NZ527727A

NZ527727A - Recombinant high molecular weight major outer membrane protein of Moraxella

Info

Publication number: NZ527727A
Application number: NZ527727A
Authority: NZ
Inventors: Sheena M Loosemore; Yan-Ping Yang; Ken Sasaki; Michel H Klein
Original assignee: Aventis Pasteur
Priority date: 1999-07-27
Filing date: 2000-07-26
Publication date: 2004-07-30
Also published as: NZ527726A

Abstract

An isolated and purified outer membrane protein of a Moraxella strain, particularly M. catarrhalis strain Q8, having a molecular mass of about 200 kDa, is provided by recombinant means. The about 200 kDa outer membrane protein as well as nucleic acid molecules encoding the same are useful in diagnostic applications and immunogenic compositions, particularly for in vivo administration to a host to confer protection against disease caused by a bacterial pathogen that produces the about 200 kDa outer membrane protein or produces a protein capable of inducing antibodies in a host specifically reactive with the about 200 kDa outer membrane protein. N-terminally and C-terminally truncated about 200 kDa proteins also are produced recombinantly.

Description

<div class="application article clearfix" id="description"> 52 7 7 2 7 INTELLECTUAL PROPERTY OFFICE OF N.Z 2 1 AUG 2003 RECEIVED NEW ZEALAND PATENTS ACT 1953 No: Divided out of No. 517235 Date: dated 26 July 2000 COMPLETE SPECIFICATION RECOMBINANT HIGH MOLECULAR WEIGHT MAJOR OUTER MEMBRANE PROTEIN OF MORAXELLA We, AVENTIS PASTEUR LIMITED, of 1755 Steeles Avenue West, Toronto, Ontario, Canada, M2R 3T4, do hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement: - 1 - (followed by page 1 a) TITLE OF INVENTION RECOMBINANT HIGH MOLECULAR WEIGHT MAJOR OUTER MEMBRANE PROTEIN OF MORAXELLA This specification is related to New Zealand patent specification No. 517235, from which it is divided, and to New Zealand patent specification No , also divided from New Zealand patent specification No. 517235. FIELD OF INVENTION The present invention relates to the field of immunology and is particularly concerned with outer membrane proteins from Moraxella, methods of recombinant production thereof, genes encoding such proteins and uses thereof. BACKGROUND OF THE INVENTION Otitis media is the most common illness of early childhood with approximately 70% of all children suffering at least one bout of otitis media before the age of seven. Chronic otitis media can lead to hearing, speech and cognitive impairment in children. It is caused by bacterial infection with Streptococcus pneumoniae (approximately 50%), non-typable Haemophilus influenzae (approximately 30%) and Moraxella (Branhamella) catarrhalis (approximately 20%). In the United States alone, treatment of otitis media costs between one and two billion dollars per year for antibiotics and surgical procedures, such as tonsillectomies, adenoidectomies and insertion of tympanostomy tubes. Because otitis media occurs at a time in life when language skills are developing at a rapid pace, developmental disabilities specifically related to learning and auditory perception have been documented in youngsters with frequent otitis media. M. catarrhalis mainly colonizes the respiratory tract and is predominantly a mucosal pathogen. Studies using cultures of middle ear fluid obtained by tympanocentesis have shown that M. catarrhalis causes approximately 20% of cases of otitis media (ref. 1 - Throughout this application* various references are referred to in parenthesis to more fully describe the state of the art to which this invention pertains. Full bibliographic information for each citation is found at the end of the WO 01/07619 PCT/CA00/00870 2 . specification, immediately preceding the claims. The disclosures of these references are hereby incorporated by reference into the present disclosure). The incidence of otitis media caused by M. catarrhalis is increasing. As ways of preventing otitis media caused by pneumococcus and non-typable H. 5 influenzae are developed, the relative importance of M. catarrhalis as a cause of otitis media can be expected to further increase. M catarrhalis is also an important cause of lower respiratory tract infections in adults, particularly in the setting of chronic bronchitis and emphysema (refs. 2, 3, 4, 5,6,7, and 8). M. catarrhalis also causes sinusitis in children and adults (refs. 9, 10 10.11,12, and 13) and occasionally causes invasive disease (refs. 14,15,16,17, 18, and 19). Like other Gram-negative bacteria, the outer membrane of M. catarrhalis consists of phospholipids, lipopolysaccharide (LPS), and outer membrane proteins (OMPs). Eight of the M. catarrhalis OMPs have been identified as major 15 components. These are designated by letters A to H, beginning with OMP A which has a molecular mass of 98 kDa to OMP H which has a molecular mass of 21 kDa (ref. 20). Recently, Klingman and Murphy purified and characterized a high molecular-weight outer membrane protein of M. catarrhalis (ref. 21). The apparent 20 molecular mass of this protein varies from 350 kDa to 720 kDa as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). This protein appears to be an oligomer of much smaller proteins or subunits thereof of molecular mass about 120 to 140 kDa and is antigenically conserved among strains of Moraxella. 25 Helminen et al also identified a protein of molecular mass of about 300 to 400 kDa, named UspA, that was reported to be present on the surface of Moraxella (ref. 22). In WO 96/34960 and US Patent No. 5,808,024, assigned to the assignee hereof and the disclosure of which is incorporated herein by reference, there is 30 described a new protein of M. catarrhalis which had an apparent molecular mass of about 200 kDa. Western blot analysis using antiserum raised against the 200 kDa protein suggested that this protein was different from the large UspA protein (> 300 WO 01/07619 PCT/CAOO/00870 3 kDa), reported by the two groups in refs. 21 and 22. Recently, the gene sequences encoding two related proteins, UspAl and UspA2, have been published (ref. 23). A sequence comparison between the two genes encoding the UspA proteins and the gene encoding the 200 kDa protein confirmed that the 200 kDa protein is different 5 from either of the UspAl and UspA2 proteins. Fitzgerald et al (ref. 29) have identified a 200 kDa protein associated with haemagglutination. Transmission electron microcopy studies (ref. 30) showed that the 200 kDa protein associated with haemagglutination is present on the outer fibrillar layer of M. catarrhalis. Recently, a non-clumping variant of strain 4223 was 10 prepared by serial passaging and it was observed that the non-clumping variant had reduced expression of both UspA and a 200 kDa protein that is not UspA (ref. 31). It is possible that this 200 kDa protein is the same as that described in WO 96/34960 and herein. The 200 kDa protein described herein has been detected in most, but not all, 15 strains of Moraxella catarrhalis, which have been isolated from various sources, including otitis media (OM), sputum, nasopharynx, expectorate and bronchial secretions. Table 1A below contains a listing of M. catarrhalis strains tested, their source and whether or not the 200 kDa protein is expressed. In this application, the term "about 200 kDa protein" refers, as recited in the 20 aforementioned USP 5,808,024, to family of outer membrane protein of M. catarrhalis having a molecular mass between about 160 and 230 kDa, as determined SDS-PAGE at 12% polyacrylamide following the procedure of Laemli, and includes proteins having varieties in their amino acid sequences including those naturally occurring in various strains of Moraxella. 25 M. catarrhalis infection may lead to serious disease. It would be advantageous to provide recombinant means for providing large quantities of 200 kDa outer membrane protein of M. catarrhalis strains and genes encoding such proteins from various M. catarrhalis strains for use as antigens in immunogenic preparations including vaccines, carriers for other antigens and immunogens and the 30 generation of diagnostic reagents. 4 (followed by page 4a) SUMMARY OF THE INVENTION The present invention is directed towards the provision of a recombinantly produced purified and isolated outer membrane protein of Moraxella catarrhalis and other Moraxella strains, having an apparent molecular mass of about 200 kDa, as well as genes encoding the same from various strains of Moraxella catarrhalis. In one aspect, the present invention provides an isolated and purified nucleic acid molecule having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence set forth in Figure 4 (SEQ ID No: 8) for Moraxella catarrhalis strain Q8 or the complementary sequence thereto, and (b) a nucleotide sequence encoding an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis and having the derived amino acid sequence shown in Figure 5 (SEQ ID No: 9) for Moraxella catarrhalis strain Q8. In another aspect, the present invention provides a vector for transforming a host comprising a nucleic acid molecule as defined above. In another aspect, the present invention provides a host cell transformed by a vector as defined above and expressing an about 200 kDa protein of a strain of Moraxella catarrhalis. In a further aspect, the present invention provides a recombinant about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis producible by a transformed host as defined above. In a further aspect, the present invention provides a recombinant protein as defined above producible in inclusion bodies. In still a further aspect, the present invention provides an immunogenic composition including a recombinant about 200 kDa outer membrane protein as defined above. In yet a further aspect, the present invention provides the use of a recombinant about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis producible by a transformed host as defined above in the manufacture of a medicament for inducing protection against disease caused by Moraxella catarrhalis. In yet a further aspect, the present invention provides a method for the production of an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis, which includes: growing the host cell to express the encoded about 200 kDa protein, and isolating and purifying the expressed about 200 kDa protein. 4a (followed by page 5) In still a further aspect, the present invention provides an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis or a truncation thereof whenever prepared by a method as defined above. Also described herein is an isolated and purified nucleic acid molecule having (a) a nucleotide sequence set forth in Figure 3 or 5 (SEQ ID Nos: 5, 6, 10) for Moraxella catarrhalis strains 4223 and LES-1 respectively or the complementary sequence thereto; (b) a nucleotide sequence encoding an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis and having the derived amino acid sequence shown in Figures 3 or 5 (SEQ ID Nos: 7, 11) for Moraxella catarrhalis strains 4223 and LES-1 respectively; and (c) a nucleotide sequence encoding an about 200 kDa outer membrane protein of another strain of Moraxella catarrhalis which is characterized by a tract of consecutive G nucleotides which is 3 or a multiple thereof in length, an ATG start codon about 80 to 90 bp upstream of said tract and said tract being located between about amino acids 25 and 35 encoded by the nucleotide sequence. The another strain of Moraxella catarrhalis in (c) is a strain as identified in Table 1A other than strain 4223, Q8 and LES-1 and expressing an about 200 kDa protein. Also described herein is an isolated and purified nucleic acid molecule having a nucleotide sequence selected from the group consisting of (a) a nucleotide sequence set forth in Figure 8 (SEQ ID No: 12) for a 5-truncation of the gene encoding an about 200 kDa outer membrane protein of Moraxella catarrhalis strain 4223 contained in pKS348; (b) a nucleotide sequence encoding The derived amino acid sequence set forth in Figure 9 (SEQ JD No: 13) for a N-tenuinal truncation of an about 200 kDa outer membrane protein of Moraxella catarrhalis strain 4223 produced by pKS348; (c) a nucleotide sequence set forth in Figure 21 (SEQ ID No: 45) for a 5' truncation of the gene encoding an about 200 kDa outer membrane protein of Moraxella catarrhalis strain 4223 contained in pQWF; (d) a nucleotide sequence encoding the derived amino acid sequence set forth in Figure 21 (SEQ ID No: 46) for a N-terminal truncation of ah about 200 kDa 5 outer membrane protein of Moraxella catarrhalis strain 4223 produced by pQWF; (e) a nucleotide sequence set forth in Figure 21 (SEQ ID No: 47) for a 5'- and 3'-truncation of the gene encoding an about 200 kDa outer membrane protein of Moraxella catarrhalis strain 4223 contained in pBR T7 3' 200 kDa(t); (f) a 5 nucleotide sequence encoding the derived amino acid sequence set forth in Figure 21 ( SEQ ID No: 48) for a N-terminal and C-terminal truncation of an about 200 kDa outer membrane protein of Moraxella catarrhalis strain 4223 produced by pBR T7 3' 200 VD^)IKanRJcer, (g) a nucleotide sequence encoding a 5'-truncation of a gene encoding an about 200 kDa outer membrane protein of another strain of Moraxella 10 catarrhalis corresponding to those of (a), (b), (c) and (d) and being capable of expressing the corresponding N-terminally truncated about 200 kDa outer membrane protein fromE. coli; and (h) a nucleotide sequence encoding a 5'- and 3-truncation of a gene encoding an about 200 kDa outer membrane protein of another strain of Moraxella catarrhalis corresponding to those of (e) and (f) and being 15 capable of expressing the corresponding N- and C-terminally truncated about 200 kDa outer membrane protein from E. coli. Also described herein is an isolated and purified nucleic acid molecule which is a contiguous Nde I - Pst I fragment of SEQ ID No: 5. Also described herein is a vector for transforming a host comprising a 20 nucleic acid molecule as described, which may be a plasmid vector. The plasmid vector may be one which has the identifying characteristics of pKS348 (ATCC 203,529) or pKS294 (ATCC 203,528). The plasmid vector also may be one having the identifying characteristics of pQWF. In addition, the plasmid vector may be one having the identifying characteristics of pBR pT7 3' 200 kDa(t) 25 pBR T7 3' 200 kDa(t)/KanR or pBR T7 3' 200 kDa(t)/KanR/cer. Also described herein is a host cell, such as E. coli, transformed by a vector as described herein and expressing an about 200 kDa protein of a strain of Moraxella catarrhalis or a truncation thereof. Also described is a recombinant of about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis or a 30 truncation thereof producible by the transformed host as described herein. As set forth below, various truncated forms of the full length recombinant about 200 kDa protein may be produced. In one such truncation, the protein is truncated at the N-terminal end by reason of a short deletion to amino acid 56, produced by pKS348. As set forth below, the full-length protein appeared to be 5 toxic to E. coli when expressed from pKS294, and only when truncated was the protein expressed. The truncations further include the approximately C-terminal half of the protein, which appeared to be conserved among strains of Moraxella catarrhalis and, when expressed from pQWF, was produced in significantly larger quantities 10 than from pKS34S. Plasmid pQWF expressed the truncated protein as a doublet, the higher molecular weight band corresponding to the C-terminal half of the protein and the lower molecular weight band being a C-terminal truncation. The encoding nucleic acid and amino acid sequence of the C-teiminal truncation are identified herein, expression vectors containing the nucleic acid are constructed, and the C-15 terminal truncation expressed. Described herein are nucleic acid molecules encoding portion only of the about 200 kDa protein of a strain of M. catarrhalis which are capable of being expressed as a truncated form of the about 200 kDa protein and the corresponding truncated form of the protein. 20 The recombinant about 200 kDa outer membrane protein or a truncation thereof may be formulated into an immunogenic composition, which may be formulated as a vaccine for in vivo administration to protect against disease caused by Moraxella catarrhalis, which may be provided in combination with a targeting molecule for delivery to specific cells of the immune system, formulated as a 25 microparticle, capsule or liposome preparation, and may further comprise an adjuvant Also described herein is a method of inducing protection against disease caused by Moraxella catarrhalis by administering to a susceptible host, which may be a human, an effective amount of the immunogenic composition 30 as described herein. 7 t Also described herein is a method for the production of an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis or truncation thereof, which comprises: transforming a host cell, such as E. coli, with a vector as described herein, 5 growing the host cell to express the encoded about 200 kDa protein or truncation thereof, and isolating and purifying the expressed about 200 kDa protein or truncation thereof. The encoded about 200 kDa protein or truncation thereof may be expressed 10 in inclusion bodies. The isolation and purification of the about 200 kDa protein may be effected by: disrupting the grown transformed cells to produce supernatant and die inclusion bodies, solubilizing the inclusion bodies to produce a solution of the recombinant 15 about 200 kDa protein or truncation thereof, chromatographically purifying the solution of recombinant about 200 kDa protein or truncation thereof free from contaminating proteins, and isolating the purified recombinant about 200 kDa protein or truncation thereof. 20 Advantages of the present invention include: - identification of nucleic acid and derived amino acid sequences of about 200 kDa protein from various strains of M. catarrhalis. - production of immunogenic recombinant about 200 kDa protein, which may be in various truncated forms. 25 BRIEF DESCRIPTION OF DRAWINGS Reference is made herein to the accompanying drawings, wherein: Figure 1 shows restriction maps of subclones of a gene encoding the 200 kDa outer membrane protein of M. catarrhalis from XJEMBL3 clone 811 and the location of PCR primers used to amplify the 5'-region of the gene. The open reading •j 30 frame of the about 200 kDa outer membrane protein is indicated by the shaded box. The numbers in parenthesis are approximate sizes of DNA inserts in plasmids. WO 01/07619 PCT/CA00/00870 8 Restrictions sites are Sal: Sail, N: Ncol, B: BglD., K: Kpnl, Xb: Xbal, Xh: Xhol, RV: EcoRV; Figure 2 shows the nucleotide sequence (SEQ ID No: 1 - entire sequence, SEQ ID No: 2 - coding sequence) of the gene encoding the about 200 kDa outer 5 membrane protein of M. catarrhalis strain 4223, as determined from XEMBL3 clone 811, and deduced amino acid sequence (SEQ ID No: 3 - identified GTG start codon, SEQ ID No: 4 - putative ATG start codon shaded) of the about 200 kDa outer membrane protein. A ten-G nucleotide segment of the 5-UTR is identified by underlining. An ATG start codon for the same sequence but with a nine-G 10 nucleotide segment is identified by a box (see Figure 3); Figure 3 shows the nucleotide sequence (SEQ ID No: 5 - entire sequence, SEQ ID No: 6 - coding sequence) of the gene encoding the about 200 kDa outer membrane protein of M. catarrhalis strain 4223, as determined from PCR-amplified genomic DNA of strain 4223 and the deduced amino acid sequence (SEQ ID No: 7) 15 of the corresponding about 200 kDa outer membrane protein. A nine-G nucleotide segment of the sequence corresponding to the 10-G nucleotide segment of Figure 2, is identified by underlining. The GTG start codon identified in Figure 2 is identified by a box; Figure 4 shows the nucleotide sequence (SEQ ID No: 8) of the gene 20 encoding the about 200 kDa outer membrane protein of M. catarrhalis strain Q8 and the deduced amino acid sequence (SEQ ID No: 9) of the corresponding about 200 kDa outer membrane protein. A nine-G nucleotide segment is identified by underlining; Figure 5 shows the nucleotide sequence (SEQ ID No: 10) of the gene 25 encoding the about 200 kDa outer membrane protein of M. catarrhalis strain LES-1 and the deduced amino acid sequence (SEQ ID No: 11) of the corresponding about 200 kDa outer membrane protein. A three-G nucleotide segment is identified by underlining; Figure 6 contains an alignment of the amino acid sequences (in single letter 30 code) of the about 200 kDa proteins of M. catarrhalis strain 4223 (SEQ ID No: 7), Q8 (SEQ ID No: 9) and LES-1 (SEQ ID No: 11). The alignments of the sequences were made using BLAST and manual methods and are compared to the 4223 WO 01/07619 PCT/CA0O/OO87O sequence. Gaps in the sequence where no corresponding or related amino acid exists are designated bywhile identical amino acids are designed by Figure 7 shows the restriction sites of the M. catarrhalis strain 4223 derived 200 kDa protein gene as well as the identity of various plasmids containing partial or 5 full length 200 kDa genes. Restriction sites are Sal: Sail, N: Ncol, K: Kpnl, Xh: Xhol, Rv: EcoRv, Ps: Pstl, Nd: NdeI,; Figure 8 shows the nucleotide sequence (SEQ ID No: 12) and deduced amino acid sequence (SEQ ID No: 13) of the 5'-truncated gene encoding the M56 200 kDa protein of M. catarrhalis strain 4223 contained in pKS348; 10 Figures 9A and 9B contain a schematic of the procedure for producing plasmid pKS294 expressing the full length 200 kDa protein of M. catarrhalis strain 4223; Figure 10 is a schematic of the procedure for producing plasmid pKS348 expressing the N-truncated M56 r200 kDa protein ofM catarrhalis strain 4223; 15 Figure 11 shows a schematic procedure for the purification of recombinantly-produced 200 kDa protein from E. coli; Figure 12 shows SDS-PAGE analysis of the expression of M56 r200 kDa protein gene from E. coli. M. catarrhalis strain 4223 lysate was run as a positive control (a) and uninduced KS358 cultured overnight was run as a negative control 20 (b). In each lane, 20 jig of total protein was loaded; Figure 13 shows the SDS-PAGE analysis of the purification of the M56 r200 kDa protein according to the scheme of Figure 11. Lane 1, E. coli whole cells; Lane 2, soluble proteins after 50 mM Tris/NaCl, pH8, extraction; Lane 3, soluble proteins after Tris/Triton X-100/EDTA extraction; Lane 4, soluble proteins after Tris/OG 25 extraction; Lane 5. pellet after Tris/OG extraction; Lanes 6, 7, purified 200 kDa protein; Figure 14 shows the anti-M56 r200 kDa protein antibody titers obtained in mice. Mice were immunized on day 1, day 29 and day 43 with 0.3 ^g, 1 jig, 3 ^g or 10 |ig of the purified M56 r200 kDa protein in adjuvant. Antisera were obtained on 30 days 14, 28, 42 and 56 and anti-M56 r200 kDa protein IgG. titers were determined. The reactive titers of antisera were defined as the reciprocal of the dilution WO 01/07619 PCT/CAOO/00870 10 consistently showing a two-fold increasing in absorbance over that obtained with the pre-bleed serum sample collected on day 0; Figure 15 shows the anti-M56 r200 kDa antibody titers in guinea pigs. Guinea pigs were immunized and antisera were analyzed according to the protocol 5 of Figure 14; Figure 16 shows the location of PCR primers used to amplify a DNA fragments carrying portions of the 200 kDa protein gene from chromosomal DNA of M. catarrhalis strain RH408, a spontaneous mutant of strain 4223 which does not produce the 200 kDa protein; 10 Figure 17 is a partial nucleotide and derived amino acid sequence for the 200 kDa protein of M. catarrhalis strain 4223, indicating by arrows the locations of the initial amino acid of the respective three truncations ALA12, VAL19 and GLY39; Figure 18 shows schematic diagrams for two 3* half clones of the 4223 200 kDa gene. Clone pQWE contains a fusion between the 5' end of the 200 kDa gene 15 and the 3' half of the gene. Clone pQWE contains the 3' half of the gene alone. The location of the PCR primers used to generate pQWF is indicated. Figure 19 is a construction diagram for producing plasmid pQWE expressing a C-terminal portion of the 200 kDa protein of M. catarrhalis strain 4223 fused to the N-tenninus; 20 Figure 20 is a construction diagram for producing plasmid pQWF expressing a C-terminal portion of the 200 kDa protein of M. catarrhalis strain 4223; Figure 21 shows the nucleotide sequence (SEQ ID No: 5 - entire sequence, SEQ ID No: 6 - coding sequence) of the gene encoding the about 200 kDa outer membrane protein ofM catarrhalis strain 4223, as determined from PCR-amplified 25 genomic DNA of strain 4223 and the deduced amino acid sequence (SEQ ID No: 7) of the corresponding about 200 kDa outer membrane protein and hence contains the same sequences as Figure 3. The Figure shows the identity of pKS348, containing a 5'-terminal truncation of the 200 kDa gene, the identity of pQWF (nucleotide sequence - SEQ ID No: 45, derived amino acid sequence, SEQ ID No: 46) 30 comprising a 3' terminal half of the gene, such as those potential truncation sites and certain restrictions sites (see Figure 22); WO 01/07619 PCT/CAOO/00870 11 Figure 22 shows the identity of certain restrictions sites (some of which are identified in Figure 21) is the full length gene encoding the about 200 kDa outer membrane protein of M. catarrhalis strain 4223 and the identity of truncations r200 kDa from pKS348, 3' r200 kDa from pQWF and 3' r200 kDa(t); 5 Figure 23 is a schematic procedure for producing plasmid pBR T7 3'rkDa(t)/KanR/cer from pQWF and 3' 200 kDa(t); and Figure 24 contains SDS-PAGE analyses of cell lysates of transformed E. coli strains BL21-SI and BL21(DE3) expressing carboxy-terminated protein. GENERAL DESCRIPTION OF THE INVENTION 10 In WO 96/34960 (Figure 6), the sequence of a cloned gene from M. catarrhalis 4223 encoding an about 200 kDa protein, was described. The open reading frame was predicted to start at a GTG codon. Sequence analysis of 200 kDa genes from additional strains, suggested that a slightly longer open reading frame was more generally found. A re-examination of the sequence from the lambda 15 phage-derived 200 kDa gene confirmed the GTG start codon and an upstream stretch of 10 G nucleotides in a G tract. However, when sequence analysis was performed on 4223 genomic PCR-amplified subclones, the longer open reading frame was found starting from an ATG codon. The G-tract was found to contain 9 G nucleotides in the chromosomal gene. An additional G nucleotide had been inserted 20 during cloning from the phage library. Analysis of the 5' end of the 200 kDa gene from 24 strains suggests that the number of G nucleotides in the G tract acts as regulator of expression. Utilizing the techniques described herein, the genes encoding the about 200 kDa protein from M. catarrhalis strains Q8 and LES-1 have been cloned and 25 sequenced. Figures 4 and 5 show respectively the nucleotide and derived amino acid sequences. An amino acid sequence comparison of the derived amino acid sequences of the 200 kDa protein from the three strains of M. catarrhalis is contained in Figure 6. Based on the sequence information, a plasmid (pKS294) was constructed 30 that contained the full-length 200 kDa protein gene of strain 4223 starting at the ATG codon, under control of the bacteriophage T7 promoter. However, even a basal level of expression of the full-length gene from the ATG was lethal to E. coli. WO 01/07619 PCT/CAOO/00870 12 Deletion of a 165 bp 5' fragment of the 200 kDa coding region greatly reduced the toxicity of the resultant protein to E. coli. Plasmid pKS348 contains the T7 promoter transcriptionally driving a 200 kDa protein gene which starts at amino acid residue 56. The V56 codon was changed to M56. The M56 r200 kDa protein was produced 5 and the purified protein was used to generate guinea pig antiserum. In WO 96/34960, a bactericidal antibody assay was described that was used . to demonstrate that anti-200 kDa antibody was bactericidal for M. catarrhalis. The assay was used herein to demonstrate broad bactericidal antibody activity against heterologous clinical isolates from different geographical locations, by anti-M56 10 r200 kDa antibody. A single anti-M56 r200 kDa antibody was lytic for 62% of strains tested. The 200 kDa protein was originally identified as a putative adhesin when its presence was detected in a clumping strain, but not a non-clumping derivative. In order to determine whether it were truly an adhesin, an in vitro adherence assay was 15 developed in which the inhibition of binding by antibody between M. catarrhalis and epithelial cells was measured. Using this assay, anti-M56 r200 kDa antibody was capable of inhibiting adherence of the homologous strain by 48%, demonstrating that the 200 kDa protein was an adhesin. When an additional 25 strains of M. catarrhalis were assayed, 21 were found to have reduced adherence to 20 epithelial cells in the presence of anti-M56 r200 kDa antibody. 19 of these strains had not been killed by the same antibody. Thus, a single anti-M56 r200 kDa antibody was capable of killing or blocking adherence of 91% of the strains tested. The sequence comparison for the 200 kDa gene from three strains of M. catarrhalis showed that the C-terminal half of the protein was quite conserved. 25 Strain LES-1 contained an insert of about 300 amino acids. Thus, based upon the C-terminal region, the strains may be divided into two families depending upon whether they contained the insert 4223 and Q8 formed one family while LES-1 formed the other. The carboxy terminal halves (31 halves) of the 4223 or LES-1 200 kDa genes were expressed in E. coli with good yields and the purified carboxy 30 terminal half of the proteins were used to generate antibodies. When tested in the bactericidal antibody assay, these antisera were bactericidal, as seen in Table IB. WO 01/07619 PCT/CA00/00870 13 It is clearly apparent to one skilled in the art, that the various embodiments of the present invention have many applications in the fields of vaccination, diagnosis, treatment of Moraxella infections, and in the generation of immunological reagents. A further non-limiting discussion of such uses is further 5 presented below. 1. Vaccine Preparation and Use Immunogenic compositions, including those suitable to be used as vaccines, may be prepared from the about 200 kDa outer membrane protein as disclosed herein, as well as immunological fragments and fusions thereof, which may be 10 purified from the bacteria or which may be produced recombinantly. The vaccine elicits an immune response in a subject which produces antibodies, including anti-200 kDa outer membrane protein antibodies and antibodies that are opsonizing or bactericidal. Should the vaccinated, subject be challenged by Moraxella or other bacteria that produce proteins capable of producing antibodies that specifically 15 recognize 200 kDa outer membrane protein, the antibodies bind to and inactivate the bacterium. Furthermore, opsonizing or bactericidal anti-200 kDa outer membrane protein antibodies may also provide protection by alternative mechanisms. Immunogenic compositions including vaccines may be prepared as injectables, as liquid solutions or emulsions. The about 200 kDa outer membrane 20 protein may be mixed with pharmaceutically acceptable excipients which are compatible with the about 200 kDa outer membrane protein. Such excipients may include, water, saline, dextrose, glycerol, ethanol, and combinations thereof. The immunogenic compositions and vaccines may further contain auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, or adjuvants to enhance 25 the effectiveness thereof. Immunogenic compositions and vaccines may be administered parenterally, by injection subcutaneously or intramuscularly. Alternatively, the immunogenic compositions formed according to the present invention, may be formulated and delivered in a manner to evoke an immune response at mucosal surfaces. Thus, the immunogenic composition may be 30 administered to mucosal surfaces by, for example, the nasal or oral (intragastric) routes. Alternatively, other modes of administration including suppositories and oral formulations may be desirable. For suppositories, binders and carriers may WO 01/07619 PCT/CA00/00870 14 include, for example, polyalkalene glycols or triglycerides. Oral formulations may include normally employed incipients such as, for example, pharmaceutical grades of saccharine, cellulose and magnesium carbonate. These compositions can take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations 5 or powders and contain about 1 to 95% of the about 200 kDa outer membrane protein. The immunogenic preparations and vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective, protective and immunogenic. The quantity to be administered depends on the subject to be treated, including, for example, the 10 capacity of the individual's immune system to synthesize antibodies, and if needed, to produce a cell-mediated immune response. Precise amounts of active ingredient required to be administered depend on the judgement of the practitioner. However, suitable dosage ranges are readily determinable by one skilled in the art and may be of the order of micrograms of the about 200 kDa outer membrane protein. Suitable 15 regimes for initial administration and booster doses are also variable, but may include an initial administration followed by subsequent administrations. The dosage may also depend on the route of administration and will vary according to the size of the host. The immunogenic preparations including vaccines may comprise as the 20 immunostimulating material a nucleotide vector comprising at least a portion of the gene encoding the about 200 kDa protein, or the at least a portion of the gene may be used directly for immunization. The concentration of the about 200 kDa outer membrane antigen in an immunogenic composition according to the invention is in general about 1 to 95%. 25 A vaccine which contains antigenic material of only one pathogen is a monovalent vaccine. Vaccines which contain antigenic material of several pathogens are combined vaccines and also belong to the present invention. Such combined vaccines contain, for example, material from various pathogens or from various strains of the same pathogen, or from combinations of various pathogens. 