NZ577012A - Human zymogen granule protein 16 as a marker for detection of gastric cancer - Google Patents

Abstract

Disclosed is a method for detecting gastric cancer, comprising: (i) providing a biological sample; and (ii) detecting the levels of human zymogen granule protein 16 (ZG16) in said sample, wherein the overexpression of ZG16 in the biological sample is indicative 5 of cancer.

Description

I *10058782792* PATENTS FORM NO. 5 Our ref: GL 228914NZPR NEW ZEALAND PATENTS ACT 1953 Complete After Provisional No. 577012 Filed: 15 May 2009 COMPLETE SPECIFICATION MARKERS FOR DETECTION OF GASTRIC CANCER We, PACIFIC EDGE BIOTECHNOLOGY LIMITED a New Zealand company of CI- Deloitte, 8th Floor, Otago House, 481 Moray Place, Dunedin, New Zealand hereby declare the invention, for which we pray that a patent may be granted to us and the method by which it is to be performed, to be particularly described in and by the following statement: 101788190_1. DOC: GL:qwgtn •ra£gsrtoF"&Bnv \ i, HAY 2010 receiver 2 MARKERS FOR DETECTION OF GASTRIC CANCER FIELD OF THE INVENTION This invention relates to detection of cancer. Specifically, this invention relates to the 5 use of genetic and/or protein markers for detection of cancer, and more particularly to the use of genetic and/or protein markers for detection of gastric cancer.

BACKGROUND Survival of cancer patients is greatly enhanced when the cancer is detected and 10 treated early. In the case of gastric cancer, patients diagnosed with early stage disease have 5-year survival rates of 90%, compared to approximately 10% for patients diagnosed with advanced disease. However, the vast majority of gastric cancer patients currently present with advanced disease. Therefore, developments that lead to early diagnosis of gastric cancer can lead to an improved prognosis for the patients.

Identification of specific cancer-associated markers in biological samples, including body fluids, for example, blood, urine, peritoneal washes and stool extracts can provide a valuable approach for the early diagnosis of cancer, leading to early treatment and improved prognosis. Specific cancer markers also can provide a means for monitoring disease 20 progression, enabling the efficacy of surgical, radiotherapeutic and chemotherapeutic treatments to be tracked. However, for a number of major cancers, the available markers suffer from insufficient sensitivity and specificity. For example, the most frequently used markers for gastric cancer, ca19-9, ca72-4 and carcino-embryonic antigen (CEA) detect only about 15-50% of gastric tumors of any stage, declining to approximately 2-11% for early 25 stage disease. Thus, there is a very high frequency of false negative tests that can lead patients and health care practitioners to believe that no disease exists, whereas in fact, the patient may have severe cancer that needs immediate attention. Moreover, these markers can give false positive signals in up to 1/3 of individuals affected by benign gastric disease.

SUMMARY OF THE INVENTION Aspects of this invention provide methods, compositions and devices that can provide for detection of early stage cancer, and decrease the frequency of false positives and false negative test results.

In certain embodiments, molecular analyses can be used to identify genes that are highly expressed in gastric tumor tissue, but not necessarily over-expressed compared to non-malignant gastric tissue. Such analyses include microarray and quantitative polymerase 3 chain reaction (qPCR) methods. Cancer genes, RNAs and proteins encoded by those genes are herein termed gastric tumor markers (GTM). It is to be understood that the term GTM does not require that the marker be specific only for gastric tumors. Rather, expression of GTM can be increased in other types of tumors, including malignant or non-malignant 5 tumors, including gastric, bladder, colorectal, pancreatic, ovarian, skin (e.g., melanomas), liver, esophageal, endometrial and brain cancers, among others. It should be understood, however that the term GTM does not include the prior art markers, such as CA19-9, CA72-4, pepsinogen and CEA, or any other markers that have been previously identified as being indicative of gastric tumors. Some GTM are secreted or escape from tumors at sufficient 10 levels to be diagnostic of gastric cancer with a high degree of reliability, and in other cases, measurement of two or more GTM can provide reliable diagnosis of gastric cancer.

Proteins that are secreted by or cleaved from the cell, either alone or in combination with each other, have utility as serum or body fluid markers for the diagnosis of gastric 15 cancer or as markers for monitoring the progression of established disease. Detection of protein markers can be carried out using methods known in the art, and include the use of monoclonal antibodies, polyclonal antisera and the like.

Specifically the present invention provides for a method for detecting gastric cancer, 20 comprising: (i) providing a biological sample; and (ii) detecting the levels of human zymogen granule protein 16 ("ZG16") in said sample.

In one aspect, and over expression of ZG16 in a patient is indicative of the patient having gastric cancer.

The further GTM family member according to the present invention may be selected from the group consisting of mucin 5AC ("MUC5AC"), or mucin 17 ("MUC17"). The method 30 may involve the detection of ZG16 and MUC5AC, ZG16 and MUC17, orZG16 and MUC5AC and MUC17.

The further GTM family member may also comprise one or more further GTM family member, for example anyone of MUC5AC, MUC17, ZG16, carboxypeptidase N, polypeptide 35 2, 83 kDa chain (CPN2), matrix metalloproteinase 12 (MMP12), inhibin ("INHBA"), insulin-like growth factor 7 ("IGFBP7"), gamma-glutamyl hydrolase ("GGH"), leucine proline enriched proteoglycan ("LEPRE1"), cystatin S ("CST4"), secreted frizzled-related protein 4 ("SFRP4"), 4 asporin ("ASPN"), cell growth regulator with EF hand domain 1 ("CGREF1"), kallikrein 10 (KLK10), tissue inhibitor of metalloproteinase 1 ("TIMP1"), secreted acidic cysteine-rich protein ("SPARC"), transforming growth factor, 13-induced ("TGFBI"), EGF-containing fibulin-like extracellular matrix protein 2 ("EFEMP2"), lumican ("LUM"), stannin ("SNN"), secreted 5 phosphoprotein 1 ("SPP1"), chondroitin sulfate proteoglycan 2 ("CSPG2"), N-acylsphingosine amidohydrolase ("ASAH1"), serine protease 11 ("PRSS11"), secreted frizzled-related protein 2 ("SFRP2"), phospholipase A2, group XIIB ("PLA2G12B"), spondin 2, extracellular matrix protein ("SPON2"), olfactomedin 1 ("OLFM1"), thrombospondin repeat containing 1 ("TSRC1"), thrombospondin 2 (THBS2"), adlican, cystatin SA ("CST2"), cystatin SN 10 ("CST1"), lysyl oxidase-like enzyme 2 ("LOXL2"), thyroglobulin ("TG"), transforming growth factor betal ("TGFB1"), serine or cysteine proteinase inhibitor Clade H, member 1 ("SERPINH1"), serine or cysteine proteinase inhibitor Clade B, member 5 ("SERPINB5"), matrix metalloproteinase 2 ("MMP2"), proprotein convertase subtilisin/kexin type 5 ("PCSK5"), hyaluronan glycoprotein link protein 4 ("HAPLN4"), CA19-9, CA72-4, pepsinogen, 15 CEA, MUC5AC and MUC17.

One example of a combination GTM markers according to the present invention is MUC5AC, MUC17, ZG16, cystatin SN, serpinHI and serpinB5 Any suitable method for detecting the level of the GTM can be used, and may include detecting the levels of a GTM mRNA, GTM cDNA, using an oligonucleotide complementary to at least a portion of said GTM cDNA., using qRT-PCR method using a forward primer and a reverse primer, detecting the levels of a GTM protein, detecting the levels of a GTM peptide, for example using an antibody directed against said GTM. Any suitable antibody 25 can be used, and may be a monoclonal antibody or a polyclonal antiserum. The method may be carried out using a sandwich-type immunoassay method, or using an antibody chip.

The present invention also provides for a device for detecting a GTM, comprising: a substrate having a GTM capture reagent thereon; and a detector associated with said 30 substrate, said detector capable of detecting a GTM associated with said capture reagent.

The GTM capture reagent may be an oligonucleotide or an antibody specific for either a GTM oligonucleotide, a GTM protein or a GTM peptide.

A further aspect of the present invention is a kit for detecting cancer, comprising: a substrate having a GTM capture reagent thereon; a means for visualizing a complex of said GTM capture agent and a GTM; reagents; and instructions for use, wherein said GTM comprises human zymogen granule protein 16 ("ZG16").

The GTM capture reagent is a GTM-specific oligonucleotide or a GTM-specific antibody selective for a GTM oligonucleotide, a GTM protein or a GTM peptide.

The present invention also provides for a method for detecting gastric cancer, 10 comprising the steps of: providing a test sample from a patient at risk of having gastric cancer; measuring the presence of a GTM protein in said test sample; and comparing the amount of GTM present in said test sample with a value obtained from a control sample from a subject not having gastric cancer, wherein said GTM comprises 15 human zymogen granule protein 16 ("ZG16").

In a yet further aspect the invention provides for a method for screening for gastric cancer, comprising the steps of: providing a test sample from a test subject; measuring the presence of a GTM in said test sample; and comparing the amount of GTM present in said test sample with a value obtained from a control sample from a subject not having gastric cancer, wherein said GTM comprises human zymogen granule protein 16 ("ZG16").

The GTM may be a GTM protein or peptide, or an oligonucleotide specific for a GTM.

The olionucleotide may be DNA or RNA.

According the method, the step of measuring may use an ELISA assay.

The test sample may be obtained from plasma, tissue, urine, gastric fluid, serum and stool.

