NZ540677A - Biosynthesis of the insect antifeedant peramine - Google Patents

Abstract

Disclosed are methods of manipulating peramine biosynthesis in fungal endophytes. Also disclosed are a gene and a polypeptide (encoded by the gene) which are involved in the biosynthesis of peramine from amino acids.

Description

-4 0 6 7 7 PATENTS FORM NO. 5 Fee No. 4: $250.00 PATENTS ACT 1953 COMPLETE SPECIFICATION After Provisional No: 540677 Dated: 10 June 2005 PERAMINE BIOSYNTHESIS WE AgResearch Limited, a New Zealand company of East Street, Ruakura Campus, Hamilton, NEW ZEALAND hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed to be particularly described in and by the following statement: Sr® Pro Uff'ce o f 7Pl 12 Ju^2m kLV to PERAMINE BIOSYNTHESIS TECHNICAL FIELD This invention relates to the biosynthesis of the insect antifeedant peramine. In particular, the invention relates to a gene and a polypeptide (encoded by the gene) which are involved in 5 the biosynthesis of peramine from amino acids.

BACKGROUND ART It is well established that resistance to insect predation is important for plant performance. The usual response to this problem is the application of commercial pesticides to crops.

Many of the world's crops grown on a large scale require the application of large amounts of 10 pesticides in order to maximise crop production. Many of the chemical pesticides used have significant disadvantages. These include objectionable environmental impacts, high cost of production, and the costs and difficulties of application to crops.

Biological controls are becoming more extensively used in crop protection measures as the understanding of various microorganisms increases and with the growing awareness of the 15 damage to the environment, and human health in some cases, caused by many chemical pesticides. Biological controls in many cases have less impact on the environment compared to chemical pesticide alternatives.

Many plants however, have evolved their own defence mechanisms to insect predators. One example of this is the symbiotic associations (symbiota) of Epichloe and Neotyphodium 20 endophytes with temperate grasses of the sub-family Pooideae. Epichloe and Neotyphodium endophytes are members of a group of clavicipitaceous fungi (Clavicipitaceae, Ascomycota), which systemically colonise the intercellular spaces of leaf primordia, leaf sheaths, and leaf blades of vegetative tillers and the inflorescence tissues of reproductive tillers. These biotrophic fungi are able to synthesise bioprotective alkaloids resulting in, for 25 example, increased tolerance to biotic stresses (e.g. feeding by insect and mammalian 2 herbivores) and to abiotic stresses (e.g. drought), (Scott 2001). The major benefits to the fungal symbiont include access to nutrients and a means of dissemination through the plant seed.

The ability of Epichloe and Neotyphodium endophytes to synthesize bioprotective alkaloids in 5 planta constitutes a major ecological benefit for the symbiotum (Schardl 1996). Metabolites identified to date include both anti-insect compounds (e.g. peramine and lolines) and anti-mammalian compounds (e.g. ergot alkaloids and indole-diterpenes) (Bush et al. 1997). Peramine, a pyrrolopyrazine (Rowan et al. 1986), is a potent feeding deterrent against adult Argentine stem weevil (Listronotus bonariensis) which is a major pest of perennial ryegrass 10 (Rowan et al. 1990). Peramine production appears to be unique to the Epichloe and Neotyphodium genera. The production of peramine in cultures of Neotyphodium lolii (Rowan 1993) and Epichloe typhina (Schardl et al. 1999), albeit in low amounts compared to the levels found in endophyte-infected grass tissue, confirms that this alkaloid is a fungal product. Although there is no experimental data on the biosynthesis of this compound, an analysis of 15 its structure (Figure 1) suggests peramine is the product of a reaction catalysed by a two-module non-ribosomal peptide synthetase (NRPS) (Schardl et al. 1999).

Although peramine has been synthesised chemically (Brimble and Rowan, 1988; Dumas, 1988), its synthesis is difficult and costly. Further, there exist a number of disadvantages associated with the chemical synthesis of peramine for application to crops as a pesticide. 20 These include its water solubility, leading to washing away by rain water. There is therefore a benefit in alternative sources of peramine for use as an effective antifeedant.

The inventors have found and identified a gene responsible for, or at least essential for peramine biosynthesis. This gene allows for the manipulation of peramine biosynthesis in fungal endophytes.. In addition, the present invention may also provide, at least in part, a 25 molecule required for genetically modifying organisms for the production of peramine or derivatives thereof to deter insects and thus protect the organism or its host from insects. 3 It is therefore an object of the invention to provide a nucleic acid molecule and/or polypeptide useful in maunpulation of peramine biosynthesis for the purpose or producing derivatives, or to at least provide a useful choice.

All references, including any patents or patent applications, cited in this specification are 5 hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the reference states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms parts of the 10 common general knowledge in the art, in New Zealand or in any other country.

It is acknowledged that the term 'comprise' may, under varying jurisdictions, be attributed with either an exclusive or an inclusive meaning. For the purpose of this specification, and unless otherwise noted, the term 'comprise' shall have an inclusive meaning - i.e. that it will be taken to mean an inclusion of not only the listed components it directly references, but also other 15 non-specified components or elements. This rationale will also be used when the term 'comprised' or 'comprising' is used in relation to one or more steps in a method or process.

Further aspects and advantages of the present invention will become apparent from the ensuing description which is given by way of example only.

DISCLOSURE OF INVENTION According to a first aspect of the present invention there is provided an isolated nucleic acid molecule having a nucleic acid sequence selected from the group consisting of: a) SEQ ID NO 1; b) a functional fragment or variant of the sequence in a); or 25 c) a complement to the sequences in a) or b). 4 The present invention covers a gene called perA (also known as EF103) which encodes a polypeptide in the form of a non-ribosomal peptide synthetase (NRPS) enzyme which is essential for peramine biosynthesis by fungal endophytes if the genera Epichloe and Neotyphodium.

According to yet a still further aspect of the present invention there is provided an isolated nucleic acid molecule as described above wherein the open reading frame between nucleotides 828-9332.

An isolated nucleic acid molecule encoding a polypeptide having an amino acid sequence comprising of SEQ ID NO. 2 or a functional fragment or variant thereof.

According to a second aspect of the present invention there is provided an isolated polypeptide having an amino acid sequence comprising of SEQ ID NO. 2 or a functional fragment or variant thereof.

In a further aspect of the present invention there is provided a vector or construct including a nucleotide sequence comprising SEQ ID NO. 1 including functional fragments and variants of 15 this sequence.

In a further aspect of the present invention there is provided a host cell transformed with a vector or construct as described above.

Preferably, the host cell described above is a fungal cell. Most preferably, the host cell is a fungal endophyte cell. Even more preferably the host cell may be selected from the genera: 20 Epichloe or Neotyphodium.

According to a further aspect of the present invention there is provided a plant which includes a transformed fungal endophyte cell.

Preferably the plant containing the transformed cell may be a grass. Most preferably the grass is of the sub-family Pooideae.

According to another aspect of the present invention there is provided the use of an isolated nucleic acid molecule substantially as described above to manipulate peramine biosynthesis in fungal endophytes.

Preferably, the use of said isolated nucleic acid molecule to manipulate paramine 5 biosynthesis in fungal endophytes is in planta.

According to another aspect of the present invention there is provided a host cell which has been modififed to include a nucleic acid molecule substantially as described herein.

According to a still further aspect of the present invention there is provided the use of an isolated nucleic acid molecule substantially as described herein wherein the nucleic acid 10 molecule repairs or replaces a non-functional perA gene.

In a further aspect of the present invention there is provided an isolated primer having a nucleotide sequence selected from the group consisting of: a) SEQ ID NO. 4; or b) SEQ ID NO 5.

According to a further aspect of the present invention there is provided the use of the nucleotide sequence information of SEQ ID No. 1 to identify or isolate the perA gene in fungal endophytes. For example, the nucleotide sequence information of SEQ ID No. 1 can be used to construct suitable oligionucleotide probes, or primers.

According to another aspect of the present invention there is provided an oligionucleotide 20 having at least 15-20 contiguous nucleotides selected from SEQ ID NO. 1.

Preferably, the polypeptide having an amino acid sequence comprising SEQ ID NO. 2 or a functional fragment or variant thereof is an essential part of a non-ribosomal peptide synthetase and is from the genera Epichloe, for example Epichloe festucae, or Neotyphodium, for example Neotyphodium ioiii. 6 The terms "polypeptide", "peptide" and "protein" are all used interchangeably herein to refer to a molecule comprising a chain or chains of two or more amino acids with amide bond linkages. The terms "polypeptide", "peptide" and "protein" may herein also include modifications of structure in general and more specifically include additions, substitutions, 5 biochemical oxidation or reduction, variations of amino acids including amino acids not commonly found in proteins such as D-amino acids, and prosthetic groups such as may be required for enzymic activity.

The term 'homology' as used herein refers to a nucleotide or amino acid sequence having a defined sequence similarity to the nucleotide or amino acid sequences of the present 10 invention.

For the purposes of this specification non-ribosomal peptide synthetases are multimodular enzymes that make non-ribosomal compounds (or compounds not necessarily a peptide or cyclic peptide in itself but which has molecular structural detail showing a relationship to a putative peptide or cyclic peptide) through a thiotemplate mechanism independent of 15 ribosomes. Non-ribosomal peptides can be composed of D- and L-amino acids, protein and non-protein amino acids, hydroxy acids, ornithine, P-amino acids, and other unusual constituents. Non-ribosomal peptides can be linear, cyclic, or branched cyclic and may be modified by glycosylation, N-methylation, or acylation. In addition to structural diversity, non-ribosomal peptides have a broad spectrum of biological activities, some of which have been 20 useful in medicine, agriculture, and biological research. Products made by non-ribosomal peptide synthetases or non-ribosomal peptide synthetase/polyketide synthase hybrid enzymes include well-known antibiotics (penicillin, erythromycin, and vancomycin), immunosuppressants (cyclosporin and rapamycin), antitumor agents (actinomycin, bleomycin, and epothilone), and toxins involved in pathogenesis (HC-toxin, enniatin, AM-25 toxin, and probably victorin) (Lee et al., 2005).

