cases, the use of dyes can generate background fluorescence, which may distort an imageithe fluorescence sample may be difficult to resolve from the fluorescing background. In such a case, image acquisition can be enhanced by contacting a sample in a fluid with a fluorescent dye. d dye is removed with the aid of a centrifuge (or magnetic or electric separation), which separates the sample from the unbound dye. The centrifuge may be integrated in a point of service device having the imaging device. The sample can then be re-suspended in a fluid and subsequently imaged with the aid of the imaging .
In some cases, image acquisition can be enhanced by using dynamic feedback in addition to, or in place of, the use of image enhancement species. In an example, the concentration of the sample is zed with the aid of dilution and/or amplification prior to image acquisition.
Sample separation can be facilitated with the aid of a centrifuge. As an alternative, sample separation can be performed with the aid of a magnetic or electric field. For instance, a magnetic particle can bind to a cell, which in the presence of a magnetic field can be used to t the cell towards the source of magnetic attraction.
Systems and methods provided herein can be applied to s types of samples, such as cells as may be derived from tissue (e. g., skin, blood), saliva or urine. In an example, dynamic feedback and/or imaging can be applied to tissue samples or cell samples derived from such tissue samples.
[Annotation] eaa Exam le 1: Nucleic acid am lificationb L00 -mediated isothermal am lification LAMP To evaluate the ability of the three-color image analysis method for both fluorescence and absorption to read LAMP assays the following experiments were performed.
Lamp Reaction Conditions The LAMP reaction was carried out in a total volume of 25 uL in 500 uL PCR tubes (VWR, West Chester, PA). The reaction mixture included 0.8 uM of primer 1 and primer 2, 0.2 uM of primer 3 and primer 4, 400 uM each dNTP (Invitrogen, Carlsbad, CA), lM betaine (Sigma, St. Louis, MO), lX Thermopol Buffer (New England Biolabs, Ipswitch, MA), 2 mM MgSO4 (Rockland Immunochemicals, Gilbertsville, PA), 8U Bst DNA polymerase large nt (New England Biolabs, Ipswitch, MA), and a given amount of template DNA (varied n ~10 and ~10A9 copies). In the case of negative control approximately 10A9 copies of irrelevant DNA was added.
Reaction Conditions The reaction was ted at 65 0C for 1 hour in sealed tubes. The polymerase was then inactivated by heating the reaction product to 80 °C for 5 minutes.
Product Detection and Visualization SYBR Green I stain (Invitrogen, Carlsbad, CA) stock was diluted 100 fold, 5 uL was mixed with uL of the completed LAMP reaction product mixed, and incubated for 5 minutes at room temperature. The reaction products were then read out in the following way: Fluorescence readout: PCR tubes or pipette tips containing the mixture, were illuminated with 302 nm UV light and fluorescent on (kmax ~ 524 nm) imaged by a digital camera (Canon EOS Tli, 18-55 mm, Canon, Lake s, NY).
Color readout: on products were aspirated into tips and imaged using a digital camera ] A fluorescence image of assay products in tubes is shown in Figure 81.
A fluorescence image of the assay product in tips is shown in Figure 89.
Color images of the assay products in tips are shown in Figure 82, Figure 83, Figure 84, Figure 85, Figure 86, and Figure 87. Figure 88 shows a background color image obtained for calibration.
Figure 90 shows a comparison of LAMP dose-responses obtained by measurement of “bulk" fluorescence (conventional fluorometry) and responses for two color channels obtained by . As is evident, the color method shows a response comparable to that of fluorimetry.
When the color images were analyzed and calibrated according to methods described herein using all thee color channels, the close correspondence of the calibrated color signal with the cence signal is t as shown in Figure 91.
Example 2: System maximizing sample utilization A system for maximizing sample utilization can have the following characteristics: 1. Efficient tion of blood into plasma and efficient recovery of the plasma a. Separation is ed by fugation in a capillary tube [Annotation] eaa 2. Dilution of the plasma to a few tablished levels appropriate to both high and low sensitivity assays 3. zing the volume of each assay reaction mixture ed for each assay a. Using an open-ended low volume cuvette le for assay incubations while precluding evaporation i. Cuvette is long relative to width b. Within said low volume cuvettes enabling increase in assay signal sensitivity by modifying the optical pathlength ] i. Cuvette is conical or has features where the width is wide and narrow c. When needed, achieving said increase in assay signal sensitivity by moving the reaction product (which does not fill the cuvette) to selected locations having greater pathlength at the time of optical measurement ] i. Cuvette internal volume is much larger than the volume of the assay mixture 4. Use of either or both variable pathlength and 3-color channel analysis to increase the useful dynamic range of assays Example 3: Point-of-care assay device A point of care assay device can e of single-use disposable cartridges an instrument which processes samples and operates the assays and a server remote from the instrument, the measurement and detection system comprising: - A able cartridge containing - Sample-acquisition and metering methods (such as a sample tip) ' An instrument housing containing - A light imaging sensor (such as a cell-phone camera having a light source (e.g., a flash) and a CCD image ting device) - A mechanism for moving said tip to a location where said light imaging sensor can acquire images - ing said images wirelessly (or by other methods) to a server remote from the instrument - Image reting software capable of: - Measuring volumes from the two-dimensional images - Distinguishing sample types - Using said sample type and/or volume data as part of an ing algorithm to: - Provide prompts to system users as to sample integrity - Provide any needed prompts to provide an augmented or replacement sample - Interpret signal data from said instrument in terms of assay results making allowance for sample type and/or sample volume The system can optionally include additional mechanisms for processing and/or imaging of samples acquired by users into a “sample acquisition device (capillary)" comprising: [Annotation] eaa - isms for ing the capillary in a defined location and moving said capillary to another defined location where an image can be acquired ' Mechanisms for ejecting substantially all the sample into the said cartridge at a defined location Example 4: Analysis of a agy containing a blood sample s are acquired by users by touching the distal end of the capillary to a drop of blood (typically as a fingerstick). The capillary usually fills by capillary action provided there is sufficient blood. In one version of the invention, the user places the ary at a latching location on the cartridge then inserts the cartridge onto a slide in the instrument then activates an assay by pressing a screen button on the instrument GUI. All uent assay steps are automated. The instrument moves the cartridge inside its housing and closes the door through which the cartridge was inserted. In this version of the invention, the instrument moves a component for grasping the ary and moving it to a location in front of a digital camera equipped with a flash light source a CCD. An image of the capillary is taken using flash nation and sent ssly to the server which interprets the image in terms of type, location and quantity of sample. If preset criteria are met the server instructs the instrument to continue the assay. If the sample is not appropriate the capillary is returned to the cartridge which is ejected and the server causes the GUI to display an appropriate prompt. The user may then (1) add more sample or (2) obtain a fresh sample and use a new capillary. Once the user indicates by the GUI that corrective action has been taken and the capillary/cartridge has been re-inserted into the instrument, the server instructs the instrument to resume assay processing. The criterion for appropriate volume of sample is usually that the volume is more than the minimum required for the assay. Thus in some assays for example, 10 uL of sample can be used, so typically the sample is regarded as adequate if the measured volume is > 12 uL.