30 Immunogenicity can be significantly improved if the antigens are co administered with adjuvants, commonly used as 0.05 to 0.1 percent solution in phosphate-buffered saline. Adjuvants enhance the immunogenicity of an antigen 01/07619 PCT/CA00/00870 15 but are not necessarily immunogenic themselves. Adjuvants may act by retaining the antigen locally near the site of administration to produce a depot effect facilitating a slow, sustained release of antigen to cells of the immune system. Adjuvants can also attract cells of the immune system to an antigen depot and 5 stimulate such cells to elicit immune responses. Immunostimulatory agents or adjuvants have been used for many years to improve the host immune responses to, for example, vaccines. Intrinsic adjuvants, such as lipopolysaccharides, normally are the components of the killed or attenuated bacteria used as vaccines. Extrinsic adjuvants are immunomodulators which are 10 typically non-covalently linked to antigens and are formulated to enhance the host immune responses. Thus, adjuvants have been identified that enhance the immune response to antigens delivered parenterally. Some of these adjuvants are toxic, however, and can cause undesirable side-effects, making them unsuitable for use in humans and many animals. Indeed, only aluminum hydroxide and aluminum 15 phosphate (collectively commonly referred to as alum) are routinely used as adjuvants in human and veterinary vaccines. The efficacy of alum in increasing antibody responses to diphtheria and tetanus toxoids is well established and a HBsAg vaccine has been adjuvanted with alum. While the usefulness of alum is well established for some applications, it has limitations. For example, alum is 20 ineffective for influenza vaccination and inconsistently elicits a cell mediated immune response. A wide range of extrinsic adjuvants can provoke potent immune responses to antigens. These include saponins complexed to membrane protein antigens (immune stimulating complexes), pluronic polymers with mineral oil, killed 25 mycobacteria in mineral oil, Freund's complete adjuvant, bacterial products, such as muramyl dipeptide (MDP) and lipopolysaccharide (LPS), as well as lipid A, and liposomes. To efficiently induce humoral immune responses (HIR) and cell-mediated immunity (CMI), immunogens are typically emulsified in adjuvants. Many 30 adjuvants are toxic, inducing granulomas, acute and chronic inflammations (Freund's complete adjuvant) FCA, cytolysis (saponins and Pluronic polymers) and pyrogenicity, arthritis and anterior uveitis (LPS and MDP). Although FCA is an WO 01/07619 PCT/CA00/0087Q 16 excellent adjuvant and widely used in research, it is not licensed for use in human or veterinary vaccines because of its toxicity. Desirable characteristics of ideal adjuvants include: (1) lack of toxicity; 5 (2) ability to stimulate a long-lasting immune response; (3) simplicity of manufacture and stability in long-term storage; (4) ability to elicit both CMI and HIR to antigens administered by various routes, if required; (5) synergy with other adjuvants; 10 (6) capability of selectively interacting with populations of antigen presenting cells (APC); (7) ability to specifically elicit appropriate TH1 or TH2 cell-specific immune responses; and (8) ability to selectively increase appropriate antibody isotype levels (for 15 example, IgA) against antigens. U.S. Patent No. 4,855,283 granted to LockhofF et al on August 8, 1989 which is incorporated herein by reference thereto, teaches glycolipid analogues including N-glycosylamides, N-glycosylureas and N-glycosylcarbamates, each of which is substituted in the sugar residue by an amino acid, as immuno-modulators or 20 adjuvants. Thus, Lockhoff et al. (US Patent No. 4,855,283 and ref. 27) reported that N-glycolipid analogs displaying structural similarities to the naturally-occurring glycolipids, such as glycosphospholipids and glycoglycerolipids, are capable of eliciting strong immune responses in both herpes simplex virus vaccine and pseudorabies virus vaccine. Some glycolipids have been synthesized from long 25 chain-alkylamines and fatty acids that are linked directly with the sugars through the anomeric carbon atom, to mimic the functions of the naturally occurring lipid residues. U.S. Patent No. 4,258,029 granted to Moloney, assigned to the assignee hereof and incorporated herein by reference thereto, teaches that octadecyl tyrosine 30 hydrochloride (OTH) functioned as an adjuvant when complexed with tetanus toxoid and formalin inactivated type I, II and in poliomyelitis virus vaccine. Also, Nixon-George et al. (ref. 24), reported that octadecyl esters of aromatic amino acids WO 01/07619 PCT/CAOO/00870 17 complexed with a recombinant hepatitis B surface antigen, enhanced the host immune responses against hepatitis B virus. Lipidation of synthetic peptides has also been used to increase their immunogenicity. Thus, Wiesmuller (ref. 25) describes a peptide with a sequence 5 homologous to a foot-and-mouth disease viral protein coupled to an adjuvant tripalmityl-S-glyceryl-cysteinylserylserine, being a synthetic analogue of the N-terminal part of the lipoprotein from Gram negative bacteria. Furthermore, Deres et al. (ref. 26) reported in vivo priming of virus-specific cytotoxic T lymphocytes with synthetic lipopeptide vaccine which comprised of modified synthetic peptides 10 derived from influenza virus nucleoprotein by linkage to a lipopeptide, N-palmityl-S-2,3-bis(palmitylxy)-(2RS)-propyl-[R]-cysteine (TPC). 2. Immunoassays The about 200 kDa outer membrane protein of the present invention is useful as an immunogen for the generation of anti-200 kDa outer membrane protein 15 antibodies, as an antigen in immunoassays including enzyme-linked immunosorbent assays (ELISA), RIAs and other non-enzyme linked antibody binding assays or procedures known in the art for the detection of anti-bacterial, anti-Moraxella, and anti-200 kDa outer membrane protein antibodies. In ELISA assays, the about 200 kDa outer membrane protein is immobilized onto a selected surface, for example, a 20 surface capable of binding proteins such as the wells of a polystyrene microtiter plate. After washing to remove incompletely adsorbed about 200 kDa outer membrane protein, a nonspecific protein such as a solution of bovine serum albumin (BSA) that is known to be antigenically neutral with regard to the test sample may be bound to the selected surface. This allows for blocking of nonspecific adsorption 25 sites on the immobilizing surface and thus reduces the background caused by nonspecific bindings of antisera onto the surface. The immobilizing surface is then contacted with a sample, such as clinical or biological materials, to be tested in a manner conducive to immune complex (antigen/antibody) formation. This may include diluting the sample with diluents, 30 such as solutions of BSA, bovine gamma globulin (BGG) and/or phosphate buffered saline (PBS)/Tween. The sample is then allowed to incubate for from 2 to 4 hours, at temperatures such as of the order of about 20° to 37°C. Following incubation, the WO 01/07619 PCT/CAQO/00870 18 sample-contacted surface is washed to remove non-immunocomplexed material. The washing procedure may include washing with a solution, such as PBS/Tween or a borate buffer. Following formation of specific immunocomplexes between the test sample and the bound about 200 kDa outer membrane protein, and subsequent 5 washing, the occurrence, and even amount, of immunocomplex formation may be determined by subjecting the immunocomplex to a second antibody having specificity for the first antibody. If the test sample is of human origin, the second antibody is an antibody having specificity for human immunoglobulins and in general IgG. To provide detecting means, the second antibody may have an 10 associated activity such as an enzymatic activity that will generate, for example, a colour development upon incubating with an appropriate chromogenic substrate. Quantification may then be achieved by measuring the degree of colour generation using, for example, a visible spectrophotometer. 3. Use of Sequences as Hybridization Probes 15 The nucleotide sequences of the present invention, comprising the sequence of the about 200 kDa protein gene, now allow for the identification and cloning of the about 200 kDa protein gene from any species of Moraxella. The nucleotide sequences comprising the sequence of the about 200 kDa protein gene of the present invention are useful for their ability to selectively form 20 duplex molecules with complementary stretches of other about 200 kDa protein genes. Depending on the application, a variety of hybridization conditions may be employed to achieve varying degrees of selectivity of the probe toward the other genes. For a high degree of selectivity, relatively stringent conditions are used to form the duplexes, such as low salt and/or high temperature conditions, such as 25 provided by 0.02 M to 0.15 M NaCl at temperatures of between about 50°C to 70°C. For some applications, less stringent hybridization conditions are required such as 0.15 M to 0.9 M salt, at temperatures ranging from between about 20°C to 55°C. Hybridization conditions can also be rendered more stringent by the addition of increasing amounts of formamide, to destabilize the hybrid duplex. Thus, particular 30 hybridization conditions can be readily manipulated, and will generally be a method of choice depending on the desired results. In general, convenient hybridization temperatures in the presence of 50% formamide are: 42°C for a probe which is 95 to WO 01/07619 PCT/CAQO/00870 19 100% homologous to the target fragment, 37°C for 90 to 95% homology and 32°C for 85 to 90% homology. In a clinical diagnostic embodiment, the nucleic acid sequences of the about 200 kDa protein genes of the present invention may be used in combination with an 5 appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including radioactive, enzymatic or other ligands, such as avidin/biotin and digoxigenin-labelling, which are capable of providing a detectable signal. In some diagnostic embodiments, an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of a radioactive tag may 10 be used. In the case of enzyme tags, colorimetric indicator substrates are known which can be employed to provide a means visible to the human eye or spectrophotometrically, to identify specific hybridization with samples containing about 200 kDa protein gene sequences. The nucleic acid sequences of the about 200 kDa protein genes of the present 15 invention are useful as hybridization probes in solution hybridizations and in embodiments employing solid-phase procedures. In embodiments involving solid-phase procedures, the test DNA (or RNA) from samples, such as clinical samples, including exudates, body fluids (e. g., serum, amniotic fluid, middle ear effusion, sputum, bronchoalveolar lavage fluid) or even tissues, is adsorbed or otherwise 20 affixed to a selected matrix or surface. The fixed, single-stranded nucleic acid is then subjected to specific hybridization with selected probes comprising the nucleic acid sequences of the about 200 kDa protein encoding genes or fragments or analogs thereof of the present invention under desired conditions. The selected conditions will depend on the particular circumstances based on the particular criteria required 25 depending on, for example, the G+C contents, type of target nucleic acid, source of nucleic acid, size of hybridization probe etc. Following washing of the hybridization surface so as to remove non-specifically bound probe molecules, specific hybridization is detected, or even quantified, by means of the label. It is preferred to select nucleic acid sequence portions which are conserved among 30 species of Moraxella. The selected probe may be at least 18bp and may be in the range of about 30 to 90 bp. 01/07619 PCT/CA00/00870 20 4. Expression of the about 200 kDa Protein Gene Plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell may be used for the expression of the genes encoding the about 200 kDa protein in expression systems. The vector 5 ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli may be transformed using pBR322 which contains genes for ampicillin and tetracycline resistance and thus provides an easy means for identifying transformed cells. The plasmids or phage, must also contain, or be modified to contain, promoters which 10 can be used by the host cell for expression of its own proteins. In addition, phage vectors containing replicon and control sequences that are compatible with the host can be used as a transforming vector in connection with these hosts. For example, the phage in lambda GEM™-11 may be utilized in making recombinant phage vectors which can be used to transform host cells, such 15 as E. coli LE392. Promoters commonly used in recombinant DNA construction include the -lactamase (penicillinase) and lactose promoter systems and other microbial promoters, such as the T7 promoter system as described in U.S. Patent No. 4,952,496. Details concerning the nucleotide sequences of promoters are known, 20 enabling a skilled worker to ligate them functionally with genes. The particular promoter used will generally be a matter of choice depending upon the desired results. Hosts that are appropriate for expression of the about 200 kDa protein genes, fragments, analogs or variants thereof, may include E. coli, Bacillus species, Haemophilus, fungi, yeast, Bordetella, or the baculovirus expression system may be 25 used. In accordance with this invention, it is preferred to make the protein by recombinant methods, particularly when the naturally occurring about 200 kDa protein as purified from a culture of a species of Moraxella may include trace amounts of toxic materials or other contaminants. This problem can be avoided by 30 using recombinantly produced protein in heterologous systems which can be isolated from the host in a manner to minimize contaminants in the purified material. Particularly desirable hosts for expression in this regard include Gram positive WO 01/07619 PCT/CA00/00870 21 bacteria which do not have LPS and are, therefore, endotoxin free. Such hosts include species of Bacillus and may be particularly useful for the production of non-pyrogenic about 200 kDa protein, fragments or analogs thereof. BIOLOGICAL DEPOSITS 5 Certain plasmids that contain portions and full-length of the gene having the open reading frame of the gene encoding the about 200 kDa outer membrane protein of M. catarrhalis strain 4223 that are described and referred to herein have been deposited with the America Type Culture Collection (ATCC) located at 10801 University Blvd., Manassas, VA 20110-2209, U.S.A., pursuant to the Budapest 10 Treaty and pursuant to 37 CFR 1.808 and prior to the filing of this application. Samples of the deposited plasmids will become available to the public upon grant of a patent based upon this United States patent application or relevant precursor applications. The invention described and claimed herein is not to be limited in scope by plasmids deposited, since the deposited embodiment is intended 15 • only as an illustration of the invention. Any equivalent or similar plasmids that encode similar or equivalent antigens as described in this application are within the scope of the invention. Plasmid ATCC Designation Date Deposited pKS47 97,111 April 7,1995 20 pKS5 97,110 April 7,1995 pKS9 97,114 Aprill8,1995 pKS294 203,528 December 17,1998 pKS348 203,529 December 17,1998 EXAMPLES 25 The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific Examples. These Examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. 30 Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitations. WO 01/07619 PCT/CA00/00870 22 Methods of molecular genetics, protein biochemistry, and immunology used . but not explicitly described in this disclosure and these Examples are amply reported in the scientific literature and are well within the ability of those skilled in the art. Example 1 5 This Example describes the cloning of a gene encoding the M. catarrhalis 200 kDa outer membrane protein. A M. catarrhalis genomic library in phage lambda EMBL3 was prepared as described in Example 9 of USP 5,808,024 and WO 96/34960 and was screened using guinea pig anti-200 kDa protein antiserum. A lambda phage clone 811, which 10 expressed an about 200 kDa protein, was confirmed by immunoblotting of the phage lysate using the about 200 kDa outer membrane-specific antiserum. Plate lysate cultures of this recombinant phage were prepared. The DNA was extracted from the plate lysates using a Wizard Lambda Preps DNA Purification System (Promega Corp, Madison, WI) according to the manufacturer's instructions. 15 This phage clone carried a DNA insert of about 16 kb in size (the restriction map for which is shown in Figure 1). The phage DNA was digested with a mixture of the restriction enzymes Sail and Xhol, and separated by agarose gel electrophoresis. Two DNA bands, approximately 5 kb and 11 kb in size, respectively, were cut out from the gel and extracted using a Geneclean kit (BIO 101 Inc., LaJolla, CA) 20 according to the manufacturer's direction. The smaller 5 kb fragment was ligated into a plasmid vector, pBluescript II SK +/- (Stratagene Cloning Systems, LaJolla, CA), which had been previously digested with Sail and Xhol, to produce plasmid pKS5. The larger 11 kb fragment was ligated into a plasmid vector, pSP72 (Promega Corp., Madison, WI), digested 25 with Sail and Xhol, to produce plasmid pKS9. Both ligated plasmids were used to transform E. coli, strain DH5. The lambda phage DNA was also digested with a mixture of Xhol and Kpnl and the approximately 1.1 kb fragment was isolated after agarose gel separation as described above. This 1.1 kb fragment was ligated into a plasmid vector, pGEM-30 7Zf(+) (Promega Corp., Madison, WI), to produce plasmid pKS47. WO 01/07619 PCT/CAOQ/00870 23 Example 2 This Example describes the isolation of chromosomal DNA from M. catarrhalis for use in PCR amplification. M. catarrhalis was cultured in 25 ml of BHI broth overnight and centrifuged 5 at 5,000 rpm for 10 min. The bacteria pellet was suspended in 10 ml of 10 mM Tris/HCl (pH 8.0) containing 100 mM EDTA and mixed with RNaseA (final concentration: 100 jag/ml) and lysozyme (final concentration: 1 mg/ml). After incubation on ice for 10 min and at room temperature for 50 min, the suspension was gently mixed with 1 ml of 10% SDS and then heated at 65 °C for 20 min. The 10 suspension was mixed with proteinase K (final concentration: 200 |ig/ml) and incubated at 50°C for 1 h. The suspension was gently mixed with 10 ml chloroform on a nutator for 15 min and centrifuged at 5,000 ipm for 10 min. The upper phase was slowly removed with a wide-bore pipette and mixed with 10 ml of Tris-saturated phenol and 10 ml of chloroform on a nutator. After centrifugation at 5,000 15 ipm for 10 min, the upper phase was re-extracted with a mixture of Tris-saturated phenol and chloroform, again, and then extracted with chloroform, and then twice dialyzed against 1M NaCl at 4°C and twice against TE buffer (pH 8.0) at 4°C. Example 3 This Example describes subcloning and sequence analysis of fragments of 20 the 200 kDa protein gene from M. catarrhalis strain 4223. The procedures used to produce a phage ?JEMBL3 clone 811, and its subclones, pKS5, pKS9 and pKS47, are described in USP 5,808,024 and WO 96/34960. pKSlO was constructed from the XJEMBL3 clone 811 exactly as described for pKS9. pKS59 and pKS63 were constructed by insertion of a 1.4 kb Xbal-Ncol 25 fragment of pKS9 into pGEM5Z(+) that had been digested with Ncol and SpeI. pKS71 was made by insertion of the same 1.4 kb Xbal-Ncol fragment, isolated from the XEMBL3 clone 811 into pGEM5Z(+). Sequence analysis confirmed that all three plasmids, pKS59, pKS63 and pKS71, carried identical DNA fragments. Figure 1 shows partial restriction maps for the plasmids. 30 The full sequence of the 200 kDa gene locus from the ?J3NA clone was described in USP 5,808,024 and WO 96/34960 and is shown in Figure 2. There is a tract of 10 consecutive G nucleotides between position 623 and 632 in clones WO 01/07619 PCT/CAOO/00870 24 derived from the >. library. The first possible start codon is, therefore, located at nucleotides 706 to 708 and is a GTG encoding a valine, boxed lightly in Figure 2. A series of strains expressing a 200 kDa gene, were identified by immunoblot analysis and the 5' end of their 200 kDa genes was PCR amplified and sequenced. A 5 summary of the findings is shown in Table 5 wherein the expression level of the gene appeared to be related to the number of G nucleotides in the tract and for those strains within higher expression levels, the start codon was an ATG upstream of the GTG codon identified from the 4223 A, clones. Based upon these findings, the sequence of the 5' end of the 200 kDa gene from strain 4223 was re-examined. 10 Plasmids pKS9 and pKSlO were directly derived from the X clone. The subclones pKS59 and pKS63 were derived from pKS9 whereas pKS71 contained the same fragment derived directly from the X clone. All of these plasmids contained 10 G nucleotides in the G tract, as described previously. To determine whether the X clone contained an extra G nucleotide or the strain itself contained an aberrant gene, 15 PCR amplification of the region was performed from chromosomal DNA preparations and from the X subclones. The data in Table 3 show that PCR fragments of the X subclones all contained 10 G nucleotides. The data in Table 4, however, demonstrate that PCR fragments derived directly from chromosomal DNA, contain 9 G nucleotides in the tract. When the single extra G nucleotide is 20 removed from the 200 kDa sequence of strain 4223, the open reading frame is extended in the 5' direction to start from an ATG codon 156 nucleotides earlier, at positions 541 to 543 in Figure 2. This new start codon corresponds to that suggested for the 200 kDa genes sequenced from other strains and summarized in Table 5. Example 4 25 This Example describes the construction of the full length 200 kDa protein gene from M. catarrhalis strain 4223. The construction scheme is shown in Figure 9. The full-length 200 kDa protein gene was constructed from the new ATG start codon identified by analysis of the chromosomally derived DNA as described 30 in Example 3 and shown in Figure 3. pKS47 was digested with Xhol and KpnI and separated by agarose gel electrophoresis. The 1.1 kb fragment was isolated from the gel and inserted into pKS5, which had previously been digested with the same two WO 01/07619 PCT/CAOO/00870 25 enzymes and purified to fonn pKS80. An about 5.8 kb PstI fragment from pKS80 was inserted into pT7-7 vector (ref. 28) that had been digested with PstI and dephosphorylated. The orientation of the insert was determined by restriction enzyme analysis and pKS 122 was chosen for further construction (see Figure 7). 5 The 5' region of the 200 kDa protein gene was amplified from strain 4223 chromosomal DNA. PCR reactions were performed using Taq Plus or Tsg Plus enzyme (Sangon Ltd., Scarborough, Ont., Canada) and a Perkin Elmer DNA Theimocycler (Perkin Elmer Cetus, Foster City, CA, USA). The lower PCR reaction mixture (50 pi) contained 5 pi of 10X buffer, 0.4 mM each of four deoxynucleotide ^ 10 triphosphates (Perkin Elmer, Foster City, CA, USA) and 1 to 2 pM each of two primers. The upper PCR reaction mixture (50 jjM) contained 5 pi of 10X buffer, 0.5 to 1 (j.1 of Taq Plus or Tsg Plus enzyme, and template DNA. The lower and upper mixtures were separated by a layer of AmpliWax PCR Gem50 (Perkin Elmer, Foster City, CA, USA) before heating cycles started. The thermocycling condition 15 employed for the provision of PCR products in the construction of various plasmids are set forth in Table 11 below. The PCR products were purified using a QIAquick PCR purification kit (Qiagen Inc., Mississauga, Ont., Canada). The purified PCR products were sequenced on both strands directly and/or after cloning in appropriate vectors using an Applied Biosystem sequencer. 20 The 5' primer (designated 5295.KS) was designed, so that it contained the ^ first possible translation start codon, ATG, and its flanking sequences with a mutation to introduce an Ndel site at the ATG. The 3' primer (designated 4260.KS) was based upon the non-coding strand in the region about 1 kb downstream from the ATG start codon. (The nucleic acid sequences and SEQ ID's of the PCR primers 25 utilized herein are identified in Table 10). The PCR-product was digested with Ndel and an approximately 650 bp DNA fragment was gel purified and inserted into pKS 122, which had previously been linearized with Ndel and dephosphorylated. The new construct, designated pKS294 (Figure 8), was confirmed by restriction enzyme analyses and by sequencing of the PCR-amplified DNA and its 30 joint regions. The number of G nucleotides in the G tract was nine, and the open reading frame continued from the newly found translation start codon, ATG, to the remaining portion of 200 kDa protein gene in pKSl22. pKS294, therefore, carried WO 01/07619 PCT/CA00/00870 26 the correct, full-length 200 kDa protein gene from Moraxella catarrhalis strain 4223. During construction of pKS294, E. coli strain DH5a was used for transformation and plasmid analyses. Example 5 5 This Example describes the cloning and sequence analysis of genes encoding the 200 kDa protein from additional M. catarrhalis clinical isolates. A panel of M. catarrhalis clinical isolates was analysed by immunoblot with guinea pig anti-200 kDa antibody, as described in USP 5,808,024 and WO 96/34960. From these analyses, it was evident that there is size heterogeneity among 10 the 200 kDa proteins from various strains. In order to assess the possible genetic heterogeneity, representative strains were chosen for gene cloning. Strain Q8 is a naturally occurring relatively non-clumping strain that produces a 200 kDa protein of about the same size as the 4223-derived protein. Strain LES-1 produces a larger 200 kDa protein. These strains were also selected based upon bactericidal antibody 15 data as illustrated in Table 1. The 200 kDa genes were cloned from these two strains of M. catarrhalis and sequenced. The nucleotide and derived amino acid sequences of the 200 kDa genes from strains Q8 and LES-1 are shown in Figures 4 and 5 respectively. An alignment of the amino acid sequences with the 4223-derived sequence is shown in Figure 6. As 20 can be seen, the first 68 residues of the N-terminus are quite conserved, especially between strains 4223 and Q8. In addition, the final 456 residues of the C-terminus are nearly identical among the three strains. The remainder of the sequence has regions of high homology and significant diversity, including an insert of more than 300 residues for strain LES-1. 25 The N-terminal sequence of the 200 kDa proteins is homologous to the H. influenzae Hia and Hsf proteins, as well as other high molecular weight proteins or adhesins, such as AID A (ref. 33). The C-terminal region also has some homology to H. influenzae Hia and Hsf proteins as do some stretches of internal sequence. There is also some homology in 30 the C-tenninal region to UspA (ref. 23). A further indication of the relatedness of this family of proteins, is the finding that guinea pig anti-200 kDa antibody raised to gel-purified native protein was able to recognize recombinant Hia protein by WO 01/07619 PCT/CA00/00870 27 immunoblot. This data has been described in copending United States Patent Application No. 09/268,347 filed March 16, 1999, assigned to the assignee hereof and the disclosure of which is incorporated herein by reference. Example 6 5 This Example shows the expression of the full-length about 200 kDa protein from pKS294. E. coli strain, BL21(DE3)/pLysS was transformed by electroporation with pKS294, prepared as described in Example 4, for the expression study of the full-length 200 kDa protein gene. 10 The product of the pKS294 construct was found to be toxic to the host E. coli. At room temperature, the BL21(DE3)/pLysS transformants grew very slowly on LB-agar plates containing ampicillin (Amp) and chloramphenicol (Cm) and at 37°C, no transformants were detected. When the transformants which grew at room temperature, were cultured overnight at 30°C on BHI agar containing the two 15 antibiotics and glucose, they grew well, producing colonies with a normal size. However, when these clones were cultured overnight in liquid medium at 30°C, subcultured into broth without glucose, and then induced by addition of IPTG, no recombinant protein was found on Western blot using anti-200 kDa protein serum. When the cells cultured overnight were examined before subculturing, a small 20 quantity of recombinant 200 kDa protein was detected by SDS-PAGE stained with Coomassie Blue and by Western blot, showing that the gene was expressed during the overnight culture. When E. coli strain, DH5a, which cannot express the gene under the control of a T7 promoter, was transformed with pKS294, the transformants grew well at 25 37°C both on LB-agar and in LB-broth containing the antibiotics. These results suggest that the gene product is very toxic to host E. coli, and that even a basal level of expression of the full-length 200 kDa protein gene from the ATG is lethal to E. coli. M. catarrhalis strain LES-1 also produced similar toxicity in E. coli when 30 the full length 200 kDa protein was expressed. WO 01/07619 PCT/CA00/Q0870 28 Example 7 This Example describes the deletion of a short 5'-sequence from the strain 4223 or strain LES-1 200 kDa protein gene and expression of the truncated genes producing a M56 r200 kDa product. 5 The deletion of a short 5' region from the strain 4223 200 kDa protein gene is shown in Figure 10 and was performed using a similar approach as described in Example 4. An about 500 bp 5' region of the 200 kDa gene was PCR amplified from strain 4223 using primers 5471.KS and 4257.KS (Table 8) from chromosomal DNA. The 5' primer (designated 5471.KS) was based upon the region surrounding 10 the previously identified GTG downstream start codon. In primer 5471.KS, the flanking regions around the GTG codon were incorporated and the GTG was mutated to ATG with further mutations used to introduce an Ndel site incorporating the new ATG. Using numbering from the full-length 200 kDa protein, the new start codon would be M56 replacing the previous V56 codon. The 3' primer (designated 15 4257.KS) was based upon the non-coding strand located about 500 bp downstream from the GTG codon in the 200 kDa protein gene. The PCR-product was digested with Ndel, purified using a QIAquick PCR purification kit (Qiagen Inc., Mississauga, Ont.), and inserted into Ndel digested and dephosphorylated pKS122 to provide pKS348 (see Figure 7). Plasmid pKS348 was confirmed by restriction 20 enzyme analyses and by sequencing of the PCR-amplified DNA piece and its joint regions. The nucleotide sequence (SEQ ID No: 12) and the deduced amino acid sequence (SEQ ID No: 13) for the 5'-truncation contained in pKS348 are shown in Figure 8. A similar N-terminal truncated 200 kDa gene from strain LES-1 was generated in the same manner and was designated pKS444. 25 A single colony of E. coli, BL21(DE3)/pLysS, (KS358) which carried pKS348, was suspended in 5 ml of BHI broth containing Amp (100 pM), Cm (50 pM) and 0.4% of glucose, and cultured overnight at 37°C. To study the kinetics of expression, 2.5 ml of the overnight culture was added to 250 ml of LB (Luria-Bertani) broth containing Amp (100 pM) and Cm (50 pM), and grown with shaking 30 at 37°C to A^ = 0.33 to 0.36. Another 0.3 ml of the overnight culture was added to 30 mL of LB broth containing Amp (i00 pM) and Cm (50 pM) and grown with shaking at 37°C to A«o = 0.26 to 0.44. Gene expression from the cultures was 01/07619 PCT/CA00/00870 29 induced by addition of IPTG (final concentration: 4 mM). The bacteria were grown and harvested at different time points by centrifugation. The expression of the 200 kDa protein gene in the culture was confirmed by SDS-PAGE analysis using Coomassie Blue staining and by Western blot analysis using guinea pig anti-200 5 kDa protein serum, as described in USP 5,808,024 and WO 96/34960. When E. coli BL21(DE3)/pLysS was transformed with pKS348, transformants grew well even on LB agar plates and in LB broth containing antibiotics at 37°C. Alter induction with IPTG, these clones produced a large amount of the N-terminally truncated r200 kDa protein which was clearly seen by 10 SDS-PAGE Coomassie Blue stain, as shown in Figure 12. The bacterial culture induced at A^oo= 0.26 produced slightly more truncated r200 kDa protein than the culture induced when the OD reading was 0.44. The largest amount of truncated r200 kDa protein was seen at 3 hr after induction. Similar results were observed for the M56 r200 kDa expression from strain LES-1. 