NZ546406A - Treatment of halitosis with BLIS-producing S. salivarius - Google Patents

Treatment of halitosis with BLIS-producing S. salivarius

Info

Publication number
NZ546406A
NZ546406A NZ546406A NZ54640603A NZ546406A NZ 546406 A NZ546406 A NZ 546406A NZ 546406 A NZ546406 A NZ 546406A NZ 54640603 A NZ54640603 A NZ 54640603A NZ 546406 A NZ546406 A NZ 546406A
Authority
NZ
New Zealand
Prior art keywords
use according
salivarius
composition
blis
extract
Prior art date
Application number
NZ546406A
Inventor
John Robert Tagg
Christopher Norman Chilcott
Jeremy Paul Burton
Original Assignee
Blis Technologies Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Blis Technologies Ltd filed Critical Blis Technologies Ltd
Priority to NZ546406A priority Critical patent/NZ546406A/en
Publication of NZ546406A publication Critical patent/NZ546406A/en

Links

Landscapes

  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Disclosed is the use of a BLIS-producing S. salivarius or extract thereof in the preparation of a composition for treating a disease or condition caused by the growth of anaerobic bacteria in the oral cavity of an individual, such as halitosis, wherein the anaerobic bacteria are sensitive to BLIS-producing S. salivarius.

