NZ527634A - Means and methods for synoviocyte cell transduction - Google Patents

Abstract

Disclosed is a nucleic acid delivery vehicle with or having been provided with at least a tissue tropism synoviocytes, wherein the capsid of the adenoviral vector comprises at least the knob domain of the fiber protein of adenovirus serotype 35. Disclosed also are methods for the treatment of diseases, preferably joint related diseases.

Description

NEW ZEALAND PATENTS ACT 1953 No: Divided out of No. 514570 Date: Dated 3 March 2000 COMPLETE SPECIFICATION MEANS AND METHODS FOR SYNOVIOCYTE CELL TRANDUCTION We, CRUCELL HOLLAND B.V., of Archimedesweg 4, 2333 CN Leiden, the Netherlands, do hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement: (followed by page 1 a) intellectual property office of n.z. - 8 JAN 2004 RECEIVED 79652J.DOC la WO00/52186 (followed by page 2) PCT/NLO0/QO133 — Title: Means and methods for synoviocyte cell transduction.

Tnis specification is related to New Zealand Patent Specification No. 514570, from which it is divided.

The invention lies in the field of recombinant DNA technology. More particularly, the invention relates to novel means and methods for transferring nucleic acid into fibroblast-like or macrophage-like cells, preferably synoviocytes. The invention further relates to means and methods for the treatment of diseases by at least transferring nucleic acid into fibroblast-like or macrophage-like cells, preferably synoviocytes for instance for the treatment of rheumatoid arthritis.

Efficient delivery of foreign genetic material to fibroblast-like or macrophage-like cells, especially synoviocytes, has proven to be a difficult goal to achieve. Even with the currently developed viral vectors that are, in 15 general, very effective in delivering foreign genetic. material to cells, fibroblast-like or macrophage-like cells have been difficult to provide with foreign genetic material. The relative inefficient transduction of these cells, especially of synoviocytes, has hampered the development of 20 therapeutic approaches based on nucleic acid transfer to these cells.

As a result of the inefficient delivery of nucleic acid into for example synoviocytes, therapeutic approaches based 25 on nucleic acid transfer involving these cells, have focused on strategies in which a low transduction efficiency could at least in part be tolerated. For instance by relying on delivering nucleic acid encoding proteins with so-called bystander effect, i.e. the expression in a transduced cell of 30 which affects the function of untransduced cells in the vicinity of transduced cells. Non-limiting examples of proteins with bystander effect are for instance excreted factors and/or suicide gene expression such as herpes simplex virus (HSV) thymidine kinase (TK) expression which in the intellectual property office of n.z. - 8 JAN imk PCT/NLOO/00133 — 2 presence of ganciclovir leads to production of toxic metabolites. The herpes simplex virus TK-gene encodes a protein capable of metabolising the relatively non-toxic anti-viral drug ganciclovir (GCV) into a mono-phosphorylated 5 product. Subsequent phosphorylation by mammalian kinases results in a tri-phosphorylated nucleoside analogue (GCV-PPP) that inhibits DNA-polymerase and kills cells, probably through apoptpsis (Vincent et al, 1996) .

Although the use of a bystander effect may indeed in part reduce the requirement for efficient transduction of fibroblast-like or macrophage-like cells, a more efficient method of transferring genetic material nevertheless is still desirable for economic reasons and for safety reasons. Safety 15 aspects include for- instance the relative sensitivity of liver cells toward toxicity of HSV-TK based cell kill. When cells other than liver cells form the target population for suicide by HSK-TK, liver cell transduction should be prevented as much as possible. Unintended liver cell 20 transduction can occur for instance through leakage of a nucleic acid delivery vehicle from the site of delivery into the blood stream from where it is transported to the liver. This leakage is among others dependent on the amount of nucleic acid delivery vehicle used. Thus when for instance 25 synoviocytes form the target cells, a certain amount of nucleic acid delivery vehicle will be needed for obtaining a desired level of transduction. When less nucleic acid delivery vehicle' is used, leakage of nucleic acid delivery vehicle is less of a problem.

Non-limiting examples in which nucleic acid transfer to fibroblast-like or macrophage-like cells would be beneficial are chronic erosive joint diseases like rheumatoid arthritis, ankylosing spondylitis and juvenile chronic arthritis. A 35 favourable target cell for nucleic acid transfer in these diseases is the synoviocyte. However, with the current PCT/NLOO/00133— 3 methods the efficiency of transduction of such cells leaves much to be desired.

In a diarthrodial movable joint, smooth articulation is 5 ensured by the unique macromolecular structure of articular cartilage, which covers the end of the bones. The articular cartilages move against each other within a cavity, the joint space, which is lined by a tissue known as the synovium. The synovium consists of macrophage-like type A cells and 10 fibroblast-like type B cells and is underlain by a sparsely cellular subsynovium which, depending on anatomical localisation, may be fibrous, adipose or areolar in nature. The fibroblast-like synoviocytes (FLS) are distinguishable from normal fibroblast cells in the subintimal synovium by 15 differential gene expression patterns. FLS have been shown to express high levels of uridine diphosphoglucose dehydrogenase (UDPGD), high levels of vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1) as well as CE>44 (hyaluronic acid receptor) , fibronectin receptor and 20 P3-integrins. Sublining fibroblasts or fibroblasts from other sources do not, or at a lower level, express these markers (reviewed by J.C.W. Edwards, 1995; G.S. Firestein, 1996).

Rheumatoid arthritis is characterised by massive hyperplasia of the synovium and presence of inflammatory 25 cells (lymphocytes, macrophages and mast cells) in and around the synovial tissue. Both the FLS and the type A macrophage-like cells play an important role in the destructive aspects of the disease. The type A cells constitute the majority of the cells in normal intima and hyperplastic RA tissue. The 30 highly invasive FLS exhibits histological features usually associated with immature tumour like fibroblasts (Qu et al, 1994; Firestein 1996). Proliferation of these synovial cells leads to pannus tissue which invades and overgrows the cartilage, leading to bone destruction (Zvaifler and 35 Firestein, 1994) . Removal of the diseased synovium is beneficial by decreasing inflammation and by preventing PCT/NLO0/00133 —; 4 destruction of the proliferating pannus in adjacent structures (Thompson et al, 1973). Specific removal of this proliferating pannus tissue by a simple, non-destructive local procedure, suitable for all joints and rather specific 5 for cells that are proliferating, is a valuable treatment for RA (Nakamura et al, 1997; Cruz-Esteban and Wilke, 1995).

Gene therapy is a promising treatment modality for rheumatoid arthritis (RA). Nucleic acid transfer to 10 rheumatoid synovial tissue may result either in the production of mediators that inhibit inflammation or hyperplasia or may result in toxic substances that destroy specifically the synovium. The first clinical trials in humans were based on ex-vivo transduction of synoviocytes 15 with IL1-RA, in order to inhibit inflammation (Evans, 1996) .

The present invention was made in the course of the manipulation of adenovirus vectors. In the following section therefore adenoviruses will be discussed.

Adenoviruses Adenoviruses contain a linear double-stranded DNA molecule of approximately 36000 base pairs. It contains identical Inverted Terminal Repeats (ITR) of approximately 25 90-140 base pairs with the exact length depending on the serotype. The viral origins of replication are within the ITRs exactly at the genome ends. The transcription units are divided in early and late regions. Shortly after infection the E1A and E1B proteins are expressed and function in 3 0 transactivation of cellular and adenoviral genes. The early regions E2A and E2B encode proteins (DNA binding protein, pre-terminal protein and polymerase) required for the replication of the adenoviral genome (reviewed in van der Vliet, 1995) . The early region E4 encodes several proteins PCT/NLO0/Q0133 — with pleiotropic functions e.g. transactivation of the E2 early promoter, facilitating transport and accumulation of viral mRNAs in the late phase of infection and increasing nuclear stability of major late pre-mRNAs (reviewed in 5 Leppard, 1997) . The early region 3 encodes proteins that are involved in modulation of the immune response of the host (Wold et al, 1995). The late region is transcribed from one single promoter (major late promoter) and is activated at the onset of DNA replication. Complex splicing and poly-10 adenylation mechanisms give rise to more than 12 RNA species coding for core proteins, capsid proteins (penton, hexon, fiber and associated proteins), viral protease and proteins necessary for the assembly of the capsid and shut-down of host protein translation(Imperiale, M.J., Akusjnarvi, G. and 15 Leppard, K.N. (1995) Post-transcriptional control of adenovirus gene expression. In: The molecular repertoire of adenoviruses I. P139-171. W. Doerfler and P. Bohm (eds), Springer-Verlag Berlin Heidelberg).

Interaction between virus and host cell The interaction of the virus with the host cell has mainly been investigated with the serotype C viruses Ad2 and Ad5. Binding occurs via interaction of the knob region of the protruding fiber with a cellular receptor. The receptor 25 for Ad2 and Ad5 and probably more adenoviruses is known as the ^Coxsackievirus and Adenovirus Receptor1 or CAR protein (Bergelson et al, 1997). Internalisation is mediated through interaction of the RGD sequence present in the penton base with cellular integrins (Wickham et al, 1993). This may not 30 be true for all serotypes, for example serotype 40 and 41 do not contain a RGD sequence in their penton base sequence (Kidd et al, 1993).

WO 00/52186 PCT/NL00/Q0133 6 The fiber protein The initial step for successful infection is binding of adenovirus to its target cell, a process mediated through fiber protein. The fiber protein has a trimeric structure 5 (Stouten et al, 1992) with different lengths depending on the virus serotype (Signas et al, 1985; Kidd et al, 1993) . Different serotypes have polypeptides with structurally similar N and C termini, but different middle stem regions. The first 3 0 amino acids at the N terminus are involved in 10 anchoring of the fiber to the penton base (Chroboczek et al, 1995) , especially the conserved FNPVYP region in the tail (Arnberg et al, 1997). The C-terminus, or knob, is responsible for initial interaction with the cellular adenovirus receptor. After this initial binding, secondary 15 binding between the capsid penton base and cell-surface integrins leads to internalisation of viral particles in coated pits and endocytosis (Morgan et al, 1969; Svensson and Persson, 1984; Varga et al, 1991; Greber et al, 1993; Wickham et al, 1993). Integrins are ap-heterodimers of which 20 at least 14 a-subunits and 8 S-subunits have been identified (Hynes, 1992). The array of integrins expressed in cells is complex and will vary between cell types and cellular environment. Although the knob contains some conserved regions between serotypes, knob proteins show a high degree 25 of variability, indicating that different adenovirus receptors exist.

Adenoviral serotypes At present, six different subgroups of human 30 adenoviruses have been proposed, which in total encompass approximately 50 distinct adenovirus serotypes. Besides these human adenoviruses, many animal adenoviruses have been identified {see e.g. Ishibashi and Yasue, 1984).

A serotype is defined on the basis of its immunological distinctiveness as determined by quantitative neutralisation 5 with animal antisera (horse, rabbit). If neutralisation shows a certain degree of cross-reactivity between two viruses, distinctiveness of serotype is assumed if A) the hemagglutinins are unrelated, as shown by lack of cross-reaction on hemagglutination-inhibition, or B) substantial 10 biophysical/biochemical differences in DNA exist (Prancki et al, 1991) . The serotypes identified last (42-49) were isolated for the first time from HIV infected patients (Hierholzer et al, 1988; Schnurr et al, 1993). For reasons not well understood, most of such immuno-compromised 15. patients shed adenoviruses that were never isolated from immuno-competent individuals (Hierholzer et al, 1988, 1992; Khoo et al, 1995).

Besides differences towards the sensitivity against 20 neutralising antibodies of different adenovirus serotypes, adenoviruses in subgroup C such as Ad2 and Ad5 bind to different receptors as compared to adenoviruses from subgroup B such as Ad3 and Ad7 (Defer et al, 1990; Gall et al, 1996). Likewise, it was demonstrated that receptor 25 specificity could be altered by exchanging the Ad3 knob protein with the Ad 5 knob protein, and vice versa (Krasnykh et al, 1996; Stevenson et al, 1995, 1997). Serotypes 2, 4, 5 and 7 all have a natural affiliation towards lung epithelia and other respiratory tissues. In contrast, serotypes 40 and 3 0 41 have a natural affiliation towards the gastrointestinal tract. These serotypes differ in at least capsid proteins (penton-base, hexon), proteins responsible for cell binding WO 00/52186 PCT/NL00/00133 8 {fiber protein), and proteins involved in adenovirus replication. It is unknown to what extend the capsid proteins determine the differences in tropism found between the serotypes. It may very well be that post-infection 5 mechanisms determine cell type specificity of adenoviruses. It has been shown that adenoviruses from serotypes A (Adl2 and Ad31),C (Ad2 and Ad5),D (Ad9 and Adl5),E (Ad4) and F (Ad41) all are able to bind labelled, soluble CAR (sCAR) protein when immobilised on nitro-cellulose. Furthermore, 10 binding of adenoviruses from these serotypes to Ramos cells, that express high levels of CAR but lack integrins (Roelvink et al, 1996), could be efficiently blocked by addition of sCAR to viruses prior to infection (Roelvink et al, 1998). However, the fact that (at least some) members of these 15 subgroups are able to bind CAR does not exclude that these viruses have different infection efficiencies in various cell types. For example subgroup D serotypes have relatively short fiber shafts compared to subgroup A and C viruses. It has been postulated that the tropism of subgroup D viruses 20 is to a large extend determined by the penton base binding to integrins (Roelvink et al, 1996; Roelvink et al, 1998). Another example is provided by Zabner et al, 1998 who have tested 14 different serotypes on infection of human ciliated airway epithelia (CAE) and found that serotype 17 (subgroup 25 D) was bound and internalised more efficiently then all other viruses, including other members of subgroup D.

Similar experiments using serotypes from subgroup A-F in primary foetal rat cells showed that adenoviruses from subgroup A and B were inefficient whereas viruses from 30 subgroup D were most efficient (Law et al, 1998). Also in this case viruses within one subgroup displayed different efficiencies. The importance of fiber binding for the WO 00/52186 PCT/NL00/00133 9 improved infection of Adl7 in CAE was shown by Armentano et al (WO 98/22609) who made a recombinant LacZ Ad2 virus with a fiber gene from Adl7 and showed that the chimaeric virus infected CAE • more efficiently than LacZ Ad2 viruses with Ad2 5 fibers.

Thus despite their shared ability to bind CAR, differences in the length of the fiber, knob sequence and other capsid proteins like penton base may determine the efficiency by which an adenovirus infects a certain target 10 cell. Of interest is that Ad5 and Ad2 fibers bind to fibronectin III and MHC class 1 a2 derived peptides, while Ad3 fibers do not. This suggests that adenoviruses are able to use cellular receptors other than CAR (Hong et al, 1997) .. Serotypes 4 0 and 41 (subgroup F) are known to carry two 15 fiber proteins differing in the length of the shaft. The long shafted 41L fiber is shown to bind CAR whereas the short shafted 41S is not capable of binding CAR (Roelvink et al, 1998) . The receptor for the short fiber is not known.

Adenoviral nucleic acid delivery vectors Most adenoviral nucleic acid delivery vectors currently used in gene therapy are derived from the serotype C adenoviruses Ad2 or Ad5. The vectors have a deletion in the El region, where novel genetic information can be introduced 25 The El deletion renders the recombinant virus replication defective. It has been demonstrated extensively that recombinant adenovirus, in particular serotype 5 is suitable for efficient transfer of genes in vivo to the liver, the airway epithelium and solid tumours in animal models and 30 human xenografts in immuno-deficient mice (Bout 1996, 1997; Blaese et al, 1995).

PCT/NL00/00133 — Nucleic acid transfer vectors derived from adenoviruses (adenoviral vectors) have a number of features that make them particularly useful for nucleic acid transfer: 1) the biology of the adenoviruses is well characterised, 5 2) the adenovirus is not associated with severe human pathology, 3) the adenovirus is extremely e-fficient in introducing its DNA into the host cell, 4) the adenovirus can infect a wide variety of cells and has 10 a broad host-range, ) the adenovirus can be produced at high titers in large quantities, 6) and the adenovirus can be rendered replication defective by deletion of the early-region 1 (El) of the viral genome (Brody and Crystal, 1994).

However, there are still a number of drawbacks associated with the use of adenoviral vectors: 1) Adenoviruses, especially the well investigated serotypes 2 0 Ad2 and Ad5 usually elicit an immune response by the host into which they are introduced, 2) it is currently not feasible to target the virus to certain cells and tissues, 3) Some cell types are not easily transduced by the current 25' generation of adenovirus vectors. 4) the serotypes Ad2 or Ad5, are not ideally suited for delivering additional genetic material to organs other than the liver. The liver can be particularly well transduced with vectors derived from Ad2 or Ad5. Administration of 3 0 these vectors via the bloodstream leads to a significant delivery of the vectors to the cells of the liver. In therapies were cell types other than liver cells need to be WO 00/52186 PCT/NLOO/00133 —: 11 transduced some means of liver exclusion must be applied to prevent uptake of the vector by these cells. Current methods rely on the physical separation of the vector from the liver cells, most of these methods rely on localising the vector 5 and/or the target organ via surgery, balloon angioplasty or direct injection into an organ or a bone structure via for instance needles. Liver exclusion is also being practised through delivery of the vector to compartments in the body that are essentially isolated from the bloodstream thereby 10 preventing transport of the vector to the liver. Although these methods mostly succeed in avoiding gross delivery of the vector to the liver, most of the methods are crude and still have considerable leakage and/or have poor target tissue penetration characteristics. In some cases 15 inadvertent delivery of the vector to liver cells can be toxic to the patient. For instance, delivery of a herpes simplex virus (HSV) thymidine kinase (TK) gene for the subsequent killing of dividing cancer cells through administration of ganciclovir is not without risk when also 20 a significant amount of liver cells are transduced by the vector. Significant delivery and subsequent expression of the HSV-TK gene to liver cells is associated with severe toxicity. Thus there is a discrete need for an inherently safe vector provided with the property of a reduced 25 transduction efficiency of liver cells.

The present invention provides novel means for the introduction of genetic material into fibroblast-like or macrophage-like cells, preferably synoviocytes. The present 30 invention further provides means and methods for at least in part preventing delivery of nucleic acid into liver cells. The present invention further provides means and methods for 12 the treatment of disease by at least in part specifically transferring nucleic acid into synoviocytes.

It is an object of the current invention to provide materials and methods to overcome at least part of the limitations of nucleic delivery vehicles, or at least to provide the public with a useful choice.

In broad terms, the invention provides new adenoviruses, derived in whole or in part from serotypes different from 10 Ad5. Specific genes of serotypes with preferred characteristics may be combined in a chimaeric vector to give rise to a vector that is better suited for specific applications. Preferred characteristics include, but are not limited to, improved infection of a specific target cell, 15 reduced infection of non-target cells, improved stability of the virus, reduced uptake in antigen presenting cells (APC), or increased uptake in APC, reduced toxicity to target cells, reduced neutralisation in humans or animals, reduced or increased CTL response in humans or animals, better 20 and/or prolonged transgene expression, increased penetration capacity in tissues, improved yields in packaging cell lines, etc.

One aspect of the present invention facilitates the 25 combination of the low immunogenicity of some adenoviruses with the characteristics of other adenoviruses. Such adenoviruses may be favourable for gene therapy approaches. Such characteristics may be a high specificity for certain host cells, a good replication machinery for certain cells, 30 a high rate of infection in certain host cells, low infection efficiency in non-target cells, high or low efficiency of APC infection, etc. 13 The invention thus may provide chimaeric adenoviruses having the useful properties of at least two adenoviruses of different serotypes. Typically, two or more requirements from the above non-exhaustive list are required to obtain an 5 adenovirus capable of efficiently transferring genetic material to a host cell. In one aspect the present invention therefore provides adenovirus derived vectors which can be used as cassettes to insert different adenoviral genes from different adenoviral serotypes at the required sites. This 10 way one can obtain a vector capable of producing a chimaeric adenovirus, whereby of course also a gene of interest can be inserted (for instance at the site of El of the original adenovirus) . In this manner the chimaeric adenovirus to be produced can be adapted to the requirements and needs of 15 certain hosts in need of gene therapy for certain disorders. To enable this virus production, a packaging cell will generally be needed in order to produce sufficient amount of safe chimaeric adenoviruses.