15 Example 8 This Example describes the purification of the M56 r200 kDa proteins from strain 4223 or LES-1, according to the procedure shown in Figure 11. E. coli cell pellets were obtained from 500 ml culture prepared as described in Example 7, by centrifugation and were resuspended in 50 ml of 50 mM Tris-HCl, 20 pH 8.0, containing 0.1 M NaCl, and disrupted by sonication. The sonicate was centrifuged at 20,000 xg for 30 min. and the resultant supernatant (supl) was discarded. The pellet (pptl) was extracted, in 50 ml of 50 mM Tris-HCl, pH 8.0 containing 0.5% Triton X-100 and 10 mM EDTA, then centrifuged at 20,000 xg for 30 min. and the supernatant (sup2) was discarded. The pellet (ppt2) was further 25 extracted in 50 ml of 50 mM Tris-HCl, pH 8.0, containing 1% octylglucoside, then centrifuged at 20,000 xg for 30 min. and the supernatant (sup3) was discarded. The resultant pellet (ppt3) contained the inclusion bodies. The pellet was solubilized in 6 ml of 50 mM Tris-HCl, pH 8.0, containing 6 M guanidine and 5 mM DTT. Twelve ml of 50 mM Tris-HCl, pH 8.0 was added, the mixture 30 centrifuged at 20,000 xg for 30 min, and the pellet (ppt4) discarded. The supernatant (sup4) was precipitated by adding polyethylene glycol (PEG) 4000 at a final concentration of 5% and incubated at 4°C for 30 min. The resultant pellet (ppt5) was WO 01/07619 PCT/CAOO/00870 30 removed by centrifugation at 20,000 xg for 30 min. The supernatant was then precipitated by (NH4)2S04 at 50% saturation at 4°C overnight. After the addition of (NH4)2S04, the solution underwent phase separation with protein going to the upper phase (as judged by the cloudiness of the layer). The upper phase was collected, then 5 subjected to centrifugation at 20,000 xg for 30 min. The resultant pellet was collected and dissolved in 2 ml of 50 mM Tris-HCl, pH 8.0, containing 6 M guanidine and 5 mM DTT. The clear solution was purified on a Superdex 200 gel filtration column equilibrated in 50 mM Tris-HCl, pH 8.0, containing 2 M guanidine HC1. The fractions were analysed by SDS-PAGE and those containing ^ 10 the purified r200 kDa were pooled. The pooled fraction was concentrated 5 to 10 fold using a centriprep 30 and then dialysed overnight at 4°C against PBS, and centrifuged at 20,000 xg for 30 min to clarify. The protein remained soluble under these conditions and glycerol was added to the M56 r200 kDa preparation at a final concentration of 20% for storage at -20°C 15 (Figure 12). The average yield of the purified M56 r200 kDa protein is about 10 mg L'1 culture. The purified protein was used for the immunization of animals, as described below. The procedure of this Example 8 and was repeated for M. catarrhalis strain LES-1 and a corresponding r200 kDa protein was produced. The N-terminal 20 truncated M56 r200 kDa protein from strain LES-1 gave approximately the same recovery of purified protein as described above for strain 4223. Example 9 This Example illustrates the immunogenicity of the M56 r200 kDa protein. The immunogenicity of M56 r200 kDa, prepared as described in Example 8, 25 was examined using mice and guinea pigs. Groups of five BALB/c mice (Charles River, Quebec) were immunized sub-cutaneously (s.c.) on days 1, 29 and 43 with 0.3,1.3 and 10 pg of4223 M56 r200 kDa antigen, prepared as described in Example 8, in the presence of AiPCX, (1.5 mg per dose). Blood samples were collected on days 0,14,28,42 and 56. 30 Groups of five guinea pigs (Charles River, Quebec) were immunized i.m. on days 1,29 and 43 with 25, 50 and 100 jig of 4223 M56 r200 kDa antigen prepared WO 01/07619 PCT/CAOO/00870 31 as described in Example 8, in the presence of A1P04 (1.5 mg per dose). Blood samples were collected on days 0,14,28,42 and 56. Anti-M56 r200 kDa IgG titers were determined by antigen-specific enzyme-linked immunosorbent assays (EIAs). Microtiter wells (Nunc-MAXISORP, Nunc, 5 Denmark) were coated with 50 pL of protein antigen (0.2 jig mL'1). The reagents used in the assays were as follows: affinity-purified F(ab')2 fragments of goat anti-mouse IgG (Fc-specific) conjugated to horseradish peroxidase (Jackson ImmunoResearch Labs, Mississauga, Ontario); affinity-purified guinea pig anti-IgG antibody (1 pg mr')(prepared by the inventors); and affinity-purified F(ab')2 10 fragment of goat anti-guinea pig IgG (H+L) antibodies conjugated to horseradish peroxidase (HRP) (Jackson ImmunoResearch Laboratories) used as a reporter. The reactions were developed using tetramethylbenzidine (TMB/H202, ADI, Mississauga, Ontario) and absorbancies were measured at 450 nm (using 540 nm as a reference wavelength) in a Flow Multiskan MCC microplate reader (ICN 15 Biomedicals, Mississauga, Ontario). The reactive titer of an antiserum was defined as the reciprocal of the dilution consistently showing a two-fold increase in absorbance over that obtained with the pre-bleed serum sample. The mice generated dose-dependent anti-M56 r200 kDa antibody responses, as shown in Figure 14. These results clearly show that the protein remained 20 immunogenic after inclusion bodies extraction, solubilization and purification. Only a slight difference in the antibody titers were found for the higher dose range tested in guinea pigs (Figure 15), indicating that the amount of antigen used was nearly at saturation. Example 10 25 This Example describes the . generation of hyper-immune sera against the M56 r200 kDa proteins in rabbits and guinea pigs. To generate hyper-immune sera against M56 r200 kDa proteins, groups of two rabbits and two guinea pigs (Charles River, Quebec) were immunized intramuscularly (i.m.) on day 1 with a 5 jig dose of purified M56 r200 kDa protein, 30 prepared as described in Example 8, emulsified in complete Freund's adjuvant (CFA). Animals were boosted on days 14 and 29 with the same dose of protein emulsified in incomplete Freund's adjuvant (IFA). Blood samples were taken on day 01/07619 PCT/CAOO/00870 32 42 for analyzing the' anti-M56 r200 kDa antibody titers and bactericidal activities. Anti-r200 kDa IgG titers were determined by antigen-specific enzyme-linked immunosorbent assays (EIAs), as described in Example 9. The results obtained in the two animals using r200 kDa protein from strains 4223 and LES-1 are illustrated 5 in Table 6. Example 11 This Example describes a bactericidal antibody assay. The bactericidal antibody activity of guinea pig anti-M56 r200 kDa sera from 4223 or LES-1 protein prepared as described in Example 10 against various 10 strains of M. catarrhalis was estimated using a viability plating assay. Each test strain of M. catarrhalis was cultured overnight in brain heart infusion (BHI) broth (Difco Laboratories, Detroit, MI) at 37°C. The overnight culture was subcultured into 10 ml BHI broth, and grown to an absorbance at 578 nm of 0.5. The number of bacteria at A^j = 0.5 changes from strain to strain. Therefore, several ten-fold 15 dilutions of each strain were used in order to achieve 100 to 300 colonies per plate for the preimmune serum group. Bacteria were diluted in Veronal buffered saline (VBS, pH 7.6) containing 140 mM NaCl, 93 mM NaHC03,2 mM Na-baibiturate, 4 mM barbituric acid, 0.5 mM MgCl2.6H20, 0.4 mM CaCl2.2H20, and 0.1% bovine serum albumin. Guinea pig anti-M56 r200 kDa serum and pre-immune control 20 serum were heated at 56°C for 30 min. to inactivate endogenous complement. Serum and antiserum were diluted in VBS, and placed on ice. Twenty-five pi of diluted pre-immune serum or test antiserum were added to the wells of a 96-well Nunclon microtitre plate (Nunc, Roskilde, Denmark). Twenty-five pi of diluted bacterial cells were added to each of the wells. A guinea pig 25 complement (BioWhittaker, Walkerville, MD) was diluted 1:10 in VBS, and 25 pi portions were added to each well. The plates were incubated for 60 min, gently shaking at 70 rpm on a rotary platform. Fifty pi of each reaction mixture were plated onto Mueller Hinton agar plates (Becton-Dickinson, Cockeysville, MD). The plates were incubated at 37°C for 24 hours, and thai left at room temperature for a further 30 24 hours. The number of colonies per plate was counted,, and average values of colonies per plate were estimated from duplicate pairs. 01/07619 PCT/CAOO/00870 33 When pre-immune serum plates were compared with PBS control plates (no serum), pre-immune serum had no bactericidal effect on the homologous strain 4223. Therefore, it was assumed that the number of colonies per plate on pre-immune serum plates represented 100% viability for each strain and percent 5 bactericidal killing was calculated as follows: When the bactericidal antibody activity of the 4223 anti-M56 r200 kDa antiserum was examined against the homologous strain (Table 7), 50% killing was observed at a serum dilution between 1/512 and 1/1024, showing that the antiserum raised against M56 r200 kDa protein possesses bactericidal antibody activity. Next, 10 the bactericidal antibody activity of the antiserum was tested at a dilution of 1/64 against a total of 55 different strains, which were isolated from otitis media patients in various geographical locations (Table IB). The antiserum raised against the M56 r200 kDa protein from strain 4223 showed more than 30% bactericidal antibody activity against 38 out of 56 (68%) strains examined. When LES-1 anti-M56 r200 15 kDa antibody was tested in the bactericidal antibody assay, 36/55 (65%) strains were killed, including 11 strains that were not killed by the 4223 anti-M56 r200 kDa antibody. Only six strains out of 55 strains examined were not killed by either one of the two antisera. These results indicate that the 200 kDa protein is a very good candidate for inclusion in an otitis media vaccine. 20 Example 12 This Example describes the inhibition of binding of M. catarrhalis strains to either Chang or Hep-2 epithelial cells by 4223 anti-M56 r200 kDa serum. The 200 kDa protein had previously been proposed to be an adhesin on the basis of its apparent absence from a spontaneous non-clumping variant of strain 25 4223. This strain, obtained by serial passaging of culture supematants, was designated RH408 and is described in WO 96/34960. Electron microcopy also suggested that the 200 kDa protein was an adhesin. The sequence homology demonstrated between the M. catarrhalis 200 kDa proteins and other high molecular weight adhesins from different organisms, also suggested that it was an adhesin. 30 Based upon these observations, an assay was developed to try to demonstrate that WO 01/07619 PCT/CAOO/00870 34 anti-T200 kDa antibody could block adherence between M. catarrhalis and epithelial cells, thus identifying it definitively as an adhesin. On day 1, 24 well tissue culture plates were seeded with approximately 3 x 105 Chang cells per well, to achieve a confluent monolayer following overnight 5 incubation at 37°C in the presence of 5% C02. M. catarrhalis 4223 or Q8 was cultured in 10 ml of BHI broth at 37°C for 18 hr, shaking at 200 rpm. On day 2, bacterial cultures were pelleted by centrifugation at 3500 rpm for 10 min, and washed with 10 ml of PBS. After a centrifugation as above, each pellet was resuspended in 2 ml of DMEM supplemented with 10% FBS and 2 mM 10 glutamine. The bacteria cultures were diluted 1/10 in the supplemented DMEM to OD of approximately 1.8 at 578 nm. Confluent monolayers of Chang cells were washed once with 1 ml of PBS per well, and 0.5 ml of 10% BSA in PBS was added to each well as a blocking agent. Plates were incubated at 37°C for 30 min and monolayers were washed twice with PBS as above. 15 A guinea pig anti-4223 M56 r200 kDa, antiserum, prepared as described in Example 10 and pooled pre-immune guinea pig sera were heated at 56°C for 30 min to inactivate endogenous complement. Equal volumes of appropriately diluted antisera and bacteria were mixed, and 200 pi of the mixture were added into each well. Examples of antiserum dilutions tested included 1/4, 1/16 and 1/64. The plate 20 was incubated at 37°C for 1 hr, with gentle shaking. The plate was carefully washed four times with 1 ml of PBS per well to remove the bacteria. To each well, 100 pi of trypsin were added, and the plate was incubated at 37°C for 5 min. After inactivation of trypsin by addition of 900 pi Dulbecco's Minimal Essential Medium (DMEM) to each well, the cells were resuspended by pipetting up and down several times. 25 Ten-fold dilutions of resuspended cells were prepared in a new 96-well plate. Fifty pi each of the 1 x 10"2, 1 x 10"3, 1 x 10"4 and 1 x 10"5 diluted samples were plated on a Mueller-Hinton agar plate. Plates were incubated at 37°C overnight, and then left at room temperature for a further 24 hours. The number of colonies per plate was counted for the estimation of the total bound bacteria. 30 Dilution plating was also carried out for each bacterial strain, to estimate bacterial concentrations and to calculate the total amount of bacteria added to each well. It was assumed that the number of bacteria bound to tissue culture cells in the WO 01/07619 PCT/CAOO/00870 35 presence of pre-immune sera represented 100% optimal binding for each assay, and 0% inhibition. Therefore, in order to calculate the percent inhibition of the antiserum, we used the following formula: %inhibition=100- total bacteria bound in 4223 anti-r200 kDa antiserum samples x 100 I total bacteria bound in pre-immune sera samples _] When the guinea pig 4223 anti-M56 r200 kDa protein serum was examined 5 for the inhibition of binding of strain 4223 to Chang cells (Table 8), inhibition of 98%, 92% and 83% was observed at antiserum dilutions of 1/4, 1/16 and 1/64, respectively. With the heterologous strain Q8, the inhibition ofbinding to the tissue culture cells was estimated to be 77%, 82% and 55% at antiserum dilutions of 1/4, 1/16 and 1/64, respectively. The results clearly showed that anti-M56 r200 kDa 10 protein serum inhibited the binding of M. catarrhalis to cultured human epithelial cells. Having demonstrated that 4223 anti-M56 r200 kDa antibody could block adherence of M. catarrhalis strains 4223 or Q8 to Chang epithelial cells in a dose-dependent manner, the studies were extended to other strains. Of particular interest, 15 were those strains that were not killed by anti-M56 r200 kDa antisera in the bactericidal antibody assay. To perform the in vitro adherence assay on several strains, a single antibody dilution of 1/16 was used. The data for inhibition of in vitro adherence to Hep-2 cells is summarized in Table 9. The procedure for the Hep-2 epithelial cells was identical to the Chang cell procedure described above. The 20 4223 anti-M56 r200 kDa antibody effectively blocked adherence of the homologous strain by 48%. Strain RH408 does not express the 200 kDa gene and in the assay, antibody inhibited adherence of RH408 to 9%. This would be assumed to be a background level. Of 20 strains tested, 16 were inhibited at rates higher than 9%. Among these strains were 19 strains that had not been killed by the 4223 anti-M56 25 r200 kDa antibody. To summarize and as shown in Tables 1, 8 and 9, in our collection of 89 strains of Moraxella catarrhalis, 80 express 200 kDa. Of 57 strains tested with 4223 anti-M56 r200 kDa antibody in the bactericidal antibody assay, 39 were killed (58%). An additional 15 strains were inhibited from binding to epithelial cells by the 30 same antibody for a total of 54 strains (95%), against which a single antibody was WO 01/07619 PCT/CA00/00870 36 effective. These data demonstrate the very high potential of r200 kDa proteins as vaccine antigens. Example 13 This Example describes the sequence analysis of the 200 kDa protein gene 5 from M. catarrhalis strain RH408, the non-clumping variant of 4223 described in WO 96/34960. As described in Example 4 and Table 5, it appeared that the number of G nucleotides in the G tract had a regulatory function on the expression of the 200 kDa gene. M. catarrhalis strain 4223 and its non-clumping derivative RH408 appeared to 10 differ only in the expression of the 200 kDa gene. The 200 kDa gene from strain RH408 was subcloned and sequenced and its sequence compared to the parental gene from strain 4223. Four partially overlapping fragments of the 200 kDa protein gene were PCR amplified from strain M. catarrhalis RH408, using primers illustrated in Figure 16 15 and Table 10, under the conditions set out in Table 11. The combined sequences of the four PCR products covered approximately 6.5 kb including the entire 200 kDa protein gene and its flanking regions. When the sequence of the 6.5 kb fragment was compared with the sequence of the same region from its parent strain 4223, the only difference was the number of G nucleotides in the G tract. As described in Example 20 4, the correct number of G nucleotides in the G tract was nine. However, the number G nucleotides in the G tract of RH408 was only eight. This result, along with the analysis of this region in 24 other strains of M. catarrhalis (Table 5) strongly suggests that the number of G nucleotides in the G tract controls the expression of the 200 kDa gene in M. catarrhalis strains. Similar 25 mechanisms of transcriptional control are found for other bacterial genes, such as the N. gonorrhehoae Pile gene (ref. 32). Example 14 This Example describes the generation of additional N-terminal truncated r200 kDa proteins and expression studies. 30 As described in Example 6, the full-length r200 kDa protein appeared to be toxic to E. coli and could not be expressed under normal induction conditions. The M56 r200 kDa proteins were readily expressed, as described in Example 7, and were 01/07619 PCT/CAO0/OO87O 37 subsequently shown to be highly promising vaccine candidates in in vitro assays (Examples 11 and 12). The expression of r200 kDa proteins of intermediate length and their properties was studied. Three additional N-terminal truncated 200 kDa genes were constructed from 5 the 4223 200 kDa gene using the procedures described in Example 7. The sites of truncation were chosen based upon and are illustrated in Figure 17. The arrows in Figure 17 indicate the sites of truncation, namely ALA12, VAL19 and GLY39, each modified to MET. A 5' fragment up to an internal site was PCR amplified using primers illustrated in Table 8. For the ALA12 truncation, the primers were 5' 10 6242.KS and 3' 4257.KS, for the VAL19 truncation, the primers were 5' 6243.KS and 3' 4257.KS and for the GLY39 truncation, the primers were 5' 6244.KS and 3' 4257.KS (Table 10). The amplification conditions were the same as those used for pKS348 (Table 11). The PCR products were restricted with Ndel and ligated into the Ndel sites of pKS348 for expression. While some expression of r200 kDa was 15 obtained with each of the N-terminal truncations, the level did not approach the levels obtained using pKS348. Example 15 This Example illustrates the construction of plasmids pQWE and pQWF expressing C-terminal fragments of the 200 kDa gene. 20 As shown iu the amino acid comparison of Figure 6, the carboxy half of the 200 kDa protein in quite conserved, the main difference being a large approximately 300 amino acid residue insert in strain LES-1. Since so much cross-reactivity for the anti-M56 r200 kDa antisera had been observed, the conserved caiboxy half of the protein was expressed. 25 Plasmid pKS348 prepared as described in Example 7 was digested with restriction enzymes, Nde I and Nae I, producing four fragments. The approximately 5.8 kb Nde I/Nae I fragment containing the T7 promoter, ampicillin antibiotic resistance marker and the 3' end of the 200 kDa gene was agarose gel purified. The approximately 480 bp Nde I/Nde I fragment containing the 5' end of the 200 kDa 30 gene was also gel purified. This approximately 480 bp fragment was then restriction digested with the enzymes Nla IV and Pst I and the Nde 1/Nla IV fragment ligated to the previously isolated 5.8 kb Nde VNae I fragment to produce plasmid pQWE, as 01/07619 PCT/CA00/00870 38 illustrated in Figure 19. This plasmid construct contained a 200 kDa gene with the Nla IV to Nae I fragment deleted. This plasmid construct resulted, upon expression as described in Example 7, in a fusion 200 kDa protein containing a very short piece of the 5' end and the 3' half of the 200 kDa protein. 5 An approximately 500 bp fragment around the Eco RI site in the 200 kDa gene from plasmid pKS348 was PCR amplified utilizing a 5' oligonucleotide, 6425.KS and a 3' oligonucleotide 4272.KS (Table 10) using the conditions outlined in Table 11. The 5' oligonucleotide was synthesized with an ATG translational start codon and a Nde I restriction site, while the 3' oligonucleotide was synthesized with 10 an Eco RI site. The approximately 500 bp PCR fragment was the restriction digested with the enzymes Nde I and Eco RI. Plasmid pQWE, prepared as described above, was restriction digested with Nde I and Eco RI as illustrated in Figure 20, and this larger fragment agarose gel purified. The Nde VEco RI PCR fragment was then ligated into the isolated Nde VEco RI fragment from pQWE, to produce plasmid 15 pQWF. This construct expresses a 5' truncated 200 kDa protein, having only the 3' half of this protein from the region about 40 bp upstream of the Nde I site to the 3' end. The constructs pQWE and pQWF, prepared as described above and as illustrated in Figures 19 and 20, were expressed in E. coli strain BL21(DE3)/pLysS 20 as described in Example 7. The C-terminal half proteins were obtained at levels of expression approximately twice those achieved using pKS348. Corresponding constructs were prepared from strain LES-1 and produced comparable results. Antiserum was raised against the C-terminal half of 200 kDa protein produced from construct pQWE following the procedure of Example 10 and was 25 employed in the bactericidal assay described in Example 11. As may be seen in Table IB the antiserum showed more than 30% of killing against 30 out of 31 strains which were killed by the bactericidal assay using antiserum raised against the product from pKS348. Example 16 30 This Example describes the identification of a natural site of C-terminal truncation for r200 kDa. WO 01/07619 PCT/CAOO/00870 39 The full-length M. catarrhalis r200 kDa gene containing the putative signal sequence, could not be expressed in E. coli, as described above in Example 6. When the sequence encoding the first 56 amino acids was deleted, the M56 r200 kDa protein could be produced, but not in very high yield (plasmid pKS348), 5 as described in Example 7. When the variable N-terminal half of the 200 kDa gene was completely deleted, a high expression level of the 3' r200 kDa protein was achieved (plasmid pQWF), as described in Example 15. By electrophoretic analysis, the 3' r200 kDa protein produced from pQWF was observed as two bands, with a significant portion of the product appearing as the lower molecular 10 weight, presumed degradation product. The two 3' r200 kDa protein bands were purified and submitted to N-terminal and C-terminal sequence analyses. The N-terminal sequence was found to be identical for both bands and as expected. The C-terminal sequence of the higher molecular weight protein was as expected from the gene sequence, but the lower molecular weight protein did not have the 15 expected C-terminal sequence. The possible C-terminal sequences were: H V G A A K (SEQ ID No: 33) . Y A V V . (SEQ ID No: 34) . . V G G . (SEQ ID No: 35) . Q . . . (SEQ ID No: 36) 20 . . F . . . (SEQ ID No: 37) An analysis of the 200 kDa gene (Figure 21) identified three possible sites of matching sequence: GWK (SEQ ID No: 38) at approximately residue 400; VLGGK (SEQ ID No: 39) at approximately residue 1660; and VVAGK (SEQ ID No: 40) at approximately residue 1820 (see Figure 21). Of these, the first site 25 does not appear in the 3' r200 kDa protein and only a truncation at the third site, the WAGK sequence, would result in a protein of approximately the observed size. Example 17 This Example describes the construction of a plasmid expressing a defined 30 portion of the 200 kDa gene as illustrated in Figure 23. Plasmid pQWF, prepared as described in Example 15, is a pT7-7 based plasmid containing the conserved 3'-half of the M. catarrhalis 200 kDa gene. WO 01/07619 PCT/CA00/00870 40 Plasmid pQWF was digested with Dra III and Pst I to remove 1.1 kb of the extreme 3'-end of the 200 kDa gene (Figure 23). A 260 bp PCR fragment was amplified, containing tandem stop codons after the WAGK sequence. The PCR primers were designed to contain flanking Dra HI and Pst I sites: 5 Drain ASGKHSVAIG F 5' GCCTCAGGCAAGICACTCAGTQGCGATAGGTTTC 3' 7243.SL (SEQ ID No: 41) G T GNVV A GK • * (SEQ ID No: 44) 10 GGTACAGGCAATGTGGTAGCAGGTAAGTAATAGCTGCAGCCGG (SEQ ID No: 43) 3* CCATGTCCGTTACACCATCGTCCATTCATTATQGACGTqGGCC 5* 7244.SL (SEQ ID No: 42) PstI The 260 bp PCR fragment was digested with Dra IH and Pst I and inserted 15 into the digested pQWF, generating plasmids OA-54-1-6 and OA-54-2-7, pT7 3' 200 kDa(t), containing the carboxy-teiminal truncated 3' 200 kDa gene (see Figure 22)(nucleotide sequence, SEQ ID No: 47; amino acid sequence, SEQ ID No: 48). In order to change the antibiotic selection from ampicillin to kanamycin, the Bgl II -Pst I 77 3' 200 kDa(t) gene cassette was excised and cloned into plasmid DS-1843-20 2, a pBR 328-based plasmid containing a multiple cloning site between the EcoR I and Pst I sites. The resulting pBR 77 3 ' 200 kDa(t) plasmid containing the C-teiminally truncated 3' r200 kDa(t) was subsequently linearized with Sal I, dephosphorylated, and the 1.4 kb Sal I kanR gene from pUC-4K was inserted,' generating pBR 77 3' 200 kDa (t)/kanR . Plasmid DS-2224-1-4 contains a synthetic 25 E. coli cer locus that can be used to stabilize plasmids. pBR 77 3' 200 kDa(t) was linearized with BamH I, dephosphorylated, and the approximately 200 bp BamH I cer fragment from DS-2224-1-4 was inserted, generating pBR 77 3 ' 200 kDa(t)/kanR/cer. Example 18 30 This Example illustrates the expression of 3' r200 kDa(t) from E. coli. Plasmids OA-54-1-6 and OA-54-2-7, prepared as described in Example 17, were introduced by transformation into E. coli BL21(DE3) cells to generate strains OA-54-1-6-1 /BL21 (DE3), OA-54-l-6-2/BL21(DE3), OA-54-2-7-l/BL21(DE3) and OA-54-2-7-2/BL21(DE3). Plasmids OA-54-1-6 and OA-54-2-7 were introduced by 35 transformation into E. coli BL21-SI cells (Life Technologies) to generate strains OA-54-1 -6-1 /BL21 -SI, OA-54-1-6-2/BL21-SI, OA-54-2-7- 1/BL21 -SI, and OA-54- WO 01/07619 PCT/CAOO/00870 41 2-7-2/BL21-SI. BL21(DE3) strains were grown to OD A578 of 0.4 in NZCY medium, and induced with 0.4mM IPTG for 4 hours. BL-21-SI strains were grown to OD A578 of 0.3 to 0.4 in LBON (Luria broth without NaCl) medium and induced with 0.3M sodium chloride for 4 hours. Cell lysates were analysed on 8% SDS-5 PAGE (Figure 3). Duplicate strains were found to be equivalent and the expression from both hosts was about 10 to 20% of total protein. SUMMARY OF THE DISCLOSURE In summary of this disclosure, nucleotide sequences encoding an about 200 kDa outer membrane protein from several strains of Moraxella catarrhalis are 10 described along with recombinant production of such protein. Modifications are possible within the scope of this invention. WO 01/07619 PCT/CA0O/OO87O 42 Table 1A Examination of 200 kDa protein in M. catarrhalis strains STRAIN /ANATOMICAL ORIGIN SOURCE EXPRESSION OF 200 kDa PROTEIN 4223 MID. EAR FLUID TJ. MURPHY +++ RH408 MUTANT OF 4223 - 3 SPUTUM If . 56 SPUTUM l» - 135 MID. EAR FLUID 1 +++ 585 BACTEREMIA It + 5191 MID. EAR FLUID *1 +++■ 8185 NASOPHARYNX (( +++ M2 SPUTUM «t +++ M5 SPUTUM II - ATCC25240 ATCC - H-04 OTITIS G.D. CAMPBELL +++ H-12 M «< - PO-34 tt «« +++ PO-51 « 44 +++ E-07 M 4* +++ | E-22 «< 44 +++ E-23 44 -H-f E-24 M <« +++ M-02 « 44 +++ M-20 U it +++ M-29 u «« +++ M-32 «« U +++ M-35 44 C< +++ 0-2 EXPECTORATION M.G. BERGERON + 0-6 44 44 - 0-8 44 «C +++ 0-9 tc 44 - O-IO «« 44 +++ 0-11 U 44 +++ 0-12 «« 44 . R-l BRONCHIAL SECRETIONS 44 + R-2 •« 44 - R-4 OTrns 44 +++ R-5 M 44 +++ R-6 it 44 +++ R-7 «« 44 . +++ N-209 BLOOD 4 +++ VH-1 OTrns V. HOWIE +++ VH-2 «« U +++ VH-3 «< 44 +++ VH-4 «< 44 +++ VH-5 u 44 +++ VH-6 M 44 +++ VH-7 44 44 +++ WO 01/07619 PCT/CAOO/00870 43 vh-8 U (4 +++ vh-9 it 44 +++ vh-10 44 4i +++ vh-11 a (i -H-+ vh-12 M 4« +++ vh-13 «« 44 +++ vh-14 44 +++ vh-15 41 44 +++ vh-16 44 44 +++ vh-17 •4 it +++ vh-18 44 it +++ vh-19 44 44 +++ vh-20 44 44 +++ vh-23 44 44 +++ vh-24 44 41 +++ vh-25 a 44 +++ vh-26 44 44 +++ vh-27 44 44 +++ vh-28 44 44 -H-+ vh-29 44 44 +++ vh-30 44 44 +++ les1 onns l.s. stenfors +++ les2 44 44 +++ les4 (4 44 +++ les5 44 44 +++ les6 44 44 +++ les7 ' 44 41 +-H- les8 1* 44 +++ les9 44 44 +++ les10 44 44 +++ les11 44 44 +++ les12 44 44 +++ les13 44 44 +++ les16 if 44 +++ les17 44 44 -W-+ les21 44 44 +++ 30607 otitis C.W. ford +++ CJ1 44 C. johnson +++ cj3 44 u +++ cj4 44 it +++ cj7 44 H +++' cj8 44 it +++ cj9 44 it +++ an 44 tt +++ Bacteria were lysed and proteins were separated on SDS-PAGE gels. The expression of 200 kDa protein was examined by Coomassie Blue staining and by Western blot using anti-200 kDa protein guinea pig serum. WO 01/07619 PCT/CA00/00870 TABLE IB Bactericidal assay results against Moraxella catarrhalis using antisera raised against recombinant M56 200 kDa protein from strains 4223 and LES1, and recombinant C-terminal half of200 kDa protein from strain 4223. STRAIN Killed by anti-M56 Killed by anti-C- Killed by anti-M56 200 200 kDa from 4223 terminal half of 200 kDa from 4223 kDa from LES1 4223 ++ ++ . 135 ++ ++ ++ H-04 ++ ++ ? H-12* . NT - PO-34 NT ++ PO-51 - - NT - E-07 . NT ++ E-22 ++ ++ - E-24 . . NT - M-02 ++ ++ ++ M-20 ++ + - M-29 ++ ++ ++ M-32 ++ ++ M-35 ++ ++ ++ • R4 - NT ++ R5 ++ +4" ++ R6 ++ + + R7 -H- NT ? 08** ++ + . NT VH-1 ++ NT ++ VH-2 ++ NT ++ VH-4 . NT ++ VH-5 ++ ++ - VH-7 ++ + ? VH-8 ++ ++ ++ VH-9 . NT ++ VH-10 ++ ++ ++ VH-13 - NT - VH-15 ++ ++ ++ VH-17 - NT - ■ VH-19 ++ ++ ++ VH-20 + + ++ VH-23 + NT ++ VH-24 ++ ++ - VH-25 . NT ++ VH-26 - NT ++ VH-27 - NT - VH-28 + NT . VH-29 ++ ++ 4+ VH-30 - NT ++ LES1 - NT ++ LES2 ++ ++ + LES4 + NT ++ LES5 - NT •H- WO 01/07619 PCT/CAOO/00870 45 LES9 ++ ++ ++ LES11 + + + LES12 - NT ? LES13 . NT ++ LES16 + ++ -H- LES17 ++ ++ - LES21 ++ ++ - 30607 + NT ++ CJ1 ++ ++ ++ CJ3 ++ - ++ CJ4 ++ ++ ++ CJ7 ++ ++ ++ CJ8 ++ ++ ? ' * This strain does not produce 200 kDa protein. ** This is the only non-otitis media strain (isolated from expectorate) in this Table. ++: Killed more than 60% (>60%), +: killed between 30% and 60%, killed 30% or less, NT: not tested, ?: the results not tested. WO 01/07619 PCT/CA00/00870 46 TABLE2 The number of G nucleotides in the G tract of the 200 kDa protein gene determined by sequencing of subcloned genes from a XEMBL3 clone. Plasmid* Number of G's pKSlO 10 pKS59 10 PKS63 10 PKS71 10 * pKSlO and pKS71 carried a DNA insert directly subcloned from a XEMBL3 clone. pKS59 and pKS63 carried a subcloned DNA fragment, pKS9, which was a subclone from an XEMBL3 clone. pKS59, pKS63 and pKS71 carried identical DNA inserts. TABLE 3 The number of G nucleotides in the G tract of the 200 kDa protein gene amplified by PCR from subcloned genes Primers Template DNA* Number of G's 4211 and 4213 pKS9 10 4211 and 4213 pKSlO 10 4211 and 4213 pKS71 10 * pKS9, pKSlO and pKS71, which contain a 5' fragment of the 200 kDa protein gene, were independently subcloned from the ?JEMBL3 clone. WO 01/07619 PCT/CA00/00870 47 TABLE4 The number of G nucleotides in the G tract of the 200 kDa protein gene amplified by PCR from chromosomal DNA of strain 4223 Primers Template* Number of G 4211 and 4166 4223B 9 4211 and 4213 4223B 9 4211 and 4213 4223R 9 * The template chromosomal DNAs, 4223B and 4223R, were independently prepared from M. catarrhalis strain 4223. TABLE5 The number of G nucleotides in the G tract in different strains of M. catarrhalis Expression Number of G Number of strains examined Possible start codon +++ 3 1 ATG +++ 6 7 ATG +++ 9 7 ATG + 10 3 GTG - 7 . 3 GTG 8 2 GTG - 9 1* ATG Total 24 * The 200 kDa protein gene of this strain was prematurely terminated by a stop codon. WO 01/07619 PCT/CA00/00870 48 TABLE 6 Anti-M56 r200 kDa antibody titers in guinea pig and rabbit sera ANTISERA ANTIBODY TITERS Against M56 r200 kDa (4223) Against M56 r200 kDa (LES-1) Gp anti-r200 kDa (4223) 204,800 102,400 409,600 409,600 Gp anti-r200 kDa (LES1) 204,800 1,638,400 102,400 1,638,400 Rbanti-r200 kDa (4223) 102,400 102,400 102,400 . 102,400 Rb anti-r200 kDa (LES1) 25,600 102,400 204,800 409,600 WO 01/07619 PCT/CAOO/0087© 49 TABLE 7 Killing of M. catarrhalis strain 4223 by the bactericidal antibody activity of guinea pig anti-M56 r200 kDa protein serum Serum dilution 1/64 1/128 1/256 1/512 1/1024 Killing % 97% 95% 95% 80% 38% * The guinea pig antiserum was raised against M56 r200 kDa protein from strain 4223, and the bactericidal antibody activity of the serum at various dilutions were examined against the strain 4223. TABLE 8 Inhibition of the binding of M. catarrhalis strains to Chang cells by guinea pig anti M56 r200 kDa protein serum Strain 1/4 1/16 1/64 4223 98% 92% 83% Q8 77% 82% 55% * The guinea pig antiserum was raised against M56 r200 kDa protein from strain 4223. WO 01/07619 PCT/CA00/Q0870 50 TABLE 9 Inhibition of in vitro adherence of Moraxella catarrhalis to Hep-2 cells by antiserum raised against recombinant 200 kDa protein from strain 4223 STRAIN Inhibition 4223* +++ PO-34 4-H- PO-51 ++ E-07 ++ R4 ++ VH-4 ++ VH-9 - VH-13 + VH-17 ++ VH-23 ++ VH-25 ++ VH-26 +-H- VH-27 + VH-28 +-H- LES1 ++ LES4 LES12 - LES13 - 30607 + +++: Inhibition was 30% or higher, ++: Inhibition was 20% to 30%, +: Inhibition was 15% to 20%, Inhibition was lower than 15%. *: This strain is the positive control, and the only strain in this Table which was killed by the bactericidal activity of anti-recombinant 200 kDa protein serum. WO 01/07619 PCT/CA00/00870 51 TABLE 10 Nucleotide sequences of primers used for PCR amplifications PRIMER NUCLEOTIDE SEQUENCE SEQ ED No: | 4211.KS GATGCCTACGAGTTGATTTGGGT 14 1 4213.KS GAGCGTTGCACCGATCACGAGGA 15 4166.KS CACTAGCCnTACATCACCACCGATG 16 5295JCS AAGGTAAACCCATATGAATCACATCTATAAAGTCA 17 4260.KS GCTTCTAGCTGTGCCACATTGA 18 5471 ICS CGCTCGCTGTCCATATGATCGGTGCAACGCTCA 19 4257.KS GACCCTGTGCATATGACATGGCT 20 4254.KS CCTTGGCATCAATCGTGGCACA 21 4278.KS TTACCTGCATCAATGCCATTGTCT 22 . 4329.KS CTGAGGTGAATACAACTACA 23 4272.KS CATCAGAGGTCTTTGAGGTGTCAT 24 4118.KS CATCACCGTGGGTCAAAAGAACGCA 25 4267JCS GATGTCGGCAATGTTTACCTGA 26 4269JCS CCACATTGACCAGTACTGGCACAGGTGCTA 27 4981.KS ACCTATGATCAATGGCGATTTGGT 28 6425.KS AAAGATCATATGGTTACCTTTGGCATTAAC 29 6242 GTCATCTTTCATATGGCCACAGGCACA 30 6243 ACATTTATGCATATGGCAGAGTACGCCA 31 6244 GCTACAGGGCATATGGGCAGTGTATGCACT 32 WO 01/07619 PCT/CA00/00870 52 TABLE 11 PCR Cycle Conditions 1. For the construction of pKS294, oligonucleotides 5295 and 4260 and of pKS348, oligonucleotides 5471 and 4257: 95°C for 2 min -> 95°C for 1 min, 60°C for 30 sec, 72°C for 1 min (10 cycles) 95°C for 1 min, 62°C for 30 sec, 72°C for 1 min (20 cycles with extension of 1 sec/cycle) 72°C for 10 min -+ 4°C. 2. For the construction of pQWF, oligonucleotides 6425 and 4272: 95°C for 2 min -» 95°C for 1 min, 60°C for 30 sec, 72°C for 1 min (10 cycles) -» 95°C for 1 min, 60°C for 30 sec, 72°C for 1 min (20 cycles with extension of 1 sec/cycle) -* 72°C for 10 min -> 4°C. 3. For the amplification of 700 bp fragment for sequencing the G-nucleotide tract from different strains, oligonucleotides 4211 and 4166. 