In a second version of the invention which may be implemented alone or in combination with the first, image acquisition is used to measure the volume of sample taken from the al sample by the instrument. In the assay ce, sample is ejected from the capillary into a sample well in the cartridge either (1) by the user, or (2) by the instrument. Then an exact volume is taken from sample well using a second tip either by capillary action or (preferred) pneumatic s. At this stage the type of the sub-sample and the sub-sample volume is ed (as above) by imaging the tip. If the sample type and volume is acceptable (target +/- < 5%), the assay proceeds. If not, the assay may be aborted and the user prompted to take remedial action. Sample types that may be discriminated are blood and plasma or serum and others. The imaging system makes the distinction by observing the much greater st between blood e) and the tip parent) than is the case for plasma and serum. In the event that the sample volume while not at the target level is still sufficient for the assay to give satisfactory results (in the above example, a volume > 5 uL would be acceptable if the target volume is 10 uL). The assay algorithm that calculates the analyte concentration then uses a correction function Conc. (true) = Conc. (observed assuming target volume) *Target volume/Measured volume.
Blood can easily be detected and its volume measured by creating a pixel map of the tip and counting the dark pixels then comparing with a previously established number for the target volume. Even though sample types serum and plasma (and other s non-blood samples) are transparent, the imaging system can still detect the presence of sample due to the change in refraction that occurs over the sample meniscus and the difference in refractive index between the tip material and the sample. Alternatively a dye [Annotation] eaa may be added to the sample by providing a dried dye formulation coated within the capillary which is dissolved by the sample Other s for measuring the volume of sample include locating the top and bottom of each meniscus and using simple geometric techniques (as described herein). Bubbles within the sample liquid column can be recognized and measured by the methods discussed above and the appropriate volume subtracted from the total volume ed by the sample.
The methods given above measure the sample within the sample capillary or pendent from the end of the capillary (as described herein). After the sample is measured and accepted by the system it is ejected by pipetting/pneumatic methods within the ment. Once this has happened, the tip can be imaged again and any residual sample measured. The volume that actually is used in the assay is the difference between the total volume and the residual volume.
Another particular problem in FCC assay systems especially when used by non-technically trained users is the ce of sample on the outside of the sample ary.
This can be imaged and measured using the invention and the user prompted to remove excess blood.
The iveness of sample ition and delivery in assay devices depends on the liquid handling techniques used. Automated s may use (1) pneumatic tion and ejection (as in many laboratory single and multi-channel pipetting devices that use disposable tips; pneumatic s may use positive or negative pressure (vacuum)), (2) positive displacement (as in a syringe), ink jet-like technology and the like. Samples and other liquids such as reagents can be (3) drawn out of oirs by capillary action or (4) wicking into porous media. Liquids (samples and/or reagents) may be ejected with or without contacting other liquids. For example, if the sample is to be d, the sample tip can be dipped into the diluent or displaced into air so as to drop into a dry well or a well containing diluent. The performance of all of the above systems and methods may be verified and/or measured using the invention.
In other embodiments, the ary can be imaged by a user outside the instrument with an external camera. Volume measurements can be scaled to the size of the capillary. Such an externally oriented camera can be used for recognition of the user/patient so that s can more ly be attributed to the correct patient. The method may also be used to verify appropriate medication is being used (image the pill container or pill or alternatively the bar code reader in the instrument may be used for this purpose).
The invention may also be used to measure location and volumes of reagent aspirated into assay tips. In some cases dyes may be added to reagents to make them more easily imaged (improved contrast).
In assays where plasma is separated from blood, the invention can be used to verify the effectiveness of red cell removal and the available volume of plasma. An alternative to moving the sample containing tip is to move the camera Such a system can have the following advantages: 1. Quantitative measurement of sample 2. Ability to identify the sample type 3. Creation of an objective, tative record of sample volume 4. Enables assays to give results when sample volume is not correct 5. es reliability of assay system [Annotation] eaa Example 5: Tips Figure 18 shows diagrams of tips used to aspirate samples and reagents (dimensions in mm).
Example 6: Geometry measurements of a cylindrical capillary Figure 19 shows dimensions of a cylindrical capillary containing a sample.
