NZ612038B2 - Antibody against the csf-1r - Google Patents

Antibody against the csf-1r Download PDF

Info

Publication number
NZ612038B2
NZ612038B2 NZ612038A NZ61203812A NZ612038B2 NZ 612038 B2 NZ612038 B2 NZ 612038B2 NZ 612038 A NZ612038 A NZ 612038A NZ 61203812 A NZ61203812 A NZ 61203812A NZ 612038 B2 NZ612038 B2 NZ 612038B2
Authority
NZ
New Zealand
Prior art keywords
csf
antibody
seq
human
cell
Prior art date
Application number
NZ612038A
Other versions
NZ612038A (en
Inventor
Michel Geist
Benoit Grellier
Helene Haegel
Jeanbaptiste Marchand
Christine Thioudellet
Jean Baptiste Marchand
Original Assignee
Transgene Sa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US13/026,944 external-priority patent/US8470977B2/en
Application filed by Transgene Sa filed Critical Transgene Sa
Publication of NZ612038A publication Critical patent/NZ612038A/en
Publication of NZ612038B2 publication Critical patent/NZ612038B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/51—Complete heavy chain or Fd fragment, i.e. VH + CH1
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515—Complete light chain, i.e. VL + CL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

Disclosed is an isolated, recombinant or purified antibody that specifically binds to CSF-1 R, wherein said antibody comprises: (i) (a) first variable region consisting in SEQ 10 NO:42, and (b) a second variable region consisting in SEQ ID NO:44; or (ii) (a) first variable region consisting in SEQ 10 NO:43, and (b) a second variable region consisting in SEQ ID NO:45; or (iii) (a) first variable region consisting in SEQ 10 NO:42, and (b) a second variable region consisting in SEQ ID NO:46. 10 NO:43, and (b) a second variable region consisting in SEQ ID NO:45; or (iii) (a) first variable region consisting in SEQ 10 NO:42, and (b) a second variable region consisting in SEQ ID NO:46.

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is a continuation-in-part of US. Application No. 12/922,441, filed September 13, 2010, which is a US. national phase application based on , filed March 11, 2009, and which claimed priority of European Application No. 08 36 0005.6, filed March 14, 2008, and the benefit of v U.S. Provisional Application No. 61/043,884, filed April 10, 2008.
Sequence Listing The instant ation contains a Sequence Listing which has been submitted via EFS-Web and is hereby incorporated by reference in its entirety.
Said ASCII copy, created on March 30, 2011, is named 13026944.txt and is 56,764 bytes in size. = ption - [0003] The CSF-1 (Colony-Stimulating Factor-1) is a ne expressed particularly by various types of cells. It is a differentiation, growth and survival factor for cells of the mononuclear phagocyte lineage which express the receptor for CSF-1 (CSF-1 R) (SHERR. Colony-stimulating factor-1 receptor. blood. 1990, vol.75, no.1, p.1-12. ). CSF-1R is a tyrosine kinase receptor encoded by the c-fms protoonogen‘e containing an intracellular kinase domain and a ligand-binding extracellular region organized in five globulin-like subdomains. Response to CSF—1 results in increased al, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker.
The extent of c-fms expression is stronger than that of other macrophage-specific genes including lysozyme and a hage-specific n ne atase (HUME, et al. Regulation of CSF-1 receptor expression. Molecular reproduction and development. 1997, vol.46, no.1 , p.46-52, ).
In addition to cells of the mononuclear phagocyte lineage, the CSF—1 R is also expressed by many types of human tumors. In breast , CSF-1 R expression is associated with larger tumor sizes and decreased survival (KLUGER, et al. Macrophage colony-stimulating factor-1 receptor expression is associated with poor outcome in breast cancer by large cohort tissue microarray analysis. Clinical cancerresearch. 2004, vol.10, no.1, p.173-7. ; SCHOLL, et al.
Anti-colony-stimulating -1 antibody ng in y breast adenocarcinomas correlates with marked inflammatory cell infiltrates and sis. l ofthe National Cancer Institute. 1994, vol.86, no.2, p. 1 20—6. ). ln epithelial ovarian cancer, the majority of primary tumors and metastases strongly express the CSF-1 R, and metastases ntly co-express CSF-1 and CSF-1R. The CSF-1 R is also expressed by infiltrating hages (CHAMBERS, et al; pression of epithelial macrophage colony-stimulating factor (CSF-1) and CSF—1 receptor: a poor prognostic factor in epithelial ovarian cancer, contrasted with a protective effect of stromal CSF-1. Clinical Cancer Research. 1997, vol.3, no.6, p.999-1007. ). ln ovarian and trial cancers, Northern blot is shows that the vast majority of tumors co—express CSF-1 and CSF—1 R , while CSF-1 R expression is only weakly detected in normal endometrial tissue samples CHI, et al. Expression of the macrophage colony—stimulating factor and its receptor in gynecologic malignancies. Cancer. 1991, vol.67, no.4, p.990-6. ). ln cervical carcinomas, CSF-1 R expression is up- regulated both in tumor stroma and in tumor epithelium, compared with normal endometrium (KIRMA, et al. Elevated expression of the oncogene c-fms and its ligand, the macrophage colony-stimulating factor-1, in cervical cancer and the role of transforming growth factor—beta1 in inducing c—fms expression. Cancer res.. 2007, vol.67, no.5, p.1918-26. ). in renal carcinoma, infiltration of tumor-associated macrophages expressing high levels of CSF—1 R is associated with tumor ssion (HEMMERLEIN, et al. Expression of acute and late-stage inflammatory antigens, c¥fms, CSF-1, and human monocytic serine esterase 1, in tumor-associated macrophages of renal cell carcinomas. Cancer Immunology immunoz‘herapy. 2000, vol.49, no.9, p.485-92. ). CSF—1 R is expressed by close to 100% prostatic intraepithelial neoplasia or cancer samples (IDE, et al. Expression of colony-stimulating factor 1 receptor during prostate development and prostate cancer progression. Proc. Natl. Acad. Sci: USA. 2002, vol.99, no.22, p.14404—9.
). CSF-1 R expression has also been detected in acute myeloblastic leukemias and B-cell c lymphocytic leukemias (RAMBALDI, et al. Expression of the macrophage colony-stimulating factor and c—fms genes in human acute myeloblastic leukemia cells. Journal of Clinical igation. 1988, vol.81, no.4, p.1030-5. ).
Work done by immunohistochemistry and in situ hybridization has demonstrated city of the expression of CSF-1 in invasive breast cancer cells while such production is not observed in canal or non-invasive tumor cells (SCHOLL. et al. olony-stimulating factor-1 antibody staining in y breast adenocarcinomas correlates with marked inflammatory cell infiltrates and prognosis. Journal ofthe National Cancer Institute. 1994, , no.2, p.120-6. ; TANG, at al. M-CSF (monocyte colony stimulating factor) and M-CSF receptor expression by breast tumor cells: M-CSF mediated recruitment of tumor infiltrating monocytes?. Journal ofcellular biochemistry.’_1 992, vol.50, no.4, p.350-6.).
Production of CSF-1 by invasive tumor cells correlates with its increase in concentration in the plasma of patients, where it can exceed 1000 pg/ml ed with less than 300 pg/ml in normal subjects. High serum concentration correlates with advanced stages of the disease and unfavorable short term prognostic (SCHOLL. et al. Circulating levels of colony-stimulating factor 1 as a prognostic indicator in 82 patients with epithelial ovarian cancer. Brit/29hjournal ofcancer. 1994, ’vol.69, no.2, 6. ; . Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients.
A pilot study. Breast cancerresearch and treatment. 1996, vol.39, no.3, p.275- 83.). Moreover, it has been demonstrated that CSF-1 stimulates mobility and invasiveness of tumor cells (DORSCH, et al. Macrophage colony-stimulating factor gene transfer into tumor cells s macrophage infiltration but not tumor suppression. Europeanjournal ofIMmuno/ogy. 1993, vol.23, no.1, p.186-90. ; WANG, et al. Induction of monocyte migration by recombinant macrophage colony-stimulating factor. Journal ofimmuno/ogy. 1988, vol.141, no.2, p.575-9. ; FILDERMAN, et al. Macrophage colony-stimulating factor (CS F-1) enhances veness in CSF—1 receptor-positive carcinoma cell lines. Cancerres.. 1992, vol.52, no.13, p.3661-6. ). ' CSF-1 also has a chemotactic effect on precursors of the d line, which facilitates infiltration of monocytes in the tumor. However, the presence of these monocytes is not sufficient to observe destruction of the tumor by the W0 2012/110360 immune system (DORSCH, et al. Macrophage colony-stimulating factor gene transfer into tumor cells s macrophage infiltration but not tumor suppression. Europeanjournal ofimmunology. 1993, vol.23, no.1, p.186-90. ). it appears that at the high serum contents commonly found in patients suffering from tumors of the breast, ovaries or pancreas, CSF-1 orients the differentiation of these monocytes into macrophages and not into tic cells capable of presenting tumoral antigens and thus initiating an efficient cytotoxic immune response directed against tumor cells (SCHOLL. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer ts. A pilot study. Breast cancer research and ent 1996, vol.39, no.3, p.275-83. ; BARON, et al. Modulation of MHC class ll transport and lysosome distribution by macrophage-colony ating factor in human dendritic cells derived from monocytes. Journal ofcell science. 2001, vol.114, no.pt5, p.999-1010. ).
CSF-1 is also essential for proliferation and differentiation of osteoclasts lNl, et al. Role of CSF-1 in bone and bone marrow pment.
Molecular reproduction and development. 1997, vol.46, no.1 , 3. ).
Osteoclasts are multinucleated cells that express the CSF-1 R, deriving from hematopoietic precursors that are primarily responsible for the degradation of mineralized bone during bone development, homeostasis and repair. In various skeletal disorders such as osteoporosis, hypercalcemia of ancy, rheumatoid arthritis, tumor ases and s disease, bone resorption by osteoclasts exceeds bone formation by osteoblasts leading to sed bone mass, skeletal fragility and bone fracture ( BRUZZANITI, et al. Molecular regulation of osteoclast activity. Reviews in endocrine. 2006, vol.7, no.1-2, p.123-39. ). For example, patients with advanced breast cancer frequently develop metastasis to bone. Bone metastasis results in intractable pain and a high risk of fractures due to tumor- driven bone loss (osteolysis), which is caused by increased osteoclast activity (CICEK, et al. Breast cancer bone asis and current small therapeutics.
Cancer metastasis reviews. 2006, vol.25, no.4, p.635-44. ). it has been shown that osteolysis is linked to a high level of circulating CSF-1 (KlTAURA, et al. The l of clinical investigation. M-CSF es TNF-induced inflammatory osteoivsis. 2005, vol.115, no.12, p.3418-27. ) .
The CSF-1 pathway is also ed in mediating intestinal inflammation in disease such as inflammatory bowel disease (MARSHALL, et al. Blockade of colony stimulating factor-1 (CSF—l) leads to inhibition of DSS-induced s. afe/ybowe/ diseases. 2007, vol.13, no.2, 24. ), in mediating macrophage proliferation during acute aft rejection (JOSE. et al. Blockade of macrophage colony-stimulating factor reduces macrophage proliferation and accumulation in renal allograft rejection. Americanjournal oftransplantation . 2003, , no.3, p.294-300. and in HIV-1 replication in infected macrophage (KUTZA, et al. Macrophage colony-stimulating factor antagonists inhibit. replication of HIV-1 in human macrophages. Journa/ofimmuno/ogy. 2000, no.164, p.4955- 4960.
For these reasons, the inhibition of the CSF-1 ty by various compounds has been proposed for the treatment of cancer and bone degradation.
Background Art WO 01/30381 relates to the use of inhibitors of the CSF—1 activity in the production of medicaments for the treatment of tumor diseases. The two proposed approaches for the inhibition of the CSF-1 activity are the suppression of the CSF- 1 activity itself, and the suppression of the activity of the CSF-1 R. Neutralizing antibodies against CSF-1 or its receptor are red as the inhibitors of CSF-1 activity.
W0 03/059395 describes combination products comprising a substance capable of ting CSF—1 activity and a nce having a cytotoxic activity for the treatment of cancer. discloses a method for preventing and treating osteolysis, cancer metastasis and bone loss'associated with cancer metastasis by administering an antibody against CSF-1 to a subject.
EP 2 A relates to the use of mono- and/or bicyclic aryl or heteroaryl quinazoline compounds which exhibit ive inhibition of differentiation, proliferation or mediator release by effectively inhibiting CSF-1 R tyrosine kinase activity. This application also relates to the use of such compounds for the manufacture of a medicament for ting abnormal cell proliferation.
' US 2005059113 relates to antibodies and antigen-binding portions thereof that specifically bind to aCSF-1. The invention also relates to human anti-CSF-1 antibodies and antigen-binding portions thereof. This application invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti—CSF-1 antibodies. l and Sherr, 1989, PNAS, 86, 7924-7927 and Ashmun et al.. 1989, Blood, 73, 827-837 are sing monoclonal dies to the human CSF-1 receptor (e.g. 12-3A3 and 2-4A5) which specifically block CSF-1 binding to the human receptor, thereby inhibiting -dependent growth. The recognized epitope has been zed between positions amino acids 349-512.
W02009l026303 provides antigen binding proteins that are able to compete with CSF-1 and therefore t CSF-1 from binding to its receptor, and in certain embodiments inhibit binding between lL-34 and CSF-1 R. Moreover the mental section of W02009/026303 indicates that the antibodies developed by the Inventors are binding epitopes that are mainly located at the N-terminus between amino acids 20 to 223 of SEQ ID NO 29 sponding to lg-Iike loop 1 and lg-like loop 2 in W02009/026303) of CSF-1 R and require the presence of both the lg-like loop 1 and lg-like loop 2 regions.
Disclosure of Invention The present invention relates to an antibody that specifically binds to the CSF-1R, and more specifically to human CSF-1 R.
As used hout the entire application, the terms "a" and "an" are used in the sense that they mean "at least one", "at least a first", "one or more" or "a plurality" of the referenced components or steps, unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures f.
The term "and/or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements ted by said term".
The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.
W0 2012/110360 As used herein, the terms "comprising" and “comprise” are intended to mean that the kits of parts, products, compositions and methods include the referenced components or steps, but not ing . "Consisting essentially of" when used to define products, compositions and methods, shall mean eXcluding other components or steps of any essential significance. Thus, a composition consisting ially of the recited components would not exclude trace contaminants and pharmaceutically acceptable carriers. sting of" shall mean excluding more than trace elements of other ents or steps.
As used herein, the term "specifically binds to" refers to a binding reaction which is determinative of the presence of a target protein in the presence of a heterogeneous population of proteins and other biologics. Thus, under designated assay ions, the antibody according to the invention bind preferentially to at least part of the CSF-1 R and do not bind in a significant amount to other components present in a test sample. Specific binding between the antibody ing to the invention and the CS F-1 R target means that the binding affinity is of at least 103 M1, and preferably 105 MT, 105 M1, 107 M1, 108 M4, 109 M-1 or 1010 M". In particularly advantageous embodiment, the binding affinity is of at least 109 M-1 or 1010 M".
As used herein, the term “CSF-1 R” refers to the human CSF1 receptor.
The human CSF-1 receptor has been sequenced and its amino acid sequence is depicted in SEQ ID NO: 29.
As used herein, "antibody" or “Ab” is used in the broadest sense.
Therefore, an "antibody" or “Ab” can be naturally occurring or de such as onal antibodies (mAbs) produced by conventional hybridoma technology, inant technology and/or a functional fragment thereof, Antibodies of the present invention are meant to include both intact immunoglobulin molecules for example a polyclonal antibody, a onal antibody (mAb), a monospecific antibody, a bispecific antibody, a polyspecific antibody, a human antibody, an animal antibody (e.g. camelid antibody), chimeric antibodies, as well as portions, fragments, regions, peptides and tives thereof (provided by any known que, such as, but not limited to, enzymatic cleavage, peptide synthesis, or recombinant techniques), such as, for example, immunoglobulin devoid of light W0 2012/110360 chains (see for example US 079), Fab, Fab’, F (ab')2, Fv, scFv, antibody fragment, y , Fd, CDR regions, or any portion or peptide sequence of the antibody that is capable of binding antigen or epitope. An antibody is said to be "capable of g" a le if it is capable of specifically ng with the molecule to thereby bind the molecule to the antibody. Antibody nts or portions may lack the Fc fragment of intact antibody, clear more rapidly from the ation, and may have less non-specific tissue binding than an intact antibody.
Examples of. antibody may be produced from intact antibodies using methods well known in the art, for example by proteolytic cleavage with enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments (see e.g., Wahl et al., 24 J. Nucl. Med. 316-25 (1983). ns of antibodies may be made by any of the above methods, or may be made by expressing a portion of the recombinant molecule. For example, the CDR (s) of a recombinant antibody may be isolated and subcloned into the appropriate expression vector.
As used herein, the term ble region" refers to the variable region, or domain, of the light chain (VL) or heavy chain (VH) which contain the determinants for binding recognition specificity. The variable domains are involved in antigen recognition and form the antigen binding site. As used , the term "framework region" refers to portions of light and heavy chain le regions that are at least 85 % homologous (i.e., other than the CDR's) among different antibodies in the same species. As used herein, the term "homologous» refers to a comparison of the amino acids of two polypeptides which, when aligned by using the Smith- Waterman algorithm (SMITH, et al. Identification of common molecular subsequences. Journal ofMolecularB/o/ogy 1981, no.147, p.195-7. ), have approximately the designated tage of the same amino acids. For example, "85% homologous" refers to a comparison of the amino acids of two polypeptides which when optimally aligned have 85% amino acid identity. The variable region of both the heavy and light chain is divided into segments comprising four framework sub-regions (FR1, FR2, FR3, and FR4), interrupted by three stretches of hypervariable sequences, or the complementary determining regions (CDR's), as defined in Kabat’s database (Kabat et al., op. cit), with the CDR1 positioned between FR1 and FR2, CDR2 n FRZ and FR3, and CDR3 between FR3 and FR4. Without specifying the particular sub-regions as FR1, FR2, FR3 or FR4, W0 2012/110360 a framework region as referred by others, represents the ed FR's within the variable region of a single, naturally occurring immunoglobulin chain. As used herein, a FR represents one of the four sub-regions, and FR's represents two or more of the four sub—regions tuting a framework region. The sequences of the framework regions of different light or heavy chains are relatively ved within a species. The framework region of an antibody is the combined framework regions of the constituent light and heavy chains and serves to position and align the CDR's. The CDR's are primarily responsible for forming the binding site of an antibody ring binding specificity and affinity to an epitope of an antigen.
Within the variable regions of the H or L chains that provide for the antigen binding regions are smaller sequences dubbed "hypervariable" because of their extreme variability between antibodies of differing specificity. Such ariable regions are also referred to as "complementarity ining regions" or "CDR" regions.
These CDR regions t for the basic city of the dy for a particular antigenic determinant struCture. The CDRs represent non-contiguous stretches of amino acids within the variable regions but, less of species, the positional locations of these critical amino acid sequences within the variable heavy and light chain regions have been found to have similar locations within the amino acid sequences of the variable chains. The variable heavy and light chains of all antibodies each have 3 CDR s, each non-contiguous with the others (termed L1, L2, L3, H1, H2, H3) for the respective light (L) and heavy (H) chains.
The accepted CDR regions have been described by Kabat et al, 252 J. Biol.
Chem. 6609—16 , and CDR loops may be identified by applying these rules during an examination of a linear amino acid sequence. The rules for defining the CDR -H3 loop can vary, however (see Chapter 4, Antibody Engineering: Methods & Protocols, (Lo, ed. Humana Press, , NJ, 2004)), and the actual boundaries of some CDR -H3 loops may not be identified without mental techniques such as circular dichroism, nuclear magnetic resonance, or X-ray crystallography. in all mammalian species, antibody peptides contain constant (i.e., highly conserved) and variable regions, and, within the latter, there are the CDRs and the so-called "framework regions" made up of amino acid sequences within the variable region of the heavy or light chain but outside the CDRs. The CDR regions can also be defined using Chothia nomenclature (CHOTHIA and LESK. Canonical structures for the hypervariable regions of immunoglobulins (1987) J Mol Biol. 1987 Aug 20;196(4):901-17). Therefore, in certain embodiments, the CDRs are Kabat defined CDRs, and in other embodiments, the CDRs are a defined CDRs. Regarding the antigenic determinate recognized by the CDR regions of the antibody, this is also referred to as the "epitope." In other words, epitope refers to that portion of any molecule capable of being recognized by, and bound by, an antibody (the corresponding antibody binding region may be referred to as a paratope). In generai, epitopes consist of chemically active surface groupings of molecules, for example, amino acids or sugar side chains, and have specific dimensional structural characteristics as well as specific charge characteristics.
The term "monoclonal antibody" or “mAb” as used herein refers to an antibody that is derived from a single clone. Monoclonal antibodies can be prepared using hybridoma techniques such as those disclosed in HARLOW.
Antibodies: A Laboratory manual. 2nd edition. Cold Spring Harbor: tory press, 1988 and HAMMERLING. et al. Monoclonal Antibodies and T Cell .
Hybridomas. New York: Elsevier, 1981. p.563—681. .
As used herein, the term "human antibody" refers to an dy having le and constant regions derived from or closely ng human germline immunoglobulin ces. The human antibody of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by c mutation in vivo). Thus, as used herein, the term "human dy" refers to an antibody in which substantially every part of the protein is substantially similar to a human germline antibody. “Substantially similar" refers to an antibody having a nucleic acid sequence which is at least 80, preferably 85, more preferably 90 and even more preferably 95% homologous to the c acid sequence a human ne dy.
As used herein, the term "Fab" refers to regions of antibody molecules which e the variable region of the heavy chain and light chain and which exhibit binding activity. "Fab" includes aggregates of one heavy and one light chain (commonly known as Fab), whether any of the above are covalently or non— W0 2012/110360 covalently aggregated so long as the ation is capable of selectively reacting with a particular antigen or antigen family. The Fab fragment is a heterodimer comprising a VL and a second polypeptide comprising the VH and CH1 domains.
In a preferred embodiment the antibody is an Fab' fragment. By Fab' fragments differ from Fab fragments in that the Fab' nt contains a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody "hinge region".
“F(ab')2” refers to an antibody fragment obtained by the pepsin ent of an antibody or to the equivalent protein obtained by other techniques such as recombinant technologies. 2 fragment has two n-combining sites and is still capable of cross-linking an antigen.
"Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy-and one light- chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the VH VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
"Single-chain Fv" or "scFv" comprise the VH and VL domains of antibody, wherein these domains are t in a single polypeptide chain. Preferably, the scFv further comprises a polypeptide linker between the VH and VL s which enables the scFv to form the desired structure for antigen binding RD. Standard protocols for the construction of scFv libraries. Methods in molecularbio/ogy. 2002, no.178, p.59-71. ).
As used herein, the term “antibody fragment" refers to one or more fragments of an antibody that retain the ability to specifically bind to the CSF-1 R.