BRIEF DESCRIPTION OF THE FIGURES This invention is described with reference to specific embodiments thereof and with reference to the figures, in which: Figure 1 depicts a table of microarray analysis showing genes with high relative expression in tumor tissue. Signal intensity for each gene in both tumor tissue and non- 6 malignant tissue was ranked. The table shows GTMs with a higher ranking than the existing gastric cancer marker CEA (encoded by the gene CEACAM5).

Figure 2 depicts a table showing the characteristics of serum samples used in antibody array analysis.

Figure 3 depicts histograms showing the distribution of tumor and nonmalignant samples according to their level of expression of (a) ZG16 and (b) MUC17. The level of expression of the two genes was obtained using RT-qPCR.

Figure 4 depicts boxplots showing the detection of (a) MUC17 and (b) ZG16 in the serum of gastric cancer patients and controls using antibody arrays and RCA detection.

DETAILED DESCRIPTION Definitions Before describing embodiments of the invention in detail, it will be useful to provide some definitions of terms as used herein.

The term "GTM" or "gastric tumor marker" or "GTM family member" means a gene, gene fragment, RNA, RNA fragment, protein or protein fragment related or other identifying molecule associated with gastric cancer. The GTMs disclosed as part of the present invention do not include molecules that are known in the prior art to be associated with 20 gastric cancer, e.g. CA19-9, CA72-4., pepsinogen and CEA. However, the markers of the present invention can be used in novel and inventive combinations with previously disclosed GTMs.

The term "marker" refers to a molecule that is associated quantitatively or qualitatively 25 with the presence of a biological phenomenon. Examples of "markers" include a polynucleotide, such as a gene or gene fragment, RNA or RNA fragment; or a gene product, including a polypeptide such as a peptide, oligopeptide, protein, or protein fragment; or any related metabolites, by products, or any other identifying molecules, such as antibodies or antibody fragments, whether related directly or indirectly to a mechanism underlying the 30 phenomenon. The markers of the invention include the nucleotide sequences (e.g., GenBank sequences) as disclosed herein, in particular, the full-length sequences, any coding sequences, any fragments, or any complements thereof, and any measurable marker thereof as defined above.

As used herein "antibodies" and like terms refer to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. These include, 7 but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fc, Fab, Fab1, and Fab2 fragments, and a Fab expression library. Antibody molecules relate to any of the classes IgG, IgM, IgA, IgE, and IgD, which differ from one another by the nature of heavy chain present in the molecule. These include subclasses as well, such as IgGI, lgG2, and others. The light 5 chain may be a kappa chain or a lambda chain. Reference herein to antibodies includes a reference to all classes, subclasses, and types. Also included are chimeric antibodies, for example, monoclonal antibodies or fragments thereof that are specific to more than one source, e.g., a mouse or human sequence. Further included are camelid antibodies, shark antibodies or nanobodies.

The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by abnormal or unregulated cell growth. Cancer and cancer pathology can be associated, for example, with metastasis, interference with the normal functioning of neighbouring cells, release of cytokines or other secretory products at 15 abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc. Specifically included are melanomas.

The term "tumour" refers to all neoplastic cell growth and proliferation, whether 20 malignant or benign, and all pre-cancerous and cancerous cells and tissues.

The term "gastric cancer" refers to a tumor originating in the stomach. These tumors are able to metastasize to any organ.

The terms "differentially expressed," "differential expression," and like phrases, refer to a gene marker whose expression is activated to a higher or lower level in a subject (e.g., test sample) having a condition, specifically cancer, such as melanoma, relative to its expression in a control subject (e.g., reference sample). The terms also include markers whose expression is activated to a higher or lower level at different stages of the same condition; in 30 diseases with a good or poor prognosis; or in cells with higher or lower levels of proliferation. A differentially expressed marker may be either activated or inhibited at the polynucleotide level or polypeptide level, or may be subject to alternative splicing to result in a different polypeptide product. Such differences may be evidenced by a change in mRNA levels, surface expression, secretion or other partitioning of a polypeptide, for example.

Differential expression may include a comparison of expression between two or more markers (e.g., genes or their gene products); or a comparison of the ratios of the expression 8 between two or more markers (e.g., genes or their gene products); or a comparison of two differently processed products (e.g., transcripts or polypeptides) of the same marker, which differ between normal subjects and diseased subjects; or between various stages of the same disease; or between diseases having a good or poor prognosis; or between cells with 5 higher and lower levels of proliferation; or between normal tissue and diseased tissue, specifically cancer, or melanoma. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages, or cells with different levels of 10 proliferation.

The term "expression" includes production of polynucleotides and polypeptides, in particular, the production of RNA (e.g., mRNA) from a gene or portion of a gene, and includes the production of a polypeptide encoded by an RNA or gene or portion of a gene, 15 and the appearance of a detectable material associated with expression. For example, the formation of a complex, for example, from a polypeptide-polypeptide interaction, polypeptide-nucleotide interaction, or the like, is included within the scope of the term "expression". Another example is the binding of a binding ligand, such as a hybridization probe or antibody, to a gene or other polynucleotide or oligonucleotide, a polypeptide or a protein fragment, and 20 the visualization of the binding ligand. Thus, the intensity of a spot on a microarray, on a hybridization blot such as a Northern blot, or on an immunoblot such as a Western blot, or on a bead array, or by PCR analysis, is included within the term "expression" of the underlying biological molecule.

The terms "expression threshold," and "defined expression threshold" are used interchangeably and refer to the level of a marker in question outside which the polynucleotide or polypeptide serves as a predictive marker for patient survival. The threshold will be dependent on the predictive model established are derived experimentally from clinical studies such as those described in the Examples below. Depending on the 30 prediction model used, the expression threshold may be set to achieve maximum sensitivity, or for maximum specificity, or for minimum error (maximum classification rate). For example a higher threshold may be set to achieve minimum errors, but this may result in a lower sensitivity. Therefore, for any given predictive model, clinical studies will be used to set an expression threshold that generally achieves the highest sensitivity while having a minimal 35 error rate. The determination of the expression threshold for any situation is well within the knowledge of those skilled in the art. 9 The term "sensitivity" means the proportion of individuals with the disease who test (by the model) positive. Thus, increased sensitivity means fewer false negative test results.

The term "specificity" means the proportion of individuals without the disease who test 5 (by the model) negative. Thus, increased specificity means fewer false positive test results.

The term "microarray" refers to an ordered or unordered arrangement of capture agents, preferably polynucleotides (e.g., probes) or polypeptides on .a substrate. See, e.g., Microarray Analysis, M. Schena, John Wiley & Sons, 2002; Microarray Biochip Technology, 10 M. Schena, ed., Eaton Publishing, 2000; Guide to Analysis of DNA Microarray Data, S. Knudsen, John Wiley & Sons, 2004; and Protein Microarray Technology, D. Kambhampati, ed., John Wiley & Sons, 2004.

The term "oligonucleotide" refers to a polynucleotide, typically a probe or primer, 15 including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded ribonucleotides, RNA: DNA hybrids, and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available, or by a variety of other methods, including in vitro expression systems, recombinant techniques, 20 and expression in cells and organisms.

The term "overexpression" or "overexpressed" refers to an expression level of a gene or marker in a patient that is above that seen in normal tissue. Expression may be considered to be overexpressed if it is 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, or greater then 2 25 times the expression in normal tissue.

The term "polynucleotide," when used in the singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. This includes, without limitation, single- and double-stranded DNA, 30 DNA including single- and double- stranded regions, single-and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. Also included are triple-stranded regions comprising RNA or DNA or both RNA and DNA. Specifically included are mRNAs, cDNAs, and genomic DNAs, and 35 any fragments thereof. The term includes DNAs and RNAs that contain one or more modified bases, such as tritiated bases, or unusual bases, such as inosine. The polynucleotides of the invention can encompass coding or non-coding sequences, or sense or antisense sequences. It will be understood that each reference to a "polynucleotide" or like term, herein, will include the full-length sequences as well as any fragments, derivatives, or variants thereof.

"Polypeptide," as used herein, refers to an oligopeptide, peptide, or protein sequence, or fragment thereof, and to naturally occurring, recombinant, synthetic, or semi-synthetic molecules. Where "polypeptide" is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, "polypeptide" and like terms, are not meant to limit the amino acid sequence to the complete, native amino acid sequence for the full-length 10 molecule. It will be understood that each reference to a "polypeptide" or like term, herein, will include the full-length sequence, as well as any fragments, derivatives, or variants thereof.

The term "qPCR" or "QPCR" refers to quantative polymerase chain reaction as described, for example, in PCR Technique: Quantitative PCR, J.W. Larrick, ed., Eaton 15 Publishing, 1997, and A-Z of Quantitative PCR, S. Bustin, ed., IUL Press, 2004.

The term RCA is an abbreviation for rolling circle amplification. RCA is a technique which involves the repeated copying of a circular template to amplify a signal in a linear manner.

"Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally 25 depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridisable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. Additional 30 details and explanation of stringency of hybridization reactions, are found e.g., in Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

"Stringent conditions" or "high stringency conditions", as defined herein, typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium 35 chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ a denaturing agent during hybridization, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficol 1/0.1% polyvinylpyrrolidone/50 mM sodium 11 phosphate, buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5X SSC (0.75 M NaC1, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X, Denhardt's solution, sonicated salmon sperm DNA (50 ug/m1), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 5 0.2X SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash comprising 0.1X SSC containing EDTA at 55°C.