Description

1 54 64 0 6 *10051125895* NEW ZEALAND PATENTS ACT, 1953 No: 527075/532382 Date: 18 July 2003/20 April 2004 COMPLETE SPECIFICATION TREATMENT OF MALODOUR We, BLIS TECHNOLOGIES LIMITED, a New Zealand company of Level 10, Otago House, 481 Moray Place, Dunedin, New Zealand, do hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement: / INTELLECTUAL PROPERTY OFFICE OF N.Z. "1' - 6 apr 2006 TREATMENT OF MALODOUR FIELD OF THE INVENTION This invention relates to the use of BLIS-producing Streptococcus salivarius strains, extracts thereof, and compositions containing same in the prevention or treatment of halitosis. Methods of inhibiting growth of anaerobic bacteria, particularly halitosis causing bacteria are also described.
BACKGROUND Halitosis or bad breath is a common complaint characterised at least in part by the production of volatile sulfur compounds. The production of such compounds is generally associated with 15 oral bacteria, particularly certain anaerobic species. These bacteria generally inhabit oral surfaces, and particularly periodontal pockets and the dorsa of the tongue surface.
The primary source of volatile sulphur compounds (VSC's) from the subgingival microflora is from microorganisms that can be both commensal and pathogenic. Previous culture-based 20 studies have indicated that Porphyromonas gingivalis, Prevotella intermedia (both black pigmented species, Fusobacterium nucleatum, Micromonas micros (formerly, Peptostreptococcus), Bacteroides species, Campylobacter rectus, Eikenella corrodens, Desulfovibrio species, Treponema denticola, and Eubacterium species amongst others are responsible for the production of VSC's that contribute to halitosis (as summarized by 25 Loesche WJ, Kazor C. Periodontol 2000. 2002;28:256-79. and Khaira N, Palmer RM, Wilson RF, Scott DA, Wade WG. Oral Dis. 2000 Nov;6 (6):371-5.). However, recent non-culture based studies have shown that there are certain species associated with subjects that are either healthy or afflicted with halitosis. Atopobium pavulum, Eubacterium sulci, Fusobacterium periodontium, Dialister, a phylotype of streptococci, a phylotype of the uncultivated phylum 30 TM7, and Solobacterium moorei appeared to be present in subjects with halitosis. By contrast, Streptococcus salivarius, Rothia mucilaginosa (Stomatococcus mucilaginosus), and an uncharacterized Eubacterium (strain FTB41) were commonly detected only amongst healthy individuals (Kazor, C.E. et al., J. Clin Microbiol, Feb 2003, pp 558-563).
Over the years various methods have been developed and tried with varying success, to prevent or at least alleviate the problem of halitosis. Current treatments focus on anti bacterial regimes to reduce numbers of oral bacteria, or agents to mask or neutralise the offensive odour. Oral rinses with chlorine dioxide (see for example, WO 95/27472 and US 5,738,840) have been shown to have some effect in the control of halitosis, but offer only temporary relief in the order of a few days. Generally, current methods of treating halitosis require complex physical, chemical or expensive regimes to be carried out and are typically only of short term effect, as the malodour-causing oral bacteria recover to former levels after treatment is stopped.
What is sought to treat halitosis is the replacement of the disease-causing organisms, with a non-virulent commensal microorganism. To serve as an effector strain in replacement therapy, the microorganism must be able to compete successfully with the pathogenic microorganism either via competitive action (e.g. for attachment sites), and/or antibiotic 15 action, or inhibition by other metabolism-associated by-products.
In WO 01/27143 S. salivarius strains are identified which have utility in the treatment of infections of the upper respiratory tract caused by streptococcal organisms, including treatment of sore throats caused mainly by S. pyogenes, and dental caries caused at least in 20 part by S. sobrinus. No activity was recorded against any anaerobic microorganisms. Moreover, the treatment of halitosis is nowhere contemplated in that document.
The present invention is broadly directed to methods of at least inhibiting growth of anaerobic microorganisms using BLIS-producing S. salivarius strains or compositions comprising same, 25 or at least provides the public with a useful choice.
SUMMARY OF THE INVENTION Described but not claimed is a method for at least inhibiting the growth of anaerobic bacteria 30 sensitive to BLIS-producing S. salivarius, wherein the anaerobic bacteria are in the oral cavity of an individual, the method comprising contacting the sensitive bacteria with an inhibitory effective amount of a BLIS-producing S. salivarius, or an extract thereof, or a composition comprising said S. salivarius or extract thereof.
C.TtCS CJ* W- i *[ [ trsiv r'Z NOW AMENDED Also described is a method of prophylactic or therapeutic treatment /{halitosis in an individual in need thereof, the method comprising administering to said individual a BLIS-producing S. salivarius, extract thereof, or composition comprising said S. salivarius or extract thereof, in an amount effective to at least inhibit growth of anaerobic bacteria, or in an amount to allow 5 effective colonisation in the oral cavity of the individual by outproducing S. salivarius.
Preferably the S. salivarius are Salivaricin B producers.
Commonly, the anaerobic bacteria are black pigmented species, and/or Eubacterium and/or 10 Micromonas, especially Prevotella species, Eubactefrium saburreum and Micromonas micros.
Also described is a method of controlling the mciaence and/or severity of halitosis, the method comprising introducing into the oral cavity of an individual susceptible to halitosis an amount of a BLIS-producing S. salivarius, extract thereof, /or composition comprising said S. salivarius or extract thereof, effective to control the incidence or severity of said halitosis.
In one embodiment the halitosis is causedM least in part by one or more black pigmented species, Eubacterium and/or Micromonas, particularly Prevotella species, Eubacterium saburreum and Micromonas micros.
Preferably, S. salivarius is administered as part of a lozenge, spray, mouth rinse, or other drug delivery device, confectionary (including chewing gum), food, drink or nutraceutical.
The methods preferably /ncmde the preliminary step of pre-treating the individual to at least 25 reduce the oral microflora already present.
The invention alsc/ re/ates to the use of BLIS-producing S. salivarius, extracts thereof, or compositions comprising same in the halitosis treatment methods discussed above. Particlarly, to the use of the S./salfvarius in the preparation of medicaments for use in treating halitosis.
In another aspe/t, the invention also relates to the use of BLIS-producing S. salivarius, extracts thereof, a/id ^compositions comprising said S. salivarius or extracts thereof in the methods discussed jfoove for inhibiting, controlling, preventing or treating halitosis caused at FNT^nSr^L p^OpERTY OFFICE of n z jul 2008 rec Eivfd] RECEIVED at IPONZ on 19 May 2011 as amended Also described is a method of prophylactic or therapeutic treatment of halitosis in an individual in need thereof, the method comprising administering to said individual a BLIS-producing S. salivarius, extract thereof, or composition comprising said S. salivarius or extract thereof, in an amount effective to at least inhibit growth of anaerobic bacteria, or in an amount to allow 5 effective colonisation in the oral cavity of the individual by BLIS-producing S. salivarius.
Preferably the S. salivarius are Salivaricin B producers.
Commonly, the anaerobic bacteria are some black pigmented species, and/or Eubacterium and/or 10 Micromonas, especially Prevotella species, Eubacterium saburreum and Micromonas micros.
Also described is a method of controlling the incidence and/or severity of halitosis, the method comprising introducing into the oral cavity of an individual susceptible to halitosis an amount of a BLIS-producing S. salivarius, extract thereof, or composition comprising said S. salivarius or 15 extract thereof, effective to control the incidence or severity of said halitosis.
In one embodiment the halitosis is caused at least in part by one or more black pigmented species, Eubacterium and/or Micromonas, particularly Prevotella species, Eubacterium saburreum and Micromonas micros.
Preferably, S. salivarius is administered as part of a lozenge, spray, mouth rinse, or other drug delivery device, confectionary (including chewing gum), food, drink or nutraceutical.
The methods preferably include the preliminary step of pre-treating the individual to at least 25 reduce the oral microflora already present.
The invention also relates to the use of BLIS-producing S. salivarius, extracts thereof, or compositions comprising same in the halitosis treatment methods discussed above. Particlarly, to the use of the S. salivarius in the preparation of medicaments for use in treating halitosis.
In another aspect, the invention also relates to the use of BLIS-producing S. salivarius, extracts thereof, and compositions comprising said S. salivarius or extracts thereof in the methods discussed above for inhibiting, controlling, preventing or treating halitosis caused at 4 NOW AMENDED least in part by one or more Prevotella species and/or Eubfcte/rium saburreum and/or Micromonas micros.
Accordingly, in one aspect the invention relates to a use of p. BLIS-producing S. salivarius or 5 extract thereof in the preparation of a composition for the prophylactic or therapeutic treatment of halitosis in an individual in need thereof, wherein the halitj/sis/is caused at least in part by one or more species of anaerobic bacteria.
Also described is the use of a BLIS-producing S. saliyarins or extract thereof in the preparation of 10 a composition for treating a disease or condition caused/4)y the growth of anaerobic bacteria in the oral cavity of an individual, wherein the anaerobic Joacteria are sensitive to BLIS-producing S. salivarius.
Also described is a method of prophylactic or therapeutic treatment of halitosis in an individual in need thereof, the method comprising administering to said individual a BLIS-producing S. salivarius, extract thereof, or composition comprising said S. salivarius or extract thereof, effective to at least inhibit growth of anaerobic bacteria, or in an amount to allow effective colonisation in the oral cavity of me individual by BLIS-producing S. salivarius.
Although the invention is broadly as described above, it will be appreciated by those persons skilled in the art that the indention is not limited thereto but also includes embodiments of which the following description ,giWs examples. In particular, the invention will be described in relation to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Ex/mme of inhibitory effect of S1. salivarius K12 on black-pigmented bacteria 30 (Prevotella species) from saliva sample.
Figure id. Bar graph showing VSC levels of mouth air from two case subjects (4 and 12) over 28 days and/after treatment. pete^0perty ' OFFICE OF m.2 Receive RECEIVED at IPONZ on 19 May 2011 as amended least in part by one or more Prevotella species and/or Eubacterium saburreum and/or Micromonas micros.
Accordingly, in one aspect the invention relates to a use of a BLIS-producing S. salivarius or 5 extract thereof in the preparation of a composition for the prophylactic or therapeutic treatment of halitosis in an individual in need thereof, wherein the halitosis is caused at least in part by one or more species of anaerobic bacteria sensitive to said BLIS-producing S. salivarius.
Also described is the use of a BLIS-producing S. salivarius or extract thereof in the preparation of 10 a composition for treating a disease or condition caused by the growth of anaerobic bacteria in the oral cavity of an individual, wherein the anaerobic bacteria are sensitive to BLIS-producing S. salivarius.
Also described is a method of prophylactic or therapeutic treatment of halitosis in an individual in 15 need thereof, the method comprising administering to said individual a BLIS-producing S. salivarius, extract thereof, or composition comprising said S. salivarius or extract thereof, effective to at least inhibit growth of anaerobic bacteria, or in an amount to allow effective colonisation in the oral cavity of the individual by BLIS-producing S. salivarius.
Although the invention is broadly as described above, it will be appreciated by those persons skilled in the art that the invention is not limited thereto but also includes embodiments of which the following description gives examples. In particular, the invention will be described in relation to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Example of inhibitory effect of S. salivarius K12 on black-pigmented bacteria (Prevotella species) from saliva sample.
Figure 2A. Bar graph showing VSC levels of mouth air from two case subjects (4 and 12) over 28 days and after treatment.
Figure 2B. Bar graph showing detection of BLIS activity of Streptococcus salivarius isolates (%) from case subjects over time by sensitive indicator microorganism Micrococcus leuteus (II, sensitive to SAL A and B).
Figure 2C. Bacterial counts of saliva from subject 4.
Figure 2D. Bacterial counts of saliva from subject 12.
DETAILED DESCRIPTION OF THE INVENTION As noted above, described herein is a method for at least inhibiting the growth of anaerobic bacteria in the oral cavity of an individual which bacteria are sensitive to BLIS-producing S. salivarius. The method comprises contacting the sensitive bacteria with an inhibitory 15 effective amount of a BLIS-producing S. salivarius, or an extract thereof, or a composition containing the S. salivarius or extract thereof.