The term "diabodies" refers to small dy fragments with two n- binding sites, which fragments comprise a heavy-chain le domain (VH) connected to a light-chain variable domain (VL) in the same ptide chain (VH VL). By using a linker that is too short to all0w pairing between the two domains on W0 2012/110360 ' the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies may bind to one ‘ or more than one epitope. Diabodies are more fully described in POLJAK.
Production and structure of diabodies. Structure. 1994, vol.2, no.12, p.1121-3, HUDSON, et al. High avidity scFv multimers; diabodies and triabodies. l of immunologicalmethods. 1999, vol.231, no.1-2, p.177-89 and ANOV.
Generation of bispecific and tandem diabodies. Methods in molecular biology. 2002, no.178, p.317—31.
Various techniques have been ped for the production of antibody fragments. Traditionally, these fragments Were d via proteolytic digestion of intact antibodies. However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and scFv antibody fragments can all be expressed in and secreted from E. coli, thus allowing the production of large amounts of these fragments. Techniques for the production of antibody fragments will be apparent to the skilled in the art. In other embodiments, the antibody of choice is a single chain Fv nt .
As used herein “Domain Antibodies” (dAbs) consist in the smallest ' functional binding units of antibodies, corresponding to the le regions of either the heavy (VH) or light (VL) chains of the antibodies. Domain dies have a molecular weight of approximately 13 kDa, or less than one-tenth the size of a full antibody.
As used herein, “Fd” refers to an antibody fragment that consists of the VH and CH1 domains.
The term “antibody" or "Ab” also refers to other antibody fragment well known to the one skilled in the art, for example those described in HOLLIGER, et al. Engineered antibody fragments and the rise of single s. Nature biotechnology. 2005, vol.23, no.9, p.1126-36 and HOOGENBOOM, et al. Natural and designer g sites made by phage display technology. Immunology today 2000, vol.21, no.8, 8.
According to one embodiment, the antibody of the ion binds specifically to CSF—1 R, and more specifically to human CSF-1 R, and comprises: W0 2012/110360 (i) at least one CDR wherein said CDR is comprising at least five consecutive amino acids of the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, of the sequence starting in position 66 and finishing in position 87 of SEQ ID NO:2 or of the sequence starting in position 117 and finishing in position 126 of SEQ ID NO:2; (ii) at least one CDR wherein said CDR is comprising at least five consecutive amino acids of the sequence starting in on 44 and finishing in position 56 of SEQ ID NO:4, of the sequence starting in position 66 and finishing in position 76 of SEQ ID NO:4 or of the ce starting in position 109 and finishing in position 117 of SEQ ID'NO:4.
According to another embodiment, the antibody of the Invention binds specifically to CSF_-1 R, and more specifically to human CSF-1 R, and comprises at least one CDR Wherein said CDR is, ndently from one another, selected in the group of CDRs sing at least five consecutive amino acids: - of the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, - of the sequence starting in position 66 and finishing in position 87 of SEQ ID NO:2, - of the ce ng in position 117 and finishing in position 126 of SEQ ID NO:2, - of the sequence starting in position 44 and finishing in position 56 of SEQ ID NO:4, - of the sequence starting in position 66 and finishing in on 76 of SEQ ID NO:4 - or of the sequence starting in on 109 and finishing in position 117 of SEQ ID NO:4.
According to a preferred embodiment, the antibody of the Invention binds specifically to CS F-1 R, and more specifically to human CSF-1 R, and comprises 2, 3, 4 or 5 and even more preferably 6 CDRs n said CDRs are, independently W0 2012/110360 from one another, selected in the group of CDRs comprising at least five consecutive amino acids : - of the sequence ng in position 45 and finishing in position 54 of SEQ ID NO:2, - of the sequence starting in on 66 and finishing in position 87 of SEQ ID NO:2, - of the sequence starting in position 117 and finishing in position 126 of SEQ ID NO:2, - of the sequence starting in position 44 and finishing in position 56 of SEQ ID NO:4, - of the sequence starting in position 66 and finishing in position _76 of SEQ ID NO:4 - or of the sequence starting in position 109 and finishing in on 117 of SEQ ID NO:4.
According to a another preferred embodiment, the antibody of the Invention binds specifically to CSF—1 R more cally to human CSF-1 R, , and and comprises : (i) 2 and even more preferably 3 CDRs wherein said CDRs are, independently from one another, selected in the group of CDRs comprising at least five consecutive amino acids : . of the sequence ng in on 45 and finishing in position 54 of SEQ ID NO:2, - of the sequence starting in position 66 and finishing in position 87 of SEQ ID NO:2, - of the sequence starting in position 117 and finishing in position 126 of SEQ ID NO:2, W0 10360 (ii) 2 and even more preferably 3 CD Rs wherein said CDRs are, independently from one another, selected in the group of CDRs comprising at least five consecutive amino acids : - of the sequence starting in on 44 and finishing in position 56 of SEQ ID NO:4, - of the sequence starting in position 66 and finishing in on 76 of SEQ ID N024 - or of the sequence starting in position 109 and finishing in on 117 of SEQ ID N024.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specificallyto human CSF—1 R, and comprises: (i) at least one CDR ed, independently from one another, in the group of the CDR as set forth in : - the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, - the sequence starting in position 66 and finishing in position 87 of SEQ ID N02 and — the sequence starting in position 117 and finishing in position 126 of SEQ ID NO:2; (ii) at least one CDR selected, independently from one another. in the group of the CDR as set forth in : -the ce starting in position 44 and finishing in position 56 of SEQ ID N024, - the sequence starting in position 66 and finishing in position 76 of SEQ ID N014 and - the sequence starting in position 109 and finishing in position 117 of SEQ ID N024.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises at WO 10360 least one CDR selected, independently from one another, in the group of the CDR as set forth in : - the sequence starting in position 45 and finishing in position 54 of SEQ ID N0:2, - the sequence starting in position 66 and finishing in position 87 of SEQ ID No:2, - the ce starting in on 117 and finishing in position 126 of SEQ ID N0:2, - the sequence starting in position 44 and ng in position 56 of SEQ ID NO:4, — the sequence starting in position 66 and ng in position 76 of SEQ ID N024 and - the sequence starting in position 109 and finishing in position 117 ofSEQ ID NO:4. - According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises 2, 3, 4 or 5 and even more preferably 6 CDRs selected, independently from one another, in the group of the CDR as set forth in : - the sequence starting in position 45 and finishing in position 54 of SEQ ID N0:2, - the sequence starting in position 66 and finishing in position 87 of SEQ ID N0:2, - the sequence starting in position 117 and finishing in position 126 ofSEQ ID NO:2. — the ce starting in position 44 and finishing in position 56 of SEQ ID NO:4, - the sequence ng in position 66 and finishing in position 76 of SEQ ID NO:4 and - the sequence starting in position 109 and finishing in position 117 of SEQ ID NO:4.
According to a another preferred embodiment, the antibody of the ion binds specifically to CSF—1 R, and more specifically to human CSF—1 R, and comprises : (i) 2 and even more preferably 3 CDRs wherein said CDRs are, independently from one another, selected in the group of the CDRs as set forth in : - the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, - the sequence starting in position 66 and finishing in position 87 of SEQ ID NO:2, - the sequence starting in position 117 and finishing in position 126 ofSEQ lD NO:2, (ii) 2 and even more preferably 3 CDRs wherein said CDRs are, independently from one r, selected in the group of the CDRs as set forth in : - the sequence starting in on 44 and finishing in position 56 of SEQ ID NO:4, - the sequence starting in position 66 and finishing in position 76 of SEQ ID NO:4, - the ce starting in position 109 and finishing in on 117 of SEQ lD NO:4.
According to one embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and ses (i) at least one CDR comprising an amino acid ce as set forth in any one of SEQ ID N03: 11, 12, or 13; or (ii) at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N05: 14, 15 or 16.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1R, and more specifically to human CSF-1R, and comprises at least one CDR comprising an amino acid sequenCe as set forth in any one of SEQ lD NOs:11,12,13,14,150r16.
According to a preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF—1 R, and comprises 2, 3, 4, 5 and even more preferably 6 CD Rs comprising an amino acid sequence as set forth in any one of SEQ ID NOs:11,12,13,14,15 or 16.
According to another embodiment, the antibody of the Invention binds specifically to CSF—1 R, and more specifically to human CSF—1 R, and comprises (i) at least one CDR as set forth in any one of SEQ ID N03: 11, 12 or 13; or (ii) at least one CDR set forth in any one of SEQ ID N03: 14, 15 or 16.
According to another ment, the antibody of the Invention binds specifically to CSF-1 R, and more cally to human CSF-1 R, and comprises at least one CDR as set forth in any one of SEQ ID N05: 11, 12, 13, 14, 15 or 16.
According to one preferred embodiment, the dy of the ion binds cally to CSF-1 R, and more specifically to human CSF-1 R, and comprises 2, 3, 4, 5 and even more preferably 6 CDRs as set forth in any one of SEQ ID ,12,13,14,15 or 16.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and ses (i) at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N03: 17, 18 or'19; or (ii) at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N03: 20, 21 or 22.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF—1 R, and comprises at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N03: 17, 18, 19, 20, 21 or 22.
According to one preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises 2, 3, 4, 5 and even more preferably 6 CDRs comprising an amino acid sequence as set forth in any one of SEQ ID N03: 17, 18, 19, 20, 21 or 22.
According to another embodiment, the antibody of the ion binds specifically to CSF-1 R, and more specifically to human CSF—1 R, and comprises (i) WO 10360 ‘ at least one CDR as set forth in any one of SEQ ID NOs: 17, 18 or 19; or (ii) at least one CDR as set forth in any one of SEQ ID NOs: 20, 21 or 22.
According to another embodiment, the antibody of the Invention binds specifically to CSF—1 R, and more specifically to human CSF-1 R, and comprises at least one CDR set forth in any one of SEQ ID N03: 17, 18, 19, 20, 21 or 22.
According to one preferred embodiment, the antibody of the Invention binds specifically to CSF—1 R, and more specifically to human CSF-1 R, and comprises 2, 3, 4, 5 and even more preferably 6 CDRs as set forth in any one of SEQ ID N03: 17, 18, 19, 20, 21 or 22.
According to another ment, the antibody of the Invention binds specifically to CSF—1 R, and more specifically to human CSF-1 R, and ses (i) at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N03: 23, 24 or 25; or (ii) at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N03: 26, 27 or 28.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-_1 R, and ses at least one CDR comprising an amino acid sequence as set forth in any one of SEQ ID N03: 23, 24, 25, 26, 27 or 28.
According to one preferred embodiment, the antibody of the Invention binds specifically to CSF—1 R, and more specifically to human CSF-1 R, and comprises 2, 3, 4, 5 and even more preferably 6 CDRs comprising an amino acid sequence as set forth in any one of SEQ ID N03: 23, 24, 25, 26, 27 or 28.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises (i) at least one CDR as set forth in any one of SEQ ID N05: 23, 24 or 25; or (ii) at least one CDR as set forth in any one of SEQ ID N03: 26, 27 or 28.
According to another ment, the antibody of the Invention binds specifically to CSF-1 R, and more cally to human CSF-1 R, and comprises at least one CDR as set forth in any one of SEQ ID N03: 23, 24, 25, 26, 27 or 28.
According to one preferred embodiment, the antibody of the ion binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and W0 2012/110360 2012/052043 comprises 2, 3, 4, 5 and even more preferably 6 CDRs as set forth in any one of SEQ ID N03: 23, 24, 25,- 26, 27 or 28.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises a variable region, wherein said variable region ses the CDRs as set forth in : - the sequence starting in position 45 and finishing in on 54 of SEQ ID NO:2, - the sequence ng in position 66 and finishing in position 87 of SEQ ID NO:2 and - the sequence starting in position 117 and finishing in position 126 of SEQ ID NO:2.
According to another embodiment, the antibody of the invention binds specifically to CSF—1 R, and more specifically to human CSF—1 R, and comprises a variable region, wherein said variable region comprises the CDRs as set forth in : - the sequence ng in position 44 and finishing in position 56 of SEQ. ID NO:4, - the sequence starting in position 66 and finishing in position 76 of SEQ ID NO:4 and - the sequence starting in position 109 and finishing in position 117 of SEQ ID NO:4.
According to another embodiment, the antibody of the invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises a variable , wherein said le region comprises the three CDRs as set forth in SEQ ID NOs: 11, 12, and 13.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1R, and more specifically to human CSF-1 R, and comprises a variable region, wherein said variable region comprises the three CDRs as set forth in SEQ lD N03: 14, 15, and 16.
According to r embodiment, the antibody of the Invention binds specifically to CSF—1 R, and more ically to human CSF—1 R, and comprises a W0 10360 variable region, wherein said variable region comprises the three CDRs set forth in SEQ ID N03: 17, 18, and 19. ing to another embodiment, the antibody of the Invention binds specifically to CSF-1 R, and more specifically to human CSF-1 R, and comprises a variable region, wherein said variable region comprises the three CDRs as set forth in SEQ ID N05: 20, 21, and 22. ing to another embodiment, the antibody of the Invention binds cally to CSF-1 R, and more specifically to human CSF-1 R, and comprises a variable region, wherein said variable regiOn comprises the three CDRs as set forth in SEQ ID' N03: 23, 24, and 25.
According to another embodiment, the antibody of the Invention binds specifically to CS F-1 R, and more specifically to human CSF-1 R, and comprises a variable , wherein said variable region comprises the three CDRs [as set forth in SEQ ID N03: 26, 27, and 28.
In preferred embodiments, the said variable region further comprises one, more preferably two, even more preferably three and definitely preferably four framework region, and more preferably human FR. As used herein, a "human FR" is a framework region that is at least 75 % homologous to the ork region of a naturally ing human antibody. ing» to one preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises a variable region, wherein the variable region comprises an amino acid sequence as set forth in SEQ ID NO:6.
In a more preferred ment, the antibody of the Invention binds specifically to CSF-1 R and comprises a variable region, wherein the variable region is as set forth in SEQ ID N026.
In another preferred embodiment, the antibody of the ion binds specifically to CSF—‘I R and comprises a variable region, wherein the variable region comprises an amino acid sequence as set forth in SEQ ID NO:9.
In another more preferred embodiment, the antibody of the Invention binds cally to CSF—1 R and comprises a variable region, wherein the variable region is as set forth in SEQ ID NO:9.
In another embodiment, the antibody of the Invention binds cally to CSF-1R and comprises two variable regions, n the variable regions are, independently from one another, selected in the group of (i) variable regions comprising the CDRs as set forth in : - the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, - the sequence starting in position 66 and finishing in position 87 of SEQ ID N02 and - the sequence starting in position 117 and finishing in position 126 of SEQ ID N022; (ii) le regions comprising the CDR as set forth in : - the sequence starting in position 44 and finishing in position 56 of SEQ ID NO:4, - the ce starting in position 66 and finishing in position 76 of SEQ ID NO:4 and - the sequence starting in position 109 and finishing in on 117 of SEQ ID NO:4; (iii) variable regions comprising the three CDRs set forth in SEQ ID NOS: 11, 12, and 13; (iv) variable regions sing the three CDRs set forth in SEQ ID N05: 14, 15, and 16; (v) variable regions comprising the three CDRs set forth in SEQ ID N03: 17, 18, and 19; (vi) variable regions comprising the three CDRs set forth in SEQ ID N03: 20, 21, and 22; (vii) variable regions comprising the three CDRs set forth in SEQ ID N03: 23, 24, and 25 (viii) variable regions comprising the three CDRs set forth in SEQ ID N03: 26, 27 and 28. . 2012/052043 ing to a preferred embodiment, the antibody of the Invention binds specifically to CSF—1 R and comprises : (i) a first variable region, wherein said variable region ses : - the CDR as set forth in the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, - the CDR as set forth in the sequence starting in position 66 and finishing in position 87 of SEQ ID N02 and - the CDR as set forth in the sequence starting in position 117 and finishing in position 126 of SEQ ID N022; (ii) a second variable region, wherein said variable region comprises : - the CDR as set forth in the ce starting in position 44 and finishing in position 56 of SEQ ID NO:4, — the CDR as set forth in the sequence starting in position 66 and finishing in position 76 of SEQ ID NO:4 and - the CDR as set forth in the sequence starting in position 109, , and finishing in position 117 of SEQ ID NO:4.
According to a red embodiment, the antibody of the Invention binds specifically to CS F-1 R and ses : - a variable region comprising the three CDRs as set forth in SEQ ID N03: 11, 12, and 13, and - a variable region comprising the three CDRs as set forth in SEQ ID N03: 14, 15, and 16.
According to a preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and Comprises : - a variable region sing the three CDRs as set forth in SEQ ID N03: 17, 18, and 19, and - a variable region comprising the three CDRs as set forth in SEQ ID N03: 20, 21, and 22.
WO 10360 According to a preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises : - a variable region comprising the three CDRs as set forth in SEQ ID NOs: 23, 24, and 25, and - a variable region comprising the three CDRs as set forth in SEQ ID NOs: 26, 27, and 28.
According to a preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises : - a variable region as set forth in SEQ ID NO:6 and - a variable region as set forth in SEQ ID NO:9.
According to a preferred embodiment, the antibody of the ion binds specifically to CSF-1 R and comprises : (i) a heavy-chain le region comprising : - the CDR as set forth in the sequence ng in position 45 and finishing in position 54 of SEQ ID NO:2, - the CDR as set forth in the sequence starting in- position 66 and finishing in position 87 of SEQ ID N022 and - the CDR as set forth in the sequence starting in on 117 and finishing in position 126 of SEQ ID N022; (ii) a light-chain variable region comprising : - the CDR as set forth in the sequence ng in position 44 and finishing in position 56 of SEQ ID NO:4, - the CDR as set forth in the sequence starting in position 66 and finishing in position 76 of SEQ ID N014 and - the CDR as set forth in the sequence starting in position 109 and finishing in position 117 of SEQ ID NO:4. ing to another embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises (i) a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N05: 11, 12, and 13, and (ii) a light-chain W0 2012/110360 variable region comprising the three CDRs as set forth in SEQ ID N03: 14, 15, and 16.
According to r embodiment, the dy of the Invention binds specifically to CS F-1 R and comprises (i) a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 17, 18, and 19, and (ii) a light-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 20, 21, and 22.
According to another embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises (i) a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 23, 24, and 25, and (ii) a light-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 26, 27, and 28.
According to a preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises (i) a heavy-chain variable region as set forth in SEQ ID NO:6 and (ii) a light-chain variable region as set forth in SEQ ID N019. :[0088] According to another preferred embodiment, the antibody of the ion binds cally to CSF-1 R and is a scFv, wherein said scFv comprises : (i) a le regions comprising : - the CDR as set forth in the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2, - the CDR set forth in the sequence starting in position 66 and ng in position 87 of SEQ ID N022 and - the CDR set forth In the sequence starting in on 117 and finishing in position 126 of SEQ ID NO:2;' (ii) a variable region comprising : - the CDR set forth in the sequence starting in position 44 and finishing in position 56 of SEQ ID N014, - the CDR set forth in the sequence ng in position 66 and finishing in positiOn 76 of SEQ ID NO:4 and W0 2012/110360 - the CDR set forth in the sequence starting in position 109 and finishing in position 117 of SEQ ID NO:4.
According to another preferred embodiment, the antibody of the Invention binds specifically to CSF—1R and is a scFv, wherein said scFv comprises : - a variable region comprising the three CDRs as set forth in SEQ ID N05: 11, 12, and 13, and - a le region comprising the three CDRs as set forth in SEQ ID N03: 14, 15, and 16.
According to another preferred embodiment, the antibody of the Invention binds specifically to CSF—1 R and is a scFv, n said scFv ses : - a le region comprising the three CDRs as set forth in SEQ ID N05: 17, 18, and 19, and - a variable region comprising the three CDRs as set forth in SEQ ID N05: 20, 21, and 22.
According to r preferred embodiment, the antibody of the Invention binds specifically to CSF—1R and is a scFv, wherein said scFv comprises - a variable region comprising the three CDRs as set forth in SEQ ID NOs: 23, 24, and 25, and - a variable region sing the three CDRs as set forth in SEQ ID N03: 26, 27, and 28.
According to a more preferred embodiment, the dy of the Invention binds specifically to CSF-1 R and is a scFv, wherein said scFv comprises : - a variable region as set forth in SEQ ID NO:6 and - a variable region as set forth in SEQ ID NO:9.
According to another preferred embodiment, the antibody of the Invention binds specifically to CSF—1 R and is a scFv, wherein said scFv comprises : (i) a heavy-chain variable region comprising : - the CDR set forth in the sequence starting in position 45 and finishing in position 54 of SEQ ID N02, the CDR set forth in the sequence starting in position 66 and finishing in position 87 of SEQ ID N02 and the CDR set forth in the sequence starting in on 117 and finishing in position 126 of SEQ ID NO:2 (ii) a light-chain variable region comprising : the CDR set forth in the sequence starting in position 44 and finishing in position 56 of SEQ ID NO:4, the CDR set forth in the sequence ng in position 66 and finishing in on 76 of SEQ ID NO:4 and the CDR set forth in the sequence starting in position 109 and finishing in position 117 of SEQ ID NO:4.
According to another preferred embodiment, thevantibody of the ion binds specifically to CSF-1 R and is a scFv, wherein said scFv comprises : a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID NOs: 11, 12, and 13, and a light-chain variable region comprising the three CDRs as set forth in SEQ ID NOs: 14, 15, and 16.
According to another preferred embodiment, the antibody of the Invention binds specifically to CSF—1R and is a scFv, wherein said scFv comprises : a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N08: 17, 18, and 19, and a light-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 20, 21, and 22.
According to another preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and is a scFv, wherein said scFv comprises : a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 23, 24, and 25, and a light-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 26, 27, and 28.
W0 2012/110360 According to a more preferred embodiment, the antibody of the invention binds specifically to CSF—1 R and is a scFv, n said scFv comprises : - the heavy-chain variable region as set forth in SEQ ID NO:6 - the light-chain variable region as set forth in SEQ lD NO:9.
In an even more preferred embodiment, the scFv is provided wherein at least one amino acid is substituted (according to Table 1 and Table 2) within the amino acid sequence as set forth in SEQ ID NO 6 and 9. In a definitely preferred embodiment the human antibody is provided wherein all the amino acid depicted in Table 1 and Table 2 are substituted (according to Table 1 and Table 2) within the amino acid sequence as set forth in SEQ ID NO 6 and 9.
According to another preferred embodiment, the antibody of the invention binds specifically to CSF-1 R and comprises the heavy chain as set forth in SEQ lD NO:2.
According to another red embodiment, the antibody of the invention binds specifically to CSF—1R and comprises the light chain as set forth in SEQ lD NO:4. ing to a more preferred embodiment, the dy of the invention binds specifically to CSF—1R and comprises the heavy chain as set forth in SEQ ID NO:2 and the light chain as set forth in SEQ ID NO:4.