"Moderately stringent conditions" may be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and 10 include the use of washing solution and hybridization conditions (e. g., temperature, ionic strength, and % SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5X SSC (150 mM NaC1, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm 15 DNA, followed by washing the filters in 1X SSC at about 37-50°C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.

The term "MUC5AC" means mucin 5AC (Seq ID Nos 1 and 4), and includes the marker 20 MUC5AC, including a polynucleotide, such as a gene or gene fragment, RNA or RNA fragment; or a gene product, including a polypeptide such as a peptide, oligopeptide, protein, or protein fragment; or any related metabolites, by products, or any other identifying molecules, such as antibodies or antibody fragments The term "MUC17" means human mucin 17, cell surface associated (Seq ID Nos 2 and 5), and includes the marker MUC17, including a polynucleotide, such as a gene or gene fragment, RNA or RNA fragment; or a gene product, including a polypeptide such as a peptide, oligopeptide, protein, or protein fragment; or any related metabolites, by products, or any other identifying molecules, such as antibodies or antibody fragments,.

The term "ZG16" means human zymogen granule protein 16 (Seq ID Nos 3 and 6), and includes the marker ZG16, including a polynucleotide, such as a gene or gene fragment, RNA or RNA fragment; or a gene product, including a polypeptide such as a peptide, oligopeptide, protein, or protein fragment; or any related metabolites, by products, 35 or any other identifying molecules, such as antibodies or antibody fragments. 12 The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory 5 Manual, 2nd edition, Sambrook et al., 1989; Oligonucleotide Synthesis, MJ Gait, ed., 1984; Animal Cell Culture, R.I. Freshney, ed., 1987; Methods in Enzymology, Academic Press, Inc.; Handbook of Experimental Immunology, 4th edition, D .M. Weir & CC. Blackwell, eds., Blackwell Science Inc., 1987; Gene Transfer Vectors for Mammalian Cells, J.M. Miller & M.P. Calos, eds., 1987; Current Protocols in Molecular Biology, F.M. Ausubel et al., eds., 1987; 10 and PCR: The Polymerase Chain Reaction, Mullis et al., eds., 1994.

It is to be understood that the above terms may refer to protein, DNA sequence and/or RNA sequence. It is also to be understood that the above terms also refer to non-human proteins, DNA and/or RNA having homologous sequences as depicted herein.

DESCRIPTION OF EMBODIMENTS OF THE INVENTION Typically, tumor markers are differentially expressed between tumor tissue and corresponding non-malignant tissue. This provides a means to distinguish between patients with and without cancer. However, it is probable that the anatomical structure and 20 physiological characteristics of tumor tissues will lead to differences in the accumulation of markers in serum and other biological fluids even when those markers aren't over-expressed in tumor tissue. In particular, the abnormal polarity of tumor cells, the leaky vasculature and the high interstitial pressure of tumor tissue would be predicted to favour the efflux of specific markers out of tumor tissue compared to non-malignant tissue. Consequently, it is 25 hypothesized that secreted proteins that are expressed at very high levels in gastric tumour tissue, but not necessarily over-expressed compared to non-malignant gastric tissue, would constitute useful gastric cancer markers.

Using a combination of microarray analysis and quantitative polymerase chain reaction 30 (qPCR), novel markers for the detection of gastric cancer have been identified. This novel gastric tumor marker (GTM), provide further tools in the early detection of gastric cancer. Specifically, the invention comprises the novel GTMs: MUC5AC (Seq ID Nos 1 and 4), MUC17 (Seq ID Nos 2 and 5), and ZG16 (Seq ID Nos 3 and 6).

The novel GTMs can be used in isolation, or alternatively they can be combined together as signature (comprising two or more GTMs). A signature according to the present invention includes at least one of MUC5AC, MUC 17, and ZG16, and at least one further 13 GTM, which can either be a GTM according to the present invention, or any other GTM, including known GTMs.

Known GTMs suitable for use in combination with the presently disclosed GTMs 5 include carboxypeptidase N, polypeptide 2, 83 kDa chain (CPN2), matrix metalloproteinase 12 (MMP12), inhibin ("INHBA"), insulin-like growth factor 7 ("IGFBP7"), gamma-glutamyl hydrolase ("GGH"), leucine proline-enriched proteoglycan ("LEPREI"), cystatin S ("CST4"), secreted frizzled-related protein 4 ("SFRP4"), asporin ("ASPN"), cell growth regulator with EF hand domain 1 ("CGREF1"), kallikrein 10 (KLK10), tissue inhibitor of metalloproteinase 1 10 ("TIMP1"), secreted acidic cysteine-rich protein ("SPARC"), transforming growth factor, 13-induced ("TGFBI"), EGF-containing fibulin-like extracellular matrix protein 2 ("EFEMP2"), lumican ("LUM"), stannin ("SNN"), secreted phosphoprotein 1 ("SPP1"), chondroitin sulfate proteoglycan 2 ("CSPG2"), N-acylsphingosine amidohydrolase ("ASAH1"), serine protease 11 ("PRSS11"), secreted frizzled-related protein 2 ("SFRP2"), phospholipase A2, group XIIB 15 ("PLA2G12B"), spondin 2, extracellular matrix protein ("SPON2"), olfactomedin 1 ("OLFM1"), thrombospondin repeat containing 1 ("TSRC1"), thrombospondin 2 ("THBS2"), adlican, cystatin SA ("CST2"), cystatin SN ("CSTI"), lysyl oxidase-like enzyme 2 ("LOXL2"), thyroglobulin ("TG"), transforming growth factor beta I ("TGFB1"), serine or cysteine proteinase inhibitor Clade H, member 1 ("SERPINH1"), serine or cysteine proteinase inhibitor 20 Clade B, member 5 ("SERPINB5"), matrix metalloproteinase 2 ("MMP2"), proprotein convertase subtilisin/kexin type 5 ("PCSK5"), hyaluronan glycoprotein link protein 4 ("HAPLN4"), CA19-9, CA72-4, pepsinogen and CEA, or any other markers that have been previously identified as being indicative of gastric tumors.

By the term "reliability" we include the low incidence of false positives and/or false negatives. Thus, with higher reliability of a marker, fewer false positives and/or false negatives are associated with diagnoses made using that marker. Therefore, in certain embodiments, markers are provided that permit detection of gastric cancer with reliability greater than the reliability of prior art markers of about 50%. In other embodiments, markers 30 are provided that have reliability greater than about 70%; in other embodiments, greater than about 73%, in still other embodiments, greater than about 80%, in yet further embodiments, greater than about 90%, in still others, greater than about 95%, in yet further embodiments greater than about 98%, and in certain embodiments, about 100% reliability.

General Approaches to Cancer Detection General methodologies for determining expression levels are outlined below, although it will be appreciated that any method for determining expression levels would be suitable. 14 Quantitative PCR (qPCR) Quantitative PCR (qPCR) can be carried out on tumour samples, on serum and plasma using GTM specific primers and probes. In controlled reactions, the amount of product formed in a PCR reaction (Sambrook, J., E Fritsch, E. and T Maniatis, Molecular Cloning: A 5 Laboratory Manual 3rd. Cold Spring Harbor Laboratory Press: Cold Spring Harbor (2001)) correlates with the amount of starting template. Quantification of the PCR product can be carried out by stopping the PCR reaction when it is in log phase, before reagents become limiting. The PCR products are then electrophoresed in agarose or polyacrylamide gels, stained with ethidium bromide or a comparable DNA stain, and the intensity of staining 10 measured by densitometry. Alternatively, the progression of a PCR reaction can be measured using PCR machines such as the Applied Biosystems' Prism 7000 or the Roche LightCycler which measure product accumulation in real-time. Real-time PCR measures either the fluorescence of DNA intercalating dyes such as Sybr Green into the synthesized PCR product, or the fluorescence released by a reporter molecule when cleaved from a 15 quencher molecule; the reporter and quencher molecules are incorporated into an oligonucleotide probe which hybridizes to the target DNA molecule following DNA strand extension from the primer oligonucleotides. The oligonucleotide probe is displaced and degraded by the enzymatic action of the Taq polymerase in the next PCR cycle, releasing the reporter from the quencher molecule. In one variation, known as Scorpion®, the probe is 20 covalently linked to the primer.

Reverse Transcription PCR (RT-PCR) RT-PCR can be used to compare RNA levels in different sample populations, in normal and tumour tissues, with or without drug treatment, to characterize patterns of expression, to 25 discriminate between closely related RNAs, and to analyze RNA structure.

For RT-PCR, the first step is the isolation of RNA from a target sample. The starting material is typically total RNA isolated from human tumours or tumour cell lines, and corresponding normal tissues or cell lines, respectively. RNA can be isolated from a variety 30 of samples, such as tumour samples from breast, lung, colon (e.g., large bowel or small bowel), colorectal, gastric, esophageal, anal, rectal, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, bladder etc., tissues, from primary tumours, or tumour cell lines, and from pooled samples from healthy donors. If the source of RNA is a tumour, RNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed 35 (e.g., formalin-fixed) tissue samples.

The first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avian myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukaemia virus reverse transcriptase (MMLV-5 RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.

Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease activity but lacks a 3-5' proofreading endonuclease activity. Thus, TaqMan qPCR typically utilizes the 5' nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe 15 bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.

Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located 20 between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent 25 manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

TaqMan RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700 Sequence Detection System (Perkin-Elmer-Applied Biosystems, Foster City, CA, USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany). In a preferred embodiment, the 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI PRISM 7700 Sequence Detection 35 System. The system consists of a thermocycler, laser, charge-coupled device (CCD), camera, and computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fibre 16 optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data. ' nuclease assay data are initially expressed as Ct, or the threshold cycle. As 5 discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle.