A minimal non-ribosomal peptide synthetase module is composed of an AMP-binding adenylation (A) and a thiolation (T, also called peptidyl carrier protein) domain. The A 7 domain (500 to 600 amino acid residues) is required for amino acid substrate recognition and activation. The 80- to 100-amino- acid-residue T domain, located downstream of the A domain, is the site for 4'-phosphopantetheine cofactor binding; the holoenzyme then activates aminoacyl substrates to form a thioester bond. A condensation (C) domain ( * 450 5 amino acids) is typically found after each A-T module and functions in peptide bond formation and elongation of the nascent peptide. Generally, the number and order of modules present in a non-ribosomal peptide synthetase determine the length and structure of the resulting non-ribosomal peptide. In addition to A, T, and C domains, an N-methyl transferase (M) domain that methylates the amino acid specified by the A domain may be inserted between 10 the A and T domains of any given module, and an epimerase (E) domain that changes an amino acid from the L- to the D-form may be inserted between the T and C domains. In some non-ribosomal peptide synthetases, a thioesterase domain is found at the C-terminal end of the protein and is thought to release the non-ribosomal peptide from the nonribosomal peptide synthetase (Lee et al., 2005).

The term "variant" as used herein refers to nucleic acid molecule or polypeptide wherein the nucleotide or amino acid sequence exhibits: at least substantially 70%, or at least substantially 75% homology with the nucleotide or amino acid sequences contained in the sequence listing; preferably exhibits at least substantially 80% or 85% homology or greater with 20 said sequences; and most preferably exhibits a homology selected from substantially 90-99% homology to the sequences contained in the sequence listing and which may include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology to said sequences in the sequence listing; as assessed by GAP or BESTFIT (nucleotides and peptides), or BLASTP (peptides) or BLASTN (nucleotides). The variant may result from modification of the native 8 nucleotide, or amino acid sequence, by such modifications as; insertion, substitution or deletion of one or more nucleotides or amino acids, or it may be a naturally-occurring variant.

Thus, the term variant should be taken to include changes (i.e. conservative substitution) to 5 the nucleotide sequences set forth herein which do not alter the amino acid being coded for, due to the degenerate nature of the genetic code.

The term "variant" also includes homologous sequences which hybridise to the sequences of the invention under standard, but most preferably under stringent conditions.

In general "stringent conditions" for determining the degree of homology may refer to: a) low salt concentrations (i.e. less than 1M, preferably less than 500mM and most preferably less that 200mM); and b) high hybridization temperatures (i.e. at least 30°C, preferably greater than 37°C and most preferably greater than 50°C).

The term 'oligonucleotide' as used herein refers to a short singled stranded nucleic acid 15 molecule which can hybridise to a complementary portion of SEQ ID No. 1, or a similar sequence, under stringent conditions.

However, as the stringency of hybridization can be affected by other factors including probe composition and the presence of organic solvents, it is the combination of parameters above that, which is important in determining stringency.

The term "isolated" means substantially separated or purified away from contaminating sequences in the cell or organism in which the nucleic acid naturally occurs and includes nucleic acids purified by standard purification techniques as well as nucleic acids prepared by recombinant technology, including PCR technology, and those chemically synthesised. 9 The nucleic acid molecule may be an RNA, cRNA, genomic DNA or cDNA molecule, and may be single- or double-stranded. The nucleic acid molecule may also optionally comprise one or more synthetic, non-natural or altered nucleotide bases, or combinations thereof.

The term 'host cell' as used herein refers to a cell which is capable of being manipulated, 5 such as for example only, via a vector or construct, so as to support the replication and/or expression of the PerA gene. However, this should not be seen as limiting as in some embodiments, the cell may be manipulated to inhibit or silence expression of the PerA gene. Understandably, the term 'host cell' should also be taken to include a transgenic organism which comprises a host cell.

A fragment of a nucleic acid is a portion of the nucleic acid that is less than full length and comprises at least a minimum sequence capable of hybridising specifically with a nucleic acid molecule according to the present invention (or a sequence complementary thereto) under stringent conditions as defined herein.

The term 'exogenous' as used herein, refers to a nucleic acid molecule originating from 15 outside an organism.

A fragment of a polypeptide is a portion of the polypeptide that is less than full length but which still preferably retains a biological role in peramine biosynthesis and most preferably is capable of influencing peramine biosynthesis via fungi, in particular fungal endophytes. A fragment according to the invention has at least one of the biological activities of the nucleic 20 acid or polypeptide of the invention.

The polypeptides of the invention can be prepared in a variety of ways. For example, they can be produced by isolation from a natural source, by synthesis using any suitable known techniques (such as by stepwise, solid phase, synthesis described by Merryfield (1963), or as preferred, through employing DNA techniques.

A cloning vector may be selected according to the host or host cell to be used. Useful vectors will generally have the following characteristics: (a) the ability to self-replicate in a suitable host; (b) the possession of an appropriately positioned single target for any particular restriction endonuclease; and (c) desirably, carry genes for a readily selectable marker such as antibiotic resistance.

Generally, eucaryotic, yeast, insect or mammalian cells are useful hosts. Also included within the term hosts are plasmid vectors. Suitable procaryotic hosts include E. coli, Bacillus species and various species of Pseudomonas. Commonly used promoters such as p-lactamase (penicillinase) and lactose (lac) promoter systems are all well known in the art. Any available promoter system compatible with the host of choice can be used. Vectors used 10 in yeast are also available and well known. A suitable example is the 2 micron origin of replication plasmid.

The term 'transformation' as used herein refers to any process by which the genetic material carried by an individual cell is altered by incorporation of an exogenous nucleic acid molecule. In the present invention, the exogenous DNA may include the PerA gene.

The term 'modified' as used herein refers to any process wherein the genetic material carried by an individual cell is altered or otherwise manipulated to express or inhibit expression of the PerA gene.

The term construct as used herein refers to an artificially assembled or isolated nucleic acid molecule which includes the gene of interest. In general a construct may include the gene or 20 genes of interest and appropriate regulatory sequences. It should be appreciated that the inclusion of regulatory sequences in a construct is optional for example, such sequences may not be required in certain situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto.

In the construction of a vector it is also an advantage to be able to distinguish the vector 25 incorporating the foreign DNA from unmodified vectors by a convenient and rapid assay. 11 Reporter systems useful in such assays include reporter genes, and other detectable labels which produce measurable colour changes, antibiotic resistance and the like. In one preferred vector, the p-galactosidase reporter gene is used, which gene is detectable by clones exhibiting a blue phenotype on X-gal plates. This facilitates selection. In one 5 embodiment, the p-galactosidase gene may be replaced by a polyhedrin-encoding gene; which gene is detectable by clones exhibiting a white phenotype when stained with X-gal. This blue-white colour selection can serve as a useful marker for detecting recombinant vectors.

It should be appreciated by those skilled in the art that there are provided details regarding 10 the biosynthesis of the insect antifeedant peramine. The invention describes a gene encoding a polypeptide which is capable of acting as an enzyme involved in the biosynthesis of peramine from amino acids It should be appreciated by those skilled in the art that, by knowing a biosynthetic pathway, improved endophytes, particularly fungi, may be produced that exhibit increased pest resistance derived from the compound peramine.

BRIEF DESCRIPTION OF SEQUENCE LISTINGS SEQ ID No. 1: shows the nucleotide sequence information for the PerA gene.

SEQ ID No. 2: shows the amino acid sequence information for NRPS.

SEQ ID No. 3 shows the nucleotide sequence information of the methyl transferase domain of NRPS.

SEQ ID No. 4: shows the F prius RJ17-F.

SEQ ID No. 5: shows the R prius RJ17-R.

SEQ ID No. 6: shows the nucleotide sequence information for the PerA gene of AR37. BRIEF DESCRIPTION OF DRAWINGS Figure 1 shows the structure of peramine. 12 Figures 2A to 2C illustrate the design of primers to amplify non-ribosomal peptide synthetase (NRPS).

Figure 2A shows the domain structure of a typical single NRPS module showing the condensation (C), adenylation (A) and thiolation (T) domains, and optional methylation (M) 5 and epimerisation (E) domains.

Figure 2B shows the alignment of polypeptide sequences for the adenylation domains from the Ala (CAB39315Ala) and Pro (CAB39315Pro) modules of Claviceps purpurea D-lysergyl-peptide-synthetase (Tudzynski et al. 1999), the Pro (Q01886Pro), Ala (Q01886Ala) and Aoe (Q01886Aoe) modules of the Cochliobolus carbonum HC-toxin synthetase (Scott-10 Craig et al. 1992), and the Pro (AAL26315Pro) module of Neotyphodium lolii ergovaline synthetase (Panaccione et al. 2001) showing the conserved TGKPKG and YKTGDL sequences.

Figure 2C shows the design of degenerate primers from conserved NRPS nucleotide molecules (where N=A, C, G or T; R=A or G; and Y=C or T).

Figure 3 shows the reverse transcriptase-polymerase chain reaction (RT-PCR) amplification of NRPS nucleotide molecules from Neotyphodium lolii expressed in culture and in planta. RT-PCR products were amplified from total RNA isolated from N. lolii grown in liquid culture (lane 1), pseudostems of perennial ryegrass infected (lane 2) and uninfected (lane 3) with N. lolii strain Lp19 (deposit lodged at the American Type Culture Collection 20 (ATCC). The uninfected material (G1057) is clonal material derived from the curing of endophyte from the infected material (G1056).

Figure 4 shows the sequence alignment of in planta expressed NRPS nucleotide molecules from N. lolii. (p7 & p9) and the Pro domain of IpsA.

Figure 5 shows an estimation of the relative biomass of endophyte in planta by RT-PCR 25 analysis. Total RNA was isolated from Lp19-infected perennial ryegrass pseudostems 13 (G1056) and Lp19 mycelia harvested from liquid culture. The different dilutions of cDNA amplified by RT-PCR using primers specific for tub2 and ItmG indicated.

Figure 6 shows the RT-PCR expression analysis of NRPS genes from N. lolii. Total RNA was isolated from Lp19-infected perennial ryegrass pseudostems (A) and Lp19 mycelia 5 harvested from liquid culture (B). cDNA was amplified by RT-PCR using primers specific for p7, p9, IpsA, ItmG and tub2.