According to an even more preferred embodiment, the antibody of the Invention binds specifically to CSF-1 R and comprises two heavy chains as set forth in SEQ ID NO:2 and two light chain as set forth in SEQ lD NO:4. This ular antibody will be named CXIlG6 throughout the t application. ing to another preferred embodiment, the present invention relates to a human antibody, that specifically binds to CSF-1 R, comprising : (i) a heavy-chain variable region comprising : - the CDR as set forth in the sequence starting in on 45 and finishing in position 54 of SEQ ID NO:2, W0 2012/110360 - the CDR as set forth in the sequence starting in on 66 and finishing in position 87 of SEQ ID N022 and - the CDR as set forth in the sequence starting in position 117 and finishing in position 126 of SEQ ID N022; (ii) a light-chain variable region comprising : - the CDR as set forth in the sequence starting in position 44 and finishing in position 56 of SEQ ID NO:4, - the CDR as set forth in the sequence starting in position 66 and ng in position 76 of SEQ ID NO:4 and - the CDR as set forth in the sequence ng in position 109 and ng in position 117 of SEQ ID NO:4.
According to another embodiment, the present invention relates to an human antibody, that specifically binds to CSF—1 R, comprising : - a heavy-chain variable region sing the three CDRs as set forth in SEQ ID N03: 11, 12, and 13, and - a chain variable region comprising the three CDRs as set forth in SEQ ID N08: 14, 15, and 16.
According to another embodiment, the present invention relates to an human antibody, that specifically binds to CSF-1 R, comprising : - a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N08: 17, 18, and 19, and - a light-chain variable region comprising the three CDRs as set forth in SEQ ID N08: 20, 21, and 22.
According to r embodiment, the present invention relates to an human antibody, that specifically binds to CSF-1R, comprising : - a heavy-chain variable region comprising the three CDRs as set forth in SEQ ID N08: 23, 24, and 25, and - a light-chain variable region comprising the three CDRs as set forth in SEQ ID N03: 26, 27, and 28.
] According to a preferred embodiment, the present invention s to an human antibody, that specifically binds to CSF-1 R, comprising : - the heavy-chain variable region set forth in SEQ ID NO:6 and - the light-chain variable region set forth in SEQ lD NO:9. in a more preferred embodiment, the human antibody is ed wherein at least one amino acid is substituted (according to Table 1 and Table 2) within the amino acid sequence as set forth in SEQ ID NO: 6 and 9. In a even more preferred embodiment the human antibody is provided n all the amino acid depicted in Table 1 and Table 2 are substituted (according to Table 1 and Table 2) within the amino acid sequence as set forth in SEQ ID NO: 6 and 9.
Table 1 SEQ ID N016 position Preferred substitution WD—lr—l (.0000 Lil-54>Com LII H im\DC\._. 4>~ H0 WIZ>N~1~3WQNQ><7UF<O ii4s. > SEQ NOn.7. mn PmpmHw SubS.Umt.mn According to another embodiment, the present inventionrelates to an isolated, recombinant or purified antibody that specifically binds to CSF-1 R, more ably human CSF-1 R, comprising: (a) a first variable region being defined by the following formula FR1 - CDR1 — FR2 — CDR2 — FR3 — CDR3 — FR4 wherein: FR1, FRZ, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each complementarity ining s; wherein: CDR1 has at least five consecutive amino acids of the sequence starting in position 45 and finishing in position 54 of SEQ ID NO:2; CDR2 has at Ieastfive consecutive amino acids of the sequence starting in position 66 and finishing in position 87 of SEQ ID NO:2; and CDR3 has at least five consecutive amino acids of the sequence starting in position 117 and finishing in position 126 of SEQ ID NO:2; (b) a second variable region being defined by the following formula FR1 - CDR1 — FR2 — CDR2 - FR3 — CDR3 — FR4 wherein: FR1, FRZ, FR3 and FR4 are each framework s; CDR1, CDR2 and CDR3 are each complementarity determining regions; wherein: CDR1 has at least five consecutive amino acids of the sequence starting in on 44 and finishing in position 56 of SEQ ID NO:4; CDR2 has at, least five consecutive amino acids of the sequence starting in position 66 and finishing in position 76 of SEQ ID NO:4; and CDR3 has at least five utive amino acids of the sequence starting in on 109 and finishing in poSition 117 of SEQ ID NO:4.
W0 2012/110360 According to another embodiment, the present invention relates to an isolated, recombinant or purified antibody that specifically binds to CSF-1R, comprising: (a) a first variable region being defined by the following formula FR1 — CDR1 — FR2 — CDR2 — FR3 - CDR3 —- FR4 wherein: FR1, FR2, FR3 and FR4 are each ork regions; CDR1, CDR2 and CDR3 are each complementarity determining regions; wherein: CDR1 has an amino acid sequence selected from the group ting of: SEQ ID .NO:11, 17 and 23; CDR2 has an amino acid-sequence selected from the group consisting of: SEQ ID NO: 12, 18 and 24; and CDR3 has an amino acid sequence selected from the group consisting of: SEQ ID NO: 13, 19 and 25; (b) a second variable region being defined by the following a FR1 - CDR1 — FR2 — CDR2 — FR3 — CDR3 — FR4 wherein: FR1, FR2, FR3 and FR4 are each framework regions; CDR1. CDR2 and CDR3 are each complementarity determining regions; wherein: CDR1 has an amino acid sequence selected from the group consisting of: SEQ ID NO: 14, 20 and 26; CDR2 has an amino acid sequence ed from the group consisting of: SEQ ID NO: 15, 21 and 27; and CDR3 has an amino acid sequence ed from the group consisting of: SEQ ID NO: 16, 22 and 28.
W0 2012/110360 According to another embodiment, the present invention relates to an isolated, recombinant or purified antibody that cally binds to CSF-1 R, more preferably human CSF-1 R, comprising any one of the following (i), (ii) or (iii) : (a) a first variable region being defined by the following a FR1 - CDR1 — FR2 - CDR2 — FR3 — CDR3 - FR4 wherein: FR1, FR2, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each complementarity determining regions; wherein: CDR1 is asset forth in SEQ lD NO: 11; CDR2 is as set forth in SEQ lD NO: 12; and CDR3 is as set forth in SEQ ID NO: 13; (b) a second variable region being defined by the ing formula FR1 - CDR1 — FR2 — CDR2 — FR3 — CDR3 — FR4 wherein: FR1, FR2, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each mentarity determining regions; wherein: CDR1 is as set forth in SEQ lD NO: 14; CDR2 is as set forth in SEQ lD N0: 15; and CDR3 is as set forth in SEQ lD NO: 16; (ii) (a) a first variable region being defined by the following formula FR1 - CDR1 —- FR2 - CDR2 — FR3 -— CDR3 — FR4 W0 2012/110360 FR1, FR2, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each complementarity ining regions; wherein: CDR1 is as set forth in SEQ ID NO: 17; CDR2 is as set forth in SEQ ID NO: 18; and CDR3 is as set forth in SEQ ID NO: 19; (b) a second variable region being defined by the following formula FR1 - CDR1 — FR2 — CDR2 —- FR3 — CDR3 - FR4 wherein: FR1, FR2, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each complementarity determining regions; _ wherein: CDR1 is as set forth in SEQ ID NO: 20; CDR2 is as set forth in SEQ ID NO: 21; and CDR3 is as set forth in SEQ ID NO: 22; (iii) (a) a first variable region being defined by the following formula FR1 - CDR1— FR2 — CDR2 — FR3 - CDR3 — FR4 wherein: FR1, FRZ, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each complementarity determining regions; wherein: CDR1 is as set forth in SEQ ID NO: 23; CDR2 is as set forth in SEQ ID NO: 24; and ‘35, W0 2012/110360 CDR3 is as set forth in SEQ lD NO: 25; (b) a second variable region being defined by the following formula FR1 - CDR1 — FR2 - CDR2 f FR3 - CDR3 — FR4 wherein: FR1, FR2, FR3 and FR4 are each framework regions; CDR1, CDR2 and CDR3 are each complementarity determining regions; wherein: CDR1 is as set forth in SEQ ID NO: 26; CDR2 is as set forth in SEQ lD NO: 27; and CDR3 is as set forth in SEQ ID NO: 28.
According to r embodiment, the present invention relates to an isolated, recombinant or purified antibody that specifically binds to CSF-1 R, more preferably human ,, comprising : - a first variable region comprising the amino acid sequence of SEQ ID NO: 6; and - a second variable region comprising the amino acid sequence of SEQ lD NO: 9.
According to another embodiment, the present invention s to an isolated, recombinant or purified antibody that cally binds to CSF-1 R, more preferably human CSF-1R, sing : - a first variable region comprising the amino acid sequence of SEQ lD NO: 2; and - a second variable region comprising the amino acid sequence of SEQ ID NO: 4.
According to another embodiment, the present invention relates to an ed, recombinant or purified antibody that specifically binds to CSF-1R, more preferably human CSF-1 R, comprising : W0 2012/110360 - an heavy chain selected in the group consisting in SEQ ID NO :37 (see Figure 32) and SEQ ID NO :38, and - a light chain selected in the group consisting in SEQ ID NO :39, SEQ ID NO :40 and SEQ ID NO :41. [001151 According to another embodiment, the present invention relates to an isolated, recombinant or purified antibody that specifically binds to CSF—1 R, more preferably human CSF—1 R, sing : - a first le region selected in the group consisting of SEQ ID NO :42 and SEQ ID NO :43; and - a second variable region selected in the group consisting of SEQ ID NO :44, SEQ ID NO :45 and SEQ ID NO :46.
According to one preferred embodiment, the present invention relates to an ed, recombinant or purified antibody that specifically binds to CS F-1 R, more preferably human CSF—1 R, comprising (a) an heavy chain consisting in SEQ ID NO :37, and (b) a light chain consisting in SEQ ID NO :39.
According to r red embodiment, the present invention relates to an isolated, recombinant or purified dy that specifically binds to CSF-1 R, more preferably human CSF-1 R, comprising (a) an heavy chain ting in SEQ ID NO :38, and (b) a light chain consisting in SEQ ID NO :40.
According to one advantageous embodiment, the present invention relates to an isolated, recombinant or purified antibody that specifically binds to CSF-1 R, more preferably human CSF-1 R, comprising (a) an heavy chain consisting in SEQ ID NO :37, and (b) a light chain consisting in SEQ ID NO :41.
According to one preferred embodiment, the present invention relates to an isolated, recombinant or purified antibody that specifically binds to CSF—1 R, more ably human'CSF—1 R, comprising (a) first variable region ting in SEQ ID NO :42, and (b) a second variable region consisting in SEQ ID NO :44.
According to another preferred embodiment, the present invention s to an isolated, recombinant or purified antibody that specifically binds to CSF-1 R, W0 2012/110360 more preferably human CSF-1 R, comprising (a) first variable region consisting in SEQ ID NO :43, and (b) a second variable region consisting in SEQ ID NO E45.
] According to one advantageous embodiment, the present invention s to an isolated, inant or purified antibody that cally binds to CSF-1 R, more preferably human CSF-1 R, comprising (a) first variable region consisting in SEQ ID NO :42, and (b) a second variable region consisting in SEQ ID NO :46.
The antibody, more specifically the human antibody, according to the invention may be of different isotypes, such as lgG, lgA, IgM or IgE. in a preferred embodiment the antibody, more cally the human antibody, aCcording to the invention is an lgG.
In a related embodiment, the human antibody comprises a modified or unmodified constant region of a human lgG1, IgG2, |gG3 or lgG4. In a preferred embodiment, the constant region is human lth or lgG4, which may optionally be modified to e or decrease certain properties. in the case of lgG1, modifications to the constant region, particularly the hinge or CH2 region, may increase or decrease effector function, including ADCC and/or CDC activity. in other embodiments, an lgG2 constant region is modified to se antibody-antigen aggregate formation. In the case of lgG4, modifications to the constant region, particularly the hinge region, may reduce the formation of half-antibodies.
The d binding affinity may be retained even though one or more of the amino acids in the antibody are mutated. These variants have at least one amino acid in the antibody replaced by a different residue. According to another embodiment, the present invention provides an antibody that specifically binds to CSF1 as above described in which at least one of the amino acid comprised in the CDR(s) is vatively substituted. Conservative substitutions are shown in Table 3.
Table 3 Original Amino Preferred conservative More preferred conservative Acid tution substitution W0 10360 Acid substitution substitution _—'_ __-_ n—'S—gm| {11> HZ NQKR LWVMAF IWVMAF R,QN WIFW'} LF,I SEé:lWWLVIAY5aU2:4#11 _..< WFTS _'11 —< LMFA _IKIFt“ The present invention also relates to a process of ing the antibody of the invention by affinity maturation.
As used herein, “affinity maturation” refers to the substitution of one or more amino acid sed in one or more CDRs, said substitution resulting in an improvement in the affinity of the antibody to CSF-1 R, compared to a parent antibody which does not s those substitution(s). Affinity maturation processes are known in the art. See for example methods disclosed in MARKS, et al. By—passing immunization: building high affinity human antibodies by chain shuffling. hnology. 1992, vol.10, no.7, p.779-83. ; BARBAS, et al. In vitro evolution of a neutralizing human antibody to human immunodeficiency virus type 1 to enhance affinity and broaden strain cross-reactivity. Proceedings ofthe Nationa/AcademyofSciences ofthe United States ofAmerica. 1994, vol.91, no.9, p.3809-13. ; SCHIER. fication of functional and structural amino-acid residues by parsimonious mutagenesis. Gene. 1996, vol.169, no.2, p.147-55. ; YELTON. Affinity maturation of the BR96 anti-carcinoma antibody by codon-based mutagenesis. J. immunoi. 1995, vol.155, no.4, p.1994-2004. ; JACKSON, et al. In vitro dy maturation. ement of a high affinity, neutralizing antibody against |L-1 beta. J. immunoi. 1995, vol.154, no.7, p.3310—9. and HAWKINS, etal.
Selection of phage antibodies by g affinity. Mimicking affinity maturation. l cu/arbio/ogy. 1992, vol.226, no.3, p.889-96. ‘ [00128] The present invention also relates to an antibody, which specifically binds to CSF-1 R, obtained by affinity maturation as usly described.
In another embodiment, the present invention es variants of the antibody previously described, having an amino acid sequence which is at least 80%, preferably at least 85%, more ably at least 90%, and even more preferably at least 98% homologous to the amino acid sequence of the previously described antibody.
In another embodiment, the antibody ing to the invention specifically binds to more than one epitope. For example, the antibody according to the invention may bind to two different es of CSF-1 R. AIternativer, the antibody according to the invention can be able to bind to CSF-1 R and to another molecule. As used herein, antibodies that cally bind to more than one epitope can be cross-linked antibodies. For example, an antibody can be coupled to avidin, the other to biotin. Cross-linked antibodies may be made using any convenient cross-linking methods well known in the art. Techniques for generating bispecific antibodies from antibody fragments have also been described see for example BRENNAN, et al. Preparation of bispecific antibodies by chemical recombination of monoclonal immunoglobulin G1 fragments. Science. 1985, vol.229, no.4708, p.81 -3 and SHALABY, et al. Development of humanized bispecific antibodies reactive with xic lymphocytes and tumor cells overexpressing the HER2 protooncogene. The Journal ofexperimental medicine. 1992, vol.175, no.1, 25; KOSTELNY, et al. Formation of a bispecific W0 2012/110360 antibody by the use of leucine zippers. J. immunol.. 1992, vol.148, no.5, p.154?- ] According to a preferred embodiment, the antibody that specifically binds to more than one epitope according to the invention is a diabody.
According to another preferred embodiment, the antibody that specifically binds to more than one epitope according to the invention is a linear antibody as described in ZAPATA, et al. Engineering linear F(ab')2 fragments for efficient production in Escherichia coli and ed antiproliferative activity. Protein ' V engineering. 1995, vol.8, no.10, -62.
In preferred ment, the antibody according to the Invention specifically binds to at least one e located n on amino acids 20 to 41 of SEQ ID N0:29 (i.e. N-terminal part of the human domain D1). In preferred embodiment, the antibody according to the Invention binds to one epitope located between position amino acids 20 to 41 of SEQ ID N0:29 (i.e. N-terminal part of the humandomain D1) and does not bind to any epitope located between position amino acids 42 to 90, and/or between position amino acids 91 to 104, and/or between on amino acids 105 to 199, and/or between position amino acids 200 to 298 of SEQ ID N0:29. According to preferred embodiment, the antibody of the present Invention is able to recognize the minimal epitope located between position amino acids 20 to 41 of SEQ ID N0:29 (i.e. inal part of the human domain D1). According to ageous embodiment, the antibody of the present Invention is able to ize and bind to construct pTG18016 (see Figure 19 and related example).
In preferred embodiment, the antibody according to the Invention does not compete with IL-34 ligand for binding to the CSF-1 R receptor. The term “does not compete with IL-34 ligand” as used herein refers to no inhibition of the IL34 ligand to its receptor CSF-1 R binding.
] In preferred embodiment, the antibody according to the Invention competes partially with CSF-1 ligand for binding to the CSF-1 R receptor. The term “competes partially with CSF-1 ligand” as used herein refers to an inhibition of the CSF-1 ligand to its receptor CSF-1 R binding which is less than 100%, preferably less than 50%, and even more preferably less than 20%, and advantageously less W0 2012/110360 than 10% . This partial inhibitor only reduces but does not totally exclude ligand binding, the inhibition is called partial inhibition. in preferred embodiment, the antibody according to the invention is able to invention lly prevents binding of CSF1 to its receptor CSF-1R, and is not able to totally inhibit said binding. More ularly, the antibodies according to the invention are able to decrease the CSF-1 binding to CSF-1 R by approximately 5 to %. ing to special embodiment, said binding decrease is measured as described in the present Experiment Section, by measuring CSF-1 (having an amino acid sequence extending from position 1' to 444 of SEQ ID: 47 — see figure 21) binding on receptor CSF-1R having an amino acid sequence extending from lie 20 to'Glu 512 of SEQ iD N0229. in preferred embodiment, the antibodies according to the ion are characterized by high affinity binding to CSF1-R. More particularly, the antibodies according to the invention have a Ki of less than 1 nM, preferably less than 0.8 nM, and more preferably less than 0.6 nM. As a result of such unexpectedly high affinity, the antibodies of the invention may be administered in less quantity and therefore ate potential side effects. > '[00138] in particular embodiments, an antibody of the present invention is an antagonist dy, which partially or fully blocks or inhibits axbioiogical activity of a polypeptide or cell to which it specifically or preferentially binds, Le. a CSF1-R - expressing cells, more preferably a CSF1-R -expressing human cells, and advantageously a CSF1-R -expressing human cancer cells. ing to specific embodiment of the present invention, the antibody of the present invention has at least one of the following advantageous properties: - in Vitro Test : the antibody according to the invention does not compete with lL-34 ligand for binding to the CSF-1 R or; - in Vitro Test : the antibody ing to the invention competes lly with CS F-1 ligand for g to the CSF-1 R receptor; - ADCC Test: in the presence of normal human peripheral blood clear cells, the antibody of the present invention exerts antibody- dependent cellular cytotoxicity (ADCC) against CSF1-R—expressing human cells, especially CSF1-R-expressing human cancer cells; - In Vivo Test : the antibody of the present invention exerts antitumor effects against man animals bearing CSF1-R-expressing human cancer cells; - In Vivo Test : the antibody of the present invention exerts antitumor effects against animals, including human, bearing CSFt-R-expressing human cancer cells, — in Vivo Test : the antibody of the present invention inhibits the CSF. dependent proliferation of AML5 cells.
- In Vivo Test : the antibody of the present invention partially inhibits CSF dependent phosphorylation of CSF-1R ; - in Vivo Test : the dy of the t ion has no direct agonistic activity on CSF—1 R.
The antibody according to the invention may be glycosylated or non- glycosylated.
As used , the term "glycosylation" refers to the presence of carbohydrate units that are covalently attached to the antibody.
In another embodiment, the antibody according to the invention is conjugated to a radiosensitizer agent, a receptor and/or a cytotoxic agent As used herein, the term "radiosensitizer" refers to a molecule that makes cells more sensitive to radiation therapy. Radiosensitizer includes, but are not limited to, metronidazole, misonidazole, desmethylmisonidazole, pimonidazole, etanidazole, nimorazole, cin C, RSU 1069, SR 4233, E09, RB 6145, nicotinamide, odeoxyuridine (BUdR), deoxyuridine(lUdR), bromodeoxycytidine, fluorodeoxyuridine (FUdR), hydroxyurea and cisplatin.
] As used , the term “receptor” refers to a compound able to specifically'bind to a ligand. According to a preferred embodiment of the invention, the or is biotin.
As used herein, the term cytotoxic agent refers to a compound that is directly toxic to cells, preventing their reproduction or growth. According to a preferred embodiment, the cytotoxic agent used in the context of the present invention is chosen from the group singcancer therapeutic agent, toxin (e. 9., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope. in another embodiment, the antibody according to the invention is conjugated to a labeling agent. [0014?] As used herein, "a labeling agent" refers to a detectable compound. The labeling agent may be detectable by itself (e. g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical modification of a substrate compound which is detectable.
As used , the term "conjugated” means that the antibody according to the invention and the labeling agent are covalently or valently linked.
“Covalent link" refers to coupling through reactive functional groups, ally with the intermediary use of a cross linker or other activating agent (see for example HERMANSON. Bioconjugate techniques. Academic press, 1996). The antibody according to the invention and/or the conjugated agent may be modified in order to allow their coupling via, for e, substitution on an activated carbonyl group ding those activated in situ) or on an imidoester, via on on an rated ‘carbonyl group, by reductive amination, nucleophilic substitution on a saturated carbon atom or on a atom, by reaction on aromatic cycles, In particular, coupling may be done using homobifunctional or heterobifunctional linking ts. Homobifunctional cross s including glutaraldehyde, succinic acid and bis-imidoester like DMS (dimethyl suberimidate) can be used to couple amine groups which may be present on the various moieties. Numerous examples are given in HERMANSON. Bioconjugate techniques. Academic press, 1996. p.118-228. which are well known by those of the art. Heterobifunctional cross linkers include those having both amine reactive and sulfhydryl-reactive groups, carbonyl-reactive and sulfhydryl-reactive groups and sulfhydryl-reactive groups and photoreactive s. Suitable heterobifunctional cross-linkers are, for example, described in HERMANSON.
Bioconjugate techniques. Academic press, 1996. 285, Examples are, for example, SPDP (N-succinimidyl 3-(2-pyridyldithio) propionate), SMBP W0 2012/110360 2012/052043 (succinimidyl(p-maleimidophenyl) butyrate), SMPT (succinimidyloxycarbonyl-d- methyl-d—(2-pyridyldithio)toluene), MBS (m-maleimidobenzoyl-N- hydroxysuccinimide ester), SlAB (N-succinimidyl (4 iodoacetyl) aminobenzoate), GMBS (y-maleimidobutyryloxy) succinimide ester), SIAX (succinimidyl-G- iodoacetyl amino hexonate, SIAC (succinimidyI-4—iodoacetyl amino methyl), NPIA (p—nitrophenyl iodoacetate). Other es are useful to couple carbohydrate- containing molecules (e.g. env roteins, antibodies) to sulfydryl-reactive groups. Examples include MPBH (4-(4-N maleimidophenyl) butyric acid hydrazide) and PDPH (4-(N— maleimidomethyl) cyclohexane-1~carboxyl~hydrazide (MZCZH and 3-2(2-pyridyldithio) proprionyl hydrazide).