The phrase "inhibiting the growth of anaerobic bacteria sensitive to BLIS-producing S. salivarius" as used herein refers to the growth inhibition of at least one strain of one or more 20 species of anaerobic bacteria sensitive to BLIS-producing S. salivarius. Inhibition of growth may be determined by deferred antagonism tests on agar as described by Tagg and Banister (J. Med. Microbiol. 1979; 12: 397) as illustrated in the accompanying examples.
The term "contacting" as used herein refers to both direct and indirect contact between the 25 anaerobic bacteria and a BLIS-producing S. salivarius, extract, or composition herein. Indirect contact comprises exposure of the anaerobic bacteria in its native environment, particularly native environment, to a BLIS-producing S. salivarius, extract, or composition herein.
The anaerobic bacteria to be treated are preferably in the oral cavity of an individual.
In another embodiment described are methods of prophylactially or therapeutically treating halitosis, and to methods of controlling the incidence and severity of halitosis as set out above. -—— . ;--r OF N.7. -7 1.5AS 2023 NOW AMENDED Preferably, the S. salivarius strains for use in the invention are/najave Salivaricin B producers with activity against anaerobic bacteria, particularly bladk pigmented species (such as Prevotella), Eubacterium saburreum and/or Micromonas micros. Salivaricin B BLIS-5 producing strains with activity against anaerobic bacteria: include K12, and K30 both deposited with Deutche Sammlung von Mikroorgjanismen Und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124, Braunschweig, Gertnapfy on 8 October 1999, and 8 October 1999, and assigned Accession Nos. DSM 13084 ancj 13085 respectively.
Strain Sal 20P3 was deposited at the Australian^ Government Analytical Laboratories, 1 Suakin Street, Pymble, New South Wales, Aiystrcjiia in July 1992 under Accession No. AGAL 92/32401.
Sal 20P3 is a producer of Salivaricin PL omy and has activity against at least Micromonas.
Salivaricin B producers K12 and H30/have a broader range of activity against black pigmented species, Eubacterium and/Micromonas at least.
S. salivarius BLIS-producers msfy be identified by testing potential producer strains in agar surface assays as taught in WO 01/27143. Production of Salivaricin A, A2 and B may be confirmed by comparing sequence identity and activity to those sequences and activity data given in WO 01/27143. Far convenience, the amino acid sequences of Salivaricins useful in the invention are as follows:, lWTEU.r:nruAi p*> GrrtCc OP -7 i4Afi m 7 RECEIVED at IPONZ on 19 May 2011 AS AMENDED Preferably, the S. salivarius strains for use in the invention are native Salivaricin B producers with activity against anaerobic bacteria, particularly some black pigmented species (such as Prevotella), Eubacterium saburreum and/or Micromonas micros. Salivaricin B BLIS-producing strains with activity against anaerobic bacteria include K12, and K30 both 5 deposited with Deutche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124, Braunschweig, Germany on 8 October 1999, and 8 October 1999, and assigned Accession Nos. DSM 13084 and 13085 respectively.
Strain Sal 20P3 was deposited at the Australian Government Analytical Laboratories, 1 10 Suakin Street, Pymble, New South Wales, Australia in July 1992 under Accession No. AGAL 92/32401.
Sal 20P3 is a producer of Salivaricin A only and has activity against at least Micromonas. Salivaricin B producers K12 and K30 have a broader range of activity against black 15 pigmented species, Eubacterium and Micromonas at least.
S. salivarius BLIS-producers may be identified by testing potential producer strains in agar surface assays as taught in WO 01/27143. Production of Salivaricin A, A2 and B may be confirmed by comparing sequence identity and activity to those sequences and activity data 20 given in WO 01/27143. For convenience, the amino acid sequences of Salivaricins useful in the invention are as follows: 7 Salivaricin Amino Acid and Nucleic Acid Sequence A MKNSKDILNNAIEEVSEKELMEVAGG -1 KRGSGWIATITDDCPNSVFVCC +1 ATGAATGCCATGAAAAACTCAAAAGATATTTTGAACAATGCTATCGAAGAAGTTTCTGA AAAAGAACTTATGGAAGTAGCTGGTGGTAAAAGAGGTTCAGGTTGGATTGCAACTATTA CTGATGACTGTCCAAACTCAGTATTCGTTTGTTGTTAA MKNSKDILTNAIEEVSEKELMEVAGG KKGSGWFATITDDCPNSVFVCC +1 ATGAGTTTTATGAAAAATTCAAAGGATATTTTGACTAATGCTATCGAAGAAGTTTCT GAAAAAGAACTTATGGAAGTAGCTGGTGGTAAAAAAGGTTCAGGTTGGTTTGCAACT ATTACTGATGACTGTCCGAACTCAGTATTTGTTTGTTGTTAA atg att gee atg aaa aac tea aaa gat att ttg aac aat Met lie Ala Met Lys Asn Ser Lys Asp lie Leu Asn Asn get ate gaa gaa gtt tct gaa aaa gaa ctt atg gaa gta Ala lie Glu Glu Val Ser Glu Lys Glu Leu Met Glu Val get ggt ggt aaa aga ggt aca ggt tgg ttt gca act att Ala Gly Gly Lys Arg Gly Thr Gly Trp Phe Ala Thr lie -l +1 act gat gac tgt cca aac tea gta tte gtt tgt tgt taa Thr Asp Asp Cys Pro Asn Ser Val Phe Val Cys Cys B ttg act ctt gaa gaa ctt gat aac gtt ctt ggt get ggt Leu Thr Leu Glu Glu Leu Asp Asn Val Leu Gly Ala Gly -l +1 ggt gga gta ate caa ace att tea cac gaa tgt cgt atg Gly Gly Val lie Gin Thr lie Ser His Glu Cys Arg Met aac tea tgg cag tte ttg ttt act tgt tgc tct taa Asn Ser Trp Gin Phe Leu Phe Thr Cys Cys Ser The sequence for Salivaricin Ai is also given as a further BLIS useful in the invention.
Sequence comparison may be achieved using BLASTP. 8 NOW AMENDED More particularly, polypeptide sequence identity can be determined/in the following manner. The subject polypeptide sequence is compared to a candidate polypeptide sequence using BLASTP (from the BLAST suite of programs, version 2.2.5/[Ne>v 2002]) in bl2seq, which is publicly available from NCBI (ftp://ftp.ncbi.nih.gov/blast/)/ 1)ie default parameters of bl2seq may be utilized.
Polypeptide sequence identity may also be calculate between a candidate and subject polynucleotide se programs. EMBOSS-needle (available at http:/\ (Huang, X. (1994) On Global Sequence Alii /er the entire length of the overlap ices using global sequence alignment /.ebi.ac.uk/emboss/align/) and GAP lent. Computer Applications in the Biosciences 10, 227-235) are also suitab/e global sequence alignment programs for calculating polypeptide sequence identity.
Use of BLASTP as described above is 15 variants useful in the present inventioi Preferred for use in the determination of polypeptide As noted above black pigmented species, Eubacterium and Micromonas are considered causative agents in halitosis, while the BLIS-producing strains of S. salivarius above are known to be active against gpnypositive aerobic bacteria, their activity against anaerobic bacteria, such as black pigmented species, Eubacterium and Micromonas in particular, is unexpected. All the more^o J&ecause BLIS-producing organisms are typically known to act against more closely related Species.
These BLIS-producing SI salivarius are therefore useful as anaerobic antibacterial agents per 25 se as well as therapeutically. In this context, "therapeutic" includes prophylactic treatment. Therapeutic uses/indude the treatment or prevention of anaerobic microbial infections, especially Eubacterium and Micromonas infections, and infections by black pigmented species. The S. salivarius are particularly suitable for use against Prevotella species including P. intermedia/and P. melaninogenica', Eubacterium saburreum, Micromonas micros, 30 Streptococcus anginosus, some or all of which may be implicated in halitosis. Conditions amenable tor treatment with the S. salivarius strains include halitosis (or bad breath).
Extract/ obtainable from the BLIS-producing salivarius strains are also useful in the ion. Extracts include those in which the BLIS or BLIS' produced by the salivarius 9 RECEIVED at IPONZ on 19 May 2011 AS AMENDED More particularly, polypeptide sequence identity can be determined in the following manner. The subject polypeptide sequence is compared to a candidate polypeptide sequence using BLASTP (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq, which is publicly available from NCBI (ftp://ftp.ncbi.nih.gov/blast/). The default parameters of bl2seq 5 may be utilized.
Polypeptide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs. EMBOSS-needle (available at http:/www.ebi.ac.uk/emboss/align/) and GAP 10 (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235) are also suitable global sequence alignment programs for calculating polypeptide sequence identity.
Use of BLASTP as described above is preferred for use in the determination of polypeptide 15 variants useful in the present invention.
As noted above black pigmented species, Eubacterium and Micromonas are considered causative agents in halitosis. While the BLIS-producing strains of S. salivarius above are known to be active against gram-positive aerobic bacteria, their activity against anaerobic 20 bacteria, such as some black pigmented species (eg Prevotella), Eubacterium and Micromonas in particular, is unexpected. All the more so because BLIS-producing organisms are typically known to act against more closely related species.
These BLIS-producing S. salivarius are therefore useful as anaerobic antibacterial agents per 25 se as well as therapeutically. In this context, "therapeutic" includes prophylactic treatment. Therapeutic uses include the treatment or prevention of anaerobic microbial infections, especially Eubacterium and Micromonas infections, and infections by some black pigmented species. The S. salivarius are particularly suitable for use against Prevotella species including P. intermedia and P. melaninogenica; Eubacterium saburreum, Micromonas micros, 30 Streptococcus anginosus, some or all of which may be implicated in halitosis. Conditions amenable to treatment with the S. salivarius strains include halitosis (or bad breath).
Extracts obtainable from the BLIS-producing salivarius strains are also useful in the invention. Extracts include those in which the BLIS or BLIS' produced by the salivarius 9 strain is/are provided in isolated or pure form. An "isolated" BLIS is one which has been identified and separated and/or recovered from its natural cellular environment. Extracts can be obtained using known art protocols, conveniently by cell culture and centrifugation. Routine isolation methods include ammonium sulphate precipitation, column chromatography (e.g. ion exchange, gel filtration, affinity chromatography etc.), electrophoresis, and ultimately, crystallisation (see generally "Enzyme Purification and Related Techniques". Methods in Enzymology, 22: 233-577 (1991)). The BLIS may be purified as necessary using conventional techniques (see for example, Parente, E and Ricciardi, A. Applied Microbiol. Biotechnol 52: 628 (1999)).
The BLIS may be purified to greater than 95% by weight of BLIS as determined by the Lowry method (Lowry, O. H. et al., 1951. Protein Measurement with Folin-Phenol Reagents. J. Biol. Chem. 193: 265-275). Preferably the BLIS will be purified to 99% or more by weight.
These active extracts may similarly be used in therapeutic formulations and methods. Extracts include the BLIS antibiotics salivaricin A, Ai, A2 and B or variants thereof in isolated or pure form. The variants are functionally equivalent in that they exhibit similar antibiotic properties to salivaricin A, Aj, A2 and B. The antibiotics and variants together with 20 processes for their production are taught in WO 01/27143 incorporated herein by reference. The term "variant" of the antibiotic polypeptides encompasses naturally occurring, recombinantly and synthetically produced polypeptides.
Variant polynucleotide and polypeptide sequences refer to polynucleotide or polypeptide 25 sequences different from the specifically identified BLIS antibiotic sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted or added. Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or other species and encompasses homologues, paralogues and orthologues. Both cDNA and genomic sequence variants are contemplated. Variant sequences preferably 30 exhibit at least 70%, preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, and most preferably at least 99% identity to a BLIS sequence useful in the present invention. For polypeptides, identity is found over a comparison window of at least 15, preferably at least 18 amino acid positions, more preferably at least 20 amino acid positions, and most preferably over the entire length of a polypeptide.
Sequence identity may be determined as discussed above.
Conservative substitutions of one or several amino acids of a described polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al., 1990, Science 247,1306) and WO 01/27143.
The antibiotics and variants useful in the invention can be prepared in a variety of ways. For example, by isolation from a natural source (such as S. salivarius strains K12 and/or K30), by synthesis using any suitable known techniques (such as is described for nisin synthesis by Wakamiya et al., (1991) in "Nisin and Novel Lantibiotics" ed. G. Jung and H. G Shal, 189-15 203, Escom, Leiden or by solid phase synthesis as described by Merrifield (1964) J. Am. Chem. Assoc. 85, 2149-2154, or by synthesis in homogeneous solution as described by Houbenwycl (1987), Methods of Organic Chemistry, Vol I and II) or through employing recombinant DNA techniques such as described by Sambrook et al (1989), Molecular cloning: A Laboratory Manual, Cold Spring Harbour Press, New York, USA.
