NZ612375B2 - Promoters, expression cassettes, vectors, kits, and methods for the treatment of achromatopsia and other diseases - Google Patents

Abstract

Disclosed is an isolated promoter comprising 1.8 kb of the 5’-NTR of the CNGB3 gene. Also disclosed is an isolated promoter comprising 400 bp of the cytomegalovirus (CMV) enhancer and 1.4 kb of the 5’-NTR of the CNGB3 gene. Further disclosed is the use of vectors comprising the promoters in the manufacture of a medicament for treatment of achromatopsia. facture of a medicament for treatment of achromatopsia.

Description

WO 94560 PCT/U52012/020423 ERS, EXPRESSION CASSETTES, VECTORS, KITS, AND S FOR THE TREATMENT OF ACHROMATOPSIA AND OTHER ES Related Applications This application claims the benefit of the filing date of US. Provisional Application No. 61/430,710, filed on January 7, 2011, the entire contents of which are hereby incorporated herein by reference.

Background of the ion Achromatopsia is a color vision disorder, which is typically a congenital autosomal recessive disorder. It may be partial or complete. See Pang, J.-J . et a1. (2010). Achromatopsia as a Potential Candidate for Gene Therapy. In Advances in Experimental Medicine and Biology, Volume 664, Part 6, 639-646 (2010) (hereinafter Pang et a1). Symptoms of achromatopsia include reduced visual acuity, atopia (lack of color perception), hemeralopia (reduced visual capacity in bright light accompanied by photoaversion, meaning a dislike or avoidance of bright light), nystagmus (uncontrolled oscillatory movement of the eyes), iris operating abnormalities, and impaired stereovision (inability to perceive three-dimensional aspects of a scene).

Electroretinograms reveal that in atopsia, the function of retinal rod photoreceptors s intact, whereas retinal cone photoreceptors are not functional.

The rod and cone photoreceptors serve functionally different roles in vision. Pang et al.

Cone photoreceptors are primarily responsible for central, fine resolution and color vision while operating in low to very bright light. They are concentrated in the central macula of the retina and comprise nearly 100% of the fovea. Rod photoreceptors are sible for peripheral, low light, and night vision; they are found primarily outside the macula in the peripheral retina.

Approximately 1 in 30,000 individuals s from complete achromatopsia. In complete achromatopsia, there is total color vision loss, central vision loss, and visual acuity of 20/200 or worse. Thus, most individuals with achromatopsia are legally blind.

The current standard of care ts of limiting retinal light exposure with tinted contact lenses and providing magnification to boost central vision. However, there is no treatment available that corrects cone function in achromatopsia. Pang et al.

WO 94560 PCT/U52012/020423 There are various genetic causes of congenital atopsia. Mutations in the cyclic nucleotide-gated ion channel beta 3 (CNGB3, also known as ACHM3) gene, are one genetic cause of atopsia. Recent s in dogs suggest some promise for the use of recombinant associated virus (rAAV)-based gene therapy for the treatment of atopsia caused by mutations in the CNGB3 gene. Komaromy et 611., Gene therapy rescues cone function in congenital achromatopsia. Human Molecular Genetics, 19(13): 2581-2593 (2010) (hereinafter Komaromy et al.). In the canine studies, the rAAV vectors used packaged a human CNGB3 (hCNGB3) expression cassette that contained elements including a 2.1 kb cone red opsin promoter (PR2.1) and a human CNGB3 (hCNGB 3) cDNA. One limitation of the studies is that the hCNGB3 driven by the PR2.l promoter is expressed only in red and green cones, whereas endogenous hCNGB3 is expressed in all three types of cones (red, green and blue cones). Another limitation is that the overall size of the expression cassette utilized (5,230 bp) was well beyond the normal packaging capacity (<4.9 kb) of AAV particles; the over-stuffed rAAV particles dramatically impaired the rAAV packaging efficiency, resulting in low yields, a higher empty—to—full particle ratio, and likely a lower infectivity of the vector. sion cassettes ning a shorter version of the cone red opsin promoter, or a cone arrestin promoter, were much less effective in restoring visual on. The present ion addresses these limitations.

The present invention has the advantage of ing promoters that are capable of promoting hCNGB3 expression in all three types of cones. In addition, the promoters of the invention have the advantage that they are short enough to make the hCNGB3 expression cassette fit well within the normal packaging capacity of rAAV. A promoter that fits within the normal rAAV ing capacity provides benefits, such as improved yields, a lower empty-to-full particle ratio, and higher infectivity of the vector.

The present invention also provides expression cassettes, vectors and kits that utilize these improved ers, as well as methods for treating achromatopsia by administering the vectors.

The present invention addresses the need for an effective achromatopsia 110311110111.

PCT/U52012/020423 Summary of the Invention In one aspect, the t invention provides an isolated promoter comprising approximately 1.8 kb of the 5’-NTR of the CNGB3 gene. In an exemplary embodiment, the promoter comprises the sequence set forth as SEQ ID NO: 1 In another aspect, the invention provides an isolated promoter comprising approximately 1.6 kb of the 5’-NTR of the CNGB3 gene. In an ary embodiment, the promoter comprises the sequence set forth asSEQ ID N022 In another aspect, the invention provides an isolated promoter comprising approximately 400 bp of the cytomegalovirus (CMV) enhancer and approximately 1.4 kb of the 5’-NTR of the CNGB3 gene. In an exemplary ment, the promoter comprises a cytomegalovirus (CMV) enhancer set forth as SEQ ID NO: 3 and the 5’-NTR of the CNGB3 gene set forth as SEQ ID NO: 4.

In specific embodiments of the invention, the CNGB3 gene is the human CNGB3 gene.

In ic embodiments, the ers of the invention are capable of promoting CNGB3 expression in S-cone cells, M-cone cells, and L—cone cells.

In other specific embodiments, the promoter is capable of promoting CNGA3 sion in S-cone cells, M-cone cells, and L-cone cells.

In other specific embodiments, the promoter is capable of promoting GNAT2 expression in S—cone cells, M—cone cells, and L—cone cells.

In r aspect, the ion provides a transgene sion cassette comprising a promoter described herein; a nucleic acid selected from the group consisting of a CNGB3 nucleic acid, a CNGA3 nucleic acid, and a GNAT2 nucleic acid; and minimal regulatory elements.

In another aspect, the invention es a transgene expression cassette comprising a promoter described herein, a CNGB3 nucleic acid, and minimal regulatory elements.

In specific embodiments, the nucleic acid is a human nucleic acid.

WO 94560 PCT/U52012/020423 In another aspect, the invention provides nucleic acid vectors comprising a expression cassette bed herein. In one embodiment, the vector is an adeno- associated viral (AAV) vector. In exemplary embodiments, vectors comprise a serotype of the capsid ce and a serotype of the ITRs of said AAV vector independently selected from the group ting of AAVl, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAVIO, AAVl l, and AAVIZ. In r embodiment, the capsid sequence is a mutant capsid sequence.

In another aspect, the invention provides methods for treating a disease associated with a genetic on, substitution, or deletion that affects retinal cone cells, wherein the method ses administering to a subject in need of such treatment a vector that comprises a promoterdescribed herein, thereby treating the subject. In one ment, the disease is achromatopsia.

In another aspect, the invention provides methods for treating achromatopsia comprising administering a vector described herein to a subject in need of such treatment, thereby treating the subject. In one ment, the vector is administered subretinally.

In another aspect, the invention provides kits comprising a vector that comprises a promoter described herein and instructions for use thereof.

In another embodiment, the invention provides kits comprising a nucleic acid vector described herein, and instructions for use thereof.

In another aspect, the invention provides methods of making a recombinant adeno-associated viral (rAAV) vector comprising ing into an adeno-associated viral vector described herein and a nucleic acid selected from the group consisting of a CNGB3 nucleic acid, a CNGA3 nucleic acid, and a GNA'I‘Z nucleic acid. In one ment, the nucleic acid is a human nucleic acid.

In other embodiments, the serotype of the capsid sequence and the serotype of the ITRs of said AAV vector are independently ed from the group consisting of AAVl, AAVZ, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAVlO, AAVll, and AAVIZ. In a specific embodiment, the capsid sequence is a mutant capsid sequence.

PCT/U52012/020423 Brief Description of the Drawings Figure 1: Schematic drawing of the truncated human red/green opsin promoter.

Figure 2: Schematic drawing of the rAAVS-PR2.1-hCNGB3 vector.

Figure 3: Schematic drawings of four proviral plasmids that contain variants of the PR2.l promoter.The PR2.l promoter (a truncated human red/green opsin promoter) was truncated at its 5’—end by 300 bp, 500 bp, and 1,100 bp to create shorter promoters, designated PR1.7, PR1.5, and PR1.1, respectively. A CMV enhancer was added to the ’ end of the PR1.1 to create a hybrid promoter. The 500 bp core promoter (shown in gray) and the locus control region (shown in red) of PR2.1 were left intact in each of these constructs. Terminal repeats are ted by the , and the location of SV40 splicing signal ces is shown.

Figure 4: 5’-NTR sequences of different s were PCR ied from the hCNGB3 gene.

Figure 5 sets for the SEQ ID NOs: 1-4.

Figure 6 sets forth images of representative retinal sections. RPE: retinal pigment epithelium; PR: photo receptor. Green: stained for GFP protein sion; Red: stained for cones; Blue: stained for neuclei.

Detailed Description of the Invention: I. Overview and Definitions Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a l definition of many of the terms used in this invention: Singleton et a1, Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The dge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al.

PCT/U52012/020423 (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.