Figure 7 illustrates the distribution of NRPS nucleotide molecules in Epichloe and Neotyphodium species. Primers specific for the p7 & p9 sequences were used to PCR amplify NRPS nucleotide molecules, using as template genomic DNA (20 ng) from E typhina 10 e8 (lane 1), Neotyphodium sp. Lp1 (lane 2), Neotyphodium sp. Tf13 (lane 3), Neotyphodium sp. Tf16 (lane 4), E. festucae FI1 (lane 5), N. lolii Lp14 (lane 6), Neotyphodium sp. Lp1 (lane 7), E. typhina e8 (lane 8), N. lolii Lp19 (lane 9), Neotyphodium sp. Tf13 (lane 10), N. coenophialum AR542 (lane 11), and N. lolii Lp19 (lane 12).

Figure 8 depicts the gene organization at the perA (EF103) biosynthesis locus in E. 15 festucae. A physical map of cosmid pPN60 showing restriction enzyme sites for Not\ (N), H/ndlll (H), Xba\ (X), EcoRI (E) fiamHI (B) and A/col (Nc) and putative genes (EF100-EF109) encoded by this DNA. The two modules of the peptide synthetase encoded by EF103 contain domains for condensation (C), adenylation (A), thiolation (T), methylation (M) and reductase/dehydrogenase (R).

Figure 9a & 9b show the nucleotide (SEQ ID NO. 1) numbered arbitrarily from the first nucleotide and deduced polypeptide sequence (SEQ ID NO. 2) for EF103 (peramine synthetase). Nucleotides of the EF103 open reading frame including the TAG stop codon (nucleotides 828-9332) are in uppercase.

Figure 10a Degenerate PCR on N. lolii Lp19, Epichloe typhina E8 (ET), N. lolii AR64 and 25 N. coenophialum AR501 using primers (RJ17-F and RJ17-R) designed to identify Methyltransferase domains specific to NRPS genes. 14 Figure 10b Nucleotide sequence (SEQ ID NO. 3) of an NRPS methyltransferase domain, isolated from three independent E. typhina clones (13-3, 13-4 and 13-5). The sequence is identical to the methyltransferase domain identified in EF103.

Figure 11a Physical map of the EF103 genomic region and the Ef\03\:hph genomic 5 region. Abbreviations: B, BamHV, E, EcoRI; H, /-//ndlll; K, Kpn\\ N, Not\. Two fragments were amplified using primers nx3-Pst, xb1-H, xb1-Kpn and nx1-2 (xb1-H and xb1-Kpn contain Hind\\\ or Kpn\ sites, respectively). The xb1-Kpn/nx1-2 PCR product was digested with Kpn\ and EcoRI and the resulting 2473 bp fragment was cloned into pPN1688 (pCYhph) to make pPN1688KE. The nx3-Pst/xb1-H PCR product and pPN1688KE were digested with H/ndlll 10 and the H/'ndlll fragment (2589 bp) was cloned into pPN1688KE to make pPN61 (9.6 kb).

Figure 11b pPN61 nucleotide sequence.

Figure 12 DNA gel blot analysis of EF103 deletion mutant. Total DNA (2 ng/lane) from the wild-type strain (W) or transformants (1:PN2323, 2: PN2324) was digested with Sell and fractionated in 0.8% agarose gel. The blots were hybridized with pPN61. Sizes (in kilobases) 15 of marker DNA fragments (HindIll-digested nDNA) are indicated on left.

Figure 13a EF103 Complementation Strategy: Physical map of the EF103 genomic region. Abbreviations: B, fiamHI; E, EcoRI; H, H/'ndlll; K, Kpn\; N, Not\. An EcoRV-H/'ndlll fragment from cosmid pPN60 (3.6 kb) was cloned into pBlueScript KS+ to make pVH3.6. A Not\-EcoRV fragment from cosmid pPN60 (8.1 kb) was cloned into pVH3.6 to make pPN62 (14.7 20 kb).

Figure 13b pPN62 Nucleotide sequence.

Figure 14 Shows photographs of the results of an insect bioassay experiment with plants containing endophyte (E+) and without endophyte (E-).

Figure 15a EF103 Non Ribosomal Peptide Synthetase Genomic Sequence derived from SEQ ID NO. 1 used for construction of expression vectors. Key: Binding sites for oligonucleotide primers RJ68F and RJ67R are underlined, no introns predicted.

Figure 15b Vector map of EF103 full length genomic sequence cloned into the Gateway 5 entry vector pDONR221.

Figure 16 Schematic representations showing how SEQ ID No. 1 differs from SEQ ID No. 6.

BEST MODES FOR CARRYING OUT THE INVENTION Example 1. Isolation of the Peramine Biosynthesis Gene Fungal strains and growth conditions Fungal endophyte strains, their hosts and other characteristics are listed in Table 1. All endophyte isolates were grown on 2.4% (w/v) potato dextrose (PD) agar plates at 22°C. Liquid cultures were prepared by grinding a small amount of mycelium from a plate culture into flasks containing 30 ml of PD broth and incubating on a rotary shaker at 200 rpm for 7 to 15 14 days at 22"C Table 1: Fungal endophyte strains 16 Species or taxon isolate Host species Reference or source Epichloe typhina E8 Lolium perenne Schardl etal., 1991 Epichloe festucae FI1 Festuca longifolia Leuchtmann, 1994 Neotyphodium lolii Lp19 Lolium perenne Christensen 1993. et al., Neotyphodium lolii Lp14 Lolium perenne Christensen 1993. et al., LpTG-1 Lp1 Lolium perenne Christensen 1993. et al., Neotyphodium coenophialum AR542 Festuca arundinaceae Christensen 1993 et al., FaTG-2 Tf13 Festuca arundinaceae Christensen 1993. et al., FaTG-3 Tf16 Festuca arundinaceae Christensen 1993. et al., Epichloe festucae PN2323 Lolium perenne Tanaka etal., 2005 Epichloe festucae PN2326 Lolium perenne Tanaka etal., 2005 Epichloe festucae PN2327 Lolium perenne Tanaka etal., 2005 Preparation of fungal DNA and PCR analysis Fungal genomic DNA was prepared by a modification of the method described by Byrd et al. (1990) as described by Young et al. (1998). PCR amplifications of genomic DNA (10 ng) were carried out in 20 pi volumes containing 10 mM Tris-HCI, 1.5 mM MgCI2, and 50 mM KCI, 5 pH 8.3, 50 pM of each dNTP, 1 pM of each primer, and 1.0 unit of Taq DNA polymerase (Roche). Gene-specific primer pairs (Table 2) used to amplify p7, and p9, and amplification conditions were identical to those used for RT-PCR (see below).

Table 2: Sequence of primers Name Sequence Nucleotide Use 17 PS1-17A ACNGGNAARCCNAAAGG 17 RT-PCR PS1-17G ACNGGNAARCCNAAGGG 17 RT-PCR PS2R-17A ARRTCNCCNGTYTTATA 17 RT-PCR PS2R-17G ARRTCNCCNGTYTT GTA 17 RT-PCR T1.1 G AG AAAAT GCGT GAG ATT GT RT-PCR T1.2 TGGT CAACCAGCT CAGCACC RT-PCR lol3 ACCG ACGCCATT AAT GAG RT-PCR loll TGGAT CATT CGCAG ATAC RT-PCR P7f T CCAACTT CAGCAGCGCGTT PCR/RT-PCR p7r TAAGCCAAGTCGGGTTCTTC PCR/RT-PCR p9f GCAAACGCCGTCTCTGCTCA PCR/RT-PCR p9r GG AT CCCCTT AAC AACCACT PCR/RT-PCR e1-1 ACGGGAAAACCCAAGGG 17 RT-PCR e1-2 AGGTCTCCGGTTTTGTA 17 RT-PCR nx1-2 CT G ACT CG ACT CG AT ACT C A Sequencing nx3-Pst AACT GC AG AGCT CAT CC AT C AG 22 Sequencing HPS9-Hf AATATGGGCCTGCAGAGTGC PCR HPS9-Kr AGCCGAAGACT ACAT CATT C PCR xb1 -H CGT AG AAGCTT CAGG ACT G A Sequencing xb1 -Kpn GGGGTACCAT GCAT CACAACAT 22 Sequencing Preparation of RNA and RT-PCR analysis Total RNA was isolated from snap frozen mycelia or pseudostem tissue of perennial ryegrass using TRIZOL Reagent (Invitrogen) followed by treatment with DNase I at 37°C for 30 min (Young et al. 2001). RNA (1 jug) was reverse transcribed using Expand reverse transcriptase (Roche) in a reaction mixture (20 pi) containing 2.5 pM of primer (see below). The mixture was incubated at 42°C for 45 min, and the enzyme inactivated by incubating the reaction mixture at 95°C for 5 min. For subsequent PCR, 2 (j.l of the cDNA (or 1/2, 1/10, 1/100 and 18 1/1000 dilutions) was added to a reaction mixture (20 m') containing 10 mM Tris-HCI, 1.5 mM MgCI2, and 50 mM KCI, pH 8.3, 50 pM of each dNTP, 1 jjM of each primer, and 1.0 unit of Taq DNA polymerase (Roche).

RT-PCR of NRPS gene products was carried out using the primer PS2R-17A (Table 2) for 5 first strand cDNA synthesis followed by PCR with this primer paired with primer PS1-17A (Figure 2). The strategy for the design of these degenerate primers is shown in Figure 2a-c and is based on known conserved motifs within the adenylation domain of other NRPS nucleotide molecules (Marahiel et al. 1997; von Dohren et al. 1997). The PCR was initiated by incubating the mixture for 3 min at 94°C to denature the template followed by 35 cycles 10 consisting of 30 s at 94°C, 30 s at 37°C, and 1 min at 72°C.

RT-PCR of all other transcripts was carried out using an oligo-dT primer for first strand cDNA synthesis followed by PCR with a pair of gene-specific primers. These included: T1.1 and T1.2 for tub2\ loll and lol3 for ItmG] p7f and p7rfor p7; p9f and p9rfor p9; and e1.1 and e1.2 for IpsA. The PCR was initiated by incubating the mixture for 3 min at 94°C to denature the 15 template followed by 30 cycles consisting of 30 s at 94°C, 30 s at 60°C, and 1 min at 72°C.

All PCR reactions were carried out in either a PC-960 or FTS-960 (Corbett Research) thermocycler.

Cloning of PCR products PCR products were cloned into pGEM®-T Easy (Promega) using standard techniques 20 (Sambrook et al. 1989).