R = radius L1 = distance from lower end of cylinder to lower sample meniscus L2 = distance from lower end of to lower upper meniscus Volume introduced = 71*(RA2)*(L2 - Ll) Example 7: ry measurements of a conical capillapy Figure 20 and Figure 21 shows dimensions of a conical capillary.
Rb = radius at base of cone L = length L1 = ce from (projected) top of the cone to lower sample meniscus L2 = distance from (projected) top of the cone to lower upper meniscus Volume introduced = 71* (Rb/L)A2*[(L1)A3 - (L2)A3]/3 Tan 6 = Rb/L e 8: Effects of liquid meniscus As is well known, liquids in aries typically have a curved meniscus. Depending on the t angle the meniscus may be curved inward or outward relative to the liquid. When no net external pressure is applied, if the capillary surface is hydrophilic (contact angle < 71/2) the meniscus is inward directed or outward directed if the surface is hydrophobic (contact angle > 71/2). When net pressure is applied to the liquid column lary oriented vertically or pneumatic pressure applied by the instrument) the lower meniscus can project below the lower end of the capillary. In small diameter capillaries, surface tension forces are strong relative to the small gravitational force across a meniscus. Surface tension pressure across a meniscus in a vertically oriented ar capillary is 27t*R*y*cos0 where y is the surface tension and 0 is the contact angle.
Pressure across a meniscus caused by gravity is pgAL/(71*RA2) where p is liquid density and AL is the distance across the us and g is the gravitational constant. Accordingly the meniscus surface is spherical. The volume of liquid in the segment(s) occupied by the us (menisci) can be ated as s and used to obtain a more accurate estimate of volume.
Distances defined from the bottom of the sample capillary L1 = ce to the bottom of the lower meniscus L2 = distance to the top of the lower meniscus L3 = distance to the bottom of the upper meniscus L4 = distance to the top of the upper meniscus Volume of a spherical cap ] I‘m-{3&2 +8335“ Dimensions of a spherical cap are shown in Figure 22.
Several different situations can arise defined by the number and location of the menisci. Note that the formulae given below deal with both inward and dly curved menisci.
[Annotation] eaa Case 1: Upper meniscus is curved, lower is horizontal (as shown in Figure 23) Substituting: a = R, h = L47 L3 Volume between L3 and L4 = n*( L47 L3)*(3*(R) 2 + (L47 L3) 2)/6 Total volume = 2)*L3 + (L47 L3)*(3*(R) 2 + (L47 L3) 2)/6) ] Case 2: Both menisci are within the capillary and curved (as shown in Figure 24) Total volume = 7T*((R2)*L3 — (L2 , L1)*(3*(R) 2 + (L2 , L1) 2)/6 + (L47 L3)*(3 *(R) 2 + (L47 L3) 2)/6 Case 3: There are two curved menisci. The lower being curved and below the lower end of the ary (as shown in Figure 25) Total volume = 7T*((R2)*L3 + (L1)*(3*(R) 2 + (L1) 2)/6 + ( L47 L3)*(3*(R) 2 + (L47 L3) 2)/6) e 9: Bubbles Bubbles in liquid samples or reagents cause variable reductions in volume of liquid metered. In small capillaries bubbles when smaller than the capillary cross section, are cal. When they are bigger they occupy a cylindrical space (in a cylindrical capillary) and have hemispherical ends.
Case 1: Bubble is not big enough to span the width of the capillary (as shown in Figure 26) Subtract bubble volume = ‘7T"‘r3 Case 2: Bubble occludes the entire width of the capillary (as shown in Figure 27) Subtract bubble volume = 471"“R3 + L Example 10: Blood outside the capillapy tip Case 1: Pendant blood or reagents outside a vertical capillary can cause major problems in assays since it represents an -control situation. As shown in Figure 28, imaging can easily ize this situation.
Case 2: Blood outside the capillary other than pendant Residual blood outside the capillary also is problematic since it is a potential source of contamination of reagents and of extra volume. Again imaging can recognize the situation.
Example 11: Residual blood inside the capillagy once sample dispensing has occurred This can be dealt with by ting the residual volume and subtracting from the total sample volume. Figure 29 shows an example of a capillary with residual blood.
Residual volume = 71*R2*L e 12: Evaluation of red cell separation from blood samples In many assays it is desirable to remove red cells from the sample thus making plasma. When this is done, it is desirable, especially in POC devices, to know that the separation was effective and to determine that there is sufficient plasma to perform the assay.
Figure 30 - Figure 39 show a schematic of one preferred embodiment of red cell removal suited to POC devices of the present ion. Magnetizable particles have antibody to red cells mixed with free antibody to red cells are provided as a dried preparation in the well that will receive a blood sample, as shown in Figure 30. When a blood sample is added to the well (shown in Figure 3 l) and mixed with the magnetic reagent (shown in Figure 32, Figure 33, and Figure 34), the red cells agglutinate with the magnetic particles and can be d by g the blood-containing well in proximity to a strong magnet (shown in Figure 35). By appropriately moving the well relative to the magnet, the red cells are separated from plasma (shown in Figure [Annotation] eaa 36) which can then be ejected into a receiving well for use in an assay (shown in Figure 37, Figure 38, and Figure 39). It is evident that the imaging analysis can determine how ively the separation was effected and estimate the volume of plasma available for assay.
Example 13: Images of liquid samples in capillaries Figure 40 shows a high contrast image of a cylindrical tip containing a liquid with low absorbance.
Figure 41 shows an image of a l tip containing a liquid with high absorbance.
Figure 42 shows a tip with a high absorbance liquid showing two i within the tip.
Figure 43 shows a tip with a sample liquid and large bubbles that span the diameter of the tip.