The articles “a” and “an” are used herein to refer to one or to more than one (Le. to at least one) of the grammatical object of the article. By way of e, “an t” means one element or more than one element.

The term ding” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”.

The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.

The term “such as” is used herein to mean, and is used interchangeably, with the phrase “such as but not limited to”.

A “subject” or “patient” to be treated by the method of the invention can mean either a human or non-human . A “nonhuman animal” includes any vertebrate or invertebrate organism.

“Achromatopsia” is a color vision disorder. Symptoms of achromatopsia include achromatopia (lack of color perception), amblyopia (reduced visual acuity), hemeralopia ed visual capacity in bright light accompanied by photoaversion, meaning a dislike or nce of bright light), nystagmus trolled oscillatory movement of the eyes), iris operating abnormalities, and impaired stereovision (inability to ve three-dimensional aspects of a scene). As used herein, the term “achromatopsia” refers to a form of achromatopsia caused by genetic mutations, tutions, or deletions.

“Treating”a disease (such as, for example, achromatopsia) means alleviating, preventing, or delaying the occurrence of at least one sign or symptom of the disease.

The asymmetric ends of DNA and RNA strands are called the 5’ (five prime) and 3’ (three prime) ends, with the 5' end having a terminal phosphate group and the 3' end a terminal hydroxyl group. The five prime (5’) end has the fifth carbon in the sugar-ring of the deoxyribose or ribose at its terminus. Nucleic acids are synthesized in vivo in the '- to 3'—direction, because the polymerase used to assemble new strands attaches each new nucleotide to the 3'—hydroxyl (-OH) group via a phosphodiester bond.

The term “5’-NTR” refers to a region of a gene that is not transcribed into RNA.

PCT/U52012/020423 This region is sometimes also known as the 5'—flanking region, which is generally before or upstream (i.e., toward the 5’ end of the DNA) of the transcription initiation site. The ’-NTR contains the gene er and may also n enhancers or other protein binding sites.

A “promoter” is a region of DNA that facilitates the transcription of a particular gene. As part of the process of transcription, the enzyme that synthesizes RNA, known as RNA polymerase, attaches to the DNA near a gene. Promoters n specific DNA sequences and response elements that provide an initial binding site for RNA polymerase and for transcription s that recruit RNA polymerase.

The retina contains three kinds of eceptors: rod cells, cone cells, and photoreceptive ganglion cells. Cone cells are of three types: S—cone cells, M—cone cells, and L-cone cells. S-cone cells respond most strongly to short wavelength light (peak near 420-440 nm) and are also known as blue cones. M-cone cells respond most strongly to medium wavelength light (peak near 5 nm) and are also known as green cones. L—cone cells respond most strongly to light of long ngths (peak near 564—580 nm) and are also known as red cones. The difference in the signals received from the three cone types allows the brain to ve all possible colors.

A “transgene expression cassette” or “expression cassette” comprises the gene ces that a nucleic acid vector is to deliver to target cells. These sequences include the gene of interest (e.g., a CNGB3 nucleic acid), one or more promoters, and minimal regulatory elements.

“Minimal regulatory elements” are regulatory elements that are necessary for effective expression of a gene in a target cell and thus should be included in a transgene expression cassette. Such sequences could include, for example, promoter or enhancer sequences, a polylinker ce facilitating the insertion of a DNA fragment within a plasmid vector, and sequences responsible for intron splicing and polyadenlyation of 111RNA transcripts. In a recent example of a gene y treatment for achromatopsia, the expression te included the minimal regulatory elements of a polyadenylation site, ng signal sequences, and AAV inverted terminal repeats. See, e.g., Komaromy et a].

A “nucleic acid” or “nucleic acid molecule” is a molecule composed of chains of monomeric nucleotides, such as, for example, DNA molecules (e.g., cDNA or genomic WO 94560 PCT/U52012/020423 DNA). A nucleic acid may encode, for example, a promoter, the CNGB3 gene or a portion thereof, or regulatory elements. A nucleic acid molecule can be single-stranded or -stranded. A “CNGB3 nucleic acid” refers to a nucleic acid that comprises the CNGB3 gene or a portion thereof, or a functional variant of the CNGB3 gene or a portion thereof. Similarly, a “CNGA3 nucleic acid” refers to a nucleic acid that comprises the CNGA3 gene or a portion thereof, or a functional variant of the CNGA3 gene or a portion thereof, and a “GNAT2 nucleic acid” refers to a nucleic acid that ses the GNAT2 gene or a portion thereof, or a functional t of the GNAT2 gene or a portion thereof. A onal variant of a gene includes a variant of the gene with minor variations such as, for example, silent mutations, single nucleotide polymorphisms, missense mutations, and other mutations or deletions that do not significantly alter gene function.

An "isolated" nucleic acid molecule (such as, for example, an isolated promoter) is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. For example, with regard to genomic DNA, the term ”isolated" includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated. Preferably, an ”isolated" nucleic acid molecule is free of sequences which naturally flank the nucleic acid molecule in the genomic DNA of the organism from which the c acid molecule is derived.

II. Methods 0fthe invention The present invention provides promoters, expression cassettes, vectors, kits, and methods that can be used in the treatment of c es that affect the cone cells of the retina. Genetic diseases that affect the cone cells of the retina include achromatopsia; Leber congenital amaurosis; od dystrophy; tis tosa, including X-linked retinitis pigmentosa; maculopathies; and age-related r degeneration. In preferred embodiments, the disease is achromatopsia.

Achromatopsia is a color vision disorder. Autosomal recessive mutations or other types of sequence alterations in three genes are the predominant cause of congenital achromatopsia. See Pang, J.-J. et al. (2010). Achromatopsia as a Potential Candidate for Gene Therapy. In Advances in Experimental Medicine and Biology, PCT/U52012/020423 Volume 664, Part 6, 639-646 (2010). Achromatopsia has been associated with mutations in either the alpha or beta subunits of cyclic nucleotide gated channels (CNGs), which are respectively known as CNGA3 and CNGB3. ons in the CNGA3 gene that were associated with achromatopsia are reported in Patel 194, et a].

Transmembrane 81 mutations in CNGA3 from achromatopsia 2 patients cause loss of function and impaired cellular trafficking of the cone CNG l. Invest. lmol.

Vis. Sci. 46 (7): 2282790. (2005)., Johnson S, et a1. Aehromatopsia caused by novel mutations in both CNGA3 and CNGB3. J. Med. Genet. 41 (2): e20. (2004)., Wissinger B, et a1. CNGA3 mutations in tary cone photoreceptor disorders. Am. J. Hum.

Genet. 69 (4): 722—37.(2001)., and Kohl S, et a]. Total colourblindness is caused by mutations in the gene encoding the alpha-subunit of the cone photoreceptor cGMP-gated cation channel. Nat. Genet. 19 (3): 257—9. (1998). Mutations in CNGB3 gene that were associated with achromatopsia are reported in Johnson S, et a]. Achromatopsia caused by novel mutations in both CNGA3 and CNGB3. J. Med. Genet. 41 (2): 620. (2004)., Peng C, et a]. Achromatopsia-associated mutation in the human cone photoreceptor cyclic nucleotide—gated channel CNGB3 subunit alters the ligand sensitivity and pore properties of heteromeric channels. J. Biol. Chem. 278 (36): 40 (2003)., Bright SR, et al. e-associated mutations in CNGB3 produce gain of function alterations in cone cyclic nucleotide-gated ls. Mal. Vis. 11: 1141—50 (2005)., Kohl S, et a1.

CNGB3 mutations t for 50% of all cases with autosomal recessive achromatopsia. Eur. J. Hum. Genet. 13 (3): 302—8 (2005)., Rojas CV, et (ILA frameshift ion in the cone cyclic nucleotide gated cation channel causes complete achromatopsia in a consanguineous family from a rural isolate. Eur. J. Hum. Genet. 10 (10): 638742 (2002)., Kohl S, et a1. Mutations in the CNGB3 gene encoding the beta— subunit of the cone photoreceptor cGMP—gated channel are responsible for atopsia (ACHM3) linked to some 8q21. Hum. M01. Genet. 9 (14): 2107— 16 (2000)., Sundin OH, et (11.. Genetic basis of total colourblindness among the Pingelapese islanders. Nat. Genet. 25 (3): 289—93 (2000). Sequence alterations in the gene for cone cell transducin, known as GNAT2, can also cause achromatopsia. See Kohl S, et al., Mutations in the cone photoreceptor G-protein alpha-subunit gene GNAT2 in patients with achromatopsia. Kokl S, et al. Mutations in the cone photoreceptor G-protein alpha-subunit gene GNAT2 in patients with achromatopsia. Am J Hum Genet 71 (2): 422—425 (2002) (hereinafter Kohl et al.). The severity of mutations PCT/U52012/020423 in these proteins correlates with the severity of the achromatopsia phenotype. /en.wikipedia.org/wiki/Achromatopsia. ons in CNGB3 account for about 50% of cases of achromatopsia. Kohl et al. Mutations in CNGA3 account for about 23% of cases, and mutations in GNAT2 account for about 2% of cases.

The “CNGB3 gene” is the gene that encodes the cyclic nucleotide-gated channel beta 3 ). The “CNGA3 gene” is the gene that encodes the cyclic nucleotide- gated channel alpha 3 (CNGA3). The CNGB3 and CNGA3 genes are expressed in cone cells of the retina. Native retinal cyclic nucleotide gated channels (CNGs) are critically involoved in ransduction. CNGs are cation channels that consist of two alpha and two beta subunits. In the dark, cones have a relatively high concentration of cyclic guanosine 3'—5' monophosphate (cGMP), which causes the CNGs to open, resulting in depolarization and uous glutamate release. Light exposure activates a signal transduction pathway that breaks down cGMP. The reduction in cGMP concentrarion causes the CNGs to close, preventing the influx of positive ions, hyperpolarizing the cell, and stopping the release of glutamate. Mutations in either the CNGB3 or CNGA3 genes can cause defects in cone photoreceptor function resulting in achromatopsia.

