NZ526924A

NZ526924A - Means and methods for treatment evaluation

Info

Publication number: NZ526924A
Application number: NZ526924A
Authority: NZ
Inventors: Der Kuyl Antoinette Cornel Van; Marion Cornelissen
Original assignee: Primagen Holding B
Priority date: 2001-01-23
Filing date: 2002-01-23
Publication date: 2005-09-30
Also published as: WO2002059558A2; WO2002059558A3; CA2369183A1; WO2002059558A8; JP2004523232A; NZ537458A

Abstract

Described is a method for determining whether a treatment is effective in changing the status of a certain set of target cells, such as tumour cells, in a patient. This method comprises determining whether a sample contains an expression product of at least one marker gene from the patient after initiation of a treatment. Preferably, the sample is a blood sample. In one aspect, the expression product is expressed by a peripheral blood mononuclear cell. The marker gene may be a gene involved in the generation, maintenance and/or breakdown of blood vessels (angiogenesis). The method is suitable for determining whether a certain treatment against Kaposi's Sarcoma is being successful. Moreover, this method is suitable for determining the presence of angiogenesis and/or tumour cells in a patient.

Description

526924 Title: Means and methods for treatment evaluation.

The invention relates to the field of medicine. The invention particularly relates to the fields of molecular biology and detection methods.

Recent advances in the knowledge of molecular processes in a cell 5 and techniques to study these processes have resulted in improved methods of typing and treating diseases. Understanding of the underlying molecular diversity of tumors has, for instance, already led to a better understanding of the diversity of response to treatment of morphologically similar tumors. Improved typing influences the way tumor patients are being treated. A 10 drawback of the current methods of treatment is, however, that it takes a relatively long time to determine whether a treatment given to a patient is actually effective. This impedes the optimization of dosages and/or schedules with which treatment is given. Moreover, it also slows down the possibility to adjust the treatment regimen all together. For instance, adjustment of 15 therapy is currently only possible when macroscopic analysis of tumor cells in the body indicates that the therapy given is not effective. Macroscopic changes typically need several weeks to manifest themselves and equipment to measure such changes is often not readily available.

The present invention provides a method for determining whether a 20 treatment is effective in changing a status of a certain set of target cells in an individual comprising determining whether a hemopoietic cell obtained from said individual after initiation of said treatment comprises an expression product of at least one marker gene. In one embodiment of the invention said set of target cells comprises a tumor cell. By changing a status 25 of a set of target cells is meant herein that at least one property of said set of target cells is altered. For instance, the amount of said target cells may be changed. Said amount may either be increased or decreased. Alternatively, the activity of said target cells may be altered. Said activity may be a replication ■i^l£cm WEBIT um«| I A DEC 200*1 RECEIVED activity. As another example, said activity may be an activity involved with angiogenesis. Alternatively, said activity may be an apoptotic activity.

It was found that tumor cells and/or surrounding tissue respond, on a molecular level, very quickly to an effective treatment. This response can be 5 detected by measuring an expression product of a marker gene. Marker gene expression products are indicative for a response to treatment. Marker genes are typically genes that are expressed by said set of target cells, for instance tumor cells, and/or surrounding tissue. However, marker genes can also be expressed in non-tumor target cells in other compartments of the body, for 10 instance blood cells and/or cardiovascular cells.

Alternatively, marker gene expression can be initiated upon treatment given to the individual. Marker gene expression products are responsive to treatment given to a patient. A response can be an alteration in the relative amounts of expression product. However, it can also be an 15 alteration in absolute presence or absence of expressed product such as UNA and/or protein.

According to the invention, a sample which is obtained from a patient may comprise at least one of said target cells. This is particularly suitable for detecting circulating tumor cells which have released themselves 20 from a tumor and are circulating in the blood of a patient. Alternatively, said target cells may be non-tumor cells. In another embodiment of the invention, said sample does not comprise any target cells. However, said sample may comprise another, non-target cell. Expression, or change of expression, of at least one marker gene by said non-target cell is indicative for the status of a 25 certain set of target cells. Said non-target cell preferably comprises a peripheral blood mononuclear cell, as is described below. In yet another embodiment, said sample does not comprise any cell at all. For instance, an expression product of a marker gene, produced by a target cell or non-target cell elsewhere in an individual's body, may be present in said sample at 30 detectable levels.