Figure 44 shows a tip containing water showing a clear upper meniscus in a transparent tip or capillary.
Figure 41 was analyzed for the length of the liquid column (corresponding to 5 uL) and the resolution of the upper liquid meniscus (Definition of the position of the meniscus with > 90% confidence). The precision of the meniscus location corresponded to < 1% of the length of the liquid column. tion of meniscus Example 14: Effect of insufficient sample volume an assay result The system was used to measure Protein-C in blood. The sample volume inserted into the system was designed to be 20 uL when the sample transfer device was used properly. The instrument was set up to use lOuL of blood from this sample. The analyte concentration calculated by the system is shown in Figure 45 as the sample volume was deliberately sed from the target level. The result was essentially constant until the sample volume was less than the volume required.
Example 15: Sample transfer device Figure 46 shows an e of a sample transfer device. The device consists of (a) a capillary (made of glass or plastic) optionally coated with an anticoagulant or other reagent le for pre-analytical treatment of samples, (b) a g which holds the capillary fitted with (c) a plunger (piston) which can slide within the housing and has a raised feature which slides within a groove in the housing, (d) a groove in the housing which engages the piston feature and limits the axial motion of the plunger so that its motion stops once the sample has been displaced and (e) a vent in the g normally open which is blocked when the plunger is activated (moved towards the distal end of the device) so as to ce any liquid in the capillary.
Figure 47 shows a sample transfer device with its capillary filled with sample. The “fill to" location is indicated.
Figure 48 shows a sample transfer device with sample displaced by movement of the plunger.
Figure 49 shows a sample transfer device after a sample has been letely ejected.
Example 16: Measurement of volume by image analysis Known volumes of a liquid sample were aspirated into sample tips using a pipetting device.
Images of the tips were collected using a cial flatbed scanner (Dell) and the distances (a) from the distal end of the tip to the meniscus and (b) from the distal end of the tip to the feature marked on the image below [Annotation] eaa measured. The orientation of the tip and its position relative to the scanner platen were not controlled since the image was analyzed by measuring the ratio of distance (a) to distance (b) as a measure of sample volume. ons of the tip, meniscus and feature were measured using commercially imaging software (Jasc). The image was oriented horizontally using the software before the locations were recorded and could be read directly on a scale ed by the software. Figure 50 shows an exemplary image.
] Distance Ll was the on of the tip Distance L2 was the location of the meniscus Distance L3 was the location of the arrow indicated in Figure 50.
V01.——Ratio Calc. V01. uL ALZ-l AL3-1 uL .0 120 374 590 254.00 470 0.540426 9.7 12.5 112 400 584 288.00 472 69 12.9 .0 156 470 636 314.00 480 0.654167 15.2 17.5 171 505 654 334.00 483 0.691511 17.3 .0 114 469 596 355.00 482 0.736515 20.0 .0 214 m 694 386.00 480 0.804167 24.5 .0 165 585 640 420.00 475 0.884211 30.3 As shown in Figure 51 the volume was simply d to the ratio of distances and could be calculated. The volume estimate was within less than 2% of the actual volume on average.
Exam le 17: Ima es of blood centrifu ed in a ti Hematocrits were determined from digital images by measuring the ratio of length of the column of packed red cells and the total liquid column (tip to meniscus). This is easily achieved by feature recognition re which orients the tip to a known direction and counts pixels between the features. For the tips above, the distances corresponded to several hundred pixels permitting a precise measurement.
Figure 10 shows an empty capped sample tip.
Figure 11 shows a capped sample tip containing a sample of blood.
Figure 12 shows a capped sample tip containing a sample of 23% hematocrit blood after centrifugation.
Figure 13 shows a capped sample tip containing a sample of 31% hematocrit blood after centrifugation.
Figure 14 shows a capped sample tip containing a sample of 40% hematocrit blood after centrifugation.
Figure 15 shows a capped sample tip containing a sample of 52% hematocrit blood after centrifugation.
Figure 16 shows a capped sample tip containing a sample of 68% hematocrit blood after fugation.
Figure 17 shows a comparison of hematocrit measured using by the lly imaging system a fuged sample (hematocrit, % reported) and hematocrit measured by rd techniques (hematocrit, % [Annotation] eaa target). An example of a standard technique of hematocrit measurement may include ematocrit measurement in a glass capillary using a rd laboratory centrifuge and measuring the length of the packed red cell bed and the total length of capillary occupied by the sample.
Example 18: System including components for blood separation A system designed for separation of blood can include the following features: 1. Design of the tip shape. a. Aspect ratio about 20:1 lengthzdiameter provides convenient s for measurement of sample, packed cell and plasma volumes b. Shaped tips enable tight sealing with a vinyl cap and easy removal of cap if needed. c. Slight draft angle conical shape of main part of tip and wider conical upper section of tip " design (tip is are optimal for insertion of the plasma recovery means. Note that the “counter radia narrower at the end distal to the axis of rotation) is unusual. d. Wider conical upper section of tip is configured to be odated on an automated pipetting and x-y-z movement stage. Connection to form a fluid tight connection and easy removal when needed are facilitated. 2. Use of a very e and te x-y-Z stage to move the plasma recovery tip. 3. Use of imaging technology automatically to control the operations of centrifugation and plasma ry. Movement of the plasma recovery tip to within less than a millimeter of the packed cellplasma interface.