Construction of E. festucae cosmid library Genomic DNA isolated from protoplasts of E. festucae strain FI1 was partially digested with Mbo\ using the method described by Frischauf et al. (1983) to generate the maximum yield of DNA fragments in the size range of 35-40 kb. This DNA was partially end filled with dATP 25 and dGTP using the Klenow fragment of DNA polymerase I to generate 5'-GA protruding 19 termini. This DNA was then ligated into Xba\/Xho\ digested pMOcosX, containing Xba\ termini that had been partially end-filled by incorporation of dCTP and dTTP, to generate protruding 5'-TC ends with the Klenow fragment of DNA polymerase I. The ligated mixture (~ 4 |jg) was packaged using a Gigapack III Gold system (Stratagene), according to the manufacturer's 5 instructions. The DNA was transduced into E. coli host TOPIO (Invitrogen) and 32,000 independent ampicillin-resistant colonies selected. The library was screened by colony hybridisation using standard techniques (Sambrook et al. 1989).

Subcloning of pPN60 for mapping and sequence analysis All fragments of pPN60 that were used for sequencing were subcloned into pBLUESCRIPT 10 KS(+) using methods familiar to those skilled in the art. Sufficient subclones were isolated to allow full sequencing of the Cosmid.

DNA sequencing PCR generated and cloned genomic products were sequenced by the dideoxynucleotide chain termination method (Sanger et al. 1977) using BigDye chemistry (Applied BioSystems) 15 with oligonucleotide primers as shown in Table 2 synthesised by Sigma Genosys. Products were separated by capillary electrophoresis on an Applied BioSystems 3730 DNA Analyzer.

Bioinformatics Sequence data were assembled into contigs using SEQUENCHER version 3.1.1 (Gene Codes) and analysed using the Wisconsin Package. Sequence comparisons were performed 20 through Internet Explorer at the National Center for Biotechnology Information (NCBI) site using the Brookhaven (PDB), SWISSPROT and GenBank (CDS translation), PIR and PRF databases employing BLAST algorithms for sequence comparisons (Altschul et al. 1990; Altschul et al. 1997). Polypeptide alignments were performed using ClustalW (Higgins et al. 1994).

Results Molecular cloning of N. lolii peptide synthase genes Candidate NRPS nucleotide molecules were amplified from RNA isolated from N. lolii mycelia and perennial ryegrass pseudostem material by RT-PCR (Figure 3). The products of these 5 amplifications are shown in Figure 3. A product of the expected size, approximately 700-bp, is observed for amplifications using RNA from Lp19 mycelia (lane 1) and Lp19-infected perennial ryegrass (lane 2) but not endophyte-free perennial ryegrass (lane 3). The 700 bp products amplified with these primer sets were gel-purified, cloned into pGEM®-T Easy and transformed into E. coli strain DH5a.

Plasmid DNA isolated from 6 arbitrarily selected transformants containing the Lp19 product (Figure 3, lane 1) was sequenced and the data analysed by BLASTX. All clones had identical DNA sequences and shared significant similarity with other fungal NRPS nucleotide molecules.

Twelve randomly selected transformants containing the plant amplified product (Figure 3, 15 lane 2) were sequenced and six found to share sequence similarity to known NRPS genes. These six clones fell into three distinct groups, clones p5, p8, and p9 sharing 54% identity to the Claviceps purpurea cp608 polypeptide sequence (Accession number AAA74269) (Panaccione 1996), one, clone p7, sharing 96% identity at the nucleotide level to N. coenophialum ac205 (Accession number U30623) (Panaccione 1996) and two other clones 20 shared identity with Claviceps purpurea cpps2 (accession number CAD28788; Correia et al., 2003). The sequences of the other six clones shared no similarity to NRPS nucleotide molecules and were therefore discarded.

An alignment of the polypeptide sequences of two of these NRPS nucleotide molecules, together with that of the putative proline domain of IpsA is shown in Figure 4.

Expression analysis of NRPS genes from N. lolii 21 Given peramine is very difficult to detect in free-living cultures of endophytes but is abundant in perennial ryegrass leaf tissue infected with Epichloe!Neotyphodium strains that have the genetic capability to synthesize this compound, the expectation was that the NRPS required for peramine biosynthesis would be up-regulated in plant tissue compared to expression of 5 the same gene in mycelia. Before carrying out this experiment an estimate was made of the amount of endophyte mRNA found in plant tissues by comparing the levels of expression of (3-tubulin (tub2), a housekeeping gene, with ItmG, a gene known to be up-regulated in the plant (Young et al., 2005). Total RNA isolated from Lp19 infected tissue was used as template to analyse by RT-PCR the expression of tub2 and ItmG. A 1/10 dilution of cDNA 10 prepared from mycelia showed a comparable level of expression to tub2 in undiluted cDNA from plant-infected tissue (Figure 5). Under these conditions ItmG is dramatically upregulated in plant tissue, a result consistent with previous experiments.

Using these dilutions of cDNA, expression of the different possible NRPS sequence clones was examined. Clone p9, and the positive controls IpsA and ItmG, were all up-regulated in 15 expression compared to the tub2 control (Figure 6). Clone p7 was not up-regulated and is unlikely to be a NRPS sequence for peramine biosynthesis (Figure 6).

Distribution of NRPS nucleotide molecules in Epichloe and Neotyphodium species and comparison with the ability of these strains to synthesize peramine in planta A second expectation for a NRPS gene, specific for peramine biosynthesis, would be its 20 presence in the genome of Epichloe and Neotyphodium species that have the capacity to synthesise peramine in planta (Table 3). Primers that were specific for each NRPS were used to PCR amplify these sequences using as template, genomic DNA from a range of strains. Products of the expected size of approximately 700 bp were amplified from all strains using primers specific for clones p7 and p9 (Figure 7).

Of the two clones selected, p9 is the only clone that is up-regulated in planta and cross hybridises to the genome of known peramine producing strains. This clone was therefore selected as a candidate for a NRPS gene required for peramine biosynthesis. 22 Table 3: A comparison of the peramine phenotype of various Epichloe and Neotyphodium grass symbiota with the NRPS genotype of the corresponding endophyte strains.

Species Strain ■mi ■fl| Peramine phenotype Reference N. lolii Lp19 + + + Christensen et al. 1993.

N. lolii Lp14 + + - Christensen etal. 1993.

LpTG-2 Lp1 + + + Christensen et al. 1993.

N. coenophialum AR542 + + + Christensen etal. 1993.

FaTG-2 Tf13 + + - Christensen et al. 1993.

FaTG-3 Tf16 + + + Christensen etal. 1993.

E. typhina E8 + + + Zhang, 2004 E. festucae FI1 + + + Young et al., 2005 Molecular cloning of a gene for peramine biosynthesis from E. festucae Using clone p9 as a probe, a pMOcosX cosmid library of E. festucae was screened by colony hybridisation and 19 positive clones were identified from 18,000 screened. Cosmid DNA was prepared from these clones and restriction enzyme digestions carried out to identify shared genomic fragments. All clones had shared fragments indicating they were from a single 10 genomic locus. One cosmid, pPN60 (synonymous with original naming of pcFI9-9) was selected for further study. A physical map of this cosmid is shown in Figure 8. Various internal fragments of this cosmid were sub-cloned for DNA sequence analysis. Using a combination of end-sequencing from pPN60 sub-clones and primer walking, the complete DNA sequence of cosmid pPN60 was determined.

Analysis of this 37.4-kb region identified ten putative genes, EF100-EF109, including an 8505 bp (including the stop codon) uninterrupted ORF, EF103, that shows all the characteristic motifs of a two-module NRPS gene (Figure 8). The first module of EF103 contains an A 23 (adenylation) and T (thiolation) domain and the second contains C (condensation), A (adenylation) and T (thiolation) core domains but in addition has domains for methylation (M) and reduction (R). The module and domain structure of this NRPS gene is consistent with the type of enzyme functions required for the synthesis of peramine. The nucleotide sequence (SEQ ID NO. 1) for EF103, including the 827 bp 5' and 353 bp 3' non-translated regions, and the deduced polypeptide sequence (SEQ ID NO. 2) is shown in Figure 9b.

A summary of the putative functions of the other genes based on BLASTP analysis is shown in Table 4.

Table 4: Bioinformatic analysis of genes identified on cosmid pPN60 Gene EF100 EF101 EF102 EF103 EF104 EF105 EF106 EF107 EF108 EF109 Putative function unknown dehydrogenase/reductase membrane protein peptide synthetase ubiquinol-cytochrome c reductase hypothetical protein Dimethylmenaquinone methyltransferase unknown dioxygenase cyclase/isomerase Homologue accession number EAA29563 EAA29562 AAF01762 EAA28659 EAA28658 EAA36387 EAA29404 EAA28451 P38677 Blast E value 5e-66 8e-48 0 0.0001 1e-29 0.00000003 e-114 e-118 e-135 Example 2. Additional information supporting identity of EF103 gene: Isolation of NRPS genes containing methyl transferase domains using a degenerate PCR approach. 24 In many cases the genes encoding NRPS enzymes have been cloned and characterised and all share a common modular structure containing functional domains. Based on highly conserved motifs within these domains, degenerate oligonucleotides have been successfully used in polymerase chain reaction (PCR) experiments to identify several fungal genes 5 encoding NRPS. This is how the original p9 sequence was identified from adenylation domains in Example 1.

This approach has been used in the present study to identify novel peptide synthetases from grass endophytes. PCR fragments produced following amplification with degenerate primers were sequenced and used as probes to identify BAC or Cosmid clones that contain the full 10 length peptide synthetase gene, and that may also carry other secondary metabolite genes associated with secondary metabolite gene clusters.

Methodology Two regions of putative peptide synthetases from endophytes were selected for the degenerate PCR screening experiment. One region spanned highly conserved regions within 15 all NRPS genes (within the adenylation domain; as also demonstrated in Example 1), and the other targeted the methyltransferase domain found in specific NRPS genes. Two regions were chosen to increase the diversity of the genes recovered and in particular, since the biosynthesis of peramine is predicted to have a methylation step, identification of NRPS genes that encode this step would greatly increase the chances of isolating the peramine 20 NRPS gene.

Core motifs from NRPS methyltransferase domains were identified from ClustalW amino acid alignments of the Enniatin synthetase (NCBI accession number Q00869) NRPS methyltransferase containing modules, and the Cyclosporin synthetase (NCBI accession number S41309) methyltransferase modules. These motifs were used to design degenerate 25 primers as follows: Motif 1 N..S..V..A..Q..Y..F..P..