Real-time Quantitative PCR (qRT-PCR) A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan probe). Real time PCR is compatible both with quantitative competitive PCR and with quantitative comparative PCR. The former uses an internal competitor for each target sequence for normalization, while the latter uses a normalization gene contained within the 15 sample, or a housekeeping gene for RT-PCR. Further details are provided, e.g., by Held et al., Genome Research 6: 986-994 (1996).

Expression levels can be determined using fixed, paraffin-embedded tissues as the RNA source. According to one aspect of the present invention, PCR primers are designed to 20 flank intron sequences present in the gene to be amplified. In this embodiment, the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done by publicly available software, such as the DNA BLAT software developed by Kent, W. J., Genome Res. 12 (4): 656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design.

In order to avoid non-specific signals, it is useful to mask repetitive sequences within the introns when designing the primers and probes. This can be easily accomplished by using the Repeat Masker program available on-line through the Baylor College of Medicine, which screens DNA sequences against a library of repetitive elements and returns a query 30 sequence in which the repetitive elements are masked. The masked sequences can then be used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the VIMNV for general users and for biologist programmers in: Krawetz S, 35 Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386). 17 The most important factors considered in PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3' end sequence. In general, optimal PCR primers are generally 1730 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Melting 5 temperatures between 50 and 80°C, e.g., about 50 to 70°C, are typically preferred. For further guidelines for PCR primer and probe design see, e.g., Dieffenbach, C. W. et al., General Concepts for PCR Primer Design in: PCR Primer, A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1995, pp. 133-155; Innis and Gelfand, Optimization of PCRs in: PCR Protocols, A Guide to Methods and Applications, CRC Press, London, 1994, 10 pp. 5-11; and Plasterer, T. N. Primerselect: Primer and probe design. Methods Mol. Biol. 70: 520-527 (1997), the entire disclosures of which are hereby expressly incorporated by reference.

Microarray Analysis Differential expression can also be identified, or confirmed using the microarray technique. Thus, the expression profile of GTMs can be measured in either fresh or paraffin-embedded tumour tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences (i.e., capture probes) are then hybridized with 20 specific polynucleotides from cells or tissues of interest (i.e., targets). Just as in the RT-PCR method, the source of RNA typically is total RNA isolated from human tumours or tumour cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumours or tumour cell lines. If the source of RNA is a primary tumour, RNA can be extracted, for example, from frozen or archived formalin fixed paraffin-25 embedded (FFPE) tissue samples and fixed (e.g., formalin-fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice.

In a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate. The substrate can include up to 1, 2, 5, 10, 15, 20, 25, 30, 30 35, 40, 45, 50, or 75 nucleotide sequences. In other aspects, the substrate can include at least 10,000 nucleotide sequences. The microarrayed sequences, immobilized on the microchip, are suitable for hybridization under stringent conditions. As other embodiments, the targets for the microarrays can be at least 50, 100, 200, 400, 500, 1000, or 2000 bases in length; or 50-100, 100-200, 100-500, 100-1000, 100-2000, or 500-5000 bases in length. As 35 further embodiments, the capture probes for the microarrays can be at least 10, 15, 20, 25, 50, 75, 80, or 100 bases in length; or 10-15, 10-20, 10-25, 10-50, 10-75, 10-80, or 20-80 bases in length. 18 Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is 5 scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual colour fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is 10 thus determined simultaneously.

The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per 15 cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93 (2): 106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, lllumina microarray technology or Incyte's microarray technology. The development of microarray methods for large-scale 20 analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumour types.

RNA Isolation, Purification, and Amplification General methods for mRNA extraction are well known in the art and are disclosed in 25 standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56: A67 (1987), and De Sandres et al., BioTechniques 18: 42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set, and protease from commercial 30 manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPure Complete DNA and RNA Purification Kit (EPICENTRE (D, Madison, Wl), and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test). 35 RNA prepared from tumour can be isolated, for example, by cesium chloride density gradient centrifugation. 19 The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are given in various published journal articles (for example: T. E. Godfrey et al. J. Molec. Diagnostics 2: 84-91 (2000); K. Specht et al., Am. J. Pathol. 158: 5 419-29 (2001)). Briefly, a representative process starts with cutting about 10 micron thick sections of paraffin-embedded tumour tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. Finally, the data are analyzed to identify the 10 best treatment option(s) available to the patient on the basis of the characteristic gene expression pattern identified in the tumour sample examined.

Immunohistochemistry and Proteomics Immunohistochemistry methods are also suitable for detecting the expression levels of 15 the proliferation markers of the present invention. Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker, are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horseradish peroxidase or alkaline phosphatase. 20 Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available.

Proteomics can be used to analyze the polypeptides present in a sample (e.g., tissue, organism, or cell culture) at a certain point of time. In particular, proteomic techniques can be used to assess the global changes of polypeptide expression in a sample (also referred to as expression proteomics). Proteomic analysis typically includes: (1) separation of individual polypeptides in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the 30 individual polypeptides recovered from the gel, e.g., by mass spectrometry or N-terminal sequencing, and (3) analysis of the data using bioinformatics. Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone or in combination with other methods, to detect the products of the proliferation markers of the present invention.

Hybridization Methods Using Nucleic Acid Probes Selective for a Marker These methods involve binding the nucleic acid probe to a support, and hybridizing under appropriate conditions with RNA or cDNA derived from the test sample (Sambrook, J., E Fritsch, E. and T Maniatis, Molecular Cloning: A Laboratory Manual 3rd. Cold Spring Harbor 5 Laboratory Press: Cold Spring Harbor (2001)). These methods can be applied to GTM derived from a tumour tissue or fluid sample. The RNA or cDNA preparations are typically labeled with a fluorescent or radioactive molecule to enable detection and quantification. In some applications, the hybridizing DNA can be tagged with a branched, fluorescently labeled structure to enhance signal intensity (Noite, F.S., Branched DNA signal amplification for 10 direct quantitation of nucleic acid sequences in clinical specimens. Adv. Clin. Chem. 33, 201-35 (1998)). Unhybridized label is removed by extensive washing in low salt solutions such as 0.1x SSC, 0.5% SDS before quantifying the amount of hybridization by fluorescence detection or densitometry of gel images. The supports can be solid, such as nylon or nitrocellulose membranes, or consist of microspheres or beads that are hybridized when in 15 liquid suspension. To allow washing and purification, the beads may be magnetic (Haukanes, B-1 and Kvam, C., Application of magnetic beads in bioassays. Bio/Technology 11, 60-63 (1993)) or fluorescently-labeled to enable flow cytometry (see for example: Spiro, A., Lowe, M. and Brown, D., A Bead-Based Method for Multiplexed Identification and Quantitation of DNA Sequences Using Flow Cytometry. Appl. Env. Micro. 66, 4258-4265 (2000)).

A variation of hybridization technology is the QuantiGene Plexe assay (Genospectra, Fremont) which combines a fluorescent bead support with branched DNA signal amplification. Still another variation on hybridization technology is the Quantikine® mRNA assay (R&D Systems, Minneapolis). Methodology is as described in the manufacturer's 25 instructions. Briefly the assay uses oligonucleotide hybridization probes conjugated to Digoxigenin. Hybridization is detected using anti-Digoxigenin antibodies coupled to alkaline phosphatase in colorometric assays.

Additional methods are well known in the art and need not be described further herein.

Enzyme-Linked Immunological Assays (ELISA) Briefly, in sandwich ELISA assays, a polyclonal or monoclonal antibody against the GTM is bound to a solid support (Crowther, J.R. The ELISA guidebook. Humana Press: New Jersey (2000); Harlow, E. and Lane, D., Using antibodies: a laboratory manual. Cold Spring 35 Harbor Laboratory Press: Cold Spring Harbor (1999)) or suspension beads. Other methods are known in the art and need not be described herein further. Monoclonal antibodies can be hybridoma-derived or selected from phage antibody libraries (Hust M. and Dubel S., Phage 21 display vectors for the in vitro generation of human antibody fragments. Methods Mol Biol. 295:71-96 (2005)). Nonspecific binding sites are blocked with non-target protein preparations and detergents. The capture antibody is then incubated with a preparation of sample or tissue from the patient containing the GTM antigen. The mixture is washed before the 5 antibody/antigen complex is incubated with a second antibody that detects the target GTM. The second antibody is typically conjugated to a fluorescent molecule or other reporter molecule that can either be detected in an enzymatic reaction or with a third antibody conjugated to a reporter (Crowther, Id.). Alternatively, in direct ELISAs, the preparation containing the GTM can be bound to the support or bead and the target antigen detected 10 directly with an antibody-reporter conjugate (Crowther, Id.).

Methods for producing monoclonal antibodies and polyclonal antisera are well known in the art and need not be described herein further.

Immunodetection The methods can also be used for immunodetection of marker family members in sera or plasma from gastric cancer patients taken before and after surgery to remove the tumour, immunodetection of marker family members in patients with other cancers, including but not limited to, colorectal, pancreatic, ovarian, melanoma, liver, oesophageal, stomach, 20 endometrial, and brain and immunodetection of marker family members in urine and stool from gastric cancer patients.