Example 19: Use of image ement of liquid volumes to improve assay calibration Automatic pipetting devices are generally accurate and e to about 5 % or better in the range (say) 5 , 50 uL. In many assays, volume cy and precision have both to be very good (say < 2 %) to obtain the required cy and precision of analyte measurement. ng and delivery of (l) liquids at volumes less than 5 uL (highly desirable when maximum use of a small volume sample is required), and (2) liquids having “problematic" physical properties (such as viscous solutions, solutions containing detergents etc.) can often have poor precision and accuracy which compromises the cy of assay results. One inventive solution to these issues is to use image analysis of the liquids to measure the volume of liquids es, diluents, reagents, calibrators and controls) and then to correct the assay calibration function to allow for deviations (up to [say] 20%) from the intended volume. We have shown that in pipette tips which have very precise dimensions, volumes as small as 5 uL can be measured with very good accuracy and precision (< 2%).
Below we document (1) volume measurement accuracy and precision and (2) use of known relationships n the volumes of solutions used in assays es, reagents etc.) and assay response to correct the calibration of . (1) Accuracy of volume measurement by image analysis: In the table below, known volumes of a solution of bromphenol blue were aspirated into conical tips.
The solutions were positioned in the middle portion of the tip and imaged using a scanner. Tip orientation and position were determined by standard methods. The tip orientation was adjusted by an algorithm and the length of the liquid column measured. Using the known internal dimensions of the tip, the liquid [Annotation] eaa volume was calculated. Four replicate images were taken for four aliquots in four tips. The error given below therefore reflects image ucibility and tip dimensional accuracy and precision.
Target Measured Total volume volume Error Note that the volume measurement does not rely on accurately positioning the liquid in the tip.
Image analysis provides information as to the location of the liquid in the tip. Knowing the ions of the tip one can always compute the volume from the portion of the tip occupied by the liquid wherever it is. ] (2) Correction of assay calibration by incorporation of liquid volume measurement ] This is achieved as illustrated in the following simulation. Consider an assay in which a sample is combined with two reagents (called 1 and 2). The target volume for sample, reagent 1 and reagent 2 is 10 uL.
The assay result is calculated from a standard curve relating measured signal to analyte concentration. As part of the assay calibration process the experiments can be med in which volumes used for sample and ts are changed to 8 and 12 uL in addition to 10 uL and assay results calculated based on the ation appropriate for 10 uL volumes. In Figure 105, Figure 106, and Figure 107, the results were plotted against actual volumes. For the sample volume, the assay result is essentially directly tional to the volume used (shown in Figure 105). For the reagents, somewhat non-rectilinear responses were seen (shown in Figure 106 and Figure 107). These responses are based on “typical" assays nown in the field and the magnitude of the changes with volume are representative.
We then simulate an evaluation in which we have imposed a degree of random error (about 5 %, to reflect a “real world situation") on assay results in addition to the effects of the use of inappropriate volumes.
We include results in which sample, reagent 1 and reagent 2 s are set at 8, 10 and 12 uL in all combinations. When the results from this exercise are plotted as shown in Figure 108 without correction for volume errors, as would be expected there is a significant error in the reported result due to ignoring the fact that the actual volumes used were different from those used for assay calibration.
When we allow for the volume variances from target values using the known assay response to volumes, and plot ted analyte values we obtain the much improved result shown in Figure 109, however.
This was achieved by multiple regression analysis of the data.
Summary statistics comparing results calculated with and t volume correction are presented in the table below and reflect a significant improvement in all metrics by the use of volume correction. SEE is the standard error of the estimate.
[Annotation] eaa Regression ation Volume correction coefficient Analyte CV SEE/Mean ————— Exam le 20: Hema lutination inhibition assa read usin microsco and ima eanal sis: In phosphate buffered saline (100 uL), containing 0.3 % w/V glutaraldehyde stabilized turkey red blood cells, and 0.5 mg/mL bovine serum albumin and, where indicated, 2 hemagglutination units of inactivated za Virus and 15 ug goat polyclonal anti-influenza B antibody were ted for 15 s in a conical bottom PCR tube at RT. The reaction product from the bottom of the tube was transferred to a transparent slide illuminated with white light and imaged with a 4-fold cation using a digital camera. As may be seen in Figure 131, ination caused by reaction of the red cells with the hemeagglutinin of the Virus (Figure 131 sample 3) is easily observable by comparison with an unagglutinated control (Figure 131 sample 1).
When excess antibody to the virus was also present agglutination was completely inhibited. Two effects of the agglutination reaction are notable: (1) in inated samples, there are more red cells due to the more rapid sedimentation of the agglutinates compared with the control and (2) each red cell is on average more clustered with other red cells. The ination reaction can be quantified following image recognition software to identify, locate and count red cells and agglutinates.
Figure 131 sample 1 shows a non-agglutinated control (no Virus, no antibody). Figure 131 sample 2 shows non agglutinated sample (Virus plus antibody). Figure 131 sample 3 shows an agglutinated (Virus, no antibody) .
Example 21: Sample preparation, ation of supernatant Quality and tion of the Quality of the LDL precipitate ] Plasma was diluted (1:10) into a mixture of dextran sulfate (25mg/dL) and magnesium sulfate (100mM) then incubated for 1 minute to precipitate LDL-cholesterol. The reaction product was aspirated into the tube of a centrifuge, capped then and spun at 3000 rpm for three minutes. Images were taken of the original reaction e prior to centrifugation (showing the white precipitate), following centrifugation (showing a clear supernatant) and of the LDL-cholesterol pellet (after removal of the cap). For example, Figures 132, 134 illustrate examples of images taken of reaction product.
Images of the LDL-precipitation reaction product were ed as follows. The pixel color levels were d as a function of their vertical position. The variance of the values was measured and values for the three colors . Because of the particles of precipitated LDL, which strongly scatter light, the precipitate value (1154) was much greater than (672) of the clear supernatant. Comparison of the supernatant value with that of a l no exposed to the precipitation reagent allows the quality of the centrifugation to be evaluated (data not shown). Figure 133 provides examples of images that were analyzed before spinning in the centrifuge, and after spinning in the centrifuge.