N..S..V..V..Q..Y..F..P..

AATT CNGTNGTNCAATATTTT CCN AACAGNGTNGCNCAGTACTTCCCN Forward Primer (RJ17-F): 5'-AAYWSNGTNGYNCARTAYTTYCC-3' (SEQ ID NO. 4) Motif 2 I..K..H..V..E..V..L..P..K V..E..H..V..E..I..I..P..K 10 I..Q..H..V..E..V..L..P..K GTNCARCAYGTNGARGTNYTNCCNAAR athmrcaygtngarathathccnaar Reverse Primer (RJ17-R; reverse complement) -YTTNGGNADNAYYTCNACRTG 3' (SEQ ID NO. 5) RJ17-F and RJ17-R primers were expected to amplify a heterogeneous product of approximately 300 bp using the following PCR conditions.

DNA template 5ng Primers 1pM MgCI2 2mM Taq polymerase 1.25U dNTPs 0.2mM (50 pM of each dNTP) 1 cycle 95°C for 5 min 30 cycles 94°C for 1 min 25 48.1°C for 1 min 30 sec 60°C for 2 min 26 1 cycle 60°C for 10 min Several PCR amplification products from each strain (Figure 10a) were cloned into pCR2.1 Topo vectors. 96 clones were sequenced using the M13R primer. The sequences were trimmed of vector and BLASTX searched against SWISPROT. Peptide synthetase matches 5 were aligned in Vector NTI and sorted into related sequences. We identified gene sequences for many different NRPS adenylation domains (data not shown) and also identified 4 methyltransferase domain sequences. Three of these (clones 13-3, 13-4 and 13-5 from E. typhina) were shown to be identical at the nucleotide level (Figure 10b).

Comparison of these sequences with those of the peramine gene (Seq ID NO. 1) described in 10 Example 1 showed that they were identical to the proposed methyltransferase domain identified in the EF103 sequence. These data validate this alternative approach for isolating peptide synthetase genes containing methyltransferase domains as a peramine NRPS gene fragment was isolated using this method.

Example 3. Targeted Disruption of the EF103 Gene in E. festucae Strain FI1 One method commonly used to determine the function of fungal genes especially those with a haploid genome is targeted gene disruption. The gene is mutated by replacement with a fungal selectable marker gene by double homologous recombination, or disrupted by single homologous recombination. Both approaches generate a mutant strain where the gene is disrupted and non-functional, To determine the role of the EF103 gene this approach was adopted and the mutant strains were then able to be infected into perennial ryegrass plants for testing of the chemical phenotype. As peramine is not produced in in vitro cultures analysis of infected plant material is required to determine capability for peramine production and therefore the analytical chemical analysis needed to be performed with infected plants. In this example we 25 generated a mutant in the peramine NRPS gene EF103.

Construction of the EF103 gene disruption vector 27 To generate a gene disruption vector for double homologous gene replacement of EF103, a portion of the EF103 gene was replaced with the hygromycin resistance gene. Two fragments of the EF103 gene were amplified by PCR using primers nx3-Pst and xb1-H, and xb1-Kpn and nx1-2 respectively (Table 2 and Figure 11a). The PCR product amplified using 5 primers xb1-H and nx1-2 was digested with Kpn\ and EcoRI and the 2473 bp fragment was cloned into pPN1688 (pCYhph) to generate pPN1688KE. The PCR product amplified using primers nx3-Pst and xb1-H was digested with HindiII and the 2589 bp fragment was cloned into pPN1688KE that had also been digested with Hind\\\ to generate the 9.7 kb pPN61 (Figure 11b).

Transformation of E. festucae strain FI1 with pPN61 Protoplasts of E. festucae FI1 were prepared as previously described (Young et al., 1998), except 10 mg/ml Glucanex (Chemcolour industry) was used to digest the cell walls, and the mycelium was gently shaken (100 rpm) overnight at 30°C. Protoplasts were transformed with 5 |wg of linear PCR-amplified product (pPN61) using the method of (Vollmer and Yanofsky, 15 1986) as modified by (Itoh et al., 1994). Transformants were selected on YPS media (yeast extract 1 g/l, tryptone 1 g/l, sucrose 342.3 g/l) containing hygromycin (150 ng/ml). The 120 hygromycin-resistant transformants were nuclear purified by sub-culturing mycelium from the edge of a colony to PD media containing hygromycin (150 |jg/ml). This process was repeated two times.

Screening of FI1 transformants to identify EF103 disruptants The replacement in EF103 was identified by PCR screening of hygromycin-resistant transformants using a primer set (HPS9-Hf and HPS9-Kr) that amplifies the region across the hph cassette within pPN61. Genomic DNA of transformants was isolated from frozen mycelium using a DNAeasy plant miniprep kit (QIAGEN). Of 120 transformants, the strain 25 PN2323 lacked the 1.6-kb fragment derived from wild-type genomic DNA indicating a double cross-over event in this transformant. PCR with other primer sets and DNA gel blot analysis 28 of genomic digests of PN2323 confirmed the replacement event, but also showed the integration of multiple copies of pPN61 along with the replacement (Figure 12).

Construction of a Complementation Vector for EF103 To verify that the EF103 gene knockout PN2323 were peramine negative specifically due to 5 the disruption of the EF103 peptide synthetase, a complementation vector was prepared.

This vector when transformed into the EF103 mutant could restore the peramine phenotype demonstrating that the mutation was due to the loss of a single gene and not due to some other undetected recombination event.

The 12-kb wild-type genomic fragment containing the promoter and coding region of perA 10 (the EF103 gene), pPN62 (Figures 13a and 13b), was prepared by ligating a 3.6-kb H/wJIII/EcoRV fragment and a 8.1-kb A/ofl/EcoRV fragment from pPN60 into pBlueScript II KS(+). Purified A/ofl-digested pPN62 was used to co-transform the strain PN2323 with pll99 (Inoue et al., 2002). Protoplasts of the strain PN2323 were prepared and transformed with 5 ng of circular pll99 and 15 pg of linearized pPN62 as described above. Transformants were 15 selected on YPS media containing geneticin (200 |ig/ml). The resulting transformants were nuclear purified by sub-culturing mycelium from the edge of a colony to PD media containing geneticin (200 ng/ml). This process was repeated two times. The complemented strains containing a full length copy of the transformed genomic DNA fragment were selected by PCR and Southern blot analysis. Perennial ryegrass seedlings were inoculated with the 20 selected strains, PN2336 and PN2337 (data not shown).

The peramine status of these plants have is described in Example 4.

Example 4. infection of Perennial Ryegrass with the EF103 Mutants, Complemented Strains and Determination of the Chemical Phenotype.

This Example demonstrates that the mutant strain of E. festucae strain FI1 containing a 25 disrupted EF103 peptide synthetase gene (PN2323) when infected into perennial ryegrass plants were deficient in peramine biosynthesis. The mutant strain PN2323 was then 29 complemented as described in Example 3 and infected into perennial ryegrass plants. Plants containing the complemented strains (PN2336 and PN2337) contained peramine indicating that the mutation in the EF103 gene was restored. This clearly confirms EF103 is essential for peramine biosynthesis.

Plant infections The EF103 knock-out strain PN2323, the complemented EF103 mutant strains PN2336 and PN2337, as well as the control FI1 strain, were inoculated into endophyte-free perennial ryegrass cv 'Grasslands Nui' using the seedling inoculation method (Latch & Christensen, 1985). Seeds were surface sterilized by immersing in 50% sulphuric acid for 15 minutes 10 following which they were washed 3 times in tap water. The seeds were then immersed in 2% w/v sodium hypochlorite solution followed by three washes in sterile water. The seed was dried on sterile filter paper in a laminar flow cabinet and 5 seeds were placed in a row in each of several Petri plates containing 4% water agar. The Petri plates were incubated on their side in the dark at 22 degrees C so that the seedlings would grow against the agar and the 15 apical meristems would be located away from the seeds.

After 5-6 days each seedling was inoculated by making an incision with a scalpel in the region of the apical meristem and mycelium obtained from a potato dextrose culture of a strain inserted. The inoculated seedlings were maintained in the dark for 5-7 days and then under lights for a similar time, following which they were planted into potting mix and 20 maintained in a glasshouse.

Detection of infected plants When the seedlings were starting to form new tillers a leaf sheath was removed and an epidermal strip was removed and placed in a drop of aniline blue solution, (lactic acid: glycerol: water (1:2:1) containing 0.15% w/v aniline blue (water soluble)) on a glass slide. 25 The leaf tissue was covered with a glass slide and heated to boiling. The hyphae, present as seldom branched longitudinal strands with non-staining septa, were visible when examined at 100-400x with a compound microscope. Typically with E. festucae strain FI1 and transformed strains of FI1, ~ 80% of inoculated seedlings are infected.

Peramine detection by high performance liquid chromatography (HPLC).

This procedure was a minor variation of the method of Spiering et al., (2002). For larger 5 samples (>50 mg dry matter) the herbage was separated into leaf blade and pseudostem (leaf sheaths and the enclosed growing point, pseudostem) fractions, freeze dried and milled to fine particles (<1 mm) in a small volume coffee mill. Smaller whole herbage samples (< 80 mg dry matter) were freeze dried and used without milling.

Weighed portions of milled samples (c. 50 mg) were extracted with 1 ml of propan-2-ol:water, 10 1:1 by volume containing also 1% w/v lactic acid, in 2 ml polypropylene screw cap vials, vigorously shaken (Savant FastPrep FP120, 20 sec at speed 5) and then rotated for gentle agitation for 1 hour at ambient temperature in darkness. Internal standard of homoperamine nitrate (custom synthesis, c. 2 |jg/ml) was added to the extraction solvent. Small herbage samples (50-70 mg) were similarly treated but with a 5 mm stainless steel ball to assist 15 disintegration of the tissue during shaking. The extraction vials were then held at c. 4° C for 4 to16 h (as convenient) to allow lipids and pigments to condense before the extracts were separated off by centrifugation and portions transferred to HPLC vials.