Described herein are , .V. adenoviral vectors comprising at least a part of a fiber protein of an adenovirus from subgroup B, in particular of serotypes 11, 16, 35 and/or 51. Said fiber protein may be the native fiber protein of the adenoviral vector or may be derived from a serotype different from the serotype the 25 adenoviral vector is based on. In the latter case the adenoviral vector is a chimaeric adenovirus displaying at least a part of the fiber protein derived from subgroup B adenoviruses that part comprising at least the receptor binding sequence. Typically such a virus 30 will be produced using a vector (typically a plasmid, a cosmid or baculovirus vector) . Such vectors are also subject of the present invention. A preferred vector is a vector PCT/NLOO/OQ133 — 14 (followed by page 14a) that can be used to make a chimaeric recombinant virus specifically adapted to the host to be treated and the disorder to be treated.

Accordingly, in a first aspect the present invention provides a recombinant adenoviral vector having a tissue tropism for synoviocytes, wherein the capsid of said adenoviral vector comprises at least the knob domain of the fiber protein of adenovirus serotype 35, and wherein said adenoviral vector comprises at least one non-fiber capsid protein from an adenovirus of subgroup C.

The present invention also provides a chimaeric adenovirus based on adenovirus type 5 but having at least a part of the fiber sequence from adenovirus type 35, whereby the part of the fiber of Ad35 at least comprises a part of the fiber protein that, is involved in binding a host cell.

The present invention also provides chimaeric adenoviral vectors that show improved infection as compared to adenoviruses from other subgroups in specific host cells for example, but not limited to, fibroblast-like or macrophage-like cells, preferably synoviocytes of human or animal origin. An important feature of part of the present invention is a means to produce the chimaeric virus. Typically, one does not want an adenovirus batch to be administered to the host cell, which contains replication competent adenovirus. In general therefore it is desired to omit a number of genes (but at least one) from the adenoviral genome on the vector encoding the chimaeric virus and to supply these genes in .the genome of the cell in which the vector is brought to produce chimaeric adenovirus. Such a cell is usually called a packaging cell. The invention thus also provides a packaging cell for producing a chimaeric adenovirus according to the invention, comprising 14a in trans all elements necessary for adenovirus production not present on the adenoviral vector according to the invention. Typically vector and packaging cell have to be adapted to one another in that they have all the necessary elements, but that they do not have overlapping elements which lead to replication competent virus by recombination Also described herein is a kit of parts comprising a WO 00/52186 PCT/NLOO/00133 packaging cell according to the invention and a recombinant vector according the invention whereby there is essentially no sequence overlap leading to recombination resulting in the production of replication competent adenovirus between 5 said cell and said vector.

For certain applications for example when the therapy is aimed at eradication of tumour cells, the adenoviral vector according to the invention may be replication competent or capable of replicating under certain conditions 10 for example in specific cell types like tumour cells.

It is within the scope of the invention to insert more genes, or a functional part of these genes from the same or other serotypes into the adenoviral vector replacing the corresponding native sequences. Thus for example replacement 15 of (a functional part of the) fiber sequences with corresponding sequences of other serotypes may be-combined with for example replacements of (a functional part of) other capsid genes like penton base or hexon with corresponding sequences of said serotype or of other 20 distinct serotypes. Persons skilled in the art understand that other combinations not limited to said genes are possible and are within the scope of the invention. A chimaeric adenoviral vector according to the invention may originate from at least two different serotypes. This may 25 provide the vector with preferred characteristics such as improved infection of target cells and/or less infection of non-target cells, improved stability of the virus, reduced immunogenicity in humans or animals (e.g. reduced uptake in APC, reduced neutralisation in the host and/or reduced 30 cytotoxic T-lymphocyte (CTL) response), increased penetration of tissue, better longevity of transgene expression, etc. In this aspect it is preferred to use WO 00/52186 PCT/NL00/0Q133 — 16 capsid genes e.g. penton and/or hexon genes from less immunogenic serotypes as defined by the absence or the presence of low amounts of neutralising antibodies in the vast majority of hosts. It is also preferred to use fiber 5 and/or penton sequences from serotypes that show improved binding and internalisation in the target cells. Furthermore it is preferred to delete from the viral vector those genes which lead to expression of adenoviral genes in the target cells. In this aspect a vector deleted of all adenoviral 10 genes is also preferred. Furthermore it is preferred that the promoter driving the gene of interest to be expressed in the target cells is a cell type specific promoter.

In order to be able to precisely adapt the viral vector 15 and provide the chimaeric virus with the desired properties at will, it is preferred that a library of adenoviral genes is provided whereby the genes to be exchanged are located on plasmid- or cosmid-based adenoviral constructs whereby the genes or the sequences to be exchanged are flanked by 20 restriction sites. The preferred genes or sequences can be selected from the library and inserted in the adenoviral constructs that are used to generate the viruses. Typically such a method comprises a number of restriction and ligation steps and transfection of a packaging cell. The adenoviral 25 vector can be transfected in one piece, or as two or more overlapping fragments, whereby viruses are generated by homologous recombination. For example the adenoviral vector may be built up from two or more overlapping sequences for insertion or replacements of a gene of interest in for 3 0 example the El region, for insertion or replacements in penton and/or hexon sequences, and for insertions or replacements into fiber sequences. In one aspect the PCT/NL00/Q0133 — 17 invention provides a method for producing chimaeric adenoviruses having one or more desired properties like a desired host range and diminished antigenicity, comprising providing one or more vectors according to the invention 5 having the desired insertion sites, inserting into said vectors at least a functional part of a fiber protein derived from an adenovirus serotype having the desired host range and/or inserting a functional part of a capsid protein derived from an adenovirus serotype having relatively low 10 antigenicity and transfecting said vectors in a packaging cell according to the invention and allowing for production of chimaeric viral particles. Of course other combinations of other viral genes originating from different serotypes can also be inserted as disclosed herein before. Chimaeric 15 viruses having only one non-native sequence in addition to an insertion or replacement of a gene of interest in the El region, are also within the scope of the invention.

An immunogenic response to adenovirus that typically occurs, is the production of neutralising antibodies by the 20 host. This is typically a reason for selecting a capsid protein like penton, hexon and/or fiber of a less immunogenic serotype.

Of course it may not be necessary to make chimaeric adenoviruses which have complete proteins from different 25 serotypes. It is well within the skill of the art to produce chimaeric proteins. For instance in the case of fiber proteins, it is very well possible to have the base of one serotype and the shaft and the knob from another serotype. In this manner it becomes possible to have the parts of the 30 protein responsible for assembly of viral particles originate from one serotype, thereby enhancing the production of intact viral particles. Thus the invention also provides a chimaeric WO 00/52186 PCT/NL00/Q0133 —: 18 adenovirus according to the invention, wherein the hexon, penton, fiber and/or other capsid proteins are chimaeric proteins originating from different adenovirus serotypes. Besides generating chimaeric adenoviruses by swapping entire 5 wild type capsid (protein) genes etc. or parts thereof, it is also within the scope of the present invention to insert capsid (protein) genes etc. carrying non-adenoviral sequences or mutations such as point mutations, deletions, insertions, etc. Such chimaeric adenoviruses can be easily screened for 10 preferred characteristics such as temperature stability, assembly, anchoring, redirected infection, altered immune response etc. Again other chimaeric combinations can also be produced and are within the scope of the present invention.

It has been demonstrated in mice and rats that upon in 15 vivo systemic delivery of recombinant adenovirus of common used serotypes for gene therapy purposes, more than 90% of the virus is trapped in the liver (Herz et al, 1993; Kass-Eisler et al, 1994; Huard et al, 1995) . It is also known that human hepatocytes are efficiently transduced by adenovirus 20 serotype 5 vectors (Castell, J.V., Hernandez, D. Gomez-Foix, A.M., Guillen, I, Donato, T. and Gomez-Lechon, M.J. (1997). Adenovirus-mediated gene transfer into human hepatocytes: analysis of the biochemical functionality of transduced cells. Gene Ther. 4(5), p455-464). Thus in vivo gene therapy 25 by-systemic delivery of Ad2 or Ad5 based vectors is seriously hampered by the efficient uptake of the viruses in the liver leading to unwanted toxicity and less virus being available for transduction of the target cells. Therefore, alteration of the adenovirus serotype 5 host cell range to be able to 30 target other organs in vivo is a major interest of the invention.

WO 00/52186 PCT/NL00/C0I33—i 19 To obtain re-directed infection of recombinant adenovirus serotype 5, several approaches have been or still are under investigation. Wickham et al have altered the RGD (Arg, Gly, Asp) motif in the penton base which is believed 5 to be responsible for the avP3 and avp5 integrin binding to the penton base. They have replaced this RGD motif by another peptide motif which is specific for the (X4P1 receptor. In this way targeting the adenovirus to a specific target cell could be accomplished (Wickham et al, 1995). 10 Krasnykh et al (1998) have made use of the HI loop available in the knob. This loop is, based on X-ray crystallography, located on the outside of the knob trimeric structure and therefore is thought not to contribute to the intramolecular interactions in the knob. Insertion of a FLAG coding 15 sequence into the HI loop resulted in fiber proteins that were able to trimerise and it was further shown that viruses containing the FLAG sequence in the knob region could be made. Although interactions of the FLAG-containing knob with CAR are not changed, insertion of ligands in the HI loop may 20 lead to retargeting of infection. Although successful introduction of changes in the adenovirus serotype 5 fiber and penton-base have been reported, the complex structure of knob and the limited knowledge of the precise amino acids interacting with CAR render such targeting approaches 25 laborious and difficult.- The use of antibodies binding to CAR and to a specific cellular receptor has also been described (Wickham et al, 1996; Rogers et al, 1997). This approach is however limited by the availability of a specific antibody and by the complexity of the gene therapy 3 0 product.

To overcome the limitations described above we used pre-existing adenovirus fibers, penton base proteins, hexon PCT/NLOO/00133— proteins or other capsid proteins derived from other adenovirus serotypes. By generating chimaeric adenovirus serotype 5 libraries containing structural proteins of alternative adenovirus serotypes, we have developed a 5 technology, which enables rapid screening for a recombinant adenoviral vector with preferred characteristics.

It is an object of the present invention to provide methods for the generation of chimaeric capsids which can be 10 targeted to specific cell types in vitro as well as in vivo, and thus have an altered tropism for certain cell types; and/or to provide methods and means by which an adenovirus or an adenovirus capsid can be used as a protein or nucleic acid delivery vehicle to a specific cell type or tissue, or at 15 least to provide the public with a useful choice.

The generation of chimaeric adenoviruses based on adenovirus serotype 5 with modified late genes is described. For this purpose, three plasmids, which together contain the complete adenovirus serotype 5 genome, were constructed. 2 0 From one of these plasmids part of the DNA encoding the adenovirus serotype 5 fiber protein was removed and replaced by linker DNA sequences that facilitate easy cloning. This plasmid subsequently served as template for the insertion of DNA encoding fiber protein derived from different adenovirus 25 serotypes. The DNA sequences derived from the different serotypes were obtained using the polymerase chain reaction technique in combination with (degenerate) oligonucleotides. At the former El location in the genome of adenovirus serotype 5, any gene of interest can be cloned. A single 30 transfection procedure of the three plasmids together results in the formation of a recombinant chimaeric adenovirus. Alternatively, cloning of sequences obtained WO 00/52186 PCT/NL00/00133 — 21 from a library of genes can be such that the chimaeric adenoviral vector is built up from one or more fragments. For example one construct contains at least the left ITR and sequences necessary for packaging of the virus,- an 5 expression cassette for the gene of interest and sequences overlapping with a second construct, wherein a second construct comprises all sequences necessary for replication and virus formation not present in the packaging cell as well as non-native sequences providing the preferred characteristics. This new technology of libraries consisting of chimaeric adenoviruses thus allows for a rapid screening for improved recombinant adenoviral vectors for in vitro and in vivo gene therapy purposes.

The use of adenovirus type 5 for in vivo gene therapy is limited by the apparent inability to infect certain cell types efficiently e.g. fibroblast-like or macrophage-like cells, preferably synoviocytes and the preference of infection of certain organs e.g. liver and spleen. 2 0 Specifically this has consequences for treatment of rheumatoid arthritis (RA). Adenovirus-mediated delivery of for instance herpes simplex virus thymidine kinase into synoviocytes has been proposed as a possible treatment for RA. However, efficient delivery of said gene is required.

In one embodiment this invention describes adenoviral vectors that are, amongst others, especially suited for nucleic acid delivery to fibroblast-like or macrophage-like cells, most especially to synoviocytes. This feature is of particular importance for the treatment of diseases related to joints, particularly for the treatment of rheumatoid arthritis. The adenoviral vectors preferably are derived PCT/NL00/00I33— 22 from subgroup B adenoviruses or contain at least a functional part of the fiber protein from an adenovirus from subgroup B comprising at least the cell-binding moiety of said fiber protein.

In a further preferred embodiment the adenoviral vectors are chimaeric vectors based on adenovirus type 5 and contain at least a functional part of the fiber protein from adenovirus type 35.

Also described herein are 10 adenoviral vectors or chimaeric adenoviral vectors that escape at least in part the liver following systemic administration. Psreferably said .adenoviral vectors are derived from subgroup B, in particular serotype 35 or: contain at least the cell-binding moiety of the fiber 15 protein derived from said adenovirus.

It is to be understood that in all embodiments adenoviral vectors and/or particles may be derived Solely from one serotype having the desired properties or that an adenoviral vector and/or particle comprises sequences and/or protein or 20 functional parts, derivatives and/or analogues thereof, of two or more adenovirus serotypes.

In another aspect this invention describes chimaeric adenoviruses and methods to generate viruses that have an 25 altered tropism different from that of adenovirus serotype 5. For example, viruses based on adenovirus serotype 5 but displaying any adenovirus fiber existing in nature. This chimaeric adenovirus serotype 5 is able to infect certain cell types more efficiently, or less efficiently in vitro and 30 in vivo than the adenovirus serotype 5. Such cells include but are not limited to endothelial cells, smooth muscle cells, dendritic cells, neuronal cells, glial cells, WO 00/52186 PCT/NLOO/OOI33 23 synovical cells, lung epithelial cells, hemopoietic stem cells, monocytic/macrophage cells, tumour cells, skeletal muscle cells, mesothelial cells, synoviocytes, etc.

Also described herein are the construction and use of libraries consisting of distinct parts of adenovirus serotype _5 in which one or more genes or sequences have been replaced with DNA derived from alternative human or animal serotypes. This set of 10 constructs, in total encompassing the complete adenovirus genome, allows for the construction of unique chimaeric adenoviruses customised for a certain disease, group of patients or even a single individual.

In all aspects of the invention the chimaeric 15 adenoviruses may, or may not, contain deletions in the El region and insertions of heterologous genes linked either or not to a promoter. Furthermore, chimaeric adenoviruses may, or may not, contain deletions in the E3 region and insertions of heterologous genes linked to a promoter. 20 Furthermore, chimaeric adenoviruses may, or may not, contain deletions in the E2 and/or E4 region and insertions of heterologous genes linked to a promoter. In the latter case E2 and/or E4 complementing cell lines are required to generate recombinant adenoviruses. In fact any functional 25 nucleic acid in the genome of the viral vector can be taken out and supplied in trans. Thus, in the extreme situation, chimaeric viruses do not contain any adenoviral genes in their genome and are by definition minimal adenoviral vectors. In this case required adenoviral functions are 30 supplied in trans using stable cell lines and/or transient expression of these genes. A method for producing minimal adenoviral vectors is described in W097/00326 and is taken PCT/NLOO/00133 — 24 as reference herein. In another case Ad/AAV chimaeric molecules are packaged into the adenovirus capsids of the invention. A method for producing Ad/AAV chimaeric vectors is described in EP 97204085.1 and is taken as reference 5 herein. In principle any nucleic acid may be provided with the adenovirus capsids of the invention.

Also described herein is a nucleic acid delivery vehicle comprising or having been provided with 10 at least a tissue tropism for fibroblast-like or macrophage-like cells, preferably synoviocytes.

Also described are a nucleic acid delivery vehicle comprising an at least in part reduced or having at least in part been deprived of a tissue tropism for at least liver 15 cells. Preferably, said nucleic acid delivery vehicle is provided with a tissue tropism for at least fibroblast-like or macrophage-like cells, preferably synoviocytes and at least in part deprived of a tissue tropism for at least liver cells. Described herein are nucleic acid delivery vehicles 20 provided with a tissue tropism for at least fibroblagt-like or macrophage-like cells, preferably synoviocytes and/or at least in part deprived of a tissue tropism for at least liver cells using a fiber protein derived from a subgroup B 25 adenovirus, typically of serotypes 11, 16, 35 and/or 51 and preferably of adenovirus 35. In a preferred aspect, the nucleic acid delivery vehicle comprises a virus capsid or a functional part, derivative and/or analogue thereof. Preferably said virus capsid comprises a virus capsid derived 30 in whole or in part from an adenovirus of subgroup -B, preferably from adenovirus 35., or it comprises proteins, or functional parts, derivatives or analogues thereof, from an adenovirus of subgroup B, preferably of adenovirus 35. In a preferred embodiment, the virus capsid 35 comprises proteins, or functional parts, derivatives or PCT/NLOO/OOI33 — analogues thereof, from at least two different viruses, preferably adenoviruses. In a preferred embodiment at least one of said viruses is an adenovirus of subgroup B, preferably adenovirus 35.

Preferred nucleic acid delivery vehicles comprise an \ adenovirus fiber protein or parts thereof. Said fiber protein is preferably derived from an adenovirus of subgroup B, preferably of adenovirus 35. Said nucleic acid delivery vehicle may further comprise other fiber proteins, or parts thereof, from other adenoviruses. Said nucleic acid delivery vehicle may or may not comprise Other adenovirus proteins. Nucleic acid may be linked directly to said fiber protein, or parts thereof, but may also be linked indirectly. Examples of indirect linkages 15 include but are not limited to, packaging of nucleic acid into adenovirus capsids or packaging of nucleic acid into liposomes, wherein a fiber protein, or a part thereof, is incorporated into an adenovirus capsid or linked to a liposome. Direct linkage of nucleic acid to a fiber protein, 2 0 or a part thereof, may be performed when said fiber protein, is not part of a complex or when said fiber protein is part of complex such as an adenovirus capsid.

In one embodiment, described herein is a nucleic 25 acid delivery vehicle comprising, an adenovirus fiber protein wherein said fiber protein comprises at least a tissue determining part of an adenovirus of subgroup B adenovirus, preferably of adenovirus 35. Adenovirus fiber protein comprises at least three functional domains. One domain, the 30 base, is responsible for anchoring a fiber to a penton base of an adenovirus capsid. Another domain, the knob, is responsible for receptor recognition whereas the shaft domain functions as a spacer separating the base from the knob. The different domains may also have other function. For instance, 35 the shaft is presumably also involved in target cell specificity. Each of the domains mentioned above alone or in PCT/NLOO/00133 — 26 combination, may be used to define a part of a fiber.

However, parts may also be identified in another way. For instance the knob domain comprises of a receptor binding part and a shaft binding part. The base domain comprises of a 5 penton base binding part and a shaft binding part. Moreover, the shaft comprises of repeated stretches of amino acids.

Each of these repeated stretches may be a part or used in combination with one or more other parts to form a tissue determining part of a fiber protein. Preferably said tissue i determining part of a fiber protein comprises at least the knob domain of said fiber protein, or a functional part, derivative and/or analogue thereof.

A tissue tropism determining part of a fiber protein may be a single part of a fiber protein or a combination of 15 parts derived from at least one fiber protein, wherein said tissue tropism determining part, either alone or in combination with a virus capsid, determines the efficiency with which a nucleic acid delivery vehicle can transduce a given cell or cell type, preferably but not necessarily in a 20 positive way. With a tissue tropism for liver cells is meant a tissue tropism for cells residing in the liver, preferably liver parenchyma cells.

A tissue tropism for a certain tissue may be provided by increasing the efficiency with which cells of said tissue 25 are transduced, alternatively, a tissue tropism for a certain tissue may be provided by decreasing the efficiency with which other cells than the cells of said tissue are transduced.