95°C for 2 min ^ 95°C for 1 min, 60°C for 1 min, 72°C for 2 min (10 cycles) 95°C for 1 min, 60°C for 1 min, 72°C for 2 min (20 cycles with extension of 5 sec/cycle) ->72°C for 10 min -> 4°C. 4. For sequencing 200 kDa protein from M. catarrhalis strain RH408, (a) oligonucleotides 4254 and 4278; 4118 and 4267; and 4269 and 4981: 95°C for 2 min 95°C for 1 min, 62°C for 30 sec, 72°C for 1 min (10 cycles) -> 95°C for 1 min, 62°C for 30 sec, 72°C for 1 min (20 cycles with extension of 2 sec/cycle) 72°C for 10 min -*■ 4°C. (b) oligonucleotides 4329 and 4272 95°C for 2 min 95°C for 1 min, 58°C for 30 sec, 72°C for 1 min 30 sec (10 cycles) -> 95°C for 1 min, 58°C for 30 sec, 72°C for 1 min 30 sec (20 cycles wilh extension of 1 sec/cycle) 72°C for 10 min -> 4°C. WO 01/07619 PCT/CA00/00870 53 REFERENCES 1. Van Hare, G.F., P.A. Shurin, C.D. Marchant, N.A. Cartelli, C.EJohnson, D. Fulton, S. Carlin, and C.H. Kim. Acute otitis media caused by Branhamella catarrhalis: biology and therapy.(1987) Rev. Infect. Dis. 9:16-27. 2. Chapman, A .J., D.M. Musher, S. Jonsson, J.E. Clarridge, and R.J. Wallace. 1985. Development of bactericidal antibody during Branhamella catarrhalis infection. J. Infect Dis. 151:878-882. 3. Hager, H., A. Verghese, S. Alvarez, and S.L. Berk. 1987. Branhamella catarrhalis respiratory infections. Rev. Infect. Dis. 9:1140-1149. 4. McLeod, D.T., F. Ahmad, M.J. Croughan, and M.A. Calder. 1986. Bronchopulmonary infection due to M. catarrhalis. Clinical features and therapeutic response. Drugs 31 (Suppl.3): 109-112. 5. Nicotra, B., M. Rivera, J.I. Luman, and R.J. Wallace. 1986. Branhamella catarrhalis as a lower respiratory tract pathogen in patients with chronic lung disease. Arch.Intem.Med. 146:890-893. 6. Ninane, G., J. Joly, and M. Kraytman. 1978. Bronchopulmonary infection due to Branhamella catarrhalis : 11 cases assessed by transtracheal puncture. Br.Med. Jr. 1:276-278. 7. Srinivasan, G., M.J. Raff, W.C. Templeton, S J. Givens, R.C. Graves, and J.C. Mel. 1981. Branhamella catarrhalis pneumonia. Report of two cases and review of the literature. Am.Rev. Respir. Dis. 123:553-555. 8. West, M., S.L. Berk, and J.K. Smith. 1982. Branhamella catarrhalis pneumonia. South.Med. J. 75:1021-1023. 9. Brorson, J-E., A. Axelsson, and S.E. Holm. 1976. Studies on Branhamella catarrhalis (Neisseria catarrhalis) with special reference to maxillary sinusitis. Scan. J. Infect. Dis. 8:151-155. 10. Evans, F.O., Jr.. J.B. Sydnor, W.E.C. Moore, G.R. Moore, J.L. Manwaring, A.H. Brill, R.T. Jackson, S. Hanna, J.S. Skaar, L.V. Holdeman, G.S. Fitz-Hugh, M.A. Sande, and J.M. Gwaltney, Jr. 1975. Sinusitis of the maxillary antrum. N.Engl.J.Med. 293:735-739. 11. Tinkelman, D.G., and H.J. Silk. 1989. Clinical and bacteriologic features of chronic sinusitis in children. Am.J.Dis.Child. 143:938-942. 12. Wald, E.R., C. Byers, N.Guerra, M.Casselbrant, and D. Beste. 1989. Subacute sinusitis in children. J.Pediatr. 115:28-32. WO 01/07619 PCT/CA00/00870 54 13. Wald, E.R., G.J. Milmoe, A. Bowen, J.Ledesma-Medina, N. Salamon, and C.D.Bluestone. 1981. Acute maxillary sinusitis in children. N.Engl.J.Med. 304:749-754. 14. Christensen, J.J., and B. Bruun. 1985. Bacteremia caused by a beta-lactamase producing strain of Branhamella catarrhalis. Acta.Pathol. Microbiol. Immunol. Scand. Sect.B 93:273-275. 15. Craig, D.B., and P.A. Wehrle. 1983. Branhamella catarrhalis septic arthritis. J. Rheumatol. 10:985-986. 16. Gray, L.D., R.E. Van Scoy, J.P. Anhalt, and P.K.W. Yu. 1989. Wound infection caused by Branhamella catarrhalis. J.Clin.Microbiol. 27:818-820. 17. Guthrie, R., K. Bakenhaster, R.Nelson, and R. Woskobnick. 1988. Branhamella catarrhalis sepsis: a case report and review of the literature. J.Infect.Dis. 158:907-908. 18. Hiroshi, S., E.J. Anaissie, N.Khardori, and G.P. Bodey. 1988. Branhamella catarrhalis septicemia in patients, with leukemia. Cancer 61:2315-2317. 19. O'Neill, J.H., and P.W. Mathieson. 1987. Meningitis due to Branhamella catarrhalis. Aust. N.Z. J. Med. 17:241-242. 20. Murphy, T.F. 1989. The surface of Branhamella catarrhalis: a systematic approach to the surface antigens of an emerging pathogen. Pediatr. Infect. Dis. J. 8:S75-S77. 21. Klingman, K.L., and T.F. Murphy. 1994. Purification and characterization of a high-molecular-weight outer membrane protein of Moraxella (Branhamella) catarrhalis. Infect. Immun. 62:1150-1155. 22. Helminen, M.E., I. Maciver, J.L. Latimer, J. Klesney-Tait, L.D. Cope, M. Paris, G.H. McCracken, Jr., and E.J. Hansen. 1994. A large, antigenically conserved protein on the surface of Moraxella catarrhalis is a target for protective antibodies. J. Infect. Dis. 170:867-872. • 23. Aebi, C., I. Maciver, J.L. Latimer, L.D. Cope, M.K. Stevens, S.E. Thomas, G.H. McCracken, Jr., and E.J. Hansen. 1997. A protective epitope of Moraxella catarrhalis is encoded by two different genes. Infect. Immun. 65:4367-4377. 24. Nixon-George et al. The adjuvant effect of Stearyl Tyrosine on a recombinant subunit hepatitis B surface antigen. (1990), J. Immunology 144:4798-4802. WO 01/07619 PCT/GAOO/00870 55 25. Wiesmuller (1989), Novel low-molecular weight synthetis vaccine against foot-and-mouth disease containing a potent B-cell and macrophage activator, Vaccine 8:29-33. 26. Deres et al. (1989), Nature 342:561. 27. Lockhof£ O. Glycolipids as Immmunomodulators: Synthesis and Properties. 1991. Chem. Int. Ed. Engl. 30:1611-1620. 28. Taber and Richardson, 1985, PNAS 82(4): 1074-8. 29. Fitzgerald et al, FEMS Immunol. & Med. Microbiol. 18:209-216,1997. 30. Fitzgerald et al, FEMS Immunol. & Med Microbiol. 23:57-66,1999. 31. Kydetal, J. Med. Microbiology, 47:159-168, 1998. 32. Johsonetal, 1997, EMBOJ. 10(2):477-488. 33. Benz, I. and Schmidt, M.A., 1992. Mol Microbiol 6:1539-1546. SEQUENCE LISTING <110> CONNAUGHT LABORATORIES LIMITED LOOSMORE, Sheena M. SASAKI, Ken YANG, Yan-Ping KLEIN, Michel H. <120> RECOMBINANT HIGH MOLECULAR WEIGHT MAJOR OUTER MEMBRANE PROTEIN OF MORAXELLA <130> 1038-1063 MIS <140> PCT/CAOO/00870 <141> 2000-07-26 <150> 09/361,619 <151> 1999-07-27 <160> 48 <170> Patentln Ver. 2.1 <210> 1 <211> 6973 <212> DNA <213> Moraxella catarrhalis <400> 1 ccatggatat catatctgta aatactgttg cattgcgccc atcagaatgg atttgatata taatggtagg tgaatgacga ccctaattat catgaatcac agagtacgcc gtgtatgcac cgctcagtgg aaaaccagcc gtgaaaatgc tcaatggaag tcggtggtga atttgcttga ttaacggcca gacgcacaac gtcatttttc tgggtcttgc ctagctcgtt ttgccctagg caccaaatac cactttccat ataaaaccga gtagaattac ctttaactat taaaagaggc ctgaggtgaa gtactacagc gggcaggtgt cgatttgaca ccatcattac ctttatgtgt tgatgctata ttttgaaact ctttttgtaa tcccaatcac ttcaatcaaa atctataaag aaatcccaca tctgagcttt cagtgcttat aagacgctca taacgcacag cagtttggat tgtaaaggct tcagcatggt tgcagtatta cgcaagcgga caacgccttt cgccacagcc gggagcgata tcaaggttct ccaggcacta tggtagtaac tgcggtcaat ttttcagggt taaaggtggt tgataatagt tacaactaca tgaattattg gctcgcctgc tgtgatatga cataatttag atcatatgaa tgatgatgcc aatctattga aaatcacatc cagattcatt tgcctatgtc tcatctttaa gcacgggggg gcccgtattg gctcaaaaaa ggcactgcca ggcggtcaag aagataggta agtggtgatg aatcctaaac aaagaaatac cacgccagta ggtacacggg gagggccaat gcccttggtg gttgtcactc gaccccaagt tctatcaaac gtggcacagc gatgataaca gcagagacca ggtctgaaag ttaaatgcca agtgatagtt cgtatgatgg tttaacatgt taacgcattt tagaatatta tacgagttga cttaaatcac gcaatattgt caagtgatgt agcatgtatc caaagccaca ggggtagctg ccgcgctcgc aagataccaa aggcggacgg ccatcgccat ccgatgctac cctcgattgc atccgaaagg gaagctcaaa ctgcagtggg caacagctaa ctacaatcgc caggtactcg agagtgataa ttcaagccac gtaaaatcat tagaagcggt gtactgacgt acgcattaac ttaaacttgc caaccacagt taacctttac cgatgacacc gacatgattt agtaacgcat tgattgtatc tttgggttaa catatggtta tctactgtta gtttgtatac atttttttaa ggcacattta tgctacaggg tgtcctcgtg acatatcgca tgatcgagcc cggtagtagt gggtcaagag catcggtagt tactctgatt ggataatgat agccatgtca aagtgcctat tattggttct tgctcagcta taattctaga caataatacg caatgtcggt ggtgaagtgg aaaaataggt cgataataat taaaacttta taaggtaggt ccagcccaat ccatttgccc aacattgttt ttgtaaaaat tgattattgt tcactctatg taatttagca ctaccatgct gcaccattta ggtaaaccac tggcagtggc caagttggca atcggtgcaa attggtgaac attgctattg aataaaactg tccatcgcca gatgacttac aacgatctta gtaaaatata tatgcacagg tccttggcag gatgcaacat cagggcagta ccggcctata aaggcgggtc gcaggtgtta gctaaggagc ttggataata atcggtgtgg aacaatctta agtagtagta acaggcagtc 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 5 T- aaagcacaag caacagcagc gtgatgttga ttgcaattac aaggtagcag taaacgcagg gcaatgttac gcactagtga aacatttggc ttaccgttaa caaaaaatgc ctaccaaaaa gcaaaagcac tcggtgctaa caaataccgc atacaaacaa acactggcat ttgccgatca ccaacgctgc accccattga ccgccacagt tggatgatac ccaccaaact ctagtgatga ccaaggaaat aaaaggtaga acgcaaataa ccgacaaaaa aaagcaccct aagtcggtgc gcattgatgg cacttgataa ttaccaacat agatttatga aaaactcatt acccttactc acggcattac gcttaaccac gccaaaatgg ataaaggtag gtgccgccag cggttgactt ctaaggtgac atgatacaac gtactggcac tcaaggccag aaggggcaag tctatgacag ccaaagaagt ctcaaatgaa aaggcatcaa aaaccaaaaa cctttgcagg gtgggcaaac atggcttcac gcaccaaaat acacccctgt gcaaaggcac tgttgggtct acatcaaaaa cggtacttgg caaaaccgtc aatcggcact tgaaaaacaa catagacaat tgctaacgat cgctggcatc cgccccaact taaatttagt aagctatcta agaagaagac cggcgcagtc agatggtacg cctaaacaac tggcattaaa tcgcattacc accttatctt taacgcaggt aagtagccgc cagcattaat ctttgtctcc aacccatgat aaccattcat gaacaaaaca agatgccctt tcacaccacc tgaaaataat tcaagtcaac tggtacggtt aaacgacggt tgatggcgtg cacaactcgc aagcaaaccc tcaatcaggt tttaaaaacc acacgaattc cagttatgac caccaaggta gcctaagctg tcaaaatacc cgtacgcacc cattgttgat tgtctccact ctatgatgac cattgaagtt aggtgctaat tgatatcgtt ccaagcgaac taccgataac tgccaaagac tgtcaaatca tgaagacaac cgccgcagta ggatacaggc agacaccaat tgtcaaactt tgatgacaaa gctaagtgcc aaaagatacc tggtaatgct agacccaaat cggtaaaggt tatggcgtta actcgtatta gcaccatatt ggcattgatg gcggttacca agtgtcacac tacaacattg gttaagggta aatgaagtca gatgatgacg agcatcttaa gttacctttg gatggcttga tttactaatg agagataaaa gatcaagaca ggtaaagcca aacatagaac gatatattaa acttatgaca accgctaaca ctaacaggca agtgctaatg gttaacgcca aaaggcacag aatgctgatg accctaacac acctttggca ggcttgtcta aagtttgcca attaccagag cacctaagca gagattgccc gaacttgaaa tcagtagcag acctcaaaga aataaaggtg accgtgggta atcacaggac acagaacagg gtgctaagcg tatgacaccg acaagcaaaa aaagataaaa aaatttgccc gctcatctaa aactcagcag aagtactatc aaactggtcg gtcattaaca gcctttgtta actgtgggtg acaacggcta aagctaaccg gccaaagacc ggcgtgtctt aatgggctgg gacgctgcca ggtaatgata tcaggttcat aataacgata atggggtgaa ccagagataa tggataaaaa caggtaataa tcgaacagct ctactgaaat gcgtgaaaac gtggtacgaa atcgaacggc ccaacgctat aactcaaagg ggcttagcca ctgttaaaga tgaatggtag ttggctttgc agctacaagt tcacagggct tgggcaatac atacaggctt ttgttgactt aaaccagtaa ctgatgacaa gtaatacagc aagacatcgc cagacaccgc acgccaacgc tcaaaggtga ttaacaccac ttaaaaaccc aggttaataa atgaaattgg aagacggcat aaaacagcca acaaaatcag atgaacaagg cctctgatgt tggtgcgtgt ataataatgg taagcaacac gcaatataat caggctttaa tcaactttgc ccagtaaagt aacttggcgt taagcaatca acaccttatc gctatgtgga aagccaaaaa cccaagccca aagaacaagt aaggacttga atttaaatgc aaaaactggg ataataacat taaccaatct ttgtagactc acctgggtgg atgtacaaca acgctgacgg catctaaccg ccgaaaaact gtttactaat aattggcttt acaacttaaa aaagatcagt caaagccgcc atcagttgat caccgagctt caatagctta tgacagtgct caccgtggct taaaaacggt agatagcggt taccaacgaa taatccaggt tggttctgat tggcaatgtt gtccccaaca aatccaagac taacctaaaa tgccaatggc agtggtatat taaaaaactt aactaacttt cgaaaatcta cctacaaacc catcaccgtg aaacggtctt aagcggtctt cactggtagc taatggtgtt ctttactggg taacgcaggt tgatgctgtg cagtactgcc taataacttt catcaccttt gggcattgac caaaggcatt tctagctaat caaagacgaa cttgcaaggc cgatggcaat ggtctatgat aaaaaccacc agctactggc tggcgacatc tgctgatggc tgatggcaca aaccccagat aaatgatgcc aaaagccgct cgttgcccaa cgagactttg cggtgtggta taacagcgtt aagcggtcaa caaggtcatc gttaaacgaa caatcaggta cactgtcatc tgccactggt aatgcagaaa gctcgagatg gtgggtagtg aatcttgcca aagcctactt gctaagagtg aacagtgatg gttaccgccg ctacaaagct aaagatacga ctaacggttg ctgaccattg caaatccaag actggcattg ggtgcagttg aagattacca ctgcctagca aaagacaaat aataataaca aatgccacca gatgtgaatg ggcgtcaaaa aatgttaact aacaccctag tttaccgtta ggtcaaaaga aatattaaaa aaagccggca gaacaaatcc gtaggtgctg actaatggct ggtaaaaaga acaggcggca aaaacagcac acggttagta gcaggtgaaa caaaccaaag gtcattgaca gttaccaatg gacaaaaccc aatggtgaag gccaccaccg gtcaatgtgg acattgacca gatgcgcttg caaactgcca aataaggtca gttgataaaa ggcacattgg aataaaaagc tctgataaca acaccgctga accatcaaag gcaggtactg aatgcaggtg gccaaagcaa agtaatgtgg gtacgcaact aacattgccg aaagcaggca ggtatacaag 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4 560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 s? tgggcgtgga aaaaagatgg atttgaccaa tccatgtcaa gtgcctcagg ccgttgccat cacaagccac actctggtgc ataacaacca ccgtgaccga acgcaggcac caaccggtac cctcaggtgc ccgatgcggt atgagcttga cgatggcgat gtattgccac atggtcaatg cagttggtgc ctcaccatag tatcacttaa gatcataggt tgtgccattg cctgcaggtc taaagacggc cagcaaaaaa caaccccgca cgatggcaat caagcactca aggcagacaa gggcgatcaa catcggcgac gtttaccgat aagtaactcg acaagccaaa ggttaaaggc tgaacgccgt caatggtagc ccatcgtatc ggcgtccatg ccacaacggt ggtatttaaa aggttttcac ttgtataaaa accattttac aaacttattg accaaaaaat gac aacgctaacg gccctgctcg gaagccattg caagagcctg gtggcgatag acccaagcag tccatcgcca ccaagcactg gccactcaaa gttgccttag aaatctgacg tttgctggac atccaaaatg cagttgtaca caccaaaacg ccacaagcct caaggtgcgg atcaatggtt ttttaagcca cagcatcagc cgctcaagtg agtaaatttt gaccgattta gcgatttaag ccacttataa acagaataaa tggtacaagg gtttccaggc gcaaccaatc tcggtacagg ttaaggctga ccgatgtctt gttcaaactc gcacagcagg aaacggcggt tggcagcagg aagccaccca aaaataaggc acattcctgg tggcagtggg cagccgatac taaatcgcaa atcagtcata attctctttc atcaatgtag tcccgaaaat caatgtttgg cgccgcaggt tgaacaaggt gcgtaacggc caaggcagat catcgccatc caatgtggta taacagttac tggtgtgggc tgccatcagt tacaaccacc tggtgcggtc tgaggtcagt aagcattgcc caatgcaggg cagatccatg actgtcgaag ccaaggccat gattttactt ttactgatgc accatgacca ttgttagata ttctgattat gtcaaaaccc cagaccaact atccgcttct attgactcaa ggtgaagccg ggtgataacg gcaggtaagc agtgtgggta aataacatca gcaggcacac acagcaggtg tccgtgggtg gccaccagca aacgcaacca atttcatcag gttaccgggg ctgtcggata gtaggggcgg aaaaatcaat tgatgttttt aatcgccatt tggttaaaat gatccgttga 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 6973 <210> 2 <211> 5976 <212> DNA <213> Moraxella catarrhalis <400> 2 gtgatcggtg gcaattggtg gccattgcta agtaataaaa gagtccatcg agtgatgact attaacgatc gatgtaaaat tcatatgcac tattccttgg tctgatgcaa ctacagggca agaccggcct acgaaggcgg ggtgcaggtg tgggctaagg ggtttggata aatatcggtg ttaaacaatc ggtagtagta aatacaggca aataatgcag tttgctcgag aaagtgggta agtaatcttg gccaagccta gatgctaaga cttaacagtg ttagttaccg caacgctcag aacaaaacca ttggtgaaaa ctgtcaatgg ccatcggtgg tacatttgct ttattaacgg atagacgcac agggtcattt cagtgggtct catctagctc gtattgccct atacaccaaa gtccactttc ttaataaaac agcgtagaat atactttaac tggtaaaaga ttactgaggt gtagtactac gtcaaagcac aaacaacagc atggtgatgt gtgttgcaat ccaaaggtag ctttaaacgc gtggcaatgt atggcactag ccgaacattt tggcagtgct gccaagacgc tgctaacgca aagcagtttg tgatgtaaag tgatcagcat ccatgcagta aaccgcaagc ttccaacgcc tgccgccaca gttgggagcg aggtcaaggt tacccaggca cattggtagt cgatgcggtc tacttttcag tattaaaggt ggctgataat gaatacaact agctgaatta aagcaaaacc agcaatcggc tgatgaaaaa taccatagac cagtgctaac aggcgctggc taccgcccca tgataaattt ggcaagctat tatgctcaaa tcaggcactg cagggcggtc gataagatag gctagtggtg ggtaatccta ttaaaagaaa ggacacgcca tttggtacac gccgagggcc atagcccttg tctgttgtca ctagacccca aactctatca aatgtggcac ggtgatgata ggtgcagaga agtggtctga acattaaatg ttgagtgata gtctatggcg actactcgta caagcaccat aatggcattg gatgcggtta atcagtgtca acttacaaca agtgttaagg ctaaatgaag aaaaagatac ccaaggcgga aagccatcgc gtaccgatgc atgcctcgat aacatccgaa tacgaagctc gtactgcagt gggcaacagc aatctacaat gtgcaggtac ctcagagtga agtttcaagc aacgtaaaat agctagaagc acagtactga ccaacgcatt aagttaaact ccacaaccac gtttaacctt ttaatggggt ttaccagaga atttggataa atgcaggtaa ccatcgaaca cacctactga ttggcgtgaa gtagtggtac tcaatcgaac caaacatatc cggtgatcga catcggtagt tacgggtcaa tgccatcggt aggtactctg aaaggataat gggagccatg taaaagtgcc cgctattggt tcgtgctcag taataattct caccaataat catcaatgtc ggtggtgaag cgtaaaaata aaccgataat tgctaaaact agttaaggta tacccagccc gaagtttact taaaattggc aaaacaactt taaaaagatc gctcaaagcc aatatcagtt aaccaccgag gaacaatagc ggctgacagt 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 57 gctctacaaa gctaaagata ggtctaacgg ggtctgacca gaacaaatcc ggtactggca gatggtgcag gttaagatta acactgccta gacaaagaca aaaaataata ggcaatgcca tatgatgtga cttggcgtca tttaatgtta ctaaacaccc acctttaccg gtgggtcaaa cttaatatta cttaaagccg agcgaacaaa gttgtaggtg gggactaatg ggtggtaaaa gtgacaggcg gccaaaacag tttacggtta tttgcaggtg gaccaaacca attgtcattg aatgttacca gaagacaaaa ggcaatggtg aatgccacca gatgtcaatg accacattga ggcgatgcgc atccaaactg ggcaataagg acagttgata gatggcacat gccaataaaa gcttctgata caaacaccgc ttgaccatca gtagcaggta gttaatgcag caagccaaag atcagtaatg gaagtacgca gtaaacattg atcaaagcag ggtggtatac tgggtcaaaa ggtcagacca ggtatccgct ggcattgact gatggtgaag atcggtgata gtagcaggta tacagtgtgg gctttaccgt cgacaaaaaa ttgctaccaa ttggcaaaag aagtcggtgc ttgcaaatac ttgatacaaa ccaacactgg gcattgccga aatccaacgc acaaccccat ccaccgccac atgtggatga aaaccaccaa actctagtga tagccaagga ttaaaaaggt agaacgcaaa aaaccgacaa gcaaaagcac tccaagtcgg ctggcattga gctcacttga agattaccaa gcaagattta cacaaaactc gtaaccctta aaaacggcat aaggcttaac acagccaaaa atgataaagg cccgtgccgc aagcggttga ccgctaaggt tggatgatac ccagtactgg ttgtcaaggc ccaaaggggc tcatctatga aaaccaaaga tggctcaaat agcaaggcat acaaaaccaa tgacctttgc aaggtgggca ctgatggctt gtggcaccaa caaacacccc tgggcaaagg acttgttggg ccgacatcaa gcacggtact aagtgggcgt cccaaaaaga actatttgac tcttccatgt caagtgcctc ccgccgttgc acgcacaagc agcactctgg gtaataacaa taaagaagaa tgccggcgca aaaagatggt caccctaaac taatggcatt cgctcgcatt caaaccttat cattaacgca tcaaagtagc tgccagcatt tgactttgtc agtaacccat tacaaccatt actgaacaaa tgaagatgcc aattcacacc agatgaaaat taatcaagtc aaatggtacg cctaaacgac tgctgatggc tggcacaact taaaagcaaa cattcaatca tgatttaaaa attacacgaa ctccagttat taccaccaag cacgcctaag tggtcaaaat tagcgtacgc cagcattgtt ctttgtctcc gacctatgat aaccattgaa cacaggtgct cagtgatatc aagccaagcg cagtaccgat agttgccaaa gaatgtcaaa caatgaagac aaacgccgca aggggataca aacagacacc cactgtcaaa aattgatgac tgtgctaagt cacaaaagat tcttggtaat aaaagaccca tggcggtaaa ggataaagac tggcagcaaa caacaacccc caacgatggc aggcaagcac cataggcaga cacgggcgat tgccatcggc ccagtttacc gacgatgatg gtcagcatct acggttacct aacgatggct aaatttacta accagagata cttgatcaag ggtggtaaag cgcaacatag aatgatatat tccacttatg gataccgcta catctaacag acaagtgcta cttgttaacg accaaaggca aataatgctg aacaccctaa gttacctttg ggtggcttgt gtgaagtttg cgcattacca ccccacctaa ggtgagattg accgaacttg ttctcagtag gacacctcaa gtaaataaag ctgaccgtgg accatcacag accacagaac gatgtgctaa acttatgaca gacacaagca gttaaagata aataaatttg gttgctcatc aacaactcag aacaagtact gacaaactgg tcagtcatta aacgcctttg gtaactgtgg ggcacaacgg aataagctaa cttgccaaag aaaggcgtgt gccaatgggc accgacgctg gctggtaatg aattcaggtt ggtaataacg ggcaacgcta aaagccctgc gcagaagcca aatcaagagc tcagtggcga caaacccaag caatccatcg gacccaagca gatgccactc acgccaacgc taaaactcaa ttgggcttag tgactgttaa atgtgaatgg aaattggctt acaagctaca ccatcacagg aactgggcaa taaatacagg acattgttga acaaaaccag gcactgatga atggtaatac ccaaagacat cagcagacac atgacgccaa cactcaaagg gcattaacac ctattaaaaa ccaaggttaa gagatgaaat gcaaagacgg cccaaaacag aaaacaaaat cagatgaaca agacctctga gtgtggtgcg gtaataataa gactaagcaa agggcaatat gcgcaggctt ccgtcaactt aaaccagtaa aaaaacttgg ccctaagcaa taaacacctt caggctatgt atcaagccaa tcgcccaagc acaaagaaca ttaaaggact gtgatttaaa ctaaaaaact ccgataataa acctaaccaa cttttgtaga tggacctggg ccaatgtaca ataacgctga catcatctaa ataccgaaaa acggcgattt tcgccactta ttgacagaat ctgtggtaca taggtttcca caggcaacca ccatcggtac ctgttaaggc aaaccgatgt tatcaccgtg aggtaaaaac ccaagatagc agataccaac tagtaatcca tgctggttct agttggcaat gctgtcccca tacaatccaa ctttaaccta ctttgccaat taaagtggta caataaaaaa agcaactaac cgccgaaaat cgccctacaa cgccatcacc tgaaaacggt cacaagcggt ccccactggt taataatggt tggctttact cattaacgca ccatgatgct cagcagtact aggtaataac tgtcatcacc tgtgggcatt tggcaaaggc cactctagct aatcaaagac taacttgcaa tgccgatggc agtggtctat cgtaaaaacc tcaagctact atctggcgac ggatgctgat aaatgatggc ccaaacccca agtaaatgat tgaaaaagcc tgccgttgcc gggcgagact catcggtgtg tcttaacagc ctcaagcggt tggcaaggtc acagttaaac cggcaatcag ccgcactgtc acttgccact aagcaatgtt taacgccgca aaatgaacaa agggcgtaac ggccaaggca atccatcgcc aggcaatgtg tgataacagt ctttggtgtg 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2 64 0 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200" 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 GO ggcaataaca tcaccgtgac cgaaagtaac tcggttgcct taggttcaaa ctctgccatc 54 60 agtgcaggca cacacgcagg cacacaagcc aaaaaatctg acggcacagc aggtacaacc 5520 accacagcag gtgcaaccgg tacggttaaa ggctttgctg gacaaacggc ggttggtgcg 5580 gtctccgtgg gtgcctcagg tgctgaacgc cgtatccaaa atgtggcagc aggtgaggtc 5640 agtgccacca gcaccgatgc ggtcaatggt agccagttgt acaaagccac ccaaagcatt 5700 gccaacgcaa ccaatgagct tgaccatcgt atccaccaaa acgaaaataa ggccaatgca 5760 gggatttcat cagcgatggc gatggcgtcc atgccacaag cctacattcc tggcagatcc 5820 atggttaccg ggggtattgc cacccacaac ggtcaaggtg cggtggcagt gggactgtcg 5880 aagctgtcgg ataatggtca atgggtattt aaaatcaatg gttcagccga tacccaaggc 5940 catgtagggg cggcagttgg tgcaggtttt cacttt 5976 <210> 3 <211> 1992 <212> PRT <213> Moraxella catarrhalis <400> 3 Val lie Gly Ala Thr Leu Ser Gly Ser Ala Tyr Ala Gin Lys Lys Asp 15 10 15 Thr Lys His lie Ala lie Gly Glu Gin Asn Gin Pro Arg Arg Ser Gly 20 25 30 Thr Ala Lys Ala Asp Gly Asp Arg Ala lie Ala lie Gly Glu Asn Ala 35 40 45 Asn Ala Gin Gly Gly Gin Ala lie Ala lie Gly Ser Ser Asn Lys Thr 50 55 60 Val Asn Gly Ser Ser Leu Asp Lys lie Gly Thr Asp Ala Thr Gly Gin 65 70 75 80 Glu Ser lie Ala lie Gly Gly Asp Val Lys Ala Ser Gly Asp Ala Ser 85 90 95 lie Ala lie Gly Ser Asp Asp Leu His Leu Leu Asp Gin His Gly Asn 100 105 110 Pro Lys His Pro Lys Gly Thr Leu lie Asn Asp Leu lie Asn Gly His 115 120 125 Ala Val Leu Lys Glu lie Arg Ser Ser Lys Asp Asn Asp Val Lys Tyr 130 135 140 Arg Arg Thr Thr Ala Ser Gly His Ala Ser Thr Ala Val Gly Ala Met 145 150 155 160 Ser Tyr Ala Gin Gly His Phe Ser Asn Ala Phe Gly Thr Arg Ala Thr 165 170 175 Ala Lys Ser Ala Tyr Ser Leu Ala Val Gly Leu Ala Ala Thr Ala Glu 180 185 190 Gly Gin Ser Thr lie Ala lie Gly Ser Asp Ala Thr Ser Ser Ser Leu 195 200 205 Gly Ala lie Ala Leu Gly Ala Gly Thr Arg Ala Gin Leu Gin Gly Ser 210 215 220 lie Ala Leu Gly Gin Gly Ser Val Val Thr Gin Ser Asp Asn Asn Ser 6/ 225 230 235 240 Arg Pro Ala Tyr Thr Pro Asn Thr Gin Ala Leu Asp Pro Lys Phe Gin 245 250 255 Ala Thr Asn Asn Thr Lys Ala Gly Pro Leu Ser lie Gly Ser Asn Ser 260 265 270 lie Lys Arg Lys lie lie Asn Val Gly Ala Gly Val Asn Lys Thr Asp 275 280 285 Ala Val Asn Val Ala Gin Leu Glu Ala Val Val Lys Trp Ala Lys Glu 290 295 300 Arg Arg lie Thr Phe Gin Gly Asp Asp Asn Ser Thr Asp Val Lys lie 305 310 315 320 Gly Leu Asp Asn Thr Leu Thr lie Lys Gly Gly Ala Glu Thr Asn Ala 325 330 335 Leu Thr Asp Asn Asn lie Gly Val Val Lys Glu Ala Asp Asn Ser Gly 340 345 350 Leu Lys Val Lys Leu Ala Lys Thr Leu Asn Asn Leu Thr Glu Val Asn 355 360 365 Thr Thr Thr Leu Asn Ala Thr Thr Thr Val Lys Val Gly Ser Ser Ser 370 375 380 Ser Thr Thr Ala Glu Leu Leu Ser Asp Ser Leu Thr Phe Thr Gin Pro 385 390 395 400 Asn Thr Gly Ser Gin Ser Thr Ser Lys Thr Val Tyr Gly Val Asn Gly 405 410 415 Val Lys Phe Thr Asn Asn Ala Glu Thr Thr Ala Ala lie Gly Thr Thr 420 425 430 Arg lie Thr Arg Asp Lys lie Gly Phe Ala Arg Asp Gly Asp Val Asp 435 440 445 Glu Lys Gin Ala Pro Tyr Leu Asp Lys Lys Gin Leu Lys Val Gly Ser 450 455 460 Val Ala lie Thr lie Asp Asn Gly lie Asp Ala Gly Asn Lys Lys lie 465 470 475 480 Ser Asn Leu Ala Lys Gly Ser Ser Ala Asn Asp Ala Val Thr lie Glu 485 490 495 Gin Leu Lys Ala Ala Lys Pro Thr Leu Asn Ala Gly Ala Gly lie Ser 500 505 510 Val Thr Pro Thr Glu lie Ser Val Asp Ala Lys Ser Gly Asn Val Thr 515 520 525 Ala Pro Thr Tyr Asn lie Gly Val Lys Thr Thr Glu Leu Asn Ser Asp 530 535 540 Gly Thr Ser Asp Lys Phe Ser Val Lys Gly Ser Gly Thr Asn Asn Ser 545 550 555 560 6a Leu Val Thr Ala Glu His Leu Ala Ser Tyr Leu Asn Glu Val Asn Arg 565 570 575 Thr Ala Asp Ser Ala Leu Gin Ser Phe Thr Val Lys Glu Glu Asp Asp 580 585 590 Asp Asp Ala Asn Ala lie Thr Val Ala Lys Asp Thr Thr Lys Asn Ala 595 600 605 Gly Ala Val Ser lie Leu Lys Leu Lys Gly Lys Asn Gly Leu Thr Val 610 615 620 Ala Thr Lys Lys Asp Gly Thr Val Thr Phe Gly Leu Ser Gin Asp Ser 625 630 635 640 Gly Leu Thr lie Gly Lys Ser Thr Leu Asn Asn Asp Gly Leu Thr Val 645 650 655 Lys Asp Thr Asn Glu Gin lie Gin Val Gly Ala Asn Gly lie Lys Phe 660 665 670 Thr Asn Val Asn Gly Ser Asn Pro Gly Thr Gly lie Ala Asn Thr Ala 675 680 685 Arg lie Thr Arg Asp Lys lie Gly Phe Ala Gly Ser Asp Gly Ala Val 690 695 700 Asp Thr Asn Lys Pro Tyr Leu Asp Gin Asp Lys Leu Gin Val Gly Asn 705 710 715 720 Val Lys lie Thr Asn Thr Gly lie Asn Ala Gly Gly Lys Ala lie Thr 725 730 735 Gly Leu Ser Pro Thr Leu Pro Ser lie Ala Asp Gin Ser Ser Arg Asn 740 745 750 lie Glu Leu Gly Asn Thr lie Gin Asp Lys Asp Lys Ser Asn Ala Ala 755 760 765 Ser lie Asn Asp lie Leu Asn Thr Gly Phe Asn Leu Lys Asn Asn Asn 770 775 780 Asn Pro lie Asp Phe Val Ser Thr Tyr Asp lie Val Asp Phe Ala Asn 785 790 795 800 Gly Asn Ala Thr Thr Ala Thr Val Thr His Asp Thr Ala Asn Lys Thr 805 810 815 Ser Lys Val Val Tyr Asp Val Asn Val Asp Asp Thr Thr lie His Leu 820 825 830 Thr Gly Thr Asp Asp Asn Lys Lys Leu Gly Val Lys Thr Thr Lys Leu 835 840 845 Asn Lys Thr Ser Ala Asn Gly Asn Thr Ala Thr Asn Phe Asn Val Asn 850 855 860 Ser Ser Asp Glu Asp Ala Leu Val Asn Ala Lys Asp lie Ala Glu Asn 865 870 875 880 £3 Leu Asn Thr Leu Ala Lys Glu lie His Thr Thr Lys Gly Thr Ala Asp 885 890 895 Thr Ala Leu Gin Thr Phe Thr Val Lys Lys Val Asp Glu Asn Asn Asn 900 905 910 Ala Asp Asp Ala Asn Ala lie Thr Val Gly Gin Lys Asn Ala Asn Asn 915 920 925 Gin Val Asn Thr Leu Thr Leu Lys Gly Glu Asn Gly Leu Asn lie Lys 930 935 940 Thr Asp Lys Asn Gly Thr Val Thr Phe Gly lie Asn Thr Thr Ser Gly 945 950 955 960 Leu Lys Ala Gly Lys Ser Thr Leu Asn Asp Gly Gly Leu Ser lie Lys 965 970 975 Asn Pro Thr Gly Ser Glu Gin lie Gin Val Gly Ala Asp Gly Val Lys 980 985 990 Phe Ala Lys Val Asn Asn Asn Gly Val Val Gly Ala Gly lie Asp Gly 995 1000 1005 Thr Thr Arg lie Thr Arg Asp Glu lie Gly Phe Thr Gly Thr Asn Gly 1010 1015 1020 Ser Leu Asp Lys Ser Lys Pro His Leu Ser Lys Asp Gly lie Asn Ala 1025 1030 1035 1040 Gly Gly Lys Lys lie Thr Asn lie Gin Ser Gly Glu lie Ala Gin Asn 1045 1050 1055 Ser His Asp Ala Val Thr Gly Gly Lys lie Tyr Asp Leu Lys Thr Glu 1060 1065 1070 Leu Glu Asn Lys lie Ser Ser Thr Ala Lys Thr Ala Gin Asn Ser Leu 1075 1080 1085 His Glu Phe Ser Val Ala Asp Glu Gin Gly Asn Asn Phe Thr Val Ser 1090 1095 1100 Asn Pro Tyr Ser Ser Tyr Asp Thr Ser Lys Thr Ser Asp Val lie Thr 1105 1110 1115 1120 Phe Ala Gly Glu Asn Gly lie Thr Thr Lys Val Asn Lys Gly Val Val 1125 1130 1135 Arg Val Gly lie Asp Gin Thr Lys Gly Leu Thr Thr Pro Lys Leu Thr 1140 1145 1150 Val Gly Asn Asn Asn Gly Lys Gly lie Val lie Asp Ser Gin Asn Gly 1155 1160 1165 Gin Asn Thr lie Thr Gly Leu Ser Asn Thr Leu Ala Asn Val Thr Asn 1170 1175 1180 Asp Lys Gly Ser Val Arg Thr Thr Glu Gin Gly Asn lie lie Lys Asp 1185 1190 1195 1200 Glu Asp Lys Thr Arg Ala Ala Ser lie Val Asp Val Leu Ser Ala Gly 6#- 1205 1210 1215 Phe Asn Leu Gin Gly Asn Gly Glu Ala Val Asp Phe Val Ser Thr Tyr 1220 1225 1230 Asp Thr Val Asn Phe Ala Asp Gly Asn Ala Thr Thr Ala Lys Val Thr 1235 1240 1245 Tyr Asp Asp Thr Ser Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val 1250 1255 1260 Asp Asp Thr Thr lie Glu Val Lys Asp Lys Lys Leu Gly Val Lys Thr 1265 1270 1275 1280 Thr Thr Leu Thr Ser Thr Gly Thr Gly Ala Asn Lys Phe Ala Leu Ser 1285 1290 1295 Asn Gin Ala Thr Gly Asp Ala Leu Val Lys Ala Ser Asp lie Val Ala 1300 1305 1310 His Leu Asn Thr Leu Ser Gly Asp lie Gin Thr Ala Lys Gly Ala Ser 1315 1320 1325 Gin Ala Asn Asn Ser Ala Gly Tyr Val Asp Ala Asp Gly Asn Lys Val 1330 1335 1340 lie Tyr Asp Ser Thr Asp Asn Lys Tyr Tyr Gin Ala Lys Asn Asp Gly 1345 1350 1355 1360 Thr Val Asp Lys Thr Lys Glu Val Ala Lys Asp Lys Leu Val Ala Gin 1365 1370 1375 Ala Gin Thr Pro Asp Gly Thr Leu Ala Gin Met Asn Val Lys Ser Val 1380 1385 1390 lie Asn Lys Glu Gin Val Asn Asp Ala Asn Lys Lys Gin Gly lie Asn 1395 1400 1405 Glu Asp Asn Ala Phe Val Lys Gly Leu Glu Lys Ala Ala Ser Asp Asn 1410 1415 1420 Lys Thr Lys Asn Ala Ala Val Thr Val Gly Asp Leu Asn Ala Val Ala 1425 1430 1435 1440 Gin Thr Pro Leu Thr Phe Ala Gly Asp Thr Gly Thr Thr Ala Lys Lys 1445 1450 1455 Leu Gly Glu Thr Leu Thr lie Lys Gly Gly Gin Thr Asp Thr Asn Lys 1460 1465 1470 Leu Thr Asp Asn Asn lie Gly Val Val Ala Gly Thr Asp Gly Phe Thr 1475 1480 1485 Val Lys Leu Ala Lys Asp Leu Thr Asn Leu Asn Ser Val Asn Ala Gly 1490 1495 1500 Gly Thr Lys lie Asp Asp Lys Gly Val Ser Phe Val Asp Ser Ser Gly 1505 1510 1515 1520 Gin Ala Lys Ala Asn Thr Pro Val Leu Ser Ala Asn Gly Leu Asp Leu 1525 1530 1535 65 Gly Gly Lys Val lie Ser Asn Val Gly Lys Gly Thr Lys Asp Thr Asp 1540 1545 1550 Ala Ala Asn Val Gin Gin Leu Asn Glu Val Arg Asn Leu Leu Gly Leu 1555 1560 1565 Gly Asn Ala Gly Asn Asp Asn Ala Asp Gly Asn Gin Val Asn lie Ala 1570 1575 1580 Asp lie Lys Lys Asp Pro Asn Ser Gly Ser Ser Ser Asn Arg Thr Val 1585 1590 1595 1600 lie Lys Ala Gly Thr Val Leu Gly Gly Lys Gly Asn Asn Asp Thr Glu 1605 1610 1615 Lys Leu Ala Thr Gly Gly lie Gin Val Gly Val Asp Lys Asp Gly Asn 1620 1625 1630 Ala Asn Gly Asp Leu Ser Asn Val Trp Val Lys Thr Gin Lys Asp Gly 1635 1640 1645 Ser Lys Lys Ala Leu Leu Ala Thr Tyr Asn Ala Ala Gly Gin Thr Asn 1650 1655 1660 Tyr Leu Thr Asn Asn Pro Ala Glu Ala lie Asp Arg lie Asn Glu Gin 1665 1670 1675 1680 Gly lie Arg Phe Phe His Val Asn Asp Gly Asn Gin Glu Pro Val Val 1685 1690 1695 Gin Gly Arg Asn Gly lie Asp Ser Ser Ala Ser Gly Lys His Ser Val 1700 1705 1710 Ala lie Gly Phe Gin Ala Lys Ala Asp Gly Glu Ala Ala Val Ala lie 1715 1720 1725 Gly Arg Gin Thr Gin Ala Gly Asn Gin Ser lie Ala lie Gly Asp Asn 1730 1735 1740 Ala Gin Ala Thr Gly Asp Gin Ser lie Ala lie Gly Thr Gly Asn Val 1745 1750 1755 1760 Val Ala Gly Lys His Ser Gly Ala lie Gly Asp Pro Ser Thr Val Lys 1765 1770 1775 Ala Asp Asn Ser Tyr Ser Val Gly Asn Asn Asn Gin Phe Thr Asp Ala 1780 1785 1790 Thr Gin Thr Asp Val Phe Gly Val Gly Asn Asn lie Thr Val Thr Glu 1795 1800 1805 Ser Asn Ser Val Ala Leu Gly Ser Asn Ser Ala lie Ser Ala Gly Thr 1810 1815 1820 His Ala Gly Thr Gin Ala Lys Lys Ser Asp Gly Thr Ala Gly Thr Thr 1825 1830 1835 1840 Thr Thr Ala Gly Ala Thr Gly Thr Val Lys Gly Phe Ala Gly Gin Thr 1845 1850 1855 bh Ala Val Gly Ala Val Ser Val Gly Ala Ser Gly Ala Glu Arg Arg lie 1860 1865 1870 Gin Asn Val Ala Ala Gly Glu Val Ser Ala Thr Ser Thr Asp Ala Val 1875 1880 1885 Asn Gly Ser Gin Leu Tyr Lys Ala Thr Gin Ser lie Ala Asn Ala Thr 1890 1895 1900 Asn Glu Leu Asp His Arg lie His Gin Asn Glu Asn Lys Ala Asn Ala 1905 1910 1915 1920 Gly lie Ser Ser Ala Met Ala Met Ala Ser Met Pro Gin Ala Tyr lie 1925 1930 1935 Pro Gly Arg Ser Met Val Thr Gly Gly lie Ala Thr His Asn Gly Gin 1940 1945 1950 Gly Ala Val Ala Val Gly Leu Ser Lys Leu Ser Asp Asn Gly Gin Trp 1955 1960 1965 Val Phe Lys lie Asn Gly Ser Ala Asp Thr Gin Gly His Val Gly Ala 1970 1975 1980 Ala Val Gly Ala Gly Phe His Phe 1985 1990 <210> 4 <211> 2047 <212> PRT <213> Moraxella <400> 4 Met Asn His lie 1 Met Ala Val Ala 20 Cys Ala Thr Gly 35 lie Ala Ala Leu 50 Ala Tyr Ala Gin 65 Asn Gin Pro Arg lie Ala lie Gly 100 lie Gly Ser Ser 115 Gly Thr Asp Ala 130 catarrhalis Tyr Lys Val lie 5 Glu Tyr Ala Lys Gin Val Gly Ser 40 Ala Val Leu Val 55 Lys Lys Asp Thr 70 Arg Ser Gly Thr 85 Glu Asn Ala Asn Asn Lys Thr Val 120 Thr Gly Gin Glu 135 Phe Asn Lys Ala 10 Ser His Ser Thr 25 Val Cys Thr Leu lie Gly Ala Thr 60 Lys His lie Ala 75 Ala Lys Ala Asp 90 Ala Gin Gly Gly 105 Asn Gly Ser Ser Ser lie Ala lie 140 Thr Gly Thr Phe 15 Gly Gly Gly Ser 30 Ser Phe Ala Arg 45 Leu Ser Gly Ser lie Gly Glu Gin 80 Gly Asp Arg Ala 95 Gin Ala lie Ala 110 Leu Asp Lys lie 125 Gly Gly Asp Val Lys Ala Ser Gly Asp Ala Ser lie Ala lie Gly Ser Asp Asp Leu His 145 150 155 160 Leu Leu Asp Gin His Gly Asn Pro Lys His Pro Lys Gly Thr Leu lie 165 170 175 Asn Asp Leu lie Asn Gly His Ala Val Leu Lys Glu lie Arg Ser Ser 180 185 190 Lys Asp Asn Asp Val Lys Tyr Arg Arg Thr Thr Ala Ser Gly His Ala 195 200 205 Ser Thr Ala Val Gly Ala Met Ser Tyr Ala Gin Gly His Phe Ser Asn 210 215 220 Ala Phe Gly Thr Arg Ala Thr Ala Lys Ser Ala Tyr Ser Leu Ala Val 225 230 235 240 Gly Leu Ala Ala Thr Ala Glu Gly Gin Ser Thr lie Ala lie Gly Ser 245 250 255 Asp Ala Thr Ser Ser Ser Leu Gly Ala lie Ala Leu Gly Ala Gly Thr 260 265 270 Arg Ala Gin Leu Gin Gly Ser lie Ala Leu Gly Gin Gly Ser Val Val 275 280 285 Thr Gin Ser Asp Asn Asn Ser Arg Pro Ala Tyr Thr Pro Asn Thr Gin 290 295 300 Ala Leu Asp Pro Lys Phe Gin Ala Thr Asn Asn Thr Lys Ala Gly Pro 305 310 315 320 Leu Ser lie Gly Ser Asn Ser lie Lys Arg Lys lie lie Asn Val Gly 325 330 335 Ala Gly Val Asn Lys Thr Asp Ala Val Asn Val Ala Gin Leu Glu Ala 340 345 350 Val Val Lys Trp Ala Lys Glu Arg Arg lie Thr Phe Gin Gly Asp Asp 355 360 365 Asn Ser Thr Asp Val Lys lie Gly Leu Asp Asn Thr Leu Thr lie Lys 370 375 380 Gly Gly 385 Lys Glu Asn Asn Val Lys Ser Leu 450 Thr Val Ala Glu Ala Asp Leu Thr 420 Val Gly 435 Thr Phe Tyr Gly Thr Asn 390 Asn Ser 405 Glu Val Ser Ser Thr Gin Val Asn Ala Leu Gly Leu Asn Thr Ser Ser 440 Pro Asn 455 Glv Val Thr Asp Lys Val 410 Thr Thr 425 Thr Thr Thr Gly Lys Phe Asn Asn 395 Lys Leu Leu Asn Ala Glu Ser Gin 460 Thr Asn He Gly Ala Lys Ala Thr - 430 Leu Leu 445 Ser Thr Asn Ala Val Val 400 Thr Leu 415 Thr Thr Ser Asp Ser Lys Glu Thr b% 465 470 475 480 Thr Ala Ala lie Gly Thr Thr Arg lie Thr Arg Asp Lys lie Gly Phe 485 490 495 Ala Arg Asp Gly Asp Val Asp Glu Lys Gin Ala Pro Tyr Leu Asp Lys 500 505 510 Lys Gin Leu Lys Val Gly Ser Val Ala lie Thr lie Asp Asn Gly lie 515 520 525 Asp Ala Gly Asn Lys Lys lie Ser Asn Leu Ala Lys Gly Ser Ser Ala 530 535 540 Asn Asp Ala Val Thr lie Glu Gin Leu Lys Ala Ala Lys Pro Thr Leu 545 550 555 560 Asn Ala Gly Ala Gly lie Ser Val Thr Pro Thr Glu lie Ser Val Asp 565 570 575 Ala Lys Ser Gly Asn Val Thr Ala Pro Thr Tyr Asn lie Gly Val Lys 580 585 590 Thr Thr Glu Leu Asn Ser Asp Gly Thr Ser Asp Lys Phe Ser Val Lys 595 600 605 Gly Ser Gly Thr Asn Asn Ser Leu Val Thr Ala Glu His Leu Ala Ser 610 615 620 Tyr Leu Asn Glu Val Asn Arg Thr Ala Asp Ser Ala Leu Gin Ser Phe 625 630 635 640 Thr Val Lys Glu Glu Asp Asp Asp Asp Ala Asn Ala lie Thr Val Ala 645 650 655 Lys Asp Thr Thr Lys Asn Ala Gly Ala Val Ser lie Leu Lys Leu Lys 660 665 670 Gly Lys Asn Gly Leu Thr Val Ala Thr Lys Lys Asp Gly Thr Val Thr 675 680 685 Phe Gly Leu Ser Gin Asp Ser Gly Leu Thr lie Gly Lys Ser Thr Leu 690 695 700 Asn Asn Asp Gly Leu Thr Val Lys Asp Thr Asn Glu Gin lie Gin Val 705 710 715 720 Gly Ala Asn Gly lie Lys Phe Thr Asn Val Asn Gly Ser Asn Pro Gly 725 730 735 Thr Gly lie Ala Asn Thr Ala Arg lie Thr Arg Asp Lys lie Gly Phe 740 745 750 Ala Gly Ser Asp Gly Ala Val Asp Thr Asn Lys Pro Tyr Leu Asp Gin 755 760 765 Asp Lys Leu Gin Val Gly Asn Val Lys lie Thr Asn Thr Gly lie Asn 770 775 780 Ala Gly Gly Lys Ala lie Thr Gly Leu Ser Pro Thr Leu Pro Ser lie 785 790 795 800 6^! Ala Asp Gin Ser Ser Arg Asn lie Glu Leu Gly Asn Thr lie Gin Asp 805 810 815 Lys Asp Lys Ser Asn Ala Ala Ser lie Asn Asp lie Leu Asn Thr Gly 820 