Injections of up to 50 pi of extracts were made into a stream of 0.4 ml/min of propan-2-ol:water:ammonium hydroxide (25%); 60:40:1 v/v, on to a silica-based mixed-mode cation 20 exchanger cartridge (RP-C8/cation guard column, 7.5 x 4.6 mm, 5 pm, Alltech Associates, Deefield, IL) for a two minute period. Peramine and homoperamine were selectively retained in the cartridge while many other unidentified UV absorbing compounds were washed through to waste. The cartridge was then flushed at 1 ml/min, via the switching of the six port valve, with the HPLC solvent of 50 mM ammonium acetate, 5 mM guanidinium carbonate, 25 0.2% (v/v) acetic acid in water:methanol; 4:1 v/v, on to a silica HPLC column, 250 x 4.6 mm (Phenosphere 5 pm, Phenomenex, Torrance, CA) at 28° C for separation of peramine (RT c. 31 11.2 min) and homoperamine (RT c. 13.4 min) which were detected by UV absorption at 286 nm.

Peramine concentrations in the extracted samples were determined from chromatograms after integration of peak areas of analyte and internal standard by ratio calculation (Class-5 LC10 software, Shimadzu).

EF103 Mutant Chemical analysis The peramine analysis of EF103 mutant PN2323 (Table 5) demonstrated that no detectable levels of peramine were present in the plants infected with the EF103 gene knock-out mutant strain PN2323. Control plants infected with wild-type E. festucae strain FI1 contained 10 between 59 and 75 ppm peramine. Plants free of infection did not contain detectable peramine. These data demonstrate that the EF103 gene is essential for peramine biosynthesis in E. festucae. Based on this result the EF103 gene is likely to be essential in all Epichloe and Neotyphodium strains that produce peramine. No effects were seen for two additional alkaloids, lolitrem B and ergovaline, indicating that other secondary metabolism in 15 the fungus was unaffected and the loss of peramine was specific to the disruption of the EF103 gene.

To confirm the deletion mutation of EF103 was responsible for the peramine negative phenotype the two complemented strains PN2336 and PN2337 were analysed as described above. Peramine production was restored (Table 5) in both transformants confirming that the 20 peramine negative phenotype of PN2323 was due to deletion of the EF103 gene. Therefore this gene is essential for peramine biosynthesis. This gene encodes a non-ribosomal peptide synthetase and based on the predicted biochemistry performs most if not all steps in the biosynthesis of peramine. We have demonstrated that this gene is essential for this pathway and that this gene likely corresponds to the peramine biosynthesis gene.

Table 5 Alkaloid analysis of perennial ryegrass plants containing EF103 mutant and complementation derivative. 32 symbiotum number fungal strain peramine PPm lolitrem B PPm ergovaline PPm Exp11 G1682 F11 pseudostem 59 4 0.1 blade 75 2.5 0.1 G1684 uninfected pseudostem 0 0 0 blade 0 0 0 G1686 PN2323 pseudostem 0 1.8 0.1 blade 0 1 0.1 G1687 PN2323 pseudostem 0 2.6 0.1 blade 0 1.4 0.1 Exp22 G1585 F11 pseudostem 65.6 12.5 0.5 blade 89.9 6.6 0.3 G1629 PN2323 pseudostem 0 14.0 1.2 blade 0 6.1 0.5 G1621 PN2336 pseudostem 62.1 7.8 1.9 blade 69.2 2.0 0.4 G1625 PN2337 pseudostem 75.6 11.0 1.2 blade 95.7 .5 1.1 'Plants harvested and analysed September 2003 2Plants harvested and analysed January 2005 Testing sensitivity of Argentine Stem Weevil adults to endophyte in plants infected with wild-type FI1 and the EF103 peramine minus mutant The EF103 peramine mutant strains were tested in an insect feeding bioassay to demonstrate that the loss of peramine resulted in reduced toxicity to the infected grass. Table 6 shows that the plants containing the peramine minus mutant PN2323 (leaves PN2323-1 10 and PN2323-1) were eaten at similar but slightly reduced levels to uninfected plants. It is 33 anticipated that some effects from ergot alkaloids may have contributed some toxic effects, however it appears that peramine has the predominant anti-feedant effect.

Bioassay 1. Sample leaves from test plants by cutting a 40 mm section of leaf from above the ligule. Note: leaf age can be a factor in amount of alkaloids so if possible take leaves that are approximately the same age. 2. Take a single leaf section from each treatment and place them in random order along a piece of masking tape (Figure 14). The end of the leaf section that was cut closest to the ligule should be stuck to the masking tape. The masking tape is then folded over to keep the leaves in place (make sure there are no sticky surfaces left exposed for weevils to adhere to). Label the treatments A, B C etc rather than the treatment name. This test should be done blind i.e. without the observer knowing which treatments are which. Each 'leaf comb' will need to fit into a 90 mm Petri dish so cut the tape and space the leaves according to this. Prepare ten of these leaf combs. 3. Take ten 90 mm diameter Petri dishes and place a 70 mm diameter piece of filter paper in each one. Moisten with 400 pi of distilled water. 4. Place the leaf comb over the filter paper and release five adult weevils into each Petri dish. Place the lid on the Petri dish and fasten pairs of Petri dishes together with rubber bands. The weevils should be left without food for 24 - 48 h prior to setting up the trial. They can be easily handled with soft forceps.

. Place all Petri dishes inside another sealed container and keep at 20 °C for 24 - 48 h at 16:8 hours light:dark ratio 6. Check after 24 h - if there is not a lot of feeding then leave for another 24 h but no more than this because the leaves will start to desiccate.

The weevils make "windows" in the leaves as they feed i.e. they nibble off the top epidermal layers to leave a transparent window (Figure 14). Scoring for feeding is based on a visual estimate of the amount of leaf surface that is covered with these windows. Score feeding on a scale of 0 - 5 where 0 = no feeding and 5 = more than 80% of the leaf surface covered in 5 feeding scars. Note any mortality of weevils although this is not usually a problem.

Table 6. Results of weevil feeding bioassay after 24 hours bStrain in ryegrass Uninfected PN2323-1 PN2323-2 Score 0.2 1.9 1.6 2.3 Scores are average of 10 leaf blades and represent percentage of leaf covered in feeding scars as follow. 0 = no feeding; 1 = 0 - 20 %; 2 = 20 - 40%; 3 = 40-60 %; 4 = 60 - 80 %; 5 = 80-100%.

The availability of isogenic strains of E. festucae with and without perA (EF103) has allowed the demonstration for the first time that peramine is indeed the metabolite that provides the perennial ryegrass-E. festucae symbiotum with protection from adult Argentine stem weevil (ASW). In this choice bioassay, plant material containing the perA mutant was as susceptible to feeding damage as endophyte-free plants, whereas material containing the wild-type strain was almost totally avoided. These results confirm that peramine, and not other alkaloids, such as the ergopeptines and indole-diterpenes (Bush etal., 1997; Rowan, 1993), is the major E. festucae metabolite responsible for adult ASW feeding deterrent activity. These results provide the first genetic evidence that a fungal produced secondary metabolite can provide protection to a plant host from insect herbivory.

Example 5 Isolation of EF103 Open Reading Frame from N. lolii and E. festucae Many fungal genes contain introns of between 50 to 120 bp that are unlikely to be recognized or correctly spliced. To ensure successful expression of the peramine biosynthetic gene candidate EF103, it was first necessary to generate a construct devoid of fungal intron sequences. Bioinfomatic analysis was used to determine the most likely splice sites (based 5 on fungal splice site consensus sequences) for splicing of introns and it was found that the EF103 gene (Figure 15) does not contain any introns.

Isolation of the EF103 open reading frame and cloning into pDONR221 The cosmid clone (pPN60) containing the peramine gene EF103 was used as the template for PCR to obtain a full length EF103 gene for recombination into the gateway-adapted entry 10 vector, pDONR 221 (Invitrogen) using BP clonase.

PCR amplification of EF103 DNA The PCR template was pPN60, a clone from a cosmid library from Epichloe festucae strain FI1. The EF103 DNA was amplified using the TripleMaster polymerase system (Eppendorf) in combination with long range tuning buffer. The primers RJ68F & RJ67R (Table 7) were 15 adapted for the Gateway system by the 5'addition of attB sites required for direct recombination of the PCR product into pDONR221 to create a Gateway entry clone. The EF103 PCR product was amplified according to manufacturer's instructions using the conditions shown below. 2.5mM mM MgCI2 (supplied in Tuning buffer) 0.5 pM primers 0.5 mM dNTPs 1.25U of TripleMaster (Eppendorf) 1 cycle 93°C for 3 min 25 25 cycles 93°C for 30sec 36 58°C for 30 sec 68°Cfor 1min 30 sec 1 cycle 68°C for 30 min The PCR product of approximately 8.4 kb was cleaned and concentrated using a centricon column (MiliQ). The PCR product was recombined into pDONR221 using BP clonase according to manufacturer's instructions (Invitrogen) and electro-transformed into E. coli TOPIO cells (Figure 15b). Transformed cells were selected on LB agar supplemented with 50 ngmL"1 of kanamycin sulphate. The identities of the cloned inserts were confirmed by restriction digest and sequencing.

Table 7: List of primers used in Examples 2 to 6 Primer Primer Sequence Comments RJ45-R TTA GGC CTT GAG AAC ACC CAG CAT G EF103 primer for RT PCR, JP54 GGT CCT TCG CGT GGC TGC TG EF103 primer for RT PCR, JP55 GTC ACA ATG CCT GAT GAG CG EF103 primer for RT PCR, GB003 CAC CAT GAC TGC CCG ATT GAA TCC EF103 primer for RT PCR, RJ17-F (SEQ ID NO. 3) AAYWSNGTNGYNCARTAYTTYCC Methyltransferase forward RJ17-R (SEQ ID NO. 4) YTTNGGNADNAYYTCNACRTG MethyltransferaseT reverse RJ68-F Attbl -AT GACGT GCCAAACAAT CTT GGCC EF103-ATG forward RJ67-R Attb2- CTAGCCT CCAG AT CTT GT G AAAGCACG EF103 reverse Example 6. Introduction of the PerA gene into peramine deficient endophyte strains to confer peramine biosynthesis 37 A chemical survey of a collection of diverse Neotyphodium/Epichloe endophyte strains indicated that not all strains were capable of synthesizing peramine in infected plants (Table 8). It is possible that these strains lack the PerA gene or contain a deficient copy of the PerA gene. To determine if these strains lacked a PerA gene, gene specific primers were designed to PerA. These primers were used in PCR experiments with different endophyte strains (Table 8) to determine the distribution of this gene across the Neotyphodium/Epichloe complex.