Fiber proteins possess tissue tropism determining properties. The most well described part of fiber protein involved in tissue tropism is the knob domain. However, the shaft domain of the fiber protein also possesses tissue tropism determining properties. However, not all of the 35 tissue tropism determining properties of an adenovirus capsid are incorporated into a fiber protein.

PCT/NLO0/00133— 27 Described herein are nucleic acid delivery vehicles in which a fiber protein derived from a subgroup B adenovirus, < typically ad 11, 16, 35 and/or 51, preferably adenovirus 35 or a functional part, derivative and/or analogue thereof, is combined with at least one non-fiber capsid proteins from an adenovirus of subgroup C, preferably of adenovirus 5.

■ Described herein is a nucleic acid delivery vehicle comprising at least part of a nucleic acid derived from an adenovirus. In a preferred embodiment V f said .adenovirus nucleic acid comprises at least one nucleic acid encoding a fiber protein comprising at least a tissue tropism determining part of a subgroup B adenovirus fiber protein, preferably of adenovirus 35. In a preferred aspect 15 said adenovirus comprise® nucleic acid from at least two different adenoviruses. In a preferred aspect said adenovirus comprises nucleic acid from at least two different adenoviruses wherein at least part of said nucleic acid encodes a fiber protein comprising at least a tissue tropism 20 determining part of a subgroup B adenovirus fiber protein, preferably of adenovirus 35.

In a preferred embodiment of the invention adenovirus nucleic acid is modified such that the capacity of said adenovirus nucleic acid to replicate in a target cell has 25 been reduced or disabled. This may be achieved among others, through inactivating or deleting genes encoding early region 1 proteins.

In another preferred embodiment said adenovirus nucleic acid is modified such that the capacity of a host 3 0 immune system to mount an immune response against adenovirus proteins encoded by said adenovirus nucleic acid has been reduced or disabled. This may among others, be achieved through deletion of genes encoding proteins of early region 2 and/or early region 4. Alternatively, genes encoding early 35 region 3 proteins, may be deleted, or on the contrary, considering the anti-immune system function of some of the PCT/NLOO/00133 — 28 proteins encoded by the genes in early region 3, the expression of early region 3 proteins may be enhanced for some purposes. Also, adenovirus nucleic acid may be altered by a combination of two or more of the alterations of 5 adenovirus nucleic acid mentioned above. It is clear that when nucleic acid encoding essential functions are deleted from adenovirus nucleic acid, said essential functions must be complemented in the cell that is going to produce adenovirus nucleic acid, adenovirus vector, vehicle or 10 chimaeric capsid. Adenovirus nucleic acid may also be modified such that the capacity of a host immune system to mount an immune response against adenovirus proteins encoded by said adenovirus nucleic acid has been reduced or disabled, in other ways then mentioned above, for instance through 15 exchanging capsid proteins, or parts thereof, by capsid proteins, or parts thereof, from other serotypes for which humans or animals do not have, or have low levels of, neutralising antibodies. Another example is the exchange of nucleic acid encoding capsid proteins with nucleic acid 20 encoding capsid proteins from other serotypes. Also capsid proteins, or parts thereof, may be exchanged for other capsid proteins, or parts thereof, for which individuals are not capable of, or have a low capacity of, raising an immune response against.

An adenovirus nucleic acid may be altered further or instead of one or more of the alterations mentioned above, by inactivating or deleting genes encoding adenovirus late proteins such as but not-limited to, hexon, penton, fiber 30 and/or protein IX.

In a preferred embodiment of the invention all genes encoding adenovirus proteins are deleted from said adenovirus nucleic acid, turning said nucleic acid into a minimal adenovirus vector.

In another preferred embodiment of the invention said adenovirus nucleic acid is an Ad/AAV chimaeric vector, PCT/NL00/0QU3— 29 wherein at least the integration means of an adeno-associated virus (AAV) are incorporated into said adenovirus nucleic acid.

In a preferred embodiment of the invention, a vector 5 or a nucleic acid, which may be one and the same or not, according to the invention further comprises at least one non-adenovirus nucleic acid. Preferably, at least one of said non-adenovirus nucleic acid is a nucleic acid encoding the following protein or a functional part, derivative and/or 10 analogue thereof: an apolipoprotein, a nitric oxide synthase, a herpes simplex virus thymidine kinase, an interleukin-3, an interleukin-IRA, an interleukin-la, an (anti) angiogenesis protein such as angiostatin or endostatin, an anti-proliferation protein, a vascular endothelial growth factor 15 (VGEF), a basic fibroblast growth factor (bFGF),a hypoxia inducible factor la (HIF-la), a PAI-1, a smooth muscle cell anti-migration protein, an erythropoietin, a CD40, a FasL, an interleukin-12, an interleukin-10, an interleukin-4, an interleukin-13, an excreted single chain antibody to CD4, 20 CD5, CD7, CD52, interleukin-2, interleukin-1, interleukin-6, tumour necrosis factor (TNF), etc. or an excreted single chain antibody to a T-cell receptor on the auto-reactive T-cells, a dominant negative mutant of promyelocytic leukemia (PML) to inhibit the immune response, an antagonist of 25 inflammation promoting cytokines such as for example interleukin-IRA(receptor antagonist) and soluble receptors like soluble interleukin 1 receptor I (IL-1RI), soluble interleukin 1 receptor II (sIL-lRII) , soluble tumour necrosis factor receptor I (sTNFRI) and II (sTNFRII) , a growth and/or 30 immune response inhibiting protein such as a protein encoded by a the genes Bcl3, cactus or IkBoc, P or y, an apoptosis inducing protein like the VP3 protein of chicken anemia virus or a protein encoded by a suicide gene like cytosine deaminase, nitroreductase and linamerase. Gene delivery 35 vehicles according to the invention comprising nucleic acid encoding one or more of said proteins or a functional parts, PCT/NLOO/0003— derivatives and/or analogues thereof can be used to kill or inhibit growth of synoviocytes and/or T-cells in the affected joints.

In another aspect, the invention provides a cell for 5 the production of a nucleic acid delivery vehicle comprising or provided with at least a tissue tropism for fibroblast-like or macrophage-like cells, preferably synoviocytes. In another aspect, the invention provides a cell for the production of a nucleic acid delivery vehicle comprising a 10 reduced tissue tropism for liver cells or having at least in part been deprived of a tissue tropism for liver cells. In another aspect, the invention provides a cell for the production of a nucleic acid delivery vehicle comprising or provided with at least a tissue tropism for fibroblast-like 15 or macrophage-like cells, preferably synoviocytes and comprising a reduced tissue tropism for liver cells or having at least in part been deprived of a tissue tropism for liver cells. In a preferred embodiment of the invention said cell is an adenovirus packaging cell, wherein an adenovirus 20 nucleic acid is packaged into an adenovirus capsid. In one aspect of an adenovirus packaging cell of the invention all functions required for the replication and packaging of an adenovirus nucleic acid, except for the proteins encoded by early region 1, are provided by proteins and/or RNA encoded 25 by said adenovirus nucleic acid. Early region 1 encoded proteins in this aspect of the invention may be encoded by genes incorporated into the cells genomic DNA. In a preferred embodiment of the invention said cell is PER.C6 (ECACC deposit number 96022940). In general, when gene products 30 required for the replication and packaging of adenovirus nucleic acid into adenovirus capsid are not provided by a adenovirus nucleic acid, they are provided by the packaging cell, either by transient transfection, or through stable transformation of said packaging cell. However, an adenovirus 3 5 product provided by the packaging cell may also, in addition, be provided by a nucleic acid present on said adenovirus WO 00/52186 PCT/NL00/Q0133 — 31 nucleic acid. For instance.fiber protein may be provided by the packaging cell, for instance through transient transfection, and may be encoded by adenovirus nucleic acid. This feature can among others be used to generate adenovirus 5 capsids comprising of fiber proteins with two different tissue tropisms for instance through the use of fiber proteins from two different viruses.

Nucleic acid delivery vehicles of the invention are useful for the treatment diseases, preferably joint related 10 diseases such as rheumatoid arthritis, ankylosing spondylitis and juvenile chronic arthritis. Non-limiting examples of proteins or functional parts, derivatives and/or analogues thereof, of which expression in for instance synoviocytes ameliorates at least in part symptoms of diseases are, an 15 apolipoprotein, a nitric oxide synthase, a herpes simplex virus thymidine kinase, an interleukin-3, an interleukin-IRA, an interleukin-la, an (anti) angiogenesis protein such as angiostatin or endostatin, an anti-proliferation protein, a vascular endothelial growth factor (VGEF), a basic fibroblast 20 growth factor (bFGF) , a hypoxia inducible factor la (HIF-la) , a PAI-1, a smooth muscle cell anti-migration protein, an erythropoietin, a CD4 0, a FasL, an interleukin-12, an interleukin-10, an interleukin-4, an interleukin-13, an excreted single chain antibody to CD4, CD5, CD7, CD52, 25 interleukin-2, interleukin-1, interleukin-6, tumour necrosis factor (TNF), etc. or an excreted single chain antibody to a T-cell receptor on the auto-reactive T-cells, a dominant negative mutant of promyelocytic leukemia (PML) to inhibit the immune response, an antagonist of inflammation promoting 30 cytokines such as for example interleukin-IRA (receptor antagonist) and soluble receptors like soluble interleukin 1 receptor I (IL-1RI), soluble interleukin 1 receptor II (sIL-1RII) , soluble tumour necrosis factor receptor I (sTNFRI) and II (sTNFRII), a growth and/or immune response inhibiting 35 protein such as a protein encoded by a the genes Bcl3, cactus or iKBa, p or y, an apoptosis inducing protein like the VP3 PCT/NL00/00I.33 - 32 protein of chicken anemia virus or a protein encoded by a suicide gene like cytosine deaminase, nitroreductase and linamerase.

Nucleic acid delivery vehicles of the invention may be 5 used as a pharmaceutical for the treatment of diseases. Alternatively, nucleic acid delivery vehicles of the invention may be used for the preparation of a medicament for the treatment of diseases. t Described herein is an adenovirus 10 capsid with or provided with a tissue tropism for fibroblast-like or macrophage-^ like cells, preferably synoviocytes wherein said capsid preferably comprises proteins from at least two different adenoviruses and wherein at least a tissue tropism determining part of a fiber protein is derived 15 from a subgroup B adenovirus, preferably of adenovirus 35, In another aspect the invention provides ^an adenovirus capsid with a reduced or having at least in part been deprived of a tissue tropism for liver cells wherein said capsid preferably comprises proteins from at least two different adenoviruses 20 and wherein at least a tissue tropism determining part of a fiber protein is derived from a subgroup B adenovirus, preferably of adenovirus 35.

Also described herein is the use of such an adenovirus capsid, for the delivery of 25 nucleic acid to fibroblast-like or macrophage-like:, cells, preferably synoviocytes.

Also described herein is the use of an adenovirus capsid of the invention, for at least in part preventing delivery of nucleic acid to liver cells. 3 0 In another embodiment the invention provides adenovirus for the treatment rheumatoid arthritis or disease treatable by nucleic acid delivery to fibroblast-like or macrophage-like cells, preferably synoviocytes.

In yet another embodiment the invention provides 35 adenovirus capsids as part of a pharmaceutical for the treatment of diseases. In yet another embodiment the PCT/NLOO/00133— 33 invention provides adenovirus capsids for the preparation of a medicament for the treatment of diseases.

Also described is a construct pBr / Ad. BamRAFib, comprising adenovirus 5 sequences 5 21562-31094 and 32794-35938.

Also described is a construct pBr/AdBamRfibl6, comprising adenovirus 5 sequences 21562-31094 and 32794-35938, further comprising an adenovirus 16 nucleic acid encoding fiber protein.

Further described is a construct pBr/AdBamR.pac/fibl6, comprising adenovirus 5 sequences 21562-31094 and 32794-35938, further comprising an adenovirus 16 nucleic acid encoding fiber protein, and further comprising a unique PacI-site in the proximity of the 15 adenovirus 5 right terminal repeat, in the non-adenovirus sequence backbone of said construct.

Further described is a construct pWE/Ad.AfUlrlTRfibl6 comprising Ad5 sequence 3534-31094 and 32794-35938, further comprising an adenovirus 16 20 nucleic acid encoding fiber protein.

Further described is a construct pWE/Ad.AflIIrITRDE2Afibl6 comprising Ad5 sequences 3534-22443 and 24033-31094 and 32794-35938, further comprising an adenovirus 16 nucleic acid encoding fiber 25 protein.

In the numbering of the sequences mentioned above, the number is depicted until and not until plus.

In a preferred embodiment of the invention said 30 constructs are used for the generation of a nucleic acid delivery vehicle or an adenovirus capsid with a tissue tropism for fibroblast-like or macrophage-like cells, preferably synoviocytes.

Also described herein is a library of 35 adenovirus vectors, or nucleic acid delivery vehicles which may be one and the same or not, comprising a large selection PCT/NLOO/OQ133 r 34 of non-adenovirus nucleic acids.

Also described herein is the use of adenovirus genes encoding capsid proteins to generate a library of adenovirus capsids comprising of proteins derived from at least two different 5 adenoviruses, said adenoviruses preferably being derived from two different serotypes, wherein preferably one serotype is an adenovirus of subgroup B. In a particularly preferred embodiment a library of adenovirus capsids is generated comprising proteins from at least-two different adenoviruses 10 and wherein at least a tissue tropism determining part of fiber protein is derived from an adenovirus of subgroup B, preferably of adenovirus 35.

Also described herein is a subgroup B 15 adenovirus capsid comprising a nucleic acid encoding at least one non-adenovirus proteinaceous molecule or RNA molecule. Preferably said subgroup B adenovirus nucleic acid further comprises subgroup B adenovirus nucleic acid. More preferably said subgroup B adenovirus nucleic acid has been deprived of 20 the capacity to express El-region encoded proteins. Most preferably said subgroup B adenovirus is adenovirus 35.

Also described herein is a method for at least in part removing synovium from a joint in an 25 individual comprising administering to said joint a nucleic acid delivery vehicle comprising nucleic acid encoding at least herpes simplex virus thymidine kinase or a functional part, derivative and/or analogue thereof and administering to said individual ganciclovir or a functional part, derivative 30 and/or analogue thereof. Preferably, said gene delivery vehicle is vehicle of the invention.

A fiber protein of adenovirus 35 preferably comprises at least part of the sequence given in figure 7. However 35 within the scope of the present invention other sequences may be used for instance obtained through using codon degeneracy.

PCT/NL00/Q0133 - Alternatively, a fiber sequence may comprise amino-acid substitutions or insertions or deletions compared to the sequence depicted in figure 7, as long as the desired tissue tropism determining property is not significantly altered.

Amino-acid substitutions may be within the same polarity group or wi thout.

A transduced cell is a cell provided with nucleic acid. Said cell may have been provided with nucleic acid through 10 any means. Similarly, to measure transduction of a cell means to measure nucleic acid transfer into said cell. Said transfer may have occurred through any means capable of transferring nucleic into a cell.

EXAMPLES Example 1: Generation of adenovirus serotype 5 based viruses with chimaeric fiber proteins Generation of adenovirus template clones lacking DNA encoding for fiber. The fiber coding sequence of adenovirus serotype 5 is located between nucleotides 31042 and 32787. To remove the adenovirus serotype 5 DNA encoding fiber we started with construct pBr/Ad.Bam-rlTR (Figure 1; ECACC 25 deposit P97082122). From this construct first a Ndel site was removed. For this purpose, pBr322 plasmid DNA was digested with Ndel after which protruding ends were filled using Klenow enzyme. This pBr322 plasmid was then re-ligated, digested with Ndel and transformed into E. coli DH5a. The 30 obtained pBr/ANdel plasmid was digested with Seal and Sail and the resulting 3198 bp vector fragment was ligated to the 1534 9 bp Seal-Sail fragment derived from pBr/Ad.BamrlTR, resulting in plasmid pBr/Ad.Bam-rITRANdeI which hence contained a unique Ndel site. Next a PCR was performed with PCT/NLOO/00133 — 36 oligonucleotides "NY-up" and "NY-down" (Figure 2) . During amplification, both a Ndel and a Nsil restriction site were introduced to facilitate cloning of the amplified fiber DNAs. Amplification consisted of 25 cycles"of each 45 sec. at 94°C, 5 1 min. at 60°C, and 45 sec. at 72°C. The PCR reaction contained 25 pmol of oligonucleotides NY-up or NY-down, 2mM dNTP, PCR buffer with 1.5 mM MgCl2, and 1 unit of Elongase heat stable polymerase (Gibco, The Netherlands) . One-tenth of the PCR product was run on an agarose gel which demonstrated 10 that the expected DNA fragment of ± 2200 bp was amplified. This PCR fragment was subsequently purified using Geneclean kit system.(BiolOl Inc.) Then, both the construct pBr/Ad.Bam-rlTRANdel as well as the PCR product were digested with restriction enzymes Ndel and Sbfl. The PCR fragment was 15 subsequently cloned using T4 ligase enzyme into the Ndel and Sbfl sites thus generating pBr/Ad.BamRAFib (Figure 3) .

Amplification of fiber sequences from adenovirus serotypes.

To enable amplification of the DNAs encoding fiber protein derived from alternative serotypes degenerate oligonucleotides were synthesised. For this purpose, first known DNA sequences encoding for fiber protein of alternative serotypes were aligned to identify conserved regions in both 25 the tail region as well as the knob region of the fiber protein. From the alignment, which contained the nucleotide sequence of 19 different serotypes representing all 6 subgroups, (degenerate) oligonucleotides were synthesised (see Table I) . Also shown in table I is the combination of 30 oligonucleotides used to amplify the DNA encoding fiber protein of a specific serotype. The amplification reaction (50 ^il) contained 2 mM dNTPs, 25 pmol of each oligonucleotide, standard lx PCR buffer, 1,5 mM MgCl2, and 1 WO 00/52186 PCT/NLOO/00133 37 Unit Pwo heat stable polymerase (Boehringer Mannheim) per reaction. The cycler program contained 2 0 cycles, each consisting of 30 sec. 94°C, 60 sec. 60-64°C, and 120 sec. 72°C. One-tenth of the PCR product was run on an agarose gel 5 to demonstrate that a DNA fragment was amplified. Of each different template, two independent PCR reactions were performed.

Generation of chimaeric adenoviral DNA constructs 10 All amplified fiber DNAs as well as the vector (pBr/Ad.BamRAFib) were digested with Ndel and Nsil. The digested DNAs were subsequently run on a agarose gel after which the fragments were isolated from the gel and purified using the Geneclean kit (Biol01 Inc). The PCR fragments were 15 then cloned into the Ndel and Nsil sites of pBr/AdBamRAFib, thus generating pBr/AdBamRFibXX (where XX stands for the serotype number of which the fiber DNA was isolated) . The inserts generated by PCR were sequenced to confirm correct amplification. The obtained sequences of the different fiber 20 genes are shown in Figure 4.

Generation of recombinant adenovirus chimaeric for fiber protein.