825 830 Phe Asn Leu Lys Asn Asn Asn Asn Pro lie Asp Phe Val Ser Thr Tyr 835 840 845 Asp lie Val Asp Phe Ala Asn Gly Asn Ala Thr Thr Ala Thr Val Thr 850 855 860 His Asp Thr Ala Asn Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val 865 870 875 880 Asp Asp Thr Thr lie His Leu Thr Gly Thr Asp Asp Asn Lys Lys Leu 885 890 895 Gly Val Lys Thr Thr Lys Leu Asn Lys Thr Ser Ala Asn Gly Asn Thr 900 905 910 Ala Thr Asn Phe Asn Val Asn Ser Ser Asp Glu Asp Ala Leu Val Asn 915 920 925 Ala Lys Asp lie Ala Glu Asn Leu Asn Thr Leu Ala Lys Glu lie His 930 935 940 Thr Thr Lys Gly Thr Ala Asp Thr Ala Leu Gin Thr Phe Thr Val Lys 945 950 955 960 Lys Val Asp Glu Asn Asn Asn Ala Asp Asp Ala Asn Ala lie Thr Val 965 970 975 Gly Gin Lys Asn Ala Asn Asn Gin 980 Glu Asn Gly Leu Asn lie Lys Thr 995 1000 Gly lie Asn Thr Thr Ser Gly Leu 1010 1015 Asp Gly Gly Leu Ser lie Lys Asn 1025 1030 Val Asn Thr Leu Thr Leu Lys Gly 985 990 Asp Lys Asn Gly Thr Val Thr Phe 1005 Lys Ala Gly Lys Ser Thr Leu Asn 1020 Pro Thr Gly Ser Glu Gin lie Gin 1035 1040 Val Gly Ala Asp Gly Val Lys Phe Ala Lys Val Asn Asn Asn Gly Val 1045 1050 1055 Val Gly Ala Gly lie Asp Gly Thr Thr Arg lie Thr Arg Asp Glu lie 1060 1065 1070 Gly Phe Thr Gly Thr Asn Gly Ser Leu Asp Lys Ser Lys Pro His Leu 1075 1080 1085 Ser Lys Asp Gly lie Asn Ala Gly Gly Lys Lys lie Thr Asn lie Gin 1090 1095 1100 Ser Gly Glu lie Ala Gin Asn Ser His Asp Ala Val Thr Gly Gly Lys 1105 1110 1115 1120 70 Lys lie Ser Ser Thr Ala 1135 Ser Val Ala Asp Glu Gin 1150 Ser Ser Tyr Asp Thr Ser 1165 Glu Asn Gly lie Thr Thr 1180 lie Asp Gin Thr Lys Gly 1185 1190 1195 1200 Leu Thr Thr Pro Lys Leu Thr Val Gly Asn Asn Asn Gly Lys Gly lie 1205 1210 1215 Val lie Asp Ser Gin Asn Gly Gin Asn Thr lie Thr Gly Leu Ser Asn 1220 1225 1230 Thr Leu Ala Asn Val Thr Asn Asp Lys Gly Ser Val Arg Thr Thr Glu 1235 1240 1245 lie Tyr Asp Leu Lys 1125 Lys Thr Ala Gin Asn 1140 Gly Asn Asn Phe Thr 1155 Lys Thr Ser Asp Val 1170 Lys Val Asn Lys Gly Thr Glu Leu Glu Asn 1130 Ser Leu His Glu Phe 1145 Val Ser Asn Pro Tyr 1160 lie Thr Phe Ala Gly 1175 Val Val Arg Val Gly Gin Gly Asn lie lie Lys Asp Glu Asp Lys Thr Arg Ala Ala Ser lie 1250 1255 1260 Val Asp Val Leu Ser Ala Gly Phe Asn Leu Gin Gly Asn Gly Glu Ala 1265 1270 1275 1280 Val Asp Phe Val Ser Thr Tyr Asp Thr Val Asn Phe Ala Asp Gly Asn 1285 1290 1295 Ala Thr Thr Ala Lys Val Thr Tyr Asp Asp Thr Ser Lys Thr Ser Lys 1300 1305 1310 Val Val Tyr Asp Val Asn Val Asp Asp Thr Thr lie Glu Val Lys Asp 1315 1320 1325 Lys Lys Leu Gly Val Lys Thr Thr Thr Leu Thr Ser Thr Gly Thr Gly .1330 1335 1340 Ala Asn Lys Phe Ala Leu Ser Asn Gin Ala Thr Gly Asp Ala Leu Val 1345 1350 1355 1360 Lys Ala Ser Asp lie Val Ala His Leu Asn Thr Leu Ser Gly Asp lie 1365 1370 1375 Gin Thr Ala Lys Gly Ala Ser Gin Ala Asn Asn Ser Ala Gly Tyr Val 1380 1385 1390 Asp Ala Asp Gly Asn Lys Val lie Tyr Asp Ser Thr Asp Asn Lys Tyr 1395 1400 1405 Tyr Gin Ala Lys Asn Asp Gly Thr Val Asp Lys Thr Lys Glu Val Ala 1410 1415 1420 Lys Asp Lys Leu Val Ala Gin Ala Gin Thr Pro Asp Gly Thr Leu Ala 1425 1430 1435 1440 Gin Met Asn Val Lys Ser Val lie Asn Lys Glu Gin Val Asn Asp Ala 7/ 1445 1450 1455 Asn Lys Lys Gin Gly lie Asn Glu Asp Asn Ala Phe Val Lys Gly Leu 1460 1465 1470 Glu Lys Ala Ala Ser Asp Asn Lys Thr Lys Asn Ala Ala Val Thr Val 1475 1480 1485 Gly Asp Leu Asn Ala Val Ala Gin Thr Pro Leu Thr Phe Ala Gly Asp 1490 1495 1500 Thr Gly Thr Thr Ala Lys Lys Leu Gly Glu Thr Leu Thr lie Lys Gly 1505 1510 1515 1520 Gly Gin Thr Asp Thr Asn Lys Leu Thr Asp Asn Asn lie Gly Val Val 1525 1530 1535 Ala Gly Thr Asp Gly Phe Thr Val Lys Leu Ala Lys Asp Leu Thr Asn 1540 1545 1550 Leu Asn Ser Val Asn Ala Gly Gly Thr Lys lie Asp Asp Lys Gly Val 1555 1560 1565 Ser Phe Val Asp Ser Ser Gly Gin Ala Lys Ala Asn Thr Pro Val Leu 1570 1575 1580 Ser Ala Asn Gly Leu Asp Leu Gly Gly Lys Val lie Ser Asn Val Gly 1585 1590 1595 1600 Lys Gly Thr Lys Asp Thr Asp Ala Ala Asn Val Gin Gin Leu Asn Glu 1605 1610 1615 Val Arg Asn Leu Leu Gly Leu Gly Asn Ala Gly Asn Asp Asn Ala Asp 1620 1625 1630 Gly Asn Gin Val Asn lie Ala Asp lie Lys Lys Asp Pro Asn Ser Gly 1635 1640 1645 Ser Ser Ser Asn Arg Thr Val lie Lys Ala Gly Thr Val Leu Gly Gly 1650 1655 1660 Lys Gly Asn Asn Asp Thr Glu Lys Leu Ala Thr Gly Gly lie Gin Val 1665 1670 1675 1680 Gly Val Asp Lys Asp Gly Asn Ala Asn Gly Asp Leu Ser Asn Val Trp 1685 1690 1695 Val Lys Thr Gin Lys Asp Gly Ser Lys Lys Ala Leu Leu Ala Thr Tyr 1700 1705 1710 Asn Ala Ala Gly Gin Thr Asn Tyr Leu Thr Asn Asn Pro Ala Glu Ala 1715 1720 1725 lie Asp Arg lie Asn Glu Gin Gly lie Arg Phe Phe His Val Asn Asp 1730 1735 1740 Gly Asn Gin Glu Pro Val Val Gin Gly Arg Asn Gly lie Asp Ser Ser 1745 1750 1755 1760 Ala Ser Gly Lys His Ser Val Ala lie Gly Phe Gin Ala Lys Ala Asp 1765 1770 1775 11 Gly Glu Ala Ala Val Ala lie Gly Arg Gin Thr Gin Ala Gly Asn Gin 1780 1785 1790 Ser lie Ala lie Gly Asp Asn Ala Gin Ala Thr Gly Asp Gin Ser lie 1795 1800 1805 Ala lie Gly Thr Gly Asn Val Val Ala Gly Lys His Ser Gly Ala lie 1810 1815 1820 Gly Asp Pro Ser Thr Val Lys Ala Asp Asn Ser Tyr Ser Val Gly Asn 1825 1830 1835 1840 Asn Asn Gin Phe Thr Asp Ala Thr Gin Thr Asp Val Phe Gly Val Gly 1845 1850 1855 Asn Asn lie Thr Val Thr Glu Ser Asn Ser Val Ala Leu Gly Ser Asn 1860 1865 1870 Ser Ala lie Ser Ala Gly Thr His Ala Gly Thr Gin Ala Lys Lys Ser 1875 1880 1885 Asp Gly Thr Ala Gly Thr Thr Thr Thr Ala Gly Ala Thr Gly Thr Val 1890 1895 1900 Lys Gly Phe Ala Gly Gin Thr Ala Val Gly Ala Val Ser Val Gly Ala 1905 1910 1915 1920 Ser Gly Ala Glu Arg Arg lie Gin Asn Val Ala Ala Gly Glu Val Ser 1925 1930 1935 Ala Thr Ser Thr Asp Ala Val Asn Gly Ser Gin Leu Tyr Lys Ala Thr 1940 1945 1950 Gin Ser lie Ala Asn Ala Thr Asn Glu Leu Asp His Arg lie His Gin 1955 1960 1965 Asn Glu Asn Lys Ala Asn Ala Gly lie Ser Ser Ala Met Ala Met Ala 1970 1975 1980 Ser Met Pro Gin Ala Tyr lie Pro Gly Arg Ser Met Val Thr Gly Gly 1985 1990 1995 2000 lie Ala Thr His Asn Gly Gin Gly Ala Val Ala Val Gly Leu Ser Lys 2005 2010 2015 Leu Ser Asp Asn Gly Gin Trp Val Phe Lys lie Asn Gly Ser Ala Asp 2020 2025 2030 Thr Gin Gly His Val Gly Ala Ala Val Gly Ala Gly Phe His Phe 2035 2040 2045 <210> 5 <211> 6972 <212> DNA <213> Moraxella catarrhalis <400> 5 ccatggatat gggcaggtgt gctcgcctgc cgtatgatgg cgatgacacc ccatttgccc 60 catatctgta cgatttgaca tgtgatatga tttaacatgt gacatgattt aacattgttt 120 73 aatactgttg cattgcgccc atcagaatgg atttgatata taatggtagg tgaatgacga ccctaattat catgaatcac agagtacgcc tgtatgcact gctcagtggc aaaccagcca tgaaaatgct caatggaagc cggtggtgat tttgcttgat taacggccat acgcacaacc tcatttttcc gggtcttgcc tagctcgttg tgccctaggt accaaatacc actttccatt taaaaccgat tagaattact tttaactatt aaaagaggct tgaggtgaat tactacagct aagcacaagc aacagcagca tgatgttgat tgcaattacc aggtagcagt aaacgcaggc caatgttacc cactagtgat acatttggca taccgttaaa aaaaaatgcc taccaaaaaa caaaagcacc cggtgctaat aaataccgct tacaaacaaa cactggcatt tgccgatcaa caacgctgcc ccccattgac cgccacagta ggatgataca caccaaactg tagtgatgaa caaggaaatt aaaggtagat cgcaaataat cgacaaaaat aagcacccta agtcggtgct cattgatggc ccatcattac ctttatgtgt tgatgctata ttttgaaact ctttttgtaa tcccaatcac ttcaatcaaa atctataaag aaatcccaca ctgagctttg agtgcttatg agacgctcag aacgcacagg agtttggata gtaaaggcta cagcatggta gcagtattaa gcaagcggac aacgcctttg gccacagccg ggagcgatag caaggttctg caggcactag ggtagtaact gcggtcaatg tttcagggtg aaaggtggtg gataatagtg acaactacat gaattattga aaaaccgtct atcggcacta gaaaaacaag atagacaatg gctaacgatg gctggcatca gccccaactt aaatttagtg agctatctaa gaagaagacg ggcgcagtca gatggtacgg ctaaacaacg ggcattaaat cgcattacca ccttatcttg aacgcaggtg agtagccgca agcattaatg tttgtctcca acccatgata accattcatc aacaaaacaa gatgcccttg cacaccacca gaaaataata caagtcaaca ggtacggtta aacgacggtg gatggcgtga acaactcgca cataatttag atcatatgaa tgatgatgcc aatctattga aaatcacatc cagattcatt tgcctatgtc tcatctttaa gcacgggggg cccgtattgc ctcaaaaaaa gcactgccaa gcggtcaagc agataggtac gtggtgatgc atcctaaaca aagaaatacg acgccagtac gtacacgggc agggccaatc cccttggtgc ttgtcactca accccaagtt ctatcaaacg tggcacagct atgataacag cagagaccaa gtctgaaagt taaatgccac gtgatagttt atggcgttaa ctcgtattac caccatattt gcattgatgc cggttaccat gtgtcacacc acaacattgg ttaagggtag atgaagtcaa atgatgacgc gcatcttaaa ttacctttgg atggcttgac ttactaatgt gagataaaat atcaagacaa gtaaagccat acatagaact atatattaaa cttatgacat ccgctaacaa taacaggcac gtgctaatgg ttaacgccaa aaggcacagc atgctgatga ccctaacact cctttggcat gcttgtctat agtttgccaa ttaccagaga taacgcattt tagaatatta tacgagttga cttaaatcac gcaatattgt caagtgatgt agcatgtatc caaagccaca gggtagctgt cgcgctcgct agataccaaa ggcggacggt catcgccatc cgatgctacg ctcgattgcc tccgaaaggt aagctcaaag tgcagtggga aacagctaaa tacaatcgct aggtactcgt gagtgataat tcaagccacc taaaatcatc agaagcggtg tactgacgta cgcattaacc taaacttgct aaccacagtt aacctttacc tggggtgaag cagagataaa ggataaaaaa aggtaataaa cgaacagctc tactgaaata cgtgaaaacc tggtacgaac tcgaacggct caacgctatc actcaaaggt gcttagccaa tgttaaagat gaatggtagt tggctttgct gctacaagtt cacagggctg gggcaataca tacaggcttt tgttgacttt aaccagtaaa tgatgacaat taatacagca agacatcgcc agacaccgcc cgccaacgcc caaaggtgaa taacaccaca taaaaacccc ggttaataat tgaaattggc agtaacgcat tgattgtatc tttgggttaa catatggtta tctactgtta gtttgtatac atttttttaa ggcacattta gctacagggc gtcctcgtga catatcgcaa gatcgagcca ggtagtagta ggtcaagagt atcggtagtg actctgatta gataatgatg gccatgtcat agtgcctatt attggttctg gctcagctac aattctagac aataatacga aatgtcggtg gtgaagtggg aaaataggtt gataataata aaaactttaa aaggtaggta cagcccaata tttactaata attggctttg caacttaaag aagatcagta aaagccgcca tcagttgatg accgagctta aatagcttag gacagtgctc accgtggcta aaaaacggtc gatagcggtc accaacgaac aatccaggta ggttctgatg ggcaatgtta tccccaacac atccaagaca aacctaaaaa gccaatggca gtggtatatg aaaaaacttg actaacttta gaaaatctaa ctacaaacct atcaccgtgg aacggtctta agcggtctta actggtagcg aatggtgttg tttactggga ttgtaaaaat tgattattgt tcactctatg taatttagca ctaccatgct gcaccattta ggtaaaccac tggcagtggc aagttggcag tcggtgcaac ttggtgaaca ttgctattgg ataaaactgt ccatcgccat atgacttaca acgatcttat taaaatatag atgcacaggg ccttggcagt atgcaacatc agggcagtat cggcctatac aggcgggtcc caggtgttaa ctaaggagcg tggataatac tcggtgtggt acaatcttac gtagtagtag caggcagtca atgcagaaac ctcgagatgg tgggtagtgt atcttgccaa agcctacttt ctaagagtgg acagtgatgg ttaccgccga tacaaagctt aagatacgac taacggttgc tgaccattgg aaatccaagt ctggcattgc gtgcagttga agattaccaa tgcctagcat aagacaaatc ataataacaa atgccaccac atgtgaatgt gcgtcaaaac atgttaactc acaccctagc ttaccgttaa gtcaaaagaa atattaaaac aagccggcaa aacaaatcca taggtgctgg ctaatggctc 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 198 0 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 H acttgataaa taccaacatt gatttatgat aaactcatta cccttactcc cggcattacc cttaaccacg ccaaaatggt taaaggtagc tgccgccagc ggttgacttt taaggtgacc tgatacaacc tactggcaca caaggccagt aggggcaagc ctatgacagt caaagaagtt tcaaatgaat aggcatcaat aaccaaaaac ctttgcaggg tgggcaaaca tggcttcact caccaaaatt cacccctgtg caaaggcaca gttgggtctt catcaaaaaa ggtacttggc gggcgtggat aaaagatggc tttgaccaac ccatgtcaac tgcctcaggc cgttgccata acaagccacg ctctggtgcc taacaaccag cgtgaccgaa cgcaggcaca aaccggtacg ctcaggtgct cgatgcggtc tgagcttgac gatggcgatg tattgccacc tggtcaatgg agttggtgca tcaccatagt atcacttaaa atcataggta gtgccattga ctgcaggtcg agcaaacccc caatcaggtg ttaaaaaccg cacgaattct agttatgaca accaaggtaa cctaagctga caaaatacca gtacgcacca attgttgatg gtctccactt tatgatgaca attgaagtta ggtgctaata gatatcgttg caagcgaaca accgataaca gccaaagaca gtcaaatcag gaagacaacg gccgcagtaa gatacaggca gacaccaata gtcaaacttg gatgacaaag ctaagtgcca aaagataccg ggtaatgctg gacccaaatt ggtaaaggta aaagacggca agcaaaaaag aaccccgcag gatggcaatc aagcactcag ggcagacaaa ggcgatcaat atcggcgacc tttaccgatg agtaactcgg caagccaaaa gttaaaggct gaacgccgta aatggtagcc catcgtatcc gcgtccatgc cacaacggtc gtatttaaaa ggttttcact tgtataaaac ccattttacc aacttattga ccaaaaaatg ac acctaagcaa agattgccca aacttgaaaa cagtagcaga cctcaaagac ataaaggtgt ccgtgggtaa tcacaggact cagaacaggg tgctaagcgc atgacaccgt caagcaaaac aagataaaaa aatttgccct ctcatctaaa actcagcagg agtactatca aactggtcgc tcattaacaa cctttgttaa ctgtgggtga caacggctaa agctaaccga ccaaagacct gcgtgtcttt atgggctgga acgctgccaa gtaatgataa caggttcatc ataacgatac acgctaacgg ccctgctcgc aagccattga aagagcctgt tggcgatagg cccaagcagg ccatcgccat caagcactgt ccactcaaac ttgccttagg aatctgacgg ttgctggaca tccaaaatgt agttgtacaa accaaaacga cacaagccta aaggtgcggt tcaatggttc tttaagccat agcatcagca gctcaagtga gtaaatttta accgatttat agacggcatt aaacagccat caaaatcagc tgaacaaggt ctctgatgtc ggtgcgtgtg taataatggc aagcaacact caatataatc aggctttaac caactttgcc cagtaaagtg acttggcgta aagcaatcaa caccttatct ctatgtggat agccaaaaat ccaagcccaa agaacaagta aggacttgaa tttaaatgcc aaaactgggc taataacatc aaccaatctt tgtagactca cctgggtggc tgtacaacag cgctgacggc atctaaccgc cgaaaaactt cgatttaagc cacttataac cagaataaat ggtacaaggg tttccaggcc caaccaatcc cggtacaggc taaggctgat cgatgtcttt ttcaaactct cacagcaggt aacggcggtt ggcagcaggt agccacccaa aaataaggcc cattcctggc ggcagtggga agccgatacc aaatcgcaag tcagtcatat ttctctttca tcaatgtagt cccgaaaatt aacgcaggtg gatgctgtga agtactgcca aataacttta atcacctttg ggcattgacc aaaggcattg ctagctaatg aaagacgaag ttgcaaggca gatggcaatg gtctatgatg aaaaccacca gctactggcg ggcgacatcc gctgatggca gatggcacag accccagatg aatgatgcca aaagccgctt gttgcccaaa gagactttga ggtgtggtag aacagcgtta agcggtcaag aaggtcatca ttaaacgaag aatcaggtaa actgtcatca gccactggtg aatgtttggg gccgcaggtc gaacaaggta cgtaacggca aaggcagatg atcgccatcg aatgtggtag aacagttaca ggtgtgggca gccatcagtg acaaccacca ggtgcggtct gaggtcagtg agcattgcca aatgcaggga agatccatgg ctgtcgaagc caaggccatg attttactta tactgatgct ccatgaccaa tgttagatat tctgattatg gtaaaaagat caggcggcaa aaacagcaca cggttagtaa caggtgaaaa aaaccaaagg tcattgacag ttaccaatga acaaaacccg atggtgaagc ccaccaccgc tcaatgtgga cattgaccag atgcgcttgt aaactgccaa ataaggtcat ttgataaaac gcacattggc ataaaaagca ctgataacaa caccgctgac ccatcaaagg caggtactga atgcaggtgg ccaaagcaaa gtaatgtggg tacgcaactt acattgccga aagcaggcac gtatacaagt tcaaaaccca agaccaacta tccgcttctt ttgactcaag gtgaagccgc gtgataacgc caggtaagca gtgtgggtaa ataacatcac caggcacaca cagcaggtgc ccgtgggtgc ccaccagcac acgcaaccaa tttcatcagc ttaccggggg tgtcggataa taggggcggc aaaatcaatc gatgtttttt atcgccattg ggttaaaatt atccgttgac 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 444 0 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 6972 <210> 6 <211> 6141 <212> DNA <213> Moraxella catarrhalis <400> 6 atgaatcaca tctataaagt catctttaac gagtacgcca aatcccacag cacggggggg gtatgcactc tgagctttgc ccgtattgcc ctcagtggca gtgcttatgc tcaaaaaaaa aaccagccaa gacgctcagg cactgccaag gaaaatgcta acgcacaggg cggtcaagcc aatggaagca gtttggataa gataggtacc ggtggtgatg taaaggctag tggtgatgcc ttgcttgatc agcatggtaa tcctaaacat aacggccatg cagtattaaa agaaatacga cgcacaaccg caagcggaca cgccagtact catttttcca acgcctttgg tacacgggca ggtcttgccg ccacagccga gggccaatct agctcgttgg gagcgatagc ccttggtgca gccctaggtc aaggttctgt tgtcactcag ccaaataccc aggcactaga ccccaagttt ctttccattg gtagtaactc tatcaaacgt aaaaccgatg cggtcaatgt ggcacagcta agaattactt ttcagggtga tgataacagt ttaactatta aaggtggtgc agagaccaac aaagaggctg ataatagtgg tctgaaagtt gaggtgaata caactacatt aaatgccaca actacagctg aattattgag tgatagttta agcacaagca aaaccgtcta tggcgttaat acagcagcaa tcggcactac tcgtattacc gatgttgatg aaaaacaagc accatatttg gcaattacca tagacaatgg cattgatgca ggtagcagtg ctaacgatgc ggttaccatc. aacgcaggcg ctggcatcag tgtcacacct aatgttaccg ccccaactta caacattggc actagtgata aatttagtgt taagggtagt catttggcaa gctatctaaa tgaagtcaat accgttaaag aagaagacga tgatgacgcc aaaaatgccg gcgcagtcag catcttaaaa accaaaaaag atggtacggt tacctttggg aaaagcaccc taaacaacga tggcttgact ggtgctaatg gcattaaatt tactaatgtg aataccgctc gcattaccag agataaaatt acaaacaaac cttatcttga tcaagacaag actggcatta acgcaggtgg taaagccatc gccgatcaaa gtagccgcaa catagaactg aacgctgcca gcattaatga tatattaaat cccattgact ttgtctccac ttatgacatt gccacagtaa cccatgatac cgctaacaaa gatgatacaa ccattcatct aacaggcact accaaactga acaaaacaag tgctaatggt agtgatgaag atgcccttgt taacgccaaa aaggaaattc acaccaccaa aggcacagca aaggtagatg aaaataataa tgctgatgac gcaaataatc aagtcaacac cctaacactc gacaaaaatg gtacggttac ctttggcatt agcaccctaa acgacggtgg cttgtctatt gtcggtgctg atggcgtgaa gtttgccaag attgatggca caactcgcat taccagagat cttgataaaa gcaaacccca cctaagcaaa accaacattc aatcaggtga gattgcccaa atttatgatt taaaaaccga acttgaaaac aactcattac acgaattctc agtagcagat ccttactcca gttatgacac ctcaaagacc ggcattacca ccaaggtaaa taaaggtgtg 7r aaagccacag gcacatttat ggcagtggca 60 ggtagctgtg ctacagggca agttggcagt 120 gcgctcgctg tcctcgtgat cggtgcaacg 180 gataccaaac atatcgcaat tggtgaacaa 240 gcggacggtg atcgagccat tgctattggt 300 atcgccatcg gtagtagtaa taaaactgtc 360 gatgctacgg gtcaagagtc catcgccatc 420 tcgattgcca tcggtagtga tgacttacat 480 ccgaaaggta ctctgattaa cgatcttatt 540 agctcaaagg ataatgatgt aaaatataga 600 gcagtgggag ccatgtcata tgcacagggt 660 acagctaaaa gtgcctattc cttggcagtg 720 acaatcgcta ttggttctga tgcaacatct 780 ggtactcgtg ctcagctaca gggcagtatt 840 agtgataata attctagacc ggcctataca 900 caagccacca ataatacgaa ggcgggtcca 960 aaaatcatca atgtcggtgc aggtgttaat 1020 gaagcggtgg tgaagtgggc taaggagcgt 1080 actgacgtaa aaataggttt ggataatact 1140 gcattaaccg ataataatat cggtgtggta 1200 aaacttgcta aaactttaaa caatcttact 1260 accacagtta aggtaggtag tagtagtagt 1320 acctttaccc agcccaatac aggcagtcaa 1380 ggggtgaagt ttactaataa tgcagaaaca 1440 agagataaaa ttggctttgc tcgagatggt 1500 gataaaaaac aacttaaagt gggtagtgtt 1560 ggtaataaaa agatcagtaa tcttgccaaa 1620 gaacagctca aagccgccaa gcctacttta 1680 actgaaatat cagttgatgc taagagtggc 1740 gtgaaaacca ccgagcttaa cagtgatggc 1800 ggtacgaaca atagcttagt taccgccgaa 1860 cgaacggctg acagtgctct acaaagcttt 1920 aacgctatca ccgtggctaa agatacgaca 1980 ctcaaaggta aaaacggtct aacggttgct 204 0 cttagccaag atagcggtct gaccattggc 2100 gttaaagata ccaacgaaca aatccaagtc 2160 aatggtagta atccaggtac tggcattgca 2220 ggctttgctg gttctgatgg tgcagttgat 2280 ctacaagttg gcaatgttaa gattaccaac 2340 acagggctgt ccccaacact gcctagcatt 2400 ggcaatacaa tccaagacaa agacaaatcc 2460 acaggcttta acctaaaaaa taataacaac 2520 gttgactttg ccaatggcaa tgccaccacc 2580 accagtaaag tggtatatga tgtgaatgtg 2640 gatgacaata aaaaacttgg cgtcaaaacc 2700 aatacagcaa ctaactttaa tgttaactct 27 60 gacatcgccg aaaatctaaa caccctagcc 2820 gacaccgccc tacaaacctt taccgttaaa 2880 gccaacgcca tcaccgtggg tcaaaagaac 294 0 aaaggtgaaa acggtcttaa tattaaaacc 3000 aacaccacaa gcggtcttaa agccggcaaa 3060 aaaaacccca ctggtagcga acaaatccaa 3120 gttaataata atggtgttgt aggtgctggc 3180 gaaattggct ttactgggac taatggctca 3240 gacggcatta acgcaggtgg taaaaagatt 3300 aacagccatg atgctgtgac aggcggcaag 3360 aaaatcagca gtactgccaa aacagcacaa 3420 gaacaaggta ataactttac ggttagtaac 3480 tctgatgtca tcacctttgc aggtgaaaac 3540 gtgcgtgtgg gcattgacca aaccaaaggc 3600 76 ttaaccacgc caaaatggtc aaaggtagcg gccgccagca gttgactttg aaggtgacct gatacaacca actggcacag aaggccagtg ggggcaagcc tatgacagta aaagaagttg caaatgaatg ggcatcaatg accaaaaacg tttgcagggg gggcaaacag ggcttcactg accaaaattg acccctgtgc aaaggcacaa ttgggtcttg atcaaaaaag gtacttggcg ggcgtggata aaagatggca ttgaccaaca catgtcaacg gcctcaggca gttgccatag caagccacgg tctggtgcca aacaaccagt gtgaccgaaa gcaggcacac accggtacgg tcaggtgctg gatgcggtca gagcttgacc atggcgatgg attgccaccc ggtcaatggg gttggtgcag ctaagctgac aaaataccat tacgcaccac ttgttgatgt tctccactta atgatgacac ttgaagttaa gtgctaataa atatcgttgc aagcgaacaa ccgataacaa ccaaagacaa tcaaatcagt aagacaacgc ccgcagtaac atacaggcac acaccaataa tcaaacttgc atgacaaagg taagtgccaa aagataccga gtaatgctgg acccaaattc gtaaaggtaa aagacggcaa gcaaaaaagc accccgcaga atggcaatca agcactcagt gcagacaaac gcgatcaatc tcggcgaccc ttaccgatgc gtaactcggt aagccaaaaa ttaaaggctt aacgccgtat atggtagcca atcgtatcca cgtccatgcc acaacggtca tatttaaaat gttttcactt cgtgggtaat cacaggacta agaacagggc gctaagcgca tgacaccgtc aagcaaaacc agataaaaaa atttgcccta tcatctaaac ctcagcaggc gtactatcaa actggtcgcc cattaacaaa ctttgttaaa tgtgggtgat aacggctaaa gctaaccgat caaagaccta cgtgtctttt tgggctggac cgctgccaat taatgataac aggttcatca taacgatacc cgctaacggc cctgctcgcc agccattgac agagcctgtg ggcgataggt ccaagcaggc catcgccatc aagcactgtt cactcaaacc tgccttaggt atctgacggc tgctggacaa ccaaaatgtg gttgtacaaa ccaaaacgaa acaagcctac aggtgcggtg caatggttca t aataatggca agcaacactc aatataatca ggctttaact aactttgccg agtaaagtgg cttggcgtaa agcaatcaag accttatctg tatgtggatg gccaaaaatg caagcccaaa gaacaagtaa ggacttgaaa ttaaatgccg aaactgggcg aataacatcg accaatctta gtagactcaa ctgggtggca gtacaacagt gctgacggca tctaaccgca gaaaaacttg gatttaagca acttataacg agaataaatg gtacaagggc ttccaggcca aaccaatcca ggtacaggca aaggctgata gatgtctttg tcaaactctg acagcaggta acggcggttg gcagcaggtg gccacccaaa aataaggcca attcctggca gcagtgggac gccgataccc aaggcattgt tagctaatgt aagacgaaga tgcaaggcaa atggcaatgc tctatgatgt aaaccaccac ctactggcga gcgacatcca ctgatggcaa atggcacagt ccccagatgg atgatgccaa aagccgcttc ttgcccaaac agactttgac gtgtggtagc acagcgttaa gcggtcaagc aggtcatcag taaacgaagt atcaggtaaa ctgtcatcaa ccactggtgg atgtttgggt ccgcaggtca aacaaggtat gtaacggcat aggcagatgg tcgccatcgg atgtggtagc acagttacag gtgtgggcaa ccatcagtgc caaccaccac gtgcggtctc aggtcagtgc gcattgccaa atgcagggat gatccatggt tgtcgaagct aaggccatgt cattgacagc taccaatgat caaaacccgt tggtgaagcg caccaccgct caatgtggat attgaccagt tgcgcttgtc aactgccaaa taaggtcatc tgataaaacc cacattggct taaaaagcaa tgataacaaa accgctgacc catcaaaggt aggtactgat tgcaggtggc caaagcaaac taatgtgggc acgcaacttg cattgccgac agcaggcacg tatacaagtg caaaacccaa gaccaactat ccgcttcttc tgactcaagt tgaagccgcc tgataacgca aggtaagcac tgtgggtaat taacatcacc aggcacacac agcaggtgca cgtgggtgcc caccagcacc cgcaaccaat ttcatcagcg taccgggggt gtcggataat aggggcggca 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6141 <210> 7 <211> 2047 <212> PRT <213> Moraxella catarrhalis <400> 7 Met Asn His lie Tyr Lys Val lie Phe Asn Lys Ala Thr Gly Thr Phe 15 10 15 Met Ala Val Ala Glu Tyr Ala Lys Ser His Ser Thr Gly Gly Gly Ser 20 25 30 Cys Ala Thr Gly Gin Val Gly Ser Val Cys Thr Leu Ser Phe Ala Arg 35 40 45 lie Ala Ala Leu Ala Val Leu Val lie Gly Ala Thr Leu Ser Gly Ser 7-? 50 55 60 Ala Tyr Ala Gin Lys Lys Asp Thr Lys His lie Ala lie Gly Glu Gin 65 70 75 80 Asn Gin Pro Arg Arg Ser Gly Thr Ala Lys Ala Asp Gly Asp Arg Ala 85 90 95 lie Ala lie Gly Glu Asn Ala Asn Ala Gin Gly Gly Gin Ala lie Ala 100 105 110 lie Gly Ser Ser Asn Lys Thr Val Asn Gly Ser Ser Leu Asp Lys lie 115 120 125 Gly Thr Asp Ala Thr Gly Gin Glu Ser lie Ala lie Gly Gly Asp Val 130 135 140 Lys Ala Ser Gly Asp Ala Ser lie Ala lie Gly Ser Asp Asp Leu His 145 150 155 160 Leu Leu Asp Gin His Gly Asn Pro Lys His Pro Lys Gly Thr Leu lie 165 170 175 Asn Asp Leu lie Asn Gly His Ala Val Leu Lys Glu lie Arg Ser Ser 180 185 190 Lys Asp Asn Asp Val Lys Tyr Arg Arg Thr Thr Ala Ser Gly His Ala 195 200 205 Ser Thr Ala Val Gly Ala Met Ser Tyr Ala Gin Gly His Phe Ser Asn 210 215 220 Ala Phe Gly Thr Arg Ala Thr Ala Lys Ser Ala Tyr Ser Leu Ala Val 225 230 235 240 Gly Leu Ala Ala Thr Ala Glu Gly Gin Ser Thr lie Ala lie Gly Ser 245 250 255 Asp Ala Thr Ser Ser Ser Leu Gly Ala lie Ala Leu Gly Ala Gly Thr 260 265 270 Arg Ala Gin Leu Gin Gly Ser lie Ala Leu Gly Gin Gly Ser Val Val 275 280 285 Thr Gin Ser Asp Asn Asn Ser Arg Pro Ala Tyr Thr Pro Asn Thr Gin 290 295 300 Ala Leu Asp Pro Lys Phe Gin Ala Thr Asn Asn Thr Lys Ala Gly Pro 305 310 315 320 Leu Ser lie Gly Ser Asn Ser lie Lys Arg Lys lie lie Asn Val Gly 325 330 335 Ala Gly Val Asn Lys Thr Asp Ala Val Asn Val Ala Gin Leu Glu Ala 340 345 350 Val Val Lys Trp Ala Lys Glu Arg Arg lie Thr Phe Gin Gly Asp Asp 355 360 365 Asn Ser Thr Asp Val Lys lie Gly Leu Asp Asn Thr Leu Thr lie Lys 370 375 380 7* Gly Gly Ala Glu Thr Asn Ala Leu Thr Asp Asn Asn lie Gly Val Val 385 390 395 400 Lys Glu Ala Asp Asn Ser Gly Leu Lys Val Lys Leu Ala Lys Thr Leu 405 410 415 Asn Asn Leu Thr Glu Val Asn Thr Thr Thr Leu Asn Ala Thr Thr Thr 420 425 430 Val Lys Val Gly Ser Ser Ser Ser Thr Thr Ala Glu Leu Leu Ser Asp 435 440 445 Ser Leu Thr Phe Thr Gin Pro Asn Thr Gly Ser Gin Ser Thr Ser Lys 450 455 460 Thr Val Tyr Gly Val Asn Gly Val Lys Phe Thr Asn Asn Ala Glu Thr 465 470 475 480 Thr Ala Ala lie Gly Thr Thr Arg lie Thr Arg Asp Lys He Gly Phe 485 490 495 Ala Arg Asp Gly Asp Val Asp Glu Lys Gin Ala Pro Tyr Leu Asp Lys 500 505 510 Lys Gin Leu Lys Val Gly Ser Val Ala lie Thr lie Asp Asn Gly lie 515 520 525 Asp Ala Gly Asn Lys Lys lie Ser Asn Leu Ala Lys Gly Ser Ser Ala 530 535 540 Asn Asp Ala Val Thr lie Glu Gin Leu Lys Ala Ala Lys Pro Thr Leu 545 550 555 560 Asn Ala Gly Ala Gly lie Ser Val Thr Pro Thr Glu lie Ser Val Asp 565 570 575 Ala Lys Ser Gly Asn Val Thr Ala Pro Thr Tyr Asn lie Gly Val Lys 580 585 590 Thr Thr Glu Leu Asn Ser Asp Gly Thr Ser Asp Lys Phe Ser Val Lys 595 600 605 Gly Ser Gly Thr Asn Asn Ser Leu Val Thr Ala Glu His Leu Ala Ser 610 615 620 Tyr Leu Asn Glu Val Asn Arg Thr Ala Asp Ser Ala Leu Gin Ser Phe 625 630 635 640 Thr Val Lys Glu Glu Asp Asp Asp Asp Ala Asn Ala lie Thr Val Ala 645 650 655 Lys Asp Thr Thr Lys Asn Ala Gly Ala Val Ser lie Leu Lys Leu Lys 660 665 670 Gly Lys Asn Gly Leu Thr Val Ala Thr Lys Lys Asp Gly Thr Val Thr 675 680 685 Phe Gly Leu Ser Gin Asp Ser Gly Leu Thr lie Gly Lys Ser Thr Leu 690 695 700 Asn Asn Asp Gly Leu Thr Val Lys Asp Thr Asn Glu Gin lie Gin Val 705 710 715 720 Gly Ala Asn Gly lie Lys Phe Thr Asn Val Asn Gly Ser Asn Pro Gly 725 730 735 Thr Gly lie Ala Asn Thr Ala Arg lie Thr Arg Asp Lys lie Gly Phe 740 745 750 Ala Gly Ser Asp Gly Ala Val Asp Thr Asn Lys Pro Tyr Leu Asp Gin 755 760 765 Asp Lys Leu Gin Val Gly Asn Val Lys lie Thr Asn Thr Gly lie Asn 770 775 780 Ala Gly Gly Lys Ala lie Thr Gly Leu Ser Pro Thr Leu Pro Ser lie 785 790 795 800 Ala Asp Gin Ser Ser Arg Asn lie Glu Leu Gly Asn Thr lie Gin Asp 805 810 815 Lys Asp Lys Ser Asn Ala Ala Ser lie Asn Asp lie Leu Asn Thr Gly 820 825 830 Phe Asn Leu Lys Asn Asn Asn Asn Pro lie Asp Phe Val Ser Thr Tyr 835 840 845 Asp lie Val Asp Phe Ala Asn Gly Asn Ala Thr Thr Ala Thr Val Thr 850 855 860 His Asp Thr Ala Asn Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val 865 870 875 880 Asp Asp Thr Thr lie His Leu Thr Gly Thr Asp Asp Asn Lys Lys Leu 885 890 895 Gly Val Lys Thr Thr Lys Leu Asn Lys Thr Ser Ala Asn Gly Asn Thr 900 905 910 Ala Thr Asn Phe Asn Val Asn Ser Ser Asp Glu Asp Ala Leu Val Asn 915 920 925 Ala Lys Asp lie Ala Glu Asn Leu Asn Thr Leu Ala Lys Glu lie His 930 935 940 Thr Thr Lys Gly Thr Ala Asp Thr Ala Leu Gin Thr Phe Thr Val Lys 945 .950 955 960 Lys Val Asp Glu Asn Asn Asn Ala Asp Asp Ala Asn Ala lie Thr Val 965 970 975 Gly Gin Lys Asn Ala Asn Asn Gin Val Asn Thr Leu Thr Leu Lys Gly 980 985 990 Glu Asn Gly Leu Asn lie Lys Thr Asp Lys Asn Gly Thr Val Thr Phe 995 1000 1005 Gly lie Asn Thr Thr Ser Gly Leu Lys Ala Gly Lys Ser Thr Leu Asn 1010 1015 1020 Asp Gly Gly Leu Ser lie Lys Asn Pro Thr Gly Ser Glu Gin lie Gin w 1025 1030 1035 1040 Val Gly Ala Asp Gly Val Lys Phe Ala Lys Val Asn Asn Asn Gly Val 1045 1050 1055 Val Gly Ala Gly lie Asp Gly Thr Thr Arg lie Thr Arg Asp Glu lie 1060 1065 1070 Gly Phe Thr Gly Thr Asn Gly Ser Leu Asp Lys Ser Lys Pro His Leu 1075 1080 1085 Ser Lys Asp Gly lie Asn Ala Gly Gly Lys Lys lie Thr Asn lie Gin 1090 1095 1100 Ser Gly Glu lie Ala Gin Asn Ser His Asp Ala Val Thr Gly Gly Lys 1105 1110 1115 1120 lie Tyr Asp Leu Lys Thr Glu Leu Glu Asn Lys lie Ser Ser Thr Ala 1125 1130 1135 Lys Thr Ala Gin Asn Ser Leu His Glu Phe Ser Val Ala Asp Glu Gin 1140 1145 1150 Gly Asn Asn Phe Thr Val Ser Asn Pro Tyr Ser Ser Tyr Asp Thr Ser 1155 1160 1165 Lys Thr Ser Asp Val lie Thr Phe Ala Gly Glu Asn Gly lie Thr Thr 1170 1175 1180 Lys Val Asn Lys Gly Val Val Arg Val Gly lie Asp Gin Thr Lys Gly 1185 1190 1195 1200 Leu Thr Thr Pro Lys Leu Thr Val Gly Asn Asn Asn Gly Lys Gly lie 1205 1210 1215 Val lie Asp Ser Gin Asn Gly Gin Asn Thr lie Thr Gly Leu Ser Asn 1220 1225 1230 Thr Leu Ala Asn Val Thr Asn Asp Lys Gly Ser Val Arg Thr Thr Glu 1235 1240 1245 Gin Gly Asn lie lie Lys Asp Glu Asp Lys Thr Arg Ala Ala Ser lie 1250 1255 1260 Val Asp Val Leu Ser Ala Gly Phe Asn Leu Gin Gly Asn Gly Glu Ala 1265 1270 1275 1280 Val Asp Phe Val Ser Thr Tyr Asp Thr Val Asn Phe Ala Asp Gly Asn Ala Thr Thr Ala Lys Val Thr Tyr Asp Asp Thr Ser Lys Thr Ser Lys 1300 1305 1310 Val Val Tyr Asp Val Asn Val Asp Asp Thr Thr lie Glu Val Lys Asp 1315 1320 1325 Lys Lys Leu Gly Val Lys Thr Thr Thr Leu Thr Ser Thr Gly Thr Gly 1330 1335 1340 Ala Asn Lys Phe Ala Leu Ser Asn Gin Ala Thr Gly Asp Ala Leu Val 1285 1290 1295 1345 1350 1355 1360 Lys Ala Ser Asp lie Val Ala His Leu Asn Thr Leu Ser Gly Asp lie 1365 1370 1375 Gin Thr Ala Lys Gly Ala Ser Gin Ala Asn Asn Ser Ala Gly Tyr Val 1380 1385 1390 Asp Ala Asp Gly Asn Lys Val lie Tyr Asp Ser Thr Asp Asn Lys Tyr 1395 1400 1405 Tyr Gin Ala Lys Asn Asp Gly Thr Val Asp Lys Thr Lys Glu Val Ala 1410 1415 1420 Lys Asp Lys Leu Val Ala Gin Ala Gin Thr Pro Asp Gly Thr Leu Ala 1425 1430 1435 1440 Gin Met Asn Val Lys Ser Val lie Asn Lys Glu Gin Val Asn Asp Ala 1445 1450 1455 Asn Lys Lys Gin Gly lie Asn Glu Asp Asn Ala Phe Val Lys Gly Leu 1460 1465 1470 Glu Lys Ala Ala Ser Asp Asn Lys Thr Lys Asn Ala Ala Val Thr Val 1475 1480 1485 Gly Asp Leu Asn Ala Val Ala Gin Thr Pro Leu Thr Phe Ala Gly Asp 1490 1495 1500 Thr Gly Thr Thr Ala Lys Lys Leu Gly Glu Thr Leu Thr lie Lys Gly 1505 1510 1515 1520 Gly Gin Thr Asp Thr Asn Lys Leu Thr Asp Asn Asn lie Gly Val Val 1525 1530 1535 Ala Gly Thr Asp Gly Phe Thr Val Lys Leu Ala Lys Asp Leu Thr Asn 1540 1545 1550 Leu Asn Ser Val Asn Ala Gly Gly Thr Lys lie Asp Asp Lys Gly Val 1555 1560 1565 Ser Phe Val Asp Ser Ser Gly Gin Ala Lys Ala Asn Thr Pro Val Leu 1570 1575 1580 Ser Ala Asn Gly Leu Asp Leu Gly Gly Lys Val lie Ser Asn Val Gly 1585 1590 1595 1600 Lys Gly Thr Lys Asp Thr Asp Ala Ala Asn Val Gin Gin Leu Asn Glu 1605 1610 1615 Val Arg Asn Leu Leu Gly Leu Gly Asn Ala Gly Asn Asp Asn Ala Asp 1620 1625 1630 Gly Asn Gin Val Asn lie Ala Asp lie Lys Lys Asp Pro Asn Ser Gly 1635 1640 1645 Ser Ser Ser Asn Arg Thr Val lie Lys Ala Gly Thr Val Leu Gly Gly 1650 1655 1660 Lys Gly Asn Asn Asp Thr Glu Lys Leu Ala Thr Gly Gly lie Gin Val 1665 1670 1675 1680 n Gly Val Asp Lys Asp Gly Asn Ala Asn Gly Asp Leu Ser Asn Val Trp 1685 1690 1695 Val Lys Thr Gin Lys Asp Gly Ser Lys Lys Ala Leu Leu Ala Thr Tyr 1700 1705 1710 Asn Ala Ala Gly Gin Thr Asn Tyr Leu Thr Asn Asn Pro Ala Glu Ala 1715 1720 1725 lie Asp Arg lie Asn Glu Gin Gly lie Arg Phe Phe His Val Asn Asp 1730 1735 1740 Gly Asn Gin Glu Pro Val Val Gin Gly Arg Asn Gly lie Asp Ser Ser 1745 1750 1755 1760 Ala Ser Gly Lys His Ser Val Ala lie Gly Phe Gin Ala Lys Ala Asp 1765 1770 1775 Gly Glu Ala Ala Val Ala lie Gly Arg Gin Thr Gin Ala Gly Asn Gin 1780 1785 1790 Ser lie Ala lie Gly Asp Asn Ala Gin Ala Thr Gly Asp Gin Ser lie 1795 1800 1805 Ala lie Gly Thr Gly Asn Val Val Ala Gly Lys His Ser Gly Ala lie 1810 1815 1820 Gly Asp Pro Ser Thr Val Lys Ala Asp Asn Ser Tyr Ser Val Gly Asn 1825 1830 1835 1840 Asn Asn Gin Phe Thr Asp Ala Thr Gin Thr Asp Val Phe Gly Val Gly 1845 1850 1855 Asn Asn lie Thr Val Thr Glu Ser Asn Ser Val Ala Leu Gly Ser Asn 1860 1865 1870 Ser Ala lie Ser Ala Gly Thr His Ala Gly Thr Gin Ala Lys Lys Ser 1875 1880 1885 Asp Gly Thr Ala Gly Thr Thr Thr Thr Ala Gly Ala Thr Gly Thr Val 1890 1895 1900 Lys Gly Phe Ala Gly Gin Thr Ala Val Gly Ala Val Ser Val Gly Ala 1905 1910 1915 1920 Ser Gly Ala Glu Arg Arg lie Gin Asn Val Ala Ala Gly Glu Val Ser 1925 1930 1935 Ala Thr Ser Thr Asp Ala Val Asn Gly Ser Gin Leu Tyr Lys Ala Thr 1940 1945 1950 Gin Ser lie Ala Asn Ala Thr Asn Glu Leu Asp His Arg lie His Gin 1955 1960 1965 Asn Glu Asn Lys Ala Asn Ala Gly lie Ser Ser Ala Met Ala Met Ala 1970 1975 1980 Ser Met Pro Gin Ala Tyr lie Pro Gly Arg Ser Met Val Thr Gly Gly 1985 1990 1995 2000 lie Ala Thr His Asn Gly Gin Gly Ala Val Ala Val Gly Leu Ser Lys 2005 S3 2010 2015 Leu Ser Asp Asn Gly Gin Trp Val Phe Lys lie Asn Gly Ser Ala Asp 2020 2025 2030 Thr Gin Gly His Val Gly Ala Ala Val Gly Ala Gly Phe His Phe 2035 2040 2045 <210> 8 <211> 6159 <212> DNA <213> Moraxella catarrhalis <400> 8 atgaatcaca gaatatgcca gtacgcactc ctcaatggca aagataaaca ggtagtcttt cctaataatg atcggtggtg tatttgccta atattaaaaa caagggcacg gcctttggta caagccacaa gcgacagcca ggttctcaga aaaacgttag attggtaata ggttctcggg aatcgtaaaa ttgggcaata atcggtgtgg ttgaccagtg gagctacaaa gtctacagca actactcgta agcaaacctt agcttgactg aaatttgcca attaccgaag tatttggata aatgctggta accatcaaac aatagtaata attagcgtga gttagtaatg aataaagtca aatagcaaca aaactcaaag tttggcattg aatggtaatc atcattaaag gcactgggca ctaaatgcag gacactgttg aatcaaacca ggcgataatg tctataaagt aatcccacag taagctttgc gtgcttatgc acacgctgaa ctaaggcaca gtagtaatgg atgtattggc agaatcttga aaatacaaac ccagtactgc catacgcaac aacaatcttc ttggtggaaa tccttgatag cagaccagta gtaataataa ataccgatgc ttacttttaa ctttaactat taacagatgg tctccgctac gcggtggttt ttgatggatt ttaccaaaaa atcttgacaa ttaataacac cagtcgctaa agaaaattgg aagaacgact atcacaagat agctcaaaga acggggatct aaaccactaa ctcatgataa atgaaacggc acgccatcac gtgaaaacgg accaaagtaa gattggttat gattgtcccc atacaatcga gctttaacct actttatcga gtaaagtggc gcaagaaaca catctttaac tacggggggg ccgtattgcc tcaacaaatt aggcgatgcc aggctctcaa taatgtaggt tgagggtgat tctgaagaat ctcaaccgat agtgggagcc agctgaagct aatcgctgtt tactgtagtt ggataataat taaagccacc taatagcagt ggtcaatgtg gggtgatggt taaaggtgat caatggtctg caacaaaatc gacctttagc gaagtttact gaaaattggt cgaaaagcta cactggtaat taatgttgca ttttgctggt taaagtgggt taccggactt cgccaagcct agttgatagt gcttaacagt caatagctta tgacagtgct cgtgggtaaa tgttaatatt tggtctcacc tgagcaagtc aacactgcct agaaaaagac aaaaaataat tggcaatgcc gtatgatgtg acttggcgtc aaagccacag ggtagctgtg gcgctcgctg actaccaaga ctagcgacag gctattgcta tcccacgcca gcctcgattg gaatttcaca ggtaaaatca atgtcatatg gcctattcct ggttccaatg aatttgggtc acagatgcca cgccagggtg atcaggcgta gcacagctta gacaataata gcacagacca aaagttaaac accgttagta ccaataacag aatgatagta tttgctggta aaagttggca aaacaaatcc aatacctcag actaatgatg cgtgttgaaa act.aatggta actttaaacg agtggcaata aatggcacca gttaccgcca ctaccaagct gatacaaacg acgaccaata acgcctaagc cctagcgctg agcattgcca aaatccaacg ggcaaagaca accaccgcca aatgtggatg aaaaccatca gcacatttat ctacagggca tcctcgtgat tcgaaattgg gtgaagcatc tcggtagtgt aaggtaacga ccatcggtag aacttattca aatatcgacg cacagggtca tggcagtagg caaaagctaa gaggcgttgc gtgcctatgt attctacgga aaatcatcaa aattggtgga gcaatagcgt acgcattaac ttgctaaaga ataccaacaa gtacaaaaac atagtatagc ctaatgatgg acagcaccct aagtcggtgc caacagtcgg gagttgatga ttaccacaga tagcaaatac caggcgatgg ttaccacccc gtggtaataa aagatttggc ttaaagtcca gcaagacctt gagccacagg tgaccgtggg acggtaacag gtccaagtgg ctgccagcat aagactttgt cagtaactta agaaaaccat aactgaccga ggccgtggcg agttggcagt cggtgcgacg tcaaacaaac cattgctttt caaaccagat gtccatcgcc tgatgactta tggccatgaa cacaagagca tttttccaac tcttgccgcc cgcgtttgca cctaggtttt accactaggt tatattttcc tgtcggtgcg ggaactggct agaaagaggt cgaagctaac gctgactgga caacaacgcc agataaaacc aactaaaggt agttgatgaa aaacagtggt taatggcatt cactgctcgt acaagcacca tagtggtatt cgatgcggtt catcagtatt aacttataac taaatttagt agactatcta aaacggtgat caacacctta tacagttacc tagcgataca caccaaaaac ccgcaacata tgatgatgtg ctccacttat tgatgaagcc tgaactgaca aacaagtact 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 aatggtaatg atcgccggca accgccctac aacgccatca