According to another embodiment, the present invention s to a nucleic acid sequence coding the antibody of the invention.
The term "nucleic acid sequence" refers to a linear sequence of nucleotides. The nucleotides: are either a linear sequence of polyribonucleotides or polydeoxyribonucleotides, or a mixture of both. Examples of polynucleotides in the context of the present invention include single and double stranded DNA, single and double stranded RNA, and hybrid molecules that have both mixtures of single and double stranded DNA and RNA. r, the polynucleotides of the present invention may have one or more ed nucleotides. ing to a red embodiment of the invention, the nucleic acid ce according to the invention is comprised in a vector.
The vector can be of plasmid or viral origin and can, where appropriate, be combined with one or more substances which improve the transfectional efficiency and/or stability of the vector. These substances are widely documented in the literature which is available to the skilled person (see, for example,- FELGNER, et al. Cationic liposome mediated ection. Proceedings ofthe Western Pharmacology Society. 1989, , p.115-21. ; HODGSON, et al.
Virosomes: cationic liposomes enhance retroviral transduction. Nature biotechnology. 1996, vol.14, no.3, p.339—42. ; REMY, et al. Gene transfer with a series of lipophilic DNA-binding molecules. Bioconjugate chemist/y. 1994, vol.5, no.6, 54. ). By way of non-limiting illustration, the nces can be polymers, lipids, in particular cationic lipids, liposomes, nuclear proteins or neutral W0 2012/110360 lipids. These substances can be used alone or in combination. A combination which can be ged is that of a recombinant plasmid vector Which is ed with cationic lipids (DOGS, DC-CHOL, spermine-chol, spermidine-chol, etc), ospholipides (for example Hexadecylphosphocholine) and neutral lipids (DOPE).
According to a preferred embodiment, the cationic lipids which can be used in the t invention are the cationic lipids describes in EP 901463 and more preferably chG90.
The choice of the plasmids which can bevused within the context of the present invention is huge. They can be g s and/or expression s.
In a general manner, they are known to the skilled person and, while a number of them are available commercially, it is also possible to construct them or to modify them using the techniques of genetic manipulation. Examples which may be mentioned are the plasmids Which are derived from pBR322 (Gibco BRL),_ pUC (Gibco BRL), pBluescript (Stratagene), pREP4, pCEP4 (lnvitrogen) or p Poly (LATHE, et al. Plasmid and bacteriophage vectors for excision of intact inserts.
Gene. 1987, vol.57, no.2-3, p.193-201). Preferably, a plasmid which is used in the context of the present invention contains an origin of replication which ensures that replication is initiated in a producer cell and/or a host cell (for example, the ColE1 origin will be chosen for a plasmid which is intended to be produced in E. coli and the oriP/EBNA1 system will be chosen if it desired that the plasmid should be self-1 replicating in a mammalian host cell, LUPTON, et al. g genetic elements of Epstein—Barr virus that facilitate extraohromosomal persistence of Epstein-Barr virus-derived plasmids in human cells. Molecular and cellular biology. 1985, vol.5, no.10, p.2533-42 ; YATES. et al. Stable replication of plasmids derived from n-Barr virus in various mammalian cells. Nature. 1985, vol.313, no.6005, p.812-5). The d can additionally comprise a selection gene which enables the transfected cells to be selected or identified (com plementation of an auxotrophic mutation, gene ng resistance to an antibiotic, etc). Naturally, the plasmid can contain additional elements which improve its maintenance and/or its stability in a given cell (cer sequence, which promotes maintenance of a plasmid in monomericform (SUMMERS, et al. Multimerization of high copy W0 2012/110360 number plasmids causes instability: ColE1 encodes a determinant essential for plasmid monomerization and ity. Cell. 1984, vol.36, no.4, p.1097-103. , sequences for integration into the cell genome).
] With regard to a viral vector, it is possible to envisage a vector which is derived from a poxvirus (vaccinia virus, in ular MVA, canarypoxvirus, etc.), from an adenovirus, from a retrovirus, from a herpesvirus, from an alphavirus, from a foamy virus or from an adenovirus-associated virus. It is possible to use replication competent or ation deficient viral vectors. Preference will be given to using a vector which does not integrate. In this respect, adenoviral vectors and vectors deriving from poxvirus and more preferably ia virus and MVA are very particularly suitable for implementing the present invention.
According to a preferred ment, the viral vector according to the invention derives from a Modified Vaccinia Virus Ankara (MVA). MVA vectors and methods to produce such vectors are fully described in European patents EP 83286 and EP 206920, as well as in SU'ITER, et al. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc. Natl. Acad. SCI: . 1992, vol.89, no.22, 7-51. . According to a more preferred embediment, the nucleic acid sequence according to the invention may be inserted in deletion I, ll, lll, IV, V and VI of the MVA vector and even more preferably in deletion l|| ( MEYER, et al. Mapping of deletions in the genome of the highly attenuated ia virus MVA and their influence on virulence. The Journal ofgeneral Virology 1991, vol.72, no.Pt5, p.1031-8. ; SU'ITER, et al. A recombinant vector derived from the host range-restricted and highly attenuated MVA strain of vaccinia virus stimulates protective immunity in mice to nza virus. Vaccine. 1994, vol.12, no.11', p.1032-40. ).
Retroviruses have the property of ing, and in most cases integrating into, dividing cells and in this regard are particularly appropriate for use in relation to cancer. A recombinant retrovirus according to the invention lly contains the LTR sequences, an encapsidation region and the nucleotide sequence according to the invention, which is placed under the control of the retroviral LTR or of an internal promoter such as those described below. The recombinant retrovirus can be derived from a retrovirus of any origin (murine, primate, feline, v W0 2012/110360 human, etc.) and in particular from the MoMuLV (Moloney murine ia virus), MVS (Murine sarcoma virus) or Friend murine retrovirus (Fb29). it is propagated in an encapsidation cell line which is able to supply in trans the viral polypeptides gag, pol and/or env which are required for constituting a viral particle. Such cell lines are described in the literature (PA317, Psi CRIP GP + Am-12 etc.). The retroviral vector according to the invention can n modifications, in particular in the LTRs (replacement of the er region with a eukaryotic promoter) or the encapsidation region (replacement with a heterologous encapsidation region, for e the VL3O type) (see US 5747323 ) Preference will be also given to using an adenoviral vector which lacks all or part of at least one region which is essential for replication and which is selected from the E1, E2, E4 and L1-L5 regions in order to avoid the vector being propagated within the host organism or the environment. A deletion of the E1 region is red. However, it can be combined with (an)other modification(s)— /de|etion(s) ing, in particular, all or part of the E2, E4 and/or L1-L5 regions, to the extent that the defective essential functions are complemented in trans by means of a complementing cell line and/or a helper virus. In this respect, it is possible to use -generation vectors of the state of the art (see, for example, international applications WO 94/28152 and WO 97/04119 ). By way of illustration, deletion of the major part of the E1 region and of the E4 transcription unit is very particularly advantageous. For the purpose of increasing the cloning ties, the adenoviral vector can additionally lack all or part of the non-essential E3 region. According to another ative, it is possible to make use of a minimal adenoviral vector which retains the sequences which are essential for encapsidation, namely the 5’ and 3’ ITRs (Inverted Terminal Repeat), and the encapsidation region. The s adenoviral vectors, and the techniques for preparing them, are known (see, for example, GRAHAM, et al. Methods in molecular biology. Edited by MURREY. The human press inc, 1991. p.109-128. ).
Furthermore, the origin of the adenoviral vector according to the invention can vary both from the point of view of the species and from the point of view of the serotype. The vector can be derived from the genome of an adenovirus of human or animal (canine, avian, bovine, , ovine, porcine, simian, etc.) W0 2012/110360 origin or from a hybrid which comprises adenoviral genome fragments of at least two different s. More particular mention may be made of the CAV-l or CAV-2 iruses of canine , of the DAV adenovirus of avian origin or of the Bad type 3 adenovirus of bovine origin (ZAKHARCHUK, at al. Physical g and gy studies of egg drop syndrome (EDS-76) adenovirus DNA. Archives of virology. 1993, vol.128, no.1-2, p.171-6. ; SPIBEY, et al. Molecular cloning and restriction endonuclease mapping of two strains of canine adenovirus type 2. The Jouma/ ofgeneral virology. 1989, vol.70, no.Pt 1, p.165-72. ; JOUVENNE, et al.
Cloning, al mapping and cross-hybridization of the canine adenovirus types 1 and 2 genomes. Gene. 1987, vol.60, no.1, p.21-8. ; MITTAL. et al. Development of a bovine adenovirus type 3-based expression vector. The Journal ofgeneral virology. 1995, vol.76, no.Pt 1 , p.93-102. ). However, preference will be given to an adenoviral vector of human origin which is preferably derived from a serotype C- adenovirus, in particular a type 2 or 5 serotype C adenovirus.
The term cation-competent" as used herein refers to a viral vector capable of replicating in a host cell in the absence of any complementation.
According to a preferred embodiment of the invention, the replication competent vector is a replication competent adenoviral vector. These replication competent iral vectors are well known by the one skilled in the art. Among these, adenoviral vectors deleted in the E1b region coding the 55kD P53 inhibitor, as in the ONYX-015 virus (BISCHOFF, et al. An irus mutant that replicates selectively in p53-deficient human tumor cells. Science. 1996, vol.274, no.5286, p.373-6. ; He HEISE, et al. An adenovirus E1A mutant that demonstrates potent and selective systemic anti-tumoral efficacy. Nature Medicine. 2000, vol.6, no.10, p.1134—9. ; W0 94l18992 ), are particularly red. Accordingly, this virus can be used to selectively infect and kill p53-deficient neoplastic cells. A person of ordinary skill in the art can also mutate and disrupt the p53 inhibitor gene in adenovirus 5 or other viruses according to established techniques. iral vectors deleted in the E1A Rb binding region can also be used in the present ion. For e, Delta24 virus which is a mutant adenovirus carrying a 24 base pair deletion in the E1A region ( FUEYO, et al. A mutant oncolytic adenovirus targeting the Rb pathway produces anti-glioma effect in vivo. Oncogene. 2000, vol.19, no.1, p.2-12. ). Delta24 has a deletion in the Rb binding region and does not bind to Rb. Therefore, replication of the mutant virus is inhibited by Rb in a normal cell. However, if Rb is inactivated and the cell becomes neoplastic, Delta24 is no longer ted. Instead, the mutant virus replicates efficiently and lyses the Rb-deficient cell.
An iral vector according to the present invention can be generated in vitro in Escherichia coli (E. coli) by ligation or gous recombination (see, for example, international ation WO 96/17070 ) or else by recombination in a complementing cell line.
According to a preferred embodiment of the invention, the vector further comprises the elements'necessary for the expression of the dy according to the invention.
The elements necessary for the expression consist of all the ts which enable the nucleic acid sequence to be transcribed into RNA and the mRNA to be translated into polypeptide. These elements comprise, in particular, a promoter which may be ble or constitutive. Naturally, the promoter is suited to the chosen vector and the host cell. Examples which may be mentioned are the eukaryotic promoters of the PGK (phosphoglycerate kinase), MT (metallothionein; MCIVOR. Human purine nucleoside phosphorylase and adenosine deaminase: gene er into cultured cells and murine hematopoietic stem cells by using inant ropic retroviruses. Molecular and cellular biology. 1987, vol.7, no.2, p.838-46. ), (1-1 antitrypsin, CFTR, surfactant, globulin, actin ( TABIN, et al. Adaptation of a retrovirus as a eukaryotic vector transmitting the herpes simplex virus thymidine kinase gene. Molecularand cellular biology. 1982, vol.2, no.4, p.426-36. ) and SRa ( TAKEBE, et al. SR alpha promoter: an efficient and versatile mammalian cDNA expression system ed of the simian virus 40 early promoter and the R—U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecular and cellularbio/ogy 1988, vol.8, no.1, p.466-72. ) genes, the early promoter of the SV40 virus (Simian virus), the LTR of RSV (Rous sarcoma , the HSV-l TK promoter, the early promoter of the CMV virus (Cytomegalovirus), the p7.5K pH5R, pK1 L, p28 and p11 promoters of the vaccinia virus, chimeric promoters such as p11K7.5 and the E1A and MLP adenoviral W0 10360 promoters. The promoter can also be a promoter which stimulates expression in a tumor or cancer cell. Particular mention may be made of the promoters of the MUC-l gene, which is overexpressed in breast and prostate cancers (CHEN, at al.
Breast cancer selective gene expression and therapy mediated by recombinant adenoviruses containing the C1 promoter. The Journal ofclinical Ihvesf/jgation. 1995, , no.6, p.2775-82. ), of the CEA (standing for carcinoma embryonic antigen) gene, which is overexpressed in colon cancers (SCHREWE, et al. Cloning of the complete gene for carcinoembryonic antigen: analysis of its promoter indicates a region conveying cell type-specific expression. Molecularana’ cellularbio/ogy. 1990, vol.10, no.6, p.2738-48. ) of the tyrosinase gene, which is pressed in melanomas ( VILE, et al. Use of tissue-specific expression of the herpes simplex virus thymidine kinase gene to t growth of ished murine melanomas following direct intratumoral injection of DNA. Cancer res. 1993, vol.53, no.17, p.3860-4. ), of the ERBB-Z gene, which is overexpressed in breast and pancreatic cancers (HARRIS, et al. Gene therapy for cancer using tumor- specific prodrug activation. Gene therapy 1994, vol.1, no.3, p.170-5. ) and of'the a—fetoprotein gene, which is overexpressed in liver cancers , et al. In vivo gene therapy for alpha-fetoprotein-producing hepatocellular carcinoma by adenovirus-mediated transfer of cytosine deaminase gene. Cancerres.. 1997, vol.57, no.3, p.461-5. ). The cytomegalovirus (CMV) early er is very particularly preferred.
However, when a vector deriving from a Vaccinia Virus (as for example an MVA vector) is used, the er of the ine kinase 7.5K gene and the pH5R promoter are particularly red.
The necessary elements can furthermore include additional elements which improve the expression of the nucleic acid sequence according to the invention or its maintenance in the host cell. Intron sequences, secretion signal sequences, nuclear localization ces, internal sites for the reinitiation of translation of lRES type, transcription termination poly A sequences, tripartite leaders and origins of replication may in particular be mentioned. These elements are known to the skilled person. Among secretion signal sequence, sequences encoding the polypeptides as set forth in SEQ ID NO 5 and/or 8 are particularly preferred.
The recombinant vector according to the invention can also comprise one or more additional genes of interest, with it being possible for these genes to be placed under the control of the same regulatory ts (polycistronic cassette) or of independent ts. Genes which may in particular be mentioned are the genes encoding interleukins lL-2, lL-4, lL-7, lL—10, IL-12, lL-15, lL-18, ines as CCL19, CCL20, CCL21, CXCL-14, interferons, tumor necrosis factor (TNF), and factors acting on innate ty and angiogenesis (for example PAl-1, standing for plasminogen tor inhibitor). in one particular embodiment, the recombinant vector ing to the invention comprises the gene of interest encoding lL-2.
The present invention also relates to a cell comprising the nucleic acid sequence according to the invention. In a red embodiment, he cell according to the invention is eukaryotic cell and more preferably a mammalian cell.
Mammalian cells available as hosts‘for expression are well known in the art and include many immortalized cell lines, such as but not limited to, Chinese Hamster Ovary (CHO) cells, Baby Hamster Kidney (BHK) cells and many . Suitable additional eukaryotic cells include yeast and other fungi.
The present ion also relates to a process for producing an antibody according to the invention sing culturing the cell according to the invention under conditions permitting expression of the antibody and purifying the antibody from the cell or medium surrounding the cell. in another embodiment, the present invention relates to a pharmaceutical composition comprising any one of the antibody, the nucleic acid sequence or the vector according to the invention and a pharmaceutically acceptable carrier. in a preferred embodiment, the pharmaceutical composition r comprises a nd of interest.
The ceutically acceptable carrier is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as for example a sucrose solution. Moreover, such a carrier may contain any t, or aqueous or partially aqueous liquid such as. nonpyrogenic sterile water. The pH of the pharmaceutical composition is, in addition, adjusted and buffered so as to meet the requirements of use in vivo. The pharmaceutical composition may also include a pharmaceutically acceptable diluent, adjuvant or ent, as well as lizing, stabilizing and preserving agents. For injectable administration, a formulation in aqueous, eous or ic solution is preferred. It may be provided in a single dose or in a multidose in liquid or dry r, lyophilisate and the like) form which can be reconstituted at the time of use with an appropriate dfluent ] The present invention also relates, to a kit of part comprising (i) a pharmaceutical composition, an antibody, a nucleic acid ce or a vector according to the invention and, (ii) a compound of interest.» As used herein theterm, "compound of interest" relates to a therapeutic compound and preferably to a cancer therapeutic agent or a compound useful in the ent of bone mass decrease.
According to a red embodiment, the cancer therapeutic agent is chosen from the group comprising Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Aldara (lmiquimod), Alemtuzumab, Alimta (Pemetrexed Disodium), .Aminolevulinic Acid, Anastrozole, Aprepitant, Arimidex (Anastrozole), in (Exemestane), n (Nelarabine), Arsenic Trioxide, Avastin (Bevacizumab), idine, Bevacizumab, Bexarotene, Bortezomib, Campath (Alemtuzumab), Camptosar (lrinotecan Hydrochloride), Capecitabine, Carboplatin, Cetuximab, Cisplatin, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), Cyclophosphamide, Cytarabine, Cytosar-U (Cytarabine), Cytoxan phosphamide), n (Decitabine), Dasatinib, Decitabine, DepoCyt (Liposomal Cytarabine), DepoFoam (Liposomal Cytarabine), Dexrazoxane Hydrochloride, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox—SL (Doxorubicin Hydrochloride Liposome), Efudex (Fluorouracil), Ellence (Epirubicin Hydrochloride), Eloxatin (Oxaliplatin), Emend (Aprepitant), Epirubicin Hydrochloride, Erbitux (Cetuximab), Erlotinib Hydrochloride, Evacet (Doxorubicin Hydrochloride Liposome), Evista (Raloxifene hloride), Exemestane, Faslodex (Fulvestrant), Femara (Letrozole), Fluoroplex ouracil), Fluorouracil, Fulvestrant, Gefitinib, Gemcitabine Hydrochloride, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine hloride), Gleevec (lmatinib Mesylate), Herceptin (Trastuzumab), Hycamtin (Topotecan Hydrochloride), lmatinib Mesylate, Imiq'uimod, lressa (Gefitinib), Irinotecan Hydrochloride, lxabepilone, lxempra (lxabepilone), ene (Raloxifene Hydrochloride), Kepivance (Palifermin), Lapatinib Ditosylate, Lenalidomide, Letrozole, Levulan (Aminolevulinic Acid), LipoDox (Doxorubicin hloride Liposome), Liposomal Cytarabine, Methazolastone (Temozolomide), Methotrexate, Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Nelarabine, Neosar (Cyclophosphamide), Nexavar (Sorafenib Tosylate), Nilotinib, Nolvadex (Tamoxifen Citrate), Oncaspar (Pegaspargase), Oxaliplatin, Paclitaxel, Paclitaxel n-stabilized Nanoparticle Formulation, Palifermin, PanitumUmab, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pegaspargase, Pemetrexed Disodium, PIatinol-AQ (Cisplatin), ol (Cisplatin), Raloxifene Hydrochloride, Revlimid (Lenalidomide), n (Rituximab), Rituximab, s'ol lntrapleural Aerosol (Talc), Sorafenib te, Sprycel (Dasatinib), e Talc Powder (Talc), Steritalc (Talc), Sunitinib Malate, Sutent (Sunitinib Malate), r (Thalidomide), Talc, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel), Taxotere (Docetaxel), r (Temozolomide), Temozolomide, olimus, Thalomid domide), Thalidomide, Totect (Dexrazoxane Hydrochloride), Topotecan Hydrochloride, Torisel (Temsirolimus), Trastuzumab, Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Vectibix (Panitumumab), Velcade (Bortezomib), Vidaza (Azacitidine), Vorinostat, Xeloda itabine), Zinecard (Dexrazoxane Hydrochloride), Zoledronic Acid, Zolinza (Vorinostat) and Zometa (Zoledronic Acid).
According to a preferred embodiment of the invention the compound useful in the treatment of bone mass decrease is a phonate, a selective oestrogen receptor tors (SERMs), a parathyroid hormone (PTH) (e.g. teriparatide (Forteo)), strontium te, mab or calcitonin, or a combination thereof. According to a more preferred embodiment, the W0 2012/110360 biphosphonate is chosen from the group comprising Alendronate (Fosamax, Fosamax Plus D), Etidronate (Didronel), l'bandronate (Boniva), Pamidronate (Aredia), Risedronate (Actonel, Actonel W/Calcium), Tiludronate (Skelid), and Zoledronic acid (Reclast, Zometa). According to a more red embodiment, the SERMs is chosen from the group comprising raloxifene (Evista), bazedoxifene/premarin (Aprelal) and tamoxifen. ing to r embodiment, the present invention relates to the use of the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the invention for the treatment of diseases associated to an increased osteoclast activity. Such disease comprised but are not limited to endocrinopathies (hypercortisolism, hypogonadism, y or secondary hyperparathyroidism, hyperthyroidism), hypercalcemia, deficiency states (rickets/osteomalacia, , malnutrition), chronic diseases (malabsorption syndromes, chronic renal failure (renal ystrophy), chronic liver disease (hepatic osteodystrophy), drugs (glucocorticoids (glucocorticoid- , induced osteoporosis), androgen ation therapy, aromatase inhibitor therapy, heparin, l), and hereditary diseases (osteogenesis imperfecta, homocystinuria), osteoporosis, osteopetrosis, inflammation of bone associated with arthritis and rheumatoid arthritis, ontal disease, fibrous dysplasia, and/or Paget's disease.
According to another ment, the present invention relates to the use of the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts ing to the invention for the treatment of diseases associated to inflammation and/or autoimmunity. Such diseases comprise but are not limited to seronegativespondyloarthropathy (psoriatic arthritis, ankylosing spondylitis, reiters syndrome, loarthropathy ated ..with inflammatory bowel disease), prosthetic joint loosening, connective tissue diseases (juvenile rheumatoid arthritis, rheumatoid arthritis,systemic lupus erythematosus (SLE) and lupus nephritis, derma, Sjogren's syndrome, mixed connective tissue disease, polymyositis, dermatomyositis), inflammatory bowel disease (e.g. s disease; ulcerative colitis), whipples disease, arthritis ated with granulomatous ileocolitis, inflammatory skin conditions WO 10360 (autoimmune bullous pemphigoid, autoimmune pemphigus vulgaris, eczema, dermatitis), inflammatory lung disease (alveolitis, pulmonary fibrosis, sarcoidoisis, asthma, bronchitis, bronchiolitis obliterans), inflammatory renal disease (glomerulonethritis, renal allograft rejection, renal tubular inflammation), atherosclerosis, systemic vasculitis ral arteritis/giant cell arteritis, takayasu arteritis, polyarteritis nodosa, Kawasaki disease, Wegener's granulomatosis, churg strauss syndrome, copic polyangiitis, necrotising glomerulonephritis, henoch ein purpura, essential cryoglobulinaemic vasculitis and other small vessel vasculitis, Behcets disease), hage activation diseases (macrophage activation syndrome (MAS), adult onset stills disease, haemophagocytic syndrome), polymyalgia rheumatica, primary biliary sclerosis, sclerosing cholangitis, autoimmune hepatitis, Type 1 es Mellitus, Hashimoto's thyroiditis, Graves' disease, multiple sclerosis (MS), Guillain-Barre Syndrome, Addison's disease, and/or Raynaud's phenomenon, Goodpasture's syndrome.