To enable efficient generation of chimaeric viruses an 25 Avrll fragment from the pBr/AdBamRFibl6, pBr/AdBamRFib28, pBr/AdBamRFib4 0-L constructs was subcloned into the vector pBr/Ad.Bam-rITR.pac#8 (ECACC deposit #P97082121) replacing the corresponding sequences in this vector. pBr/Ad.Bam-rITR.pac#8 has the same adenoviral insert as pBr/Ad .Bam-rITR 30 but has a PacI site near the rITR that enables the ITR to be separated from the vector sequences. The construct pWE/Ad.Aflll-Eco was generated as follows. pWE.pac was WO 00/52186 PCT/NL00/00133 - 38 digested with Clal and the 5 prime protruding ends were filled in with klenow enzyme. The DNA was then digested with PacI and isolate from agarose gel. pWE/AfUlrlTR was digested with EcoRI and after treatment with klenow enzyme 5 digested with PacI. The large 24 kb. fragment containing the adenoviral sequences was isolated from agarose gel and ligated to the Clal digested and blunted pWE.pac vector. Use was made of the ligation express kit from Clontech. After transformation of XLlO-gold cells from Stratagene, clones 10 were identified that contained the expected construct. pWE/Ad.AlfII-Eco contains Ad5 sequences from basepairs 3534-27336. Three constructs, pClipsal-Luc (Figure 5) digested with Sail, pWE/Ad.Aflll-Eco digested with PacI and EcoRI and pBr/AdBamR.pac/fibXX digested with BamHI and PacI were 15 transfected into adenovirus producer cells (PER.C6, Fallaux et al, 1998). Figure 6 schematically depicts the method and fragments used to generate the chimaeric viruses. Only pBr/Ad.BamRfibl2 was used without subcloning in the PacI containing vector and therefore was not liberated from 20 vector sequences using PacI but was digested with Clal which leaves approximately 16 0 bp of vector sequences attached to the right ITR. Furthermore, the pBr/Ad.BamRfibl2 and pBr/Ad.BamRfib2 8 contain an internal BamHI site in the fiber sequences and were therefor digested with Sail which cuts in 25 the vector sequences flanking the BamHI site. For transfection, 2 pg of pCLIPsal-Luc, and 4 jxg of both pWE/Ad. Af III-Eco and pBr/AdBamR.pac/f ibXX were diluted in serum free DMEM to 100 p.1 total volume. To this DNA suspension 100 p.1 2.5x diluted lipofectamine (Gibco) in 3 0 serum-free medium was added. After 3 0 minutes at room temperature the DNA-lipofectamine complex solution was added to 2.5 ml of serum-free DMEM which was subsequently added to WO 00/52186 PCT/NL00/00133 39 2 a T25 cm tissue culture flask. This flask contained PER.C6 cells that were seeded 24-hours prior to transfection at a density of lxlO6 cells/flask. Two hours later, the DNA-lipofectamine complex containing medium was diluted once by 5 the addition of 2.5 ml DMEM supplemented with 20% foetal calf serum. Again 24 hours later the medium was replaced by fresh DMEM supplemented with 10% foetal calf serum. Cells were cultured for 6-8 days, subsequently harvested, and freeze/thawed 3 times. Cellular debris was removed by 10 centrifugation for 5 minutes at 3000 rpm room temperature.

Of the supernatant (12.5 ml) 3-5 ml was used to infect again 2 PER.C6 cells (T80 cm tissue culture flasks). This reinfection results in full cytopathogenic effect (CPE) after 5-6 days after which the adenovirus is harvested as 15 described above.

Production of chimaeric adenoviruses ml of the above crude cell lysate was used to inoculate a 1 litre fermentor which contained 1 - 1.5 x 106 20 PER.C6 cells/ml growing in suspension. Three days after inoculation, the cells were harvested and pelleted by centrifugating for 10 min at 1750 rpm at room temperature (RT) . Adenovirus present in the pelleted cells was subsequently extracted and purified using the following 25 downstream processing protocol. The pellet was dissolved in 50 ml 10 mM NaP04" and frozen at -20°C. After thawing at 37°C, 5.6 ml deoxycholate (5% w/v) was added. The solution was mixed and incubated for 15 minutes at 37°C to completely lyse the cells. After homogenising the solution, 1875 (4.1 1M 30 MgCl2 and 5 ml glycerol was added. After the addition of 375 (j.1 DNase (10 mg/ml) the solution was incubated for 3 0 minutes at 37°C. Cell debris was removed by centrifugation at 1880xg WO 00/52186 PCT/NL00/Q.0133 40 for 3 0 minutes at RT without brake. The supernatant was subsequently purified from proteins by extraction with freon (3x) . The cleared supernatant was loaded on a 1M Tris/HCl buffered caesiumchloride blockgradient (range: 1.2/1.4 gr/ml) 5 and centrifuged at 21000 rpm for 2.5 hours at 10°C. The virus band is isolated after which a second purification using a 1M Tris/HCl buffered continues gradient of 1.33 gr/ml of caesiumchloride was performed. The virus was then centrifuged for 17 hours at 55000 rpm at 10°C. The virus band is isolated 10 and sucrose (50 % w/v) is added to a final concentration of 1%. Excess caesiumchloride is removed by dialysis (three times 1 hr at RT) in dialysis slides (Slide-a-lizer, cut off 10000 kDa, Pierce, USA) against 1.5 ltr PBS supplemented with CaCl2 (0.9 mM) , MgCl2 (0.5mM) and an increasing concentration 15 of sucrose (1, 2, 5%) . After dialysis, the virus is removed from the slide-a-lizer after which it is aliquoted in portions of 25 and 100 jj.1 upon which the virus is stored at -85 °C.

To determine the number of virus particles per ml, 50 ^1 20 of the virus batch is run On an high pressure liquid chromatograph (HPLC) as described by Shabram et al (1997) using a 300-600 mM NaCl gradient. The virus titer of the chimaeric virus was found to be in the same range as the Ad5. Clip. Luc virus batch (Ad5 . Clip. Luc : 2.2X1011 vp/ml; 25 Ad5 .Luc-fibl6 : 3 . 1x1012 vp/ml) .

PCT/NL00/Q0133 41 EXAMPLE 2: Biodistribution of chimaeric viruses after intravenous tail vein injection of rats.

To investigate the biodistribution of the chimaeric adenovirus Ad5. Luc-fibl6 in comparison to Ad5 based luciferase viruses, IxlO10 particles of each of the virus batches were diluted to 1 ml with PBS and the virus was injected in the tail vein of adult male Wag/Rij rats (3 10 rats/virus) . Forty-eight hours after the administration of the virus, the rats were sacrificed after which the liver, spleen, lung, kidney, heart and brain were dissected. These organs were subsequently mixed with 1 ml of lysis buffer (1% Triton X-100 in PBS) and minced for 3 0 seconds to obtain a 15 protein lysate. The protein lysate was tested for luciferase activity and the protein concentration was determined. The results, shown in Table II, demonstrate that the adenovirus serotype 5 is targeted for a large part to the liver and to the spleen, whereas the Ad5.Luc-fibl6 chimearic virus is not. 20 This experiment shows that it is possible to circumvent the uptake of adenoviruses by the liver by making use of fibers of•other serotypes.

EXAMPLE 3: Production of fiber chimeric adenovirus Another batch of Ad5 .Luc-fibl6 was made by using 10 ml crude extract to inoculate a 1 litre fermentor which contained 1 - 1.5 x 106 cells/ ml PER.C6 that were 3 0 specifically adapted to grow in suspension. Three days after inoculation, the cells were harvested and pelleted by centrifuging for 10 min at 1750 rpm at room temperature. The chimeric adenovirus present in the pelleted cells was subsequently extracted and purified using the following PCT/NLOO/00133 42 downstream processing protocol. The pellet was dissolved in 50 ml 10 mM NaP04~ and frozen at -20°C. After thawing at 37°C, 5.6 ml deoxycholate (5% w/v) was added after which the solution was homogenated. The solution was subsequently 5 incubated for 15 minutes at 3 7°C to completely crack the cells. After homogenising the solution, 1875 |il (1M) MgCl2~ was added and 5 ml 100% glycerol. After the addition of 375 |il DNase (10 mg/ ml) the solution was incubated for 3 0 minutes at 37°C. Cell debris was removed by centrifugation at 10 1880xg for 3 0 minutes at room temperature without the brake on. The supernatant was subsequently purified from proteins by loading on 10 ml of freon. Upon centrifugation for 15 minutes at 2000 rpm without brake at room temperature three bands are visible of which the upper band represents the 15 adenovirus. This band was isolated by pipetting after which it was loaded on a Tris/HCl (1M) buffered caesium chloride block gradient (range: 1.2 to 1.4 gr./ml). Upon centrifugation at 21000 rpm for 2.5 hours at 10°C the virus was purified from remaining protein and cell debris since the 20 virus, in contrast to the other components, does not migrate into the 1.4 gr. / ml caesium chloride solution. The virus band is isolated after which a second purification using a Tris/ HC1 (1M) buffered continues gradient of 1.33 gr. /ml of caesium chloride is performed. After virus loading on top of 25 this gradient, the virus is centrifuged for 17 hours at 55.000 rpm at 10°C. Subsequently, the virus band is isolated and after the addition of 30 fj.1 of sucrose (50 w/v) excess caesium chloride is removed by three rounds of dialysis, each round comprising of 1 hour. For dialysis the virus is 30 transferred to dialysis slides (Slide-a-lizer, cut off 10.000 kDa, Pierce, USA). The buffers used for dialysis are PBS which are supplemented with an increasing concentration of sucrose (round 1 to 3: 30 ml, 60 ml, and 150 ml sucrose (50% w/v)/ 1.5 litre PBS, all supplemented with 7.5 ml 2% (w/v) 35 CaMgCl2) . After dialysis, the virus is removed from the slide-a-lizer after which it is aliquoted in portions of 25 PCT/NLOO/00133 — 43 and 100 (al upon which the Ad5 .Luc-fibl6 virus is stored at -85°C.

To determine the number of virus particles per 5 millilitre, 50 (j.1 of the virus batch is run on a high- pressure liquid chromatograph (HPLC). The adenovirus is bound to the column (anion exchange) after which it is eluted using a NaCl gradient (range 300-600 mM) . By determination of the area under the virus peak the number of virus particles can 10 be calculated. To determine the number of infectious units (IU) per ml present in a virus batch, titrations are performed on 911 cells. For this purpose, 4xl04 911 cells are seeded per well of 96-well plates in rows B, D, and F in a total volume of 100 ^il per well. Three hours after seeding 15 the cells are attached to the plastic support after which the medium can be removed. To the cells a volume of 200 |il - is added, in duplicate, containing different dilutions of virus (range: 102 times diluted to 2xl09) . By screening for CPE the highest virus dilution which still renders CPE after 14 days 20 is considered to contain at least one infectious unit. Using this observation, together with the calculated amount of virus volume present in these wells renders the number of infectious units per ml of a given virus batch.

EXAMPLE 4: Chimeric viruses display differences in synoviocyte cell transduction Infection of human synoviocytes In a first set of experiments 50.000 synoviocytes (derived from 1 individual) were seeded in each well of a 24-wells plate in a volume of 1 ml per well. Twenty-four hours after seeding, the cells were washed with PBS after which 200 35 jj.1 of DMEM supplemented with 2% FCS was added to the cells. This medium contained various amounts of virus (a PCT/NL00/00133— 44 multiplicity of infection (MOI) of 50, 250, 1250, 2500, 5000, and 10000 vp/cell was used). Viruses were either Ad5.Clip.Luc or Ad5.Luc-fibl6. Two hours after addition of virus the medium was replaced by normal medium thus removing the non-5 bound virus (each infection in duplicate) . Again forty-eight hours later cells were washed and lysed by the addition of 100 jul lysis buffer after which luciferase transgene expression was monitored.. In figure 8, results are shown of the luciferase transgene expression per microgram protein 10 after infection of synoviocytes. These results show that the fiber 16 chimeric adenovirus infects synoviocytes significantly better, based on transgene expression, as compared to the control Adenovirus serotype 5. The fold increase of the fiber 16 chimeric adenovirus over the control 15 adenovirus serotype 5 ranged, depending on the MOI used, from 2.4x (MOI 50) to 1052x (MOI 10000). Identical experiments demonstrated on average (n=4) at least a factor 100 difference in transgene expression between the adenovirus serotype 5 and the fiber 16 chimeric adenovirus.

In a second set of experiments, an equal number of virus particles was added to different concentrations of synoviocytes. This experiment was performed since it is possible that the efficiency of infection of these cells is 25 dependent on the confluency of the synoviocyte cell layer. A highly confluent cell layer may mimic the in vivo situation better. For this purpose, synoviocytes were seeded at concentrations of 12.500, 25.000, 50.000, and 100.000 cells per well of 24-well plates (in duplicate) . Twenty-four hours 30 later these cells were infected as described above with medium containing 2.5 x 10s virus particles. The result of the luciferase transgene expression determined 48 hours after a two hours infection procedure (see figure 9) shows that the fiber 16 chimeric adenovirus renders a +1000 fold higher 35 expression of luciferase and thus is clearly better suited to infect synoviocytes also when cells are 100% confluent.

WO 00/52186 PCT/NLO0/00133 — 45 In a third set of experiments we determined the differences in the level of luciferase transgene expression versus the time of virus exposure. This experiment was performed to demonstrate that the binding kinetics of the 5 fiber 16 chimeric adenovirus is different from that of the adenovirus serotype 5 control virus. For this purpose 15.000 synoviocytes were seeded in 24-well plates in a volume of 1 ml. Twenty-four hours later cells were infected (in triplicate) with an MOI of 50, 500, or 5.000 vp/cell. 10 infection was allowed to proceed either for two hours or for 2 0 hours. The results, shown in figure 10, demonstrate that binding kinetics and characteristics of the fiber 16 chimeric adenovirus is distinct from that of the control adenovirus serotype 5 and that the fiber 16 chimeric adenovirus infects 15 synoviocytes much more efficient as compared to the control adenovirus serotype 5 virus.

From the above described results it is clear that the fiber 16 chimeric virus is better suited to infect 20 synoviocytes as compared to the adenovirus serotype 5. Since it is known that adenovirus serotype 5 requires the coxacki adenovirus receptor (CAR) and the integrins avP3 and avP5 for entry we monitored expression of these molecules on synoviocytes using flow cytometry. For this purpose 1x10s 25 synoviocytes were transferred to tubes designed specifically for flow cytometry. Cells were washed once with PBS/ 0.5% BSA after which the cells were pelleted by centrifugation for 5 minutes at 1750 rpm at room temperature. Subsequently, 10 |il of a 100 times diluted avP3 antibody (Mab 1961, Brunswick 30 chemie, Amsterdam, The Netherlands) , a 100 times diluted antibody avp5 (antibody (Mab 1976, Brunswick chemie, Amsterdam, The Netherlands), or 2000 times diluted CAR antibody (a gift from Dr. Bergelson, Harvard Medical School, Boston, USA (Hsu et al, 1988) was added to the cell pellet 35 after which the cells were incubated for 30 minutes at 4°C in a dark environment. After this incubation, cells were washed PCT/NL00/Q0133 r 46 twice with PBS/0.5% BSA and again pelleted by centrifugation for 5 minutes at 1750 rpm room temperature. To label the cells, 10 pi of rat-anti-mouse IgGl labelled with phycoerythrine (PE) was added to the cell pellet upon which 5 the cells were incubated for 3 0 minutes at 4°C in a dark, environment. Finally, the cells were washed twice with PBS/0.5% BSA and analysed on a flow cytometer. The results of this experiment are shown in table III.

These flow cytometric results demonstrate that synoviocytes do not express detectable levels of CAR, which may be at least one of the reasons that these cells are difficult to transduce with the adenovirus serotype 5.

As a control for the experiments performed on synoviocytes, A549 and PER.C6 cells were infected. These cell lines can be readily infected by adenovirus serotype 5. This experiment is performed to investigate whether the observed differences on the synoviocytes can indeed be attributed to 20 differences in cell binding or that the differences are caused by differences in virus particle per infectious unit ratio. For this purpose, 105 A54 9 cells were seeded in 24-well plates in a volume of 200 pi. Two hours after seeding the medium was replaced by medium containing different 25 amounts of particles of either Ad5 . Luc-f ibl6 or Ad5. Clip. Luc (MOI = 0, 5, 10, 25, 100, 500) . Twenty-four hours after the addition of virus, the cells were washed once with PBS after which the cells were lysed by the addition of 100 pi lysis buffer to each well (1% Triton X-100 in PBS) after which 30 transgene expression (luciferase activity) and the protein concentration was determined. Subsequently, the luciferase activity per pg protein was calculated. These data, shown in table IV demonstrate that when using a identical amount of virus particles, differences in transgene expression observed 35 in relevant cell types is due to differences in binding and/ PCT/NL00/Q0133 — 47 or internalisation of the virus and not to the amount of virus used.

A similar experiment was performed on PER.C6 cells using 5 adenovirus serotype 5 and the fiber chimera fiber 16. For this purpose, 105 PER.C6 cells, were seeded in 24-wells plates in a total volume of 100 pi. Three hours after seeding, the medium was replaced by medium containing 106 particles of either Ad5.Clip.Luc or Ad5 .Luc-fibl6 (MOI = 10).

Twenty-four hours after addition of the virus, cells were washed once with PBS after which 100 pi lysis buffer was added to the attached cells. The lysate was subsequently used to determine transgene expression (luciferase activity) and the protein concentration. The results, shown in table V, again demonstrate that the differences in infection efficiency as observed on synoviocytes, in favour of the. fiber 16 chimeric adenovirus, are differences related to binding efficiency rather than to the amount of virus used. 2 0 Example 5 Treatment of RA with herpes simplex virus thymidine kinase MATERIALS AND METHODS Recombinant adenoviral vectors: The adenoviral vectors used in this study contain the recombinant gene inserted into the El region of an Ad type 5 mutant. The cytomegalovirus promoter (CMV) and the major late promoter (mlp) were used to drive gene expression in the constructs harbouring the lacZ and luciferase marker genes.

Mlp was used to drive gene expression in the Ad harbouring the TK gene. Virus concentrations were determined by titration of the virus. Ad were tested to contain no replication competent wild-type Ad or Ela recombination. The adenoviral vectors IG.Ad.CMV.lacZ, IG.Ad.mlp.lacZ, IG.Ad.CMV.luc, IG.Ad.mlp.luc and IG.Ad.mlp-1. TK and their PCT/NLOO/OOL33— production have been previously described in detail (Imler et al; Vincent et al, 1996).

Synovial fibroblast culture.

Human synovium was obtained from patients with RA defined by 5 AlRA-criteria 1987 (Arnett et al, 1988) at the time of joint replacement surgery. Synovial tissue was collected in sterile Phosphate Buffered Saline (PBS). Fat and connective tissue were discarded and tissue was incubated wi.th 0.5 mg collagenase/ml for 2 h at 3 7 EC. Cells were washed and seeded 10 in 75-cm2 flasks in 10 ml of Iscoves Modified Dulbeco' s Medium (IMDM) 17 % fetal calf serum (FCS). Medium was refreshed twice a week. Confluent cultures of adherent synoviocytes were passaged at a 1:2 ratio in 75-cm2 flasks. The cells were detached from the flasks with 1.5 ml 0.25 % 15 trypsin-EDTA dissolved in PBS at room temperature.

Infections: The day prior to infections, synovial cells were plated at a density of 100,000 per 25-cmz bottle in reporter gene experiments or 5,000 per well (24 wells plate) in TK 20 experiments. Cells were cultured in respectively 10 or 1 ml of IMDM 17 % FCS. In the procedure of infection of synoviocytes, medium was replaced by the appropriate dose of modulated virus in IMDM 17 % FCS.

LacZ in-vitro experiments: After 2 days of incubation the number of synoviocytes were counted in a negative control and in a sample incubated with virus concentration multiplicity of infection (MOI) 100. Remaining samples were washed with PBS, fixed briefly with glutaraldehyde 0.25%, washed with PBS (2 x) and stained by 30 immersion in 5 mM K4Fe(CN)6, 5mM K3Fe(CN)6, 2mM MgCl2 in PBS containing 0.5 mg/ml of X-gal stain (5-bromo-4-chloro-3-indolyl-8-D-galactopyranoside; Sigma Chemical Co., St.Louis, USA) . After four to six hours samples were washed twice and the reaction was stopped by glutaraldehyde 0.25% Percentage 35 of infected cells was assessed by light microscopy after counting at least 300 cells (magnification 10x40).

PCT/NL00/00133— 49 Luciferase in-vitro experiments: After 3 days of incubation with Ad.luc synoviocyte counts were made comparable to lacZ experiment. Remaining samples were washed with PBS and trypsinised briefly. Synoviocytes 5 were lysed using 200 :1 lysis buffer. Samples of 20 :1 were analysed by luminometric methods.

TK in-vitro experiments: One day after incubation with Ad.TK medium was replaced by IMDM 40 % Normal Human Serum (NHS) . In half of the cultures 10 10 pg GCV (9-[1,3-dihydrate-2-propoxy]methyl]guanine, Roche Nederland BV, the Netherlands) was added per ml medium.

Medium plus or minus GCV was refreshed on day 3. Cells counts were made 5 days after virus infection.

In the TK-bystander killing experiment one 75-cm2 flask with 15 synoviocytes was trypsinised and divided over three flasks. Two flasks were infected with respectively IG.Ad.mlpI .TK or IG. Ad. CMV. TK. One day later infected and non-infected cells were mixed according to scheme (see figure 14) . Medium was replaced by IMDM 40 % NHS plus or minus GCV. Cell counts were 20 made after 7 days.