Mutations in the CNGB3 gene have been ated with other es in addition to atopsia, including progressive cone dystrophy and juvenile r degeneration.

The GNAT2 gene encodes the alpha-2 subunit of guanine nucleotide binding protein, which is also known as the cone-specific alpha transducin. Guanine nucleotide- binding proteins (G proteins) consist of alpha, beta, and gamma subunits. In photoreceptors, G proteins are critical in the amplification and transduction of visual signals. Various types of sequence alterations in GNAT2 can cause human achromatopsia: nonsense mutations, small deletion and/or insertion mutations, frameshift mutations, and large intragenic deletions. Pang et al.

Cun‘ently, there is no ive treatment for achromatopsia. Animal studies suggest that it is possible to use gene therapy to treat achromatopsia and other diseases of the retina. For recessive gene defects, the goal is to deliver a wild—type copy of a defective gene to the affected retinal cell type. The ability to deliver genes to some subsets of cone cells was demonstrated, for example, in Mauck, M. C. et al., Longitudinal tion of sion of y delivered transgenes in gerbil cone 2012/020423 photoreceptors. Visual Neuroscience 25(3): 273-282 (2008). The authors showed that a recombinant AAV vector could be used to achieve long-term expression of a reporter gene encoding green fluorescent n in specific types of gerbil cone cells. The s further demonstrated that a human long-wavelength opsin gene could be delivered to specific gerbil cones, resulting in cone responses to long-wavelength light.

Other studies trated that gene therapy with recombinant AAV s could be used to convert dichromat monkeys into tri ts by introducing a human I.- opsin gene into the squirrel monkey retina. Mancuso, K., et al. Gene therapy for red- green colour blindness in adult primates. Nature 461: 784-787 (2009).

Electroretinograms verified that the introduced photopigment was functional, and the monkeys showed improved color vision in a behavioral test.

There are l animal models of achromatopsia for which gene therapy experiments have demonstrated the ability to restore cone on. Sec Pang et al.

First, the Gnat2cPfl3 mouse has a recessive mutation in the cone—specific alpha transducin gene, resulting in poor visual acuity and little or no cone—specific ERT response.

Treatment of homozygous GnatZCpflj mice with a single subretinal injection of an AAV pe 5 vector cairying wild type mouse GNAT2 cDNA and a human red cone opsin promoter restored cone-specific ERG ses and visual acuity. Alexander et al.

Restoration of cone vision in a mouse model of achromatopsia. Nat Med 13:685-687 (2007) (hereinafter Alexander et al.). Second, the cpfl5 (Cone Photoreceptor Function Loss 5) mouse has an autosomal recessive missense mutation in the CNGA3 gene with no cone-specific ERG response. Treatment of cpfl5 mice with subretinal ion of an AAV vector carrying the wild type mouse CNGA3 gene and a human blue cone promoter (HB570) resulted in restoration of cone-specific ERG responses. Pang et a1.

Third, there is an Alaskan Malmute dog that has a naturally occurring CNGB3 mutation causing loss of daytime vision and absence of retinal cone function. In this type of dog, subretinal injection of an AAVS vector containing human CNGB3 cDNA and a human red cone opsin promoter restored pecific ERG responses. See, e.g., Komaromy et The prior methods for treatment of achromatopsia using gene therapy were limited by the fact that the promoters used caused expression of transgenes only in certain types of cone cell photoreceptors. The promoters of the present invention can PCT/U52012/020423 drive gene expression in all three types of cone cells that are present in humans (S-cone cells, M-cone cells, and L-cone .

Another limitation of the studies performed by Komaromy et a]. was that the overall size of the sion cassette utilized (5,230 bp) was well beyond the normal packaging capacity (<4.9 kb) of AAV les; the over-stuffed rAAV particles ically ed the rAAV packaging efficiency, resulting in low yields, a higher empty-to-full particle ratio, and likely a lower infectivity of the . sion cassettes containing a shorter version of the cone red opsin promoter, or a cone arrestin promoter, were much less effective in restoring visual function. The promoters of the t ion have the advantage that due to their shortened length, they make the hCNGB3 expression cassette efficiently e in an AAV particle. A promoter that fits within the normal rAAV packaging capacity provides benefits, such as improved yields, a lower empty-to-full particle ratio, higher infectivity of the vector, and ultimately, higher efficacy for treatment of the desired condition.

III. ers, Expression Cassettes, Nucleic Acids, and Vectors of the Invention The promoters, CNGB3 nucleic acids, regulatory elements, and expression cassettes, and vectors of the invention may be ed using methods known in the art.

The methods described below are provided as non-limiting examples of such methods.

Promoters The present invention provides ed promoters. In some aspects, these promoters include a segment of the 5’-NTR of the CNGB3 gene. In related aspects, these promoters include a segment of the 5’—NTR of the CNGB3 gene together with one or more enhancer sequences derived from other genes.

In one embodiment, the promoter is an isolated promoter that comprises approximately 1.8 kb of the 5’—NTR of the CNGB3 gene. In a specific embodimentt, the promoter has the sequence SEQ ID NO: 1.

In another embodiment, the promoter is an isolated promoter that comprises approximately 1.6 kb of the 5’-NTR of the CNGB3 gene. In a specific embodiment, the promoter has the sequence SEQ ID NO: 2.

In another embodiment, the invention provides an isolated promoter that PCT/U52012/020423 comprises (a) an enhancer sequence d from a gene other than CNGB3 and (b) approximately 1.4 kb of the 5’-NTR of the CNGB3 gene.

In one embodiment, the promoter is an isolated promoter comprising (a) approximately 400 bp of the cytomegalovirus (CMV) enhancer and (b) approximately 1.4 kb of the 5’-NTR of the CNGB3 gene. The cytomegalovirus (CMV) enhancer is an immediate early promoter derived from the cytomegalovirus. It serves to augment ene sion. In one such embodiment, the promoter comprises the following sequences: (a) [SEQ ID NO: 3] and (b) [SEQ ID NO: 4].

In another embodiment, the promoter is an isolated promoter comprising (a) a promoter sequence selected from the group consisting of a CBA promoter, a Rous sacrcoma virus-RSV promoter, the proximal mouse opsin promoter (mOP), the human ein-coupled receptor protein kinase 1 promoter (hGRKl); and (b) approximately 1.4 kb of the 5’-NTR of the CNGB3 gene. The CBA promoter is a fusion of the chicken—actin promoter and CMV immediate—early enhancer, and it allows stable GFP reporter expression in photoreceptor cells after inal injections. Dinculescu, A et al., Adeno-associated virus-vector gene therapy for l disease. Human Gene Therapy 2005; -663. The RSV promoter has been also been sfully employed to promote in vivo transgene expression in the retina. Lei B et al. Molecular Vision 15: 382 (2009).

In other embodiments, the promoters of the invention that comprise segments of the CNGB3 gene, the CNGB3 gene is a human CNGB3 (hCNGB3) gene. In other ments, the CNGB3 gene is a CNGB3 gene from a non-human animal.

In some embodiments of the promoters of the invention, the promoter is capable of promoting expression of a transgene in S—cone, M—cone, and L—cone cells. A “transgene” refers to a segment of DNA containing a gene sequence that has been isolated from one organism and is uced into a different organism. For example, to treat an individual who has achromatopsia caused by a mutation of the human CNGB3 gene, a wild-type (i.e., non-mutated, or onal variant) human CNGB3 gene may be administered using an riate vector. The wild-type gene is referred to as a “transgene.” In preferred embodiments, the transgene is a wild-type version of a gene that encodes a protein that is normally expressed in cone cells of the retina. In one such embodiment, the transgene is derived from a human gene. In a first specific PCT/U52012/020423 embodiment, the promoter is capable of promoting expression of a CNGB3 nucleic acid in S-cone, M-cone, and L-cone cells. In a second specific ment, the promoter is capable of promoting expression of a CNGA3 nucleic acid in S-cone, M-cone, and L- eone cells. In a third specific ment, the promoter is capable of promoting sion of a GNAT2 nucleic acid in S-cone, M-cone, and L-cone cells. In these three specific embodiments, the CNGB3, CNGA3, or GNAT2 is preferably human CNGB3, CNGA3, or GNATZ.

In another aspect, the present invention es promoters that are shortened ns of the PR2.1 promoter (see e.g., e 1), which may optionally include onal enhancer sequences. Such promoters have the advantage that they fit better within the packaging capacity of AAV vectors and therefore provide advantages such as, for example, improved yields, a lower empty-to-full particle ratio, and higher infectivity of the vector. In some embodiments, these promoters are created by truncating the 5’— end of PR2.1 while leaving the 500bp core promoter and the 600bp locus control region (LCR) intact. In some such embodiments, the lengths of the tions are selected from the group consisting of approximately 300bp, 500bp, and 1,100 bp (see, e.g., PR1.7, PR1.5, and PR1.1, respectively, as described in Example 1). In one particular embodiment, the present ion provides a shortened promoter that includes a CMV enhancer that is added to the 5’-end of PR1 .1. In other embodiments of the present invention, the invention provides promoters that include other types of enhancer sequences, as described supra, that are added to shortened versions of the PR2.1 promoter.