According to another embodiment, the present ion relates to the use of the antibody, the nucleic acid sequence, the vector, the ceutical ition or the kit of parts ing to the invention for the treatment of cancer.
As used herein, the term “cancer” refers but is not limited to adenocarcinoma, acinic cell arcinoma, adrenal cortical carcindmas, alveoli cell oma, anaplastic carcinoma, basaloid carcinoma, basal cell carcinoma, bronchiolar Carcinoma, bronchogenic oma, renaladinol carcinoma, embryonal oma, anometroid carcinoma, fibrolamolar liver cell carcinoma, follicular carcinomas, giant cell carcinomas, hepatocellular carcinoma, intraepidermal carcinoma, intraepithelial carcinoma, leptomanigio carcinoma, medullary carcinoma, melanotic carcinoma, menigual carcinoma, mesometonephric oma, oat cell carcinoma, squamal cell carcinoma, sweat gland carcinoma, transitional cell carcinoma, tubular cell oma, blastic sarcoma, angiolithic a, botryoid sarcoma, endometrial stroma sarcoma, ewing sarcoma, fascicular sarcoma, giant cell sarcoma, granulositic sarcoma, immunoblastic sarcoma, ordial osteogenic sarcoma, coppices sarcoma, leukocytic sarcoma (leukemia), lymphatic sarcoma (lympho sarcoma), medullary W0 2012/110360 sarcoma, myeloid sarcoma (granulocitic sarcoma), austiogenci sarcoma, periosteal sarcoma, reticulum cell sarcoma (histiocytic lymphoma), round cell sarcoma, spindle cell sarcoma, synovial sarcoma, telangiectatic audiogenic sarcoma, Burkitt‘s lymphoma, NPDL, NML, NH and e lymphomas. According to a preferred embodiment, the method according to the invention is directed to the treatment of metastatic cancer to bone, wherein the metastatic cancer is , lung, renal, multiple myeloma, thyroid, prostate, adenocarcinoma, blood cell malignancies, including leukemia and lymphoma; head and neck cancers; gastrointestinal cancers, including esophageal cancer, stomach , colon cancer, intestinal , ctal cancer, rectal cancer, pancreatic cancer, liver cancer, cancer of the bile duct or gall bladder; malignancies of the female genital tract, including ovarian carcinoma, uterine endometrial cancers, vaginal cancer, and cervical cancer; bladder cancer; brain cancer, including neuroblastoma; sarcoma, osteosarcoma; and skin cancer, including malignant melanoma or us cell .
The present invention further concerns a method for improving the treatment of a cancer patient which is undergoing chemotherapeutic treatment with a cancer therapeutic agent, which comprises co-treatment of said t along with a method as above disclosed.
] The present invention further concerns a method of improving cytotoxic iveness of cytotoxic drugs or radiotherapy which comprises co-treating a patient in need of such treatment along with a method as above disclosed.
The present invention further concerns a method for improving the ent of a patient with a disease ated to an increased osteoclast activity which is undergoing ent with a biphosphonate, a selective oestrogen receptor modulators ('SERMs), a parathyroid hormone (PTH) (e.g. teriparatide (Forteo)), strontium te, Denosumab or calcitonin, or a combination thereof, which ses co—treatment of said patient along with a method as above disclosed. in another ment use of an antibody of the ion is contemplated in the manufacture of a medicament for preventing or treating metastatic cancer to bone in a patient suffering from metastatic cancer. in a W0 2012/110360 related embodiment, the atic cancer is breast, lung, renal, multiple myeloma, thyroid, prostate, arcinoma, blood cell ancies, including leukemia or lymphoma; head or neck cancers; gastrointestinal cancers, including esophageal cancer, stomach cancer, colon cancer, intestinal cancer, colorectal , rectal cancer, pancreatic cancer, liver cancer, cancer of the bile duct or gall bladder; malignancies of the female genital tract, including ovarian carcinoma, e endometrial cancers, vaginal , or cervical cancer; bladder cancer; brain cancer, including neuroblastoma; sarcoma, osteosarcoma; or skin cancer, including malignant melanoma or squamous cell cancer.
] According to another embodiment, the present invention relates to the use of the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the ion in the manufacture of a medicament. ing to another embodiment, the present invention relates to the use of the antibody, the c acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the ion in the manufacture of a medicament for treating a patient having cancer.
According to another ment, the present ion relates to the use of the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the invention in the manufacture 'of a medicament for treating a t having a disease associated to an increased osteoclast activity.
According to another embodiment, the t invention relates to the use of the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the invention in the manufacture of a medicament for treating a patient having an inflammatory disease, more specifically an inflammatory bowel disease.
According to another embodiment, the present invention relates to the use of the antibody, the nucleic acid sequence, the vector, the pharmaceutical ition or the kit of parts according to the invention in the manufacture of a medicament for treating a patient suffering from rheumatoid arthritis.
W0 2012/110360 Administering the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the invention may be accomplished by any means known to the skilled artisan. Preferred routes of administration include but are not limited to ermal, aneous, oral, parenteral, intramuscular, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, and . According to a preferred embodiment the antibody, the nucleic acid sequence, the vector, the pharmaceutical composition or the kit of parts ing to the ion are delivered systemically.
] The administration may take place in a single dose or a dose repeated one or several times after a certain time interval. Desirably, the antibody, the c acid sequence, the vector, the pharmaceutical composition or the kit of parts according to the invention are administered 1 to 10 times at weekly intervals.
] For general guidance, suitable dosage for the antibody is about 2mg/kg to 30mg/kg, 0.1 mg/kg to 30 mg/kg or 0.1 mg/kg to 10 mg/kg body weight. Suitable dosage for the vector according to the invention varies from about 104 to 1010 pfu (plaque forming , desirably from aboUt 105 and 108 pfu for MVA vector whereas it varies from about 105 to 1013 iu tious units), desirably from about 107 and 1012 iu for adenovirus based vector. A composition based on vector plasmids may be administered in doses of between 10 pg and 20 mg, advantageously between 100 pg and 2 mg.
When the use or the method according to the invention is for the treatment of cancer, the method or use of the invention can be carried out in conjunction with one or more conventional therapeutic modalities (e.g. radiation, chemotherapy and/or surgery). ‘The use of le therapeutic approaches provides the patient with a broader based intervention. In one embodiment, the method of the invention can be preceded or followed by a surgical intervention. in another ment, it can be preceded or followed by radiotherapy (e.g. gamma radiation). Those skilled in the art can readily formulate riate radiation therapy protocols and parameters which can be used (see for example PEREZ.
Principles and practice of radiation oncology. 2nd edition. LlPPlNCOTT, 1992 ).
W0 2012/110360 Brief Description of Figures in the Drawings Figure 1 depicts the specific staining of CSF-1R—transfected NIH/3T3 cells by mAb .
Figure 2 shows the inhibition of CSF—1 g to cell-surface CSF-1 R in presence of mAb CXllG6.
Figure 3 shows the specific blockade of soluble human CSF-1 R by mAb CXIlG6 (‘ctrl’ means control; ‘neg SN’ means ve control hybridoma supernatant).
Figure 4 shows the inhibition of human osteoclast entiation and secretion of matrix-metalloprotease-9 (MMP-9) in presence of mAb CXl|G6 (‘ctrl’ means control; “CXIIGS SN’ means CXIlG6 hybridoma supernatant; ‘neg SN’ means negative control hybridoma supernatant).
Figure 5 shows the non-crossereactivity of mAb CXIlG6 with other tyrosine kinase receptors having homology to CSF-1R (‘SN’ means hybridoma supernatant).
Figure 6 shows the c acid sequence (SEQ lD NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of the CXIlG6 heavy chain. The primer sequences ing restriction sites for cloning added to the nucleotide sequences are underlined. The restriction sites are shown in underlined italic type.
The amino acid sequences of the V-domains are highlighted in bold type.
Figure 7 shows the nucleic acid sequence (SEQ ID NO: 3) and deduced amino acid sequence (SEQ lD NO: 4) of the CXIlG6 light chain. The primer sequences including restriction sites for g added to the nucleotide sequences are underlined. The restriction sites are shown in underlined italic type.
The amino acid sequences of the V-domains are ghted in bold type. [3]ng shows the plasmid construct pTG17753.
Eiggg—zfi shows the plasmid construct pTG17727.
Figure 10 shows the plasmid construct pOptiVECTM.
] Figure 11 shows the plasmid construct pTG17895.
W0 2012/110360 Figure 12 shows the plasmid construct pTG17812.
] Figure 13 shows the plasmid construct pTG17868.
Figure 14 shows the plasmid construct pTG17869.
Figure 15 shows zed CXIIG6 light chain variants.
] Figure 16 shows humanized CXIIG6 lgG1 heavy chain variants.
Figure 17 shows the specific blockade of soluble human CSF-1 R by recombinant murine CXllG6 and chimeric CXIIG6 lgG1.
Figure 18 shows the inhibition of human osteoclast differentiation and secretion of matrix-metalloprotease-Q ) in presence of recombinant murine CXIIG6 and ic CXllG6 lgG1 Figure 19 shows the different constructs of CSF-1 R used to map the epitope of the monoclonal antibodies of the Invention versus those of commercially available anti-CSF-1'R antibodies. Human sequence is represented as an open bar and murine ce as a filled bar. Antibodies with their names crossed indicate that they do not bind the construct.
Figure 20 shows the limits of the lg-like domains of the different constructs of CSF-1 R used to map the epitope Figure 21: Competition curve between 125l-H27K15 antibody and unlabeled H27K15 on EL4-CSF-1R Figure 22: Competition curve between 125l-H27K15 dy and various antibodies on EL4-CS F-1 R Figure 23 : Post-incubation competition curves : CSF-1/mAb Figure 24 : Pre—incubation competition curves : mAb/ CSF-1 Figure 25 : Co—incubation competition curves : mAB + CSF-1 Figure 26 : ubation competition curves : mAB + CSF-1R Figure 27 : Lack of cross-reactivity of mAB variants Figure 28 : de of soluble CSF—1 R. The three hCXl|G6 variants and the chCXllG6 block soluble human CD115 and restore the CSFdependent 2012/052043 growth of M-NFS-60 cells. Results are expressed as means +/- SEM of quadruplicate wells. ND50 values were calculated using GraphPadPrism five- parameter logistic equation.
Figures 29 :A/BICID : Inhibition of CSF-1 dependent proliferation of AML3 cells. For Figure 29A, AML5 cells were stained with either the anti-human CD115 mAN 3291 (left panel) or with chCXIIGG (right . For each panel, the left histogram corresponds to AML5 cells stained with the isotope ls (respectively mouse lgG1 and rituximab). Figure 293 shows that AML5 cell growth is stimulated by CSF-1 in a dose-dependent fashion. Figure 290 shows that hCXllG6 variants and chCXIIG6 inhibit CSF—Ldependent proliferation of AML5 cells, showing results from three independent experiments. Figure 29D includes the EC50 and R square values, as calculated by GraphPad Prism, from the results shown in Figure 29C.
Figures 30 NB : ADCC activity on EL4-CSF-R target cells. In 30A, PBMC from blood donor #1 were used as effector cells to measure the cytotoxic activity of H27K5, H27K15 and H19K12 on EL4-CD115 target cells at an E:T ratio of 25. - In 308, PBMC from donor #2 were tested in the same assay as Figure 30A at the indicated E:T ratios. Asterisks (*) indicate p<0.05 compared with rituximab, while theta symbols (<13) indicate p<0.05 ed with chCXllG6.
Figures 31 NB : Therapeutic effect in BeWo choriocarcinoma tumor model Figure 32 : Listing of sequences SEQ ID NO: 37 to SEQ ID NO:47 EXAMPLES Specific staining of CSF-1R-transfected NIH/3T3 cells by mAb CXIIGS The -5 cell line was generated by stable ection of NIH/3T3 cells with an expression plasmid encoding the full-length human CSF-1 R. Cell- surface CSF-1 R sion on B45 cells was verified by indirect staining with the anti-human CSF-1R mAbs 61701 (mouse lgG1, R&D Systems) or 2-4A5-4 (rat , GeneTex), compared to e controls (Figure 1, upper and middle panels). Culture supernatants from hybridoma CXIIGS or from a W0 2012/110360 negative control hybridoma were used for immunostaining B45 cells or parental NIH/3T3 cells (Figure 1, lower panels).
Flow cytometry analysis showed that culture supernatant from hybridoma CXl|G6 selectively stained B45 cells, trating the mAb specificity for cell-surface CSF-1 R.
Partial Inhibition of CSF-1 binding to cell-surface CSF-1R 3 x 105 THP-1 cells (human CSF-1R-positive monocytic leukemia cell line) were ted for 30 min at 4°C in the presence of either hybridoma culture atants, serum from a naive or an anti-CSF-1R-immunized mouse (dilution 1:1000), mAb anti-CSF-1 R 2-4A5-4 (GeneTex) or a l rat lgG1 (10 pg/ml), or no reagent. After two washes with cold PBS, cells were incubated with 1 pg/ml biotinylated recombinant human CSF-1 for 30 min. Cells were washed twice and further incubated for 30 min at 4°C with 10 pg/ml streptavidin-Alexa Fluor 488 (lnvitrogen). After washing with' PBS and fixation with 4% paraformaldehyde, cell staining was ed by flow cytometry. sed fluorescence intensities compared to control samples reflect the inhibition of CSF—1 binding to cell-surface CSF—1 R. Serum from a CSF-1R— immunized mouse blocks CSF-1 binding to THP-1 cells (Figure 2). While negative control hybridoma supernatant or an vant mAb show no effect, culture - atant from hybridoma CXllG6 seems to inhibit, at least partially, CSF-1 binding to THP-1 cells (Figure 2, lower right panel).
First localization of mAb CXIIGS binding site.
] To identify the binding site of mAb CXllG6 on the CSF-1R, a Western blot was performed using e forms of the human CS F-1 R comprising either the five extracellular immunoglobulin-like s (Met 1 to Glu 512, R&D Systems) or only the three N-terminal immunoglobulin-like domains of the extracellular region of CSF-1R (Met 1 to Ser 290), both fused at their C-terminal ends to the Fc region of a human lgG1. A soluble form of the EGFR fused to human lgG1 Fc (R&D Systems) was used as a negative control.
Hundred nanograms of each soluble receptor were submitted to electrophoresis in native conditions before transfer to nitrocellulose sheet and W0 2012/110360 probing with either hybridoma supernatants, rabbit pAb CSF-1 R H300 (Santa Cruz hnology), mouse mAb 61701 (R&D Systems) or serum from naive or -immunized mice.
Both soluble forms of the CSF-1 R were detected as broad bands when probed with pAb c-fms/CSF-1 R H300, mAb 61701 or serum from the immunized mouse. No detectable signals were observed with naive mouse serum or a negative control hybridoma atant. CXIIGB hybridoma supernatant recognized CSF-1R1-2eoch as well as CSF—1R1-512:Fc, but not EGFR:Fc, indicating that CXlle binds specifically to an epitope lying within the three N—terminal immunoglobulin-like domains (between residues 1 to 290) of the human CSF—1 R.
Specific blockade of soluble human CSF-1R by mAb CXllGB The CSF—1—dependent murine myeloid leukemia M—N FS—6O cell line (# 38, ATCC) was used to assess the ng activity of CXIIG6 hybridoma supernatant on human and murine'CSF-1 R. Five nanograms of soluble human CSF-1R (CSF-1R1-512:Fc from R&D Systems) were preincubated in white l microplates with serial dilutions of either hybridoma supernatants, mAb 61701 (R&D Systems) or murine isotype control mAb. 10E4 M-NFS-60 cells cultured overnight in the absence of CSF-1 were then added into the culture wells together with 0.1 ng of human CSF—1 in a final assay volume of 100 pl. Cultures were incubated for 48 h at 37°C and proliferation was quantified by BrdU incorporation using a‘Cell Proliferation ELlSA (Roche). e human CSF-1 R tely inhibited the eration of M-NFS-SO cells mediated by human CSF-1, as shown in the presence of negative hybridoma supernatant containing or not a negative control IgG1 (Figure 3; mean +/- SEM of 3 wells). In contrast, CXIIG6 hybridoma supernatant and positive control mAb 61701 were-both able to restore cell proliferation in a dose-dependent manner, showing that they were able to neutralize soluble human CSF-1 R.
In this assay, active M-NFS-60 cell proliferation in the presence of low dilutions of CXIIG6 hybridoma supernatant showed that mAb CXIIG6 was unable to block the murine CSF—1 R expressed by M-NFS-60 cells. Moreover, in a murine CSFsupported M-N FS-60 proliferation assay med in the absence of soluble CSF—1 R, treatment with mAb AFSQ8 ouse CSF-1R (eBioscience) resulted in a dramatic concentration-dependent decrease of cell growth (data not shown). CXIIG6 hybridoma supernatant, like negative l antibodies and negative hybridoma atant, caused no reduction in cell proliferation. These results demonstrate that mAb CXllG6 specifically targets human CSF-1 R.
Inhibition of human osteoclast differentiation and secretion of matrix- metalloprotease-Q (MMP-S) Osteoclasts were generated from human monocytes ed by elutriation of PBMCs from a healthy blood donor. in brief, monocytes were seeded at 2 x 10E4 cells per well in 96~we|l plates and treated for 45 min with either hybridoma culture supernatants, mAbs anti-human CSF-1 R 61701 (R&D Systems) or 2-4A5-4 (GeneTex), mAb anti-human CSF—1 26730 (R&D Systems), murine or rat isotype controls, or sera from naive and —immunized mice diluted in hybridoma culture . Complete a-MEM medium was added to the culture wells with or without human CSF-1 and RANKL (PeproTech, 25 and 40 ng/ml respectively). Hybridoma supernatants, mAbs or/and medium with or without cytokines were replenished every 3 days for 9 days. Conditioned culture supernatants were harvested on day 9 and d for total human MMP-Q using an ELISA assay (R&D Systems). Osteoclast formation was evaluated by staining , of tartrate-resistant acid phosphatase (TRAP) using the leukocyte acid phosphatase kit from Sigma-Aldrich.
CSF—1 + RANKL induced monocytes to differentiate into osteoclasts, defined as large multinucleated TRAP-positive cells, whereas no TRAP-positive osteoclasts were obtained in the absence of cytokines. Addition of 0.5 pg/ml anti- CSF-1 mAb 26730 completely abrogated osteoclast differentiation, as shown by lack of MMP—9 ion. Anti-CSF-‘l R mAbs 61701 or 2-4A5-4 at the same concentration and immunized mouse serum (dilution 1:1000) ted osteoclast formation only partially (Figure 4; with (+) or without (—) cytokines; mean +/- SEM of 3 wells; *: mean of 2 wells). Treatment with CXIIGES hybridoma culture atant diluted 1:20 or 1:100 significantly reduced the level of MMP-9 production, compared with two ve l hybridoma supernatants (A, B). These results trate that mAb CXllG6 inhibits the differentiation of osteoclasts from human monocytes by ng the function of cell surface CSF—1 R.
W0 2012/110360 inhibition of the CSFdependent phosphorylation of CSF-1 R The -5 cell line obtained by stable transfection of NIH/3T3 cells with a plasmid expressing human CSF—1R was used to investigate the effect of CXIIGB oma supernatant on CSFdependent CSF-1 R phosphorylation. Cells were seeded at 2 x 10E5 cells per 60-mm Petri dish and cultured for 48 to 72 h.
Following serum deprivation for 1 h at 37°C, cells were treated for ‘l h at 37°C with culture medium containing either CXIIG6 oma supernatant, mAb 2-4A5-4 (NeoMarkers) or isotype control mAbs (diluted in negative hybridoma atant), and then stimulated with 100 ng/ml hCSF—1 or left unstimulated for 5 min at 37°C. Cell layers were then lysed and total proteins were extracted. Ten pg proteins were analyzed by probing Western blots with either the rabbit pAb c- fms/CSF—1 R H300 or the rabbit pAb p-c-fms/CSF—1R(Tyr708)—R (Santa Cruz Biotechnology), followed by goat anti-rabbit immunoglobulinsHRP.
In the absence of CSF-1, neither CXIIG6 hybridoma supernatant nor mAb 2-4A5-4 induced or phosphorylation as seen with the antibody specific for CSF-1 R phosphorylated at position 708, shoWing that mAb CXllG6 alone does not exert an agonistic effect. Upon stimulation with CSF—1, CSF-1 R was phosphorylated on Tyr708 and the amount of CSF-1 R decreased in isotype control-treated cells ed with unstimulated cells, reflecting receptor degradation (data not shown). Pretreatment with CXllG6 hybridoma supernatant or with mAb 2-4A5-4 did not enhance CSF—1 R disappearance. Phosphorylation of CSF-1 R was decreased following treatment with CXllG6 oma supernatant or with mAb 2-4A5-4. These results show that mAb CXIIG6 is able to block the CSF- 1—dependent phosphorylation of CSF-i R.
Cross-reactivity of mAb CXlle The cross~reactivity of mAb CXllG6 was tested by ELISA on a series of purified soluble ors belonging to the type lll subfamily of tyrosine kinase receptors and showing homology to CSF—1 R in their extracellular lg-like domains : e VEGFR—1, VEGFR—Z, Flt-3 and PDGFRB (all four expressed as Fc fusion ns), as well as PDGFROL and SCFR (c-kit) were obtained from R&D Systems and used for coating an ELISA plate. e EGFR (R&D s), from the EGFR subfamily of tyrosine kinase receptors, was used as a negative control.
W0 2012/110360 e supernatants from either hybridoma CXIIGG (CXIIG6 SN) or a negative control hybridoma, or the anti-CSF—1R mouse lgG1 61701 (R&D Systems) were incubated on the coated ELISA plate at antibody concentrations of 500 ng/ml. After washing the ELISA plate, bound antibodies were revealed using peroxidase-conjugated goat anti-mouse lg (Sigma) and OD (450- 540 nm) was measured. Results depicted in Figure 5 show that like mAb 61701, CXIIG6 strongly bound the CSF-1R while no specific signal was detected on any other ne kinase receptor. This shows that among the various type Ill tyrosine kinase receptors tested, CXIIG6 is specific for CSF-1 R.
Construction of expression vectors for mAb CXIIG6 The OTM Antibody s Kit (lnvitrogen, Catalog No.12762—019) was used for the cloning of the genes ng the CXIIG6 heavy and light chains in order to produce the mAb CXIIG6 in DG44 mammalian cell line. The OptiCHOTM Antibody Express Kit includes: (1) The pOptiVECTM vector, a bicistronic plasmid that allows the cloning of the gene of interest downstream of CMV promoter. The transcription of the gene of interest is separated from the ofolate ase (DH FR) auxotrophic selection marker by an internal ribosome entry site (IRES), allowing ription of the gene of interest and of the selection marker on the same mRNA; (2) The pcDNATM3.3 vector that allows the cloning of the gene of interest ream of CMV promoter. The pcDNATM3.3 contains a neomycin resistance gene allowing selection using Geneticin®. The pOptiVECTM and pcDNATM3.3 vectors contain the TK poly-A sequence which directs proper processing of the 3' end of the mRNA of the gene of interest.