GTMs can also be detected in tissues or samples using other standard immunodetection techniques such as immunoblotting or immunoprecipitation (Harlow, E. and 25 Lane, D., Using antibodies: a laboratory manual. Cold Spring Harbor Laboratory Press: Cold Spring Harbor (1999)). In immunoblotting, protein preparations from tissue or fluid containing the GTM are electrophoresed through polyacrylamide gels under denaturing or non-denaturing conditions. The proteins are then transferred to a membrane support such as nylon. The GTM is then reacted directly or indirectly with monoclonal or polyclonal antibodies 30 as described for immunohistochemistry. Alternatively, in some preparations, the proteins can be spotted directly onto membranes without prior electrophoretic separation. Signal can be quantified by densitometry.

In immunoprecipitation, a soluble preparation containing the GTM is incubated with a 35 monoclonal or polyclonal antibody against the GTM. The reaction is then incubated with inert beads made of agarose or polyacrylamide with covalently attached protein A or protein G. The protein A or G beads specifically interact with the antibodies forming an immobilized 22 complex of antibody-GTM-aritigen bound to the bead. Following washing the bound GTM can be detected and quantified by immunoblotting or ELISA.

Threshold Determination For tests using GTM, thresholds will be derived that will enable a sample to be called either positive or negative for gastric cancer. These thresholds will be determined by the analysis of cohorts of patients who are being investigated for the presence of gastric cancer. Thresholds may vary for different test applications; for example, thresholds for use of the test in population screening will be determined using cohorts of patients who are largely free of 10 urological symptoms, and these thresholds may be different to those used in tests for patients who are under surveillance for gastric cancer recurrence. A threshold could be selected to provide a practical level of test specificity in the required clinical setting; that is, a specificity that allows reasonable sensitivity without excessive numbers of patients receiving false positive results. This specificity may be within the range of 80-90%. An alternative 15 method to obtain a test threshold is to plot sensitivity against specificity for different test thresholds (ROC curves) then select the point of inflexion of the curve.

As an alternative to single thresholds, the test may use test intervals which provide different degrees of likelihood of presence of disease and which have different clinical 20 consequences associated with them. For example, a test may have three intervals; one associated with a high (e.g. 90%) risk of the presence of gastric cancer, a second associated with a low risk of gastric cancer and a third regarded as being suspicious of disease. The "suspicious" interval could be associated with a recommendation for a repeat test in a defined period of time.

Antibodies to Gastric Cancer Markers In additional aspects, this invention includes manufacture of antibodies against GTMs. Using methods described herein, novel GTMs can be identified using microarray and/or qRT-PCR methods. Once a putative marker is identified, it can be produced in sufficient amount 30 to be suitable for eliciting an immunological response. In some cases, a full-length GTM can be used, and in others, a peptide fragment of a GTM may be sufficient as an immunogen. The immunogen can be injected into a suitable host (e.g., mouse, rabbit, etc) and if desired, an adjuvant, such as Freund's complete adjuvant or Freund's incomplete adjuvant can be injected to increase the immune response. It can be appreciated that making antibodies is 35 routine in the immunological arts and need not be described herein further. As a result, one can produce antibodies, including monoclonal or phage-display antibodies, against GTMs identified using methods described herein. 23 In yet further embodiments, antibodies can be made against the protein or the protein core of the tumour markers identified herein or against an oligonucleotide sequence unique to a GTM. Although certain proteins can be glycosylated, variations in the pattern of glycosylation can, in certain circumstances, lead to mis-detection of forms of GTMs that lack 5 usual glycosylation patterns. Thus, in certain aspects of this invention, GTM immunogens can include deglycosylated GTM or deglycosylated GTM fragments. Deglycosylation can be accomplished using one or more glycosidases known in the art. Alternatively, GTM cDNA can be expressed in glycosylation-deficient cell lines, such as prokaryotic cell lines, including E. coli and the like.

Vectors can be made having GTM -encoding oligonucleotides therein. Many such vectors can be based on standard vectors known in the art. Vectors can be used to transfect a variety of cell lines to produce GTM -producing cell lines, which can be used to produce desired quantities of GTM for development of specific antibodies or other reagents for 15 detection of GTMs or for standardizing developed assays for GTMs.

Kits Based on the discoveries of this invention, several types of test kits can be envisioned and produced. First, kits can be made that have a detection device pre-loaded with a 20 detection molecule (or "capture reagent"). In embodiments for detection of GTM mRNA, such devices can comprise a substrate (e.g., glass, silicon, quartz, metal, etc) on which oligonucleotides as capture reagents that hybridize with the mRNA to be detected is bound. In some embodiments, direct detection of mRNA can be accomplished by hybridizing mRNA (labeled with cy3, cy5, radiolabel or other label) to the oligonucleotides on the substrate. In 25 other embodiments, detection of mRNA can be accomplished by first making complementary DNA (cDNA) to the desired mRNA. Then, labeled cDNA can be hybridized to the oligonucleotides on the substrate and detected.

Antibodies can also be used in kits as capture reagents. In some embodiments, a 30 substrate (e.g., a multiwell plate) can have a specific GTM capture reagent attached thereto. In some embodiments, a kit can have a blocking reagent included. Blocking reagents can be used to reduce non-specific binding. For example, non-specific oligonucleotide binding can be reduced using excess DNA from any convenient source that does not contain GTM oligonucleotides, such as salmon sperm DNA. Non-specific antibody binding can be reduced 35 using an excess of a blocking protein such as serum albumin. It can be appreciated that numerous methods for detecting oligonucleotides and proteins are known in the art, and any 24 strategy that can specifically detect GTM associated molecules can be used and be considered within the scope of this invention.

Antibodies can also be used when bound to s a solid support, for example using an 5 antibody chip, which would allow for the detection of multiple markers with a single chip.

In addition to a substrate, a test kit can comprise capture reagents (such as probes), washing solutions (e.g., SSC, other salts, buffers, detergents and the like), as well as detection moieties (e.g., cy3, cy5, radiolabels, and the like). Kits can also include instructions 10 for use and a package.

Cancer markers can be detected in a sample using any suitable technique, and can include, but are not limited to, oligonucleotide probes, qPCR or antibodies raised against cancer markers.

It will be appreciated that the sample to be tested is not restricted to a sample of the tissue suspected of being a tumour. The marker may be secreted into the serum or other body fluid. Therefore, a sample can include any bodily sample, and includes biopsies, blood, serum, peritoneal washes, cerebrospinal fluid, urine and stool samples.

It will also be appreciate that the present invention is not restricted to the detection of cancer in humans, but is suitable for the detection of cancer in any animal, including, but not limited to dogs, cats, horses, cattle, sheep, deer, pigs and any other animal known to get cancer.

Tests for Gastric Cancer Markers in Body Fluids In several embodiments, assays for GTM can be desirably carried out on samples obtained from blood, plasma, serum, peritoneal fluid obtained for example using peritoneal washes, or other body fluids, such as urine, lymph, cerebrospinal fluid, gastric fluid or stool 30 samples.

In general, methods for assaying for oligonucleotides, proteins and peptides in these fluids are known in the art. Detection of oligonucleotides can be carried out using hybridization methods such as Northern blots, Southern blots or microarray methods, or 35 qPCR. Methods for detecting proteins include such as enzyme linked immunosorbent assays (ELISA), protein chips having antibodies, suspension beads radioimmunoassay (RIA), Western blotting and lectin binding. However, for purposes of illustration, fluid levels of a GTM can be quantified using a sandwich-type enzyme-linked immunosorbent assay (ELISA). For plasma assays, a 5 uL aliquot of a properly diluted sample or serially diluted standard GTM and 75 uL of peroxidaseconjugated anti-human GTM antibody are added to wells of a microtiter plate. After a 30 minute incubation period at 30°C, the wells are washed with 5 0.05% Tween 20 in phosphate-buffered saline {PBS) to remove unbound antibody. Bound complexes of GTM and anti-GTM antibody are then incubated with o-phenylendiamine containing H202 for 15 minutes at 30°C. The reaction is stopped by adding 1 M H2S04, and the absorbance at 492 nm is measured with a microtiter plate reader.

It can be appreciated that anti-GTM antibodies can be monoclonal antibodies or polyclonal antisera. It can also be appreciated that any other body fluid can be suitably studied.

It is not necessary for a marker to be secreted, in a physiological sense, to be useful.

Rather, any mechanism by which a marker protein or gene enters the serum can be effective in producing a detectable, quantifiable level of the marker. Thus, normal secretion of soluble proteins from cells, sloughing of membrane proteins from plasma membranes, secretion of alternatively spliced forms of mRNA or proteins expressed therefrom, cell death (either apoptotic) can produce sufficient levels of the marker to be useful.

There is increasing support for the use of serum markers as tools to diagnose and/or evaluate efficacy of therapy for a variety of cancer types.

Yoshikawa et al., (Cancer Letters, 151: 81-86 (2000) describes tissue inhibitor of matrix metalloproteinase-1 in plasma of patients with gastric cancer.

Rudland et al., (Cancer Research 62: 3417-3427 (2002) describes osteopontin as a metastasis associated protein in human breast cancer.

Buckhaults et al., (Cancer Research 61:6996-7001 (2002) describes certain secreted and cell surface genes expressed in colorectal tumors.

Kim et al., (JAMA 287(13): 1671-1679 (2002) describes osteopontin as a potential diagnostic biomarker for ovarian cancer.

Hotte et al., (AJ. American Cancer Society 95(3):507-512 (2002) describes plasma osteopontin as a protein detectable in human body fluids and is associated with certain malignancies.

Martin et al., (Prostate Cancer Prostatic Dis. March 9, 2004 (PMID: 15007379) (Abstract) described use of human kallikrein 2, prostate-specific antigen (PSA) and free PSA as markers for detection of prostate cancer. 26 Hall et al (Laryngoscope 113(1 ):77-81 (2003) (PMID: 12679418) (Abstract) described predictive value of serum thyroglobulin in thyroid cancer.