Animals and intra-articular injections: All animal protocols were approved by the Medical Ethical Committee and performed according to institutional guidelines. 8 Adult rhesus monkeys (Macaca mulatta) suffering 25 from CIA (Bakker, 1992) were used for these experiments and held under D2 containment. Before handling, monkeys were anaesthetised with a single intramuscular dose of approximately 1 ml of 85-90 % ketamine [100 :l/kg, 10 mg/ml] (ASP Pharma BV Oudewater, The Netherlands) and 10-15 % 30 vetranguil. If an animal was experiencing severe pain it was given twice a day 0.06 mg Burprenorfine (Temgesic-R, Schering-Plough BV, Amstelveen, the Netherlands).

Before intra-articular punction the area surrounding knees was shaved and rinsed with iodine. Using sterile technique, 35 respectively 1 ml or 0.1 ml of purified recombinant virus suspended in PBS was injected according to scheme into the PCT/NL00/00.133— 50 intra-articular space of the knee or proximal interphalangeal joint (pip). Beginning forty-eight hours after injection of the virus, monkey 7 and 8 received 10 mg/kg GCV infused in half an hour, daily for fourteen days. Animals were killed by 5 intracordial punction and bleeding. For summary of rhesus monkeys experiments see table VI.

Parameters: Animals were monitored daily for general health, which included recording of behaviour, appetite and stool 10 consistency. Evaluation of biochemical parameters was performed on a number of days after virus administration (see table VI) . For this purpose, animals were sedated as described above, body weight and rectal temperature were measured and venous blood samples were collected [clotted and 15 sodium ethylenediamine tetra-acetic acid (EDTA)-treated blood]. Analysis of the blood serum included electrolytes (Na, K, Cl and bicarbonate) ; kidney function (urea, creatinine) and liver function [alkaline phosphatase, asparagine-aminotransferase (ASAT) , alanine-aminotransferase 20 (ALAT) ; lactate dehydrogenate (LDH) and total bilirubin] ; total protein and albumin; and haematological parameters (red and white blood cell counts, differential count, platelet count, erythrocyte sedimentation rate (ESR) . In monkey 5-8 venous blood was drawn in clot tubes and analysed for the 25 presence of antibodies against Ad by complement fixation assay, according to routine procedures at the department of infectious diseases and immunology (SSDZ Delft, The Netherlands) .

Faeces, urine and pharyngeal swabs were collected on 30 different sampling days (see table VI) and stored frozen.

Analysis consisted of culturing extracts on 2 93 cells (growth of wild-type and recombinant virus) and hep-2 cells (growth of wild-type virus)(Bout et al, 1994).

A complete post-mortem necropsy and histopathological 35 examination of aorta, axillary lymphnodes, bladder, colon, duodenum, hart, inguinal lymphnodes, lung, liver, lymphnodes PCT/NL00/00133 — of the lung hilus, spleen, left kidney, oesophagus, pancreas, thyroid gland, skeleton muscle, bone marrow, thymus, trachea, cervix/vagina and ovary or prostate and testis were performed. Samples of these tissues were fixed in 10 % 5 phosphate buffered formalin for routine histopathological analysis.

In addition in monkey 1-5 snap frozen samples of axillary lymphnodes, hart, inguinal lymphnodes, liver, spleen, left kidney, lung, bladder, oesophagus, bone marrow and synovium 10 injected joints and non-injected control joints were taken for luciferase assay (Sawchuk, 1996) . Joints were opened, coloured with X-gal staining solution (Roessler et al, 1993; Bout et al, 1993) and post-fixed in formalin for at least 72 hours. Joints were cut using a diamond saw, subsequently 15 pieces were imbedded in plastic and 6 : slices were cut using a microtome. Slices were stained with haematoxylin and eosin according to standard procedures at the pathological laboratory of Leiden University Hospital, The Netherlands.

PCT/NLOO/OOX33 — 52 RESULTS IN-VITRO: Possibility of gene transfer to synoviocytes.

Synoviocytes were infected with modified Ad using different 5 reportergenes arid different promoters. Two days after infection of synoviocytes with IG.Ad.CMV.lacZ at MOI 100, 67 % cells were positive for X-gal, as evidenced by a microscopically visible blue colour of the cells. In synQvial cell cultures a doses response relation was observed between 10 the amount of virus added and gene expression of the reporter gene, both after infection with IG.Ad.CMV.lacZ and IG.Ad.CMV.luc (see table XI and table XII). When incubation time was prolonged to five days, 100 % of synoviocytes stained blue. Gene expression after infection with Ad 15 constructs driven by the CMV promoter is higher than by Ad constructs driven by the mlp-promoter. This difference is more prominent using lacZ as a reporter gene (± 100' x) than using luciferase as a reporter gene (+ 10 x) . Two days after infection with IG.Ad.mlp. lacZ at MOI 100, less than 1 % was 20 positive for lacZ. However, clear gene expression in a dose dependent fashion was observed if the luciferase reporter gene was used (table XII).

Toxicity of crene transfer to synoviocytes.

To assess possible toxicity of high doses Ad for synoviocytes, synoviocytes were cultured without virus or incubated with Ad.lacZ, Ad. luc or Ad.TK at MOI 100. Cell counts of synoviocyte cultures after infection with modified Ad at MOI 100 showed no significant differences compared to 30 non-infected cultures (table VII).Students t-test for paired samples p > 0.2.

Efficacy of cell-killing.

Synoviocytes incubated with IG.Ad.mlp.TK were cultured with or without 10 :ju.g/ml GCV. 99 percent cell killing was 35 observed after infection of synoviocytes with IG.Ad.CMV.TK and incubation with GCV, infection with IG.Ad.mlp.TK led to WO 00/52186 PCT/NL00/00I33— 53 80 % cell killing (see figure 11). After mixing 25 % transduced with 75 % untransduced synoviocytes, bystander killing was assessed. Both in IG.Ad.CMV.TK and IG.Ad.mlp.TK experiments extensive cell killing was observed (see figure 5 12) .

IN-VIVO: Possibility and specificity of gene transfer to inflamed synovial tissue in-vivo: 36 joints (10 knees and 26 pip's) of 8 different monkeys were 10 injected with different amounts of IG.Ad.lacZ, IG.Ad.luc or IG.Ad.mlp-I.TK. In the biodistribution experiments, a CMV promoter was chosen to allow maximum sensitivity in detection of reporter gene product.

Histological examination of articular and peri-articular 15 tissues obtained 2-3 days after infection with IG.Ad.CMV.lacZ showed lacZ expressing cells present in synovial villi as . well as in the synovial tissue covering tendons, bone, articular cartilage and subsynovial adipose tissue-(figure 13) . The cells expressing lacZ activity were synoviocytes as 20 evidenced by typical location and morphologic appearance. The percentage of infected cells ranged from 5 to 70 %.., Joints injected with PBS and non-injected joints did not show any lacZ positive cells. No infection of cartilage, bone, fat or muscle tissue was observed. If the less efficient mlp 25 promoter was used (in monkey 5 and in pip 2 monkey 2) no lacZ positive cells could be found.

Dose response after gene transfer to synoviocytes in-vivo.

In monkey 4 and 5 increasing amounts of modified Ad were injected in consecutive pip-joints in the monkeys. In the 30 pip-joints of monkey 4, injected with IG.Ad.CMV.lacZ, an obvient dose-response relation was observed in percentage of lacZ expressing cells (table VIII). In monkey 5, injected with IG.Ad.mlp.lacZ, no lacZ positive cells were observed in the synovium.

WO 00/52186 PCT/NL00/00133— 54 Toxicity of intra-articular (i.a.) administration of Ad harbouring a reportercreiae: Biodistribution s To asses toxicity of the procedure, biodistribution of the virus was determined using Ad harbouring the luciferase reportergene. Luciferase-activity, measured by luminometric methods, indicates infection of the organ by Ad. Monkey 1-5 were injected by Ad.CMV. luc or IG.Ad. mlp. luc and were 10 sacrificed 2-3 days after virus administration. Specimens of synovial tissue were harvested. From the same biopsies histological confirmation was obtained to judge if the sample contained relevant tissue. In monkey 4 the samples contained mainly connective tissue and no synovial tissue. Samples of 15 above mentioned organs and joints were analysed using the luciferase assay. Samples obtained from a non-treated monkey were used as a control. Except for one sample (cervix) and two non-virus injected joints that had slightly elevated luciferase counts, only IG.Ad.luc injected joints were 20 positive in the luciferase assay (table IX) .

To assess shedding of the virus excreta were cultured during the first 3 days of the experiment. In the faeces (day 0-3) of monkey 5 Ad could be cultured both on 293- and hep-2 cells. The throat swab of this monkey was positive on 293 25 cells on day 1. In the other monkeys faeces, urine and throat swabs were negative in the Ad culture assay.

Clinical behaviour.

During the experiment monkey 3 and 5 suffered from a severe arthritis, which made climbing difficult and led to 30 diminished appetite and weight loss. One monkey that suffered from severe arthritis had a slightly elevated body temperature up to 40 °C. Analyses on blood samples indicated increase in CRP, thrombocytosis, hypalbuminaemia and anaemia related to the presence of arthritis symptoms. A small 35 increase in LDH-levels was observed (table X).

PCT/NLOO/00133 — Histopathological analysis showed synovitis, moderate chronic pleuritis, necrotizing dermatitis, mild-chronic enteritis and inguinal and axillary lymphadenopathy in all monkeys. In order to analyse local inflammation induced by the procedure 5 of i.a. administration of Ad, non-injected, saline-injected and Ad-injected joints were compared by routine histopathological analysis. No significant differences were observed in synovial hyperplasia or lymphocyte infiltration. Toxicity of i.a. administration of Ad harbouring the suicide 10 crene TK.

During the TK-experiments, monkeys were closely observed to detect any toxicity of the procedure. The behaviour of the monkeys, clinical observations, biochemical parameters and histopathological analysis did only show abnormalities as has 15 been reported before in monkeys with CIA. No additional toxicity was seen in suicide gene treated groups as compared to reporter gene treated groups. Histopathological analysis revealed no differences except for multifocal mid-zonal and peripheral infiltrations with lymphocytes and plasma cells in 20 the liver of monkey 6 with single hepatocellular necrosis. Effectivity of suicide gene transfer to inflamed synovial tissue can be seen as local toxicity of the procedure. Histopathological analysis of the injected joint revealed no differences in synovial hyperplasia or lymphocyte 25 infiltration compared to control joints. Joint circumference diminished 1 cm in knees injected with IG.Ad.mlp-1 .TK followed by GCV and 1 to 1.5 cm in non-injected knees. In monkey 6, 7 and 8 who were terminated- 14 to 18 days after intra-articular injection, a turn in antibody titer from 30 negative to positive was observed after day 5-7. No viruses were cultured from the excreta.

WO 00/52186 PCT/NLOO/00133 56 EXAMPLE 6: Plasmid-based system for rapid RCA-free generation of recombinant adenoviral vectors.

Construction of adenovirus clones 1. pBr/Ad.Bam-rITR (ECACC deposit P97082122) In order to facilitate blunt end cloning of the ITR sequences, wild-type human adenovirus type 5 (Ad5) DNA was 10 treated with Klenow enzyme in the presence of excess dNTPs. After inactivation of the Klenow enzyme and purification by phenol/chloroform extraction followed by ethanol precipitation, the DNA was digested with BamHI. This DNA preparation was used without further purification in a 15 ligation reaction with pBr322 derived vector DNA prepared as follows: pBr322 DNA was digested with EcoRV and BamHI, dephosphorylated by treatment with TSAP enzyme (Life Technologies) and purified on LMP agarose gel (SeaPlaque GTG) . After transformation into competent E.coli DH5a (Life 20 Techn..) and analysis of ampiciline resistant colonies, one clone was selected that showed a digestion pattern as expected for an insert extending from the BamHI site in Ad5 to the right ITR.

Sequence analysis of the cloning border at the right ITR 25 revealed that the most 3' G residue of the ITR was missing, the remainder of the ITR was found to be correct. Said missing G residue is complemented by the other ITR during replication. 2. pBr/Ad.Sal-rlTR (ECACC deposit P97082119) pBr/Ad.Bam-rITR was digested with BamHI and Sail. The vector fragment including the adenovirus insert was isolated in LMP agarose (SeaPlaque GTG) and ligated to a 4.8 kb SalI-BamHI fragment obtained from wt Ad5 DNA and purified with the 35 Geneclean II kit (Bio 101, Inc.). One clone was chosen and the integrity of the Ad5 sequences was determined by PCT/NLOO/00133 — restriction enzyme analysis. Clone pBr/Ad.Sal-rITR contains adeno type 5 sequences from the Sail site at bp 16746 up to and including the rITR (missing the most 3' G residue). 3. PBr/Ad.Cla-Bam (ECACC deposit P97082117) wt Adeno type 5 DNA was digested with Clal and BamHI, and the 20.6 kb fragment was isolated from gel by electro-elution. pBr322 was digested with the same enzymes and purified from agarose gel by Geneclean. Both fragments were ligated and 10 transformed into competent DH5a. The resulting clone pBr/Ad.Cla-Bam was analysed by restriction enzyme digestion and shown to contain an insert with adenovirus sequences from bp 919 to 21566. 4. pBr/Ad.AfIII-Bam (ECACC deposit P97082114) Clone pBr/Ad.Cla-Bam was linearised with EcoRI (in pBr322) and partially digested with Aflll. After heat inactivation of Aflll for 20' at 65 °C the fragment ends were filled in with Klenow enzyme. The DNA was then ligated to a blunt double 20 stranded oligo linker containing a PacI site (5'- AATTGTCTTAATTAACCGCTTAA-3 ' ) . This linker was made by annealing the following two oligonucleotides: 5'-AATTGTCTTAATTAACCGC-3 1 and 5 '-AATTGCGGTTAATTAAGAC-3 ' , followed by blunting with Klenow enzyme. After precipitation 25 of the ligated DNA to change buffer, the ligations were digested with an excess PacI enzyme to remove concatameres of the oligo. The 22016 bp partial fragment containing Ad5 sequences from bp 3534 up to 21566 and the vector sequences, was isolated in LMP agarose (SeaPlaque GTG), religated and 30 transformed into competent DH5a. One clone that was found to contain the PacI site and that had retained the large adeno fragment was selected and sequenced at the 51 end to verify correct insertion of the PacI linker in the (lost) Aflll site.

WO 00/52186 PCT/NLOO/00133— 58 . pBr/Ad. Bam-rITRpac#2 (ECACC deposit P97082120) and pBr/Ad.Bam-rITR#8 (ECACC deposit P97082121) To allow insertion of a PacI site near the ITR of Ad5 in clone pBr/Ad.Bam-rITR about 190 nucleotides were removed 5 between the Clal site in the pBr322 backbone and the start of the ITR sequences. This was done as follows: pBr/Ad.Bam-rITR was digested with Clal and treated with nuclease Bal31 for varying lengths of time (2', 5', 10' and 15'). The extend of nucleotide removal was followed by separate reactions on 10 pBr322 DNA (also digested at the Clal site) , using identical buffers and conditions. Bal31 enzyme was inactivated by incubation at 75 °C for 10', the DNA was precipitated and resuspended in a smaller volume TE buffer. To ensure blunt ends, DNAs were further treated with T4 DNA polymerase in the 15 presence of excess dNTPs. After digestion of the (control) pBr322 DNA with Sail, satisfactory degradation ("150 bp) was observed in the samples treated for 10' or 151. The 10' or 15' treated pBr/Ad.Bam-rlTR samples were then ligated to the above described blunted PacI linkers (See pBr/Ad.Aflll-Bam). 20 Ligations were purified by precipitation, digested with excess PacI and separated from the linkers on an LMP agarose gel. After religation, DNAs were transformed into competent DH5a and colonies analysed. Ten clones were selected that showed a deletion of approximately the desired length and 25 these were further analysed by T-track sequencing (T7 sequencing kit, Pharmacia Biotech). Two clones were found with the PacI linker inserted just downstream of the rITR. After digestion with PacI, clone #2 has 2 8 bp and clone #8 has 27 bp attached to the ITR. pWE/Ad.Aflll-rITR (ECACC deposit P97082116) Cosmid vector pWE15 (Clontech) was used to clone larger Ad5 inserts. First, a linker containing a unique PacI site was inserted in the EcoRI sites of pWE15 creating pWE.pac. To 35 this.end, the double stranded PacI oligo as described for pBr/Ad.Aflll-BamHI was used but now with its EcoRI protruding PCT/NL00/00133 — 59 ends. The following fragments were then isolated by electro-elution from agarose gel: pWE.pac digested with PacI, pBr/AfIII-Bam digested with PacI and BamHI and pBr/Ad.Bam-rITR#2 digested with BamHI and PacI. These fragments were 5 ligated together" and packaged using X phage packaging extracts (Stratagene) according to the manufacturer's protocol. After infection into host bacteria, colonies were grown on plates and analysed for presence of the complete. insert. pWE/Ad.Aflll-rlTR contains all adenovirus type 5 10 sequences from bp 3534 (Aflll site) up to and including the right ITR (missing the most 3' G residue).

PWE/Ad.Af1II-EcoRI pWE.pac was digested with Clal and 5' protruding ends were 15 filled using Klenow enzyme. The DNA was then digested with PacI and isolated from agarose gel. pWE/Aflll-rlTR was digested with EcoRI and after treatment with Klenow enzyme digested with PacI. The large 24 kb fragment containing the adenoviral sequences was isolated from agarose gel and 20 ligated to the Clal-digested and blunted pWE.pac vector using the Ligation Expresstm kit from Clontech. After transformation of Ultracompetent XLIO-Gold cells from Stratagene, clones were identified that contained the expected insert. pWE/Af111-EcoRI contains Ad5 sequences from 25 bp 3534-27336.

Generation of adapter plasmids and recombinant adenoviruses.

Generation of the adapter plasmid pMLPI.TK 30 Adapter plasmid pMLPTK (patent application EP 952 02213) was modified as follows: SV4 0 polyA sequences were amplified with primer SV40-1 (introduces a BamHI site) and SV40-2 (introduces a Bglll site). In addition, Ad5 sequences present in this construct (from nt. 2496 to nt. 2779; Ad5 sequences 35 nt. 3511 to 3794) were amplified with primers Ad5-1 (introduces a Bglll site) and Ad5-2.

PCT/NLOO/00133 60 S V4 0 -1: 5 ' - GGGGGATCCGAACTTGTTTATTGCAGC - 3 ' S V4 0 - 2 : 5 ' - GGGAGATCTAGACATGATAAGATAC - 3 ' Ad5 -1: 5 1 - GGGAGATCTGTACTGAAATGTGTGGGC - 3 ' Ad5 - 2 : 5 1 - GGAGGCTGCAGTCTCCAACGGCGT - 3 ' Both PCR fragments were digested with Bglll and ligated. The ligation product was amplified with primers SV40-1 and Ad5-2 and digested with BamHI and Aflll. The digested fragment was then ligated into pMLP.TK predigested with the same enzymes. 10 The resulting construct, named pMLPI.TK, contains a deletion in adenovirus El sequences from nt. 459 to nt. 3510.

Generation of pAd5/L420.HSA, pAd5/Clip and pAd5/Clipsal pMLPI.TK was used to make a new vector in which nucleic acid 15 molecules comprising specific promoter and gene sequences can be easily exchanged.

First, a PCR fragment was generated from pZipAMo+PyFlOl(N~) template DNA (described in PCT/NL96/00195) with the following primers: LTR-1: 5'-CTG TAC GTA CCA GTG CAC TGG CCT AGG CAT 2 0 GGA AAA ATA CAT AAC TG-3 1 and LTR-2 : 5 1 -GCG GAT CCT TCG AAC CAT GGT AAG CTT GGT ACC GCT AGC GTT AAC CGG GCG ACT CAG TCA ATC G-3'. Pwo DNA polymerase (Boehringer Mannheim) was used according to manufacturers protocol with the following temperature cycles: once 51 at 95°C; 3' at 55°C; and I1 at 25 72°C, and 30 cycles of 1' at 95°C, 1' at 60°C, 1' at 72°C, followed by once 10' at 72°C. The PCR product was then digested with BamHI and ligated into pMLPIO (Levrero et al. , 1991; Gene 101, 195-202) digested with PvuII and BamHI, thereby generating vector pLTRlO. This vector contains 30 adenoviral sequences from bp 1 up to bp 454 followed by a promoter consisting of a part of the Mo-MuLV LTR having its wild-type enhancer sequences replaced by the enhancer from a mutant polyoma virus (PyFlOl) . The promoter fragment was designated L420. Sequencing confirmed correct amplification 35 of the LTR fragment however the most 5' bases in the PCR fragment were missing so that the PvuII site was not WO 00/52186 PCT/NL00/00133— 61 restored. Next, the coding region of the murine HSA gene was inserted. pLTRlO was digested with BstBI followed by Klenow treatment and digestion with Ncol. The HSA gene was obtained by PCR amplification on pUC18-HSA (Kay et al., 1990; J.