Expression Cassettes In another aspect, the present invention provides a transgene expression cassette that includes (a) a promoter of the invention; (b) a nucleic acid selected from the group consisting of a CNGB3 nucleic acid, a CNGA3 nucleic acid, and a GNATZ c acid; and (c) minimal regulatory elements. A er of the invention includes the promoters discussed supra.

A “CNGB3 nucleic acid” refers to a nucleic acid that comprises the CNGB3 gene or a portion thereof, or a functional variant of the CNGB3 gene or a portion thereof. Similarly, a “CNGA3 c acid” refers to a nucleic acid that comprises the CNGA3 gene or a portion thereof, or a functional variant of the CNGA3 gene or a PCT/U52012/020423 portion thereof, and a “GNAT2 nucleic acid” refers to a nucleic acid that comprises the GNAT2 gene or a n thereof, or a functional variant of the GNAT2 gene or a portion thereof. A functional variant of a gene includes a variant of the gene with minor variations such as, for example, silent mutations, single tide polymorphisms, missense mutations, and other ons or deletions that do not significantly alter gene function.

In certain embodiments, the nucleic acid is a human nucleic acid (i.e., a nucleic acid that is derived from a human CNGB3, CNGA3, or GNAT2 gene). In other embodiments, the nucleic acid is a non-human nucleic acid (i.e., a nucleic acid that is derived from a non-human CNGB3, CNGA3, or GNAT2 gene).

“Minimal regulatory elements” are tory ts that are necessary for effective expression of a gene in a target cell. Such regulatory elements could include, for example, promoter or enhancer sequences, a polylinker ce facilitating the insertion of a DNA fragment within a plasmid vector, and sequences responsible for intron splicing and enlyation of mRNA transcripts. In a recent example of a gene therapy ent for achromatopsia, the expression cassette included the minimal regulatory elements of a polyadenylation site, splicing signal sequences, and AAV inverted terminal repeats. See, e. g., Komaromy et al.. The expression cassettes of the invention may also optionally include additional regulatory elements that are not necessary for effective oration of a gene into a target cell.

The present invention also provides vectors that include any one of the expression cassettes discussed in the preceding section. In some embodiments, the vector is an oligonucleotide that comprises the sequences of the sion cassette. In specific embodiments, delivery of the oligonucleotide may be accomplished by in vivo electroporation (see, e. g., Chalberg, TW, et al. phiC3l integrase s genomic ation and long—term transgene expression in rat retina. Investigative Ophthalmology &Visual Science, 46, 2140—2146 (2005) (hereinafter Chalberg et al., 2005)) or electron avalanche transfection (see, e.g., Chalberg, TW, et al. Gene er to rabbit retina with electron avalanche transfection. Investigative Ophthalmology l Science, 47, 4083—4090 (2006) (hereinafter Chalberg et al, 2006)). In further embodiments, the vector is a mpacting peptide (see, e. g., Farjo, R, et al.

PCT/U52012/020423 Efficient ral ocular gene transfer with compacted DNA nanoparticles. PLoS ONE, 1, e38 (2006) (hereinafter Farjo et al., 2006), where CK30, a peptide ning a cystein e coupled to polyethylene glycol followed by 30 lysines, was used for gene transfer to photoreceptors), a peptide with cell penetrating properties (see Johnson, LN, et al., enetrating peptide for enhanced delivery of nucleic acids and drugs to ocular tissues including retina and cornea. Molecular Therapy, 16(1), 107—1 14 (2007) (hereinafter n et al., 2007), Barnett, EM, et al. Selective cell uptake of modified Tat peptide—fluorophore conjugates in rat retina in ex vivo and in vivo models.

Investigative lmology & Visual Science, 47, 2589—2595 (2006) (hereinafter t et al., 2006), Cashman, SM, et al. Evidence of protein transduction but not ellular transport by proteins fused to HIV Latin retinal cell culture and in vivo.

Molecular Therapy, 8, 130—142 (2003) (hereinafter Cashman et al., 2003), Schorderet, DF, et al. D-TAT transporter as an ocular peptide delivery system. Clinical and Experimental Ophthalmology, 33, 628—635 (2005)(hereinafter Schorderet et al., 2005), Kretz, A, et al.. HSV-l VP22 augments adcnoviral gene transfer to CNS neurons in the retina and striatum in vivo. Molecular Therapy, 7, 6597669 (2003)(hereinafter Kretz et al. 2003) for examples of e delivery to ocular cells), or a DNA-encapsulating lipoplex, polyplex, liposome, or immunoliposome (see e. g., Zhang, Y, et al. Organ- specific gene expression in the rhesus monkey eye following intravenous nonviral gene transfer. Molecular Vision, 9, 465—472 (2003) (hereinafter Zhang el al. 2003), Zhu, C, el al. Widespread expression of an exogenous gene in the eye after enous administration. Investigative lmology & Visual e, 43, 3075—3080 (2002) (hereinafter Zhu et al. 2002), Zhu, C., et al. Organ-specific expression of the lacZ gene controlled by the opsin promoter after intravenous gene administration in adult mice.

Journal of Gene Medicine, 6, 9067912. (2004) (hereinafter Zhu et al. 2004)).

In preferred embodiments, the vector is a viral vector, such as a vector derived from an adeno-associated virus, an adenovirus, a retrovirus, a lentivirus, a vaccinia/poxvirus, or a herpesvirus (e. g., herpes x virus . See e. g., Howarth. In the most preferred embodiments, the vector is an adeno—associated viral (AAV) vector.

Multiple serotypes of adeno-associated virus (AAV), including 12 human serotypes (AAVl, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, —16— PCT/U52012/020423 AAV10, AAV11, and AAV12) and more than 100 serotypes from nonhuman primates have now been identified. Howarth JL et al., Using viral vectors as gene transfer tools.

Cell Biol Toxicol 26: 1-10 (2010) nafter Howarth et al.). In embodiments of the present invention n the vector is an AAV vector, the serotype of the inverted terminal repeats (ITRs) of the AAV vector may be selected from any known human or nonhuman AAV serotype. In preferred embodiments, the serotype of the AAV ITRs of the AAV vector is selected from the group consisting of AAVl, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAVS, AAV9, AAV10, AAV11, and AAV12. Moreover, in embodiments of the present invention wherein the vector is an AAV vector, the serotype of the capsid sequence of the AAV vector may be selected from any known human or animal AAV serotype. In some embodiments, the serotype of the capsid sequence of the AAV vector is selected from the group consisting of AAVl, AAV2, AAVS, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAVlO, AAV11, and AAV12. In preferred embodiments, the pe of the capsid sequence is AAVS. In some embodiments wherein the vector is an AAV vector, a pseudotyping approach is employed, wherein the genome of one ITR serotype is packaged into a different serotype capsid. See e.g., Zolutuhkin S. et al. Production and cation of serotype 1,2, and 5 recombinant adeno-associated viral vectors. Methods 28(2): 158-67 (2002). In preferred embodiments, the serotype of the AAV ITRs of the AAV vector and the serotype of the capsid sequence of the AAV vector are ndently selected from the group consisting of AAVl, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.

In some embodiments of the t invention wherein the vector is a rAAV vector, a mutant capsid sequence is employed. Mutant capsid sequences, as well as other techniques such as rational mutagenesis, engineering of ing peptides, generation of ic particles, library and directed evolution approaches, and immune evasion modifications, may be employed in the t invention to optimize AAV vectors, for purposes such as achieving immune evasion and enhanced eutic output. See e. g., Mitchell A.M. et al. AAV’s anatomy: Roadmap for optimizing vectors for translational success. Curr Gene Ther. 10(5): 319-340.

Making the nucleic acids of the invention A nucleic acid molecule (including, for example, a promoter, CNGB3 nucleic PCT/U52012/020423 acid, CNGA3 nucleic acid, a GNAT2 nucleic acid, or a regulatory element) of the present invention can be isolated using standard molecular biology techniques. Using all or a portion of a nucleic acid sequence of interest as a hybridization probe, nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as bed in Sambrook, J E. F., and Maniatis, T. Molecular Cloning. A ., Fritsh, Laboratory . 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).

A nucleic acid le for use in the methods of the invention can also be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of a nucleic acid molecule of interest. A nucleic acid molecule used in the methods of the ion can be amplified using cDNA, mRNA or, alternatively, genomic DNA as a te and appropriate oligonucleotide primers according to standard PCR amplification techniques.

Furthermore, oligonucleotides corresponding to nucleotide sequences of st can also be chemically synthesized using standard techniques. Numerous methods of chemically sizing polydeoxynucleotides are known, including solid-phase synthesis which has been automated in commercially available DNA synthesizers (See c.g., Itakura ct al. US. Patent No. 4,598,049; crs ct al. US. Patent No. 4,458,066; and Itakura US. Patent Nos. 4,401,796 and 4,373,071, incorporated by reference herein). Automated methods for designing synthetic oligonucleotides are available. See e. g., Hoover, D.M. & Lubowski, J. Nucleic Acids Research, 30(10): e43 (2002).

Many embodiments of the invention involve a CNGB3 nucleic acid, a CNGA3 nucleic acid, or a GNAT2 nucleic acid. Some aspects and ments of the invention involve other nucleic acids, such as isolated ers or regulatory elements. A nucleic acid may be, for example, a cDNA or a chemically synthesized nucleic acid. A cDNA can be obtained, for example, by ication using the polymerase chain reaction (PCR) or by screening an appropriate cDNA y. Aternatively, a nucleic acid may be chemically synthesized. —18— PCT/U52012/020423 IV. Methods and Kits ofthe Invention Methods of Treatment The invention provides methods for treating a disease associated with a genetic mutation, substitution, or deletion that affects retinal cone cells, n the methods comprise administering to a t in need of such treatment a vector that es one of the promoters of the invention, thereby treating the t. In one embodiment, the disease affects the retinal pigment epithelium (PRE). In a specific embodiment, the e is achromatopsia. Other diseases associated with a genetic mutation, substitution, or on that affects retinal cone cells include achromatopsia, Leber congenital amaurosis, cone-rod dystrophy, maculopathies, age-related macular degeneration and tis pigmentosa, including X-linked retinitis pigmentosa.