Mazzaferri et al., (J. Clin. Endocrinol. Metab. 88(4): 1433-1441 (2003) (Abstract) describes thyroglobulin as a potential monitoring method for patients with thyroid carcinoma.

Whitley et al, (Dim Lab. Med. 24(1):29-47 (2004) (Abstract) describes thyroglobulin as a serum marker for thyroid carcinoma.

Kuo et al (Clin. Chim. Acta. 294(1-2): 157-168 (2000) (Abstract) describes serum matrix metalloproteinase-2 and -9 in HCF- and HBV-infected patients.

Koopman et al., (Cancer Epidemiol. Biomarkers Prey 13(3):487-491 (2004) (Abstract) describes osteopontin as a biomarker for pancreatic adenocarcinoma.

Pellegrini et al., (Cancer Immunol. Immunother. 49(7):388-394 (2000) (Abstract) describes measurement of soluble carcinoembryonic antigen and TIMP 1 as markers for pre-invasive colorectal cancer.

Melle et al., (Clin. Chem. 53(4), 629-635 (2007) (Abstract) describes HSP27 as a serum marker for pancreatic adenocarcinoma.

Leman et al., (Urology, 69(4) 714-20 (2007) (Abstract) describes EPCA-2 as a serum marker for prostate cancer.

Tsigkou et al., (I Clin Endocrinol Metab, 92(7) 2526-31 (2007) (Abstract) describes total inhibin as a potential serum marker for ovarian cancer.

Marchi et al., (Cancer 112, 1313-1324 (2008) (Abstract) describes ProApolipoprotein Al as a serum marker of brain metastases in lung cancer patients.

Methods The following general methods were used to evaluate the suitability of various approaches to molecular identification of markers associated with gastric tumors.

Tumor Collection Gastric tumor samples and non-malignant gastric tissues were collected from surgical specimens resected at Seoul National University Hospital. Diagnosis of gastric cancer was made on the basis of symptoms, physical findings and histological examination of tissues.

RNA Extraction In some embodiments, expression of genes associated with gastric tumors was analyzed by determining the levels of RNA in samples taken from tumors. Frozen surgical specimens were embedded in OCT medium. 60 micron sections were sliced from the tissue blocks using a microtome, homogenized in a TriReagent: water (3:1) mix, then chloroform 27 extracted. Total RNA was then purified from the aqueous phase using the RNeasy™ procedure (Qiagen). In total, RNA from 58 gastric tumors and 58 non-malignant ("normal") gastric tissue samples were extracted and used in the microarray analysis described below. RNA was also extracted from 16 cancer cell lines and pooled to serve as a reference RNA.

Microarray Slide Preparation Epoxy coated glass slides were obtained from MWG Biotech AG, Ebersberg, Germany) and were printed with -30,000 50mer oligonucleotides using a Gene Machines microarraying robot, according to the manufacturer's protocol.

RNA labeling and Hybridization cDNA was transcribed from 10ug total RNA using Superscript II reverse transcriptase (Invitrogen) in reactions containing 5-(3 -aminoallyl)- 2' deoxyuridine - 5'-triphosphate. The reaction was then de-ionized in a Microcon column before being incubated with Cy3 or Cy5 15 in bicarbonate buffer for 1 hour at room temperature. Unincorporated dyes were removed using a Qiaquick column (Qiagen) and the sample concentrated to 15ul in a SpeedVac. Cy3 and Cy5 labeled cDNAs were then mixed with Ambion ULTRAhyb buffer, denatured at 100°C for 2 minutes and hybridized to the microarray slides in hybridization chambers at 42°C for 16 hours. The slides were then washed and scanned twice in an Axon 4000A scanner at two 20 power settings to yield primary fluorescence data on gene expression.

Normalization Procedure To measure the expression of cancer genes in tumors and non-cancerous tissues, median fluorescence intensities detected by GenepixTm software were corrected by 25 subtraction of the local background fluorescence intensities. Spots with a background corrected intensity of less than zero were excluded. To facilitate normalization, intensity ratios and overall spot intensities were log-transformed. Log-transformed intensity ratios were corrected for dye and spatial bias using local regression implemented in the LOCFITTm package. Log-transformed intensity ratios were regressed simultaneously with respect to 30 overall spot intensity and location. The residuals of the local regression provided the corrected log-fold changes. For quality control, ratios of each normalized microarray were plotted with respect to spot intensity and localization. The plots were subsequently visually inspected for possible remaining artifacts. Additionally, an analysis of variance (ANOVA) model was applied for the detection of pin-tip bias. All results and parameters of the 35 normalization were inserted into a Postgres-database for statistical analysis. 28 Marker Selection Microarray gene expression data for each of 29,718 genes was ranked according to the relative intensity of signal for each gene in both tumor and non-malignant tissue. Further analysis was limited to (i) genes encoding secreted proteins (ii) genes with an intensity rank 5 in tumor tissue higher than that observed for the gene (CEACAM5) encoding the existing tumor marker CEA and (iii) genes with no significant expression in blood or vascular tissue, as determined by EST counts in the Unigene database (Wheeler DL et al 2003). Secreted proteins were predicted by identifying transcripts expected to contain an N-terminal signal peptide. Proteins with predicted transmembrane helices that were not in the first 20 N-10 terminal amino acids [Krogh A. et al 2001] were discarded. Further subcellular localization was predicted using TARGETP [Emanuelsson 0 et al 2000].

Reference numbers (MWG oligo #) for relevant oligonucleotides, and the NCBI mRNA and protein reference sequences of selected GTMs are shown in Figure 1. Figure 1 also 15 shows the rank intensity of the selected GTMs in both tumor and nonmalignant tissue. Full DNA sequences of the GTM of this invention are shown herein below.

Quantitative Real-Time PCR In other embodiments, real-time, or quantitative PCR (qPCR) can be used for absolute 20 or relative quantitation of PCR template copy number. The primer set for MUC17 (Fwd: GAGGTGGTCAGCAGCATTGAC; Rev: CCTGGGAAGAGTGGTTTTTTAGC) was designed using Primer Express V 2.0TM (Applied Biosystems) and amplified product detected using SYBR green labelling. ZG16 was represented by the Assay-on-Demand™ expression assay Hs.00380609_ml (Applied Biosystems). Amplification was carried out on an ABI Prism™ 25 7000 sequence detection system under standard cycling conditions.

Assays were performed over two 96 well plates with each RNA sample represented by a single cDNA. Up to 45 RNA samples from both gastric tumours and non-malignant gastric tissue was analysed. Each plate contained a reference cDNA standard curve, over a 625-fold 30 concentration range, in duplicate. Analysis consisted of calculating the ACT (target gene CT - mean reference cDNA CT). ACT is directly proportional to the negative log2 fold change. Log2 fold changes relative to the median non-malignant log2 fold change were then calculated (log2 fold change -median normal log2 fold change). These fold changes were then clustered into frequency classes and graphed. 29 Protein expression and antibody generation To validate ZG16 at the protein level it was necessary to generate new antibodies against the recombinant protein. The coding region 17-167 of ZG16 was PCR amplified from human cell line cDNA using the forward primer CACCAATGCCATTCAGGCCAGGT and the 5 reverse primer TCAGCATCTGCTGCAGCTA. The PCR product was gel purified and cloned into the "Gateway" entry vector "pENTR/dTOPO" from Invitrogen before being sequence to verify correct insert. Using the "Gateway" system ZG16 was then cloned from pENTR/dTOPO into the Invitrogen expression vector pDEST17 containing an N terminal 6xHIS tag. Expression of ZG16 was carried out in BL21-AI E.coli cells (Invitrogen), cells were 10 grown at 37°C on a shaker until they were in mid log phase (OD6oo = 0.5) whereby they were induced at a final concentration of 0.2% arabinose and grown for a further 3hours at 37°C on a shaker. Cells were harvested by centrifuging at 6000xg for 15 minutes and supernatant discarded. The cells were resuspended in PBS (pH7.0) and lysed by sonication using a Sonics Vibra cell at 60% power. Lysed cells were cleared by centrifuging at 12000xg for 10 15 minutes and the supernatant was discarded. Cell pellet was washed three times in PBS (pH7.0) buffer containing 0.5% Triton X-100 followed by one wash with PBS (pH7.0). Then, pellet was further washed once using 8M urea in PBS (pH7.0). Each wash step was clarified by centrifuging at 12000xg and supernatant was discarded. The pellet was then solubilised in solubilisation buffer containing 10mM TRIS (pH8.0), 8M urea, 100mM NaC1 overnight at 20 room temperature. Solubilisation buffer was further centrifuged at 12000xg, filtered through a 0.45nm membrane and loaded onto a NiSepharose colum pre-washed with washing buffer containing PBS (pH7.0), 8M Urea and 20mM Imidazole. After loading, column was washed with 10 column volumes of washing buffer and solubilised proteins were eluted in washing buffer, supplemented with 500mM Imidazole. Eluted proteins were desalted into PBS (pH7.0) 25 and 8M urea buffer and then refolded by drop-wise dilution in refolding buffer containing 50mM Sodium Acetate (pH 4.5), 0.1M NDSB-201, 10% Glycerol, lmM/0.1mM GSH/GSSH. Refolding buffer was clarified by centrifugation at 12000xg and refolded protein was concentrated using Centriprep filters with nominal molecular cut-off of 10KDa (Millipore). Refolded proteins were buffer exchanged into a buffer containing 100mM sodium acetate 30 (pH 5.0) supplemented with 10% glycerol using a G25 desalt column and aliquots were stored at -80°C. Coomassie stained 10% SDS PAGE gel and Western blot analysis collectively indicated the presence of a His-tagged protein of 18KDa at up to 95% purity. The 18KDa Coomassie stained band was excised and identified by MALDI-TOF/TOF MS/MS to contain ZG16.