The variants of both the native BLIS and its variants can similarly be made by any of those techniques known in the art. For example, variants can be prepared by site-specific mutagenesis of the DNA encoding the native amino acid sequence as described by Adelman et al., DNA 2,183 (1983).
The variant sequences, including both polynucleotide and polypeptide variants, may also be identified by computer-based methods well-known to those skilled in the art, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and 30 others). See, e.g., Nucleic Acids Res. 29: 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments. 11 An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]) including BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp://ftp .nchi .nib, eov/bl astA or from the National Center for Biotechnology Information 5 (NCBI), National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894 USA. The NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases. BLASTN compares a nucleotide query sequence against a nucleotide sequence database. BLASTP compares an amino acid query sequence against a protein sequence database. BLASTX compares a nucleotide query sequence 10 translated in all reading frames against a protein sequence database. tBLASTN compares a | protein query sequence against a nucleotide sequence database dynamically translated in all reading frames. tBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database. The BLAST programs may be used with default parameters or the parameters may be altered as required to 15 refine the screen.
The use of the BLAST family of algorithms, including BLASTN, BLASTP, and BLASTX, is described in the publication of Altschul et al., Nucleic Acids Res. 25: 3389-3402,1997.
The "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm, align and identify similar . portions of sequences. The hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence. 25 i The BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce "Expect" values for alignments. The Expect value (E) indicates the number of hits one can "expect" to see by chance when searching a database of the same size containing random contiguous sequences. The Expect value is used as a significance threshold for determining 30 whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in that 12 database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm.
Multiple sequence alignments of a group of related sequences can be carried out with 5 CLUSTALW (Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-4680, http://www-igbmc.u-strasbg.fr/BioInfo/ClustalW/Ton.htmn or T-COFFEE (Cedric Notredame, Desmond G. Higgins, Jaap Heringa, T-Coffee: A novel method 10 for fast arid accurate multiple sequence alignment, J. Mol. Biol. (2000) 302: 205-217))or PILEUP, which uses progressive, pairwise alignments. (Feng and Doolittle, 1987, J. Mol. 0 Evol. 25,351).
Pattern recognition software applications are available for finding motifs or signature sequences. For example, MEME (Multiple Em for Motif Elicitation) finds motifs and 15 signature sequences in a set of sequences, and MAST (Motif Alignment and Search Tool) uses these motifs to identify similar or the same motifs in query sequences. The MAST results are provided as a series of alignments with appropriate statistical data and a visual overview of the motifs found. MEME and MAST were developed at the University of California, San Diego.
PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et al., 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized proteins translated from genomic or cDNA sequences. The PROSITE database (www.expasy.org/prosite) contains biologically significant patterns and profiles and is designed so that it can be used with appropriate computational tools to assign a new sequence 25 to a known family of proteins or to determine which known domain(s) are present in the sequence (Falquet et al., 2002, Nucleic Acids Res. 30, 235). Prosearch is a tool that can search SWISS-PROT and EMBL databases with a given sequence pattern or signature.
In addition to the computer/database methods described above, polypeptide variants may be 30 identified by physical methods, for example by screening expression libraries using antibodies raised against antibiotic polypeptides used in the invention (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Haibor Press, 1987) or by identifying polypeptides from natural sources with the aid of such antibodies. 13 Variant polynucleotides useful herein also or alternately hybridize to the polynucleotide sequences recited above, or complements thereof, antisense sequences and complements thereof, under stringent conditions. As used herein, "stringent conditions" refers to 5 hybridization conditions such as pre-washing in a solution of 6 x SSC, 0.2% SDS; hybridizing at 65°C, 6 x SSC, 0.2 SDS overnight; followed by two washes of 30 minutes each in 1 x SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2 x SSC, 0.1% SDS at 65°C. Such conditions are discussed more fully in, for example, Sambrook et al., Molecular supra.
Recombinant production of a BLIS useful in the invention can be achieved using well known | art techniques as taught in WO 01/27143.
A "therapeutic composition" is a composition appropriate for administration of a S. salivarius strain or extract herein, to an individual in need of same, particularly a halitosis-susceptible 15 individual. In general, therapeutic compositions are composed of a S. salivarius strain or extract discussed above and an acceptable carrier, diluent and/or excipient.
An "acceptable carrier, diluent and/or excipient" means a vehicle for delivery of a S. salivarius strain or extract, to the individual, in which the vehicle is compatible with bacterial 20 cell viability, or activity of the extract. Acceptable carriers, diluents and excipients suitable for use in the administration of viable S. salivarius strains and extracts are well known to ^ those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th ed., Gennaro, ed., 1990, Mack Publishing Co., Easton, Pa., incorporated herein by reference. Suitable carriers are generally inert and can be either solid or liquid.
In one embodiment, the carrier is a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers suitable for use with the S. salivarius strains herein include, but are not limited to, water, buffered saline solutions (e.g., phosphate-buffered saline), pharmaceutically acceptable culture media (e.g. BACa, TSBCaYE agar), or other solutions which maintain the 30 viability of the bacterium. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. A variety of pharmaceutically acceptable carriers suitable for oral administration of viable or lyophilized bacteria are well known in the art (see, for example, Remington's supra.); and the pharmaceutical composition LACTINEX™ (Hynson, Westcott and Dunning, Baltimore, Md. USA), a commercially 14 available formulation for oral administration of viable lactobacilli). Suitable solid carriers known in the art include, for example, magnesium carbonate; magnesium stearate; celluloses; talc; sugars such as fructose, sucrose, mannitol, lactose; starches; flours; oligosaccharides and skim milk, and similar edible powders, but are not limited thereto. Carriers for administration of extracts are similarly well known.
Typical diluents, by way of example, are: starches; lactose; mannitol; kaolin; calcium phosphate or sulphate; inorganic salts such as sodium chloride; and powdered sugars or celluloses.
The compositions may also include excipients such as tableting aids; resins; fillers; binders; lubricants; solvents; glidants; disintegrants; preservatives; buffers; flavourings; colourings; sweeteners; and fragrances as appropriate. A preferred excipient for tablet flowability and compactability is ProSolv™ (Penwest, NY, USA). A preferred sweetener is isomalt.
Typical binders include starch; gelatin; sugars such as lactose, fructose, and glucose; and the like. Natural and synthetic gums are also convenient, including acacia; alginates; locust bean gum; methylcellulose; polyvinylpyrrolidine tragacanth; Xanthan gum: and the like. Polyethylene glycol; ethyl cellulose; and waxes can also serve as binders. A currently 20 preferred binder is Emdex™ (Penwest, NY, USA).
Lubricants to prevent sticking to the die during formation include slippery solids such as talc, silica, magnesium and calcium stearate, polyethylene glycol, stearic acid and hydrogenated vegetable oils.
Disintegrators are substances which swell when wetted to break up the composition and release the S. salivarius or extract. The disintegrators include starches; clays; celluloses; algins and gums; more particularly corn and potato starches; methylcellulose; agar; bentonite; wood cellulose; cation exchange resins; alginic acid; guar gum; citrus pulp; 30 carboxymethylcellulose; powdered sponge; and sodium lauryl sulfate.
The S. salivarius strains or extracts herein can be formulated in any of a variety of compositions suitable for oral administration. For example, the S. salivarius strains can be formulated for administration as a lyophil or cell paste prepared from a S. salivarius culture, or can be directly administered to the oral cavity. The strain or extract can also be administered in the form of a mouthwash, mouth rinse, toothpaste, dentifrice, mouthspray, gargle, capsule, lozenge, syrup, floss, film, chewing gum, or chewable tablet but the forms are not limited thereto.
Therapeutic compositions may include food, confectionary or drink. In one embodiment, the foodstuff or drink is a dairy product-based food or drink including by way of example, yoghurt, cheese, milk, milk power, milk biscuits, and flavoured milks. In the case of confectionary, the formulation can be a chewing gum such as described in WO 00/05972. 10 One preferred composition employs freeze dried S. salivarius strains herein, in milk powder | formulations in a manner similar to that previously reported for the preparation of Bifidus Milk Powder (Nagawa et al. (1988); J. Dairy Sci. 71:1777-1782).
One orally administrable composition of S. salivarius is a blend of freeze dried S. salivarius 15 strains with skim milk powder or the like which has been flavoured to enhance palatability.
Presently preferred orally administrable compositions of S. salivarius, or extracts herein are lozenges, chewable tablets, or capsules. Lozenges such as BLIS K12 formulations (BLIS Technologies Limited, Wellington, New Zealand) are particularly preferred. A suckable 20 lozenge preferably comprises an S. salivarius strain or extract, isomalt and Emdex™. The lozenge may be prepared by direct compression, wet granulation, or dry granulation. The lozenges may be coated according to well known pharmaceutical practice.
The therapeutic composition can additionally contain nutrients to maintain the viability of the 25 bacterium in the formulation. As noted above, the composition can also contain flavouring agents, colouring agents, fragrances, or other compounds which increase the palatability of the composition and/or enhance patient compliance without compromising the effectiveness of the composition. Methods for preparation of compositions for oral administration are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 18th ed., supra, 30 incorporated herein by reference).
For general antimicrobial use, compositions may also be produced for other methods of administration including topically administrable compositions but not limited thereto. 16 The compositions may further comprise one or more secondary antibacterial agents. These secondary agents may, for example, be antibiotics, or other antibacterial agent or antibacterial producing microorganisms. Preferably, the secondary antibacterial agent is a BLIS or BLIS producing microorganism. The BLIS may be one or more of salivaricin A, Ai, A2 and B.
Secondary agents useful in such a composition may be odour masking or neutralising agents such as peppermint, chlorine dioxide, zinc, baking soda or other agents with a similar purpose.
Other ingredients useful in such a composition are anticariogenic agents, for example Xylitol, fluoride, and calcium.
Further ingredients useful in such a composition are agents that selectively enhance growth of desirable bacteria over non desirable organisms. These agents may, for example, be 15 oligosaccharides such as Nutriose® FB (Roquette Freres, Lestrem, France).
In the treatment of halitosis, S. salivarius strains or extracts can be administered to any individual susceptible to halitosis, usually an individual in which black pigmented species, Eubacterium and/or Micromonas colonises the oral cavity such that the halitosis is caused at 20 least in part by one or more black pigmented species, Eubacterium and/or Micromonas.
The term "individual" as used herein includes humans, horses, dogs, cats, pigs, sheep, cattle, | goats but is not limited thereto. Preferably, the individual is a human. The S. salivarius strains can be administered to the individual at any age, e.g. childhood, adolescence, or 25 adulthood.