The invention further provides methods for treating achromatopsia comprising administering any of the vectors of the invention to a subject in need of such treatment, thereby treating the subject.

A “subject” to be d by the methods of the invention can mean either a human or non-human animal. A “nonhuman animal” includes any vertebrate or ebrate organism. In some embodiments, the nonhuman animal is an animal model of retinal disease, or of achromatopsia in particular. See e.g., Pang et al., Alexander et al., Komaromy et al. s large animal models are available for the study of AAV- mediated ased therapies in the retina. Stieger K. et al. AAV-mediated gene y for retinal disorders inlarge animal models. ILAR J. 50(2): 206-224 (2009).

The promoters of the ion are described supra. “Treating”a disease (such as, for example, achromatopsia) means alleviating, preventing, or delaying the occurrence of at least one sign or symptom of the disease. A “sign” of a e is a station of the disease that can be observed by others or measured by objective methods, such as, e. g., electroretinography or behavioral testing. A “symptom” of a disease is a characteristic of the disease that is subjectively perceived by the subject.

In either of these two methods of treatment, the vector can be any type of vector known in the art. In some embodiments, the vector is a non-viral vector, such as a naked DNA plasmid, an oligonucleotide (such as, e. g., an antisense oligonucleotide, a small molecule RNA (siRNA), a double stranded oligodeoxynucleotide, or a single stranded _19_ PCT/U52012/020423 DNA oligonucleotide). In specific embodiments involving oligonucleotide vectors, delivery may be lished by in vivo electroporation (see e.g., Chalberg et (11., 2005) or electron avalanche transfection (see e.g., Chalberg et al. 2006). In further embodiments, the vector is a dendrimer/DNA complex that may optionally be encapsulated in a water soluble polymer, a DNA-compacting peptide (see e.g., Farjo et al. 2006, where CK30, a peptide containing a cystein residue coupled to poly ethylene glycol followed by 30 lysines, was used for gene transfer to photoreceptors), a peptide with cell ating properties (see Johnson et al. 2007; Barnett et (11., 2006; Cashman er al., 2003; Schorderet er al., 2005; Kretz et al. 2003 for examples of peptide delivery to ocular cells), or a DNA-encapsulating lipoplex, polyplex, liposome, or immunoliposome (see e.g., Zhang et a]. 2003; Zhu et a]. 2002; Zhu et a]. 2004). In many additional embodiments, the vector is a viral vector, such as a vector derived from an adeno- associated virus, an adenoviius, a retrovirus, a lentivirus, a vaccinia/poxviius, or a herpesvirus (e.g., herpes simplex virus (HSVD. See e.g., Howarth. In preferred ments, the vector is an adeno-associatcd viral (AAV) vector.

In the methods of treatment of the present invention, administering of a vector can be accomplished by any means known in the art. In preferred ments, the stration is by subretinal ion. In n embodiments, the inal injection is delivered preferentially to one or more regions where cone density is ularly high (such as e.g., the tapetal zone superior to the optic disc). In other embodiments, the administration is by intraocular injection, intravitreal injection, or intravenous injection. Administration of a vector to the retina may be unilateral or ral and may be accomplished with or without the use of general anesthesia.

In the methods of treatment of the present invention, the volume of vector delivered may be ined based on the characteristics of the subject receiving the treatment, such as the age of the subject and the volume of the area to which the vector is to be delivered. It is known that eye size and the volume of the subretinal space differ among individuals and may change with the age of the subject. In ments n the vector is administered subretinally, vector volumes may be chosen with the aim of covering all or a certain percentage of the subretinal space, or so that a particular number of vector genomes is delivered.

PCT/U52012/020423 In the methods of treatment of the present ion, the concentration of vector that is administered may differ depending on production method and may be chosen or optimized based on concentrations ined to be therapeutically effective for the particular route of administration. In some embodiments, the concentration in vector s per milliliter (vg/ml) is selected from the group consisting of about 108 vg/ml, about 109 vg/ml, about 1010 vg/ml, about 10“ vg/ml, about 1012 vg/ml, about 1013 vg/ml, and about 1014 . In preferred embodiments, the concentration is in the range of 1010 vg/ml — 1013 vg/ml delivered by inal injection or intravitreal injection in a volume of about 0.1 mL, about 0.2 mL, about 0.4 mL, about 0.6 mL, about 0.8 mL, and about 1.0 mL Kits The present invention also provides kits. In one aspect, a kit of the invention comprises a vector that comprises (a) any one of the promoters of the ion and (b) instructions for use thereof. In another aspect, a kit of the invention comprises (a) any one of the vectors of the invention, and (b) instructions for use thereof. The promoters and vectors of the invention are described supra. In some ments, a vector of the ion may be any type of vector known in the art, including a non—viral or viral vector, as described supra. In preferred embodiments, the vector is a viral vector, such as a vector derived from an adeno-associated virus, an adenovirus, a retrovirus, a lentiVirus, a vaccinia/poxvirus, or a herpesvirus (e. g., herpes simplex virus . In the most preferred embodiments, the vector is an adeno-associated Viral (AAV) vector.

The instructions provided With the kit may describe how the promoter can be incorporated into a vector or how the vector can be administered for therapeutic purposes, e.g., for treating a disease associated With a genetic mutation, substitution, or on that affects retinal cone cells. In some embodiments wherein the kit is to be used for therapeutic purposes, the instructions include details regarding recommended dosages and routes of administration.

PCT/U52012/020423 Methods of making recombinant adeno-associated viral vectors {AAV vectors) The present invention also provides methods of making a recombinant adeno— associated viral (rAAV) vector comprising inserting into an adeno-associated viral vector any one of the promoters of the invention (described supra) and a nucleic acid selected from the group consisting of a CNGB3 nucleic acid, a CNGA3 nucleic acid, and a GNAT2 nucleic acid (also bed supra). In some embodiments, the nucleic acid is a human nucleic acid, i.e., a nucleic acid derived from a human CNGBS, CNGA or GNAT gene, or a functional variant thereof. In alternative embodiments, the c acid is a nucleic acid derived from a non-human gene.

In the methods of making an rAAV vector that are provided by the invention, the serotype of the capsid sequence and the serotype of the ITRs of said AAV vector are ndently selected from the group consisting of AAVl, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAV 10, AAVl 1, and AAV 12. Thus, the invention encompasses vectors that use a typing approach, wherein the genomne of one ITR pe is packaged into a ent serotype . See e.g., Daya S. and Berns, K.I., Gene therapy using adeno-associated virus vectors. Clinical Microbiology Reviews, 21(4): 583-593 (2008) (hereinafter Daya et al.). Furthermore, in some embodiments, the capsid sequence is a mutant capsid sequence.

AAV s AAV vectors are derived from adeno-associated virus, which has its name because it was originally described as a contaminant of adenovirus preparations. AAV vectors offer numerous well-known advantages over other types of vectors: wildtype s infect humans and nonhuman primates without evidence of e or adverse effects; the AAV capsid displays very low immunogenicity combined with high chemical and al stability which s rigorous methods of virus purification and concentration; AAV vector transduction leads to sustained transgene expression in post- mitotic, nondividing cells and provides long—term gain of function; and the variety of AAV subtypes and variants offers the possibility to target selected tissues and cell types.

Heilbronn R & Weger S, Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics, in M. Schafer-Korting (ed.), Drug Delivery, Handbook of Experimental Pharmacology, 197: 143-170 (2010) (hereinafter Heilbronn). A major limitation of AAV vectors is that the AAV offers only a limited transgene capacity (<4.9 kb) for a _22_ PCT/U52012/020423 conventional vector containing -stranded DNA.

AAV is a nonenveloped, small, single-stranded DNA-containing virus encapsidated by an icosahedral, 20nm diameter capsid. The human serotype AAV2 was used in a majority of early s of AAV. Heilbronn. It contains a 4.7 kb linear, single—stranded DNA genome with two open reading frames rep and cap (“rep” for replication and “cap” for capsid). Rep codes for four overlapping nonstructural proteins: Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep69 are required for most steps of the AAV life cycle, including the initiation of AAV DNA replication at the hairpin- structured inverted al repeats (ITRs), which is an essential step for AAV vector production. The cap gene codes for three capsid proteins, VP], VP2, and VP3. Rep and cap are flanked by 145 bp ITRs. The ITRs contain the origins of DNA replication and the packaging s, and they serve to mediate chromosomal integration. The ITRs are generally the only AAV elements maintained in AAV vector construction.

To achieve replication, AAVs must be cted into the target cell with a helper virus. Grieger JC & Samulski RJ, associated virus as a gene therapy vector: Vector development, production, and clinical applications. Adv Biochem Engin/Biotechnol 992119-145 (2005). Typically, helper Viruses are either adenovirus (Ad) or herpes x virus (HSV). In the e of a helper virus, AAV can establish a latent infection by integrating into a site on human chromosome 19. Ad or HSV infection of cells latently infected with AAV will rescue the integrated genome and begin a productive infection. The four Ad proteins required for helper function are ElA, ElB, E4, and E2A. In addition, synthesis of Ad virus-associated (VA) RNAs is required. Herpesviruses can also serve as helper viruses for productive AAV replication. Genes encoding the helicase-primase complex (UL5, ULS, and UL52) and the DNA-binding n (U129) have been found ient to mediate the HSV helper effect. In some embodiments of the present invention that employ rAAV vectors, the helper virus is an adenovirus. In other embodiments that employ rAAV vectors, the helper virus is HSV.