Specific primers (see Table 4) were synthesized and used forthe PCR cation and cloning of the entire CXIIG6 heavy chain and light chain genes (respectively SEQ ID NO:1 and {SEQ ID NO:3; see respectively Figure 6 and Figure 7). The backward primers included the Kozak consensus sequence for efficient eukaryotic translation (KOZAK M. An is of 5'—noncoding sequences from 699 vertebrate messenger RNAs. NucleicAcids Res. 1987,15(20): 8125- 8148.).
Table 4 Primer ce OTG1 3929 GCCGCCACCATGTACTTGGGACTGAACTATGTATTC (SEQ ID NO :30) OTG18930 GGAGATCTTCATI'TACCCGGAGTCCGGGA (SEQ ID NO :31) OTG18931 GCCGCCACCATGAGTGTGCCCACTCAGGTCCTG (SEQ lD NO :32) OTG18932 GCCCGGGCTAACACTCATTCCTGTTGAAGCTC (SEQ lD NO :33) CXllG6 heavy chain was PCR amplified by using OTG18929 and OTG18930 with plasmid pTG17753 (Figure 8) as template, and cloned into the vector pOptiVECTM-TOPO® (pOptiVECTM-TOPO® TA Cloning® Kit, lnvitrogen, Catalog no.1 2744-01 7-01) and the pcDNATM3.3-TOPO® vectors (pcDNATM3.3- TOPO® TA Cloning® Kit, lnvitrogen, Catalog No.K8300-01) to obtain respectively pTG17786 and pTG17789.
CXllG6 light chain was PCR amplified by using OTG18931 and OTG18932 with plasmid pTG17727 (Figure 9) as te, and cloned into the vector pOptiVECTM-TOPO® (pOptiVECTM-TOPO® TA g® Kit, lnvitrogen, Catalog no.12744-017—01) and the pcDNATM3.3-TOPO® vectors (pcDNATM3.3- TOPO® TA g® Kit, lnvitrogen, Catalog 00—01) to obtain respectively pTG17788 and 87.
The nucleotide sequence of the whole expression cassette, including CMV promoter and TK polyA signal of pTGt7786, pTG17787, 88 and pTG17789 were sequenced and found in compliance with their theoretical sequences.
Generation of chimeric dies from mAb CXllG6 The variable domains of mAb CXllG6 were combined with human constant regions.
] To generate the chimeric light chain (named Chimeric CXI|G6 IgK chain), a theoretical sequence was designed by joining the sequence encoding the CXIIG6 VK Domain (from SEQ ID N023) to the sequence encoding for the human IGKC region nk accession number: J00241). This Xbai Notl DNA nt kept the same non translated sequence at 5’ end, including Kozak sequence, as the one used in the murine version (as in pTG17787 and pTG17788 described above).
The chimeric CXIIG6 light chain sequence was codon optimized for expression in CHO, assembled from synthetic oligonucleotides, and subcloned into pOptiVECTM (Figure 10) via Xbai Notl by GeneArt AG. The obtained chimeric CXIIGS light chain (variable and constant regions) codon optimized nucleic acid sequence is as set forth in SEQ ID NO:34. The obtained plasmid was named 95 (flgul'g To generate the chimeric heavy IgG1 and IgG4 chains (respectively named Chimeric CXIIG6 IgG1 and ic CXI|G6 lgG4 chains), the theoretical sequences were designed by g the sequence encoding the CXIIG6 VH Domain (from SEQ ID NO:1) to the sequences encoding either for the human lGHG1C region (GenBank accession number: J00228) or for the human lGHG4C region (GenBank accession number: K01316). These Xba/ Notl DNA fragments kept the same non translated sequence at 5’ end, including Kozak sequence, as the one used in the murine version (as in pTG17786 and pTG17789 as described above). The chimeric CXIIG6 heavy chains were then codon optimized for ‘ expression in CHO, synthesized and cloned into pTG17812 (Figure 12) via Xbai Not/ by t AG. The obtained chimeric CXIIG6 lgG1 heavy chain ble and constant regions) codon optimized nucleic acid sequence is as set forth in SEQ ID NO:35 and the obtained plasmids was named pTG17868 (Figure 13). The obtained chimeric CXIIG6 lgG4 heavy chain (variable and constant regions) codon optimized nucleic acid sequence is as set forth in SEQ ID NO:36 and the obtained plasmids was named pTG17869 (Figure 14).
Generation of humanized antibodies from mAb CXIIGS To generate the zed light chain ts, amino acid tutions according to Table 2 were performed within the chain variable region as set forth in SEQ ID NO:9.
DNA sequences were designed by joining modified sequences bearing substitutions of the CXllG6 VK Domain (from SEQ ID N023) to the sequence encoding for the human IGKC region (GenBank accession : J00241). This Xba/ Nof/ DNA fragment kept the same non translated sequence at 5’ end including Kozak sequence as the one used in the murine version (as in pTG17787 and pTG17788 as described . The humanized CXllGG light chain ces were then codon optimized for expression in CHO, assembled from synthetic oligonucleotides and cloned into pOptiVECTM (Figure 10) via Xba/ Not/ by GeneArt AG. The obtained humanized CXIIGG light chain variants and plasmids are listed in Figure 15.
To generate the humanized heavy chain variants, amino acid substitutions according to Table 1 were performed within the heavy-chain variable region as set forth in SEQ ID NO:6.
] DNA sequences were designed by joining d sequences bearing substitutions of the CXllG6 VH Domain (from SEQ ID NO:1) to the sequences encoding for the human lGHGlC region (GenBank accession number: J00228).
The a/ DNA fragments kept the same non translated sequence at 5’ end including Kozak sequence as used the one in the murine version (as in pTG17786 and pTG17789 as described above). The DNA sequences were then codon optimized for expression in CHO, synthesized and cloned into pTG17812 (5w ]_2_) via Xba/Apa/ by GeneArt AG. The obtained humanized CXllGB lgG1 heavy chain variants and plasmids are listed in Figure 16.
In vitro inhibitory activities of recombinant murine CXIIGG and chimeric CXllGS lgG1 To determine whether purified recombinant murine CXllG6 (as usly described) and its chimeric lgG1 variant ric CXllG6 lgG1 as previously described) were able to block soluble human CSF—1R. dose-response studies were performed in the M-NFS-60 cell eration and osteoclast differentiation models (as usly described). Purified polyclonal murine lgG2a from nd and, 010-0141) and a chimeric lgG1 produced by the applicant were tested in parallel as control antibodies. Blocking effect was evaluated by exposing cells to concentration ranges of active anti-CSF—1 R antibodies, as measured by antigen W0 2012/110360 binding in a SPR biosensor assay. Comparison between mAbs CXllG6 and their respective l mAb was done by loading equal amounts of total antibody (SPR biosensor assay by F0 binding).
M-N FS-60 bioassay: In the M-N FS-6O bioassay, cells were treated with 0.23 ng/ml to 0.5 uglml active mAbs CXllG6 binant murine CXllG6; chimeric CXllGG lgG1) or corresponding trations of control mAbs in the presence of 50 ng/ml human soluble CSF-1R and 1 nglml human CSF-1 for 48 h.
Results depicted in Figure 17 show that M-NFS—60 cell growth increased in response to increasing concentrations of both mAbs CXIIGG (recombinant murine CXllGB; chimeric CXllG6 lgGi) demonstrating that they antagonized the binding of e CSF-1 R to CSF-1 (mean +/- SEM of triplicate wells). Chimeric CXllG6 lgG1 was as effective as recombinant murine CXllGB in restoring cell proliferation. l murine lgG2a and chimeric lgGi had no effect on CSF-1 neutralization by soluble CSF-1 R over their respective concentration range. These results show that purified recombinant murine CXllG6 and chimeric CXllG6 |gG1 inhibit soluble human CSF-1 R.
] Osteoclast bioassay: in the last bioassay, elutriated human monocytes were ted for 8 days with 0.85 ng/ml to 0.62 pg/ml active mAbs CXllG6 (recombinant murine CXllG6; chimeric CXllG6 lgG1) in the presence of 25 ng/ml CSF-1 (lmmunoTools) and 40 ng/ml RANKL. The medium and all added agents were replenished on day 4 and 6 and total MMP-9 was ed in culture media conditioned from day 6 to 8. Results depicted in Figure 18 show that in comparison with control antibodies, inant murine CXllG6 and its chimeric variant (chimeric CXIIGG lgG1) each cantly reduced MMP-9 production which parallels osteoclast differentiation, indicating that growth retardation occurred (Figure 18; mean +/- SEM of triplicate wells). . [00257] These results further demonstrate that purified recombinant murine CXllG6 and chimeric CXllG6 IgGi inhibit the function of cell-surface CSF-1 R.
Egitoge magging of the Antibody of the Invention versus cial antibodies These experiments have been designed in order to determine the epitope localization of the antibodies of the present invention, and more precisely to W0 2012/110360 determine if they are binding cal or different epitopes than a number of commercially-available anti-CSF-1 R antibodies.
Chimeric CXIlG6 (chCXlIGG) of the Invention, mAb 3291 (murine lgG1, clone 61701, R&D Systems MAB3291) and mAb JF14 (murine lgG1, Santa Cruz sc-80174) bind human but not murine CSF-1 R. Monoclonal antibodies 3291 and JF14 have being selected as they have been generated t the N-terminal moiety of human CSF-1 R. In order to map the mAb binding sites on CSF-1R, truncated mutants of human CSF-1 R and chimeras between human and murine D1—D3 CSF-1R fused to Histidine tags were constructed (see Figures 19 and Q for details). These constructs were expressed as secreted proteins using CHO cells. Expression of ucts was checked by immunoblot analysis using an anti- His tag antibody for detection. All constructs were captured on ELISA plate by incubating CHO culture atant into wells coated with an Anti-His tag antibody. Antibodies were biotinylated using -NHS (Sigma ref B3295—10MG). ylated antibodies were added to each well and binding was detected with streptavidin-HRP. Biotinylated Rituximab (Du et al., 2007, J. Biol. Chem. 282 (20), 15080, NCBI Access s 20$L_H & 208L_L) was used as a negative isotype control (not binding to CSF-1R). Results are summarized in Figure 19.
Results .' As expected, Rituximab does not bind to any tested construct.
Chimeric CXllG6, mAb 3291 and mAb JF14 are able to bind the isolated domain 1 (D1) of human CSF-1 R (see construct pTG18038; 19). Furthermore, replacement of human D1 by murine D1 completely abolishes the binding of the three mAb (seeconstruct pTG18003; Figure19). Results obtained using ucts pTG18015 and pTG18000 combining human and murine D1 subdomains show that binding of mAbs 3291 and JF14 requires. both the N-terminus and the central part of the human CSF-1R D1 domain, while binding of the monoclonal antibody of the ion requires only the N-terminal part of the human domain D1 (see construct pTG18016; Figure19).
These data show that the epitope of the monoclonal antibody of the Invention binds to human CSF-1R on a different epitope than monoclonal antibodies 3291 and JF14. stingly, the N-terminal parts of human and murine W0 2012/110360 CSF-1R differ by only 4 residues: i20A, V27G. K33E and A36E ing nine is residue 1).
Monoclonal Antibodies H19K12, H27K5 and H27K15 The tion of oma CXIIG6, producing mouse inga with blocking ty to human CSF—1 R function, has been described above. The heavy and light chains of CXIIG6 lnga were cloned and sequenced (see Figures 6 and 7). A chimeric version of the monoclonal antibody (chCXiiG6) was constructed, combining the variable domains VH and VL of mAb CXIIGG with human igG1 constant regions (see above). To increase homology to human antibody ces and diminish potential immunogenicity of the monoclonal antibodies, humanized variants were generated by introducing ons in the VH and VL domains (see Figures 15 and 1_6_). 262 ns of the humanized monoclonal antibody of the invention were expressed transiently in Chinese Hamster Ovary (CHO) cells and tested for their CSF—1R binding capacity. Out of this first screening,thirty—one humanized CXIIG6 variants (hCXIlG6) were selected on the basis of (i) affinity to human CSF—1 R, (ii) highest homology with human germline sequences (preferably said homology is at least 76%, more preferably at least 85%) and (iii) lowest in silico immunogenicity.
Affinity studies using quartz crystal microbalance (Attana) technology showed that all selected hCXIlG6 variants had similar ies for recombinant human CSF- 1R, in the range of 10-9 to 10-10 M like (parental mAb G6. Three out of 30 humanized variants characterized by high affinity to CSF-1 R, t degree of human homology and lowest in silico immunogenicity were selected for further studies : H19K12, H27K5 and H27K15.
Biochemical characterization of monoclonal Antibody H27K15 of the invention A- Radioiabeiing of H27K15 antibody with Iodine—125 Materials Monoclonal antibody H27K15 of the Invention was provided as an aqueous solution (PBS pH7.5) at 2.1 mglmL concentration.
Iodine-125 radionuclide was purchased from Perkin Elmer; as sodium iodide in 10-5N sodium hydroxide (specific ty: 643.8 GBq/mg — radionuclide purity: 99.95%).
Chloramine-T (N-chloro-p-toluenesulfonamide, PM: 227.6 g.mol-1), sodium metabisulfite (PM=190.1 g.mol-1), bovine serum albumin (BSA) and trichloroacetic acid were purchased from Sigma.
] Phosphate-buffered saline 0. 1 M, pH7.2 was prepared in our tory.
Method . To 100‘ ugof antibody, 1.2 mCi of Na125l solution (44.4 MBq) and 7.6 uL of freshly prepared chloramine—T solution (1 mg/mL in phosphate buffer) were added.
After 2 min at room ature, the reaction was stopped by adding 12.7 uL of sodium metabisulfite (1 mglmL in phosphate buffer).
Nonincorporated Iodine-125 was d by gel filtration on Sephadex G- column (PD-10, Pharmacia) previously saturated with elution buffer (phosphate buffer 0.1M pH7.2/ 0.5% BSA). The column was eluted in 40 aliquots of 0.5 mL.
Radioactivity in each fraction was measured in an automatic Gamma Counter calibrated for iodine~125 radionuclide (Wallace Wizard 2470 automatic Gamma- counter calibrated for iodine-125 radionuclide — Perkin Elmer) and the fractions containing the d radioiodinated product were pooled .
The radiochemical purity of radiolabeled compound was estimated by ITLC analysis performed on Gelman Sciences precoated silica gel plates, using % TCA as eluant .
Results and characteristics o/abe/edantibody solutions [00271.] Before purification, radiochemical yield as determined by lTLC was 97.8%.
The characteristics of radiolabeled dy solution are ized below : 125|- H27K15 Molecular weight (Da) 150 000 Concentration ug/mL 58.19 W0 2012/110360 Radiochemlcal purity (%) 99.84 The purity and integrity of the radiolabeled antibody were assessed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) under reducing and non-reducing conditions. A broad range molecular weight rd (Biorad Laboratories) consisting of 10 lar weight markers from 10 to 250 kDa was used to calibrate the gel. Gels were stained by coomassie blue. In a second step, gels were dried and exposed on a screen for autoradiography using a orlmager 445 SI (Amersham Biosciences). lmageJ software (Molecular Dynamics) was used for data analysis.
Electrophoretic profiles obtained after coomassie blue staining and autoradiography are cal. In non-reducing conditions, one major band at 150 kDa is visualized, corresponding to entire lgG molecule. In reducing conditions, 50 kDa and 25 kDa bands are ed, corresponding to heavy and light chains of dy, respectively. These electrophoresis results confirm that Chloramine—T method doesn’t affect the integrity ‘of antibody. 3- Binding assays of radiolabeled H27K15 antibody on FR cells b1 Measurement of affinity binding of 125l-H27K15 The equilibrium dissociation constant (KD) was used as a measurement of binding affinity. The KD for 125I-H27K15 antibody was determined by a saturation assay where an increasing concentration of radiolabeled antibody was added to a constant number of cells.
Materials Solution of radiolabeled antibody in PBS containing 0.5% BSA W0 2012/110360 Specific activity (mCi/mg) Radiopurity (%) Dilution in PBS containing Range of concentrations: 4.5 05% BSA pg/mL to 0.54 nglmL (30 nM to 3.6 pM) 2-fold dilution series Solutions of radiolabeled antibody with 100—fold molar excess of unlabeled antibody (non-specific binding) : A solution containing 45 pg/mL of unlabeled antibody and 0.45 pg/mL of radiolabeled antibody was prepared and then 4-fold dilution series in PBS/BSA 0.5% were performed.
Cells :A sion of EL4-CSF-1 R cells at 40 x 106 cells/mL in PBS containing 0.5% BSA was prepared.
Method The EL4-CSF-1 R cells were incubated (2x106 in 50 uL PBS/BSA 0.5%) with increasing trations of radiolabeled antibody in a final volume of 150uL for 1h on ice with agitation.
Non-specific binding was determined by ubating an excess of unlabeled antibody (100-fold molar excess). ing incubation, reaction mixtures were overlaid onto 200 uL of a dibutylphtalate oil cushion and centrifuged in microfuge tubes at 12000 rpm for 3 min. Tubes were frozen in liquid nitrogen and the tips of the tubes containing the cell pellets were cut off for determination of radioactivity using a Wallace Wizard 2470 automatic counter calibrated for -125 radionuclide (efficiency: 63%).
Non-specific binding was determined by measuring the bound radioactivity of four point concentration of abeled antibody containing 100-fold molar excess of unlabeled antibody. A graph ng bound fraction versus free fraction was made and a linear regression was used in order to definite the slope of the straight line. Specific binding was defined by subtraction of the binding observed in W0 2012/110360 2012/052043 the presence (non-specific binding) from that observed in the absence (total binding) of excess unlabeled antibody.
Results The y constant of humanized 125l-H27K15 antibody for EL4—CSF-1 R cells and the maximum binding sites per cell were determined by Prism software.
The binding characteristics of 125l-H27K15 antibody for EL4—CSF-1 R cells are summarized below : Dissociation constant in nM 0.7161 1 0.061 in pg/mL 0.107 i 0.009 Number of binding sites per cell 3393 i 71 b2 Measurement of tion nt of led H27K15 The aim of this study was to determine whether the affinity of the reactive radiolabeled antibody is the same as of the unlabeled antibody. A radiolabeled displacement binding assay was performed with a constant concentration of radiolabeled antibody and serial dilutions of unlabeled antibody.
Material Solutions ofradiolabeled 125l-H27K15 antibody in PBS containing 0.5% BSA Specific activity (mCi/mg) Rad iopurity (.%) Concentration W0 10360 Solutions ofunlabeled ant/”body .' A solution at 450 nM (67.5 ug/m L) Was prepared and then 25-fold dilution series in PBS/BSA 0.5% were performed.
Range concentration: 450 nM to 7.56 pM.
CellsxA suspension of EL4-CSF-1R cells at 40 x 106 cells/mL in PBS ning 0.5% BSA was prepared.
Method: The cells were ted (2x106 in 50 uL PBS/BSA 0.5%) with 50 uL of radiolabeled antibody at 1.5 nM in the absence (total binding: control well) and in the presence of variable concentrations (above mentioned) in 50 uL of unlabeled antibody for 1h on ice with agitation. ing tion, reaction mixtures were overlaid onto 200 uL of dibutylphtalate oil cushion and centrifuged in microfuge tubes at 12000 rpm for 3 min. Tubes were frozen in liquid nitrogen and the tips of the tubes ning the cell pellets were cut off for determination of radioactivity using a gamma counter.
Percentage of relative binding of radiolabeled antibody was calculated as: Radioactivity in control well Radioactivity in test well x 100 (Control well is that with no unlabeled antibody t) Results The binding data are presented in Figure 21.
The ICso value obtained from competition curve was determined by Prism software and was converted to an absolute inhibition constant Ki using the Cheng- Prusoff equation (Biochem. Pharmacol, 22, 3099-3108, 1973) : Ki = leo 1 + ([L]/KD) [L] is concentration of radiolabeled antibody used in the assay leo is concentration of unlabeled antibody necessary to achieve 50% inhibition of radiolabeled antibody The leo value and the inhibition constant are summarized below : 0.856 :I: 0.090 0.128i 0.013 Inhibition constant in nM 0.504 t 0.053 In pglmL 0.076 1- 0.008 b3 Competition study between 125l-H27K15 and various antibodies Materials Solution ofradiolabe/ed H27K15 antibody in PBS ning 0.5% BSA .' As above Solutions ofunlabeled antibody ] The different antibodies are presented in table as follows: ---H9K12 H27K5 chCXllG6 3291 JF14 2-4A5 Concentration of stock 1 8.9 2 2 solution (mg/mL) For each antibody, a solution at 450 nM (67.5 pglmL) was prepared and then 25-fold on series in A 0.5% were performed. Range concentration: 450 nM to 7.56 pM.
Cells .'A suspension of F-1 R cells at 40 x 106 cells/mL in PBS containing 0.5% BSA was prepared.
Method The cells were incubated (2X106 in 50pL PBS/BSA 0,5%) with 50pL of 125|- H27K15 antibody at 1.5 nM in the absence (total binding? control well) and in the presence of variable concentrations (above ned) in 50pL of unlabeled competitor for 1h on ice with agitation.
Following incubation, reaction mixtures were overlaid onto 200pL of dibutylphtalate oil cushion and centrifuged in microfuge tubes at 12000rpm for 3 min. Tubes were frozen in liquid nitrogen and the tips of the tubes containing the cell pellets were cut off for determination of radioactivity using a gamma counter.
Percentage of relative binding of abeled antibody was calculated as: Radioactivity in test well x 100 ctivity in control well Control well is that with no competitor t.
Results The binding data are ted Figure 22 The |C50 value obtained from competition curve was determined by Prism software and was converted to an absolute inhibition constant Ki using the Cheng- Pursoff equation: Ki = leo 1 + ([L]/KD) [L] is concentration of 125l-H27K15 antibody used in the assay leo is concentration of competitor necessary to achieve 50% inhibition of 125I- H27K15 antibody K0 is affinity constant of 125l-H27K15 antibody.
For each competitor, the |Cso values and Ki constants are ized below: -chCXllG6 H19K12 H27K5 3291 |C50 1.483 a 1.280 4.- 0998 i 2.176 i 3.025 t No (nM) 0.220 0.246 0.173 0.281 0.588 ompefifion Ki 0.874 i 0.754 1- 0.588 i- 1.281 i 1.781 i (nM) 0.130 0.145 0.102 0.165 0.334 The affinity of the monoclonal antibodies of the ion (H27K15, chCXlIG6, H19K12 and H27K5) are quite similar with a value of Ki from 0.5 to 0.8 The Ki values of commercial monoclonal antibodies 3291 and JF14 are higher than 1nM. Consequently, these antibodies have lower affinity for CSF-1R antigen than the monoclonal antibodies of the Invention.