S. salivarius herein can be orally administered in a variety of ways. For example, in the form of compositions discussed above, particularly lozenges, or as suspensions, sustained release formulas (e.g. an oral implant containing the S. salivarius strain) or lyophil powders. The S. 30 salivarius strains can also be administered by direct application of a lyophil, culture, or cell paste to the oral cavity of the individual. Any mode of administration is suitable as long as the composition is applied to the oral cavity. In one embodiment, the S. salivarius or extracts are administered by applying directly to the tongue of the individual, e.g. by brushing. 17 In general, the amount of S. salivarius administered to the individual will be an amount effective for at least partial replacement of one or more halitosis-causing anaerobic bacteria species, or at least black pigmented species, Eubacterium and/or Micromonas in the oral 5 cavity of the host. "An amount effective for replacement of halitosis-causing anaerobic bacterial strains or at least black pigmented species, Eubacterium and/or Micromonas in the oral cavity of the host" means an amount effective for oral cavity colonisation by the S. salivarius strain, and significant reduction of the resident halitosis-causing anaerobic bacteria (e.g. by competition between the bacteria for nutrients and attachment sites and/or by the 10 production of BLIS by the S. salivarius strain). The colonisation by S. salivarius may effect short or long term colonisation. Short term colonisation is in the order of up to one month. Long term colonisation means months, or even years.
A significant reduction in anaerobic bacteria in one embodiment may be measured indirectly 15 as a reduction, in an individual's pre-treatment average VSC reading, of 50 ppb, preferably 75 ppb, and more preferably 100 ppb for at least 7 days post-treatment.
The term "unit dose" when used in reference to a composition herein refers to physically discrete units suitable as unitary dosage for the individual, each unit containing a 20 predetermined quantity of active material (viable S. salivarius or active extract thereof) calculated to produce the desired therapeutic effect in association with the required diluent, ^ carrier, or excipient.
Specific dosages can vary widely according to various individual variables including size, 25 weight, age, disease severity (e.g. the tenacity and/or number of halitosis-causing resident bacteria) and responsiveness to therapy (e.g. the susceptibility of the individual's oral cavity to colonisation). Methods for determining the appropriate route of administration and dosage may be determined by the consumer as they deem appropriate, or on a case-by-case basis by an attending dentist or other clinician. Such determinations are routine to one of ordinary 30 skill in the art (see for example, Remington's Pharmaceutical Sciences, 8th ed., Gennaro, ed., Mack Publishing Company, Easton, Pa., 1990).
In general, the number of S. salivarius administered to the individual will range from about 102 to 1015 bacteria, preferably from about 103 to 1014 bacteria, more preferably from about 18 105 to 1012 bacteria, normally about 109 to 1010 colony forming units (CFU) per dose. One formulation employs 3.8 x 109 CFU/lozenge.
Multiple doses of the S. salivarius strain can be administered to achieve oral cavity colonisation and replacement of the resident, halitosis-causing strains, particularly black pigmented species, Eubacterium and/or Micromonas of the individual. The S. salivarius strain or extract may need to be administered to the patient once only or more usually repeatedly. Repeat treatments may be once a month, once a week, once a day, twice a day, or as may otherwise be required. Conveniently, the administration may be effected as part of the patient's routine dental care, e.g. as a component of a lozenge, gum, toothpaste, floss, or mouthwash.
To facilitate colonisation, in one embodiment the treatment method includes a preliminary step of pre-treating the individual to at least reduce the normal microflora present in the oral cavity, including halitosis causing organisms. This pre-treatment comprises the step of administering an antimicrobial agent such as chlorhexidine, chlorine dioxide, triclosan, lactoperoxidase, green tea, or pineapple juice (freeze dried), but not limited thereto. Where a chlorine dioxide mouth rinse is used, it is preferably mixed with water or desirably fruit juice, especially orange juice, prior to administration. The concentration of chlorine dioxide is conveniently between 2,000 and 7,000 ppm, more usually 2,500 to 5,000 ppm, and pH of 3 to 5, preferably 3.5. The pre-treatment may also include physical removal methods such as brushing, flossing and/or tongue scaping, or may follow a prescribed course of antibiotics such as tetracyclines, penicillin, erythromycin, metronidazole, or amoxycillin administered to said individual. S. salivarius, or compositions containing same are then administered to the depopulated environment to repopulate same.
One treatment protocol for halitosis comprises pre-treatment by scraping the tongue, brushing teeth and tongue with antibacterial toothpaste (e.g. Perioguard®, 2% chlorhexidine (Colgate, Australia); gargling or rinsing with chlorhexidine (e.g. a rinse with 0.2% chlorhexidine); then taking a lozenge. In a preferred protocol for treatment of halitosis the pre-treatment comprises scraping the tongue and optionally brushing teeth and tongue with a non-chlorhexidene containing toothpaste (e.g. most commercially available toothpastes); gargling or rinsing with chlorine dioxide; then taking a lozenge. In each case, a lozenge is administered 1-4 hours, preferably 2 hours after the pre-treatme ' 19 administration of a further 2-5, preferably 3 lozenges through the day at intervals of 1-4 hours, preferably about every 2 hours. This protocol is followed for 2-4 days to facilitate colonisation. Usually, in this period the teeth and tongue are brushed and the gargle or rinse continued. However, the brushing with chlorhexidine toothpaste, if used, is discontinued. For maintenance purposes 1, 2, or 3 lozenges, usually 1 to 2 lozenges axe taken each day following ordinary tooth brushing. The regime is continued for as long as required.
Successful colonisation of the individual's oral cavity by the S. salivarius strain can be established by culturing the bacteria of the individual's oral cavity, and identifying the S. salivarius strain by, for example, BLIS production or other methods well known in the art for bacterial strain identification.
Success of treatment can be measured indirectly where post-treatment levels of volatile sulphur compounds are reduced below pre-treatment levels in an individual being treated.
The uses of the invention and methods described may further comprise the use of one or more secondary agents, including secondary antibacterial agents as discussed above.
Where the term comprise, comprises, comprised or comprising are used in this specification, they are to be interpreted as specifying the presence of the stated features, integers, steps or components referred to, but not to preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.
All references cited throughout the specification including in the Reference listing are specifically incorporated herein by reference.
In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.
INTELnL|CTUAL PTOPimv] OFFICE OF Mi Various aspects of the invention will now be illustrated in a non-limiting way by reference to the following experimental section.
EXAMPLES Deferred Antagonism Test of Anti-bacterial Activity The spectrum of inhibitory activity of Streptococcus salivarius K12 and K30 was established by use of a deferred antagonism test, essentially as described by Tagg and Bannister (J. Med. Microbiol. 1979; 12:397). In brief, a 1-cm wide diametric streak culture of K12 and K30 20a jul 2008 i rec Ely ED (producer strain) was inoculated onto blood agar-calcium medium (Columbia agar base plates, 5% human blood, 0.1% CaCC>3 [BDH]). Following incubation in a 5% CO2 atmosphere, for 24 hours at 37°C, the macroscopic cell growth was removed with a glass slide and residual cells on the agar surface were killed by exposure to chloroform vapours for 30 5 minutes. The agar surface was then aired for 30 minutes. Indicator strains implicated in halitosis which had been grown for 48 hour on blood agar-calcium plates, were suspended in Todd Hewitt broth and used to inoculate at 90-degree angles across the line of the original streak culture with the use of sterile cotton swabs, under anaerobic conditions. After incubation for 48 hours in an anaerobic environment at 37°C the extent of inhibition of each 10 indicator strain was recorded. The scoring system for the measurement of inhibition was the ^ following: a negative sign (-) denoted no inhibition of the indicator microorganism; a positive symbol (+) indicated that there was some inhibition on the plate where the producer microorganism had grown, but not exclusively over that entire region; two positive symbols (++) denoted that the indicator strain was inhibited where the producer strain was grown; 15 when three positive symbols (+++) were used, growth of the indicator strain was at least 5 mm away from where the producer strain had grown; and four positive symbols (++++) represented inhibition of the indicator strains beyond 5 mm of growth. The results are shown in Table 1 below.
Effect of S. Salivarius K12 extract on bacteria S. salivarius K12 was grown in skim milk powder broth at 33°C for 18 h. The bacterial cells were harvested by centrifugation and freeze-dried. One gram of freeze-dried cells were incubated in 10 ml of 95% methanol, pH 2.5 at room temperature for 2 h. The preparation was centrifuged to remove undissolved material. The toxicity of the supernatant was tested 25 using a well diffusion assay.
Inhibition of black-pigmented bacteria (Prevotella species) in saliva by S. salivarius strains To test the ability of S. salivarius against black-pigmented microorganisms which have been 30 implicated in halitosis, S. salivarius strains K12 (salA and B producer), NR (salB producer), 20P3 (salA producer) and MU-Neg (non-producer) were swabbed from master plates onto the entire half of several pH-buffered blood plates (Columbia agar base plates, 5% human blood, 0.1% CaC03 [BDH]). Plates were incubated for 18 hours at 37°C under 5 % CO2 conditions. Bacterial growth by removed using cotton-tipped swabs and chloroform vapours were used to 21 kill any remaining bacteria. Fifteen millilitres of vancomycin blood agar (per L; 30 g trypticase soy broth [BBL], 15 g agar [BBL] and after autoclaving, 50 ml of defibrinated blood and 10 ml of filter-sterilized vancomycin stock solution [0.014g in 10 ml H2O]) was overlaid on plates and allowed to set. Fresh saliva-samples from two 'normal' subjects were 5 diluted in sterile saline and 50 ul aliquots were immediately spiral plated on to the prepared agar plates. Plates were incubated under anaerobic conditions at 37°C for 48-72 hours depending on growth. Both sectors of the plate were counted.
Effect of S. salivarius K12 on halitosis subjects Subjects, treatment, probiotic instillation and sample collection Sixty-five subjects were screened for volatile sulphur compound (VSC) breath readings by halimeter (InterScan Corp., Chatsworth, CA). VSC readings in persons with normal breath are typically in the range of 80-150 ppb. At levels of 200-300 ppb oral malodor is noticeable by an observer standing close to the patient. At 350-400 ppb, the odour is noticeable by an 15 observer standing several feet away from the patient. Those subjects with breath scores of greater than 200 ppb on two separate visits were were recruited for the study (n=13). Each signed an Informed Consent under a protocol approved by the Otago Ethics Committee. Subject's upon their second positive visit undertook a mechanical and chemical treatment of their mouths at the laboratory. This consisted of teeth and tongue brushing (2 minutes with 20 Colgate Total™ [0.3% w/v triclosan], Colgate-Palmolive, NY, USA), tongue scraping for 30 seconds, brushing teeth and tongue with a CHX gel (Colgate, Australia) (Perioguard 2.0% CHX mouth gel, 2 minutes) and followed by a 30 second CHX rinse (0.2% CHX, 10% ethanol alcohol). This was followed at intervals by the sucking of a lozenge (BLIS Technologies Limited, Wellington, New Zealand) (commencing 2 hours after treatment and 25 typically 2 hours apart, 4 times daily), each containing >1 x 109 colony forming units of streptomycin-resistant S. salivarius K12. On days 2 and 3, subjects brushed their teeth and tongue in the morning with Colgate Total™, used a 30 second CHX rinse (0.2% CHX, 10% ethanol alcohol) and used K12 lozenges as per the first day. The subjects then ceased with the chlorhexidine treatment and took just two lozenges per day on days 4 to 14 after conducting 30 their normal oral care regimen, morning and night.
At each pre-treatment visit and at one and two weeks after treatment initiation the subjects were tested for VSC levels and both saliva samples and tongue swabs were taken (prior to 22 taking morning lozenge). During the study two subjects were sampled more frequently and kept on two lozenges for a period of 28 days. These subjects provided additional samples at day 4, 11, 21, 28 and two weeks post ceasing K12 administration. All measurements were taken in the morning prior to the subjects eating, drinking smoking or using any oral care.
After the study 4 subjects who responded positively to the treatment were followed up six weeks later. To determine the effect of the chlorhexidine treatment on breath scores subjects were asked to repeat the study using the same 3-day CHX regimen, but with no S. salivarius probiotic. As for the study subjects were seen on the seventh day for measurements and 10 samples.