Making recombinant AAV (rAAV) s The production, purification, and characterization of the rAAV vectors of the t invention may be carried out using any of the many methods known in the art.

For reviews of laboratory—scale production methods, see, e.g., Clark RK, Recent PCT/U52012/020423 advances in recombinant adeno-associated virus vector production. Kidney Int. 61s19-15 (2002); Choi VW et al., Production of recombinant adeno-associated viral vectors for in Vitro and in Vivo use. Current Protocols in Molecular y 16251-162524 (2007) nafter Choi et al.); Grieger JC & Samulski RJ, Adeno-associated Virus as a gene therapy vector: Vector development, production, and clinical applications. Adv Biochem Engin/Biotechnol 99: 1 19-145 (2005) (hereinafter r & Samulski); Heilbronn R & Weger S, Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics, in M.

Schafer—Korting (ed), Drug Delivery, Handbook of Experimental Pharmacology, 197: 0 (2010) (hereinafter Heilbronn); Howarth JL et al., Using Viral vectors as gene er tools. Cell Biol Toxicol 26:1-10 (2010) (hereinafter Howarth). The production s described below are intended as non-limiting examples.

AAV vector production may be accomplished by cotransfection of packaging ds. onn. The cell line supplies the deleted AAV genes rep and cap and the required helpervirus functions. The adenovirus helper genes, VA—RNA, E2A and E4 are transfected together with the AAV rep and cap genes, either on two separate plasmids or on a single helper construct. A recombinant AAV vector plasmid wherein the AAV capsid genes are ed with a transgene expression cassette (comprising the gene of interest, e.g., a CNGB3 nucleic acid; a promoter; and minimal regulatory elements) bracketed by ITRs, is also ected. These packaging plasmids are typically ected into 293 cells, a human cell line that constitutively expresses the remaining required Ad helper genes, ElA and ElB. This leads to amplification and packaging of the AAV vector carrying the gene of interest.

Multiple serotypes of AAV, including 12 human serotypes and more than 100 serotypes from nonhuman primates have now been identified. Howarth et al. The AAV vectors of the present invention may comprise capsid sequences d from AAVs of any known serotype. As used herein, a “known serotype” encompasses capsid mutants that can be produced using methods known in the art. Such s, include, for example, genetic manipulation of the Viral capsid sequence, domain swapping of d surfaces of the capsid regions of different serotypes, and generation of AAV chimeras using techniques such as marker rescue. See Bowles et al. Marker rescue of adeno-associated Virus (AAV) capsid mutants: A novel approach for chimeric AAV production. Journal of Virology, 77(1): 423-432 (2003), as well as references cited PCT/U52012/020423 therein. Moreover, the AAV s of the present invention may comprise ITRs derived from AAVs of any known serotype. Preferentially, the ITRs are derived from one of the human serotypes AAVl-AAV12. In some embodiments of the present invention, a pseudotyping approach is employed, wherein the genome of one ITR serotype is packaged into a ent serotype capsid.

Preferentially, the capsid sequences employed in the present invention are derived from one of the human serotypes AAVl—AAV12. Recombinant AAV vectors containing an AAVS serotype capsid sequence have been demonstrated to target retinal cells in vivo. See, for example, Komaromy et al. Therefore, in preferred ments of the present invention, the serotype of the capsid sequence of the AAV vector is AAVS. In other embodiments, the serotype of the capsid sequence of the AAV vector is AAVl, AAV2, AAV3, AAV4, AAV6, AAV7, AAV8, AAV9, AAVlO, AAVll, or AAV12. Even when the serotype of the capsid sequence does not naturally target retinal cells, other methods of ic tissue targeting may be employed. See Howarth et al.

For e, recombinant AAV vectors can be directly targeted by genetic manipulation of the Viral capsid sequence, ularly in the looped out region of the AAV three— dimensional ure, or by domain swapping of exposed surfaces of the capsid regions of different pes, or by generation of AAV chimeras using ques such as marker rescue. See Bowles et al. Marker rescue of adeno-associated Virus (AAV) capsid mutants: A novel approach for chimeric AAV tion. Journal of Virology, 77(1): 423-432 (2003), as well as references cited therein.

One possible protocol for the production, cation, and characterization of recombinant AAV (rAAV) vectors is provided in Choi et al. Generally, the following steps are involved: design a transgene expression cassette, design a capsid sequence for targeting a specific receptor, generate adenoVirus-free rAAV vectors, purify and titer.

These steps are summarized below and described in detail in Choi et al.

The transgene expression te may be a single-stranded AAV (ssAAV) vector or a ic” or self—complementary AAV (scAAV) vector that is packaged as a pseudo—double—stranded transgene. Choi et al.; Heilbronn; Howarth. Using a traditional ssAAV vector generally results in a slow onset of gene expression (from days to weeks until a plateau of transgene expression is d) due to the required conversion of single-stranded AAV DNA into double-stranded DNA. In contrast, scAAV vectors PCT/U52012/020423 show an onset of gene expression within hours that plateaus within days after transduction of quiescent cells. Heilbronn. However, the packaging capacity of scAAV vectors is approximately half that of traditional ssAAV vectors. Choi et al.

Alternatively, the ene expression cassette may be split between two AAV vectors, which allows ry of a longer construct. See e. g., Daya et al. A ssAAV vector can be constructed by digesting an appropriate plasmid (such as, for e, a plasmid containing the hCNGB3 gene) with restriction endonucleases to remove the rep and cap fragments, and gel purifying the plasmid backbone containing the TRs. Choi et al. Subsequently, the desired transgene expression cassette can be inserted between the appropriate restriction sites to construct the single-stranded rAAV vector plasmid. A scAAV vector can be constructed as described in Choi et al.

Then, a large-scale plasmid preparation (at least 1 mg) of the pTR proviral plasmids and the suitable AAV helper d and pXX6 Ad helper plasmid can be purified by double CsCl gradient onation. Choi et al. A suitable AAV helper plasmid may be selected from the pXR series, pXRl-pXR5, which respectively permit cross-packaging of AAV2 ITR genomes into capsids of AAV serotypes l to 5. The appropriate capsid may be chosen based on the efficiency of the capsid’s targeting of the cells of interest. For example, in a preferred embodiment of the present invention, the serotype 0f the capsid sequence of the rAAV vector is AAVS, because this type of capsid is known to ively target retinal cells. Known s of g genome (i.e., transgene expression te) length and AAV capsids may be employed to improve expression and/or gene transfer to specific cell types (e.g., retinal cone cells).

See, e.g., Yang GS, Virus—mediated transduction of murine retina with adeno—associated virus: Effects of viral capsid and genome size. Journal of Virology, 76(15): 7651-7660.

Next, 293 cells are transfected with pXX6 helper d, rAAV vector d, and AAV helper plasmid. Choi et al. Subsequently the fractionated cell s are subjected to a multistep process of rAAV purification, ed by either CsCl gradient purification or heparin sepharose column purification. The production and quantitation of rAAV virions may be determined using a dot—blot assay. In vitro transduction of rAAV in cell culture can be used to verify the infectivity of the virus and functionality of the expression cassette.

In addition to the methods described in Choi et a], various other transfection —26— PCT/U52012/020423 methods for production of AAV may be used in the context of the present invention.

For example, transient transfection methods are available, including methods that rely on a calcium phosphate precipitation protocol.

In on to the laboratory—scale methods for producing rAAV vectors, the present invention may utilize techniques known in the art for bioreactor—scale manufacturing of AAV vectors, including, for example, Heilbronn; t, N. et a1.

Large-scale adeno-associated viral vector production using a herpesvirus-based system enables manufacturing for clinical studies. Human Gene Therapy, 20: 796-606.

The t invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all figures and all references, s and published patent applications cited throughout this application, as well as the Figures, are expressly incorporated herein by reference in their entirety.

Exaones EXAMPLE 1: Creation and Testing of r Versions of the PR2.1 Promoter Prior investigators created a truncated human red/green cone opsin promoter based on the locations of six different deletions found in blue cone monochromats (0.6 to 55 kb). Wang, Y., et al. A locus control region adjacent to the human red and green pigment genes. Neuron 9: 429—440 ; Nathans, J ., et al. Molecular genetics of human blue cone romacy. Science 245: 8 (1989); Shaaban, S. et al.

Functional analysis of the promoters of the human red and green visual t genes; Integrative Opthalmology & Visual Science: 39(6): 885-896 (1998). This ted red/green opsin promoter is shown in Figure 1.

In Komaromy et al. a recombinant adeno associated viral (rAAV) vector was utilized, as shown in Figure 2. This vector was derived from a human adeno-associated virus of serotype 5 and thus contained the capsid sequences of AAV5. It packaged an expression cassette that contained the PR2.1 cone red opsin promoter (PR2.1) of 2064 bp and a human CNGB3 (hCNGB3) sequence of 2430 bp. In addition, the sion cassette contained SV40 poly(A) and ng signal sequences, flanked by AAV2 3O inverted terminal repeats (I'l'Rs). The total size of the expression te was 5231bp, which is well beyond the normal packaging capacity of an AAV vector. In two 2012/020423 production runs, it was found that the yield of rAAV5-PR2.1-hCNGB3 was approximately 3- to 5-fold lower when compared to production runs of rAAVl-hAAT that packages a hAAT expression cassette of 3843 bp, which is much smaller that that of the hCNGB3 expression cassette (5231 bp). Also, a higher empty-to-full particle ratio was observed using silver staining and electron copy (EM) when compared to rAAVl-hAAT that was manufactured using the same HSV complementation system.