The oligonucleotide primers RJ6F and RJ6R were designed using the PerA gene sequence.

RJ6F 5'-ATCAACAACCGACCTATCAGTCCTGAAGCT-3' RJ6R 5'-CCGACCCGGGTGGCCGGAAACACCACGCAA-3' The reaction conditions used were: Per 15 jjL reaction: DNA template 15ng 1 x PCR buffer 0.2 mM dNTPs 0.5 |jM each primer RJ6F and RJ6R 1.5 mM MgCh 1U Taq. polymerase per reaction Cycling conditions: 38 1X 95°C 4 min 30X 95°C 30 s 58°C 30 s 72°C 60 s 1X 72°C 7 min PCR reactions were analysed on agarose gels and PerA positive strains were identified by the presence of a single 243bp band.

The results of the PCR screen indicated that all strains, including those that lacked detectible levels of peramine in infected plant material, contained a sequence that 10 could be amplified by primers RJ6F and RJ6R. The identity of this PCR fragment was confirmed by sequence analysis and was determined to be a PerA gene fragment.

Table 8. Summary of Neotyphodium/Epichloe strain characterization for presence of PerA gene sequence and determination of their capacity to produce peramine in 15 infected grass plants Strain PCR Analysis peramine AR512 + positive AR535 + positive AR514 + positive AR525 + positive 39 AR546 (Tf5) + Not known AR567(Tf30) + Not known RS2 + Not known RS6 + Not known RS10 + Not known AR542 + positive AR584 + positive AR593 + positive AR553 (Tf13) + negative AR555 (TF15) + positive AR40 + negative AR1501 (FL1) + positive AR1 + positive AR12 + positive AR56 + positive AR59 + positive AR29 (Lp5) + positive AR37 + negative 40 AR30 (Lp6) + Not known AR42 (Lp19) + positive AR 34 (Lp11) + positive AR47 + trace AR48 + trace AR49 + negative AR64 + negative AR17 + trace AR66 + negative AR26 (Lp2) + positive E8 + Not known AR501 + positive AR502 + positive AR506 + positive AR507 + positive AR510 + positive Fp1 + Not known AR1002 (Fp2) + Not known 41 Fp3 + Not known Fp5 + negative Strain AR37 does not produce detectible levels of peramine using techniques highlighted in Example 4. PCR analysis indicated that at least part of the PerA gene is present in this strain. The full length sequence, including the promoter region, was 5 amplified using multiple PCR reactions with primer combinations from Table 9.

Table 9 Examples of oligonucleotide primers used to amplify perform sequence analysis of perA gene fragments from AR37.

Primer Primer Sequence Comments JP007 GTC CGG CGA AGC CAT ATA GC PerA sequencing JP008 CGG CGA GGC CAT TGC GTG TC PerA sequencing JP009 CAG TGG CTG CGA ATA GAC CTG PerA sequencing JP010 GAC CTC ATG TCA CCG GAC GAC PerA sequencing JP011 CAT TGC CGT TGA TGA AGG CTG PerA sequencing JP012 GTT CTA GAC TGT TGA AGA GG PerA 42 sequencing JP013 CAT ATT CGT TGA CGA CGT CG PerA sequencing JP014 GCG ACT CTC ACA TCA GGA GC PerA sequencing JP015 GAA CGA AGC GGC GGT CTT GAT G PerA sequencing JP016 GGC CGC TTG GAT TAC CGA CC PerA sequencing JP017 CTC GCT GCG CTT CAG GCA TG PerA sequencing JP018 GAG TGC ATC TCG GCG ACG TCG PerA sequencing JP019 TCG ATG CAA TAG AAT CGC CG PerA sequencing JP020 GCA ACC GAC TTG CGA GAT GG PerA sequencing JP021 GGC ATG GCC TTG ACT GCC TG PerA sequencing JP022 CTG CAC GCG GCT CCA GGA GG PerA sequencing JP023 CCA TAT GCC TCG GCG ACA G PerA sequencing 43 JP024 GTT GGT TAG AGA CGA GGA GG PerA sequencing JP025 CCG CAT TGC GAC CGT GGA GG PerA sequencing JP026 GACGCG GCT GTT GCG CAC AG PerA sequencing JP027 TGG TCC TGG CTG TCG CTC CG PerA sequencing JP028 CGC CTT GTC TTC TGA TGC AG PerA sequencing JP029 AGT AGG TCG TGG ATA CAT CG PerA sequencing JP030 GTG ACA GGC ATG CTG CAG CG PerA sequencing JP031 GGA AGA TGT GGA TCA AGG AG PerA sequencing JP032 GCA GCT TGG TGC CGG CTT CC PerA sequencing JP033 GCT GAT GGT GCT GAG CAG AG PerA sequencing JP034 CTT GAT TGG ACG CAG CAA GAG PerA sequencing 44 JP035 TGT CAG CTG ACG CAC CGC GG PerA sequencing JP036 CAG CGA GAG TGA CCG CAC AG PerA sequencing JP037 TAA CCT CGA CCG ACA AGA GG PerA sequencing JP038 GGT GCA GGC GTT GTG ACG TG PerA sequencing JP039 GCA AGT GAT TGG CTC TGT GG PerA sequencing JP040 AGC GGT TCT GCG GAG CCA CG PerA sequencing JP041 TGG CCG GAT CCA CGC CTA TG PerA sequencing JP042 ACG ACA CCA TTG CTA CCA TG PerA sequencing JP043 GCC TTG CCA TGA ATT CCT TG PerA sequencing JP044 ACT TGC CGT CAT GAA TTC CG PerA sequencing JP045 GTT GCT TAT GGC CAC TCT GG PerA sequencing 45 JP046 ATA TTG GTG CGG ACG AGT GG PerA sequencing JP047 TGC GGC ACC ATG TAA GAA GG PerA sequencing JP048 CCA CTG ATG ATG AAG GCC GG PerA sequencing JP049 TGG AGT GAT GGA ACA TGT CG PerA sequencing JP050 CGA TGG ATT CAT CAA GCT GG PerA sequencing JP051 GCC ATA CCT CTA GCT CGC TG PerA sequencing JP052 CGT GTG ATT GCT ATT GTC AGG PerA sequencing JP053 GCC ATA CCT CTA GCT CGC TG PerA sequencing JP054 GGT CCT TCG CGT GGC TGC TG PerA sequencing JP055 GTC ACA ATG CCT GAT GAG CG PerA sequencing JP056 CTG TAT ACG GGT AGG CGT CG PerA sequencing 46 PCR products were sequenced with the appropriate oligonucleotide primers (Table 9) and the full length sequence of the gene was assembled using the programme Sequencher (Gene Codes Corporation, Ann Arbor, Michigan). The draft sequence of the AR37 PerA gene (SEQ ID No. 6) is presented in Figure 16. The full length AR37 5 PerA sequence was compared to the PerA gene from E. festucae strain FI1 (SEQ ID No. 1). There were 169 base substitutions identified corresponding to the first 8121 bp of SEQ ID No. 1 of the PerA gene plus a 12 bp insertion at the position corresponding to base 7154 in SEQ ID No. 1. A single base substitution corresponding to position 3750 bp in SEQ ID No. 1 created a premature stop codon, 10 which is predicted to result in a truncated peptide PerA (Figure 17). Additionally, there is limited sequence homology between the E. festucae FI1 and AR37 PerA genes after 8121 bp (SEQ ID No. 1) suggesting that the AR37 PerA 3' end is absent or substantially altered. The sequence derived from strain AR37 does not encode a functional PerA gene. Therefore it appears that although this strain may at one stage 15 have contained a functional PerA gene, the copy has undergone mutation resulting in the inability to synthesise peramine.

This leads to the opportunity to repair the defective PerA gene. The method by which a defective PerA gene in an endophyte strain may be repaired is by homologous recombination. In this procedure cosmid pPN60 (See example 4 and Tanaka et al, 20 2005 Molecular Microbiology 57(4): 1036-1050) will be digested with the restriction enzyme Hind\\\ and a 10334 bp fragment, containing the entire perA open reading frame (including 800 bp 5 prime of perA and 1030 bp 3 prime of perA), will be isolated. This fragment will be cloned into any conventional cloning vector such as pUC118 to yield a construct to be used in homologous transformation experiments 25 with AR37 protoplasts (see Example 3 for transformation methodology). Co- 47 transformation with the vector pPN1168 (Tanaka et al, 2005 Molecular Microbiology 57(4): 1036-1050) which confers hygromycin resistance will be used to select transformants. Transformants will be purified by sub-culture and screened for the homologous recombination event by PCR using primers specific to the AR37 mutated sequence. A negative PCR with these primers would indicate that the mutated AR37 sequence had been replaced with the FI1 functional sequence corresponding to SEQ ID No. 1. An alternative approach to repair non-functional peramine genes, such as that described in SEQ ID No. 6 for AR37, would be to insert into the genome, via ectopic integration, a functional copy of the PerA gene. This could be done using the complementation construct pPN62, a vector containing a full length, functional PerA gene, described in Example 3.

Aspects of the present invention have been described by way of example only and it should be appreciated that modifications and additions may be made thereby without departing from the scope of the appended claims.

REFERENCES Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403-410 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389-3402 Brimble MA, Rowan DD (1988) Synthesis of peramine, an insect feeding deterrent mycotoxin from Acremonium lolii. J Chem Soc Chem Commun 978-979 Bush LP, Wilkinson HH, Schardl CL (1997) Bioprotective alkaloids of grass-fungal endophyte symbioses. Plant Physiol 114:1-7 Byrd AD, Schardl CL, Songlin PJ, Mogen KL, Siegel MR (1990) The b-tubulin gene of Epichloe typhina from perennial ryegrass (Lolium perenne). Curr Genet 18:347-354 Christensen MJ, Ball OJ-P, Bennett RJ, Schardl CL (1997) Fungal and host genotype effects on compatibility and vascular colonization by Epichloe festucae. Mycolog Res 101:493-501 Christensen MJ, Leuchtmann A, Rowan DD, Tapper BA (1993) Taxonomy of Acremonium endophytes of tall fescue (Festuca arundinacea), meadow fescue (F. pratensis) and perennial rye-grass (Lolium perenne). Mycolog Res 97:1083-1092 Correia, T., Grammel, N., Ortel, I., Keller, U., and Tudzynski, P. (2003) Molecular cloning and analysis of the ergopeptine assembly system in the ergot fungus Claviceps purpurea. Chem Biol 10: 1281-1292. 49 Ditta G., Stanfield S., Corbin D., and Helinski D.R. (1980) Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci USA 77:7347-7351.