After removal of the black Vinyl cap, an image of the LDL precipitate was taken. Its volume can be measured quite accurately, knowing the geometry of the tip and the size of a pixel in the image. In this experiment, the volume of the precipitate was estimated as 0.155 +/- 0.015 uL.
[Annotation] eaa e 22: Improving the performance of an assay for alanine aminotransferase (ALT) by use of 3- color image blanking of optical signals due to the sample ALT in serum can be measured in an assay in which the enzyme ts alanine to pymvate which is in turn used to make hydrogen peroxide with oxygen and pymvate oxidase. The peroxide is then used to make a colored t by the enzyme horseradish peroxidase, aminoantipyrene and l-N- (3- sulfopropy1)ani1ine. The colored product absorbs maximally at 560 nm.
It was found that some serum samples have cant ance at this wavelength as shown in Figure 135 and accordingly interfered with the assay. In particular when using relatively high sample concentrations (such as a final dilution in the assay of 1:10), 3-color image analysis of the ALT assay gave poor results with clinical samples.
Figure 135 illustrates spectra of several serum samples diluted 1:10 into buffer; OD is plotted against wavelength (nm). Great variation of OD is i11ustratedin Figure 135.
In conventional spectroscopy, this issue is dealt with by taking a blank reading of the sample t the assay ingredients added and subtracting the blank from the signal generated by the assay. In 3-color image analysis as in the t invention, it has been found that an analogous method can be used. The diluted sample may be imaged and three-color values extracted. The assay calibration thm may then be changed to include the signals from the unreacted . Specifically in this case, the original algorithm (not including sample blank ) was ALT concentration a b*R c*G d*B e"‘R2 where a, b, c, d and e are empirically derived nts and R, G, B are the signal values in red, green and blue channels respectively. The improved algorithm was: ALT tration a b*R c*G d*B e*Rs, i f“‘Rs2 where Rs is the signal from the sample blank in the red channel (note that the empirically derived values of a, b, c, d and e were different from those of the original algorithm).
When 21 serum samples ranging in ALT activity from 0 to 250 U/L were measured in triplicate and results of 3-color image analysis compared with those provided by a clinical laboratory method (Teco) the following regression statistics were obtained indicating much-improved results.
Calibration method .pam Original 0922 0922 Improved 0.972 0972 Exam le 23: S eedin -u and rovidin ob'ective anal sis ofahema lutination inhibition assa for anti-influenza antibodies Reaction mixtures prepared as described in Example 20, were incubated for only one minute then introduced into three separate micro channels (as described for the cytometry examples above) and imaged. About 5-10 images are taken for each sample, in order to get te statistics. On average, each image ts of around 800-900 cells. The agglutination process can be objectively ted by ing the radial distribution of cells around a representative selection of individual cells using the function.
The images were processed to obtain centroid positions of the individual cells in 2D space. The 2D positions were used to compute a radial distribution function (RDF), also known as a pair correlation fimction.
[Annotation] eaa The radial bution function, g(r) quantifies the probability of finding a cell at a distance r from the selected cell. Mathematically, g(r)= p(r)/ pa where p(r)27:rdr is the number of cells found at a distance of r from a particular cell and p0 is the average cell density over the entire image window. The value g(r) is calculated as an average over all particles in the image and over multiple images, to ensure a statistically meaningful result.
Results The value of the first peak of g(r) quantifies the number of doublets in the sample. Hence, the g(r) for the inated sample should be higher in magnitude compared to the other two samples. The value ofg rises quickly from 0 to a maximum over a distance of about 20 pixels (corresponding to about 12 um about twice the diameter of a red cell) then declines to about 1.0. As shown below, the agglutination due to Virus was distinguishable from no ination when Virus is absent or antibody inhibits the Virus-induced agglutination.
Ol’lC —._— Example 24: Preparation of e detection systems using aptamers Two oligo DNA aptamers were designed to selectively capture proteins (thrombin and insulin).
The oligo DNA aptamer was composed of a binding site having a sequence selected from published data, an inert portion to extend the binding site from the surface of the bead or microarray, and a reactive group to chemically lize the aptamer to the surface. Aptamer 1 (specific for thrombin) had the following sequence: 5’7Am-(T)45GGTTGGTGTGGTTGG73’. Aptamer 2 (specific for insulin) had the ing sequence: 5’7Am-(T)32ACAGGGGTGTGGGGACAGGGGTGTGGGG73’. The “Am" at the beginning of each sequence ents an amino group.
The two aptamers were immobilized on polystyrene beads (Sum) functionalized with carboxyl groups. The beads were then washed and the excess t removed. The beads were then mixed with oligo DNA probes fluorescently labeled and complementary to the binding sites of the aptamers. Hybridization of the probes with the aptamers was detected by fluorescence emission. Only the complementary probe showed a positive hybridization event, as measured by mean fluorescence emission. Hybridization specificity is illustrated by comparison of Figure 139, which shows beads after hybridization with mentary probe, to Figure 140, which shows beads after hybridization with non-complementary probe. Detection was performed with a laser excitation at 635nm, and on filtered at 650nm m) on a CCD camera, after deposition of the beads on the analysis substrate. A similar procedure was used on a glass e coated with epoxysilane to immobilize rs 1 and 2. The array was hybridzed with the cent probe and the specific recognition of the aptamer binding site measured by fluorescence emission detection with a CCD camera set-up and an Array Scanner ys). Figure 141 illustrates the binding specificity of the aptamers on the array, with more detail illustrated in Figure 142. Figure 143 shows an example array scan.