Another limitation of the PR2.1 promoter is that it promotes expression of the hCNGB3 transgene in red/green cones with little expression in blue cones.

In the present experiments, shortened versions of the PR2.1 promoter were created and tested.

Materials and Methods The PR2.1 promoter was shortened by making truncations starting from the ’-end of PR2.1. The 500 bp core promoter and the 600 bp locus control region (LCR) of PR2.1 were left intact. Three shortened ns of the PR2.1 promoter were created: PR1.7, PR1.5, and PR1.1. These were respectively created by truncating PR2.1 at the ’-end by approximately 300 bp, 500 bp, and 1,100 bp. A CMV enhancer was added to the 5’ end of the PR1.1 to create a hybrid promoter. Proviral plasmids that contained each of these promoters were created, as shown in Figure 3. These proviral ds (p) contained AAV terminal repeats (TR), a synthesized promoter (PR2.1—syn) or tions thereof, with or without a CMV enhancer (CMVenh), and a green fluorescent protein (GFP) transgene. The following four proviral plasmids were constructed and sequenced: (1) 2.1syn-GFP (2) pTR-PR1.8-GFP (3) pTR-PR1.6-GFP (4) Venh—PR1.1—GFP.

To ct pTR-PR2.1syn-GFP, a parental plasmid pTR-CMVenh-hGFP was first constructed from pTR-CBA-hRSl by replacing the CBA and hRSl sequences with enh—hGFP sequences. The human GFP (hGFP) DNA sequence was PCR ed from A—hGFP, a plasmid ning hGFP open reading frame, with oligonucleotide primers with endonuclease restriction sites at both ends (Not I and BspHI), digested with —28— WO 94560 PCT/U52012/020423 Not I /BspHI, and joined into pTR-CBA-hRSl plasmid that had been digested with NotI/NcoI to remove all uncessary DNA sequences including the chicken beta actin promoter and the hRSl (but not the CMV enhancer). The resulting plasmid pTR- CMVenh-hGFP contains the CMV enhancer, the hGFP open reading frame (CRT), and the SV40 poly (A) sequence flanked by AAV2 ITRs. The PR2.1 DNA sequence was synthesized according to the DNA sequence 5’ of the human red cone opsin (Wang Y. et al., A locus control region adjacent to the human red and green visual pigment genes, Neuron, vol 9, pp429—440, 1992). The synthesized PR2.1 was composed of bases spanning -4564 to -3009 joined to bases -496 to 0 and contained a LCR essential for expression of both the L and M opsin genes in humans omy AM et al., Targeting gene sion to cones with human cone opsin promoters in recombinant AAV, Gene Therapy, vol 15, pplO49-1055, 2008). In addition, a 97 base pair SV40 splice splice acceptor (SD/SA) was attached to the end of PR2.1 promoter. Synthesized PR2.1 including the SD/SA sequence was inserted into the pJ206 cloning vector to gcncratc pJ206-PR2.1syn. Thc PR2.1syn DNA sequence, ing the SV40 SD/SA ce, was released from pJ206—PR2. lsyn by HindIII/Acc651 digestion and inserted into pTR-CMVenh-hGFP that had been digested with HindIII/Acc651 to remove the unnecessary CMV enhancer sequence to generate the plasmid pTR-PR2.1syn-hGFP.

To uct plasmids with shorter versions of the PR2.1 promoter, the PR2.1 sequence with truncation of 300 bp, 500 bp or 1,100 bp from the 5’ end of PR2.1 were PCR amplified from pJ206-PR2.1syn. Four oligonucleotide s were designed: 1) PR right-Hind: ’-GATTTAAGCTTGCGGCCGCGGGTACAATTCCGCAGCTTTTAGAG-3’ ; 2) PR1.1 Left-Hind: 5’-CTGCAAGCTTGTGGGACCACAAATCAG-3’; 3) PR1.5 Ileft-Acc65l: 5’- TAGCGGTACCAGCCATCGGCTGTTAG-3’; and 4) PR1.7 left-AccéSI: 5’-GTGGGTACCGGAGGCTGAGGGGTG-3’. Primer PR right- Hind was paired with the other three primcrs to PCR amplify PR1.1, PR1.5, and PR1.7 respectively. Pfu Ultra HS polymerase mix was used with a thermal cycle of 95 0C for min, and then 35 cycles of 94 0C for 1 min, 58 0C for 45 sec, and 72 °C for 2 min.

DNA was amplified from Venh-PR1.1-hGFP: PR1.1 using the primer set of PR Hind and PR1.1-left—Hind. The amplified DNA was digested with 2012/020423 HindIII and inserted into pTR-CMVenh—hGFP that had been digested with HindIII to te plasmid pTR-CMVenh-PRl.l-hGFP.

DNA was amplified from pTR-PR1.5-hGFP: PR1.5 using the primer set of PR right-Hind and PR1.5-left-Acc651. The amplified DNAwas digested with HindIII/Acc651, and inserted into pTR-CMVenh-hGFP that had been digested with HindIII/Acc651 to generate plasmid pTR-PRl.5-hGFP DNA was amplified from pTR-PR1.7-hGFP: PR1.7 using the primer set of PR right-Hind and PR1.7-left-Acc651. The amplified DNAwas digested with HindIII/Acc651, and inserted into pTR-CMVenh-hGFP that had been digested with I/Acc651 to generate plasmid pTR-PRl .7-hGFP.

The DNA sequence of the expression cassette, including the promoter and hGFP, were confirmed by DNA sequencing, and the location of TRs was med by SmaI restriction mapping.

To e if the PR2.1 promoter is functional for RNA transcription and subesequent protein expression, a human retinal pigment lia (RPE) cell line, APRE-l9, and human embryonic kidney HEK293 cells were seeded in 6-well plates (5 x105 cells/well) and then transfected with 1 pg of DNA from each of six plasmids: pTR- CMVenh-PR1.1-GFP, pTR-PR1.5-GFP, pTR-PR1.7-GFP, pTR-PR2. lsyn-GFP, pTR- PR2.l-GFP (Control), or pTR-smCBA-GFP (positive control). ected cells were incubated at 37”C, 5% C02 incubator for 4 days. During the period of incubation, transfected cells were examined by fluoresecence microscopy for GFP expression.

Results DNA sequencing and restriction mapping of all four plasmids med that the sequence and the TRs of these proviral plasmids are correct.

In Vitro analysis using ARPE—l9 and HEK293 cells found that neither of these cell lines supported functionality of the PR2.1 promoter. At 24 h post transfection, strong pression was observed in cells transfected with DNA from pTR-smCBA- GFP (positive control). At 48 h post transfection, weak GFP expression was observed in cells transfected with DNA from Venh-PRI. l-GFP. No GFP-expressing cells were observed in all other wells, i.e. those transfected with DNA from pTR-PRl.5-GFP, 1.7-GFP, pTR-PR2.lsyn-GFP, or pTR-PR2.l-GFP. Plasmid pTR-PR2. l-GFP PCT/U52012/020423 contains the full-length PR2.1 promoter that is known to be functional for RNA transcription and quent GFP expression in vivo (Komaromy AM et al., Targeting gene expression to cones with human cone opsin promoters in inant AAV, Gene y, vol 15, pp1049-1055, 2008). Therefore these s indicate that the ARPE- 19 cell line does not support PR2.1 promotor, neither any other shorter versions of PR2.1 promoter. Weak expression of GFP from pTR-CMVenh-PR1.1-GFP transfected cells is most likely due to the CMV enhancer, which greatly elevates the strength of the PR1.1 promoter.

In follow-up experiments, the new constructs will be packaged in a rAAV capsid and tested in vivo in a mouse model. Five rAAV vectors, i.e. rAAV5-CMVenh-PR1.1- GFP, rAAV5—PR1.5—GFP, rAAV5—PR1.7—GFP, PR2.1syn—GFP, and rAAV5— PR2.1-GFP, will be produced by a standard plasmid transfection method. The rAAV vectors that have been packaged in transfected cells will be harvested by cell lysis and then purified by nol (IDX) gradient followed by Q Sepharose HP column chromatography, and formulated in Alcon BSS solution. Normal mice will then be injected by subretinal injection (1 pl.) in both eyes (5 mice per vector). Six weeks post injection, mice will be iced, eyes enucleated and retinal sections prepared. Slides will be stained with DAPI to identify nuclei and immunostaincd for GFP and for PNA (a marker for cone photoreceptors). The slides will be evaluated for quantitative GFP expression and localization of GFP expression in cones.

EXAMPLE 2: Creation of Native and Hybrid hCNGB3 Promoters In these experiments, new native and hybrid hCNGB3 promoters were created with the goal of enabling hCNGB3 expression in all three types of cone photoreceptors.