^ Saliva analysis Fresh saliva samples and tongue swabs were tested for iV-benzoyl-DL-arginine-2-naphthylamide (BANA) hydrolysis (BANAMet ILC, Ann Arbor, MI.), since positive scores 15 by the BANA test have previously been associated with the presence of malodour-forming enzyme activities of certain oral bacterial species (1,3). This was conducted according to the manufacturers' directions. Organoleptic assessment was performed on aliquots of the subjects' frozen saliva specimens. Briefly, 300 ul of thawed saliva was incubated at 37°C for 10 minutes in a closed eppendorf. After incubation, the lid was removed and the vessel held at 20 approximately 4 cm from the examiner's nose for assessment purposes. The samples were graded according to the same criteria used to assess breath air of halitosis sufferers (7), using ^ a scale of 0-5, with 0 equating to no odour detected and 5 the most severe.
Culture analysis Fresh saliva samples were immediately diluted ten-fold in sterile phosphate-buffered saline (PBS, pH 7.5). Fifty-micro litre aliquots were spiral plated onto pH-buffered blood plates (as previously described), Mitis-salivarius agar (Difco, S. salivarius selective) and K12-selective Mitis-salivarius agar containing streptomycin (100 ug/ ml, Sigma, Mo, USA). Plates were incubated in a 5% CO2 atmosphere, for 24 hours at 37°C. An estimate of colonisation levels 30 with S. salivarius K12 was obtained from the colony counts on the Mitis-saiivarius/streptomycin agar.
Results Inhibitory effect 23 The testing of Streptococcus salivarius strains that were non-producers of salivaricins or that produced either salA and salB, salA only, salB only against some of the bacterial species implicated in halitosis showed that only the gram-positive bacteria were affected when tested by deferred antagonism (Table 1.).
Table 1. Sensitivities of selected microoganisms implicated in halitosis to various S. salivarius strains Inhibition of growth of organisms implicated in halitosis £2 o L 1 lis i! I a Iii § a C § Pi of c -a c -S3 -s a* •& c c U §! <* 1 3 r. |3 S S(j S. salivarius Bacteriocin/s ;S -S « "§ -S t? -2 H © £* f- © k | ■§ h ■fart. produced * •* w ^ ^ < ^s<: * -S ^ K12 Salivaricin A2 ++++ Mil ++++ I I II ... Salivaricin B K30 Salivaricin A2 Mil Mil Mil mm ... Salivaricin B NR Salivaricin B Mil Mil ++ Mil 20P3 Salivaricin A Mil MU Neg. Non producer 0 The maximum amount of inhibition of the gram-positive bacteria was produced by strain K12 and K30, which produces salA and salB. S. salivarius strain NR (a salB only producer) had good activity against the Micromonas micros strain but reduced activity against Eubacterium saburreum when compared to strain K12 and K30. The non bacteriocin-producing strain (MU Neg.) did not inhibit any of the strains tested.
Table 2. Well diffusion assay of S. salivarius K12 extract 24 Extract Zone size (mm) Micromonas micros ATCC 33270 Prevotella intermedia ATCC 256111 Prevotella intermedia WSO S. salivarius K12 4 4 4 The titre of the S. salivarius K12 extract against Micrococcus luteus was 128. The extract had 10 activity against Micromonas micros and the two Prevotella intermedia strains.
^ Effect against organisms in saliva In both subjects the largest reduction (8 and 37% of respective counts) of black-pigmented microorganisms appeared on the control half of the agar plate where K12 (salA, B producer) 15 had grown (Table 2., Figl.).
In both subjects there were substantial reductions (8% and 37% respectively) in the counts of colonies of black-pigmented bacteria on the side of the plate where strain K12 had previously been grown when compared with the counts on the control half of the plate (Table 2., Figl.).
Table 2. Effect of S. salivarius strains on black-pigmented bacterial counts in saliva specimens Streptococcus salivarius strain and numbers of black-pigmented colonies* Subject K-12 Control-half NR Control-half 20P3 Control-half MUNeg Control-half A 1.4 xlO5 1.7 xlO6 1.4 xlO6 3.0 xlO6 2.0 x 106 3.5 x 106 1.8 x 10® 2.2 x 106 B 3.0 x 106 7.9 x 106 4.1 x 106 6.9 x 106 3.1 x 106 6.6 x 106 .4 xlO6 2.6 x 106 *CFU/ml of black-pigmented colony morphology.
There was also some reduction in numbers of black pigmented colonies on the plateson which either the salA only or salB only producers had been grown, but little reduction of numbers on the control plate on which the non-salivaricin producing strain had been grown. 30 Several black pigmented colonies of the type that had been inhibited by the presence of the salivaricins were picked from the control sections of the plates andtheir DNA was extracted, amplified by PCR and sequenced. The sequencing results (not shown) indicated that the susceptible bacteria had highest homology to Prevotella sp. oral clone BE073 (closely related to Prevotella melaninogenica) 99% 152bp (AF385551).
Clinical data All subjects completed the two-week study. Volatile sulphur compound (VSC) readings decreased by greater than 100 ppb in 11/13 subjects when measured at 7 days and 8 of these subjects maintained lower than pre-treatment levels when tested again at day 14 (Table 3). 26 Table 3. Subject readings at baseline and after treatment Bas eline Treatment Demographies Initial Screen Second Visit Dav7 Dav 14 Subject (n=13) Age Sex VSC (ppb) BANA Saliva organoleptic VSC (ppb) BANA Saliva organoleptic VSC (ppb) BANA Saliva organoleptic VSC (ppb) BANA Saliva organoleptic 4 18 F 386 +/- 3 504 ND 175 +/- 2 222 2 M 292 ND ND 394 ND ND 159 - 1 97 - 2 12 18 M 404 + 3 434 +/- ND 59 +/- 1 364 - 2 27 F 324 - 3 514 - 3 128 - 1 145 - 1 39 M 320 - 4 200 ND ND 631 - 413 +/- 4 38 69 M 363 +/- 3 290 + 3 197 +/- 2 358 - 3 46 47 M 229 + 3 327 + 4 75 +/- 2 266 +/- 4 47 64 F 307 + 3 443 + 3 126 +/- 2 183 +/- 3 52 68 M 486 + 4 312 +/- 3 109 +/- 3 56 - 2 58 68 M 408 - 3 213 +/- 3 154 +/- 2 122 - 1 59 33 F 254 + 3 206 +/- 2 304 +/- 1 303 - 2 60 41 M 433 +/- 4 381 - 3 287 - 3 244 - 3 64 43 M 286 + 3 210 +/- 2 132 - 2 135 - 1 Mean (SD) 42.54 (19.59) F=4 M=9 345.54 (75.06) 3.25 (0.45) 340.62 (113.74) 2.88 (0.60) 195.08 (149.26) 2.077 (1.12) 223.69 (112.6 5) 2.307 (1.03) +/-=weak positive. ND=not determined. 26 The BANA readings were also lower in most subjects post treatment, where no strong positives were detected, whereas several were detected prior. Changes in the organoleptic readings also generally correlated with the other clinical parameters that were measured.
Four subjects who had maintained lower breath readings and parameters during the K12 treatment were recalled six weeks later for monitoring the effect of the chlorhexidine alone. One subject was excluded as their VSC breath levels had not returned to greater than 200 ppb. /There was no decrease in the VSC, organoleptic or BANA readings of the three subjects after treatment with CHX only (Table 4.).
Table 4. Subject readings of three recalled subjects before and after chlorhexidine Baseline Post CHX treatment Mean VSC (ppb) VSC change in K12 VSC Saliva VSC Saliva (ppb) change Subject trial (ppb) BANA organoleptic (ppb) BANA organoleptic after CHX only 27 -282.5 532 +/- 2 527 + 2 -5 47 -220.5 298 +/- 3 244 +/- 3 -54 60 -141.5 216 +/- 3 274 +/- 2 +58 Culture data The average colonisation for the subjects after treatment with S. salivarius K12 ranged from 29 to 95 percent. (Table 5) Generally, there was no significant change in total bacterial counts of the subjects either before or after treatment, however, there was a slight though non-significant increase in S. salivarius numbers (Table 5.). m0 27 Table 5. Mean salivary counts (CFU/ml) of total facultative bacteria, S. salivarius and S. salivarius K12 in 13 subjects prior to and at 7 and 14 days post initiation of K12 treatment Bacterial population Media Pre-treatment* Initial Second screen visit Treatment* Day 7 Day 14 Total Columbia blood agar calcium 8.7 x 108 (1.4 xlO9) 2.4 x 108 (2.7 x 108) 3.3 x 108 (4.8 x 108) 2.3 x 108 (3.7 xlO8) S. salivarius Mitis salivarius 4.4 x 107 (6.8 x 107) 4.5 x 107 (6.2 x 107) 6.1 xlO7 (7.8 x 107) 6.1 x 107 (6.6 xlO7) S. salivarius K12 Mitis salivarus + streptomycin 0 0 1.8 x 107 (4.9 x 107) .8 x 107 (1.4 xlO7) Proportion K12 to all S. salivarius 0 0 0.2951 0.9508 Values in parentheses indicate standard deviation of mean.
"Total and S. salivarius cell counts were not significantly different before or after treatment (Non parametric ANOVA, PX).5).
Discussion Streptococcus salivarius K12 was detectable in each subject's saliva in both post samples taken at least 12 hours after subjects took their last dose the previous night.
When examining the percentage of S. salivarius as a proportion of the total bacterial composition, 85% of the subjects had an increase in the proportion of this bacterium as part of 5 the total count, suggesting that it had become more common in the oral cavity.
The VSC levels of eight subjects were significantly lower when tested one and two weeks after commencing treatment. Three subjects had Iowa: readings only after one week and the remaining two subjects maintained high levels throughout the study. Reduction of BANA 20 activity occurred in most subjects following treatment. In deferred antagonism studies, S. salivarius K12 inhibited gram positive bacterial species implicated in halitosis, and significantly inhibited black-pigmented colony types present in saliva samples.
Based on these studies, the replacement of bacteria implicated in halitosis with a bacteriocin-25 producing commensal bacterium, particularly S. salivarius K12, appears to provide an alternative therapy for the long term reduction of halitosis. 28 LOZENGE Lozenge Ingredients Per 945 mg lozenge S. salivarius 3.8 x 10y CFU (freeze dried) Isomalt 600mg Emdex™ 150mg ProSolv HD™ 50mg Magnesium stearate 15mg Flavour lOmg The ingredients are blended and tablets produced using dry compression.
BLIS-producing S. salivarius strains, particularly salivaricin B producing strains are active against a number of microorganisms implicated in halitosis (Tables 1, 2 and 6). More particularly, the strains are shown for the first time to be active in a maintenance regime, that is, for generating a cumulative effect against at least some anaerobic halitosis-causing organisms over a period of a week or more. This is surprising where generally S. salivarius 15 strains are thought to be active against only closely related aerobic organisms. Halitosis-causing organisms are anaerobic and occupy niches not generally accessed by S. salivarius, The strains and related active extracts, formulations and compositions herein therefore have application in methods of prophylactically or therapeutically treating individuals against the ^ harmful effects at least of some Eubacterium and Micromonas infections, as well as some 20 black-pigmented colony types, especially in the oral cavity. These methods include treatment of halitosis in which these organisms are the primary causative agents. The S. salivarius extracts and compositions of the invention also have application in the treatment of sore throats.
It will be appreciated that the above description is provided by way of example only and that variations in both the materials and techniques used which are known to those persons skilled in the art are contemplated. 29 Bosy, A., G. V. Kulkarni, M. Rosenberg, and C. A. McCulloch. 1994. Relationship of oral malodor to periodontitis: evidence of independence in discrete subpopulations. J Periodontol 65:37-46.
Burton, J. P., and G. Reid. 2002. Evaluation of the bacterial vaginal flora of 20 postmenopausal women by direct (Nugent score) and molecular (polymerase chain reaction and denaturing gradient gel electrophoresis) techniques. J Infect Dis 186:1770-80.
De Boever, E. H., and W. J. Loesche. 1995. Assessing the contribution of anaerobic microflora of the tongue to oral malodor. J Am Dent Assoc 126:1384-93.
Kazor, C. E., P. M. Mitchell, A. M. Lee, L. N. Stokes, W. J. Loesche, F. E. Dewhirst, and B. J. Paster. 2003. Diversity of bacterial populations on the tongue dorsa of patients with halitosis and healthy patients. J Clin Microbiol 41:558-63.
Tagg, J. R., and L. V. Bannister. 1979. "Fingerprinting" beta-haemolytic streptococci by their production of and sensitivity to bacteriocine-like inhibitors. J Med Microbiol 12:397-411.
Walter, J., G. W. Tannock, A. Tilsala-Timisjarvi, S. Rodtong, D. M. Loach, K. Munro, and T. Alatossava. 2000. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl Environ Microbiol 66:297-303.
Yaegaki, K., and J. M. Coil. 2000. Examination, classification, and treatment of halitosis; clinical perspectives. J Can Dent Assoc 66:257-61.
NOW AMENDED WHAT WE CLAIM IS: 1. A use of a BLIS-producing S. salivarius or extract >diei£of in the preparation of a composition for the prophylactic or therapeuti/ treatment of halitosis in an individual in need thereof, wherein the halitosis/s caused at least in part by one or more species of anaerobic bacteria. 3.
A use of claim 1 wherein the composition fis for controlling the incidence of halitosis in an individual in need thereof./ A use of claim 1 wherein the compos/tioj/ is for controlling the severity of halitosis in an individual in need thereof.
A use according to any one offclaims 1 to 3 wherein the anaerobic bacteria are strains of: (i) black-pigmented specie (ii) Eubacterium species; /nd/or (iii) Micromonas spejzies/ A use according to yclajrn 4 wherein the black-pigmented species are Prevotella species. 6. A use according/to claim 5 wherein the Prevotella species are Prevotella intermedia and/or Prevotella melaninogenica. 7. A use acoordmg to claim 4 wherein the Eubacterium are Eubacterium saburreum. 8. A use/according to claim 4 wherein the Micromonas are Micromonas micros.
(VLSf according to any one of claims 1 to 8 wherein the S. salivarius produce one )r more of Salivaricin A, Salivaricin Aj, Salivaricin A2, Salivaricin B, or variants of any one of these.
A use according to claim 9 wherein the S. salivarius produces Salivaricin B or a variant thereof. 31 ''NTEOffSVw®tv| 1 5 JUL 2008 I £L£ceive d RECEIVED at IPONZ on 19 May 2011 as amended