Immunol. 145, 1952-1959) using the following primers: HSA1, 5'-GCG CCA CCA TGG GCA GAG CGA TGG TGG C-3 ' and HSA2, 5 ' -GTT AGA TCT AAG CTT GTC GAC ATC GAT CTA CTA ACA GTA GAG ATG TAG AA-3'. The 269 bp amplified fragment was subcloned in a shuttle vector using the Ncol and Bglll sites. Sequencing 10 confirmed incorporation of the correct coding sequence of the HSA gene, but with an extra TAG insertion directly following the TAG stop codon. The coding region of the HSA gene, including the TAG duplication was then excised as a Ncol(sticky)-Sail(blunt) fragment and cloned into the 3.5 kb 15 Ncol(sticky)/BstBI(blunt) fragment from pLTRlO, resulting in pLTR-HSAlO.

Finally, pLTR-HSAlO was digested with EcoRI and BamHI after which the fragment containing the left ITR, packaging signal, L420 promoter and HSA gene was inserted into vector pMLPI.TK 20 digested with the same enzymes and thereby replacing the promoter and gene sequences. This resulted in the new adapter plasmid pAd5/L42 0-HSA that contains convenient recognition sites for various restriction enzymes around the promoter and gene sequences. SnaBI and Avrll can be combined with Hpal, 25 Nhel, Kpnl, Hindlll to exchange promoter sequences, while the latter sites can be combined with the Clal or BamHI sites 3 ' from HSA coding region to replace genes in this construct.

Another adapter plasmid that was designed to allow easy exchange of nucleic acid molecules was made by replacing the 30 promoter, gene and polyA sequences in pAd5/L420-HSA with the CMV promoter, a multiple cloning site, an intron and a polyA signal. For this purpose, pAd5/L420-HSA was digested with Avrll and Bglll followed by treatment with Klenow to obtain blunt ends. The 5.1 kb fragment with pBr322 vector and 35 adenoviral sequences was isolated and ligated to a blunt 1570 bp fragment from pcDNAl/amp (Invitrogen) obtained by PCT/NLOO/0O133 ~ 62 digestion with Hhal and Avrll followed by treatment with T4 DNA polymerase. This adapter plasmid was named pAd5/Clip. To enable removal of vector sequences from the adenoviral fragment pAd5/Clip was partially digested with EcoRI and the 5 linear fragment was isolated. An oligo of the sequence 5' TTAAGTCGAC-31 was annealed to itself resulting in a linker with a Sail site and EcoRI overhang. The linker was ligated to the partially digested pAd5/Clip vector and clones were selected that had the linker inserted in the EcoRI site 23 bp 1.0 upstream of the left adenovirus ITR in pAd5/Clip resulting in pAd5/Clipsal.

Generation of pAd5ClipLacZ, pAd5Clip.Luc, pAd5Clip.TK and pAd5Clipsal.Luc The adapter plasmid pAd5/Clip.LacZ was generated as follows: The E.coli LacZ gene was amplified from the plasmid pMLP.nlsLacZ (EP 95-202 213) by PCR with the primers 5'GGGGTGGCCAGGGTACCTCTAGGCTTTTGCAA and 5 ' GGGGGGATCCATAAACAAGTTCAGAATCC. The PCR reaction was 2 0 performed Ex Taq (Takara) according to the suppliers protocol at the following amplification program: 5 minutes 94°C, 1 cycle; 45 seconds 94°C and 3 0 seconds 60°C and 2 minutes 72°C, 5 cycles; 45 seconds 94°C and 3 0 seconds 65°C and 2 minutes 72°C, 25 cycles; 10 minutes 72; 45 seconds 94°C and 30 seconds 60°C and 2 minutes 72°C, 5 cycles, I cycle. The PCR product was subsequently digested with Kpnl and BamHI and the digested DNA fragment was ligated into Kpnl/BamHI digested • pcDNA3 (Invitrogen) , giving rise to pcDNA3 .nlsLacZ. Next, the plasmid pAd5/Clip was digested with Spel. The large fragment 3 0 containing part of the 5' part CMV promoter and the adenoviral sequences was isolated. The plasmid pcDNA3.nlsLacZ was digested with Spel and the fragment containing the 3'part of the CMV promoter and the lacZ gene was isolated. Subsequently, the fragments were ligated, giving rise to pAd/Clip.LacZ. The reconstitution of the CMV promoter was confirmed by restriction digestion.

PCT/NL00/00133— The adapter plasmid pAd5/Clip.Luc was generated as follows: The plasmid pCMV.Luc (EP 95-202 213) was digested with Hindlll and BamHI. The DNA fragment containing the luciferase gene was isolated. The adapter plasmid pAd5/Clip 5 was digested with Hindlll and BamHI, and the large fragment was isolated. Next, the isolated DNA fragments were ligated, giving rise to pAd5/Clip. Luc. The adapter pClipsal.Luc was generated in the same way but using the adapter pClipsal digested with HIII and BamHI as vector fragment. Likewise, 10 the TK containing HIII-BamHI fragment from pCMV.TK (EP 95-202 213) was inserted.in pClipsal to generate pAd5/Clip.TK. The presence of the Sail site just upstream of the left ITR enables liberation of vector sequences from the adeno insert. Removal of these vector sequences enhances frequency of 15 vector generation during homologous recombination in PER.C6.

Generation of pWE/Ad.Aflll-rlTRfib!6 To enable convenient generation of recombinant adenoviruses with a Ad5/Adl6 chimeric fiber we cloned the 20 chimeric fiber gene in the place of the Ad5 fiber in the cosmid clone pWE/Ad.Aflll-rITR. The pBr/AdBamRpac.fibl6 constructs and the pBr/Ad.Aflll-BamHI construct were digested with BamHI and PacI to free it from the pBr plasmid. They were isolated from gel and cleaned by using agarase 25 (Boehringer) . The pWE.pac construct was digested with PacI to linearize it and cleaned by phenol/ chloroform. A three-point ligation was used in which the BamHI sites of the pBr/AdBamRpac . fibl6 constructs and the pBr/Ad. Aflll-BamHI construct are ligated together and the pWE.pac construct is 30 ligated at the PacI sites. The ligation mix consists out of the three constructs, T4 ligase, 5mM ATP and ligation buffer without PEG. 1-4 pi of the ligation mixture, containing 0.1-1.0 jog of ligated DNA, is added to the packaging extract. Separately, 1 pi of the positive wild-type lambda DNA control 35 was packaged. The tubes were spinned quickly and incubated at RT for maximum 2 hrs. Respectively 500 pi SM buffer (5.8 g PCT/NLOO/00133— 64 NaCl, 2.0 g MgS04"7H20, 50 ml 1M Tris-HCl (PH 7.5), 5 ml 2% (w/v) gelatine and deionised water up to 1 litre) and 2 0 pi of chloroform was added to the packaging mixture to stop the reaction. The tube was spinned briefly to sediment the 5 debris. The supernatant, which contains the phage, can now be stored at 4°C up to 1 month.

A bacterial glycerol stock of DH5a strain and VCS257 strain were streaked onto LB agar plates and incubated 0/N at 37°C. The next day 10 ml LB medium supplemented with 10 mM 10 MgS04 and 0.2% (w/v) maltose was inoculated with a single colony of each bacteria strain. This was grown at- 37°C until an OD600 value of maximum 1.0 is reached. The bacteria were then pelleted at 500 x g for 10 minutes. The pellet is resuspended into 5 ml of sterile 10 mM MgS04 and diluted in 15 10 mM MgS04 till an OD600 value of approximately 0.5 is reached.

Of the positive wild-type lambda phage control a 10~2 and a 10~4 dilution was made in SM buffer. Of the other final packaged reactions a 10 1 and a 10'2 dilution was made in SM 20 buffer. Out of the 10"4 dilution of the positive control 10 pi was added to 200 pi of VCS257 host cells (OD600 0 . 5). This is incubated for 15 minutes at 37°C, 3 ml of LB top agar (0.7% agarose in LB medium) (50°C) is added and immediately plated on a prewarmed LB agar plate. Out of the 10"1 and a 10"2 25 dilution of the other final packaged reactions 25 pi was added to 25pl of DH5a host cells (OD600 0 . 5) . This is incubated for 30 minutes at RT. Respectively 200 pi LB medium is added and an incubation for 1 hr at 37°C followed. The mixture is spinned down shortly, the bacteria pellet is 3 0 resuspended in 100 pi LB medium and plated on LB agar plates with the required amount of ampicillin. The plates are incubated O/N at 37°C. Eventually the colonies are grown and the required DNA is tested by restriction digestion. pWE/Ad .Aflll -rITRf ibl6 contains all adenovirus type 5 35 sequences except for the fiber coding region 3 ' from the Ndel site present in Ad5 fiber, these sequences are replaced by WO 00/52186 PCT/NLOO/OOL33—: 65 fiber sequences from Adl6 leaving the open reading frame intact.

Generation of recombinant viruses with fiber modifications 5 The adapter plasmids pAd5/Clip.TK, pAd5/Clip.LacZ or pAd5/Clip.Luc were digested with Sail to liberate the homologous adenovirus sequences and the left ITR from the vector. pWE/Ad.Af111-rITRfibl6 was digested with PacI. DNA was then purified using phenol/chloroform extraction and EtOH 10 precipitation and redissolved in sterile transfection qualified water. Four /igr of each construct was transfected into PER.C6 cells in a T25 flask seeded one day before with 2.5xl06 cells. At the occurrence of full CPE 6-8 days later cells were harvested in the medium and amplified by infection 15 of 3 ml 3x freeze-thawed cell lysate on fresh PER.C6 cells. At full CPE cells were harvested by freeze-thawing and virus was purified by two rounds of plaque purification on PER.C6 cells. In all cases plaques were positive for transgene expression and one was picked to generate seed stocks for 20 production.

Example 7 Infection of synoviocytes with recombinant adenoviral vectors in non-human primates suffering from collagen induced 25 arthritis.

The transducibility of arthritic synovium by chimeric adenoviruses carrying the LacZ gene from E.coli, which codes for the enzyme p-galactosidase, was tested in vivo in a non-human primate model for RA. The rhesus monkey Maccaca mulatta 30 was injected 10 times subcutaneously with, in total, 5 mg Bovine Collagen type II (10 mg/ml) emulsified in an equal volume of Complete Freunds Adjuvant. The animal developed a full blown collagen induced arthritis (CIA) within a period of 8 weeks. Subsequently, the left knee was injected intra-35 articularly with l*10n virus particles (vp) IG.Ad.CLIP.LacZ. The right knee was injected with 1*10" vp WO 00/52186 PCT/NLOO/00133 Tr ee IG.Ad.ClipLacZ.fibl6. The vectors were administered in a total volume of 1 ml diluens {PBS supplemented with 5% sucrose) . The site of entry was medially, just below the midpoint of the patella. The needle was introduced in a line 5 towards the suprapatellar pouch. After passing the joint capsule, the vector was injected into the joint cavity. Thereafter, the syringe and needle were removed from the joint. At day 3 post infection, the animal was sacrificed. The left elbow was injected with 1 ml diluens only and served 10 as a negative control. The right elbow was left untreated. The knee joints and elbows were isolated and fixed in phosphate buffered 2% paraformaldehyde/0.25% glutaraldehyde for 3 hours and washed 3 times with PBS, incubated over night in X-Gal solution (5 mM K4Fe(CN)6, 5mM K3Fe(CN)6, 2mM MgCl2 and 15 0.5 mg/ml 5-bromo-4-chloro-3-indolyl-8-D-galactopyranoside) and extensively washed with PBS. The hyperplastic synovial lining of the knee joint stained blue with IG.Ad. CLIP.LacZ. However, the knee IG.Ad.ClipLacZ.fibie injected with stained blue more intensely, showing that recombinant chimeric 20 adenoviruses carrying the fiber of Adie infects hyperplastic synovium more efficiently than recombinant adenoviruses carrying fiber of Ad5. Detailed analysis of the transduced tissue confirmed that the number of positive nuclei in the pannus tissue of the IG.Ad.ClipLacZ.fibl6 treated joint was 25 significantly higher than the number of positive nuclei found in the IG.Ad.CLIP.LacZ treated joints. Stained nuclei were found several cell layers deep in the pannus tissue. No staining was found in chondrocytes of the cartilage layer or in the diluens or non-injected injected joint. These results 3 0 show that hyperplastic synovium can be transduced more efficiently with chimeric recombinant IG .Ad. ClipLacZ.fibl6 vectors in vivo, as compared to'IG.Ad.CLIP.LacZ vectors. Moreover, the results show that the diseased tissue (hyperplastic synovium) , but not the chondrocytes (benign 35 cells that are required for cartilage regeneration) were at PCT/NLOO/OOL33— 67 least preferably transduced by the recombinant adenoviral vectors.

Example 8 Dose dependent transduction of synoviocytes with recombinant adenoviral vectors in non-human primates suffering from collagen induced arthritis.

The transducibility of arthritic synovium by chimeric adenoviruses carrying the LacZ gene was tested in a dose 10 escalation study in vivo in the non-human primate model for RA as described above. A monkey suffering from CIA was treated with increasing doses of IG.Ad.CLIP.LacZ or IG.Ad.ClipLacZ.fibl6 given intra-articularly in the proximal interphalangeal (pip) in a total volume of 0.1 ml. Pip 2 to 5 15 were injected with increasing vector doses, ranging from IxlO7 to lxlO10 vp, in the left or right hand, for IG.Ad.CLIP.LacZ or IG.Ad.ClipLacZ.fibl6 respectively. As a control, 0.1 ml diluens was injected in pip 1 of both hands. After sacrifice on day 5, the pip joints of the hands were 20 fixed in 2% paraformaldehyde / 0.25 % and stained with X-GAL to monitor lacZ expression, as described above. A positive correlation was observed between injected dose of LacZ Adenoviruses and the number of lacZ expressing cells in the synovial tissue. Moreover, the IG.Ad.ClipLacZ.fibl6 vector 25 treated joints contained more LacZ positive cells than the IG.Ad.CLIP.LacZ treated joints at the same vector dose, confirming that hyperplastic synovium is transduced more efficiently by chimeric recombinant IG.Ad.ClipLacZ.fibl6 vectors than by IG.Ad.CLIP.LacZ vectors in a relevant model 30 for rheumatoid arthritis. Microscopy of the injected joints confirmed that the cells expressing lacZ activity were synoviocytes, as evidenced by typical location and morphologic appearance.

PCT/NL00/00133 — 68 Example 9 Killing of diseased synovium from patients suffering from RA infected with IG.Ad.CLIP.TK and IG.Ad.CLIP.TK.fibl6 followed by treatment with Ganciclovir in vitro. • 5 Synovium was isolated from patients suffering from RA as discussed above. The day prior to infection, 104 synovium cells were plated on a tissue culture dish. The next day, eight dishes with synovial cells were infected with either IG.Ad.CLIP.TK or IG.Ad. CLIP.TK.fibl6 at an increasing m.o.i. 10 of 1, 10, 100 and 1000 vp/cell or mock treated. Four hours post infection, the infection medium was replaced by IMDM containing 4 0% normal human serum supplemented with or without 10 pg/ml Ganciclovir. At day 0, 5, 7 and 10 cells were counted. IG.Ad.CLIP.TK.fib infected cells were killed in 15 medium containing Ganciclovir more efficiently, especially at lower m.o.i.'s, than IG.Ad.CLIP.TK infected cells, as determined by the decrease in the total cell numbers in these dishes. Neither the mock treated cells, nor the infected cells in medium without Ganciclovir were killed, showing that 20 killing was caused by the combination of Ad.TK vectors and Ganciclovir. Thus hyperplastic synovium from patients suffering from RA is sensitive to infection with recombinant IG.Ad vectors expressing TK in combination with treatment with the pro-drug Ganciclovir. Moreover, killing of 25 synoviocytes following IG.Ad.CLIP.TK. fibl6 infection was more efficient than killing after IG.Ad.CLIP.TK infection in the presence of Ganciclovir.

Next, the bystander effect of -the treatment was addressed. To that end, synovial cells were infected with 30 IG.Ad.CLIP.TK at an M.O.I, of 100 as described above. The next day, the infected cells were trypsinized and mixed v/ith non-infected synovial cells from the same patient at the ratio of 1:4 (25%) or 1:2 (50%). As controls, non-infected (0%) and non-mixed (100%) cells were included in the 35 experiment. The following 7 days, the cells were cultured in IMDM supplemented with 40% normal human serum and lOpg/ml PCT/NL00/D0133— 69 Ganciclovir and the total amount of cells per dish was determined. The synovial cells infected (100%) with IG.Ad.CLIP.TK were killed. Moreover, the mixed cell populations in which only a percentage of the cells (50% and 5 25% respectively) was infected with IG.Ad.CLIP.TK were killed too. This shows that human synovium cells that are infected with recombinant IG.Ad vectors expressing the TK gene have a substantial bystander effect following GCV treatment.

Example 10 Killing of hyperplastic synovium after intra-articular injection of IG.Ad.CLIP.TK and IG.Ad.CLIP.TK.fibl6 followed by Ganciclovir treatment in non-human primates suffering from collagen induced arthritis.

A rhesus monkey was injected 10 times subcutaneously with, in total, 5 mg Bovine Collagen type II (10 mg/ml) emulsified in an equal volume of Complete Freunds Adjuvant to induce CIA. The animal developed a full-blown arthritis within a period of 8 weeks. Subsequently, the left knee was injected intra-20 articularly with IxlO11 vp IG.Ad. CLIP.TK in a total volume of 1 ml diluens. The right knee was injected with IxlO11 vp IG.Ad.CLIP.TK. fibl6 in a total volume of 1 ml diluens. The sites of entry were medially, just below the midpoint of the patella. The needle was introduced in a line towards the 25 Suprapatellar pouch. After the joint capsule was passed, the substances were injected into the knee joint. Thereafter, syringes and needles were removed from the joints. The left elbow was injected with 1 ml diluens and served as a negative control. From day 2 to day 15 the monkey was treated daily 30 intravenously with Ganciclovir, 10 mg/kg/day in 25 ml sterile water given in approximately 30 minutes. After sacrifice on day 18 the knees and elbows of the monkey were taken out for histopathological analysis. Synovial biopsies of the knees were snap-frozen in liquid nitrogen and stored at < - 60 °C. 35 Cleaving of genomic DNA during apoptosis yields double- stranded low molecular weight nuclear DNA fragments (mono- 70 PCT/NLOO/00133— •* and oligonucleosomes) as well as single strand breaks ("nicks") in high molecular weight DNA. TUNEL (TdT-mediated dUTP nick end labeling) is a method for enzymatic in situ labeling of apoptosis induced DNA strand breaks. Strand 5 breaks in the DNA can be identified by labeling the free 3'-OH termini of DNA fragments with modified nucleotides in an enzymatic reaction. Terminal deoxynucleotidyl transferase (TdT), which catalyses polymerization of nucleotides to the free 3 1 -OH termini of fragmented DNA, is used as the 10 polymerase. Incorporated fluorescein-12-dUTP is detected by anti-fluorescein antibody Fab fragments from sheep, conjugated with horseradish peroxidase (POD). The procedure is extensively described by the supplier (Promega). After substrate reaction, the labelled fragmented genomic DNA were 15 visualised under the light microscope.