Antibodies against ZG16 were obtained by panning a phage display antibody library with the purified ZG16 protein (Antibodies by Design; a division of Morphosys AG, Germany. www.morphosvs.com).

Antibody arrays Antibody arrays were used to validate the candidate markers. Serum samples were obtained from patients with gastric cancer, colorectal cancer (before and after surgery) and from surgical patients with non-malignant disease. Samples were made available by Dunedin Public Hospital, New. Zealand, and the Christchurch Cancer Society tissue bank, 10 Christchurch, New Zealand. Antibodies against ZG16 and MUC17 that were obtained from either commercial sources or selected from phage libraries (Morphosys) were printed onto glass slides (Schott Nexterion Slide H) using the GeneMachines OmniGrid 100 array robot. Each array was circumscribed with a hydrophobic pen. Slides were then washed in 3X PBS-0.5% Tween 20 (3X PBS-T) before blocking with 50mM ethanolamine in 50mM sodium 15 borate buffer, pH8.0 followed by caseinate blocking buffer (3X PBS-T, 1% sodium caseinate). Biotin-labelled serum samples were then added to the slides before incubation overnight at 4°C. Slides were then washed in 3X PBS-T before being air-dried. Bound antibody was then detected using rolling circle amplification (RCA), largely as previously described (Haab BB, Lizardi PM. RCA-enhanced protein detection arrays. Methods Mol Biol. 20 2006;328:15-29). Briefly, the slides were incubated with anti-biotin antibodies that had been conjugated with an oligonucleotide primer (5' - CCT GGT GCT CAA ATT TCA GTT CTG C -3'). A circular DNA template was then hybridised to the slides at 37°C for 30mins in a humidified sealed chamber, before the slides were washed in decreasing concentrations of PBS-T (3X PBS-0.05% Tween 20, 1X PBS-0.05% Tween 20 and 0.1X PBS-0.05% Tween 25 20) and dried. The template was then extended using phi29 at 30°C for 3hrs before the slides were washed and dried by centrifugation. The amplified template was then detected using homologous fluorescently labeled probes. Slides were scanned with an Axon 4000A scanner and signal measured with the GenePix Pro 6.1.0.4 software.

Cy5 fluorescence intensity was adjusted using quantile normalization, using the normalizeBetweenArrays function from the limma (Smith, 2005) package for R (the R package for statistical computing (R Development Core ). Quantile normalization adjusts the values of the intensities so that the distribution of intensities is the same for each block (each block corresponding to a separate sample), by setting the quantiles of the intensities from 35 different blocks to the same value. The rank of each intensity value does not change during this procedure, only the relative magnitude of the intensities. The assumption is that the underlying probability distribution function describing the range of antigen concentrations is 31 the same for all samples. This procedure improved the average correlation of signals between blocks across all samples and also when considering reference-only blocks, which indicates an improvement in the quality of the data. Genepix-flagged spots were removed before taking the median across replicates to obtain normalized intensities for each antibody.

Thus, we have identified three genes and/or proteins that are useful for developing reagents, devices and kits for detecting and evaluating gastric cancer. One or more markers of gastric cancer can be used, either singly or in combination to provide a reliable molecular test for gastric cancer.

EXAMPLES The examples described herein are for purposes of illustrating embodiments of the invention. Other embodiments, methods and types of analyses are within the scope of persons of ordinary skill in the molecular diagnostic arts and need not be described in detail 15 hereon. Other embodiments within the scope of the art are considered to be part of this invention.

Example 1: Identification of Markers for Gastric Malignancy Markers were selected using the gene expression data obtained from gastric tumors 20 and non-malignant samples. The following criteria was used for marker selection: (i) the presence of a signal sequence characteristic of a secreted protein (ii) the microarray signal intensity ranking in tumor tissue and (iii) the levels of corresponding ESTs in blood or vascular tissues. The use of these criteria enabled the identification of secreted markers that are abundantly expressed in tumor tissue but likely to have a low background in serum, 25 blood or plasma. Figure 1 depicts a table that shows the three markers for gastric malignancy selected using the above criteria, MUC5AC, MUCI7 and ZG16. Figure 1 includes the symbol for the gene ("symbol"), the MWG oligo number, the NCBI mRNA reference sequence number, the protein reference sequence number, the rank intensity of the gene on the arrays derived using tumor tissue, and the rank intensity of the gene on the arrays 30 derived using nonmalignant tissue. All three GTMs had a higher expression (intensity) rank than CEACAM5, the gene that encodes the existing gastric cancer marker CEA. The lowest expressing rank possible was 29,718. Examination of the ranking also shows that the expression of these GTMs in tumor tissue was comparable to non-malignant tissue, indicating that the genes had not been strongly down-regulated during carcinogenesis. 35 Unigene EST counts (Wheeler et al, 2003) for the three GTMs in blood and vascular tissue were all zero. 32 Example 2: qRT-PCR Analysis The abundance and identity of the GTMs ZG16 and MUC17 was confirmed in tumor tissue using the more sensitive and accurate gene expression quantification technique, qPCR. Up to 45 gastric tumor samples and an equal number of nonmalignant gastric tissue 5 samples from the same patients were analysed by RT-qPCR using the primers and probes described in the methods section. Expression of these genes was quantified using the number of PCR cycles required to reach a threshold level of product amplification (Ct). qPCR analysis confirmed the array data: both markers were readily detected in tumor 10 tissue by qPCR and there was no evidence for a significant decrease in expression in tumor tissue compared to non-malignant tissue. The abundance of these RNAs in tumor tissue compared to non-malignant tissue is illustrated by the histograms in Figure 2a-b.

Example 3: Detection of Gastric Tumor Marker Proteins in Serum In certain embodiments, detection of GTM proteins can be accomplished using antibodies directed against either the entire protein, a fragment of the protein (peptide) or the protein core. Methods for detecting and quantifying expression of proteins and peptides are known in the art and can include methods relying on specific antibodies raised against the protein or peptide. Monoclonal antibodies and polyclonal antisera can be made using 20 methods that are well known in the art and need not be described herein further.

To detect the GTMs in serum, antibodies against the GTMs were printed onto glass slides using Gene Machine OmniGrid™ robotics. Each antibody was repeated 8 times on the array. Serum samples from 33 gastric cancer patients and 41 controls were then labeled with 25 biotin before being incubated with the antibody slides. Bound proteins were detected with anti-biotin antibodies and the signal amplified using rolling circle amplification (RCA) and fluorescent labeling. The amount of bound protein was quantified using an Axon 4000a scanner and the Genepix 6.1.0.4 software. The characteristics of the patients are shown in Figure 2.

The fluorescent signal from each antibody on the array was normalized and the median signal for the 8 replicates expressed in arbitrary fluorescent units. Box plots illustrating the data spread are shown in Figure 3. The median signal for MUC 17 was 18,836AU for gastric cancer patients and 16,130 for the control group. These medians were significantly different 35 (p=0.007). Significant differences between the medians were observed for two phage display ZG16 antibodies (5902 and 5905) obtained from MorphoSys. The median signal for ZG16_5902 in gastric cancer patient samples was 2139AU compared to 1837AU for 33 controls; the median ZG16_5905 signal in patients was 3063AU compared to 1675AU for controls. The median signal between patients and controls for both ZG16_5902 and ZG16_5905 were significantly different (p=0.05 and p=0.005, respectively).

This data demonstrates that MUC17 and ZG16 are present at significantly higher levels in the serum of gastric cancer patients than controls. Further differentiation between patient and control groups will be achieved by refinement of the immunological testing procedure, the identification of antibodies with greater specificity for the target antigens and the use of combinations of markers.

Example 8: Cells Transfected with GTM-Containing Vectors In still further embodiments, cells are provided that can express GTMs, GTM fragments or peptide markers. Both prokaryotic and eukaryotic cells can be so used. For example, E. coli (a prokaryotic cell) can be use to produce large quantities of GTMs lacking in mature 15 glycosylation (if the particular GTM normally is glycosylated). COS cells, 293 cells and a variety of other eukaryotic cells can be used to produce GTMs that are glycosylated, or have proper folding and therefore, three-dimensional structure of the native form of the GTM protein. Methods for transfecting such cells are known in the art and need not be described further herein.

Example 9: Kits Based on the discoveries of this invention, several types of test kits can be produced. First, kits can be made that have a detection device pre-loaded with a detection molecule (or "capture reagent"). In embodiments for detection of GTM mRNA, such devices can comprise 25 a substrate (e.g., glass, silicon, quartz, metal, etc) on which oligonucleotides as capture reagents that hybridize with the mRNA to be detected. In some embodiments, direct detection of mRNA can be accomplished by hybridizing mRNA (labeled with cy3, cy5, radiolabel or other label) to the oligonucleotides on the substrate. In other embodiments, detection of mRNA can be accomplished by first making complementary DNA (cDNA) to the 30 desired mRNA. Then, labeled cDNA can be hybridized to the oligonucleotides on the substrate and detected.