[Annotation] eaa Example 25: ion of e using aptamers An array comprising Aptamer 1 hybridized with fluorescently labeled, complementary probe was prepared as in e 24. Thrombin was introduced to the array at a concentration of about 100nM and allowed to react with the Aptamer 1-probe complex. The fluorescent emission signal from Aptamer 1 on the array was d by 2.5 fold, indicating displacement of the probe by binding of Aptamer 1 and thrombin.
Example 26: binders Two types of binder are biotinylated and used to create capture surfaces on an assay unit solid- phase coated with avidin. Assay reagent production and luminescence-readout assay results are obtained using (1) aptamers and (2) single-chain Fv antibody fragments ) on microtiter plates. Aptamer and SCFVS as binders for luminescence-based assays are adaptable to tips and imaging systems and devices ed herein.
Analytes can be assayed and read using cameras to measure color by changing the signal-generating reagent from ne phosphatase to, e. g., horse-radish peroxidase with a chromogenic substrate or using ne phosphatase with a chromogenic substrate. Tips in microtiter plate (or other formats) can be read in any cartridge (assay unit) format.
Example 27: Vitamin D Assay Using DNA Aptamers on Microtiter Plate In this example, an assay for vitamin D is performed using single-stranded DNA aptamers.
Biotinylated DNA aptamers are coated on a idin coated polystyrene surface of a microtiter plate having a plurality of wells. Before coating, the aptamers are quickly denatured and renatured by heating at about 95 degrees Celsius, then immediately cooled on ice. About 15 microliters of the refolded biotinylated vitamin D DNA aptamers in 25 mM Tris, containing NaCl, MgCl2, 10% Ethanol, pH 7.5, are then added into each well to form the capture e. After coating, the wells are washed and blocked with about 100 uL of a blocking reagent to reduce nonspecific g.
The analyte for the assay (vitamin D) is diluted in Tris, NaCl, MgC12, 10% Ethanol, pH 7.5, and is mixed with a solution of vitamin D-A1ka1ine Phosphatase conjugate at different concentrations in the desired assay range, and provided to the assay unit for 10 minutes tion at room temperature. The assay unit is then washed three times with 100 uL of wash buffer. About 40 uL of substrate for Alkaline phosphatase is added to each assay well and chemiluminescence data (table below) is ted after about 10 minutes. Figure 144 is a plot of chemiluminescence against the tration (ng/ml) of vitamin D.
Vitamin D (ng/ml) 0 l 100 200 Chemluminescence (RLU) 1556741 1138243 49346.13 27 159471 1107942 49699.04 35794.18 1626503 1016557 53158.25 36655.66 159920.8 99266.41 50195.63 35166.41 1594291 1 50599.76 35360.13 1.80 6.60 3.44 3.37 100% 67% 32% [Annotation] eaa Example 28: iol Assay 0n Microtiter Plate In this e, an assay is performed for a steroid hormone (estradiol) using single-chain variable fragments (scfv). In this assay, the inner surface of the assay unit is coated with biotinylated scFv on ultravidin coated polystyrene surface of a microtiter plate having a plurality of wells. About 15 microliters of 1 ug/ml biotinylated scFv in Tris buffered , pH 8, 0.03% BSA, 0.05% Thimerasol were added to each assay unit.
After washing, each assay unit is fixed with 100 uL Fixative reagent ed by an overnight dry with dry air and stored dessicated.
The analyte for the assay (free estradiol) is diluted in Tris buffered Saline, pH 8, BSA, Thimerasol, mixed with an estradiol-Alkaline atase conjugate, in stabilizer from Biostab, and is provided to the assay unit coated with the scfv for about 10 minutes at room temperature.
The assay wells are then washed 5 times with 100 uL of wash buffer. After the washes, 40 uL of luminogenic ate for Alkaline phosphatase (KPL aGlo) is added to each assay unit and chemiluminescence data (table below) is collected after about 10 minutes. Figure 145 is a plot of uminescence against the concentration (pg/ml) of estradiol. 5505.454 85 493.864 389.863 Chemluminescence 5505.454 2005.112 496.932 374.317 (RLU) 5659.613 1739.771 503.25 417.021 Example 29: White blood cell count and ential assay The concentration of white blood cells (WBCs) in the peripheral blood of human subjects can range from about 1000 ul to 100,000 cells/ul. However, in some cases the range of the imaging system is more limited, such as from about 4000 cells/ul to 7000 cells/ul. If the cell concentration is less than 4000 cells/ul, the system may not be able to enumerate a target of 10,000 cells, as may be required by the assay. If the cell concentration in the sample is more than 7000 cells/ul, each field of view may be too crowded to perform accurate image segmentation and cell enumeration. An exemplary approach for imaging WBCs is provided below.
In an example, an imaging system (e.g., cytometer) is provided configured for fluorescence spectrophotometry. The system uses fluorescence spectrophotometry to measure the cell concentration in the sample. The sample is labeled with fluorescently conjugated antibodies for imaging (e.g., AF647-CD45) and also with a fluorescent nucleic acid marker (e.g., DRAQ5). A quantitative fluorescence readout on the spectrophotometer module provides a measurement of the concentration of WBCs at low sensitivity (LLOQ of about 5000 cells/ul) but high c range (e. g., 5000-100,000 cells/ul). A concentration measured on the spectrophotometer allows the calculation of the l dilution ratio such that the final concentration of the cell suspension is between 4000-7000 cells/ul. —104— [Annotation] eaa ] Figure 146 shows the high dynamic range of fluorescence in the spectrophotometric measurement ofWBC concentration. WBCs tagged with fluorescently d anti-CD45 and other antibodies were excited with red light having a wavelength of about 640 nm and the quantitative fluorescence emission spectrum was ted. Integrated fluorescence is plotted on the y-axis.