ggtaaaaacg acccaaagcg aaaaacaccg gttaataatg attggcttta ggcattaacg agccatgatg atcagcagta caaggtaata gatgtcatca cgtgtgggca aatggcaaag aacactctag ataatcaaag tttaacttgc tttgccaatg aaagtggtct ggcgtaaaaa aatcaagcta ttatctggcg gtggatgctg aaaaatgatg gcccaaaccc caagtaaatg cttgaaaaag aatgccgttg ctgggcgaga aacatcggtg aatcttaaca gacgcaaacg ggtggcaagg caacagttaa caggtaaaca gtcatcaaag actggtggtg gtttgggtca gcaggtcaga caaggtatcc aacggcattg gcagatggtg gccatcggtg gtggtagcag agttacagtg gtgggcaata atcagtgcag accaccacag gcggtctccg gtcagtgcca attgccaacg gcagggattt tccatggtta tcgaagctgt ggccatgtag caactacatt atctaaacac aaacctttac ccgtgggtaa gtcttgatat gtcttaaagc ctagtaacga gtgttgtagg ctgggactaa caggtggtaa ctgtgacagg ctgccaaaac actttacggt cctttgcagg ttgaccaaac gcattgtcat ctaatgttac acgaagacaa aaggcaatgg gcaataccac atgatgtcaa ccaccacatt ctggcgatgc acatccaaac atggcaataa gcacagttga cagatggcac atgccaataa ccgcttctga cccaaacacc ctttgaccat tggtagcagg gcgttaatgc gtcaagccaa tcatcagtaa acgaagtacg ttgccgacat caggcacggt tacaagtggg aaacccaaaa ccaactatgt gcttcttcca actcaagtgc aagccgccgt ataacgcaca gtaagcactc tgggtaataa acatcaccgt gcacacacgc caggtgccac tgggtgcctc ccagcaccga caaccaatga catcagcgat ccgggggtat cggataatgg gggcggcagt tagtaccgac cctagccgag cgttaaaaag agatggcaca taaaaccgac cggcgacagc acaaatccaa tgctggcatt tggctcactt aaagattacc cggcaagatt agcacaaaac tagtaaccct tgaaaacggc caaaggctta taacagccaa caatgataaa aacccgtgcc tgaagcggtt caccgctaag tgtggatgat gaccagtact gcttgtcaag tgccaaaggg ggtcatctat taaaaccaaa attggctcaa aaagcaaggc taacaaaacc gctgaccttt caaaggtggg tactgatggc aggtggcacc agcaaacacc tgtgggcaaa caacttgttg caaaaaagac acttggcggt cgtggataaa agatggcagc gaccaacaac tgtcaacgat ctcaggcaag tgccataggc agccacgggc tggtgccatc caaccagttt gaccgaaagt aggcacacaa aggtacggtt aggtgctgaa tgcggtcaat gcttgaccat ggcgatggcg tgccacccac tcaatgggta tggtgcaggt gatgaccatg gaaattcaca gtagatgaaa agtggtaaag aaagatggta accactctaa gtcggtgctg gatggcacaa gataaaagca aacattcaat tatgatttaa tcattacacg tactccagtt attaccacca accacgccta aatggtcaaa ggtagcgtac gccagcattg gactttgtct gtgacctatg acaaccattg ggcacaggtg gccagtgata gcaagccaag gacagtaccg gaagttgcca atgaatgtca atcaatgaag aaaaacgccg gcaggggata caaacagaca ttcactgtca aaaattgatg cctgtgctaa ggcacaaaag ggtcttggta ccaaattcag aaaggtaata gacggcaacg aaaaaagccc cccgcagaag ggcaatcaag cactcagtgg agacaaaccc gatcaatcca ggcgacccaa accgatgcca aactcggttg gccaaaaaat aaaggctttg cgccgtatcc ggtagccagt cgtatccacc tccatgccac aacggtcaag tttaaaatc.a tttcacttt cccttgttaa ccaccaaagg atgataaggc tcaacacctt cggttacctt acaacaatgg atggcgtgaa ctcgcattac aaccccacct caggtgagat aaaccgaact aattctcagt atgacacctc aggtaaataa agctgaccgt ataccatcac gcaccacaga ttgatgtgct ccacttatga atgacacaag aagttaaaga ctaataaatt tcgttgctca cgaacaactc ataacaagta aagacaaact aatcagtcat acaacgcctt cagtaactgt caggcacaac ccaataagct aacttgccaa aaaaaggcat gtgccaatgg ataccgacgc atgataacgc gttcatcatc acgataccga ctaacggcga tgctcgccac ccattgacag agcctgtggt cgataggttt aagcaggcaa tcgccatcgg gcactgttaa ctcaaaccga ccttaggttc ctgacggcac ctggacaaac aaaatgtggc tgtacaaagc aaaacgaaaa aagcctacat gtgcggtggc atggttcagc agccagtgat cacagcaaac tgatgacacc aaaactcaaa tggcattaac cttgtctatt gtttgccatg cagagatgaa aagcaaagac tgccaaaaac tgaaaataaa agcagatgaa aaagacctct aggtgtggtg gggtaataat aggactaagc acagggcaat aagcgcaggc caccgtcaac caaaaccagt taaaaaactt tgccctaagc tctaaacacc agcaggctat ctatcaagcc ggtcgcccaa taacaaagaa tgttaaagga gggtgattta ggctaaaaaa aaccgataat agacctaacc ctcttttgta gctggacctg tgccaatgta tgacggcaat taaccgcact aaaacttgcc tttaagcaat ttataacgcc aataaatgaa acaagggcgt ccaggccaag ccaatccatc tacaggcaat ggctgataac tgtctttggt aaactctgcc agcaggtaca ggcggttggt agcaggtgag cacccaaagc taaagccaat tcctggcaga agtgggactg cgatacccaa 2820 2880 2 940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6159 <210> 9 <211> 2053 <212> PRT <213> Moraxella catarrhalis <400> 9 Met Asn His lie Tyr Lys Val lie Phe Asn Lys Ala Thr Gly Thr Phe 15 10 15 Met Ala Val Ala Glu Tyr Ala Lys Ser His Ser Thr Gly Gly Gly Ser 20 25 30 Cys Ala Thr Gly Gin Val Gly Ser Val Arg Thr Leu Ser Phe Ala Arg 35 40 45 lie Ala Ala Leu Ala Val Leu Val lie Gly Ala Thr Leu Asn Gly Ser 50 55 60 Ala Tyr Ala Gin Gin lie Thr Thr Lys lie Glu lie Gly Gin Thr Asn 65 70 75 80 Lys lie Asn Asn Thr Leu Lys Gly Asp Ala Leu Ala Thr Gly Glu Ala 85 90 95 Ser lie Ala Phe Gly Ser Leu Ser Lys Ala Gin Gly Ser Gin Ala lie 100 105 110 Ala lie Gly Ser Val Lys Pro Asp Pro Asn Asn Gly Ser Asn Gly Asn 115 120 125 Val Gly Ser His Ala Lys Gly Asn Glu Ser lie Ala lie Gly Gly Asp 130 135 140 Val Leu Ala Glu Gly Asp Ala Ser lie Ala lie Gly Ser Asp Asp Leu 145 150 155 160 Tyr Leu Pro Lys Asn Leu Asp Leu Lys Asn Glu Phe His Lys Leu lie 165 170 175 His. Gly His Glu lie Leu Lys Lys lie Gin Thr Ser Thr Asp Gly Lys 180 185 190 lie Lys Tyr Arg Arg Thr Arg Ala Gin Gly His Ala Ser Thr Ala Val 195 200 205 Gly Ala Met Ser Tyr Ala Gin Gly His Phe Ser Asn Ala Phe Gly Thr 210 215 220 Tyr Ala Thr Ala Glu Ala Ala Tyr Ser Leu Ala Val Gly Leu Ala Ala 225 230 235 240 Gin Ala Thr Lys Gin Ser Ser lie Ala Val Gly Ser Asn Ala Lys Ala 245 250 255 Asn Ala Phe Ala Ala Thr Ala lie Gly Gly Asn Thr Val Val Asn Leu 260 265 270 Gly Arg Gly Val Ala Leu Gly Phe Gly Ser Gin lie Leu Asp Arg Asp 275 280 285 Asn Asn Thr Asp Ala Ser Ala Tyr Val Pro Leu Gly Lys Thr Leu Ala 290 295 300 2b Asp Gin Tyr Lys Ala Thr Arg Gin Gly Asp Ser Thr Asp lie Phe Ser 305 310 315 320 lie Gly Asn Ser Asn Asn Asn Asn Ser Ser lie Arg Arg Lys lie lie 325 330 335 Asn Val Gly Ala Gly Ser Arg Asp Thr Asp Ala Val Asn Val Ala Gin 340 345 350 Leu Lys Leu Val Glu Glu Leu Ala Asn Arg Lys lie Thr Phe Lys Gly 355 360 365 Asp Gly Asp Asn Asn Ser Asn Ser Val Glu Arg Gly Leu Gly Asn Thr 370 375 380 Leu Thr lie Lys Gly Asp Ala Gin Thr Asn Ala Leu Thr Glu Ala Asn 385 390 395 400 lie Gly Val Val Thr Asp Gly Asn Gly Leu Lys Val Lys Leu Ala Lys 405 410 415 Glu Leu Thr Gly Leu Thr Ser Val Ser Ala Thr Asn Lys lie Thr Val 420 425 430 Ser Asn Thr Asn Asn Asn Asn Ala Glu Leu Gin Ser Gly Gly Leu Thr 435 440 445 Phe Ser Pro lie Thr Gly Thr Lys Thr Asp Lys Thr Val Tyr Ser lie 450 455 460 Asp Gly Leu Lys Phe Thr Asn Asp Ser Asn Ser lie Ala Thr Lys Gly 465 470 475 480 Thr Thr Arg lie Thr Lys Lys Lys lie Gly Phe Ala Gly Thr Asn Asp 485 490 495 Gly Val Asp Glu Ser Lys Pro Tyr Leu Asp Asn Glu Lys Leu Lys Val 500 505 510 Gly Asn Ser Thr Leu Asn Ser Gly Ser Leu Thr Val Asn Asn Thr Thr 515 520 525 Gly Asn Lys Gin lie Gin Val Gly Ala Asn Gly lie Lys Phe Ala Thr 530 535 540 Val Ala Asn Asn Val Ala Asn Thr Ser Ala Thr Val Gly Thr Ala Arg 545 550 555 560 lie Thr Glu Glu Lys lie Gly Phe Ala Gly Thr Asn Asp Gly Val Asp 565 570 575 Glu Gin Ala Pro Tyr Leu Asp Lys Glu Arg Leu Lys Val Gly Arg Val 580 585 590 Glu lie Thr Thr Asp Ser Gly lie Asn Ala Gly Asn His Lys lie Thr 595 600 605 Gly Leu Thr Asn Gly lie Ala Asn Thr Asp Ala Val Thr lie Lys Gin 610 615 620 Leu Lys Asp Ala Lys Pro Thr Leu Asn Ala Gly Asp Gly lie Ser lie s* 625 630 635 640 Asn Ser Asn Asn Gly Asp Leu Val Asp Ser Ser Gly Asn lie Thr Thr 645 650 655 Pro Thr Tyr Asn lie Ser Val Lys Thr Thr Lys Leu Asn Ser Asn Gly 660 665 670 Thr Ser Gly Asn Asn Lys Phe Ser Val Ser Asn Ala His Asp Asn Asn 675 680 685 Ser Leu Val Thr Ala Lys Asp Leu Ala Asp Tyr Leu Asn Lys Val Asn 690 695 700 Glu Thr Ala Asp Ser Ala Leu Pro Ser Phe Lys Val Gin Asn Gly Asp 705 710 715 720 Asn Ser Asn Asn Ala lie Thr Val Gly Lys Asp Thr Asn Gly Lys Thr 725 730 735 Phe Asn Thr Leu Lys Leu Lys Gly Glu Asn Gly Val Asn lie Thr Thr 740 745 750 Asn Arg Ala Thr Gly Thr Val Thr Phe Gly lie Asp Gin Ser Asn Gly 755 760 765 Leu Thr Thr Pro Lys Leu Thr Val Gly Ser Asp Thr Asn Gly Asn Arg 770 775 780 Leu Val lie Glu Gin Val Pro Ser Ala Asp Gly Asn Ser Thr Lys Asn 785 790 795 800 lie lie Lys Gly Leu Ser Pro Thr Leu Pro Ser lie Ala Ser Pro Ser 805 810 815 Gly Arg Asn lie Ala Leu Gly Asn Thr lie Glu Glu Lys Asp Lys Ser 820 825 830 Asn Ala Ala Ser lie Asp Asp Val Leu Asn Ala Gly Phe Asn Leu Lys 835 840 845 Asn Asn Gly Lys Asp Lys Asp Phe Val Ser Thr Tyr Asp Thr Val Asp 850 855 860 Phe lie Asp Gly Asn Ala Thr Thr Ala Thr Val Thr Tyr Asp Glu Ala 865 870 875 880 Asn Gin Thr Ser Lys Val Ala Tyr Asp Val Asn Val Asp Glu Lys Thr 885 890 895 lie Glu Leu Thr Gly Asp Asn Gly Lys Lys Gin Leu Gly Val Lys Thr 900 905 910 lie Lys Leu Thr Glu Thr Ser Thr Asn Gly Asn Ala Thr Thr Phe Ser 915 920 925 Thr Asp Asp Asp His Ala Leu Val Lys Ala Ser Asp lie Ala Gly Asn 930 935 940 Leu Asn Thr Leu Ala Glu Glu lie His Thr Thr Lys Gly Thr Ala Asn 945 950 955 960 Thr Ala Leu Gin Thr Phe Thr Val Lys Lys Val Asp Glu Asn Asp Lys 965 970 975 Ala Asp Asp Thr Asn Ala lie Thr Val- Gly Lys Asp Gly Thr Ser Gly 980 985 990 Lys Val Asn Thr Leu Lys Leu Lys Gly Lys Asn Gly Leu Asp lie Lys 995 1000 1005 Thr Asp Lys Asp Gly Thr Val Thr Phe Gly lie Asn Thr Gin Ser Gly 1010 1015 1020 Leu Lys Ala Gly Asp Ser Thr Thr Leu Asn Asn Asn Gly Leu Ser lie 1025 1030 1035 1040 Lys Asn Thr Ala Ser Asn Glu Gin lie Gin Val Gly Ala Asp Gly Val 1045 1050 1055 Lys Phe Ala Met Val Asn Asn Gly Val Val Gly Ala Gly lie Asp Gly 1060 1065 1070 Thr Thr Arg lie Thr Arg Asp Glu lie Gly Phe Thr Gly Thr Asn Gly 1075 1080 1085 Ser Leu Asp Lys Ser Lys Pro His Leu Ser Lys Asp Gly lie Asn Ala 1090 1095 1100 Gly Gly Lys Lys lie Thr Asn lie Gin Ser Gly Glu lie Ala Lys Asn 1105 1110 1115 1120 Ser His Asp Ala Val Thr Gly Gly Lys lie Tyr Asp Leu Lys Thr Glu 1125 1130 1135 Leu Glu Asn Lys lie Ser Ser Thr Ala Lys Thr Ala Gin Asn Ser Leu 1140 1145 1150 His Glu Phe Ser Val Ala Asp Glu Gin Gly Asn Asn Phe Thr Val Ser 1155 1160 1165 Asn Pro Tyr Ser Ser Tyr Asp Thr Ser Lys Thr Ser Asp Val lie Thr 1170 1175 1180 Phe Ala Gly Glu Asn Gly lie Thr Thr Lys Val Asn Lys Gly Val Val 1185 1190 1195 1200 Arg Val Gly lie Asp Gin Thr Lys Gly Leu Thr Thr Pro Lys Leu Thr 1205 1210 1215 Val Gly Asn Asn Asn Gly Lys Gly lie Val lie Asn Ser Gin Asn Gly 1220 1225 1230 Gin Asn Thr lie Thr Gly Leu Ser Asn Thr Leu Ala Asn Val Thr Asn 1235 1240 1245 Asp Lys Gly Ser Val Arg Thr Thr Glu Gin Gly Asn lie lie Lys Asp 1250 1255 1260 Glu Asp Lys Thr Arg Ala Ala Ser lie Val Asp Val Leu Ser Ala Gly 1265 1270 1275 1280 Phe Asn Leu Gin Gly Asn Gly Glu Ala Val Asp Phe Val Ser Thr Tyr 1285 1290 1295 Asp Thr Val Asn Phe Ala Asn Gly Asn Thr Thr Thr Ala Lys Val Thr 1300 1305 1310 Tyr Asp Asp Thr Ser Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val 1315 1320 1325 Asp Asp Thr Thr lie Glu Val Lys Asp Lys Lys Leu Gly Val Lys Thr 1330 1335 1340 Thr Thr Leu Thr Ser Thr Gly Thr Gly Ala Asn Lys Phe Ala Leu Ser 1345 1350 1355 1360 Asn Gin Ala Thr Gly Asp Ala Leu Val Lys Ala Ser Asp lie Val Ala 1365 1370 1375 His Leu Asn Thr Leu Ser Gly Asp lie Gin Thr Ala Lys Gly Ala Ser 1380 1385 1390 Gin Ala Asn Asn Ser Ala Gly Tyr Val Asp Ala Asp Gly Asn Lys Val 1395 1400 1405 lie Tyr Asp Ser Thr Asp Asn Lys Tyr Tyr Gin Ala Lys Asn Asp Gly 1410 1415 1420 Thr Val Asp Lys Thr Lys Glu Val Ala Lys Asp Lys Leu Val Ala Gin 1425 1430 1435 1440 Ala Gin Thr Pro Asp Gly Thr Leu Ala Gin Met Asn Val Lys Ser Val 1445 1450 1455 lie Asn Lys Glu Gin Val Asn Asp Ala Asn Lys Lys Gin Gly lie Asn 1460 1465 1470 Glu Asp Asn Ala Phe Val Lys Gly Leu Glu Lys Ala Ala Ser Asp Asn 1475 1480 1485 Lys Thr Lys Asn Ala Ala Val Thr Val Gly Asp Leu Asn Ala Val Ala 1490 1495 1500 Gin Thr Pro Leu Thr Phe Ala Gly Asp Thr Gly Thr Thr Ala Lys Lys 1505 1510 1515 1520 Leu Gly Glu Thr Leu Thr lie Lys Gly Gly Gin Thr Asp Thr Asn Lys 1525 1530 1535 Leu Thr Asp Asn Asn lie Gly Val Val Ala Gly Thr Asp Gly Phe Thr 1540 1545 1550 Val Lys Leu Ala Lys Asp Leu Thr Asn Leu Asn Ser Val Asn Ala Gly 1555 1560 1565 Gly Thr Lys lie Asp Glu Lys Gly lie Ser Phe Val Asp Ala Asn Gly 1570 1575 1580 Gin Ala Lys Ala Asn Thr Pro Val Leu Ser Ala Asn Gly Leu Asp Leu 1585 1590 1595 1600 Gly Gly Lys Val lie Ser Asn Val Gly Lys Gly Thr Lys Asp Thr Asp °10 1605 1610 1615 Ala Ala Asn Val Gin Gin Leu Asn Glu Val Arg Asn Leu Leu Gly Leu 1620 1625 1630 Gly Asn Asp Asn Ala Asp Gly Asn Gin Val Asn lie Ala Asp lie Lys 1635 1640 1645 Lys Asp Pro Asn Ser Gly Ser Ser Ser Asn Arg Thr Val lie Lys Ala 1650 1655 1660 Gly Thr Val Leu Gly Gly Lys Gly Asn Asn Asp Thr Glu Lys Leu Ala 1665 1670 1675 1680 Thr Gly Gly Val Gin Val Gly Val Asp Lys Asp Gly Asn Ala Asn Gly 1685 1690 1695 Asp Leu Ser Asn Val Trp Val Lys Thr Gin Lys Asp Gly Ser Lys Lys 1700 1705 1710 Ala Leu Leu Ala Thr Tyr Asn Ala Ala Gly Gin Thr Asn Tyr Val Thr 1715 1720 1725 Asn Asn Pro Ala Glu Ala lie Asp Arg lie Asn Glu Gin Gly lie Arg 1730 1735 1740 Phe Phe His Val Asn Asp Gly Asn Gin Glu Pro Val Val Gin Gly Arg 1745 1750 1755 1760 Asn Gly lie Asp Ser Ser Ala Ser Gly Lys His Ser Val Ala lie Gly 1765 1770 1775 Phe Gin Ala Lys Ala Asp Gly Glu Ala Ala Val Ala lie Gly Arg Gin 1780 1785 1790 Thr Gin Ala Gly Asn Gin Ser lie Ala lie Gly Asp Asn Ala Gin Ala 1795 1800 1805 Thr Gly Asp Gin Ser lie Ala lie Gly Thr Gly Asn Val Val Ala Gly 1810 1815 1820 Lys His Ser Gly Ala lie Gly Asp Pro Ser Thr Val Lys Ala Asp Asn 1825 1830 1835 1840 Ser Tyr Ser Val Gly Asn Asn Asn Gin Phe Thr Asp Ala Thr Gin Thr 1845 1850 1855 Asp Val Phe Gly Val Gly Asn Asn lie Thr Val Thr Glu Ser Asn Ser 1860 1865 1870 Val Ala Leu Gly Ser Asn Ser Ala lie Ser Ala Gly Thr His Ala Gly 1875 1880 1885 Thr Gin Ala Lys Lys Ser Asp Gly Thr Ala Gly Thr Thr Thr Thr Ala 1890 1895 1900 Gly Ala Thr Gly Thr Val Lys Gly Phe Ala Gly Gin Thr Ala Val Gly 1905 1910 1915 1920 Ala Val Ser Val Gly Ala Ser Gly Ala Glu Arg Arg lie Gin Asn Val 1925 1930 1935 Ala Ala Gly Glu Val Ser Ala Thr Ser Thr Asp Ala Val Asn Gly Ser 1940 1945 1950 Gin Leu Tyr Lys Ala Thr Gin Ser lie Ala Asn Ala Thr Asn Glu Leu 1955 1960 1965 Asp His Arg lie His Gin Asn Glu Asn Lys Ala Asn Ala Gly lie Ser 1970 1975 1980 Ser Ala Met Ala Met Ala Ser Met Pro Gin Ala Tyr lie Pro Gly Arg 1985 1990 1995 2000 Ser Met Val Thr Gly Gly lie Ala Thr His Asn Gly Gin Gly Ala Val 2005 2010 2015 Ala Val Gly Leu Ser Lys Leu Ser Asp Asn Gly Gin Trp Val Phe Lys 2020 2025 2030 lie Asn Gly Ser Ala Asp Thr Gin Gly His Val Gly Ala Ala Val Gly 2035 2040 2045 Ala Gly Phe His Phe 2050 <210> 10 <211> 6942 <212> DNA <213> Moraxella catarrhalis <400> 10 atgaatcaca tctataaagt catctttaac aaagccacag gcacatttat ggccgtggca 60 gagtgcgcca aatcccacag cggagggagt agcagtagta ccgcaggaca ggtgggcagc 120 tctcctgtca tccgcctgac tcgtgttgcc acgctcgcta tcctagtgat cggtgcgacg 180 ctcaatggca gtgcttatgc tcaaaataat agcaagatcg catttggtac cacaggcaac 240 aatgacaatg cctcggctag caatgaagca tccattgcta ttggtagtct tgctaaggca 300 catgccaatc aagctattgc tatcggtggt agcaaaccag atcctcgtaa tcaagcggct 360 aatcagaagg caggttccca cgccaaaggt aaagagtcca tcgccatcgg tggtgatgta 420 ctggctgagg gtgatgcctc gattgccatt ggtagtgatg acttatattt ggataggaat 480 agcactaact ctaaatatcc aaatggtctt cttagcactc ttattcaaaa ccatacagta 540 ttacgccaaa tacgagactc aaatggttct cagaaatata gacgcacagc agcagaagga 600 cacgccagta ctgcagtggg agccatggca tatgcaaagg gtcattttgc caacgccttt 660 ggtacacggt caacagctga aggcaactat tccttggcag taggtcttac cgccaaagcc 720 gaaaaaggat atacaatcgc tattggttct aatgcacaag ctatcaatta tggagcacta 780 gcccttggtg cagatactcg agttgatttg gattacggta ttgccctagg ttatggttct 840 cagatcctta ataataataa taataataat aataaagcct atgtaccaga aggtaatggg 900 tcaaacataa aatcgtctaa agccaccggc aatggtttat tttccattgg tagtagcact 960 atcaagcgta aaatcatcaa tgtcggtgca ggttatgagg ataccgatgc ggtcaatgtg 1020 gcacagctaa aagcggtgga gaatctggct aagcgtcaaa ttacttttaa gggtgatgat 1080 aacggtactg gcgttaagaa aaaactgggc gagactttaa ccattaaagg tggtgagacc 1140 caagcggaca agctaaccga taataataac attggtgtgg taacagataa taatactggt 1200 ctgaaagtta aacttgctaa aaacctaagc ggtcttgaaa cagttagcac caaaaaccta 1260 accgccagcg agaaagttac ggtaggtagt ggtaataaca ccgctgagct acaaagcggt 1320 ggtttaacct ttaccccaac aacaaatgca agcacagaca aaaccgtcta tggcactgat 1380 gggcttaagt ttactgataa ttctaatacg gcacttgaag atactactcg tatcaccaaa 1440 gataaaattg gttttagcaa taaagctggt acagttgatg aaaacaaacc ttatcttgat 1500 aaagacaagc taaaagttgg caacagcacc ctaaacaacg gtggcttgac tgttaataac 1560 accattggtg gtagcaataa acaaatccaa gtcggtgctg atggcattaa atttgccgat 1620 gtgaatgtta atgtatcaaa tgccgcaaaa ttcggcacta ctcgtattac cgaagaggaa 1680 attggctttg ctgatgctga tggtaaagtt gataaaaagt caccatattt ggataaaaaa 1740 caacttcaag aagatcagta aaacaagtcc ggtcaggaat accatcacct gtcaaagttg gataaagatg aacatcatta accacagaac ggtgatatat tccacttata gatgaaacca gaactcacag acaacaaatg aacgccaaag ggcacagcag gaaaccatca ctcaaaggtg attaacaccc tctattaaaa gccaaggttg gatcaaattg aaagacaagc aaaaagatta ggcggtcggg acagcacaaa gttagtaacc ggtgaaaacg accaaaggct attgacagta accaatgatg cgtgccgcca gcggttgact gctaaggtga gataataaaa accaaaacaa gttaaagcca aaaggggcaa atctatgaca aacaaagaag gctcaaatga caaggcatca aaaaccaaaa acctttgcag ggtgggcaaa gatggcttca ggcaccagaa aacacccctg ggtgcagctg acggtcaaca gatgccaatg gccgatggta cccatcaccg ggtcatcaag aagtccactt caaagtctgc ctaaatgtag gataccgtca ggcacgatga gtgcttatca tcactaaaag tgggtggtgt atgttaaaga aacaagacgc ttacgattag ttgcaggtga gtattgaccc gtaaaactca gaggattgtc agggcaatac taaatacagg acactgttga atcaaaccag gcgataatgg ctaatggtaa acatcgccga acaccgccct ccgtgggtaa aaaacggtct aaagcggtct accccgctag ataagggtaa gctttactgg ttaaagtggg ccaacattca tttatgattt actcattaca cttactccag gcattaccac taaccacgcc aagatggtca gtgcaggaca gcattggtga ttgtctccac cctatgatga ccattgaagt gtgctaatgg gtgatatcgc gccaagcaag gtaccgataa ttgccaaaga atgtcaaatc atgaagacaa acgccgcagt gggatacagg cagacaccaa ctgtcaaact ttgatgaaaa tgctaagtgc ttgatgataa acctaaacaa gcaagcccat aatactatca atgcggacaa tggtggcaag tgccacaaat ccagcctatc gctttaactt actttgtcaa gtaacatcac aagccaaaga caggcaaatc taaaattacc tgcaacggac cgacggtgcc taacttgtat aaacggcatc aatcaatggt attggttatt cccaacactg aatcaccagc ctttaaccta ctttatcgat taaagtaact caagacaaac agcaaccaac aaatctaaac acaaaccttt agatggtaca aacggttgct taaagccggc taacgaacaa ttcaagcact ggctaatggc tgaagttgaa atcaggtgat aaaaaccgaa cgaattctca ttatgacacc caaggtaaat taagctgacc aaataccatc cgcactaagc tgtgctaaac ttatgacact cacaagcaaa gacaagtgat taatgcaacc cacccatcta cagctcagca gaagtactat caaactggtc agtcattaac cgcctttatc aactgtgggt cacaacggct taagctaacc tgccaaagac aggcatctct caatgggctg cgatgcggtg ccaaagtaac caatggcacc cgccaacgcc acttgccaat cctaggcggc tgacacacca agcagcacag gcagaccaat tggtacaggt cgtcaacacc tggtaagttc agccagtgat aaagacagtg gataccgatg ctacaaagct tctaatggta agtatcagca ctcaccacgc gagcaagtgg cctagcatta gacgaagaca aaaaataata ggcaatgcca tatgatgtca aaaattggcg tttagtacca accctagcca aaagtcaaaa caaaacggca accaataaag gacagcacca atccaagtcg ggcattgatg tcacttgata attaccaaca attacccaaa cttgaaagca gtagcagatg tcaaagacct aaaggtgtgg gtgggtaata acaggactaa caagggcttg gcaggcttta gttgacttta accagtaaag aaaaaacttg aaatttagtg aataccttgg agctatgtgg caagtcaatg gcccaagccc aaagagcaag aaagggcttg gatttaaatg aaaaaactgg gataataaca ctaaccaatc tttgtagacg gacctgggtg aactttaagc tcaggtgcgt gatggcaagc aacggcgtac ctggcagctc aactcagatg aacacaggta caaagtaatg cacaatcaag gccgacatca gccttagcag tacaaagcag gccaaaactc gcattaatgc cagtcactta tctctattcg ataccccaaa atgacatagc ctaagctgac ctagcggtaa ccaatgcagg aatccaaagc gcaactccgt ccaccgctaa atgtggatga tcaaaaccac ccgataacga aggaaattca aagacggtgc agaccgtcaa atggtacggt ctctaaacaa gtgctgatgg gcacaagccg ccaccaaacc ctggcattaa acagcaatga aaatcaacag aacaaggtaa ctgatgtcat tgcgtgtggg ataatggcaa gcaacactct ccaatgacac acttgcaagg tcgatggcaa tggtctatga gcgtcaaaac ccgccgatgg ctggcgacat atgctgatgg acaagggtca aaaccccaga taaatgatgc aaaacgccgc ccgttgccca gcgagacttt tcggtgtggt ttaacagcgt caaacggtca gcaaacgcat agtttaatga cattaccctt cccaaaaagc ctgtggacaa atggcaaacc ccatcaccct atgccaatgc ctgccagtgt tggactttgt caagcgtgcg cgaccgatga acgacctcat caactggtct aggtgatcaa taaacagctt tgatgaaaaa tacctttgag caaaggtaaa cgtgggtagc cgacaccaaa tggcgtacgc cgccagtatc tggctttgtc ggtaacttac gaaaaccatt cacactgacc tgcccttgtt caccaccaaa aactgatgac cactctaaaa tacctttggc agatggcttg cgtgaagttt tatcaccaaa ccacctaacc cgcaggtggt tgctgtgaca tgctgctaaa tcactttacg cacctttgca cattgaccaa aggcattgtc agctaatgtt cgacaaaacc caatggtgaa tgccaccacc tgtcaatgtg caccacactg cgatgccctt ccaaaccgcc caacaaggtc agtggacaaa tggcacattg caataaaaag caaagacacc aacaccgctg gaccatcaaa agcaggtact taatgcaggt agccaaagca cagtaacatc agttgccaaa tgtggtaacc catcaagggc agatggcaag ccttgatgca aaccaacatc agggcaagcc caaagatgtg caaagcctat tagtgctgat tgatggcaat gccaaacggc aagccttgtt 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4 920 4980 5040 5100 5160 5220 5280 5340 5400 ^3 aaccccaatg ctggtaaagg cagtacaggc gatgcagtgg ctcttaataa cttatcaaaa 54 60 gcggtattta aatccaaaga tggtacaact actaccacag taagctctga tggcatcagt 5520 atccaaggca aagataacag cagcatcacc ctaagcaaag atgggctgaa tgtaggcggt 5580 aaggtcatca gcaatgtggg taaaggcaca aaagacaccg acgctgccaa tgtacaacag 5640 ttaaacgaag tacgcaactt gttgggtctt ggtaatgctg gtaatgataa cgctgacggc 5700 aatcaggtaa acattgccga catcaaaaaa gacccaaatt caggttcatc atctaaccgc 57 60 actgtcatca aagcaggcac ggtacttggc ggtaaaggta ataacgatac cgaaaaactt 5820 gccactggtg gtgtacaagt gggcgtggat aaagacggca acgctaacgg cgatttaagc 5880 aatgtttggg tcaaaaccca aaaagatggc agcaaaaaag ccctgctcgc cacttataac 5940 gccgcaggtc agaccaacta tttgaccaac aaccccgcag aagccattga cagaataaat 6000 gaacaaggta tccgcttctt ccatgtcaac gatggcaatc aagagcctgt ggtacaaggg 6060 cgtaacggca ttgactcaag tgcctcaggc aagcactcag tggcgatagg tttccaggcc 6120 aaggcagatg gtgaagccgc cgttgccata ggcagacaaa cccaagcagg caaccaatcc 6180 atcgccatcg gtgataacgc acaagccacg ggcgatcaat ccatcgccat cggtacaggc 6240 aatgtggtaa caggtaagca ctctggtgcc atcggcgacc caagcactgt taaggctgat 6300 aacagttaca gtgtgggtaa taacaaccag tttatcgatg ccactcagac cgatgtcttt 6360 ggtgtgggca ataacatcac cgtgaccgaa agtaactcgg ttgccttagg ttcaaactct 6420 gccatcagtg caggcacaca cgcaggcaca caagccaaaa aatctgacgg cacagcaggt 6480 acaaccacca cagcaggtgc aacaggtacg gttaaaggct ttgctggaca aacggcggtt 654 0 ggtgcggtct ccgtgggtgc ctcaggtgct gaacgccgta tccaaaatgt ggcagcaggt 6600 gaggtcagtg ccaccagcac cgatgcggtc aatggtagcc agttgtacaa agccacccaa 6660 ggcattgcca acgcaaccaa tgagcttgac catcgtatcc accaaaacga aaataaagcc 6720 aatgcaggga tttcatcagc gatggcgatg gcgtccatgc cacaagccta cattcctggc 6780 agatccatgg ttaccggggg tattgccacc cacaacggtc aaggtgcggt ggcagtggga 6840 ctgtcgaagc tgtcggataa tggtcaatgg gtatttaaaa tcaatggttc agccgatacc 6900 caaggccatg taggggcggc agttggtgca ggttttcact tt 6942 <210> 11 , <211> 2314 <212> PRT <213> Moraxella catarrhalis <400> 11 Met Asn His lie Tyr Lys Val lie Phe Asn Lys Ala Thr Gly Thr Phe 15 10 15 Met Ala Val Ala Glu Cys Ala Lys Ser His Ser Gly Gly Ser Ser Ser 20 25 30 Ser Thr Ala Gly Gin Val Gly Ser Ser Pro Val lie Arg Leu Thr Arg 35 40 45 Val Ala Thr Leu Ala lie Leu Val lie Gly Ala Thr Leu Asn Gly Ser 50 55 60 Ala Tyr Ala Gin Asn Asn Ser Lys lie Ala Phe Gly Thr Thr Gly Asn 65 70 75 80 Asn Asp Asn Ala Ser Ala Ser Asn Glu Ala Ser lie Ala lie Gly Ser 85 90 95 Leu Ala Lys Ala His Ala Asn Gin Ala lie Ala lie Gly Gly Ser Lys 100 105 110 Pro Asp Pro Arg Asn Gin Ala Ala Asn Gin Lys Ala Gly Ser His Ala 115 120 125 Lys Gly Lys Glu Ser lie Ala lie Gly Gly Asp Val Leu Ala Glu Gly 130 135 140 Asp Ala Ser lie Ala lie Gly Ser Asp Asp Leu Tyr Leu Asp Arg Asn 145 150 155 160 Ser Thr Asn Ser Lys Tyr Pro Asn Gly Leu Leu Ser Thr Leu lie Gin 165 170 175 Asn His Thr Val Leu Arg Gin lie Arg Asp Ser Asn Gly Ser Gin Lys 180 185 190 Tyr Arg Arg Thr Ala Ala Glu Gly His Ala Ser Thr Ala Val Gly Ala 195 200 205 Met Ala Tyr Ala Lys Gly His Phe Ala Asn Ala Phe Gly Thr Arg Ser 210 215 220 Thr Ala Glu Gly Asn Tyr Ser Leu Ala Val Gly Leu Thr Ala Lys Ala 225 230 235 240 Glu Lys Gly Tyr Thr lie Ala lie Gly Ser Asn Ala Gin Ala lie Asn 245 250 255 Tyr Gly Ala Leu Ala Leu Gly Ala Asp Thr Arg Val Asp Leu Asp Tyr 260 265 270 Gly lie Ala Leu Gly Tyr Gly Ser Gin lie Leu Asn Asn Asn Asn Asn 275 280 285 Asn Asn Asn Lys Ala Tyr Val Pro Glu Gly Asn Gly Ser Asn lie Lys 290 295 300 Ser Ser Lys Ala Thr Gly Asn Gly Leu Phe Ser lie Gly Ser Ser Thr 305 310 315 320 lie Lys Arg Lys lie lie Asn Val Gly Ala Gly Tyr Glu Asp Thr Asp 325 330 335 Ala Val Asn Val Ala Gin Leu Lys Ala Val Glu Asn Leu Ala Lys Arg 340 . 345 350 Gin lie Thr Phe Lys Gly Asp Asp Asn Gly Thr Gly Val Lys Lys Lys 355 360 365 Leu Gly Glu Thr Leu Thr lie Lys Gly Gly Glu Thr Gin Ala Asp Lys 370 375 380 Leu Thr Asp Asn Asn Asn lie Gly Val Val Thr Asp Asn Asn Thr Gly 385 390 395 400 Leu Lys Val Lys Leu Ala Lys Asn Leu Ser Gly Leu Glu Thr Val Ser 405 410 415 Thr Lys Asn Leu Thr Ala Ser Glu Lys Val Thr Val Gly Ser Gly Asn 420 425 430 Asn Thr Ala Glu Leu Gin Ser Gly Gly Leu Thr Phe Thr Pro Thr Thr 435 440 445 Asn Ala Ser Thr Asp Lys Thr Val Tyr Gly Thr Asp Gly Leu Lys Phe 450 455 4 60 Thr Asp Asn Ser Asn Thr Ala Leu Glu Asp Thr Thr Arg lie Thr Lys 465 470 475 480 Asp Lys lie Gly Phe Ser Asn Lys Ala Gly Thr Val Asp Glu Asn Lys 485 490 495 Pro Tyr Leu Asp Lys Asp Lys Leu Lys Val Gly Asn Ser Thr Leu Asn 500 505 510 Asn Gly Gly Leu Thr Val Asn Asn Thr lie Gly Gly Ser Asn Lys Gin 515 520 525 lie Gin Val Gly Ala Asp Gly lie Lys Phe Ala Asp Val Asn Val Asn 530 535 540 Val Ser Asn Ala Ala Lys Phe Gly Thr Thr Arg lie Thr Glu Glu Glu 545 550 555 560 lie Gly Phe Ala Asp Ala Asp Gly Lys Val Asp Lys Lys Ser Pro Tyr 565 570 575 Leu Asp Lys Lys Gin Leu Gin Val Gly Gly Val Lys lie Thr Lys Asp 580 585 590 Ser Gly lie Asn Ala Gly Asp Gin Lys lie Ser Asn Val Lys Asp Ala 595 600 605 Thr Asp Asp Thr Asp Ala Val Thr Tyr Lys Gin Leu Lys Gin Val Gin 610 615 620 Gin Asp Ala Asp Gly Ala Leu Gin Ser Phe Ser lie Arg Asp Glu Lys 625 630 635 640 Gly Gin Glu Phe Thr lie Ser Asn Leu Tyr Ser Asn Gly Asn Thr Pro 645 650 655 Asn Thr Phe Glu Thr lie Thr Phe Ala Gly Glu Asn Gly lie Ser lie 660 665 670 Ser Asn Asp lie Ala Lys Gly Lys Val Lys Val Gly lie. Asp Pro lie 675 680 685 Asn Gly Leu Thr Thr Pro Lys Leu Thr Val Gly Ser Asp Lys Asp Gly 690 695 700 Lys Thr Gin Leu Val lie Glu Gin Val Ala Ser Gly Asn Asp Thr Lys 705 710 715 720 Asn lie lie Arg Gly Leu Ser Pro Thr Leu Pro Ser lie Thr Asn Ala 725 730 735 Gly Gly Val Arg Thr Thr Glu Gin Gly Asn Thr lie Thr Ser Asp Glu 740 745 750 Asp Lys Ser Lys Ala Ala Ser lie Gly Asp lie Leu Asn Thr Gly Phe 755 760 765 Asn Leu Lys Asn Asn Ser Asn Ser Val Gly Phe Val Ser Thr Tyr Asn 770 775 780 Thr Val Asp Phe lie Asp Gly Asn Ala Thr Thr Ala Lys Val Thr Tyr 785 790 795 800 Asp Glu Thr Asn Gin Thr Ser Lys Val Thr Tyr Asp Val Asn Val Asp 805 810 815 Glu Lys Thr lie Glu Leu Thr Gly Asp Asn Gly Lys Thr Asn Lys lie 820 825 830 Gly Val Lys Thr Thr Thr Leu Thr Thr Thr Asn Ala Asn Gly Lys Ala 835 840 845 Thr Asn Phe Ser Thr Thr Asp Asn Asp Ala Leu Val Asn Ala Lys Asp 850 855 860 lie Ala Glu Asn Leu Asn Thr Leu Ala Lys Glu lie His Thr Thr Lys 865 870 875 880 Gly Thr Ala Asp Thr Ala Leu Gin Thr Phe Lys Val Lys Lys Asp Gly 885 890 895 Ala Thr Asp Asp Glu Thr lie Thr Val Gly Lys Asp Gly Thr Gin Asn 900 905 910 Gly Lys Thr Val Asn Thr Leu Lys 915 920 Val Ala Thr Asn Lys Asp Gly Thr 930 935 Ser Gly Leu Lys Ala Gly Asp Ser 945 950 Ser lie Lys Asn Pro Ala Ser Asn 965 Leu Lys Gly Glu Asn Gly Leu Thr 925 Val Thr Phe Gly lie Asn Thr Gin 940 Thr Thr Leu Asn Lys Asp Gly Leu 955 960 Glu Gin lie Gin Val Gly Ala Asp 970 975 Gly Val Lys Phe Ala Lys Val Asp Lys Gly Asn Ser Ser Thr Gly lie 980 985 990 Asp Gly Thr Ser Arg lie Thr Lys Asp Gin lie Gly Phe Thr Gly Ala 995 1000 1005 Asn Gly Ser Leu Asp Thr Thr Lys Pro His Leu Thr Lys Asp Lys Leu 1010 1015 1020 Lys Val Gly Glu Val Glu lie Thr Asn Thr Gly lie Asn Ala Gly Gly 1025 1030 1035 1040 Lys Lys lie Thr Asn lie Gin Ser Gly Asp lie Thr Gin Asn Ser Asn 1045 1050 1055 Asp Ala Val Thr Gly Gly Arg Val Tyr Asp Leu Lys Thr Glu Leu Glu 1060 1065 1070 Ser Lys lie Asn Ser Ala Ala Lys Thr Ala Gin Asn Ser Leu His Glu 1075 1080 1085 Phe Ser Val Ala Asp Glu Gin Gly Asn His Phe Thr Val Ser Asn Pro 1090 1095 1100 Tyr Ser Ser Tyr Asp Thr Ser Lys Thr Ser Asp Val lie Thr Phe Ala 1105 1110 1115 1120 Gly Glu Asn Gly lie Thr Thr Lys Val Asn Lys Gly Val Val Arg Val 1125 1130 1135 Gly lie Asp Gin Thr Lys Gly Leu Thr Thr Pro Lys Leu Thr Val Gly 1140 1145 1150 Asn Asn Asn Gly Lys Gly lie Val lie Asp Ser Lys Asp Gly Gin Asn 1155 1160 1165 Thr lie Thr Gly Leu Ser Asn Thr Leu Ala Asn Val Thr Asn Asp Gly 1170 1175 1180 Ala Gly His Ala Leu Ser Gin Gly Leu Ala Asn Asp Thr Asp Lys Thr 1185 1190 1195 1200 Arg Ala Ala Ser lie Gly Asp Val Leu Asn Ala Gly Phe Asn Leu Gin 1205 1210 1215 Gly Asn Gly Glu Ala Val Asp Phe Val Ser Thr Tyr Asp Thr Val Asp 1220 1225 1230 Phe lie Asp Gly Asn Ala Thr Thr Ala Lys Val Thr Tyr Asp Asp Thr 1235 1240 1245 Ser Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val Asp Asn Lys Thr 1250 1255 1260 lie Glu Val Thr Ser Asp Lys Lys Leu Gly Val Lys Thr Thr Thr Leu 1265 1270 1275 1280 Thr.Lys Thr Ser Ala Asn Gly Asn Ala Thr Lys Phe Ser Ala Ala Asp 1285 1290 1295 Gly Asp Ala Leu Val Lys Ala Ser Asp lie Ala Thr His Leu Asn Thr 1300 1305 1310 Leu Ala Gly Asp lie Gin Thr Ala Lys Gly Ala Ser Gin Ala Ser Ser 1315 1320 1325 Ser Ala Ser Tyr Val Asp Ala Asp Gly Asn Lys Val lie Tyr Asp Ser 1330 1335 1340 Thr Asp Lys Lys Tyr Tyr Gin Val Asn Asp Lys Gly Gin Val Asp Lys 1345 1350 1355 1360 Asn Lys Glu Val Ala Lys Asp Lys Leu Val Ala Gin Ala Gin Thr Pro 1365 1370 1375 Asp Gly Thr Leu Ala Gin Met Asn Val Lys Ser Val lie Asn Lys Glu 1380 1385 1390 Gin Val Asn Asp Ala Asn Lys Lys Gin Gly lie Asn Glu Asp Asn Ala 1395 1400 1405 Phe lie Lys Gly Leu Glu Asn Ala Ala Lys Asp Thr Lys Thr Lys Asn 1410 1415 1420 Ala Ala Val Thr Val Gly Asp Leu Asn Ala Val Ala Gin Thr Pro Leu 1425 1430 1435 1440 Thr Phe Ala Gly Asp Thr Gly Thr Thr Ala Lys Lys Leu Gly Glu Thr 1445 1450 1455 Leu Thr lie Lys Gly Gly Gin Thr Asp Thr Asn Lys Leu Thr Asp Asn 1460 1465 1470 Asn lie Gly Val Val Ala Gly Thr Asp Gly Phe Thr Val Lys Leu Ala 1475 1480 1485 Lys Asp Leu Thr Asn Leu Asn Ser Val Asn Ala Gly Gly Thr Arg lie 1490 1495 1500 Asp Glu Lys Gly lie Ser Phe Val Asp Ala Asn Gly Gin Ala Lys Ala 1505 1510 1515 1520 Asn Thr Pro Val Leu Ser Ala Asn Gly Leu Asp Leu Gly Gly Lys Arg 1525 1530 1535 lie Ser Asn lie Gly Ala Ala Val Asp Asp Asn Asp Ala Val Asn Phe 1540 1545 1550 Lys Gin Phe Asn Glu Val Ala Lys Thr Val Asn Asn Leu Asn Asn Gin 1555 1560 1565 Ser Asn Ser Gly Ala Ser Leu Pro Phe Val Val Thr Asp Ala Asn Gly 1570 1575 1580 lie Asn Gly Thr Asp Gly Lys Pro Gin Lys Ala lie Lys Gly 1590 1595 1600 Gly Lys Tyr Tyr His Ala Asn Ala Asn Gly Val Pro Val Asp 1605 1610 1615 Gly Lys Pro lie Thr Asp Ala Asp Lys Leu Ala Asn Leu Ala 1620 1625 1630 Gly Lys Pro Leu Asp Ala Gly His Gin Val Val Ala Ser Leu 1635 1640 1645 Gly Gly Asn Ser Asp Ala lie Thr Leu Thr Asn lie Lys Ser Thr Leu 1650 1655 1660 Pro Gin lie Asp Thr Pro Asn Thr Gly Asn Ala Asn Ala Gly Gin Ala 1665 1670 1675 1680 Gin Ser Leu Pro Ser Leu Ser Ala Ala Gin Gin Ser Asn Ala Ala Ser 1685 1690 1695 Val Lys Asp Val Leu Asn Val Gly Phe Asn Leu Gin Thr Asn His Asn 1700 1705 1710 Gin Val Asp Phe Val Lys Ala Tyr Asp Thr Val Asn Phe Val Asn Gly 1715 1720 1725 Thr Gly Ala Asp lie Thr Ser Val Arg Ser Ala Asp Gly Thr Met Ser 1730 1735 1740 Asn lie Thr Val Asn Thr Ala Leu Ala Ala Thr Asp Asp Asp Gly Asn 1745 1750 1755 1760 Lys Pro 1585 Ala Asp Lys Asp Ala His Val Leu lie Lys Ala Lys Asp Gly Lys Phe Tyr Lys Ala Asp Asp Leu 1765 1770 1775 91 Met Pro Asn Gly Ser Leu Lys Ala Gly Lys Ser Ala Ser Asp Ala Lys 1780 1785 1790 Thr Pro Thr Gly Leu Ser Leu Val Asn Pro Asn Ala Gly Lys Gly Ser 1795 1800 1805 Thr Gly Asp Ala Val Ala Leu Asn Asn Leu Ser Lys Ala Val Phe Lys 1810 1815 1820 Ser Lys Asp Gly Thr Thr Thr Thr Thr Val Ser Ser Asp Gly lie Ser 1825 1830 1835 1840 lie Gin Gly Lys Asp Asn Ser Ser lie Thr Leu Ser Lys Asp Gly Leu 1845 1850 1855 Asn Val Gly Gly Lys Val lie Ser Asn Val Gly Lys Gly Thr Lys Asp 1860 1865 1870 Thr Asp Ala Ala Asn Val Gin Gin Leu Asn Glu Val Arg Asn Leu Leu 1875 1880 1885 Gly Leu Gly Asn Ala Gly Asn Asp Asn Ala Asp Gly Asn Gin Val Asn 1890 1895 1900 lie Ala Asp lie Lys Lys Asp Pro Asn Ser Gly Ser Ser Ser Asn Arg 1905 1910 1915 1920 Thr Val lie Lys Ala Gly Thr Val Leu Gly Gly Lys Gly Asn Asn Asp 1925 1930 1935 Thr Glu Lys Leu Ala Thr Gly Gly Val Gin Val Gly Val Asp Lys Asp 1940 1945 1950 Gly Asn Ala Asn Gly Asp Leu Ser Asn Val Trp Val Lys Thr Gin Lys 1955 1960 1965 Asp Gly Ser Lys Lys Ala Leu Leu Ala Thr Tyr Asn Ala Ala Gly Gin 1970 1975 1980 Thr Asn Tyr Leu Thr Asn Asn Pro Ala Glu Ala lie Asp Arg lie Asn 1985 1990 1995 2000 Glu Gin Gly lie Arg Phe Phe His Val Asn Asp Gly Asn Gin Glu Pro 2005 2010 2015 Val Val Gin Gly Arg Asn Gly lie Asp Ser Ser Ala Ser Gly Lys His 2020 2025 2030 Ser Val Ala lie Gly Phe Gin Ala Lys Ala Asp Gly Glu Ala Ala Val 2035 2040 2045 Ala lie Gly Arg Gin Thr Gin Ala Gly Asn Gin Ser lie Ala lie Gly 2050 2055 2060 Asp Asn Ala Gin Ala Thr Gly Asp Gin Ser lie Ala lie Gly Thr Gly 2065 2070 2075 2080 Asn Val Val Thr Gly Lys His Ser Gly Ala lie Gly Asp Pro Ser Thr 2085 2090 2095 loo Val Lys Ala Asp Asn Ser Tyr Ser Val Gly Asn Asn Asn Gin Phe lie 2100 2105 2110 Asp Ala Thr Gin Thr Asp Val Phe Gly Val Gly Asn Asn lie Thr Val 2115 2120 2125 Thr Glu Ser Asn Ser Val Ala Leu Gly Ser Asn Ser Ala lie Ser Ala 2130 2135 2140 Gly Thr His Ala Gly Thr Gin Ala Lys Lys Ser Asp Gly Thr Ala Gly 2145 2150 2155 2160 Thr Thr Thr Thr Ala Gly Ala Thr Gly Thr Val Lys Gly Phe Ala Gly 2165 2170 2175 Gin Thr Ala Val Gly Ala Val Ser Val Gly Ala Ser Gly Ala Glu Arg 2180 2185 2190 Arg lie Gin Asn Val Ala Ala Gly Glu Val Ser Ala Thr Ser Thr Asp 2195 2200 2205 Ala Val Asn Gly Ser Gin Leu Tyr Lys Ala Thr Gin Gly lie Ala Asn 2210 2215 2220 Ala Thr Asn Glu Leu Asp His Arg lie His Gin Asn Glu Asn Lys Ala 2225 2230 2235 2240 Asn Ala Gly lie Ser Ser Ala Met Ala Met Ala Ser Met Pro Gin Ala 2245 2250 2255 Tyr lie Pro Gly Arg Ser Met Val Thr Gly Gly lie Ala Thr His Asn 2260 2265 2270 Gly Gin Gly Ala Val Ala Val Gly Leu Ser Lys Leu Ser Asp Asn Gly 2275 2280 2285 Gin Trp Val Phe Lys lie Asn Gly Ser Ala Asp Thr Gin Gly His Val 2290 2295 2300 Gly Ala Ala Val Gly Ala Gly Phe His Phe 2305 2310 <210> 12 <211> 6259 <212> DNA <213> Moraxella catarrhalis <400> 12 atgatcggtg gcaattggtg gccattgcta agtaataaaa gagtccatcg agtgatgact attaacgatc gatgtaaaat tcatatgcac tattccttgg tctgatgcaa ctacagggca caacgctcag aacaaaacca ttggtgaaaa ctgtcaatgg ccatcggtgg tacatttgct ttattaacgg atagacgcac agggtcattt cagtgggtct catctagctc gtattgccct tggcagtgct gccaagacgc tgctaacgca aagcagtttg tgatgtaaag tgatcagcat ccatgcagta aaccgcaagc ttccaacgcc tgccgccaca gttgggagcg aggtcaaggt tatgctcaaa tcaggcactg cagggcggtc gataagatag gctagtggtg ggtaatccta ttaaaagaaa ggacacgcca tttggtacac gccgagggcc atagcccttg tctgttgtca aaaaagatac ccaaggcgga aagccatcgc gtaccgatgc atgcctcgat aacatccgaa tacgaagctc gtactgcagt gggcaacagc aatctacaat gtgcaggtac ctcagagtga caaacatatc 60 cggtgatcga 120 catcggtagt 180 tacgggtcaa 240 tgccatcggt 300 aggtactctg 360 aaaggataat 420 gggagccatg 480 taaaagtgcc 540 cgctattggt 600 tcgtgctcag 660 taataattct 720 io\ agaccggcct acgaaggcgg ggtgcaggtg tgggctaagg ggtttggata aatatcggtg ttaaacaatc ggtagtagta aatacaggca aataatgcag tttgctcgag aaagtgggta agtaatcttg gccaagccta gatgctaaga cttaacagtg ttagttaccg gctctacaaa gctaaagata ggtctaacgg