Dumas (1988) Total synthesis of peramine. J Organic Chem 53:4650-4653 Frischauf AM, Lehrach H, Poustka A, Murray N (1983) Lambda replacement vectors carrying polylinker sequences. J Mol Biol 170:827-842 Goderis IJWM, De Bolle MFC, Francois IEJA, Broekaert WF, Cammue BPA (2002). A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Mol. Biol 50:17-27 Gleave, A.P. (1992). A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20: 1203-1207.

Higgins D, Thompson JN, Gibson TJ, Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice. Nucl Acids Res 22:4673-4680 Inoue I, Namiki F, Tsuge T (2002) Plant colonization by the vascular wilt fungus Fusarium oxysporum requires FOW1, a gene encoding a mitochondrial protein. Plant Cell 14: 1869-1883 Itoh Y, Johnson R, Scott B (1994) Integrative transformation of the mycotoxin-producing fungus, Penicillium paxilli. Curr Genet. 25(6):508-13 50 Latch, G.C.M. & Christensen, M.J. 1985. Artificial infection of grasses with endophytes.

Annals Applied Biology 107, 17-24 Lee B.-N., Kroken S., Chou D.Y.T., Robbertse B., Yoder O.C. & Turgeon B.G. 2005. Functional analysis of all nonribosomal peptide synthetases in Cochliobolus heterostrophus reveals a factor, NPS6, involved in virulence and resistance to oxidative stress. Eukaryotic Cell 4(3):545-555 Leuchtmann A, Schardl CL, Siegel MR (1994) Sexual compatibility and taxonomy of a new species of Epichloe symbiotic with fine fescue grasses. Mycologia 86:802-812 Marahiel MA, Stachelhaus T, Mootz HD (1997) Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem Rev 97:2651-2673 Merryfield RB (1963) Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide J. Am. Chem. Soc. 85: 2149-2154 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiologia Plantarum15, 473-97 Nagai U and Sato K (1985) Synthesis of a bicyclic dipeptide with the shape of 0-Turn central part. Tetrahedron Lett. 26: 647-650 Panaccione DG, Johnson RD, Wang J, Young CA, Damrongkool P, Scott B, Schardl CL (2001) Elimination of ergovaline from a grass-Neotyphodium endophyte symbiosis by genetic modification of the endophyte. Proc Nat Acad Sci USA 98:12820-12825 51 Rowan DD (1993) Lolitrems, peramine and paxilline: mycotoxins of the ryegrass/endophyte interaction, Agriculture, Ecosystems & Environment. Elsevier Science Publishers B.V., Amsterdam, pp. 103-122 Rowan DD, Dymock JJ, Brimble MA (1990) Effect of fungal metabolite peramine and analogs on feeding development of Argentine stem weevil (Listronotus bonariensis). J Chem Ecol 16:1683-1695 Rowan DD, Hunt MB, Gaynor DL (1986) Peramine, a novel insect feeding deterrent from ryegrass infected with the endophyte Acremonium loliae. JChemSoc Chem. Commun. 935-936 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 Schardl CL (1996) Epichloe species: fungal symbionts of grasses. Ann Rev Phytopathol 34:109-130 Schardl CL, Liu J-S, White JF, Jr., Finkel RA, An Z-Q, Siegel MR (1991) Molecular phylogenetic relationships of nonpathogenic grass mycosymbionts and clavicipitaceous plant pathogens. Plant Syst Evol 178:27-41 Schardl CL, Wang J, Wilkinson HH, Chung K-R (1999) Genetic analysis of biosynthesis and roles of anti-herbivore alkaloids produced by grass endophytes. In: Kumagai S GT, Kawai K, Takahashi H, Yabe K, Yoshizawa T, Koga H, Kamimura H, Akao M (ed) Proceeding of International Symposium of Mycotoxicology '99. Mycotoxin contamination: health risk and prevention project. Chiba, Japan, pp. 118-125 52 Scott B (2001) Epichloe endophytes: symbionts of grasses. Curr Opin Microbiol 4:393-398 Scott-Craig JS, Panaccione DG, Pocard JA, Walton JD (1992) The cyclic peptide synthetase catalyzing HC-toxin production in the filamentous fungus Cochliobolus carbonum is encoded by a 15.7-kilobase open reading frame. J Biol Chem 267:26044-26049 Smythe ML and von Itzstein M (1994) Design and Synthesis of a Biologically Active Antibody Mimic Based on an Antibody-Antigen Crystal Structure J. Am. Chem. Soc. 116: 2725-33 Spiering MJ, Davies E, Tapper BA, Schmid J, Lane GA (2002) Simplified extraction of ergovaline and peramine for analysis of tissue distribution in endophyte-infected grass tillers. J Agric Food Chem. 50(21 ):5856-62 Tanaka, A., Tapper, B.A., Popay, A.J., Parker, E.J., and Scott, B. (2005) A symbiosis expressed non-ribosomal peptide synthetase from a mutualistic fungal endophyte of perennial ryegrass confers protection to the symbiotum from insect herbivory. Mol Microbiol in press.

Tudzynski P, Holter K, Correia T, Arntz C, Grammel N, Keller U (1999) Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol Gen Genet 261:133-141 Vollmer SJ, Yanofsky C (1986) Efficient cloning of genes of Neurospora crassa. Proc Natl Acad Sci USA 83: 4869-4873 von Dohren H, Keller U, Vater J, Zocher R (1997) Multifunctional peptide synthetases. Chem Rev 97:2675-2705 53 Wiest A, Grzegorski D, Xu B-W, Goulard C, Rebuffat S, Ebbole DJ, Bodo B, Kenerley C (2002) Identification of peptaibols from Trichoderma virens and cloning of a peptaidol synthetase. J Biol Chem 277:20862-20868 Young C, Itoh Y, Johnson R, Garthwaite I, Miles CO, Munday-Finch SC, Scott B (1998) Paxilline-negative mutants of Penicillium paxilli generated by heterologous and homologous plasmid integration. Curr Genet 33:368-377 Young CA, McMillan L, Telfer E, Scott B (2001) Molecular cloning and genetic analysis of an indole-diterpene gene cluster from Penicillium paxilli. Mol Microbiol 39:754-764 Young, C.A., Bryant, M.K., Christensen, M.J., Tapper, B.A., Bryan, G.T., and Scott, B. (2005) Molecular cloning and genetic analysis of a symbiosis-expressed gene cluster for lolitrem biosynthesis from a mutualistic endophyte of perennial ryegrass. Mol Gen Genom (in press).

Zhang, X. (2004) Functional analysis of a thiamine biosynthetic gene in the interaction of Epichloe typhina with perennial ryegrass. In Institute of Molecular Biosciences Palmerston North: Massey University, pp. 336. 54

Claims (26)

WHAT WE CLAIM IS:

1. An isolated nucleic acid molecule having a nucleic acid sequence selected from the group consisting of: a) SEQ ID NO 1; b) a functional fragment or variant of the sequence in a); or c) a complement to the sequences in a) or b).

2. An isolated nucleic acid molecule as claimed in claim 1 wherein the nucleotide sequence comprises the open reading frame between nucleotides 828-9332.

3. An isolated nucleic acid molecule encoding a polypeptide having an amino acid sequence comprising of SEQ ID NO. 2 or a functional fragment or variant thereof.

4. An isolated polypeptide having an amino acid sequence comprising of SEQ ID NO. 2 or a functional fragment or variant thereof.

5. A vector or construct including a nucleotide sequence comprising a nucleic acid molecule as claimed in claim 1.

6. An isolated host cell transformed with a vector or construct as claimed in claim 5.

7. An isolated host cell which has been transformed to include a nucleic acid molecule as claimed in claim 1.

8. The host cell as claimed in claim 6 or 7 wherein the host cell is a fungal cell.

9. The host cell as claimed in claim 8 wherein the host cell is a fungal endophyte cell. intellectual Property Office of N.Z. 55 12 SEP 2007

10. The host cell as claimed in claim 9 wherein the fungal endopyte is selected from the genera: Epichloe or Neotyphodium.

11. An isolated host cell which has been modified to express a polypeptide having an amino acid sequence comprising of SEQ ID No. 2 or a functional fragment or variant thereof.

12. An isolated primer having a nucleotide sequence selected from the group consisting of: a) SEQ ID NO. 4; or b) SEQ ID NO 5, capable of binding to a portion of PerA gene nucleotide sequence or a homolog thereof under stringent conditions.

13. A plant which includes a fungal endophyte cell as claimed in claim 9 or 10.

14. A plant as claimed in claim 13 wherein the plant is a grass.

15. A plant as claimed in claim 14 wherein the grass is of the sub-family Pooideae.

16. The use of an isolated nucleic acid molecule as claimed in claim 1, 2 or claim 3 to manipulate peramine biosynthesis in fungal endophytes.

17. The use of an isolated nucleic acid molecule as claimed in claim 16, wherein the nucleic acid molecule repairs or replaces a non-functional perA gene.

18. The use of an isolated nucleic acid molecule as claimed in claims 16 and 17 wherein said use is in planta. ' * 2008;56 ' REC;W=D;

19. The use of the nucleotide sequence information of SEQ ID NO. 1 to construct oligonucleotides to identify or isolate the perA gene in fungal endophytes.;

20. An isolated nucleic acid molecule substantially as described herein with reference to any example and/or drawing thereof.;

21. An isolated peptide molecule substantially as described here with reference to any example and/or drawing thereof.;

22. A vector or construct substantially as described here with reference to any example and/or drawing thereof.;

23. An isolated host cell substantially as described here with reference to any example and/or drawing thereof.;

24. A plant cell substantially as described here with reference to any example and/or drawing thereof.;

25. The use of an isolated nucleic acid molecule such as described herein with reference to any example and/or drawing thereof.;

26. The use of the nucleotide sequence information substantially as described herein to construct oligonucleotides to identify or isolate the perA gene fungal endophyte with reference to any example and/or drawing thereof;AaResearch Limited by its-authorised agents h"oSf,f§^;* ■ 11 SEP 2007