The synovial tissue from the elbow that was injected with diluens showed background tissue staining, indicating that some apoptosis has taken place in diseased synovium. In the negative control (no TdT enzyme was added) no staining 20 could be observed. The positive control (a sample that was treated with DNase to induce DNA strand breaks before the TUNEL assay was started) showed staining in all parts of the tissue. The sample from the IG.Ad. CLIP. TK injected joint showed more stained cells than the synovial tissue sample of 25 the diluens treated joint, indicating that more cells went into apoptosis due to the IG.Ad.CLIP.TK-GCV treatment. Most stained cells were found in the joint injected with IG.Ad. CLIP. TK. fibl6 . The staining was present both in the synovial membrane and in the subsynovial tissue, suggesting 30 that the treatment is efficacious throughout the whole tissue sample. These data show that treatment with recAd vectors expressing the TK gene followed by GCV treatment is a feasible method to perform non-surgical synovectomy in arthritic joints. In addition, these data show that 35 recombinant adenoviral vectors containing fiber 16 are superior in transducing transgenes to synovial tissue.

PCT/NL00/00133 — 71 Example 11 Comparison of infection of Ad5.1uc and Ad5 . fibl6.luc on RA 5 synoviocytes In each experiment, a total of 15,000 RA synoviocytes was seeded per well in 12-well microtiter dishes. Cells were infected with Ad5.1uc (batch nr. IC020-032) or Ad5.fibl6.luc 10 (batch nr. B204-130C) at various m.o.i.'s, and incubated overnight. Luciferase activity was measured after 72 hrs.

Data are summarized in table XIII; the graphic representation is in Figure 14.

Example 12 Comparison of infection of Ad5.1acZ and Ad5.fibl6.lacZ on RA synoviocytes In each experiment, a total of 15,000 RA synoviocytes was seeded per well in 12-well microtiter dishes. Cells were infected with Ad5.1acZ (batch nr. B269-186) or Ad5.fibl6.lacZ (batch nrs. B204-120A and B204-120B) at various m.o.i.'s, and incubated overnight. % of lacZ-positive cells was determined 25 after 72 hrs. Data are summarized in table XIV; the graphic representation is in Figures .15.

Example 13 3 0 Comparison of infection of Ad5.GFP and Ad5.fibl6.GFP on RA synoviocytes In each experiment, a total of 15,000 RA synoviocytes was seeded per well in 12-well microtiter dishes. Cells were 35 infected with Ad5.GFP (batch nr. B204-103 and B204-130D) or Ad5.fibl6.GFP (batch nrs. B204-103 and IC054-024B) at various PCT/NLOO/OOU3— 72 m.o.i.'s, and incubated overnight. GFP activity was measured after 72 hrs, and % of GFP-positive cells was determined.

Data are summarized in tables XVa and XVb; the graphic representation is in Figures 16A and B.

Example 14 Comparison of infection of panel of fiber-modified viruses on RA synoviocytes A panel of chimeric adenoviruses was tested for its infectivity on RA synoviocytes. The following chimeric adenoviruses were produced : Ad5.fib5,11,16,24,28,33,35,45 and 47, each carrying a luciferase transgene. In each 15 experiment, a total of 15,000 RA synoviocytes was seeded per well in 12-well microtiter dishes. Cells were infected the chimeric adenoviruses at various m.o.i.'s, and incubated overnight. Luciferase activity was measured after 72 hrs.

Data are summarized in table XVI; the graphic representation 20 is in Figure 17.

Example 15 Comparison of infection of three B-type fiber-modified 25 viruses on RA synoviocytes Three chimeric adenoviruses, each carrying, a B-type fiber were tested for its infectivity on RA synoviocytes, in comparison to Ad5. The following chimeric adenoviruses were 30 produced : Ad5.fibl6,35 and 51, each carrying a GFP transgene. In each experiment, a total of 50,000 RA synoviocytes was seeded per well in 12-well microtiter dishes. Cells were infected the chimeric adenoviruses at various m.o.i.'s , and incubated overnight. GFP activity was 35 measured after 72 hrs, and % of GFP-positive cells was PCT/NL00/00133 — 73 determined. Data are summarized in tables XVIIa and b; the graphic representation is in Figures 18a and b.

Example 16 Comparison of infection of three B-type fiber-modified viruses on RA synoviocytes Three chimeric adenoviruses, each carrying a B-type fiber 10 were tested for its infectivity on RA synoviocytes, in comparison to Ad5. The following chimeric adenoviruses were produced : Ad5.fibll,16 and 35, each carrying a luciferase transgene. In each experiment, a total of 15,000 RA synoviocytes was seeded per well in 12-well microtiter 15 dishes. Cells were infected the chimeric adenoviruses at various m.o.i.'s , and incubated overnight. Luciferase activity was measured after 72 hrs. Data are summarized in table XVIII; the graphic representation is in Figure 19.

Example 17 Comparison of infection of RA synoviocytes with Ad5 and Ad5.fibl6 in different patients Synoviocyte cells were obtained from 6 different patients 25 suffering from rheumatoid arthritis. Synoviocytes were infected with Ad5.1acZ or Ad5.fibl6.lacZ during 2 or 20 hours, and stained for lacZ expression after 48 hours.

Numbers of blue cells were counted under the microscope. Data are summarized in table XIX, plotted in Figure 20.

PCT/NLOO/OOL33—: 74 BRIEF DESCRIPTION OF DRAWINGS Figure 1: Schematic drawing of the pBr/Ad.Bam-rITR construct. Figure 2: Schematic drawing of the strategy used to delete the 5 fiber gene from the pBr/Ad.Bam-rITR construct.

Figure 3: Schematic drawing of construct pBr/Ad.BamRAfib.

Figure 4: Sequence chimaeric fiber Ad5/16.

Figure 5: Schematic drawing of the construct pClipsal-Luc.

Figure 6: Schematic drawing of the method to generate chimaeric adenoviruses using three overlapping fragments. Early (E) and late regions (L) are indicated. L5 is the fiber coding sequence.

Figure 7: Sequences including the gene encoding adenovirus 16 fiber protein as published in Genbank and sequences including a gene encoding a fiber from an adenovirus 16 variant as isolated in the present invention, wherein the sequences of the fiber protein are from the Ndel-site. Figure 7A nucleotide sequence comparison. Figure 7B amino-acid comparison.

Figure 8 : Infection of synoviocytes using different amounts 20 of virus particles per cell (MOI) and two different adenoviruses: Ad5=Ad5.Clip.Luc; Ad5/16= Ad5.Luc-fibl6 .

Luciferase transgene expression, 48 hours after a 2 hours infection procedure is depicted as relative light units (=RLU) per microgram whole cell lysate. Error bars represent 25 standard error of the mean (SEM).

Figure 9: Infection of synoviocytes using different concentrations of cells. Luciferase transgene expression, 4 8 hours after a 2 hours infection procedure is depicted as relative light units (=RLU) per microgram total protein.

Error bars represent SEM. The actual MOI differed between the cell concentrations and ranged from 20.000 virus particles per cell (cell density 12.500) to 2.500 virus particles per cell (cell density 100.000).

Figure 10: Infection of synoviocytes using different virus 35 exposure periods. Luciferase transgene expression, 48 hours PCT/NLOO/00133— after either a 2 hours or a 20 hours virus exposure is depicted as relative light units (=RLU) per microgram protein. Error bars represent standard deviations.

Figure 11: Synoviocytes were incubated with IG.Ad.CMV.TK or 5 IG.Ad.mlp-1. TK. Cells were cultured with or without GCV. Figure 12: Bystander killing was assessed in cultures containing both TK-infected and non-TK-infected synoviocytes in a proportion 0/100, 50/50, 25/75 and 0/100. Cells were cultured with or without GCV.

Figure 13 A + B: X-gal expression in synovial tissue 3 days after intra-articular injection of IG.Ad. CMV. lacZ in the knee. 13A: macroscopy. 13B: direct LacZ staining of synovial tissue counterstained with Mayers Hamalanlosung.

Figure 14: Comparison of infection of Ad5. luc and 15 Ad5 . fibl6 . luc on RA synoviocytes Figure 15 % lacZ positive cells with Ad5.1acZ and Ad5.fibl6.lacZ in RA synoviocytes Figure 16A Infection efficiency of Ad5.GFP and Ad5fibl6.GFP in RA synoviocytes 20 Figure 16B GFP production in RA synoviocytes infected with Ad5.GFP vs. Ad5fibl6.GFP Figure 17 Infectivity of panel of chimeric adenoviruses on RA synoviocytes Figure 18A % of infected cells with three B-type fiber-25 modified viruses on RA synoviocytes Figure 18B: GFP production with three B-type fiber-modified viruses on RA synoviocytes Figure 19 Comparison of three B-type fiber modified adenoviruses for infectivity on RA synoviocytes 30 Figure 20: Comparison of infectivity Ad5.1acZ vs.

Ad5.fibl6.lac6 in RA synoviocytes from 6 different patients PCT/NL00/Q0133 r 76 TABLES Table I: Oligonucleotides and degenerate oligonucleotides used for the amplification of DNA encoding fiber protein derived from alternative adenovirus serotypes. (Bold letters represent Ndel restriction site (A-E), Nsil restriction site (1-7, 8), or PacI restriction site (7) .

Serotype Tail oligonucleotide Knob oligonucleotide 4 8 9 12 16 19p 28 32 36 37 40-1 40-2 41-s 41-1 49 50 51 A B B E C B B B B B D D D D B B C 1 2 2 3 4 2 2 2 2 2 6 5 7 2 2 8 A: ' - CCC GTG TAT CCA TAT GAT GCA GAC AAC GAC CGA CC- 3 ' B: ' - ccc GTC TAC CCA TAT GGC TAC GCG CGG- 3' C: ' - CCK GTS TAC CCA TAT GAA GAT GAA AGC- - 3' D: ' - ccc GTC TAC CCA TAT GAC ACC TYC TCA ACT C- 3 / E: ' - ccc GTT TAC CCA TAT GAC CCA TTT GAC ACA TCA GAC- 3' 1: ' ' - CCG ATG CAT TTA TTG TTG GGC TAT ATA GGA - 3 / 2 : ' - CCG ATG CAT TYA TTC TTG GGC RAT ATA GGA - 3' 3 : ' - CCG ATG CAT TTA TTC TTG GGR AAT GTA WGA AAA GGA - 3 4 : ' - CCG ATG CAT TCA GTC ATC TTC TCT GAT ATA - 3' : ' - CCG ATG CAT TTA TTG TTC AGT TAT GTA GCA - 3' 6: ' - GCC ATG CAT TTA TTG TTC TGT TAC ATA AGA - 3' 7 : ' - CCG TTA ATT AAG CCC TTA TTG TTC TGT TAC ATA AGA A 8: ' - CCG ATG CAT TCA GTC ATC YTC TWT AAT ATA - 3' 77 PCT/NL00/00133 r Table II: Biodistribution of chimaeric adenovirus upon intravenous tail vein injection. Values represent luciferase activity-expressed as relative light units/jog protein. Values in the brain are considered background.

Organ Ad5.Clip.Luc Ad5.Luc-fibl6 Liver 740045 8844 Spleen 105432 3442 Lung 428 334 Kidney 254 190 Heart 474 276 Brain 291 294 78 Table III: Expression of CAR and integrins on the cell surface of synoviocytes. Values represent percentages of cells that express CAR or either one of the integrins at levels above background. Synoviocytes incubated only with the 5 secondary, rat-anti-mouse IgGl-PE labelled antibody served as a background control.

Cells ctJ33 avp5 CAR synoviocytes 27.2% .4% 0% PER.C6 7.8% 16.8% 99.6% Table IV: Determination of transgene expression (luciferase activity) per pg of total cellular protein after infection of A549 cells MOI (VP/Cell) Control Ad5 Fiber 16 0 0 0 1025 661 1982 1704 ' 4840 3274 100 21875 13432 500 203834 93163 Table V: Determination of transgene expression (luciferase activity) per jig of total cellular protein after infection of PER.C6 cells Virus particles/ ml Control Ad5 Ad5fiberl6 24800 9300 Table VI: Summary of rhesus monkeys experiments. monkey name date of birlh sex weight (kg) virus dose (pfu's) joint sacrifice (day) blood sampling (day) excreta (day) 1: BB 112 01-01-93 M 3.000 IG.Ad.CMV.lacZ IG.Ad.CMV.luc x 10' 1 x 10' knee L knee L 2 0 - 2: 9163 -09-91 F 3.900 IG.Ad.CMV.lacZ IG.Ad.CMV.luc x 10' 1 x 10' knee L knee L 2 0 - 3: 9179 19-12-91 F 3.500 IG.Ad.CMV.lacZ IG.Ad.mlp.lacZ IG.Ad.CMV.luc x 10s 1.5 x 10' 1 x 10s pip 4 R F pip 2 LH pip 2 LH, 4 RF 2 . . 0 - 4: 0 079 01-12-93 F 2.600 IG.Ad.CMV.lacZ IG.Ad.CMV.luc 3.2 x 105-9 2.2 x 1 ()■'" pip 2,3,4,5 FF + HH and knee I.+R pip 2,3,4,5 IT <- HH and knee L+R ** 3 -3,0,3 : 94074 05-09-94 F 2.900 IG.Ad.mlp.lacZ lG.Ad.mlp.Iuc 1 x 106"10 1 xlO10 pip 2,3,4,5 LH+RH and knee L knee R 3 -7,0,1,2,3 -7,0,1,2,3 6: Z02 01-01-92 F 4.900 IG.Ad.CMV.luc IG.Ad.mlp-I.TK 1 x 10® 1 x 10" knee L+R knee L+R 0,3,7,15 0,15 7: 94044 M 2.600 IG.Ad.mlp-I.TK. .8 x 1010 knee L 18 -7,0,2,7, 10,14,18 -7,0,1,2, 3,4,5 8: 94048 M 2.850 IG.Ad.mlp-I.TK .8 x 10'° knee L 18 -7,0,2,7, 10,14,18 -7,0,1,2, 3,4,5 M = male, F = female; LH = left hand, RF = right foot, HH = both hands, FF = both feet; ** = in all joint on left side 10 % triamcinolonhexacetonide 20 mg/ml is added. r O O & o Table VII: Survival of synoviocytes after infection with modified Ad. Negative controls were ^ O carried out in duplos in 3 of 5 experiments. © patient number of cells t = 0 (x 1000) experiment cell count on day neg. control (cells x 1000) CMV MOI 100 (cells x 1000) mlp MOI 100 (cells x 1000) RA-l-a 200 IG.Ad.lacZ 2 76 187 201 RA-l-b 100 IG.Ad.lacZ 2 90 - 160 118 194 RA-2 100 IG.Ad.lacZ 2 76 56 56 RA-3-a !00 IG.Ad.luc 3 42 - 38 49 38 RA-3-b 100 IG.Ad.luc 3 - 31 31 52 CO o Table VIII: Lac Z data monkey 4. joint: left hand ** left foot ** right hand right foot concentrations injected Ad.IacZ pip 2 - - - 3.2 xlO5 pip 3 - + - - 3.2 x 106 pip 4 - + +4 - 3.2 xlO7 pip 5 ++ +++ 44+ ++ 3.2 x 108 knee left: +4-4-+ right: ++++ 3.2 x 109 Virus concentrations in plague forming units. ** =10 % triamcinolonhexacetonide (20 mg/ml) in injection. : no blue cells + : 1-10 blue cells in synovial lining ++ *. 1-5% blue cells in synovial lining +++ : 5-50% blue cells in synovial lining ++++ : > 50 % blue cells in synovial lining 82 PCT/NLO0/00133 Table IX: Luciferase counts in organs as a measure of virus spread after intra-articular injection of Ad.CMV.luc. monkey : 1-4 mean (range) mean (range) 6 control conc. injected Ad. 2,2 -10 108 IG.Ad.CMV.luc '° IG.Ad.mlp.luc ® IG.Ad. CMV.luc - termination day: 2-3 3 Ad.luc-injected joints 553,491 (47,773-1,000,460) 368 69 (66-71) - non Ad-injected joints • 390 (63 - 2515) 93 - - hart 86(82- 114) 147 (105-223) 60 142 liver 99(81 - 128) 115 49 126 spleen 99 ( 65 - 165) 98 57 101 testis 82 female 55 female cervix 227 ( 90 - 457) 101 male 115 prostate 120 female - female ovaiy 90(76- 111) 107 male 92 bone marrow 60 ( 54 - 69) 110 - - blood t=0 68(62- 71) 165 (86-349) - - blood section 56(50- 62) 91 (86-96) - - draining lymphnode 96 non-draining lymphnodes 112(105-118) kidney 110 lung 102 oesophagus 78 bladder 100 Table X: Lactate Dehydrogenate levels in U/l. 3 ((days) first: 0 2 3 4 7 ■14 18 monkey 4 t-4: 358 216 763 monkey 6 t-30: 1050 6340 6835 5939 monkey 5 760 627 1182 686 monkey 7 t-38: 999 5185 4387 4679 6547 4740 5586 6128 5226 monkey 8 t-38: 958 5994 4881 10140 8000 8230 2952 7259 3800 4053 LDH levels in monkey 5 in monkey 6, 7 and 8 4 (CMV. lacZ/CMV. luc) , 5 (mlp.lacZ / mlp.luc), 6 (mlp.TK), 7 and 8 (mlp.TK + GCV). LDH-levels are determined with an other test than monkey 4 and 5. cS 5 84 PCT/NL00/00133— Table XI: Percentage of lacZ-expressing synoviocytes 2 days after infection with IG.Ad.CMV.lacZ or IG.Ad.mlp.lacZ MOI 0 0.1 1 100 IG.Ad.CMV. 0 <1% 2.5% 12.9% 53.4% lacz (SD) (0%) (1.5%) (6.3%) (14.9%) IG.ad.MLP. 0 0 0 <1% <1% lacZ (SD) (0%) (0%) Table XII: Light counts as a measure of luciferase-expression in synoviocytes 3 days after infection with IG.Ad.CMV.luc or 10 IG.Ad.mlp. luc MOI 0 0.1 1 100 IG.Ad.MLP. 0 53 9.6 102 7.5 103 1.7 103 luc (5) (2.0 102) (2.6 103) (2.3 10") IG.Ad.CMV. 0 2.9 102 2.1 103 7.4 10". 1.1 10s luc (SD) (18) (6.0 102) (4.4 104) (9.5 104) Table XIII: Comparison ofRA synoviocyte infection of Ad5.luc and Ad5.fib16.iuc (average luciferase activity (n=3)) Virus 0 vp/cell 50 vp/cell 500 vp/cell 5000 vp/cell Ad5.luc 63 243 559 189519 Ad5.fib16.luc 62 715484 7.86E+07 1.02E+09 PCT/NLO0/00133— 8 5 Table XIV: % lacZ positive cells with Add.lacZ and Ad5.fib16.lacZ in RA synoviocytes Art^ lar7 Ad5Pib16 ,lacZ(120 A) Ad5.Fib16.lacZ (130 B) 50 vp/cell 500 vp/cell 5000 vp/cell 2.17 7.33 35.50 28.00 67.50 100.00 33.83 74.54 100.00 table XVa: comparison of infection efficiency Ad5. fib5. GFP and Ad5.fib16.GFP in RA Synoviocytes (% of GFP-positive cells) Fib5 (103) Fib5 (130D) Fib16 (103) Fib16 (IC) 4.81 5.66 35.05 52.07 26.75 24.66 85.87 90.21 75.56 72.53 100.00 100.00 50 vp/cell 500 vp/cell 5000 vp/cell 'Table XVb: GFP production in RA synoviocytes infected with Ad5. GFP vs. Ad5.fib16.GFP Fib5 (103) Fib5 (130D) Fib16 (103) Pib16 (IC) 1.02 1.04 1.61 11.92 1.36 1.31 586.34 1540.93 217.85 184.96 8058.42 7773.65 50 vp/cell 500 vp/cell 5000 vp/cell "Table XVI: infectivity of panel of chimeric adenoviruses on RA synoviocytes (Luciferase activity/well) virus 0 vp/cell 50 vp/cell 50p vp/cell 5000 vp/cell Ad5. Fib 5 31 6348 32612 497488 Ad5.Fib 11 26 10775 524221 33831033 Ad5.Fib 16 32 17937 821418 38760900 Ad5.Fib 24 29 220 1237 52601 Ad5.Fib 28 24 106 1798 15199 Ad5.Fib 33 31 163 1865 92049 Ad5.Fib 35 27 2319 103286 7812200 Ad5.Fib 45 29 95 1304 28373 Ad5.Fib 47 29 145 1901 54053 PCT/NLOO/00133 —; Table XVIIa: % of infected cells with three B-type tiber-modified viruses on RA synoviocytes Ad5 Ad5.fib16 Ad5.fib35 Ad5.fib51 50 vp/cell 7.32 52.31 69.17 57.84 500 vp/cell 38.83 92.60 94.49 93.28 5000 vp/cell 87.91 100.00 100.00 100.00 Table XVIIb: GFP production with three B-type fiber-moditied viruses on RA synoviocytes Ad5 Ad5.fib16 Ad5.fib35 Ad5.fib51 50 vp/cell 1.76 42.29 262.84 78.59 500 vp/cell .77 3126.39 8012.87 3929.21 5000 vp/cell 1386.49 9646.62 9646.62 9646.62 PCT/NL00/00133 — 87 Table XVIII: comparison of three B-type fiber modified adenoviruses for infectivity on RA synoviocytes (luc-production) 0 vp/cell 50 vp/cell 500 vp/cell 5000 vp/cell virus Ad5 31 2073 67365 848476 Ad5.Fib 11 16926 1094044 69718467 Ad5.Fib 16 38 58366 3371600 164933133 Ad5.Fib 35 3321 129236 10440833 Table XIX: comparison ofAd5.lacZ vs. Ad5.fib16.lacZ in 6 patients (# of lacZ-positive cells) P1 P2 P3 P4 Pb P6 Ad5-2hrs 3 1 28 26 14 16 Ad5-20hrs 26 32 101 39 86 34 Ad5.fib16-2hrs 267 209 365 325 713 259 Ad5.fib16-20hrs 2565 1762 5124 3258 6158 2923 PCT/NL00/0.0133 —: 88 REFERENCES Arnberg N., Mei Y. and Wadell G. , 1997. Fiber genes of adenoviruses with tropism for the eye and the genital tract. 5 Virology 227: 239-244.