With a method of the invention it is possible to determine whether a treatment is efiFective in said individual. This can be done while a treatment is given or shortly after said treatment. Thus it is possible for instance to adjust treatment schedule, dosages and type on a patient per patient basis. It is 5 preferred that said sample is obtained within a week of initiation of treatment. More preferably, said sample is obtained within two days of initiation of treatment. With a method of the invention it is possible to evaluate treatment effectiveness almost immediately after initiation of said treatment. A method of the invention thus offers a good opportunity for determining whether 10 treatment adjustments are required.

A marker gene preferably comprises a gene involved in the generation, maintenance and/or breakdown of blood vessels (angiogenesis). Classes of genes involved in the process of angiogenesis encompass among others receptors, ligands and signaling molecules. Tumor cells are dependent 15 on the growth of new blood vessels to maintain expansion of tumor mass. On the one hand, blood vessels are required to carry nutrients to the site of the tumor, whereas on the other hand waste material needs to be transported from the tumor. In the present invention it has been shown that expression products from genes involved in the generation, maintenance and breakdown 20 of a blood vessel are among the first to respond to anti-tumor treatments. Such genes are therefore very suitable marker genes of the invention. In one embodiment said marker gene comprises a sequence as depicted in table 1 or 2. In another embodiment said marker gene comprises a sequence as depicted in figures 1-18, or a part or analogue thereof. In a preferred embodiment said 25 marker gene comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof.

A change in the level of expression product of a marker gene is indicative for whether a treatment is effective or not. For instance, the level of expression product of a marker gene can be enhanced in a sample when a 30 treatment is effective, alternatively expression product of a marker gene can 4 be reduced. Thus, preferably, expression product of a marker gene is quantified. The level of expression product in a sample can vary due to changes in the expression of a marker gene. However, it is also possible that the level changes due to a change in type of cells comprising said expression 5 product in said sample, for instance due to treatment related cell death at the site of the body where the sample is obtained. Considering that the level of expression product of marker genes can vary from patient to patient, it is preferred that a method of the invention further comprises comparing the level of expression product of said marker gene with a reference. Preferably said 10 reference comprises the same type of tumor cells prior to, or in the absence of, said treatment. Preferably, said tumor cells are derived from the same patient. The difference in the level of expression product of a marker gene in an effective and a non-effective treatment can be very large. In the extreme cases the level of expression product can range from detectable to not detectable. 15 Marker genes displaying such zero to one relation in expression product levels are preferred in the present invention. A zero to one relation can be used to design relatively simple test systems. A zero to one relation is of course dependent on the detection system used to detect expression product of a marker gene. Very sensitive expression detection systems will typically detect 20 expression product where a less sensitive systems detects no expression product. An expression product can be RNA or a part thereof, transcribed from said marker gene or a translated protein or a part thereof. A person skilled in the art is well capable of designing the most appropriate expression detection system to practice this preferred embodiment of the invention. 25 A part of an RNA or DNA molecule is defined herein as an RNA or DNA sequence, comprising at least 50 nucleotides. A part and/or an analogue of an expression product is defined herein as a part and/or analogue that can be detected using essentially the same kind of detection method as said expression product, although the sensibility of detection may differ. An 30 analogue of an RNA or DNA molecule is defined herein as an RNA or DNA sequence which is essentially the same as a particular RNA or DNA sequence. However, a nucleotide mutation, replacement, alteration, addition and/or deletion may have taken place naturally and/or performed artificially, without essentially altering the detection of said analogue as compared with the 5 detection of said particular RNA or DNA sequence. A person skilled in the art is well able to determine whether a given RNA or DNA sequence is an analogue of a particular RNA or DNA sequence, using techniques known in the art.

In a preferred embodiment said tumor comprises Kaposi's Sarcoma. 10 Kaposi's Sarcoma is a disease of proliferating blood vessels and therefore very much suited for identifying marker genes involved in angiogenesis. According to the invention, changes in angiogenesis factors are among the first marker events as a result of treatment. Kaposi's Sarcoma (KS) manifests itself clinically by reddish skin lesions. Kaposi's Sarcoma is a multicentric, 15 malignant neoplastic vascular proliferation characterized by the development of bluish-red cutaneous nodules, usually on the lower extremities, most often on the toes or feet, and slowly increasing in size and number and spreading to more proximal areas. The tumors have endothelium-lined channels and vascular spaces admixed with variably sized aggregates of spindle-shaped 20 cells, and often remain confined to the skin and subcutaneous tissue, but widespread visceral involvement may occur. Kaposi's Sarcoma occurs spontaneously in Jewish and Italian males in Europe and the United States. An aggressive variant in young children is endemic in some areas of Africa. A third form occurs in about 0.04% of kidney transplant patients. There is also a 25 high incidence in AIDS patients. (From Dorland, 27th ed & Holland et al., Cancer Medicine, 3d ed, pp2105-7) Kaposi's Sarcoma is aggressive in HIV infected individuals. The angiogenic mechanism causing the lesions results from the interplay of viral and cellular gene expression and is poorly understood in terms as to which 30 genes are involved and what controls their expression. The angiogenic 6 proliferation in KS involves mechanisms likely to be universal in angiogenesis. The central role of angiogenesis in Kaposi's Sarcoma is clearly illustrated by the French name for this tumor: angiosarcomatose kaposi. Because of said central role of angiogenesis in Kaposi's Sarcoma, determination of marker genes involved in angiogenesis is very suitable to determine whether a treatment of Kaposi's Sarcoma is effective.