Regardless of the detection method employed, comparison of test GTM expression with a standard measure of expression is desirable. For example, RNA expression can be 35 standardized to total cellular DNA, to expression of constitutively expressed RNAs (for example, ribosomal RNA) or to other relatively constant markers. 34 Antibodies can also be used in kits as capture reagents. In some embodiments, a substrate (e.g., a multiwell plate) can have a specific GTM capture reagent attached thereto. In some embodiments, a kit can have a blocking reagent included. Blocking reagents can be used to reduce non-specific binding. For example, non-specific oligonucleotide binding can 5 be reduced using excess DNA from any convenient source that does not contain GTM oligonucleotides, such as salmon sperm DNA. Non-specific antibody binding can be reduced using an excess of a blocking protein such as serum albumin. It can be appreciated that numerous methods for detecting oligonucleotides and proteins are known in the art, and any strategy that can specifically detect GTM associated molecules can be used and be 10 considered within the scope of this invention.

In embodiments relying upon antibody detection, GTM proteins or peptides can be expressed on a per cell basis, or on the basis of total cellular, tissue, or fluid protein, fluid volume, tissue mass (weight). Additionally, GTM in serum can be expressed on the basis of 15 a relatively high-abundance serum protein such as albumin.

In addition to a substrate, a test kit can comprise capture reagents (such as probes), washing solutions (e.g., SSC, other salts, buffers, detergents and the like), as well as detection moieties (e.g., cy3, cy5, radiolabels, and the like). Kits can also include instructions 20 for use and a package.

Although this invention is described with reference to specific embodiments thereof, it can be appreciated that other embodiments involving the use of the disclosed markers can be used without departing from the scope of this invention.

INDUSTRIAL APPLICABILITY Methods for detecting GTM family members include detection of nucleic acids using microarray and/or real time PCR methods and detection of proteins and peptides. The compositions and methods of this invention are useful in the manufacture of diagnostic 30 devices and kits, diagnosis of disease, evaluating efficacy of therapy, and for producing reagents suitable for measuring expression of GTM family members in biological samples.

References Emanuelsson O, Nielsen H, Brunak S, von Heijne G. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol. 2000 Jul 21;300(4):1005-16.

Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001 Jan 19;305(3):567-80.

Smyth, G. K. (2005). Limma: linear models for microarray data. In: 'Bioinformatics and Computational Biology Solutions using R and Bioconductor1. R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, W. Huber (eds), Springer, New York, pages 397-420.

R Development Core Team (2008). R: A language and environment for statistical 15 computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0, URL http://www.R-proiect.org.

Wheeler DL, et al. Database Resources of the National Center for Biotechnology. Nucl Acids Res 31:28-33;2003.

Received at IPONZ on 14 November 2011 36

Claims (29)

1. A method for detecting gastric cancer, comprising: (i) providing a biological sample; and (ii) detecting the levels of human zymogen granule protein 16 ("ZG16") in said sample, 5 wherein the overexpression of ZG16 in the biological sample is indicative of cancer.

2. The method of claim 1, comprising detecting the level of one or more further gastric tumor marker (GTM) family members. 10

3. The method of any one of claims 1 or claim 2, wherein said method further comprises detecting the levels of a further GTM family member selected from the group consisting of mucin SAC ("MUC5AC"), and mucin 17 ("MUC17").

4. The method of any one of claims 1 to 3, wherein the one or more further GTM family 15 member is selected from MUC5AC, MUC17, ZG16, carboxypeptidase N, polypeptide 2, 83 kDa chain ("CPN2"), matrix metalloproteinase 12 ("MMP12"), inhibin ("INHBA"), insulin-like growth factor 7 ("IGFBP7"), gamma-glutamyl hydrolase ("GGH"), leucine proline enriched proteoglycan ("LEPRE1"), cystatin S ("CST4"), secreted frizzled-related protein 4 ("SFRP4"), asporin ("ASPN"), cell growth regulator with EF hand domain 1 ("CGREF1"), kallikrein 10 20 (KLK10), tissue inhibitor of metalloproteinase 1 ("TIMP1"), secreted acidic cysteine-rich protein ("SPARC"), transforming growth factor, 13-induced ("TGFBI"), EGF-containing fibulin-like extracellular matrix protein 2 ("EFEMP2"), lumican ("LUM"), stannin ("SNN"), secreted phosphoprotein 1 ("SPP1"), chondroitin sulfate proteoglycan 2 ("CSPG2"), N-acylsphingosine amidohydrolase ("ASAH1"), serine protease 11 ("PRSS11"), secreted frizzled-related protein 25 2 ("SFRP2"), phospholipase A2, group XIIB ("PLA2G12B"), spondin 2, extracellular matrix protein ("SPON2"), olfactomedin 1 ("OLFM1"), thrombospondin repeat containing 1 ("TSRC1"), thrombospondin 2 ("THBS2"), adlican, cystatin SA ("CST2"), cystatin SN ("CST1"), lysyl oxidase-like enzyme 2 ("LOXL2"), thyroglobulin ("TG"), transforming growth factor betal ("TGFB1"), serine or cysteine proteinase inhibitor Clade H, member 1 30 ("SERPINH1"), serine or cysteine proteinase inhibitor Clade B, member 5 ("SERPINB5"), matrix metalloproteinase 2 ("MMP2"), proprotein convertase subtilisin/kexin type 5 ("PCSK5"), hyaluronan glycoprotein link protein 4 ("HAPLN4"), CA19-9, CA72-4, pepsinogen and CEA.

5. The method of any one of claims 1 to 4, wherein the GTM markers tested comprise 35 MUC5AC, MUC17, ZG16, cystatin SN, serpinHI and serpinB5. Received at IPONZ on 14 November 2011 37

6. The method of any one of claims 1 to 5, wherein said step of detecting is carried out by detecting the levels of a GTM mRNA.

7. The method of any one of claims 1 to 5, wherein said step of detecting is carried out by 5 detecting the levels of a GTM cDNA.

8. The method of claim 7, wherein said step of detecting is carried out using an oligonucleotide complementary to at least a portion of said GTM cDNA. 10

9. The method of claim 7, wherein said step of detecting is carried out using qRT-PCR method using a forward primer and a reverse primer.

10. The method of any one of claims 1 to 5, wherein said step of detecting is carried out by detecting the levels of a GTM protein. 15

11. The method of any one of claims 1 to 5, wherein said step of detecting is carried out by detecting the levels of a GTM peptide.

12. The method of claims 10 or 11 wherein said step of detecting is carried out using an 20 antibody directed against said GTM.

13. The method of any of claims 10 to 12, wherein said step of detecting is carried out using a sandwich-type immunoassay method, or using an antibody chip. 25

14. The method of any of claims 10 to 12, wherein said antibody is a monoclonal antibody.

15. The method of any of claims 10 to 13, wherein said antibody is a polyclonal antiserum.

16. A kit for detecting cancer, comprising: 30 a substrate having a gastric tumor marker (GTM) capture reagent thereon; a means for visualizing a complex of said GTM capture agent and a GTM; reagents; and instructions for use, wherein said GTM comprises human zymogen granule protein 16 ("ZG16"). 35

17. The kit of claim 16, wherein said GTM capture reagent is a GTM-specific oligonucleotide. Received at IPONZ on 14 November 2011 38

18. The kit of claim 16, wherein said GTM capture reagent is a GTM-specific antibody selective for a GTM oligonucleotide, a GTM protein or a GTM peptide. 5

19. A method for detecting gastric cancer, comprising the steps of: providing a test sample from a patient at risk of having gastric cancer; measuring the presence of a gastric tumor marker (GTM) protein in said test sample; and comparing the amount of GTM present in said test sample with a value obtained from a control sample from a subject not having gastric cancer, wherein said GTM comprises 10 human zymogen granule protein 16 ("ZG16"), and wherein the over expression of ZG16 in the sample is indicative of cancer.

20. A method for screening for gastric cancer, comprising the steps of: providing a test sample from a test subject; 15 measuring the presence of a gastric tumor marker (GTM) in said test sample; and comparing the amount of GTM present in said test sample with a value obtained from a control sample from a subject not having gastric cancer, wherein said GTM comprises human zymogen granule protein 16 ("ZG16"), and wherein the over expression of ZG16 in the sample is indicative of cancer. 20

21. The method of claim 20, wherein said GTM is a GTM protein or peptide.

22. The method of claim 20, wherein said GTM is an oligonucleotide specific for a GTM.

23. The method of claim206, wherein said oligonucleotide is DNA. 25

24. The method of claim 22, wherein said oligonucleotide is RNA.

25. The method of any of claims 20 to 24, wherein said step of measuring uses an ELISA assay. 30

26. The method of any of claims 20 to 25, wherein said test sample is obtained from plasma.

27. The method of any of claims 20 to 26, wherein said test sample is obtained from tissue, 35 urine, gastric fluid, serum and stool. Received at IPONZ on 14 November 2011 39

28. A method according to any one of claims 1, 19 or 20, substantially as herein described with reference to any one of the accompanying Examples and/or Figures thereof.

29. A kit according to claim 16, substantially as herein described with reference to any one 5 of the accompanying Examples and/or Figures thereof. 40 ABSTRACT Early detection of tumors is a major determinant of survival of patients suffering from tumors, including gastric tumors. Members of the GTM gene family can be differentially expressed in gastric tumor tissue, and thus can be used as markers for the detection of gastric and other types of cancer. The present invention provides for novel GTMs for the detection of tumors, including gastric tumors, and in particular human zymogen granule protein 16 (ZG16). The GTMs can be used in isolation or together with other known GTMs to provide for novel signatures to be used in the detection of tumors, including gastric tumors.