Claims (40)

WHAT WE CLAIM IS:
1. A use of a BLIS-producing S. salivarius or extract thereof in the preparation of a composition for the prophylactic or therapeutic treatment of halitosis in an 5 individual in need thereof, wherein the halitosis is caused at least in part by one or more species of anaerobic bacteria sensitive to said BLIS-producing S.salivarius.
2. A use of claim 1 wherein the composition is for controlling the incidence of halitosis in an individual in need thereof. 10
3. A use of claim 1 wherein the composition is for controlling the severity of halitosis in an individual in need thereof.
4. A use according to any one of claims 1 to 3 wherein the anaerobic bacteria are 15 strains of: (i) Prevotella species; (ii) Eubacterium species; and/or (iii) Micromonas species. 20
5. A use according to claim 4 wherein the Prevotella species are Prevotella intermedia and/or Prevotella melaninogenica.
6. A use according to claim 4 wherein the Eubacterium are Eubacterium saburreum. 25
7. A use according to claim 4 wherein the Micromonas are Micromonas micros.
8. A use according to any one of claims 1 to 7 wherein the S. salivarius produce one or more of Salivaricin A, Salivaricin Ai, Salivaricin A2, Salivaricin B, or variants of any one of these. 30
9. A use according to claim 8 wherein the S. salivarius produces Salivaricin B or a variant thereof.
10. A use according to claim 9 wherein the S. salivarius also produces Salivaricin A2 35 or a variant thereof. 31 NOW AMENDED
11. A use according to claim 10 wherein the S. salivarius /ls
12. A use according to claim 11 wherein the Salivari/cin/producer is S. salivarius strain K12, on deposit at Deutsche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Braunschweig, Germany, accession number DSM 13084. 10 13. A use according to claim 11 wherein the »ali#aricin producer is S. salivarius strain K30, on deposit at Deutsche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Braunschweig, Germany, acc/ssi/n number DSM 13085. 14. A use according to any one of /laims 1 to 8 wherein the S. salivarius extract comprises Salivaricin B or a variant/thereof. 15 15. A use according to any on/ 0/ claims 1 to 8 and 14 wherein the S. salivarius extract comprises Salivarioin A2 or a variant thereof. 20 16. A use according to clajfei )f5 wherein Salivaricin B or variant is in isolated or pure form. 17. A use according p cj4im 16 wherein Salivaricin A2 or variant is in isolated or pure form. 25 18. A use according to any one of claims 1 to 17 wherein the composition further comprise/a diluent, carrier and/or excipient. 19. A user according to claim 18 wherein the composition is formulated for oral administration. 30 20. A ijse according to claim 19 wherein the composition is formulated as a lozenge, spfay, mouth rinse, toothpaste, dentifrice, gargle, capsule, floss, film, chewing mm of chewable tablet. 35 :1./ A use according to claim 20 wherein the composition is formulated as a lozenge. fNKOFFii%P™p™l 32 I 1 15 jul a® I REHFU/c J RECEIVED at IPONZ on 19 May 2011 as amended 11. A use according to claim 10 wherein the Salivaricin producer is S. salivarius strain K12, on deposit at Deutsche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Braunschweig, Germany, accession number DSM 13084. 5 12. A use according to claim 10 wherein the Salivaricin producer is S. salivarius strain K30, on deposit at Deutsche Sammlung von Mikroorganismen Und Zellkulturen GmbH, Braunschweig, Germany, accession number DSM 13085.
13. A use according to any one of claims 1 to 7 wherein the S. salivarius extract 10 comprises Salivaricin B or a variant thereof.
14. A use according to any one of claims 1 to 7 and 13 wherein the S. salivarius extract comprises Salivaricin A2 or a variant thereof.
15. 15. A use according to claim 14 wherein Salivaricin B or variant is in isolated or pure form.
16. A use according to claim 15 wherein Salivaricin A2 or variant is in isolated or pure form. 20
17. A use according to any one of claims 1 to 16 wherein the composition further comprises a diluent, carrier and/or excipient.
18. A use according to claim 17 wherein the composition is formulated for oral 25 administration.
19. A use according to claim 18 wherein the composition is formulated as a lozenge, spray, mouth rinse, toothpaste, dentifrice, gargle, capsule, floss, film, chewing gum or chewable tablet. 30
20. A use according to claim 19 wherein the composition is formulated as a lozenge.
21. A use according to any one of claims 17 to 20 wherein the composition is in unit dosage form. 35 32 NOW AMENDED
22. A use according to any one of claims 18 to 21 wherei dosage form. /
23. A use according to any one of claims 18 to 22/wherein the composition further 5 comprises one or more secondary antibacterial agents.
24. A use according to claim 23 wherein thft secondary antibacterial agent(s) are selected from bacteriocin-like inhibitory subatance(s) (BLIS). 10
25. A use according to any one of claims/l to 17 wherein said S. salivarius or extract is included in the preparation of a food,ilrink, or confectionary. 15
26. A use according to any one of iclamis 1 to 25 wherein the treating or controlling effect is caused by at least paftia¥ colonisation of the oral cavity of an individual with a BLIS-producing S. salivarius. 20
27. A use according to clain/i 26 wherein the treatment or control regime includes a preliminary step of pce-tceating said individual to at least reduce the bacterial population present in/the/oral cavity.
28. A use according t6 claim 27 wherein the pre-treatment comprises physical removal of bacteria and/or administration of an antibacterial agent.
29. A use accoraing to any one of claims 26 to 28 wherein the treatment or control 25 regime co/ipwses the steps of: )ing the tongue of the individual; ' gangling or rinsing with an antibacterial agent; and (iii)/ Administering to the resulting bacterially depopulated oral cavity an amount of a BLIS-producing S. salivarius, extract thereof, or composition 30 / / comprising said S. salivarius or extract thereof, effective to control said halitosis. A use according to claim 29 wherein the treatment regime further comprises brushing with a non-chlorhexidine containing toothpaste before gargling or rinsing 35 II with the antibacterial agent. 33 INTELLECTUAL PROPERTY QF^'OF O* /;15 jul 2008;RECEIVED at IPONZ on 19 May 2011;AS AMENDED;22. A use according to any one of claims 17 to 21 wherein the composition further comprises one or more secondary antibacterial agents.;23. A use according to claim 22 wherein the secondary antibacterial agent(s) are 5 selected from bacteriocin-like inhibitory substance(s) (BLIS).;24. A use according to any one of claims 1 to 16 wherein said S. salivarius or extract is included in the preparation of a food, drink, or confectionary.;10 25. A use according to any one of claims 1 to 24 wherein the treating or controlling effect is caused by at least partial colonisation of the oral cavity of an individual with a BLIS-producing S. salivarius.;26. A use according to claim 25 wherein the treatment or control regime includes a 15 preliminary step of pre-treating said individual to at least reduce the bacterial population present in the oral cavity.;27. A use according to claim 26 wherein the pre-treatment comprises physical removal of bacteria and/or administration of an antibacterial agent.;20;28. A use according to any one of claims 25 to 27 wherein the treatment or control regime comprises the steps of:;(i) scraping the tongue of the individual;;(ii) gargling or rinsing with an antibacterial agent; and;25 (iii) administering to the resulting bacterially depopulated oral cavity an amount of a BLIS-producing S. salivarius, extract thereof, or composition comprising said S. salivarius or extract thereof, effective to control said halitosis.;30 29. A use according to claim 28 wherein the treatment regime further comprises brushing with a non-chlorhexidine containing toothpaste before gargling or rinsing with the antibacterial agent.;
30. A use according to any one of claims 27 to 29 wherein the antibacterial agent is 35 selected from chlorine dioxide and chlorhexidine.;33;NOW AMENDED;
31. A use according to any one of claims 28 to 30 wh^reija the antibacterial agent is selected from chlorine dioxide and chlorhexidine.;
32. A use according to claim 31 wherein the antibacterial agent is chlorine dioxide.;10;15;
33. A use according to any one of claims 29 tc/32/wherein the S. salivarius or extract thereof is administered in the form of k composition according to any one of claims 18 to 24; or a food, drink or confectionary according to claim 25.;
34. A use according to claim 33 wherein the composition is in the form of a lozenge.;
35. A use according to claim p4 /wherein the lozenges are formulated for administeration 1 to 5 times apsyl;
36. A use according to claim J54 wherein the lozenges when administered are administered 1 to 5 time/a day.;20;
37. A use according to any one of claims 29 to 36 wherein the composition comprises a BLIS-producing S. salivarius.;
38. A use according Wclaim 36 wherein the administration is repeated daily for 2 to 4 days to facilitate ^colonisation of the oral cavity of the individual.;25
39. A use acoordmg to claim 38 wherein after colonisation, 1 or 2 lozenges are taken each day following ordinary tooth brushing.;30;
40. A use as defined in claim 1 of a BLIS-producing S. salivarius or extract thereof, swst/ntially as herein defined with reference to any example thereof.;34;PROPERiv);/ OFFICE Op j;15 JUL 2008 i;MLCElVFni;AS AMENDED;RECEIVED at IPONZ on 19 May 2011;31. A use according to claim 30 wherein the antibacterial agent is chlorine dioxide.;32. A use according to any one of claims 28 to 31 wherein the S. salivarius or extract 5 thereof is administered in the form of a composition according to any one of claims 17 to 23; or a food, drink or confectionary according to claim 24.;33. A use according to claim 32 wherein the composition is in the form of a lozenge.;10 34. A use according to claim 33 wherein the lozenges are formulated for administration 1 to 5 times a day.;35. A use according to claim 33 wherein the lozenges when administered are administered 1 to 5 times a day.;15;36. A use according to any one of claims 28 to 35 wherein the composition comprises a BLIS-producing S. salivarius.;37. A use according to claim 35 wherein the administration is repeated daily for 2 to 4 20 days to facilitate colonisation of the oral cavity of the individual.;38. A use according to claim 37 wherein after colonisation, 1 or 2 lozenges are taken each day following ordinary tooth brushing.;25 39. A use as defined in claim 1 of a BLIS-producing S. salivarius or extract thereof, substantially as herein defined with reference to any example thereof.;34*
NZ546406A 2003-07-18 2003-07-18 Treatment of halitosis with BLIS-producing S. salivarius NZ546406A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NZ546406A NZ546406A (en) 2003-07-18 2003-07-18 Treatment of halitosis with BLIS-producing S. salivarius