ggtctgacca gaacaaatcc ggtactggca gatggtgcag gttaagatta acactgccta gacaaagaca aaaaataata ggcaatgcca tatgatgtga cttggcgtca tttaatgtta ctaaacaccc acctttaccg gtgggtcaaa cttaatatta cttaaagccg agcgaacaaa gttgtaggtg gggactaatg ggtggtaaaa gtgacaggcg gccaaaacag tttacggtta tttgcaggtg gaccaaacca attgtcattg aatgttacca gaagacaaaa ggcaatggtg aatgccacca gatgtcaatg accacattga ggcgatgcgc atccaaactg ggcaataagg acagttgata gatggcacat gccaataaaa gcttctgata caaacaccgc atacaccaaa gtccactttc ttaataaaac agcgtagaat atactttaac tggtaaaaga ttactgaggt gtagtactac gtcaaagcac aaacaacagc atggtgatgt gtgttgcaat ccaaaggtag ctttaaacgc gtggcaatgt atggcactag ccgaacattt gctttaccgt cgacaaaaaa ttgctaccaa ttggcaaaag aagtcggtgc ttgcaaatac ttgatacaaa ccaacactgg gcattgccga aatccaacgc acaaccccat ccaccgccac atgtggatga aaaccaccaa actctagtga tagccaagga ttaaaaaggt agaacgcaaa aaaccgacaa gcaaaagcac tccaagtcgg ctggcattga gctcacttga agattaccaa gcaagattta cacaaaactc gtaaccctta aaaacggcat aaggcttaac acagccaaaa atgataaagg cccgtgccgc aagcggttga ccgctaaggt tggatgatac ccagtactgg ttgtcaaggc ccaaaggggc tcatctatga aaaccaaaga tggctcaaat agcaaggcat acaaaaccaa tgacctttgc tacccaggca cattggtagt cgatgcggtc tacttttcag tattaaaggt ggctgataat gaatacaact agctgaatta aagcaaaacc agcaatcggc tgatgaaaaa taccatagac cagtgctaac aggcgctggc taccgcccca tgataaattt ggcaagctat taaagaagaa tgccggcgca aaaagatggt caccctaaac taatggcatt cgctcgcatt caaaccttat cattaacgca tcaaagtagc tgccagcatt tgactttgtc agtaacccat tacaaccatt actgaacaaa tgaagatgcc aattcacacc agatgaaaat taatcaagtc aaatggtacg cctaaacgac tgctgatggc tggcacaact taaaagcaaa cattcaatca tgatttaaaa attacacgaa ctccagttat taccaccaag cacgcctaag tggtcaaaat tagcgtacgc cagcattgtt ctttgtctcc gacctatgat aaccattgaa cacaggtgct cagtgatatc aagccaagcg cagtaccgat agttgccaaa gaatgtcaaa caatgaagac aaacgccgca aggggataca ctagacccca aactctatca aatgtggcac ggtgatgata ggtgcagaga agtggtctga acattaaatg ttgagtgata gtctatggcg actactcgta caagcaccat aatggcattg gatgcggtta atcagtgtca acttacaaca agtgttaagg ctaaatgaag gacgatgatg gtcagcatct acggttacct aacgatggct aaatttacta accagagata cttgatcaag ggtggtaaag cgcaacatag aatgatatat tccacttatg gataccgcta catctaacag acaagtgcta cttgttaacg accaaaggca aataatgctg aacaccctaa gttacctttg ggtggcttgt gtgaagtttg cgcattacca ccccacctaa ggtgagattg accgaacttg ttctcagtag gacacctcaa gtaaataaag ctgaccgtgg accatcacag accacagaac gatgtgctaa acttatgaca gacacaagca gttaaagata aataaatttg gttgctcatc aacaactcag aacaagtact gacaaactgg tcagtcatta aacgcctttg gtaactgtgg ggcacaacgg agtttcaagc aacgtaaaat agctagaagc acagtactga ccaacgcatt aagttaaact ccacaaccac gtttaacctt ttaatggggt ttaccagaga atttggataa atgcaggtaa ccatcgaaca cacctactga ttggcgtgaa gtagtggtac tcaatcgaac acgccaacgc taaaactcaa ttgggcttag tgactgttaa atgtgaatgg aaattggctt acaagctaca ccatcacagg aactgggcaa taaatacagg acattgttga acaaaaccag gcactgatga atggtaatac ccaaagacat cagcagacac atgacgccaa cactcaaagg gcattaacac ctattaaaaa ccaaggttaa gagatgaaat gcaaagacgg cccaaaacag aaaacaaaat cagatgaaca agacctctga gtgtggtgcg gtaataataa gactaagcaa agggcaatat gcgcaggctt ccgtcaactt aaaccagtaa aaaaacttgg ccctaagcaa taaacacctt caggctatgt atcaagccaa tcgcccaagc acaaagaaca ttaaaggact gtgatttaaa ctaaaaaact caccaataat catcaatgtc ggtggtgaag cgtaaaaata aaccgataat tgctaaaact agttaaggta tacccagccc gaagtttact taaaattggc aaaacaactt taaaaagatc gctcaaagcc aatatcagtt aaccaccgag gaacaatagc ggctgacagt tatcaccgtg aggtaaaaac ccaagatagc agataccaac tagtaatcca tgctggttct agttggcaat gctgtcccca tacaatccaa ctttaaccta ctttgccaat taaagtggta caataaaaaa agcaactaac cgccgaaaat cgccctacaa cgccatcacc tgaaaacggt cacaagcggt ccccactggt taataatggt tggctttact cattaacgca ccatgatgct cagcagtact aggtaataac tgtcatcacc tgtgggcatt tggcaaaggc cactctagct aatcaaagac taacttgcaa tgccgatggc agtggtctat cgtaaaaacc tcaagctact atctggcgac ggatgctgat aaatgatggc ccaaacccca agtaaatgat tgaaaaagcc tgccgttgcc gggcgagact 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 324 0 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 (OZ ttgaccatca aaggtgggca aacagacacc aataagctaa ccgataataa catcggtgtg 4440 gtagcaggta ctgatggctt cactgtcaaa cttgccaaag acctaaccaa tcttaacagc 4500 gttaatgcag gtggcaccaa aattgatgac aaaggcgtgt cttttgtaga ctcaagcggt 4560 caagccaaag caaacacccc tgtgctaagt gccaatgggc tggacctggg tggcaaggtc 4 620 atcagtaatg tgggcaaagg cacaaaagat accgacgctg ccaatgtaca acagttaaac 4 680 gaagtacgca acttgttggg tcttggtaat gctggtaatg ataacgctga cggcaatcag 4740 gtaaacattg ccgacatcaa aaaagaccca aattcaggtt catcatctaa ccgcactgtc 4800 atcaaagcag gcacggtact tggcggtaaa ggtaataacg ataccgaaaa acttgccact 4 8 60 ggtggtatac aagtgggcgt ggataaagac ggcaacgcta acggcgattt aagcaatgtt 4 920 tgggtcaaaa cccaaaaaga tggcagcaaa aaagccctgc tcgccactta taacgccgca 4 980 ggtcagacca actatttgac caacaacccc gcagaagcca ttgacagaat aaatgaacaa 5040 ggtatccgct tcttccatgt caacgatggc aatcaagagc ctgtggtaca agggcgtaac 5100 ggcattgact caagtgcctc aggcaagcac tcagtggcga taggtttcca ggccaaggca 5160 gatggtgaag ccgccgttgc cataggcaga caaacccaag caggcaacca atccatcgcc 5220 atcggtgata acgcacaagc cacgggcgat caatccatcg ccatcggtac aggcaatgtg 5280 gtagcaggta agcactctgg tgccatcggc gacccaagca ctgttaaggc tgataacagt 5340 tacagtgtgg gtaataacaa ccagtttacc gatgccactc aaaccgatgt ctttggtgtg 5400 ggcaataaca tcaccgtgac cgaaagtaac tcggttgcct taggttcaaa ctctgccatc 54 60 agtgcaggca cacacgcagg cacacaagcc aaaaaatctg acggcacagc aggtacaacc 5520 accacagcag gtgcaaccgg tacggttaaa ggctttgctg gacaaacggc ggttggtgcg 5580 gtctccgtgg gtgcctcagg tgctgaacgc cgtatccaaa atgtggcagc aggtgaggtc 5640 agtgccacca gcaccgatgc ggtcaatggt agccagttgt acaaagccac ccaaagcatt 5700 gccaacgcaa ccaatgagct tgaccatcgt atccaccaaa acgaaaataa ggccaatgca 5760 gggatttcat cagcgatggc gatggcgtcc atgccacaag cctacattcc tggcagatcc 5820 atggttaccg ggggtattgc cacccacaac ggtcaaggtg cggtggcagt gggactgtcg 5880 aagctgtcgg ataatggtca atgggtattt aaaatcaatg gttcagccga tacccaaggc 5940 catgtagggg cggcagttgg tgcaggtttt cacttttaag ccataaatcg caagatttta 6000 cttaaaaatc aatctcacca tagttgtata aaacagcatc agcatcagtc atattactga 6060 tgctgatgtt ttttatcact taaaccattt taccgctcaa gtgattctct ttcaccatga 6120 ccaaatcgcc attgatcata ggtaaactta ttgagtaaat tttatcaatg tagttgttag 6180 atatggttaa aattgtgcca ttgaccaaaa aatgaccgat ttatcccgaa aatttctgat 6240 tatgatccgt tgacctgca 6259 <210> 13 <211> 1992 <212> PRT <213> Moraxella catarrhalis <400> 13 Met lie Gly Ala Thr Leu Ser Gly Ser Ala Tyr Ala Gin Lys Lys Asp 15 10 15 Thr Lys His lie Ala lie Gly Glu Gin Asn Gin Pro Arg Arg Ser Gly 20 25 30 Thr Ala Lys Ala Asp Gly Asp Arg Ala lie Ala lie Gly Glu Asn Ala 35 40 45 Asn Ala Gin Gly Gly Gin Ala lie Ala lie Gly Ser Ser Asn Lys Thr 50 55 60 Val Asn Gly Ser Ser Leu Asp Lys lie Gly Thr Asp Ala Thr Gly Gin 65 70 75 80 Glu Ser lie Ala lie Gly Gly Asp Val Lys Ala Ser Gly Asp Ala Ser 85 90 95 lie Ala lie Gly Ser Asp Asp Leu His Leu Leu Asp Gin His Gly Asn 100 105 110 m Pro Lys His Pro Lys Gly Thr Leu lie Asn Asp Leu lie Asn Gly His 115 120 125 Ala Val Leu Lys Glu lie Arg Ser Ser Lys Asp Asn Asp Val Lys Tyr .130 135 140 Arg Arg Thr Thr Ala Ser Gly His Ala Ser Thr Ala Val Gly Ala Met 145 150 155 160 Ser Tyr Ala Gin Gly His Phe Ser Asn Ala Phe Gly Thr Arg Ala Thr 165 170 175 Ala Lys Ser Ala Tyr Ser Leu Ala Val Gly Leu Ala Ala Thr Ala Glu 180 185 190 Gly Gin Ser Thr lie Ala lie Gly Ser Asp Ala Thr Ser Ser Ser Leu 195 200 205 Gly Ala lie Ala Leu Gly Ala Gly Thr Arg Ala Gin Leu Gin Gly Ser 210 215 220 lie Ala Leu Gly Gin Gly Ser Val Val Thr Gin Ser Asp Asn Asn Ser 225 230 235 240 Arg Pro Ala Tyr Thr Pro Asn Thr Gin Ala Leu Asp Pro Lys Phe Gin 245 250 255 Ala Thr Asn Asn Thr Lys Ala Gly Pro Leu Ser lie Gly Ser Asn Ser 260 265 270 lie Lys Arg Lys lie lie Asn Val Gly Ala Gly Val Asn Lys Thr Asp 275 280 285 Ala Val Asn Val Ala Gin Leu Glu Ala Val Val Lys Trp Ala Lys Glu 290 295 300 Arg Arg lie Thr Phe Gin Gly Asp Asp Asn Ser Thr Asp Val Lys lie 305 310 315 320 Gly Leu Asp Asn Thr Leu Thr lie Lys Gly Gly Ala Glu Thr Asn Ala 325 330 335 Leu Thr Asp Asn Asn lie Gly Val Val Lys Glu Ala Asp Asn Ser Gly 340 345 350 Leu Lys Val Lys Leu Ala Lys Thr Leu Asn Asn Leu Thr Glu Val Asn 355 360 365 Thr Thr Thr Leu Asn Ala Thr Thr Thr Val Lys Val Gly Ser Ser Ser 370 375 380 Ser Thr Thr Ala Glu Leu Leu Ser Asp Ser Leu Thr Phe Thr Gin Pro 385 390 395 400 Asn Thr Gly Ser Gin Ser Thr Ser Lys Thr Val Tyr Gly Val Asn Gly 405 410 415 Val Lys Phe Thr Asn Asn Ala Glu Thr Thr Ala Ala lie Gly Thr Thr 420 425 430 Arg lie Thr Arg Asp Lys lie Gly Phe Ala Arg Asp Gly Asp Val Asp /o4 435 440 445 Glu Lys Gin Ala Pro Tyr Leu Asp Lys Lys Gin Leu Lys Val Gly Ser 450 455 460 Val Ala lie Thr lie Asp Asn Gly lie Asp Ala Gly Asn Lys Lys lie 465 470 475 480 Ser Asn Leu Ala Lys Gly Ser Ser Ala Asn Asp Ala Val Thr lie Glu 485 490 495 Gin Leu Lys Ala Ala Lys Pro Thr Leu Asn Ala Gly Ala Gly lie Ser 500 505 510 Val Thr Pro Thr Glu lie Ser Val Asp Ala Lys Ser Gly Asn Val Thr 515 520 525 Ala Pro Thr Tyr Asn lie Gly Val Lys Thr Thr Glu Leu Asn Ser Asp 530 535 540 Gly Thr Ser Asp Lys Phe Ser Val Lys Gly Ser Gly Thr Asn Asn Ser 545 550 555 560 Leu Val Thr Ala Glu His Leu Ala Ser Tyr Leu Asn Glu Val Asn Arg 565 570 575 Thr Ala Asp Ser Ala Leu Gin Ser Phe Thr Val Lys Glu Glu Asp Asp 580 585 590 Asp Asp Ala Asn Ala lie Thr Val Ala Lys Asp Thr Thr Lys Asn Ala 595 600 605 Gly Ala Val Ser lie Leu Lys Leu Lys Gly Lys Asn Gly Leu Thr Val 610 615 620 Ala Thr Lys Lys Asp Gly Thr. Val Thr Phe Gly Leu Ser Gin Asp Ser 625 630 635 640 Gly Leu Thr lie Gly Lys Ser Thr Leu Asn Asn Asp Gly Leu Thr Val 645 650 655 Lys Asp Thr Asn Glu Gin lie Gin Val Gly Ala Asn Gly lie Lys Phe 660 665 670 Thr Asn Val Asn Gly Ser Asn Pro Gly Thr Gly lie Ala Asn Thr Ala 675 680 685 Arg lie Thr Arg Asp Lys lie Gly Phe Ala Gly Ser Asp Gly Ala Val 690 695 700 Asp Thr Asn Lys Pro Tyr Leu Asp Gin Asp Lys Leu Gin Val Gly Asn 705 710 715 720 Val Lys lie Thr Asn Thr Gly lie Asn Ala Gly Gly Lys Ala lie Thr 725 730 735 Gly Leu Ser Pro Thr Leu Pro Ser lie Ala Asp Gin Ser Ser Arg Asn 740 745 750 lie Glu Leu Gly Asn Thr lie Gin Asp Lys Asp Lys Ser Asn Ala Ala 755 760 765 lor Ser lie Asn Asp lie Leu Asn Thr Gly Phe Asn Leu Lys Asn Asn Asn 770 775 780 Asn Pro lie Asp Phe Val Ser Thr Tyr Asp lie Val Asp Phe Ala Asn 785 790 795 800 Gly Asn Ala Thr Thr Ala Thr Val Thr His Asp Thr Ala Asn Lys Thr 805 810 815 Ser Lys Val Val Tyr Asp Val Asn Val Asp Asp Thr Thr lie His Leu 820 825 830 Thr Gly Thr Asp Asp Asn Lys Lys Leu Gly Val Lys Thr Thr Lys Leu 835 840 845 Asn Lys Thr Ser Ala Asn Gly Asn Thr Ala Thr Asn Phe Asn Val Asn 850 855 860 Ser Ser Asp Glu Asp Ala Leu Val Asn Ala Lys Asp lie Ala Glu Asn 865 870 875 880 Leu Asn Thr Leu Ala Lys Glu lie His Thr Thr Lys Gly Thr Ala Asp 885 890 895 Thr Ala Leu Gin Thr Phe Thr Val Lys Lys Val Asp Glu Asn Asn Asn 900 905 910 Ala Asp Asp Ala Asn Ala lie Thr Val Gly Gin Lys Asn Ala Asn Asn 915 920 925 Gin Val Asn Thr Leu Thr Leu Lys Gly Glu Asn Gly Leu Asn lie Lys 930 935 940 Thr Asp Lys Asn Gly Thr Val Thr Phe Gly lie Asn Thr Thr Ser Gly 945 950 955 ' 960 Leu Lys Ala Gly Lys Ser Thr Leu Asn Asp Gly Gly Leu Ser lie Lys 965 970 975 Asn Pro Thr Gly Ser Glu Gin lie Gin Val Gly Ala Asp Gly Val Lys 980 985 990 Phe Ala Lys Val Asn Asn Asn Gly Val Val Gly Ala Gly lie Asp Gly 995 1000 1005 Thr Thr Arg lie Thr Arg Asp Glu lie Gly Phe Thr Gly Thr Asn Gly 1010 1015 1020 Ser Leu Asp Lys Ser Lys Pro His Leu Ser Lys Asp Gly lie Asn Ala 1025 1030 1035 1040 Gly Gly Lys Lys lie Thr Asn lie Gin Ser Gly Glu lie Ala Gin Asn 1045 1050 1055 Ser His Asp Ala Val Thr Gly Gly Lys lie Tyr Asp Leu Lys Thr Glu 1060 1065 1070 Leu Glu Asn Lys lie Ser Ser Thr Ala Lys Thr Ala Gin Asn Ser Leu 1075 1080 1085 His Glu Phe Ser Val Ala Asp Glu 1090 1095 Asn Pro Tyr Ser Ser Tyr Asp Thr 1105 1110 Phe Ala Gly Glu Asn Gly lie Thr 1125 ?oc, Gin Gly Asn Asn Phe Thr Val Ser 1100 Ser Lys Thr Ser Asp Val lie Thr 1115 1120 Thr Lys Val Asn Lys Gly Val Val 1130 1135 Arg Val Gly lie Asp Gin Thr Lys Gly Leu Thr Thr Pro Lys Leu Thr 1140 1145 1150 Val Gly Asn Asn Asn Gly Lys Gly lie Val lie Asp Ser Gin Asn Gly 1155 1160 1165 Gin Asn Thr lie Thr Gly Leu Ser Asn Thr Leu Ala Asn Val Thr Asn 1170 1175 1180 Asp Lys Gly Ser Val Arg Thr Thr Glu Gin Gly Asn lie lie Lys Asp 1185 1190 1195 1200 Glu Asp Lys Thr Arg Ala Ala Ser lie Val Asp Val Leu Ser Ala Gly 1205 1210 1215 Phe Asn Leu Gin Gly Asn Gly Glu Ala Val Asp Phe Val Ser Thr Tyr 1220 1225 1230 Asp Thr Val Asn Phe Ala Asp Gly Asn Ala Thr Thr Ala Lys Val Thr 1235 1240 1245 Tyr Asp Asp Thr Ser Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val 1250 1255 1260 Asp Asp Thr Thr lie Glu Val Lys Asp Lys Lys Leu Gly Val Lys Thr 1265 1270 ' 1275 1280 Thr Thr Leu Thr Ser Thr Gly Thr Gly Ala Asn Lys Phe Ala Leu Ser 1285 1290 1295 Asn Gin Ala Thr Gly Asp Ala Leu Val Lys Ala Ser Asp lie Val Ala 1300 1305 1310 His Leu Asn Thr Leu Ser Gly Asp lie Gin Thr Ala Lys Gly Ala Ser 1315 1320 1325 Gin Ala Asn Asn Ser Ala Gly Tyr Val Asp Ala Asp Gly Asn Lys Val 1330 1335 1340 lie Tyr Asp Ser Thr Asp Asn Lys Tyr Tyr Gin Ala Lys Asn Asp Gly 1345 1350 1355 1360 Thr Val Asp Lys Thr Lys Glu Val Ala Lys Asp Lys Leu Val Ala Gin 1365 1370 1375 Ala Gin Thr Pro Asp Gly Thr Leu Ala Gin Met Asn Val Lys Ser Val 1380 1385 1390 lie Asn Lys Glu Gin Val Asn Asp Ala Asn Lys Lys Gin Gly lie Asn 1395 1400 1405 Glu Asp Asn Ala Phe Val Lys Gly Leu Glu Lys Ala Ala Ser Asp Asn tozI 1410 1415 1420 Lys Thr Lys Asn Ala Ala Val Thr Val Gly Asp Leu Asn Ala Val Ala 1425 1430 1435 1440 Gin Thr Pro Leu Thr Phe Ala Gly Asp Thr Gly Thr Thr Ala Lys Lys 1445 1450 1455 Leu Gly Glu Thr Leu Thr lie Lys Gly Gly Gin Thr Asp Thr Asn Lys 1460 1465 1470 Leu Thr Asp Asn Asn lie Gly Val Val Ala Gly Thr Asp Gly Phe Thr 1475 1480 1485 Val Lys Leu Ala Lys Asp Leu Thr Asn Leu Asn Ser Val Asn Ala Gly 1490 1495 1500 Gly Thr Lys lie Asp Asp Lys Gly Val Ser Phe Val Asp Ser Ser Gly 1505 1510 1515 1520 Gin Ala Lys Ala Asn Thr Pro Val Leu Ser Ala Asn Gly Leu Asp Leu 1525 1530 1535 Gly Gly Lys Val lie Ser Asn Val Gly Lys Gly Thr Lys Asp Thr Asp 1540 1545 1550 Ala Ala Asn Val Gin Gin Leu Asn Glu Val Arg Asn Leu Leu Gly Leu 1555 1560 1565 Gly Asn Ala Gly Asn Asp Asn Ala Asp Gly Asn Gin Val Asn lie Ala 1570 1575 1580 Asp lie Lys Lys Asp Pro Asn Ser Gly Ser Ser Ser Asn Arg Thr Val 1585 1590 1595 1600 lie Lys Ala Gly Thr Val Leu Gly Gly Lys Gly Asn Asn Asp Thr Glu 1605 1610 1615 Lys Leu Ala Thr Gly Gly lie Gin Val Gly Val Asp Lys Asp Gly Asn 1620 1625 1630 Ala Asn Gly Asp Leu Ser Asn Val Trp Val Lys Thr Gin Lys Asp Gly 1635 1640 1645 Ser Lys Lys Ala Leu Leu Ala Thr Tyr Asn Ala Ala Gly Gin Thr Asn 1650 1655 1660 Tyr Leu Thr Asn Asn Pro Ala Glu Ala lie Asp Arg lie Asn Glu Gin 1665 1670 1675 1680 Gly lie Arg Phe Phe His Val Asn Asp Gly Asn Gin Glu Pro Val Val 1685 1690 1695 Gin Gly Arg Asn Gly lie Asp Ser Ser Ala Ser Gly Lys His Ser Val 1700 1705 1710 Ala lie Gly Phe Gin Ala Lys Ala Asp Gly Glu Ala Ala Val Ala lie 1715 1720 1725 Gly Arg Gin Thr Gin Ala Gly Asn Gin Ser lie Ala lie Gly Asp Asn 1730 1735 1740 tc% Ala Gin Ala Thr Gly Asp Gin Ser lie Ala lie Gly Thr Gly Asn Val 1745 1750 1755 1760 Val Ala Gly Lys His Ser Gly Ala lie Gly Asp Pro Ser Thr Val Lys 1765 1770 1775 Ala Asp Asn Ser Tyr Ser Val Gly Asn Asn Asn Gin Phe Thr Asp Ala 1780 1785 1790 Thr Gin Thr Asp Val Phe Gly Val Gly Asn Asn lie Thr Val Thr Glu 1795 1800 1805 Ser Asn Ser Val Ala Leu Gly Ser Asn Ser Ala lie Ser Ala Gly Thr 1810 1815 1820 His Ala Gly Thr Gin Ala Lys Lys Ser Asp Gly Thr Ala Gly Thr Thr 1825 1830 1835 1840 Thr Thr Ala Gly Ala Thr Gly Thr Val Lys Gly Phe Ala Gly Gin Thr 1845 1850 1855 Ala Val Gly Ala Val Ser Val Gly Ala Ser Gly Ala Glu Arg Arg lie 1860 1865 1870 Gin Asn Val Ala Ala Gly Glu Val Ser Ala Thr Ser Thr Asp Ala Val 1875 1880 1885 Asn Gly Ser Gin Leu Tyr Lys Ala Thr Gin Ser lie Ala Asn Ala Thr 1890 1895 1900 Asn Glu Leu Asp His Arg lie His Gin Asn Glu Asn Lys Ala Asn Ala 1905 1910 1915 1920 Gly lie Ser Ser Ala Met Ala Met Ala Ser Met Pro Gin Ala Tyr lie 1925 1930 1935 Pro Gly Arg Ser Met Val Thr Gly Gly lie Ala Thr His Asn Gly Gin 1940 1945 1950 Gly Ala Val Ala Val Gly Leu Ser Lys Leu Ser Asp Asn Gly Gin Trp 1955 1960 1965 Val Phe Lys lie Asn Gly Ser Ala Asp Thr Gin Gly His Val Gly Ala 1970 1975 1980 Ala Val Gly Ala Gly Phe His Phe 1985 1990 <210> 14 <211> 23 <212> DNA <213> Moraxella catarrhalis <4 00> 14 gatgcctacg agttgatttg ggt <210> 15 <211> 23 <212> DNA <213> Moraxella catarrhali <400> 15 gagcgttgca ccgatcacga gga 23 <210> 16 <211> 26 <212> DNA <213> Moraxella catarrhalis <4 00> 16 cactagcctt tacatcacca ccgatg 26 <210> 17 <211> 35 <212> DNA <213> Moraxella catarrhalis <210> 18 <211> 22 <212> DNA <213> Moraxella catarrhalis <4 00> 18 gcttctagct gtgccacatt ga 22 <210> 19 <211> 33 <212> DNA <213> Moraxella catarrhalis <210> 20 <211> 23 <212> DNA <213> Moraxella catarrhalis <400> 20 gaccctgtgc atatgacatg get 23 <210> 21 <211> 22 <212> DNA <213> Moraxella catarrhalis <4 00> 17 aaggtaaacc catatgaatc acatctataa agtca 35 <4 00> 19 cgctcgctgt ccatatgatc ggtgcaacgc tea 33 <400> 21 ccttggcatc aatcgtggca ca 22 no <210> 22 <211> 24 <212> DNA <213> Moraxella catarrhalis <400> 22 ttacctgcat caatgccatt gtct 24 <210> 23 <211> 20 <212> DNA <213> Moraxella catarrhalis <210> 24 <211> 24 <212> DNA <213> Moraxella catarrhalis <400> 24 catcagaggt ctttgaggtg teat 24 <210> 25 <211> 25 <212> DNA <213> Moraxella catarrhalis <210> 26 <211> 22 <212> DNA <213> Moraxella catarrhalis <400> 26 gatgteggea atgtttacct ga 22 <210> 27 <211> 30 <212> DNA <213> Moraxella catarrhalis <400> 23 ctgaggtgaa tacaactaca 20 <400> 25 catcaccgtg ggtcaaaaga aegea 25 <400> 27 ccacattgac cagtactggc acaggtgcta 30 <210> 28 <211> 24 <212> DNA <213> Moraxella catarrhalis <400> 28 acctatgatc aatggcgatt tggt 24 <210> 29 <211> 30 <212> DNA <213> Moraxella catarrhalis <400> 29 aaagatcata tggttacctt tggcattaac <210> 30 <211> 27 <212> DNA <213> Moraxella catarrhalis <400> 30 gtcatctttc atatggccac aggcaca <210> 31 <211> 28 <212> DNA <213> Moraxella catarrhalis <400> 31 acatttatgc atatggcaga gtacgcca <210> 32 <211> 30 <212> DNA <213> Moraxella catarrhalis <400> 32 gctacagggc atatgggcag tgtatgcact <210> 33 <211> 6 <212> PRT <213> Moraxella catarrhalis <400> 33 His Val Gly Ala Ala Lys 1 5 <210> 34 <211> 6 <212> PRT <213> Moraxella catarrhalis <400> 34 His Tyr Ala Val Val Lys 1 5 <210> 35 <211> 6 <212> PRT <213> Moraxella catarrhalis <400> 35 His Tyr Val Gly Gly Lys 1 5 <210> 36 <211> 6 <212> PRT <213> Moraxella catarrhalis <400> 36 His Tyr Gin Gly Gly Lys 1 5 <210> 37 <211> 6 <212> PRT <213> Moraxella catarrhalis <400> 37 His Tyr Phe Gly Gly Lys 1 5 <210> 38 <211> 4 <212> PRT <213> Moraxella catarrhalis <400> 38 Gly Val Val Lys 1 <210> 39 <211> 5 <212> PRT <213> Moraxella catarrhalis <400> 39 Val Leu Gly Gly Lys 1 5 <210> 40 <211> 5 <212> PRT <213> Moraxella catarrhalis <400> 40 Val Val Ala Gly Lys 1 5 <210> 41 <211> 33 <212> DNA <213> Moraxella catarrhalis /13 <400> 41 gcctcaggca agcactcagt ggcgataggt ttc 33 <210> 42 <211> 43 <212> DNA <213> Moraxella catarrhalis <400> 42 ccggctgcag ctattactta cctgctacca cattgcctgt acc 43 <210> 43 <211> 43 <212> DNA <213> Moraxella catarrhalis <400> 43 ggtacaggca atgtggtagc aggtaagtaa tagctgcagc egg 43 <210> 44 <211> 9 <212> PRT <213> Moraxella catarrhalis <400> 44 Gly Thr Gly Asn Val Val Ala Gly Lys 1 5 <210> 45 <211> 3135 <212> DNA <213> Moraxella catarrhalis <400> 45 ggtacggtta aacgacggtg gatggcgtga acaactcgca agcaaacccc caatcaggtg ttaaaaaccg cacgaattct agttatgaca accaaggtaa cctaagctga caaaatacca gtacgcacca attgttgatg gtctccactt tatgatgaca attgaagtta ggtgctaata gatatcgttg caagcgaaca accgataaca cctttggcat gcttgtctat agtttgccaa ttaccagaga acctaagcaa agattgccca aacttgaaaa cagtagcaga cctcaaagac ataaaggtgt ccgtgggtaa tcacaggact cagaacaggg tgetaagege atgacaccgt caagcaaaac aagataaaaa aatttgccct ctcatctaaa actcagcagg agtactatca taacaccaca taaaaacccc ggttaataat tgaaattggc agacggcatt aaacagccat caaaatcagc tgaacaaggt ctctgatgtc ggtgcgtgtg taataatggc aagcaacact caatataatc aggctttaac caactttgcc cagtaaagtg acttggcgta aagcaatcaa caccttatct ctatgtggat agccaaaaat agcggtctta actggtagcg aatggtgttg tttactggga aacgcaggtg gatgctgtga agtactgcca aataacttta atcacctttg ggcattgacc aaaggcattg ctagctaatg aaagacgaag ttgeaaggea gatggcaatg gtctatgatg aaaaccacca gctactggcg ggcgacatcc gctgatggca gatggcacag aagccggcaa aacaaatcca taggtgctgg ctaatggctc gtaaaaagat caggcggcaa aaacagcaca cggttagtaa caggtgaaaa aaaccaaagg tcattgacag ttaccaatga acaaaacccg atggtgaagc ccaccaccgc tcaatgtgga cattgaccag atgcgcttgt aaactgccaa ataaggtcat ttgataaaac aagcacccta agtcggtgct cattgatggc acttgataaa taccaacatt gatttatgat aaactcatta cccttactcc cggcattacc cttaaccacg ccaaaatggt taaaggtagc tgccgccagc ggttgacttt taaggtgacc tgatacaacc tactggcaca caaggccagt aggggcaagc ctatgacagt caaagaagtt 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 m gccaaagaca gtcaaatcag gaagacaacg gccgcagtaa gatacaggca gacaccaata gtcaaacttg gatgacaaag ctaagtgcca aaagataccg ggtaatgctg gacccaaatt ggtaaaggta aaagacggca agcaaaaaag aaccccgcag gatggcaatc aagcactcag ggcagacaaa ggcgatcaat atcggcgacc tttaccgatg agtaactcgg caagccaaaa gttaaaggct gaacgccgta aatggtagcc catcgtatcc gcgtccatgc cacaacggtc gtatttaaaa ggttttcact aactggtcgc tcattaacaa cctttgttaa ctgtgggtga caacggctaa agctaaccga ccaaagacct gcgtgtcttt atgggctgga acgctgccaa gtaatgataa caggttcatc ataacgatac acgctaacgg ccctgctcgc aagccattga aagagcctgt tggcgatagg cccaagcagg ccatcgccat caagcactgt ccactcaaac ttgccttagg aatctgacgg ttgctggaca tccaaaatgt agttgtacaa accaaaacga cacaagccta aaggtgcggt tcaatggttc tttaa ccaagcccaa agaacaagta aggacttgaa tttaaatgcc aaaactgggc taataacatc aaccaatctt tgtagactca cctgggtggc tgtacaacag cgctgacggc atctaaccgc cgaaaaactt cgatttaagc cacttataac cagaataaat ggtacaaggg tttccaggcc caaccaatcc cggtacaggc taaggctgat cgatgtcttt ttcaaactct cacagcaggt aacggcggtt ggcagcaggt agccacccaa aaataaggcc cattcctggc ggcagtggga agccgatacc accccagatg aatgatgcca aaagccgctt gttgcccaaa gagactttga ggtgtggtag aacagcgtta agcggtcaag aaggtcatca ttaaacgaag aatcaggtaa actgtcatca gccactggtg aatgtttggg gccgcaggtc gaacaaggta cgtaacggca aaggcagatg atcgccatcg aatgtggtag aacagttaca ggtgtgggca gccatcagtg acaaccacca ggtgcggtct gaggtcagtg agcattgcca aatgcaggga agatccatgg ctgtcgaagc caaggccatg gcacattggc ataaaaagca ctgataacaa caccgctgac ccatcaaagg caggt'actga atgcaggtgg ccaaagcaaa gtaatgtggg tacgcaactt acattgccga aagcaggcac gtatacaagt tcaaaaccca agaccaacta tccgcttctt ttgactcaag gtgaagccgc gtgataacgc caggtaagca gtgtgggtaa ataacatcac caggcacaca cagcaggtgc ccgtgggtgc ccaccagcac acgcaaccaa tttcatcagc ttaccggggg tgtcggataa taggggcggc tcaaatgaat aggcatcaat aaccaaaaac ctttgcaggg tgggcaaaca tggcttcact caccaaaatt cacccctgtg caaaggcaca gttgggtctt catcaaaaaa ggtacttggc gggcgtggat aaaagatggc tttgaccaac ccatgtcaac tgcctcaggc cgttgccata acaagccacg ctctggtgcc taacaaccag cgtgaccgaa cgcaggcaca aaccggtacg ctcaggtgct cgatgcggtc tgagcttgac gatggcgatg tattgccacc tggtcaatgg agttggtgca 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3135 <210> 46 <211> 1044 <212> PRT <213> Moraxella catarrhalis <400> 46 Gly Thr Val Thr Phe Gly lie Asn Thr Thr Ser Gly Leu Lys Ala Gly 15 10 15 Lys Ser Thr Leu Asn Asp Gly Gly Leu Ser lie Lys Asn Pro Thr Gly 20 25 30 Ser Glu Gin , lie Gin Val Gly Ala Asp Gly Val Lys Phe Ala Lys Val 35 40 45 Asn Asn Asn Gly Val Val Gly Ala Gly lie Asp Gly Thr Thr Arg lie 50 55 60 Thr Arg Asp Glu lie Gly Phe Thr Gly Thr Asn Gly Ser Leu Asp Lys 65 70 75 80 Ser Lys Pro His Leu Ser Lys Asp Gly lie Asn Ala Gly Gly Lys Lys 85 90 95 lie Thr Asn lie Gin Ser Gly Glu lie Ala Gin Asn Ser His Asp Ala 100 105 110 ns Val Thr Gly Gly Lys lie Tyr Asp Leu Lys Thr Glu Leu Glu Asn Lys 115 120 125 lie Ser Ser Thr Ala Lys Thr Ala Gin Asn Ser Leu His Glu Phe Ser 130 135 140 Val Ala Asp Glu Gin Gly Asn Asn Phe Thr Val Ser Asn Pro Tyr Ser 145 150 155 160 Ser Tyr Asp Thr Ser Lys Thr Ser Asp Val lie Thr Phe Ala Gly Glu 165 170 175 Asn Gly lie Thr Thr Lys Val Asn Lys Gly Val Val Arg Val Gly lie 180 185 190 Asp Gin Thr Lys Gly Leu Thr Thr Pro Lys Leu Thr Val Gly Asn Asn 195 200 205 Asn Gly Lys Gly lie Val lie Asp Ser Gin Asn Gly Gin Asn Thr lie 210 215 220 Thr Gly Leu Ser Asn Thr Leu Ala Asn Val Thr Asn Asp Lys Gly Ser 225 230 235 240 Val Arg Thr Thr Glu Gin Gly Asn lie lie Lys Asp Glu Asp Lys Thr 245 250 255 Arg Ala Ala Ser lie Val Asp Val Leu Ser Ala Gly Phe Asn Leu Gin 260 265 270 Gly Asn Gly Glu Ala Val Asp Phe Val Ser Thr Tyr Asp Thr Val Asn 275 280 285 Phe Ala Asp Gly Asn Ala Thr Thr Ala Lys Val Thr Tyr Asp Asp Thr 290 295 300 Ser Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val Asp Asp Thr Thr 305 310 315 320 lie Glu Val Lys Asp Lys Lys Leu Gly Val Lys Thr Thr Thr Leu Thr 325 330 335 Ser Thr Gly Thr Gly Ala Asn Lys Phe Ala Leu Ser Asn Gin Ala Thr 340 345 350 Gly Asp Ala Leu Val Lys Ala Ser Asp lie Val Ala His Leu Asn Thr 355 360 365 Leu Ser Gly Asp lie Gin Thr Ala Lys Gly Ala Ser Gin Ala Asn Asn 370 375 380 Ser Ala Gly Tyr Val Asp Ala Asp Gly Ash Lys Val lie Tyr Asp Ser 385 390 395 400 Thr Asp Asn Lys Tyr Tyr Gin Ala Lys Asn Asp Gly Thr Val Asp Lys 405 410 415 Thr Lys Glu Val Ala Lys Asp Lys Leu Val Ala Gin Ala Gin Thr Pro 420 425 430 Asp Gly Thr Leu Ala Gin Met Asn Val Lys Ser Val lie Asn Lys Glu IK, 435 440 445 Gin Val Asn Asp Ala Asn Lys Lys Gin Gly lie Asn Glu Asp Asn Ala 450 455 460 Phe Val Lys Gly Leu Glu Lys Ala Ala Ser Asp Asn Lys Thr Lys Asn 465 470 475 480 Ala Ala Val Thr Val Gly Asp Leu Asn Ala Val Ala Gin Thr Pro Leu 485 490 495 Thr Phe Ala Gly Asp Thr Gly Thr Thr Ala Lys Lys Leu Gly Glu Thr 500 505 510 Leu Thr lie Lys Gly Gly Gin Thr Asp Thr Asn Lys Leu Thr Asp Asn 515 520 525 Asn lie Gly Val Val Ala Gly Thr Asp Gly Phe Thr Val Lys Leu Ala 530 535 540 Lys Asp Leu Thr Asn Leu Asn Ser Val Asn Ala Gly Gly Thr Lys lie 545 550 555 560 Asp Asp Lys Gly Val Ser Phe Val Asp Ser Ser Gly Gin Ala Lys Ala 565 570 575 Asn Thr Pro Val Leu Ser Ala Asn Gly Leu Asp Leu Gly Gly Lys Val 580 585 590 lie Ser Asn Val Gly Lys Gly Thr Lys Asp Thr Asp Ala Ala Asn Val 595 600 605 Gin Gin Leu Asn Glu Val Arg Asn Leu Leu Gly Leu Gly Asn Ala Gly 610 615 620 Asn Asp Asn Ala Asp Gly Asn Gin Val Asn lie Ala Asp lie Lys Lys 625 630 635 640 Asp Pro Asn Ser Gly Ser Ser Ser Asn Arg Thr Val lie Lys Ala Gly 645 650 655 Thr Val Leu Gly Gly Lys Gly Asn Asn Asp Thr Glu Lys Leu Ala Thr 660 665 670 Gly Gly lie Gin Val Gly Val Asp Lys Asp Gly Asn Ala Asn Gly Asp 675 680 685 Leu Ser Asn Val Trp Val Lys Thr Gin Lys Asp Gly Ser Lys Lys Ala 690 695 700 Leu Leu Ala Thr Tyr Asn Ala Ala Gly Gin Thr Asn Tyr Leu Thr Asn 705 710 715 720 Asn Pro Ala Glu Ala lie Asp Arg lie Asn Glu Gin Gly lie Arg Phe 725 730 735 Phe His Val Asn Asp Gly Asn Gin Glu Pro Val Val Gin Gly Arg Asn 740 745 750 Gly He Asp Ser Ser Ala Ser Gly Lys His Ser Val Ala lie Gly Phe 755 7 60 7 65 //? Gin Ala Lys Ala Asp Gly Glu Ala Ala Val Ala lie Gly Arg Gin Thr 770 775 780 Gin Ala Gly Asn Gin Ser lie Ala lie Gly Asp Asn Ala Gin Ala Thr 785 790 795 800 Gly Asp Gin Ser lie Ala lie Gly Thr Gly Asn Val Val Ala Gly Lys 805 810 815 His Ser Gly Ala lie Gly Asp Pro Ser Thr Val Lys Ala Asp Asn Ser 820 825 830 Tyr Ser Val Gly Asn Asn Asn Gin Phe Thr Asp Ala Thr Gin Thr Asp 835 840 845 Val Phe Gly Val Gly Asn Asn lie Thr Val Thr Glu Ser Asn Ser Val 850 855 860 Ala Leu Gly Ser Asn Ser Ala lie Ser Ala Gly Thr His Ala Gly Thr 865 870 875 880 Gin Ala Lys Lys Ser Asp Gly Thr Ala Gly Thr Thr Thr Thr Ala Gly 885 890 895 Ala Thr Gly Thr Val Lys Gly Phe Ala Gly Gin Thr Ala Val Gly Ala 900 905 910 Val Ser Val Gly Ala Ser Gly Ala Glu Arg Arg lie Gin Asn Val Ala 915 920 925 Ala Gly Glu Val Ser Ala Thr Ser Thr Asp Ala Val Asn Gly Ser Gin 930 935 940 Leu Tyr Lys Ala Thr Gin Ser lie Ala Asn Ala Thr Asn Glu Leu Asp 945 950 955 960 His Arg lie His Gin Asn Glu Asn Lys Ala Asn Ala Gly lie Ser Ser 965 970 975 Ala Met Ala Met Ala Ser Met Pro Gin Ala Tyr lie Pro Gly Arg Ser 980 985 990 Met Val Thr Gly Gly lie Ala Thr His Asn Gly Gin Gly Ala Val Ala 995 1000 1005 Val Gly Leu Ser Lys Leu Ser Asp Asn Gly Gin Trp Val Phe Lys lie 1010 1015 1020 Asn Gly Ser Ala Asp Thr Gin Gly His Val Gly Ala Ala Val Gly Ala 1025 1030 1035 1040 Gly Phe His Phe <210> 47 <211> 2448 <212> DNA <213> Moraxella catarrhalis lit <400> 47 ggtacggtta aacgacggtg gatggcgtga acaactcgca agcaaacccc caatcaggtg ttaaaaaccg cacgaattct agttatgaca accaaggtaa cctaagctga caaaatacca gtacgcacca attgttgatg gtctccactt tatgatgaca attgaagtta ggtgctaata gatatcgttg caagcgaaca accgataaca gccaaagaca gtcaaatcag gaagacaacg gccgcagtaa gatacaggca gacaccaata gtcaaacttg gatgacaaag ctaagtgcca aaagataccg ggtaatgctg gacccaaatt ggtaaaggta aaagacggca agcaaaaaag aaccccgcag gatggcaatc aagcactcag ggcagacaaa ggcgatcaat cctttggcat gcttgtctat agtttgccaa ttaccagaga acctaagcaa agattgccca aacttgaaaa cagtagcaga cctcaaagac ataaaggtgt ccgtgggtaa tcacaggact cagaacaggg tgctaagcgc atgacaccgt caagcaaaac aagataaaaa aatttgccct ctcatctaaa actcagcagg agtactatca aactggtcgc tcattaacaa cctttgttaa ctgtgggtga caacggctaa agctaaccga ccaaagacct gcgtgtcttt atgggctgga acgctgccaa gtaatgataa caggttcatc ataacgatac acgctaacgg ccctgctcgc aagccattga aagagcctgt tggcgatagg cccaagcagg ccatcgccat taacaccaca taaaaacccc ggttaataat tgaaattggc agacggcatt aaacagccat caaaatcagc tgaacaaggt ctctgatgtc ggtgcgtgtg taataatggc aagcaacact caatataatc aggctttaac caactttgcc cagtaaagtg acttggcgta aagcaatcaa caccttatct ctatgtggat agccaaaaat ccaagcccaa agaacaagta aggacttgaa tttaaatgcc aaaactgggc taataacatc aaccaatctt tgtagactca cctgggtggc tgtacaacag cgctgacggc atctaaccgc cgaaaaactt cgatttaagc cacttataac cagaataaat ggtacaaggg tttccaggcc caaccaatcc cggtacaggc agcggtctta actggtagcg aatggtgttg tttactggga aacgcaggtg gatgctgtga agtactgcca aataacttta atcacctttg ggcattgacc aaaggcattg ctagctaatg aaagacgaag ttgcaaggca gatggcaatg gtctatgatg aaaaccacca gctactggcg ggcgacatcc gctgatggca gatggcacag accccagatg aatgatgcca aaagccgctt gttgcccaaa gagactttga ggtgtggtag aacagcgtta agcggtcaag aaggtcatca ttaaacgaag aatcaggtaa actgtcatca gccactggtg aatgtttggg gccgcaggtc gaacaaggta cgtaacggca aaggcagatg atcgccatcg aatgtggtag aagccggcaa aacaaatcca taggtgctgg ctaatggctc gtaaaaagat caggcggcaa aaacagcaca cggttagtaa caggtgaaaa aaaccaaagg tcattgacag ttaccaatga acaaaacccg atggtgaagc ccaccaccgc tcaatgtgga cattgaccag atgcgcttgt aaactgccaa ataaggtcat ttgataaaac gcacattggc ataaaaagca ctgataacaa caccgctgac ccatcaaagg caggtactga atgcaggtgg ccaaagcaaa gtaatgtggg tacgcaactt acattgccga aagcaggcac gtatacaagt tcaaaaccca agaccaacta tccgcttctt ttgactcaag gtgaagccgc gtgataacgc caggtaag aagcacccta agtcggtgct cattgatggc acttgataaa taccaacatt gatttatgat aaactcatta cccttactcc cggcattacc cttaaccacg ccaaaatggt taaaggtagc tgccgccagc ggttgacttt taaggtgacc tgatacaacc tactggcaca caaggccagt aggggcaagc ctatgacagt caaagaagtt tcaaatgaat aggcatcaat aaccaaaaac ctttgcaggg tgggcaaaca tggcttcact caccaaaatt cacccctgtg caaaggcaca gttgggtctt catcaaaaaa ggtacttggc gggcgtggat aaaagatggc tttgaccaac ccatgtcaac tgcctcaggc cgttgccata acaagccacg 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2448 <210> 48 <211> 816 <212> PRT <213> Moraxella catarrhalis. <400> 48 Gly Thr Val Thr Phe Gly lie Asn Thr Thr Ser Gly Leu Lys Ala Gly 15 10 15 Lys Ser Thr Leu Asn Asp Gly Gly Leu Ser lie Lys Asn Pro Thr Gly 20 25 30 Ser Glu Gin lie Gin Val Gly Ala Asp Gly Val Lys Phe Ala Lys Val 35 40 45 Asn Asn Asn Gly Val Val Gly Ala Gly lie Asp Gly Thr Thr Arg lie 50 55 60 "1 Thr Arg Asp Glu lie Gly Phe Thr Gly Thr Asn Gly Ser Leu Asp Lys 65 70 75 80 Ser Lys Pro His Leu Ser Lys Asp Gly lie Asn Ala Gly Gly Lys Lys 85 90 95 lie Thr Asn lie Gin Ser Gly Glu lie Ala Gin Asn Ser His Asp Ala 100 105 110 Val Thr Gly Gly Lys lie Tyr Asp Leu Lys Thr Glu Leu Glu Asn Lys 115 120 125 lie Ser Ser Thr Ala Lys Thr Ala Gin Asn Ser Leu His Glu Phe Ser 130 135 140 Val Ala Asp Glu Gin Gly Asn Asn Phe Thr Val Ser Asn Pro Tyr Ser 145 150 155 160 Ser Tyr Asp Thr Ser Lys Thr Ser Asp Val lie Thr Phe Ala Gly Glu 165 170 175 Asn Gly lie Thr Thr Lys Val Asn Lys Gly Val Val Arg Val Gly lie 180 185 190 Asp Gin Thr Lys Gly Leu Thr Thr Pro Lys Leu Thr Val Gly Asn Asn 195 200 205 Asn Gly Lys Gly lie Val lie Asp Ser Gin Asn Gly Gin Asn Thr He 210 215 220 Thr Gly Leu Ser Asn Thr Leu Ala Asn Val Thr Asn Asp Lys Gly Ser 225 230 235 240 Val Arg Thr Thr Glu Gin Gly Asn lie lie Lys Asp Glu Asp Lys Thr 245 250 255 Arg Ala Ala Ser lie Val Asp Val Leu Ser Ala Gly Phe Asn Leu Gin 260 265 270 Gly Asn Gly Glu Ala Val Asp Phe Val Ser Thr Tyr Asp Thr Val Asn 275 280 285 Phe Ala Asp Gly Asn Ala Thr Thr Ala Lys Val Thr Tyr Asp Asp Thr 290 295 300 Ser Lys Thr Ser Lys Val Val Tyr Asp Val Asn Val Asp Asp Thr Thr 305 310 315 320 lie Glu Val Lys Asp Lys Lys Leu Gly Val Lys Thr Thr Thr Leu Thr 325 330 335 Ser Thr Gly Thr Gly Ala Asn Lys Phe Ala Leu Ser Asn Gin Ala Thr 340 345 350 Gly Asp Ala Leu Val Lys Ala Ser Asp lie Val Ala His Leu Asn Thr 355 360 365 Leu Ser Gly Asp lie Gin Thr Ala Lys Gly Ala Ser Gin Ala Asn Asn 370 375 380 IM Ser Ala Gly Tyr Val Asp Ala Asp Gly Asn Lys Val lie Tyr Asp Ser 385 390 395 400 Thr Asp Asn Lys Tyr Tyr Gin Ala Lys Asn Asp Gly Thr Val Asp Lys 405 410 415 Thr Lys Glu Val Ala Lys Asp Lys Leu Val Ala Gin Ala Gin Thr Pro 420 425 430 + Asp Gly Thr Leu Ala Gin Met Asn Val Lys Ser Val lie Asn Lys Glu 435 440 445 Gin Val Asn Asp Ala Asn Lys Lys Gin Gly lie Asn Glu Asp Asn Ala 450 455 460 Phe Val Lys Gly Leu Glu Lys Ala Ala Ser Asp Asn Lys Thr Lys Asn 465 470 475 480 Ala Ala Val Thr Val Gly Asp Leu Asn Ala Val Ala Gin Thr Pro Leu 485 490 495 Thr Phe Ala Gly Asp Thr Gly Thr Thr Ala Lys Lys Leu Gly Glu Thr 500 ■ 505 510 Leu Thr lie Lys Gly Gly Gin Thr Asp Thr Asn Lys Leu Thr Asp Asn 515 520 525 Asn lie Gly Val Val Ala Gly Thr Asp Gly Phe Thr Val Lys Leu Ala 530 535 540 Lys Asp Leu Thr Asn Leu Asn Ser Val Asn Ala Gly Gly Thr Lys lie 545 550 555 560 Asp Asp Lys Gly Val Ser Phe Val Asp Ser Ser Gly Gin Ala Lys Ala 565 570 575 Asn Thr Pro Val Leu Ser Ala Asn Gly Leu Asp Leu Gly Gly Lys Val 580 585 590 lie Ser Asn Val Gly Lys Gly Thr Lys Asp Thr Asp Ala Ala Asn Val 595 600 605 Gin Gin Leu Asn Glu Val Arg Asn Leu Leu Gly Leu Gly Asn Ala Gly 610 615 620 Asn Asp Asn Ala Asp Gly Asn Gin Val Asn lie Ala Asp lie Lys Lys 625 630 635 640 Asp Pro Asn Ser Gly Ser Ser Ser Asn Arg Thr Val lie Lys Ala Gly 645 650 655 Thr Val Leu Gly Gly Lys Gly Asn Asn Asp Thr Glu Lys Leu Ala Thr 660 665 670 Gly Gly lie Gin Val Gly Val Asp Lys Asp Gly Asn Ala Asn Gly Asp 675 680 685 Leu Ser Asn Val Trp Val Lys Thr Gin Lys Asp Gly Ser Lys Lys Ala 690 695 700 Leu Leu Ala Thr Tyr Asn Ala Ala Gly Gin Thr Asn Tyr Leu Thr Asn 121 705 710 715 720 Asn Pro Ala Glu Ala lie Asp Arg lie 725 Asn Glu Gin G lie Arg Phe 730 735 Phe His Val Asn Asp Gly Asn Gin Glu Pro Val Val Gin Gly Arg Asn 740 745 750 Gly lie Asp Ser Ser Ala Ser Gly Lys His Ser Val Ala lie Gly Phe 755 760 765 Gin Ala Lys Ala Asp Gly Glu Ala Ala Val Ala lie Gly Arg Gin Thr 770 775 780 Gin Ala Gly Asn Gin Ser lie Ala lie Gly Asp Asn Ala Gin Ala Thr 785 790 795 800 Gly Asp Gin Ser lie Ala lie Gly Thr Gly Asn Val Val Ala Gly Lys 805 810 815 </div>