In the present invention, gene expression patterns of Kaposi's Sarcoma were examined with a method called serial analysis of gene expression (SAGE) (Velculescu et al. (1995) Science 270; 484-487). This method allows the quantitative and simultaneous analysis of a large number of transcripts. SAGE is based on two principles. First, a short nucleotide sequence TAG (14 base pairs) contains sufficient information to uniquely identify a transcript, provided it is isolated from a defined position within the transcript. Second, concatenation of short sequence TAG's allows the efficient analysis of transcript in a serial manner by sequencing of multiple TAG's within a single clone.

Briefly, in this method a bio tiny late d oligo (dT) primer is used to synthesize cDNA from mRNA, and after digestion with a restriction enzyme, the most 3' terminus (near the pofy-A tail) is isolated. These 3' fragments of cDNA are ligated to linkers and cleaved with a type II restriction enzyme to release short sequence (14 bp) of the original cDNA (TAG's). The TAG's are ligated to diTAG's and PCR amplified. These di-TAG's are then ligated to form long concatamers, which are cloned and sequenced. In this way, one sequence reaction yields information about the distribution of many different mRNA's. Finally, the calculation of the abundance of different TaG's and the matching of the TAG's in Genbank are done using the necessary computer software.

In another aspect the invention provides the use of a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, or a part or analogue thereof, in an expression product detection method wherein a hemopoietic cell of a blood sample is investigated. Preferably INTELLECTUAL PROPalTY UFHC; J OF N.Z. | - 8 JUL 2005 | RECEIVED said nucleic acid comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. Expression of a marker gene in an individual can be detected by determining whether said nucleic acid or part or analogue is able to hybridize with nucleic acid, preferably RNA, in a sample of said individual. If hybridisation takes place, it is indicative of expression of a marker gene in said individual. Of course, as is known by a person skilled in the art, a coding strand of DNA/RNA is capable of hybridizing with the complementary strand of a corresponding doublestranded nucleic acid sequence. Hence, a complementary strand of a certain coding strand is particularly suitable for detection of expression of said coding strand. For instance, a complementary strand ofa coding strand as depicted in figure 1-18 and/or table 1 or 2 is suitable for detection of expression of a gene comprising said coding strand.

In yet another aspect, the invention provides the use of a proteinaceous molecule capable of specifically binding a protein encoded by a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, or a part or analogue thereof in a detection method wherein a hemopoietic cell of a blood sample is investigated. Preferably said proteinaceous molecule is capable of specifically binding a protein encoded by a nucleic acid comprising a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. In one embodiment of the invention, said uses are directed toward determining the presence of a site of angiogenesis in an individual. In another embodiment of the invention, said uses are directed toward determining the presence of a tumor cell in an individual. The presence of a tumor cell in an individual can be determined because said tumor cell typically expresses marker genes that can be detected by an expression product detection method. For instance, an antibody, or analogue thereof, specificaUy directed against an expression product of said marker gene can be generated. Said antibody or analogue is suitable for determination of an expression product of said marker gene in a sample. To determine the presence of a tumor cell in an individual, a sample intellectual property office of n.z. - 8 JUL 2005 RECEIVED 8 from said individual can be incubated with said antibody. If said sample contains an expression product of said marker gene, said antibody will bind. Binding can be demonstrated by techniques known in the art, like for instance ELISA. If binding of said antibody is demonstrated, one can conclude that said 5 sample contains an expression product of said marker molecule. The presence of an expression product of said marker molecule can indicate the presence of a tumor cell in an individual, since said marker molecule is expressed by tumor cells. There are of course many more alternative techniques to detect an expression product with use of a proteinaceous binding molecule, which are ^ 10 well known in the art and need no further discussion here. Thus, proteins expressed by a tumor cell can be detected by a proteinaceous molecule capable of specifically binding a protein encoded by a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, like for instance a TIE 1 sequence, a Salioadhesin and/or Siglec 1 sequence, or a part or analogue 15 thereof. Likewise, the presence of a site of angiogenesis in an individual can be determined by detecting an expression product of a marker gene.