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NZ546406A NZ546406A (en) 2003-07-18 2003-07-18 Treatment of halitosis with BLIS-producing S. salivarius
NZ52707504 2004-10-12

Publications (1)

Publication Number Publication Date
NZ546406A true NZ546406A (en) 2008-08-29

Family

ID=40158428

Family Applications (1)

Application Number Title Priority Date Filing Date
NZ546406A NZ546406A (en) 2003-07-18 2003-07-18 Treatment of halitosis with BLIS-producing S. salivarius

Country Status (1)

Country Link
NZ (1) NZ546406A (en)

Similar Documents

Publication Publication Date Title
US8057790B2 (en) Treatment of malodour
EP1483366B1 (en) Antimicrobial composition
CN109890955B (en) Antibacterial agent-resistant lactic acid bacteria
CN117717569A (en) Oral compositions
JP5544234B2 (en) Composition for inhibiting periodontal disease growth
US20230303964A1 (en) Antiviral treatment comprising blis containing probiotic products
NZ546406A (en) Treatment of halitosis with BLIS-producing S. salivarius
TWI823140B (en) Novel bacillus velezensis strains and use thereof
EP4194543A1 (en) Bacillus subtilis strain and use thereof
US20240009254A1 (en) Composition for preventing or treating periodontal diseases, comprising bacillus velezensis strain, culture medium thereof, or culture supernatant thereof as active ingredient
Ramsey John TAGG, et al. Streptococcus salivarius K12 vs Halitosis
AU2022356489A1 (en) Probiotic enhancers and uses thereof
NZ536689A (en) Streptococcus salivarius strain and extract having anti-mutans Streptococci activity

Legal Events

Date Code Title Description
PSEA Patent sealed
RENW Renewal (renewal fees accepted)
S38A Application for proceedings under section 38 (amendment of specification with leave of commissioner)

Free format text: BY WAY OF DISCLAIMER AND EXPLANATION

RENW Renewal (renewal fees accepted)
S38C Proceedings under section 38 (amendment of specification with leave of commissioner): specification amended
RENW Renewal (renewal fees accepted)

Free format text: PATENT RENEWED FOR 3 YEARS UNTIL 12 OCT 2017 BY AJ PARK

Effective date: 20140822

Free format text: PATENT RENEWED FOR 7 YEARS UNTIL 12 OCT 2024 BY AJ PARK

Effective date: 20140822