Claims

<div class="application article clearfix printTableText" id="claims"> 122 What we claim is:

1. An isolated and purified nucleic acid molecule having a nucleotide sequence selected from the group consisting of:

(a) a nucleotide sequence set forth in Figure 4 (SEQ ID No: 8) for Moraxella catarrhalis strain Q8 or the complementary sequence thereto, and

(b) a nucleotide sequence encoding an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis and having the derived amino acid sequence shown in Figure 5 (SEQ ID No: 9) for Moraxella catarrhalis strain Q8.

2. An isolated and purified nucleic acid molecule as claimed in claim 1 substantially as hereinbefore described with reference to the Examples.

3. An isolated and purified nucleic acid molecule as claimed in claim 1 substantially as hereinbefore described with reference to and as illustrated in the accompanying drawings.

4. A vector for transforming a host comprising a nucleic acid molecule as claimed in any one of claims 1 to 3.

5. A vector as clairned in claim 4 which is a plasmid vector.

6. A vector for transforming a host as claimed in claim 4 substantially as hereinbefore described with reference to the Examples.

7. A vector for transforming a host as claimed in claim 4 substantially as hereinbefore described with reference to and as illustrated in the accompanying drawings.

8. A host cell transformed by a vector as claimed in any one of claims 5 to 7 and expressing an about 200 kDa protein of a strain of Moraxella catarrhalis.

9. A host cell as claimed in claim 8 which is E. coli.

10. A recombinant about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis producible by the transformed host claimed in claim 8 or 9.

11. A recombinant protein as claimed in claim 10 producible in inclusion bodies.

12. A recombinant about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis as claimed in claim 10 substantially as hereinbefore described with reference to the Examples.

123

13. A recombinant about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis as claimed in claim 10 substantially as hereinbefore described with reference to and as illustrated in the accompanying drawings.

14. An immunogenic composition including the recombinant about 200 kDa outer membrane protein claimed in any one of claims 10 to 12.

15. An immunogenic composition as claimed in claim 14 formulated as a vaccine for in vivo administration to protect against disease caused by Moraxella catarrhalis.

16. An immunogenic composition as claimed in claim 14 or 15 in combination with a targeting molecule for delivery to specific cells of the immune system or to mucosal surfaces.

17., An immunogenic composition as claimed in any one of claims 14 to 16 formulated as a microparticle, capsule or liposome preparation.

18. An immunogenic composition as claimed in any one of claims 14 to 17 further including an adjuvant.

19. An immunogenic composition as claimed in claim 14 substantially as hereinbefore described with reference to the Examples.

20. An immunogenic composition as claimed in claim 14 substantially as hereinbefore described with reference to and as illustrated in the accompanying drawings.

21. The use of a recombinant about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis producible by the transformed host claimed in claim 8 or 9 in the manufacture of a medicament for inducing protection against disease caused by Moraxella catarrhalis.

22. A use as claimed in claim 21, in which said susceptible host is a human.

23. A method for the production of an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis, which includes:

transforming a host with a vector as claimed in any one of claims 4 to 7, growing the host cell to express the encoded about 200 kDa protein, and isolating and purifying the expressed about 200 kDa protein.

24. A method as claimed in claim 23, in which the host cell is E. coli.

Jl

5277 2 7

25. A method as claimed in claim 23 or 24, in which said encoded about 200 kDa protein is expressed in inclusion bodies.

26. A method as claimed in any one of claims 23 to 25, in which said isolation and purification of the expressed about 200 kDa protein is effected by:

disrupting the grown transformed cells to produce a supernatant and inclusion bodies,

solubilizing the inclusion bodies to produce a solution of the recombinant about 200 kDa protein or truncation thereof,

chromatographically purifying the solution of recombinant about 200 kDa protein or truncation thereof free from contaminating proteins, and isolating the purified recombinant about 200 kDa protein or truncation thereof.

27. A method for the production of an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis as claimed in claim 23 substantially as hereinbefore described with reference to the Examples.

28. A method for the production of an about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis as claimed in claim 23 substantially as hereinbefore described with reference to and as illustrated in the accompanying drawings.

29. An about 200 kDa outer membrane protein of a strain of Moraxella catarrhalis or a truncation thereof whenever prepared by a method as claimed in any one of claims 23 to 28.

30. A host cell as claimed in claim 8 substantially as hereinbefore described with reference to the Examples.

31. A host cell as claimed in claim 8 substantially as herein described with reference to and as illustrated in the accompanying drawings.

32. Use as claimed in claim 21 substantially as hereinbefore described with reference to the Examples.

33. Use as claimed in claim 21 substantially as herein described with reference to and as illustrated in the accomp

By the authorised agents

A J PARK

4\J{A/T/$ U/»i7zg

</div>