A pair of oligonucleotide s was ed for PCR amplification of a 1913 bp DNA nt immediately 5’ of the start codon (ATG) of the hCNGB3 open reading frame (ORF) based on the reference hCNGB3 gene sequence (GenB ank acc# NG_016980). The 5’ nontranslated region (NTR) of the CNGB3 gene contains the native CNGB3 promoter. The primer sequences used are: pCNGB 3—N'1'R F: 5’-CAGACTAGCCAGAATCACAGATC—3’ and pCNGB3-NTR R: ’—TCTCCTATAGGCTTCACCTTGTTG—3’. Using 0.25 ug or 0.5 ug of human genomic DNA (Promega, cat# G1471, lot# ) as DNA template, PCR WO 94560 PCT/U52012/020423 amplification was performed using 2X Pfu Ultra HS Mix (Agilent Technologies, cat# 600850). The amplification parameters were 5 min at 95°C, followed by 35 cycles of 94°C for 1 min, 55°C for 45 sec, and 72°C for 2 min An amplified DNA nt of 1913 bp was purified by agarose gel electrophoresis and used as template DNA for PCR amplification to generate shortened NTR sequences 5’- of hCNGB3 gene. Two sets of oligonucleotide primers were designed to amplify 5’-NTR sequences of 1800 bp and 1600 bp, respectively. Sequences of the primer set used to amplify the 1,800 bp 5’—NTR are pCNGB3—NTF F238 : ’-GTTGGGTACCAGCCGCCATCAGGAATAAAC-3’, and NTR R SacII: 5’-TCTCCGCGGTGGTTCTGAAAACCCTC-3’. Sequences of the primer set used to amplify the 1,600 bp 5’-NTR are pCNGB3-NTR F431 Ace651: ’-CATCTTGGTACCACATTCTCTTACAGAGC-3 ’, and -NTR R XhoI: ’-ATCTTCTCGAGGGTGGTTCTGAAAACCCTC-3’. The shortened 5’-NTR sequences were amplified by PCR using 2X Pfu Ultra HS Mix (Agilent Technologies, cat# 600850), with PCR amplification parameters of 5 min at 95 °C, followed by cycles of 94 °C for 1 min, 54 °C for 45 sec, and 72 °C for 2 min.

DNA was amplified from the 1913 bp 5’-NTR fragment using the primer set of pCNGB3-NTF F238 Acc651 and pCNGB-NTR R SacII. The amplified DNA was digested with Acc651 and SacII endonuclease and inserted into pTR-PRl.7—hGFP that had been ed with Acc651 and SacII to generate plasmid R1800—hGFP.

DNA was amplified from the 1913 bp 5’-NTR fragment using the primer set of pCNGB3-NTR F431 Acc651 and pCNGB3-NTR R XhoI. The amplified DNA was digested with Acc651/Xhol, and inserted into pTR—CMVenh—PR1.1—hGFP that had been ed with Acc651/XhoI to generate d pTR-NTR1600-hGFP.

DNA was amplified from the 1913 bp 5’-N'1'R fragment using the primer set of pCNGB3-NTR F431 Acc651 and pCNGB3-NTR R XhoI. The amplified DNA was digested hoI and inserted into pTR—CMVenh—PRl.1—hGFP that had been digested with SnaBI/XhoI to generate plasmid pTR-CMVenh-NTR1350-hGFP.

The DNA sequence of the expression cassette, including the promoter, hGFl’ were confirmed by DNA sequencing, and the terminal repeats (TRs) were confirmed by SmaI restriction mapping.

PCT/U52012/020423 EXAMPLE 3: In Vivo Efficacy of Cone Specific Promoters from the Native CNGBS anslated Region in Driving GFP Expression in Retinal Cells The following experiments trated the in viva efficacy of cone specific promoters from the native CNGB3 non-translated region in driving GFP expression in retinal cells of mice.

Four AAVS vectors containing a unique promoter driving GFP were constructed and manufactured by the conventional transfection methods. These four vectors include: 1) AAV5-NTR1.8-hGFP which contains an isolated promoter comprising approximately 1.8 kb of the 5’-NTR of the CNGB3 gene as described herein. ; 2) AAV5-NTR1.6- hGFP which ns an isolated promoter comprising approximately 1.6 kb of the 5’- NTR of the CNGB3 gene as described herein.; 3) AAV5—CMVenh—NTR1.4—hGFP which contains an isolated promoter comprisingapproximately 400 bp of the cytomegalovirus (CMV) er as described herein. and approximately 1.4 kb of the ’-NTR of the CNGB3 gene as described herein; and 4) AAV5-PR2.1-hGFP which contains the 2.1 KB version of the human red/green opsin promoter (PR2.1) and served as a positive control.

One microliter (1pl) of vector (2 x 1012 vg/mL) was injected into the subretinal space of C57b16 mice of approximately 6-8 weeks of age using standard technique (Timmers et a1 2001). A total of 10 eyes were injected with each vector. Mice were sacrificed approximately 6 weeks post injection. The eyes were enucleated and ly sectioned at 10 microns with a cryostat after preparation. Retinal sections were stained with a rabbit polyclonal antibody to hGFP, and lectin PNA conjugated to Alexa Fluor 594. Retinal sections were analyzed by confocal microscopy and images were taken.

All vectors tested resulted in visible GFP expression in retinal sections. The positive l R2.1-hGFP resulted in relatively strong cone transduction and no transduction in l pigment epithelium cells (RPE). On the other hand, AAV5- NTR1.8-hGFP resulted in strong transduction ically in RPE. AAVS-CMVenh- NTR1.4-hGFP also resulted in strong transduction in RPE and l transduction in receptors (PRs) (i. 6., rods and cones). For AAV5-NTR1.6-hGFP, only minimal WO 94560 2012/020423 RPE transduction was observed. The results are shown in Figure 6 and also summarized in Table 1.

Table 1. y of relative transduction efficiencies for promoter constructs Promoter construct Rod transduction Cone transduction RPE transduction AAVS-CMVenh- + + +++ NTR1 .4-hGFP AAVS-NTR1.6- +/_ +/_ + hGFP AAVS-NTR1.8- _ +/_ +++ hGFP AAVS-PR2.1-hGFP ++ +++ - 'l'he N'l'R1.8 is a strong promoter for RPE cells and is thus useful for RPE related gene therapies.

Equivalents Those skilled in the art will ize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims (28)

1. An isolated promoter comprising 1.8 kb of the 5’-NTR of the CNGB3 gene.

2. The er of claim 1 comprising the sequence SEQ ID NO: 1

3. An isolated promoter comprising 1.6 kb of the 5’-NTR of the CNGB3 gene.

4. The er of claim 3 comprising SEQ ID NO:2. 10

5. An isolated er comprising 400 bp of the cytomegalovirus (CMV) enhancer and 1.4 kb of the 5’-NTR of the CNGB3 gene.

6. The promoter of claim 5 comprising the following sequences: cytomegalovirus (CMV) enhancer set forth as SEQ ID NO: 3 and 15 the 5’-NTR of the CNGB3 gene set forth as SEQ ID NO: 4.

7. The promoter of any one of claims 1, 3, or 5, wherein the CNGB3 gene is the human CNGB3 gene. 20

8. The promoter of any one of claims 1-7, wherein said promoter is capable of promoting CNGB3 expression in S-cone cells, M-cone cells, and L-cone cells.

9. The promoter of any one of claims 1-7, wherein said promoter is capable of ing CNGA3 expression in S-cone cells, M-cone cells, and L-cone cells.

10. The promoter of any one of claims 1-7, wherein said promoter is capable of promoting GNAT2 expression in S-cone cells, M-cone cells, and L-cone cells.

11. A transgene expression cassette comprising (a) the promoter of any of claims 1-6; (b) a nucleic acid selected from the group consisting of a CNGB3 c 5 acid, a CNGA3 nucleic acid, and a GNAT2 nucleic acid; and (c) minimal regulatory elements.

12. A transgene expression cassette comprising (a) the promoter of any of claims 1-4, 10 (b) a CNGB3 c acid, and (c) minimal regulatory ts.

13. The expression cassette of claim 11 or 12, wherein said nucleic acid is a human nucleic acid.

14. A nucleic acid vector comprising the expression cassette of any one of claims 11-

15. The vector of claim 14, wherein the vector is an adeno-associated viral (AAV) 20 vector.

16. The vector of claim 15, wherein the serotype of the capsid sequence and the serotype of the ITRs of said AAV vector are independently ed from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, 25 AAV10, AAV11, and AAV12.

17. The vector of claim 15, wherein the capsid sequence is a mutant capsid sequence.

18. Use of a vector that comprises the promoter of any one of claims 1-6 in the manufacture of a medicament for treating a disease associated with a genetic mutation, tution, or deletion that affects retinal cone cells, n the treatment comprises stration of said medicament to a subject in need of such treatment.

19. The use of claim 18, wherein the disease is achromatopsia.

20. Use of the vector of any one of claims 14-17 in the manufacture of a medicament for treating achromatopsia wherein the treatment comprises stration of said 10 medicament to a subject in need of such treatment.

21. The use of any one of claims 18-20, wherein the vector is formulated for stration subretinally. 15

22. The use of claim 18, wherein the disease affects the retinal pigment epithelium (RPE).

23. A kit comprising (a) a vector that comprises the promoter of any one of claims 1-6, and 20 (b) instructions for use thereof.

24. A kit comprising (a) the nucleic acid vector of any one of claims 14-17, and (b) instructions for use thereof.

25. A method of making a recombinant adeno-associated viral (rAAV) vector comprising inserting into an adeno-associated viral vector any one of the promoters of claims 1-10 and a nucleic acid selected from the group consisting of a CNGB3 nucleic acid, a CNGA3 nucleic acid, and a GNAT2 nucleic acid.

26. The method of claim 25, wherein said nucleic acid is a human nucleic acid.

27. The method of claim 25 or claim 26, wherein the serotype of the capsid ce and the serotype of the ITRs of said AAV vector are independently selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.

28. The method of claim 25, wherein the capsid sequence is a mutant capsid sequence. W0