Arnett FC, Edworthy SM, Bloch DA, et al (1988) . The American Rheumatism Association 1987. Revised criteria for the classification of rheumatoid arthritis. Arthritis and 10 rheumatism; 31:315-323 .

Bakker N.P.M., (1992). Collagen-induced arthritis in the Rhesus monkey. Relations between aspects of autoimmunity and disease development. Thesis, 27-10-92 Katholieke Universiteit 15 Nijmegen.

Bergelson, J.M. , Cunningham, J.A., Droguett, G., Kurt-Jones, E.A., Krithivas, A., Hong, J.S., Horwitz, M.S., Crowell, R.L. and Finberg, R.W. (1997) Isolation of a common receptor for 20 coxsackie B virus and adenoviruses 2 and 5. Science 275: 1320-1323.

A.Bout, J-L. Imler, H. Schultz, M Perricaudet, C. Zurcher, P. Herbrink, D. Valerio and A. Pavirani (1994) . In vivo adenovirus-25 mediated transfer of human CFTR-cDNA to rhesus monkey airway epithelium: efficacy, toxicity and safety. Gene therapy 1,1-10.

A.Bout, D. Valerio, B.J. Scholte. (1993) In vivo transfer and expression of the lacZ gene in the mouse lung. Exp. Lung Res. 19, 30 193-202.

Bout A. (1997) Gene therapy, p. 167-182. In: D.J.A. Crommelin and R.D. Sindelar (ed.), Pharmaceutical Biotechnology , Harwood Academic Publishers.

PCT/NL00/Q0X33.— 8 9 Bout, A. (1996) Prospects for human gene therapy. Eur. J.

Drug Met. and Pharma. 2, 175-179.

Blaese, M., Blankenstein, T., Brenner, M. , Cohen-Hagenauer, 5 O., Gansbacher, B., Russel, S., Sorrentino, B. and Velu, T. (1995) Cancer Gene Ther. 2: 291-297.

Brody, S.L. and Crystal, R.G. (1994) Adenovirus mediated in vivo gene transfer. Ann. N. Y. Acad. Sci . 716:90-101.

Carter, A.J., Laird, J.R., Farb, A., Kufs, W., Wortham, D.C. and Virmani, R. (1994) Morphologic characteristics of lesion formation and time course of smooth muscle cell proliferation in a porcine proliferative restenosis model. J. Am. Coll. 15 Cardiol. 24: 1398-1405.

Chroboczek J., Ruigrok R.W.H. , and Cusack S., 1995.

Adenovirus fiber, p. 163-200. In: W. Doerfler and P. Bohm (ed.), The molecular repertoire of adenoviruses, I. Springer-20 Verlag, Berlin.

Cruz-Esteban C., W.S. Wilke (1995). Non-surgical synovectomy BailliPre's Clinical Rheumatology vol9 , 787-800 Defer C., Belin M. , Caillet-Boudin M. and Boulanger P., 1990. Human adenovirus-host cell interactions; comparative study with members of subgroup B and C. Journal of Virology 64 (8) : 3661-3673.

Edwards J.C.W., 1995. Synovial intimal fibroblasts. Ann.

Rheum. Dis. 54, 395-397 PCT/NLOO/00133 90 EVANS, C.H. et al. (1996) Clinical protocol to assess the safety, feasibility and efficacy of transferring a potentially anti-arthritic cytokine gene to human joints with rheumatoid arthritis. Hum. Gen. Ther. 7:1261-1280.

Fallaux, F.J, Bout, A, van der Velde, I et al. New helper cells and matched El-deleted adenovirus vectors prevent generation of replication competent adenoviruses. Human Gene Therapy, 9 (1998), pl909-1917.

FIRESTEIN, G.S. (1996) Invasive fibroblast-like synoviocytes in rheumatoid arthritis. Passive responders or transformed aggressors? Arthritis Rheum. 39: 1781-1790.

Francki, R.I.B., Fauquet, C.M., Knudson, D.L. and Brown, F. 15 (1991) Classification and nomenclature of viruses. Fifth report of the international Committee on taxonomy of viruses. Arch. Virol. SuppI. 2: 140-144.

Gall J., Kass-Eisler A., Leinwand L. and Falck-Pedersen E. 20 (1996) Adenovirus type 5 and 7 capsid chimera: fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. Journal of Virology 70 (4): 2116-2123.

Greber, U.F., Willets, M., Webster, P., and Helenius, A. (1993). Stepwise dismanteling of adenovirus 2 during entry into cells. Cell 75: 477-486.

Hynes, R.O. (1992) Integrins: versatility, modulation and 30 signalling in cell adhesion. Cell 69: 11-25.

PCT/NL00/00133 —; 91 Herz, J. and Gerard, R.D. (1993) Adenovirus-mediated transfer of low density lipoprotein receptor gene acutely accelerates cholesterol clearence in normal mice. Proc. Natl. Acad. Sci. U.S.A. 96: 2812-2816.

Hierholzer, J.C. (1992) Adenovirus in the immunocompromised host. Clin. Microbiol Rev. 5, 262-274.

Hierholzer, J.C., Wigand, R., Anderson, L.J., Adrian, T., and 10 Gold, J.W.M. (1988) Adenoviruses from patients with AIDS: a plethora of serotypes and a description of five new serotypes of subgenus D (types 43-47). J. Infect. Dis. 158, 804-813.

Hong, S.S., Karayan, L. , Tournier, J., Curiel, D.T. and 15 Boulanger, P.A. (1997) Adenovirus type 5 fiber knob binds to MHC class I a2 domain at the surface of human epithelial and B lymphoblastoid cells. EMBO J. 16: 2294-2306.

Hsu, K.H., Lonberg-Holm, K., Alstein, B. and Crowell, R.L. 20 (1988) A monoclonal antibody specific for the cellular receptor for the subgroup B coxsackieviruses. J. Virol 62(5): 1647-1652.

Huard, J., Lochmuller, H., Acsadi, G., Jani, A., Massie, B. 25 and Karpati, G. (1995) The route of administration is- a major determinant of the transduction efficiency of rat tissues by adenoviral recombinants. Gene Ther. 2: 107-115.

Imler J.-L., Bout A., Dreyer D. Trans-complementation of El-30 deleted adenovirus: a new vector to reduce the possibility of co-dissemination of wild-type and recombinant adenoviruses. Human Gene Therapy 6, 711-721 WO 00/52186 PCT/NL00/Q0133 92 Ishibashi, M. and Yasue, H. (1984) The adenoviruses, H.S. Ginsberg, ed. , Plenum Press, Londen, New York. Chapter 12, 497-561.

Kass-Eisler, A., Falck-Pederson, E., Elfenbein, D.H., Alvira M., Buttrick, P.M. and Leinwand, L.A. (1994) The impact of developmental stage, route of administration and the immune system on adenovirus-mediated gene transfer. Gene Ther. 1: 395-402.

Khoo, S.H., Bailey, A.S., De Jong, J.C., and Mandal, B.K. (1995). Adenovirus infections in human immunodeficiency virus-positive patients: Clinical features and molecular epidemiology. J. Infect. Dis 172, 629-637 Kidd, A.H., Chroboczek, J., Cusack, S., and Ruigrok, R.W. (1993) Adenovirus type 40 virions contain two distinct fibers. Virology 192, 73-84.

Krasnykh V.N. , Mikheeva G.V. , Douglas J.T. and Curiel D.T. (1996) Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. J. Virol. 70(10) 6839-6846.

Krasnykh V.N. , Dmitriev I., Mikheeva G. , Miller C.R., Belousova N. and Curiel D.T. (1998) Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. J. Virol. 72 (3) : 1844-1852 Law, L., Chillon, M., Bosch, A., Armentano, D. , Welsh, M.J. and Davidson, B.L. (1998) Infection of primary CNS cells by different adenoviral serotypes: Searching for a more efficient vector. Abstract 1st Annual Meeting American Society of Gene Therapy, Seattle, Washington.

PCT/NLO0/00133 —: 93 Leppard, K.N. (1997) E4 gene function in adenovirus, adenovirus vector and adeno-associated virus infections. J. Gen. Virol. 78: 2131-2138.

Lloyd Jones, D.M. and Bloch, K.D. (1996) The vascular biology of nitric oxide and its role in atherogenesis. Annu. Rev. Med. 47: 365-375.

Morgan, C., Rozenkrantz, H.S., and Mednis, B. (1969) Structure and development of viruses as observed in the electron microscope.X. Entry and uncoating of adenovirus. J.

Virol 4, 777-796.

H. Nakamura, S. Yoshino, N. Ishiuchi, J. Fujimori, T. Kanai, Y. 15 Nishimura. (1997) . Outcome of radical synovectomy as a novel surgical treatment for refractory RA: implication of HLA-DRB1*0405 in post-operative results. Clinical and experimental rheumatology;15;53-57.

NITA, I. and S.C. GHIVIZZANI. (1996) Direct gene delivery to 20 synovium. An evaluation of potential vectors in vivo and in vitro. Arthritis Rheum. 39:820-828.

QU, 2., C.H. GARCIA, L.M. O'ROURKE, S.R. PLANCK, M. KOHL I and J.T. ROSENBAUM. (1994) Local proliferation of fibroblast-like synoviocytes contributes to synovial hyperplasia. Arthr.

Rheum. 37:212-220.

.Roelvink, P.W., Kovesdi, I. and Wickham, T.J. (1996) Comparative analysis of adenovirus fiber-cell interaction: Adenovirus type 2 (Ad2) and Ad9 utilize the same cellular 30 fiber receptor but use different binding stratagies for attachemnt. J. Virol. 70: 7614-7621.

PCT/NLOO/00133 94 Roelvink, P.W., Lizonova, A., Lee, Li, Y., Bergelson, J.M., Finberg, R.W., Brough, D.E., Kovesdi, I. and Wickham, T.J. (1998) The coxsackie-adenovirus receptor protein can function as a cellular attachment protein for adenovirus 5 serotypes from subgroups A, C, D, E, and F. J. Virol. 72: 7909-7915.

B.J. Roessler, E.D. Allen, J.M. wilson, J.W. Hartman, B.L. Davidson (1993). Adenoviral mediated gene transfer to rabbit 10 synovium in vivo. J.Clin.Invest 92/1085-1092.

Rogers, B.E., Douglas J.T., Ahlem, C., Buchsbaum, D.J., Frincke, J. and Curiel, D.T. (1997) Use of a novel cross-linking method to modify adenovirus tropism. Gene Ther.4: 15 1387-1392.

Schulick, A.H. , Vassalli, G. , Dunn, P.F., Dong, G., Rade, J.J., Zamarron, C. and Dichek, D.A. (1997) . Established immunity precludes adenovirus-mediated gene transfer in rat 20 carotid arteries.

Schnurr, D and Dondero, M.E. (1993) Two new candidate adenovirus serotypes. Intervirol. 36, 79-83.

Schwartz, R.S., Edwards, W.D., Huber, K.C., Antoniudes, L.C. Bailey, K.R., Camrud, A.R., Jorgenson, M.A. and Holmes, D.R. Jr. (1993) Coronary restenosis: Prospects for solution and new perspectives from a porcine model. Mayo Clin. Proc. 68: 54-62.

PCT/NLOO/00133— 95 Shi, Y. , Pieniek, M., Fard, A., O'Brien, J., Mannion, J.D. and Zalewski, A. (1996) Adventitial remodelling after coronary arterial injury. Circulation 93: 340-348.

Shabram, P.W., Giroux, D.D., Goudreau, A.M., Gregory, R.J., Horn, M.T., Huyghe, B.G., Liu, X., Nunnally, M.H., Sugarman, B.J. and Sutjipto, S. (1997) Analytical anion-exchange HPLC of recombinant type-5 adenoviral particles. Hum. Gene Ther. 8 (4) : 453-465.

Signas, G., Akusjarvi, G. , and Petterson, U. (198 5). Adenovirus 3 fiberpolypeptide gene: Complications for the structure of the fiber protein. J. Virol. 53, 672-678.

Stevenson S.C., Rollence M., White B., Weaver L. and McClelland A., (1995) Human adenovirus serotypes 3 and 5 bind to two different cellular receptors via the fiber head domain. J. Virol 69(5): 2850-2857.

Stevenson S.C., Rollence M., Marshall-Neff J. and McClelland A. (1997) Selective targeting of human cells by a chimaeric adenovirus vector containing a modified fiber protein. J. Virology 71(6): 4782-4790.

Stouten, P.W.F., Sander, C., Ruigrok, R.W.H:, and Cusack, S. (1992) New triple helical model for the shaft of the adenovirus fiber. J. Mol. Biol. 226, 1073-1084.

Svensson, V. and Persson, R. (1984) . Entry of adenovirus 2 30 into Hela cells. J. Virol. 51, 687-694.

PCT/NLOO/00133 — 96 S.J. Sawchuk (1996). Anti-Tcell receptor monoclonal antibody prolongs transgene expression following adenovirus-mediated in vivo gene transfer to mouse synovium. Human gene therapy 7; 4 99-506.

THOMPSON, M., G. DOUGLAS and E. P. DAVISON. (1973) Evaluation of synovectomy in rheumatoid arthritis. Proc.Roy.Soc.Med. 66:197-199 . .

Van der Vliet, P.C. (1995) Adenovirus DNA replication In: W. Doerfler and P. Bohm (eds.), The molecular repertoire of adenoviruses II. Springer-Verlag, Berlin.

Varga, M.J., Weibull, C. , and Everitt, E. (1991). Infectious 15 entry pathway of adenovirus type 2. J. Virol 65, 6061-6070.

Varenne, O., Pislaru, S., Gillijns, H., Van Pelt, N., Gerard, R.D., Zoldhelyi, P., Van de Werf, F., Collen, D. and Janssens, S.P. (1998) Local adenovirus-mediated transfer of 20 human endothelial nitric oxide synthetase reduces luminal narrowing after coronary angioplasty in pigs. Circulation 98: 919-926.

VINCENT, A.J.P.E., R. VOGELS and G. VAN SOMEREN. (1996) Herpes 25 simplex virus thymidine kinase gene therapy for malignant brain tumors. Hum. Gen. Ther. 7:197-205.

Wickham T.J., Carrion M.E. and Kovesdi I., 1995. Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. 30 Gene Therapy 2: 750-756.

PCT/NL00/00133.— Wickham T.J., Segal, D.M., Roelvink, P.W., Carrion M.E. , Lizonova, A., Lee, G-M. , and Kovesdi, I. (1996) Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies. J-. Virol. 70 (10), 5 6831-6838.

Wickham, T.J., Mathias, P., Cherish, D.A., and Nemerow, G.R. (1993) Integrins avp3 and avP5 promote adenovirus internalisation but not virus attachment. Cell 73, 309-319.

Wold, W.S., Tollefson, A.E. and Hermiston, T.W. (1995) E3 transcription unit of adenovirus. In: W. Doerfler and P. Bohm (eds.), The molecular repertoire of adenoviruses I. Springer-Verlag, Berlin.

Zabner, J. , Armentano, D. , Chillon, M. , Wadsworth, S.C. and Welsh, M.J. (1998) Type 17 fiber enhances gene transfer Abstract 1st Annual Meeting American Society of Gene Therapy, Seattle, Washington.

ZVAIFLER, N.J. and G.S. FIRESTEIN. (1994) Pannus and pannocytes, alternative models of joint destruction in RA. Arthritis Rheum. 37:783-789. 98

Claims (15)

WHAT WE CLAIM IS:

1. A recombinant adenoviral vector having a tissue tropism for synoviocytes, wherein the capsid of said adenoviral vector comprises at least the knob domain of the fiber protein of adenovirus serotype 35, . and wherein said adenoviral vector comprises at least one non-fiber capsid protein from an adenovirus of subgroup C.

2. A recombinant adenoviral vector according to claim 1, wherein said subgroup C adenovirus is adenovirus serotype 5.

3. A recombinant adenoviral vector according to claim 1 or 2, wherein said recombinant adenoviral vector does not comprise the knob domain of the fiber protein of adenovirus serotype 5, thereby having a reduced tissue tropism for liver cells.

4. A recombinant adenoviral vector according to any one of claims 1-3, wherein said adenoviral vector comprises an adenovirus nucleic acid, wherein said adenoviral nucleic acid is modified such that the capacity of said adenovirus nucleic acid to replicate in a target cell has been reduced or disabled through a deletion of at least part of the El-region.

5. A recombinant adenoviral vector according to claim 4, wherein said adenovirus nucleic acid is further modified such that the capacity of a host immune system to mount an immune response against adenovirus proteins encoded by said adenovirus nucleic acid is reduced or disabled through a deletion of E2A and/or at least part of the E4-region.

6. A recombinant adenoviral vector according to any one of claims 1-5, comprising a minimal adenovirus vector or an Ad/AAV chimaeric vector.

7. A recombinant adenoviral vector according to any one of claims 1-6, comprising at least one nucleic acid of interest. intellectual property office of n.z. - 8 JAM 2004 99

8. A recombinant adenoviral vector according to any one of claims 4-7, wherein said adenoviral nucleic acid comprises a nucleic &cid encoding at least the knob domain of the fiber protein of adenovirus serotype 35.

9. A method for the production of a recombinant adenoviral vector according to any one of claims 1-8, comprising providing a cell with means for the assembly of said recombinant adenoviral vector, wherein said means include a means for the production of an adenovirus fiber protein, wherein said fiber protein comprises at least the knob domain of the fiber protein of adenovirus serotype 35.

10. An in vitro cell for the production of a recombinant adenoviral vector according to any one of claims 1-8, comprising means for the assembly of said recombinant adenoviral vector, wherein said means include a means for the production of an adenovirus fiber protein, wherein said fiber protein comprises at least the knob domain of the fiber protein of adenovirus serotype 35.

11. A recombinant adenoviral vector according to any one of claims 1-8 for use as a pharmaceutical.

12. A recombinant adenoviral vector according to claim 11, wherein said pharmaceutical is used in the treatment of rheumatoid arthritis.

13. A recombinant adenoviral vector according to claim 11 or 12, wherein said pharmaceutical is used to transfer nucleic acid encoding a therapeutic proteinaceous molecule to synoviocytes.

14. Use of a recombinant adenoviral vector according to any one of claims 1-8 for the manuifacture of a medicament for the treatment of rheumatoid arthritis.

15. A fiber protein of adenovirus 35 for use in the delivery of nucleic acid to a synoviocyte cell. INTELLECTUAL PROPERTY OFFICE OF N.Z. - 8 JAN 2004