C — Competitive binding assays of human CSF-1 to D1-D5 human CSF-1 R CSF-1(1-444) was biotinylated using Biotin-NHS (Sigma ref. B3295- 10MG). Biotinylated CSF-1(100uI/well at 0.012pg/ml) was added to wells coated with FC- D1-D5 human CSF-1R (100uL/well at 1 pg/mL) (R&D systems ref. 329- MR-100) and bound molecule were ed using streptavidin—HRP. For competition ments, increasing amounts of monoclonal antibodies (1 ell from 0.030ug/ml to 200pg/ml) were pre-, 00- or post-incubated with biotinylated CSF—1.
We have tested commercial onal antibody 3291 (R&D Systems ref.
MAB3291), one monoclonal of the Invention H27K15, monoclonal antibody X (W02009/026303) as positive control as it is known to compete with CSF-1 g to its receptor, and Rituximab as negative control.
In case of pre-incubation, monoclonal antibodies were ted with coated human CSF-1 R one hour before addition of biotinylated CSF—1.
In case of post-incubation, biotinylated CSF-1 was incubated with coated human CSF-1 R one hour before addition of monoclonal antibodies.
In case of co-incubation, biotinylated CSF-1 and monoclonal antibodies were incubated together with coated human CSF-1R.
] Results .' It has been previously shown (see above) that both 3291 and H27K15 antibodies recognize one epitope (ie : lg-like domain 1) that is different from the one recognized by the positive control antibody X known to bind to the same binding site as CSF-1 (i.e.: in Ig-Iike domains 2-3). Here, we show that contrary to the positive control, both 3291 and H27K15antibodies are partial competitors of CSF—1 binding, even at high dose of antibody (lie. ~100 fold the IC50). In all the settings (pre, co or pest incubations), and at tion doses, H27K15 is able to decrease the CSF-1 binding to CSF-1 R by approximately 10 to % (see s 23, 24 and 25) while dy 3291 is able to decrease the same g by approximately 30 to 40% depending of the experimental setting.
W0 2012/110360 2012/052043 Accordingly the monoclonal of the present Invention are able to partially prevent binding of CSF1 to its receptor CSF—1 R.
This has been confirmed in the following experiment.
ELISA microplates were coated with O.1|Jg (lie. 100pL at 1ug/ml) of human CSF1 1-444 (Geneart— see SEQ ID N0247, Figure 32). 100 pL of Fc—D1-D5 human CSF-1 R (R&D systems ref 329—MR-100) at 0.125pg/mL was co-incubated in presence of increasing concentration of antibody. Bound Fc-D1-DS human CSF- 1R to CSF1 was detected using anti- —human-HRP (Bethyl 4P).
Since the antibody used for detection binds human Fc, murine antibody CXllG6 instead of antibody H27K15 was used for ition. Competitor mAb X (W02009/026303) was used as positive control as it is known to bind human CS F- 1R at the same site as human CSF—1. Rat IgGZa was used as negative control (irrelevant ic antibody that does not bind hCD115). s .' mAb X, as indicated in W02009/026303, inhibits totally the g of CSF1 (1-444) to Fc-D1—D5 human CSF-1R as expected for a competitive antibody. Both 3291 and mCXllG6, decrease only partially the Fc-D1- D5 human CSF-1 R binding to CSF1 even at high dose of antibody (lie. 100pg/mL). mCXllG6 and 3291 sed the binding of CSF1 to Fc—hCD1 15 by approximately 5-10% and 10—20%, respectively (see figure 26): These results are in agreement with those described above demonstrating a partial inhibition of [CSF1 binding to Fc-D1-D5 human CSF—1R by H27K15 or mAb 3291.
Figure 26 shows the partial decrease of binding of inant human Fc- human D1-D5 CD115 to human CSF1 by various mAb (coincubation experiment).
Human CSF1 /mL) was coated on 96 wells plate and incubated 1 hour 45 min with a mix (coincubation experiment) of recombinant Fc—D1-D5 human CSF- 1R (0,125 pg/mL) and increasing concentrations of mAb. The CD115 that bind to hCSF-1 was detected using anti-human Fc-lgG conjugated to HRP. 0- Competition study between 125l-H27K15 and lL-34, known as one natural ligands of CSF-1R receptor.
Materials WO 10360 ] Solutions ofradiolabeled antibodyin PBS containing 0.5% BSA 125l- H27K15 (as above) Solutions ofligands: Recombinant human lL-34 (26.1 kDa) was purchased by R&D Systems at a concentration of 0.422 mglmL. A on at 450 nM was prepared and then 25-fold dilution series in PBS/BSA 0.5% were performed.
Range tration: 450 nM to 7.56 pM.
Cells .‘A suspension of EL4-CSF-1R cells at 40 x 106 cells/mL in PBS containing 0.5% BSA was prepared.
Method Two different protocols were performed during this competition study with the natural ligands.
] The first one, the cells were coincubated (2x106 in 50pL PBS/BSA 0.5%) with 50 uL of 125l—H27K15 antibody at 1.5 nM in the absence (total binding: control well) and in the presence of variable trations (above—mentioned) in 50 pL of unlabeled competitor for 1h on ice with ion.
The second protocol was to incubate EL4—CSF-1 R cells with increasing concentrations of ligand for 30 min on ice prior to addition of radiolabeled H27K15 antibody. Then, the second incubation was also performed on ice for 1 hour with ion.
For the two experiments, reaction mixtures were overlaid onto 200 uL of dibutylphtalate oil cushion and centrifuged in microfuge tubes at 12000 rpm for 3 min. Tubes were frozen in liquid nitrogen and the tips of the tubes containing the cell pellets were cut off for determination of radioactivity using a gamma counter. tage of relative binding of radiolabeled antibody was calculated as: Radioactivity in test well x 100 Radioactivity in control well (Control well is that with no ligand present) Results: No displacement of 125l-H27K15 antibody binding was observed.
Consequently, H27K15 antibody and lL-34 ligand recognize ent epitopes of the CSF-1 R antigen.
W0 2012/110360 Moreover, competition binding study between 125l-lL-34 and zed H27K15 antibody has been performed which has shown that 125l-lL-34 binding was not displaced with increasing concentration of H27K15 antibody illustrating herein that the antibody of the invention does not compete with lL-34 for binding to the CSF—1 R receptor. hCXIIGS variants H27K5, H27K15 and H19K12 ical characterization.
A. Expression and purification of monoclonal antibodies Chimeric CXIIGG, hCXllG6 variants H19K12, H27K5, H27K15 and mab were expressed either by transient transfection of adherent CHO-K1 or CHO—DG44 cells or by polyclonal pools of stable CHO-DG44 transfectants.
B. Specificity of H27K5, H27K15 and H19K12 for CSF-1R among other tyrosine kinase receptors Met/70d Microtiter plates (Maxisorp, Nunc) were coated with 300 ng per well of each of the ing soluble receptors, purchased from R&D Systems: CSF—1ch 512-Fc (cat. 329-MR/CF); (EGFR)2—Fc-6xhis (cat. 1129-ER), Flt—3—Fc—6xhis (cat. 368-ST/CF), PDGFRB—Fc—this (cat. 385-PR/CF), vascular elial growth factor receptor (VEGFR)2-Fc—6xhis (cat. 357-KD/CF), -Fc-6xhis (cat. 321-FL-050), human SCFR (cat. 332-SR/CF) and PDGFRoc ECDs (cat. 322- PR/CF. Fifty ul of either H27K5, H27K15, H19K12 mAbs or rituximab (500 ng/ml in PBS) were added to the wells and plates were incubated for 1 h at 37°C. To l efficient coating of the wells, anti-human IgG (goat anti-human igG, Sigma cat. l3382) was also incubated with wells coated with or—human Fc fusion proteins FltFc-, PDGFRB-Fc, VEGFRZ-Fc, VEGFR1-Fc, while PDGFRoc- and oated wells were incubated with respectively anti-P DGF-Ra (mouse lgG1, R&Dsystems cat. MA8322) and anti-SCF-R goat lgG (R&DSystems cat. .
Antibody binding was detected with horseradish peroxidase (H RP)-conjugated Abs directed against either human lg kappa light chain (Bethyl Laboratories, cat. A80- 115P), goat 196 (Santa Cruz cat. sc2033) or mouse lg (Sigma cat. A 0412).
Following revelation with tetramethylbenzidine (Sigma, cat. T8665) (0.1 mg/ml in 0.05 M sodium acetate, 0.05 M citric acid, 7000), absorbance was W0 2012/110360 measured at 450 nm and ted by subtraction of ance at 540 nm using a spectrophotometer (Berthold, Tristar LB941).
Results Like chCXllGG, none of the humanized variants showed immunoreactivity to any of the other receptors ECD, while they strongly bound to immobilized CSF- 1R ECD (Figure 27). This result shows that humanization did not alter the specificity of mAbs H19K12, H27K5 and H27K15 for CS F-1 R among other tyrosine kinase receptors. 0. CSF-1R-blocking activity of hCXllG6 variants C.1 Blockade of soluble CSF-1R-Fc tested in the M-NFS-60 cell eration assay Method ' ] M-NFS—60 cells were washed twice with complete RPMl-1640 medium without CSF-1 and incubated overnight in the same medium for CSF-1 deprivation. To assay for neutralization of soluble human CSF-1R, 5 ng of human CSF-1R20e512-Fc were incubated for 30 min in white l microplates (ViewPlateTM-96, Packard) with serial dilutions of antibodies (H27K5, H27K15, H19K12 mAbs, chCXlIGS or rituximab in complete RPMl-1640 medium. 104 CSF- 1-deprived cells were then added to the culture wells er with 0.1 ng of human CSF-1 in a final assay volume of 100 pl. Cells were incubated for 48 h at 37°C and proliferation was quantified after oration of 5-bromo-2’- deoxyuridine (BrdU) for 2 h using the Cell Proliferation ELISA from Roche (cat. 223001) according to the cturer’s protocol. OD were measured in a spectrophotometer (Berthold Tristar L8941).
Results The mouse myelogenous ia cell line M-NFS-60 is dependent on CSF-1 for its growth and has previously been used to demonstrate the CSF-1R- blocking activity of murine mAb CXllGG. In this assay, M-NFS-60 cells are cultivated with human CSF-1 and human soluble homodimeric disulfide-linked CSF-1R20—512-Fc. Capture of CSF-1 by soluble CSF-1 R leads to inhibition of cell proliferation. Addition of antibodies neutralizing human CSF-1 R prevents CSF-1 W0 2012/110360 capture by e CSF-1 R and restores cell growth. in the presence of negative control rituximab, soluble CSF-1 R completely inhibited the proliferation of M-NFS- 60 cells ed by CSF-1 (Figure 28). H19K12, H27K5 and H27K15 produced a dose-dependent neutralization of soluble CSF—1R20-512—Fc and restored cell proliferation, as did chCXllG6. ND50 (neutralization dose giving 50 % of maximal CSF-1R—blocking ), calculated with the ad Prism software using a 5— parameter logistic equation, were similar for the 3 hCXllGB variants tested (29.8, .7 and 29.1 ng/ml for respectively , H27K5 and H27K15) and did not appear significantly different from that of parental mAb chCXllG6 (18.1 ng/ml).
C.2 de of cell-surface CSF-1R tested in the AML5-cell based assay Methods Immunocyz‘ochemisz‘a/ and flow cytometry analysis ofAML5 cells AML5 cells (OCl-AML5, DSMZ cat. 7) were analyzed by immunocytochemistry and flow cytometry. 5 x 105 cells were incubated for 30 min on ice with either anti-human CSF-1 R mAb 3291 e lgG1, clone 61701, 10 pg/ml) (R&D s cat. #MAB3291), murine lgGl isotype control (R&D Systems cat. #MAB002, 10 pg/ml), chCXllG6 (10 pg/ml) or rituximab in 100 pl PBS. Cells were then labeled for 30 to 45 min on ice with either phycoerythrine- conjugated goat ouse lg (BD Pharmingen cat. #550589) or fluorescein ocyanate—conjugated anti-human lgG F(ab’)2 (Millipore cat. #AQ112F).
Effect of CSF— 1 onAML5 cellproliferation AML5 cells were plated at 2.5 E4 cells/ 100 pl / well in either flat-bottomed (in experiments 1 and 2, TPP cat. #92096) or round-bottomed (in experiment 3, Falcon cat. #3077) 96-well plates. One hundred pl of medium containing human CSF-1 was added per well. Cells were cultured for 48 h and their proliferation was measured after a 4—h incorporation of BrdU, using the Cell Proliferation ELlSA from Roche (cat. #11647223001) according to the manufacturer’s protocol. OD were measured in a spectrophotometer (Berthold, Tristar LB941). Mean OD +/- sem were calculated from quadruplicate wells and plotted against log [CSF—1] (ng/ml) using GraphPad Prism to fit a nonlinear regression curve using a 3- parameter equation.
W0 2012/110360 Efi‘ect ofhCX/IGé‘ variants on AML5 cellproliferation ] Cells were cultured and plated in 96-well plates as described above.
Graded amounts of chCXllG6, H27K1'5, H27K5, H19K12 or negative control rituximab were added in 50 pl medium. Following a 30-min incubation at 37°C, 50 pl of medium containing 40 ng/ml hCSF-1 were added per well. Each experiment was med on‘4 identical 96-well plates, each comprising duplicates of each mAb concentration. Cells were cultured for 48 h and their proliferation was measured after a 4-h incorporation of BrdU as above. Result from each plate was first analyzed using ad Prism to fit a nonlinear regression curve with a 5- parameter equation. Plates giving results fitted by GraphPad Prism for at least 3 out of the 4 tested mAbs were selected to calculate the means +/- sem. Thus, experiments 1 and 2 were analyzed based on the results from 2 out of 4 plates (means calculated from quadruplicate OD values) and experiment 3 based on the results from 3 out of 4 plates (means calculated from 6 OD values). EC50 and R squares were calculated by GraphPad Prism for each mAb tested.
Results Colony-stimulating factor-1 has been reported to stimulate the growth of the human aCute myeloid leukemia cell line OCl-AML5 (AML5) (Drexler HG, Zaborski M, Quentmeier H., 2007. Cytokine se profile of human myeloid factor-dependent leukaemia cell lines. Leukemia 11:701-8). AML5 cells were analyzed by immunocytochemistry and flow cytometry. Staining was positive with the commercial anti-hCSF-1 R mouse lgG1 3291 (compared with mouse lgG1 isotype control) and with chCXllG6 red with rituximab), showing that AML5 cells expressed surface CSF-1 R (Figure 29A).
In order to set up a model for studying the effect of CSF-1 R blockage, it was necessary to first verify that CS F-1 induced a ependent increase in AML5 cell proliferation. Figure 298 shows that while AML5 are e of g in the absence of exogenous CSF-1, addition of the growth factor in the culture medium increases cell eration in a dose-dependent . AML5 cells are therefore not strictly dependent on CSF-1 for their , but they are CSF responsive. ‘ W0 2012/110360 The effects of hCXllG6 variants and of chCXllG6 were then tested on AML5 cells cultured with 10 ng/ml CSF—1, a concentration inducing near to maximal proliferation (Figure 298). Figure 290 shows the results from 3 independent experiments. Humanized variants H27K5, H27K15 and H19K12 as well as chCXllGG induced a dose-dependent se in AML5 cell proliferation.
Variability was observed between the experiments, reflected by differences in the - E050 for each mAb and the rather low R s calculated using GraphPad Prism, particularly in experiment 1 (Figure 29D). Therefore, hCXl|G6 variants could not be reliably ranked according to their EC50 in this assay. All 3 hCXllG6 variants appeared equally potent in inhibiting the CSF—1-dependent eration of AML5 cells.
C.3 Non-agonistic efiect on CSF-1R signaling and inhibitory effect on CSF dependent phosphorylation Methods B45 is a recombinant cell line obtained by stable transfection of murine NIH/3T3 cells with 66, an expression plasmid encoding human CSF-1R. B4-800—5 cells were seeded at 2 x 105 cells per 60—mm Petri dishes and cultivated for 72 h. Cells were serum-deprived by culture in 1 ml DMEM medium containing 1 % FCS at 37°C for 1 h before the experiments.
For studying CSF-1 R blockade or the effects of antibodies in the absence of cross-linking, cells were treated with 1 ml DMEM-1 % FCS containing mAb chCXllG6, H19K12, H27K5, H27K15 or human lgG1 isotype control mab for 1 h at 37°C. One hundred ng/ml hCSF-1 (lmmunoTools cat. 11343115) Were added to the cell culture for 5 min at 37°C, or cells were left unstimulated. in the antibody cross-linking ment, cells were treated with 1 ml DMEM-1 % FCS containing mAb chCXllGG, H19K12, H27K5, H27K15, human lgG1 isotype l rituximab, recombinant mouse lgGZa CXl|G6 or mouse lgGZa isotype l (R&D Systems cat. MABOO3) for 1 h on ice. Cells were washed with ice-cold PBS. Twenty pg/ml polyclonal goat ouse IgG (R&D Systems cat. , 20 pg/ml polyclonal goat anti-human lgG FcHRP (Jackson cat. 109- 035-098) or 100 ng/ml hCSF-1 were added to the cells for 10 min at 37°C, or cells were left untreated. Medium was removed and cell layers were lysed by adding W0 2012/110360 2012/052043 tion buffer (62 mM Tris, 10 % glycerol, 2 % SDS, 100 mM DTT, pH 6.8) in the Petri dishes. Cell ts were analyzed on Western blots, probed with the following antibodies: polyclonal rabbit anti-phospho-CSF-1RTV'708 (Santa Cruz Biotechnology cat scR), polyclonal rabbit anti-CSF-1R (H300, Santa Cruz Biotechnology cat. sc—13949, dilution 1/200) and monoclonal mouse anti-fi-actin (Sigma-Aldrich cat. A2228, dilution 1/2000) for the detection of tyrosine?“- phosphorylated CSF-1 R, total CSF-1R and B-actin, respectively. Rabbit and mouse primary antibodies were detected with onal goat anti-rabbit or rabbit anti-mouse lgHRP (DakoCytomation cat. P0448, P0260) respectively.
Results We investigated the effects of hCXllG6 variants H19K12, H27K5 and H27K15 and of chCXllG6 on the CSFdependent phosphorylation of tyrosine708 and their lack of agonistic effect. in the e of CSF-1, r mAb induced receptor phosphorylation when tested at either 0.1, 1 or 10 ug/ml, as seen with the antibody specific for CSF—1 R phosphorylated on tyrosine708. This showed that all CXllG6-mAb derivatives, either in ic or.humanized forms, did not exert any agonistic effect when d alone on B45 cells.
Upon CSF-1 stimulation, a band of ~150 kDa corresponding to full-length CSF-1 R was phosphorylated and total cellular CSF-1 R was decreased in cells ed with rituximab isotype control or t antibody. Three other bands of ' lower molecular weights were detected with the anti-phospho-CSF-1RTYr 703 antibody. When B45 cells were incubated at 37°C with chCXllGG or hCXllG6 variants before stimulation with CSF-1, the intensities of the 4 bands recognized by the anti-phospho-CSF-1RTW08 mAb were decreased compared to those observed in mab-treated cells. Reduction of the intensity of the 150-kDa band was comparable to that previously observed with hybridoma-derived CXllG6 in . similar conditions. The decrease in intensity of the two lower bands appeared more drastic. The inhibitory effects of chCXllG6 and the hCXllG6 variants on CSF- 1R Tyr708 phosphorylation were observed at 0.1, 1 and 10 pg/ml.
To anticipate the potential development of a humoral response to hCXllG6 in treated patients mAb (human uman antibody response), we next investigated the effect of mAb cross-linking by secondary anti-lgG Abs on CSF-1 R W0 2012/110360 receptor phosphorylation. linking of mouse CXllGG produced only a faint band of 150 kDa detected with the anti-phospho-CS F-1 RTYF7°8 antibody as previously ed with hybridoma-derived CXIIG6 and a slight down-regulation of total CSF-1 R was detectable, possibly reflecting a weak activation of CSF-1R.
Upon linking, hCXllG6 variants and chCXllGG also produced a 150 kDa band with low intensity. The intensity of the 150 kDa phosphorylated CSF-1R band was extremely weak compared to that observed after stimulation with 100 ng/ml CSF—1. The lower MW bands induced by CSF-1 were not detected by the anti- CSF-1RTY'703 antibody after cross-linking of any anti-CSF-1 R mAb tive, either chCXllG6 or 6 variants.
These experiments demonstrate that hCXllG6 variants H19K12, H27K5 and H27K15, like chCXllGG', are capable of partially inhibiting CSFdependent phosphorylation of CS F-1 R and have no direct agonistic activity on CSF-1 R.
Cross-linking of mAbs on the cell surface has only a minimal effect on CSF-1 R phosphorylation.
D- Cytotoxicity to EL4~CSF-1R target cells Method The F-1 R recombinant cell line was generated by stable transfection of the murine lymphoma-derived T cell line EL4 (ATCC cat. TlB-39) with a lentiviral vector encoding human full-length CSF-1 R. Surface CSF-1R expression was verified by immunostaining with mAbs CXllG6 (mouse lgGZa) or 3291 and flow cytometry analysis (data not shown).
EL4-CS F-1 R cells were washed in DMEM complete medium, resuspended in the same medium and seeded in l plates at 2 x 104 cells per well in 50 ul.
Cells were opsonized for 45-60 min on ice with 50 pl of antibodies diluted in culture medium. 50 pl of human peripheral blood mononuclear cells (PBMC) were then added at various effector-to-target (EzT) ratios. Humanized CXllG6 ts, chCXl|G6 and negative l Rituximab were tested at 10 ng/ml, 0.3 and 10 ug/ml. Control wells containing 150 pl of culture medium, target cells or PBMC alone were run in parallel to measure (i) culture medium (CM) background, (ii) culture medium + Lysis Solution background, (iii) target cell neous release (SR), (iv) effector cell spontaneous release at each PBMC concentration and (v) 2012/052043 target cell maximal e (MR) in presence of Lysis Solution. Plates were centrifuged at 250 x gfor 4 min and incubated overnight at 37°C. The next day, 15 pl of Lysis Solution 10X (Promega cat. G182A) were added to control wells containing culture medium or target cells alone and plates were further incubated for 45 min at 37°C. Lactate deshydrogenase (LDH) was quantified in the culture supernatants using the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega cat. G1780) according to the manufacturer’s instructions. Absorbance was recorded at 490 nm using the TriStar LB 941 reader and the in 2000 software from Berthold logies.
Mean CM background was subtracted from experimental, target SR and effector SR values. Mean CM + Lysis Solution background was subtracted from target MR values. tical analysis was done using the OD values, after subtraction of mean CM and SR controls, with GraphPad Prism software using a rametric Mann-Whitney one-tailed t-test (for comparing chCXllG6 or each hCXl|G6 variant with rituximab) or two-tailed t-test (for comparing each S variant with chCXllG6). Percent lysis was calculated using the following formula: % lysis = experimental — mean target SR - mean effector SR x100 mean target MR — mean target SR Results The ADCC activities of chCXlIGG and of hCXI|G6 variants.(human IgG1) were tested on target EL4—CSF-1 R cells, using PBMC from different blood donors.