Example 30: Streptococcus Group A Detection by Isothermal Amplification ] Isothermal amplification of specific genomic samples can be detected by turbidity. In this example, a genomic sample extracted from ococcus group A (StrepA) cells (stock concentration = 2x108 org/ml from My biosource) was amplified by isothermal amplification and the progress of the reaction measured by Turbidity. About 5 ul of stock bacterial cells and 45 ul RT PCR grade Water (10X dilution of stock) were heat treated at about 95 degrees Celsius from about 8 to 10 minutes (Cell ruptures and releases the DNA). The genomic sample was diluted and introduced in a sample volume of about 25 ul in a PCR tube containing reagents for amplification (e.g., DNA rase, Primers, Buffer). The PCR tube was incubated at about 61 degrees Celsius for about 60 minutes while the progress of the reaction was ed by turbidity. The results are as follows, and Figure 147 shows plots of turbidity as a function of time: Conc. St. dev (copies/uL) T(min) (min) Three separate experiments were ted at 800 copies/uL and 80 copies/uL. Experiment A was performed using StrepA having a synthetic c DNA template (from Genescript). Experiment B was performed by diluting stock StrepA 10-fold followed by heat inactivation at 95 degrees Celsius from about 8 to min, and followed by serial on of heat inactivated ten-fold diluted stock . Experiment C was performed using a variable concentration of stock StrepA (inactivated bacterial cells) followed by heat inactivation at 95 degrees Celsius for about 10 min. The inflections points for each experiment are shown in Figure 148. For each of 800 copies/uL and 80 copies/uL, a grouping of three plots includes Experiment A at the left, Experiment B in the middle and Experiment C at the right. The average inflections points are provided in the following table: -——— -Ave Ave Ave -800 cp/uL---“m Example 31: use of magnetic beads ] In this example, magnetic beads are used for the is of proteins and small molecules via ELISA assays. Figure 110 schematically illustrates an exemplary method for the ELISA assay. The assays include two proteins, Protein 1 and Protein 2. Protein 1 has a sample on of about l50-fold (tip protocol = [Annotation] eaa -fold), a sample volume of about 0.007 uL, a diluted sample volume of about 1 uL, a reaction volume of about 3 uL, and a reaction time of about 10 minutes (min) (sample incubation and substrate incubation). Results for Protein 1 are shown in the ing table. The results of Test 2 for Protein 1 are shown in Figure 149.
Protein 2 has a sample dilution of about 667-fold, a sample volume of about 0.0015 uL, a d sample volume of about 1 uL, a on volume of about 3 uL, and a reaction time of about 10 min (sample incubation and substrate tion). Results for Protein 2 are shown in the ing table. The results of Test 1 for Protein 2 are shown in Figure 150.
C0nc(nghnD Test 1 'RMZ CMI 200000 322161 100000 232455 117056 117 E 50000 133290 192460 43286 52415 105 25000 89282 21908 --n 12500 49856 59574 12576 12041 101 “- 4000 15926 18350 4117 4059 103 101 1000 4547 4722 1140 1124 114 112 200 1238 1229 163 504 458 22 21 109 106 0 302 292 It should be understood from the foregoing that, while ular implementations have been illustrated and described, s modifications can be made thereto and are contemplated herein. It is also not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the preferable embodiments herein are not meant to be construed in a ng sense.
Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. Various modifications in form and detail of the embodiments of the invention will be apparent to a [Annotation] eaa person d in the art. It is therefore contemplated that the invention shall also cover any such modifications, variations and equivalents.
I

Claims (7)

/WE CLAIM:
1. A method of detecting the presence or concentration of an analyte in a sample fluid contained in a container comprising: (a) illuminating the container along a first region having a first path length to yield a first measurement of light intensity transmitted across the first path length; (b) moving the sample fluid to another region in the container having another path length if the first ement falls outside a predetermined dynamic range of transmitted light intensity; (c) illuminating the container along the another region to yield r ement of light intensity transmitted across the r path ; and optionally (d) repeating steps (b) and (c) until a measurement of light intensity falls within the predetermined dynamic range, thereby detecting the presence or concentration of the analyte.
2. The method of claim 1, further comprising deconvoluting a line scan of the image, thereby detecting the presence or concentration of an analyte.
3. The method of claim 1, wherein the sample is moved from a first region of the container having a first path length to a second region of the container having r path length by aspirating the sample.
4. The method of claim 3 wherein an end of the container is ed to a pipette which is configured to aspirate the sample.
5. The method of claim 3 wherein the sample is moved up or down the length of the container.
6. The method of claim 1, wherein the container is a pipette tip.
7. The method of claim 1, wherein the container is conically shaped. 9862739
NZ613457A 2011-01-21 2012-01-20 Systems and methods for sample use maximization NZ613457B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NZ706352A NZ706352B2 (en) 2011-01-21 2012-01-20 Systems and methods for sample use maximization

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201161435250P 2011-01-21 2011-01-21
US61/435,250 2011-01-21
PCT/US2012/022130 WO2012100235A2 (en) 2011-01-21 2012-01-20 Systems and methods for sample use maximization

Publications (2)

Publication Number Publication Date
NZ613457A NZ613457A (en) 2015-04-24
NZ613457B2 true NZ613457B2 (en) 2015-07-28

Family

ID=

Similar Documents

Publication Publication Date Title
US11644410B2 (en) Systems and methods for sample use maximization
AU2018204311A1 (en) Systems and methods for sample use maximization
NZ613457B2 (en) Systems and methods for sample use maximization
NZ706352B2 (en) Systems and methods for sample use maximization