Effector cells from donor #1 were used at an EET ratio of 25:1 (Em 30A). In this experiment, above 10 % direct lysis was observed in the absence of mAb, which may reflect the activity of NK cells contained in the PBMC. Values obtained with negative control rituximab were in the same range. It had been verified by flow cytometry analysis that EL4-CSF-1 R cells did not bind rituximab (data not shown). At 10 nglml mAb, no specific lysis (above the unspecific lysis observed in the presence of rituximab) was found with the SF-1 R mAbs. At 0.3 pg/ml mAb, chCXllG6 induced above 20% cytotoxicity. Lysis by the 3 6 variants was in the same order of ude. At high mAb concentrations (10 pg/ml), all 3 6 variants produced close to 35 % cytotoxicity, while lysis by chCXllGS remained under 20 %.
Another experiment was performed using effector cells from donor #2 at E:T ratios of 25:1, 50:1 or 100:1 (Figure 30B). Direct lysis was not detected, in contrast with the first experiment. Background cytotoxicity was lower than 10% with rituximab at all E:T ratios tested. Results were in good correlation with those from the previous experiment: no specific lysis was obsen/ed at low mAb concentrations (10 ng/ml) but at 0.3 and 10 pg/ml, chCXllGG and the 3 hCXllG6 variants induced significant specific lysis of EL4-CSF-1 R cells. At both these mAb concentrations and all E:T ratios tested, lysis of target cells was again higher with H27K5, H27K15 and H19K12 than with GG (p=0.02).
These results demonstrate that chCXIiGfi and the hCXllGE variants have the potential of killing target cells expressing surface CSF-1 R. eutic effect of chimeric and humanized anti-CSF-1R mAbs in the BeWo tumor model Since chCXllG6 and hCXllG6 variants are specific for human CSF—1 R and do not recognize its murine g, their in Vivo effects can only be igated in mouse models using human CSF-1R-positive tumors. However, in the absence of human CSF-1, human CSF—1 R remains inactive and blockade of its function cannot be studied. Moreover, blockade of —positive host cells (tumor- associated hages, osteoclasts), which is expected to provide therapeutic , is not feasible in this model system. In the following experiments using human CSF-1R-positive BeWo tumors, only the cytotoxic effects of the mAbs on the tumor cells may result in therapeutic y.
BeWo human chariocarcinoma cal/s exgress e CSF- 7R BeWo cells cultivated in vitro were immunostalned with mAb H27K15 (lead humanized anti-CSF—1 R) and fluorescence was analyzed by al microscopy.
The specific ng observed with , compared with negative control rituximab, shows that BeWo cells express human CSF-1 R on their surface. BeWo cells do not secrete CSF—1, as found by ELISA titration of the culture supernatants (result not shown).
A solid tumor derived from BeWo cells implanted sub-cutaneously in NMR1 nude mice was included in OCT for analysis by immunohistochemistry. 2012/052043 Frozen tissue sections were stained with the murine n of CXIIG6 or an isotype control. A strong specific staining was observed throughout the tumor, reflecting both cell e and cytoplasmic expression of hCSF-1 R in BeWo tumor cells in vivo.
Experiment 7 .' Therapeutic effect ofchimeric (IX/[66 in the BeWo choriocarcmoma tumormodel Four million BeWo cells were implanted subcutaneously in the flanks of NMR1 nude mice. A group of 11 mice was treated with 3 injections of chimeric CXIIGS (chCXllG6, 50 mg/kg in PBS, IP, administered at days 1, 3 and 7) while another group of 11 mice was treated with rituximab isotype control based on the same scheme. Inhibition of tumor growth (Figure 31A) and prolongation of mouse survival (Figure 31B) were observed in. chCXllG6-treated mice, showing that ing human -positive BeWo tumors with this mAb has therapeutic effect.
Experiment2 : Therageutic efl'ect ofchimeric CX/IG6 and humanizedH27K75 in the BeWo choriocarcinoma tumor model The above protocol was repeated, with 2 modifications : - chCXllG6 or humanized H27K15 mAbs were tested (10 mice/group) and compared with isotype control rituximab - mAbs were ed 3 times a week for 3 weeks, instead of one week only gation of the treatment with chCXllG6 or with H27K15 did not e the results in terms of tumor growth inhibition or mouse survival, as compared with the first experiment. However, both mAbs inhibited tumor growth as compared with the rituximab isotype control group. In the case of H27K15, the reduction in tumor volumes was statistically significant at day 14 using Mann—Whitney test and close to significant at later time points (day 17 and 21). With chCXllG6, reduction in tumor volumes was close to statistically significant.
References ' WO 01/30381 W0 2012/110360 2012/052043 - WO 03/059395 . EP 1488792 A . US 2005059113 ' EP 901463 B - EP 83286 A . EP 206920 A - US 5747323 - WO 94/28152 - WO 97l04119 - WO 94/18992 - WO 96/17070 - W02009/026303 ' SHERR. Colony-stimulating factor-1 receptor. blood. 1990, vol.75, no.1, p.1-12.
- HUME, et al. Regulation of CSF-1 receptor expression. Molecular reproduction and pment. 1997, vol.46, no.1, p.46-52.
- Roussel AND SHERR, 1989, PNAS, 86, 7924-7927 F ASHMUN et al., 1989, Blood, 73, 827—837 - KLUGER, et al. Macrophage -stimulating -1 receptor expression is associated with poor outcome in breast cancer by large cohort tissue rray analysis. Clinical cancerresearch . 2004, vol.10, no.1, p.173-7.
- SCHOLL, et al. Anti-colony-stimulating factor-1 antibody staining in primary breast adenocarcinomas correlates with marked inflammatory cell infiltrates and prognosis. Journal ofthe National Cancer Institute. 1994, vol.86, no.2, p.120-6.
. CHAMBERS, et al. Overexpression of epithelial hage colony- stimulating factor (CSF-1) and CSF-1 receptor: a poor prognostic factor in 2012/052043 epithelial ovarian cancer, contrasted with a tive effect of l CSF-1.
C/inica/ Cancer Research. 1997, vol.3, no.6, p.999-1007.
. BATOCCHI, et al. Expression of the macrophage colony-stimulating factor and its receptor in gynecologic malignancies. Cancer. 1991, vol.67, no.4, p.990-6.
- KIRMA, et al. Elevated expression of the oncogene c-fms and its ligand, the macrophage colony-stimulating factor-1, in al cancer and the role of transforming growth -beta1 in inducing c-fms expression. Cancer res. 2007, vol.67, no.5, p.1918-26.
- HEMMERLEIN, et al. Expression of acute and late-stage inflammatory antigens, c-fms, CSF-1, and human monocytic serine esterase 1,, in tumor- associated macrophages of renal cell carcinomas. Cancer immunology, immunotherapy. 2000, vol.49, no.9, p.485-92.
- IDE, et al. Expression of colony-stimulating factor 1 receptor during prostate development and prostate cancer progression. Proc. Natl. Acad. Sci.
USA. 2002, vol.99, no.22, p.14404—9.
' RAMBALDI, et al. Expression of the macrophage colony-stimulating factor and c—fms genes in human acute myeloblastic ia cells. Journal of Clinical Investigation. 1988, vol.81, no.4, p.1030-5. - , et al. Anti-colony-stimulating factor-1 antibody staining in primary breast adenocarcinomas correlates with marked inflammatory cell infiltrates and sis. Journal of the National Cancer Institute. 1994, vol.86, no.2, p. 1 20-6.
. TANG, et al. M-CSF (monocyte colony stimulating ) and M-CSF receptor expression by breast tumor cells: M-CSF mediated recruitment of tumor infiltrating monocytes?. Journal ofce/lu/arbiochemisl/y 1992, vol.50, no.4, p.350- . SCHOLL, et al. Circulating levels of colony-stimulating factor 1 as a prognostic indicator in 82 patients with epithelial ovarian cancer. hjournal of cancer. 1994, vol.69, no.2, p.342-6.
. SCHOLL. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study.
Breast cancer research and treatment. 1996, .vol.39, no.3, p.275-83.
' DORSCH, et al. Macrophage colony—stimulating factor gene transfer into tumor cells induces macrophage infiltration but not tumor suppression.
Europeanjournal ofimmunology. 1993, vol.23, no. 1, p.186-90.
, - WANG, et al. ion of monocyte migration by recombinant macrophage colony-stimulating factor. Journal ofimmunology. 1988, 1, no.2, p.575-9.
~ FILDERMAN, et al. Macrophage colony-stimulating factor (CSF-1) enhances invasiveness in CSF-1 receptor-positive carcinoma cell lines. Cancer res. 1992, vol.52, no.13, p.3661—6. o DORSCH, et ai. Macrophage colony-stimulating factor gene transfer into tumor cells s macrophage infiltration but not tumor suppression.
Europeanjournal ofimmunology. 1993, vol.23, no.1 1 86-90. , p.
. SCHOLL. ating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study.
Breast cancer research and treatment. 1996, vol.39, no.3, p.275-83. 0 BARON, et al. Modulation of MHC class Ii transport and Iysosome distribution by macrophage-colony stimulating factor in human tic cells derived from monocytes. Journal ofcell science. 2001, vol.114, , p.999- 1010.
. CECCHINI, et al. Role of CSF-1 in bone and bone marrow development. Molecularreproa’ucfian and pment. 1997, vol.46, no.1, p.75- . BRUZZANiTI, et al. lar regulation of osteoclast ty.
Reviews in endocrine. 2006, vol.7, no.1-2, p.123-39.
- CICEK, et al. Breast cancer bone metastasis and current small therapeutics. mez‘astasis reviews. 2006, vol.25, no.4, p.635-44.
W0 2012/110360 . KITAURA, et al. The journal of clinical investigation. M-CSFmed/‘ates TNF-induced inflammatory ysis. 2005, vol. 1 1 5, no. 1 2, p.341 8-27. o MARSHALL, et al. Blockade of colony stimulating factor-1 ) leads to inhibition of DSS-ind uced colitis. Inflammatory bowel diseases. 2007, vol.13, no.2, p.219-24.
- JOSE, et al. Blockade of macrophage colony-stimulating factor reduces macrophage proliferation and accumulation in renal allograft rejection.
Americanjournal splantation . 2003, vol.3, no.3, 300. ~> KUTZA, et al. hage colony-stimulating factor antagonists inhibit replication of HIV-1 in human macrophages. Jouma/ofimmunology. 2000, no.164, p.4955-4960.
- SMITH, et al. Identification of common molecular subsequences.
Journal ofMolecular Biology. 1 981 no. 1 47, p. 195-7.
- HARLOW. Antibodies: A Laboratory manual. 2nd edition. Cold Spring Harbor: Laboratory press, 1988.
- HAMMERLlNG, et al. Monoclonal dies and T Cell Hybridomas.
New York: Elsevier, 1981. p.563-681.
- SMITH, et al. Identification of common molecular subsequences. l ofMolecularBiology. 1 981 1 47, p. 195-7. , no.
- LENNARD. Standard protocols for the construction of scFv libraries.
Methods in molecular y. 2002, no. 1 78, p.59-71.
- POLJAK. Production and structure of diabodies. Structure. 1994, vol.2, no.12, p.1121-3.
- HUDSON, et al. High avidity scFv multimers; diabodies and triabodies.
Journal ofimmunological methods. 1999, vol.231, no. 1 —2, p. 1 77-89.
' KIPRIYANOV. Generation of bispecific and tandem diabodies.
Methods in molecular y. 2002, no.178, p.317—31.
- HOLLIGER, et al. Engineered antibody fragments and the rise of single domains. Nature biotechnology. 2005, vol.23, no.9, p.1126-36.
W0 2012/110360 - HOOGENBOOM, et al. Natural and designer binding sites made by phage display technology. Immunologytoday 2000, vol.21, no.8, p.371-8.
. MARKS, et al. sing immunization: building high affinity human antibodies by chain shuffling. Biotechnology. 1992, , no.7, 83.
- BARBAS, et al. In vitro evolution of a neutralizing human antibody to human immunodeficiency virus type 1 to enhance affinity and broaden strain cross—reactivity. Proceedings ofthe NationalAcademy ofSciences ofthe United States ofAmerica. 1994, vol.91, no.9, p.3809-13.
. , SCHIER. Identification of functional and structural amino-acid residues by onious mutagenesis. Gene. 1996, vol.169, no.2, p.147-55.
- YELTON. Affinity maturation of the BR96 anti-carcinoma dy by codon-based mutagenesis. J. immunoi. 1995, vol.155, no.4, p.1994-2004.
- JACKSON, et al. In vitro antibody maturation. Improvement of a high affinity, neutralizing dy against IL—1 beta. J. immunol. 1995, vol.154, no.7, p.3310—9.
' HAWKINS, et al. Selection of phage antibodies by binding affinity.
Mimicking affinity tion. Journal ofmolecularbio/ogy 1992, vol.226, no.3, p.889-96.
- SMITH, et al. Identification of common molecular subsequences.
Journal ofMolecular Biology. 1 981 1 47, p. 1 95-7. , no.
- N, et al. Preparation of bispecific antibodies byvchemical recombination of monoclonal immunoglobulin G1 fragments. e. 1985, vol.229, no.4708, p.81-3.
- SHALABY, et al. Development of humanized bispecific antibodies reactive With cytotoxic lymphocytes and tumor cells overexpressing the HER2 protooncogene. The Journal ofexperimentalmedicine. 1992, vol.175, no.1, p.217- ' KOSTELNY, et al. Formation of a itic antibody by the use of Ieucine zippers. J. immunoi. 1992, vol.148, no.5, p.1547-33.
- ZAPATA, et al. Engineering linear 2 fragments for efficient production in Escherichia coli and enhanced antiproliferative activity. Protein engineering. 1995, vol.8, no.10,. p.1057-62.
. HERMANSON. jugate techniques. Academic press, 1996.
~ HERMANSON. jugate techniques. Academic press, 1996. p.118-228.
- HERMANSON. jugate ques. Academic press, 1996. p.229-285.
~ FELGNER, et al. Cationic liposome mediated ection.
Proceedings ofthe n Pharmacology Society. 1989, vol.32, p.115-21.
- HODGSON, et al. Virosomes: ic liposomes enhance retroviral transduction. Nature biotechnology. 1996, vol.14, no.3, p.339-42.
° REMY, et al. Gene transfer with a series of Iipophilic DNA-binding molecules. Bioconjugate chemist/y. 1994, vol.5, no.6, p.647-54.
. LATHE, et al. Plasmid and bacteriophage vectors for excision of intact inserts. Gene. 1987, vol.57, no.2-3, p.193-201.
- LUPTON, et al. Mapping genetic elements of Epstein-Barr virus that facilitate extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human cells. Molecularand cellularbio/ogy. 1985, vol.5, no.10, p.2533-42.
- YATES, et al. Stable replication of plasmids derived from Epstein-Barr virus in s mammalian cells. Nature. 1985, vol.313, no.6005, p.812—5.
. SUMMERS, et al. Multimerization of high copy number plasmids causes instability: ColE1 encodes a determinant essential for plasmid monomerization and stability. Cell. 1984, , no.4, p.1097-103.
- SUTTER, et al. Nonreplicating vaccinia vector efficiently ses recombinant genes. Proc. Natl. Acaa’. Sci USA. 1992, vol.89, no.22, p.10847- . MEYER, et al. Mapping of deletions in the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. The Journal of general virology. 1991, vol.72, , p.1031-8.
' SUTTER, et al. A recombinant vector derived from the host range- restricted and highly attenuated MVA strain of vaccinia virus stimulates protective immunity in mice to influenza virus. Vaccine. 1994, vol.12, no.11, p.1032-40. o GRAHAM, et al. Methods in molecular biology. Edited by MURREY.
The human press inc, 1991. p.109-128.
- ZAKHARCHUK, et al. Physical mapping and homology studies of egg drop syndrome (EDS-76) adenovirus DNA. Archives of virology. 1993, vol.128, no.1~2, p.171-6.
. SPIBEY, et al. Molecular cloning and restriction clease mapping of two strains of canine adenovirus type 2. The Journal ofgeneral virology. 1989, vol.70, no.Pt 1, p.165-72.
- JOUVENNE, et al. g, physical mapping and cross-hybridization of the canine adenovirus types 1 and 2 genomes. Gene. 1987, vol.60, no.1, p.21- - Ml'l'l'AL, et al. Development of a bovine adenovirus type 3-based expression vector. The Journal ral virology. 1995, vol.76, no.Pt 1 , p.93- 102.
~ BlSCHOFF, et al. An adenovirus mutant that ates selectively in p53-deficient human tumor cells. Science. 1996, vol.274, 6, p.373-6.
- HEISE, et al. An adenovirus E1A mutant that demonstrates potent and selective systemic anti—tumoral y. Nature Medicine. 2000, vol.6, no.10, p.1134—9.
- FUEYO, et al. A mutant tic adenovirus ing the Rb pathway produces anti-glioma effect in vivo. Oncogene. 2000, vol.19, no.1, p.2—12.
- MCIVOR. Human purine nucleoside phosphorylase and ine deaminase: gene er into cultured cells and murine hematopoietic stem cells by using recombinant amphotropic retroviruses. Molecular and cellular biology. 1987, vol.7, no.2, p.838-46.
. TABIN, et al. Adaptation of a retrovirus as a eukaryotic vector transmitting the herpes simplex virus thymidine kinase gene. Molecularand cellularbio/ogy. 1982, vol.2, no.4, p.426-36.
. TAKEBE, et al. SR alpha promoter: an efficient and ile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecularand cellularbio/ogy 1988, vol.8, no.1, p.466—72.
- CHEN, et al. Breast cancer selective gene expression and therapy mediated by recombinant adenoviruses containing the DF3/MUC1 promoter. The l ofclinicalIhvest/gafion. 1995, vol.96, no.6, p.2775-82.
- SCHREWE, et al. Cloning of the complete gene for carcinoembryonic antigen: is of its promoter tes a region ing cell type—specific expression. Molecular and cellular biology. 1990, vol.10, no.6, p.2738-48.
. VILE, et al. Use of tissue-specific expression of the herpes simplex virus thymidine kinase gene to inhibit growth of established murine melanomas ing direct intratumoral injection of DNA. Cancerres.. 1993, vol.53, no.17, p.3860-4.
. HARRlS, et al. Gene therapy for cancer using tumor-specific prodrug activation. Gene therapy. 1994, vol.1, no.3, p.170—5. _ KANAI, et al. in vivo gene therapy for alpha—fetoprotein-producing hepatocellular carcinoma by adenovirus-mediated transfer of cytosine deaminase gene. Cancerres.. 1997, vol.57, no.3, p.461-5.
. PEREZ. Principles and ce of radiation oncology. 2nd edition.
LIPPINCOTT, 1992.
- KOZAK M. An is of 5'-noncoding sequences from 699 vertebrate messenger RNAs. NucleioAcio’s Res. 1987,15(20): 148.
- CHOTHlA and LESK. Canonical structures for the hypervariable regions of immunoglobulins (1987) J Mol Biol. 1987 Aug 20;196(4):901-17.

Claims (22)

What is claimed
1. An isolated, recombinant or purified antibody that specifically binds to CSF-1R, wherein said antibody comprises: (i) (a) first variable region consisting in SEQ ID NO:42, and (b) a second variable region consisting in SEQ ID NO:44; or (ii) (a) first variable region ting in SEQ ID NO:43, and (b) a second variable region consisting in SEQ ID NO:45; or (iii) (a) first variable region consisting in SEQ ID NO:42, and (b) a second variable region consisting in SEQ ID NO:46.
2. The antibody of claim 1 (i), wherein it comprises (a) a heavy chain consisting in SEQ ID NO:37, and (b) a light chain consisting in SEQ ID NO:39.
3. The antibody of claim 1 (ii), wherein it comprises (a) a heavy chain consisting in SEQ ID NO:38, and (b) a light chain consisting in SEQ ID NO:40.
4. The antibody of claim 1 (iii), n it comprises (a) a heavy chain consisting in SEQ ID NO:37, and (b) a light chain consisting in SEQ ID NO:41.
5. The antibody of claim 1 which is a polyclonal antibody, a onal dy, an Fab, an Fab’, an F(ab’)2, an Fv, an scFv, an antigen binding fragment or a diabody.
6. The antibody of any one of claims 1 to 5, wherein the CSF-1 R is human CSF-1 R.
7. A nucleic acid sequence encoding an antibody of any one of claims 1 to 6.
8. A vector containing the nucleic acid sequence of claim 7.
9. The vector of claim 8 which is of d or viral origin.
10. The vector of claim 9 which is of viral origin and which is derived from a poxvirus, an adenovirus, a retrovirus, a herpes virus, an alphavirus, a foamy virus or an adeno-associated virus.
11. The. vector of claim 10, wherein said poxvirus is a vaccinia virus or a canarypoxvirus.
12. The vector of claim 11, wherein said vaccinia virus is an MVA.
13. A cell comprising the nucleic acid sequence of claim 7, provided that if the cell is a human cell it is ex vivo.
14. The cell of claim 13, which is a eukaryotic cell.
15. The cell of claim 14, wherein said otic cell is a mammalian cell.
16. The cell of claim 15, wherein said ian cell is a CHO or a BHK cell.
17. A process for producing an antibody of any one of claims 1 to 6 comprising culturing a cell of any one of claims 13 to 16 under conditions permitting expression of the antibody and purifying the antibody from the cell or medium surrounding the cell.
18. A pharmaceutical composition comprising the antibody of any one of claims 1 to 6, the nucleic acid sequence of claim 7 or the vector of any one of claims 8 to 12 and a pharmaceutically able carrier.
19. The antibody of any one of claims 1 to 6, the nucleic acid sequence of claim 7, the vector of any one of claims 8 to 12 or the pharmaceutical ition of claim 18 for use as a medicament.
20. The antibody of any one of claims 1 to 6, the nucleic acid of claim 7, the vector of any one of claims 8 to 12 or the pharmaceutical composition of claim 18 for use in the treatment of a disease selected from the group consisting in cancer, a disease associated to an increased osteoclast activity, inflammatory disease and rheumatoid arthritis.
21. Use of the antibody of any one of claims 1 to 6, the nucleic acid of claim 7, the vector of any one of claims 8 to 12 or the ceutical composition of claim 18 in the manufacture of a ment for the treatment of a disease ed from the group consisting in , a disease associated to an increased osteoclast activity, inflammatory disease and rheumatoid arthritis.
22. The antibody of claim 1, substantially as herein described with reference to any one of the Examples and/or
NZ612038A 2011-02-14 2012-02-07 Antibody against the csf-1r NZ612038B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US13/026,944 2011-02-14
US13/026,944 US8470977B2 (en) 2008-03-14 2011-02-14 Antibody against the CSF-1R
PCT/EP2012/052043 WO2012110360A1 (en) 2011-02-14 2012-02-07 Antibody against the csf-1r

Publications (2)

Publication Number Publication Date
NZ612038A NZ612038A (en) 2014-09-26
NZ612038B2 true NZ612038B2 (en) 2015-01-06

Family

ID=

Similar Documents

Publication Publication Date Title
US9982055B2 (en) Antibody against the CSF-1R
US9221912B2 (en) Antibody against the CSF-1R
NZ612038B2 (en) Antibody against the csf-1r