Also described is a use of a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, or a part or analogue thereof, in an expression product detection method for determining whether a treatment is effective in changing the status of a certain set of target cells in an individual. In a preferred embodiment said nucleic acid comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. In another preferred embodiment said proteinaceous molecule is capable of specifically binding a protein encoded by a nucleic acid comprising a TIE 1 sequencei, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. More preferably, said uses are directed toward determining whether a treatment is i NT£u!£CTUALTRaP£RfY^mC^ OF N.Z. - 8 JUL 2005 RECEIVED ' 9 effective in counteracting a tumor in an individual. In one embodiment of the invention, said tumor comprises Kaposi's Sarcoma.

Also described is the use of a nucleic acid comprising a sequence as depicted in table 1 or 2 and/or figure 1-18 as an indicator for angiogenesis, preferably a nucleic acid comprising a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. For instance, a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2 can be used as detection marker for the process of angiogenesis in the course of regenerative treatment. Changes in the expression level of the detection marker indicate active growth of blood vessels (i.e. angiogenesis) as was meant to induce with the regenerative treatment course. In a preferred embodiment 15 such application is in the field of heart and coronary disease aimed at generation of new blood supply to affected organs by means of new blood vessels. Likewise, the treatment of tumors with anti-angiogenesis drugs can be monitored by changes in expression levels of detection marker genes as depicted in figure 1-18 and/or table 1 or 2, such as a TIE 1 sequence, a 20 Salioadhesin and/or Siglec 1 sequence.

Also described is the use of a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2 as detection marker for tumor cells,and the use of a proteinaceous molecule encoded by a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2 or a proteinaceous molecule capable of binding a protein encoded by a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2 as detection marker for tumor cells.

INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 DEC 2004 RECEIVED With a method of the invention it is possible to monitor a specific status of an individual. The presence of a disease — or danger of developing one — can be determined by determining whether or not a sample of an individual comprises an expression product of a marker gene. This means that also the 5 absence of a marker gene in a sample can be indicative for the presence of a disease, or for danger of developing a disease. This is possible for any disease, as long as the disease involves an altered expression pattern of at least one marker gene. Preferably the presence of a marker gene in a sample is determined.

Additionally, a healing process can be followed as well. For instance, recovery of damaged tissue can involve an increasing amount of expression product of a marker gene over time. It is however also possible that recovery of damaged tissue involves a decreasing amount of expression product of a marker gene over time. Samples taken at different time intervals provide information about 15 the amount of expression product which is generated at different time points. An altered amount of a specific expression product found in samples during a period of time is indicative of the amount of tissue cells generated. Likewise, a decreasing amount of an expression product found in samples in a specific time-period can indicate a certain - either beneficial or harmful — process. For 20 instance, said process may involve the development or the treatment of disease. An important application is a treatment of heart and coronary disease. A method of the invention is very suitable for monitoring the generation of new cardiac tissue.

/D Thus, one aspect of the invention provides a method for determining whether an individual comprises a tumor cell and/or a site of angiogenesis, comprising determining whether a hemopoietic cell obtained from said individual comprises an expression product of at least one marker gene. Preferably, said marker gene comprises a 30 sequence as depicted in table 1 or 2 and/or figure 1-18, or a part or analogue INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 "i DEC 2<M RKCBIVEO 11 thereof. More preferably said marker gene comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. With a method of the invention it is possible to detect tumor cells that have released themselves from the tumor and are elsewhere 5 in the body. In a preferred embodiment such detection is performed in the blood of a person detecting circulating tumor cells. These circulating tumor cells can be used for primary identification of presence of a tumor somewhere in the body and also for identification of the risk of metastasis of the tumor to other places in the body next to the primary location of the body. Likewise, a 10 method of the invention is suitable for determining a site of angiogenesis in an individual. Angiogenesis is an indicator for different aspects. For instance, an increased level of angiogenesis indicates the presence of tumor cells, or the healing of damaged tissue, like for instance recovery of heart and coronary disease.

Since an angiogenic process is now easily monitored by a method of the invention, it is likewise easy to determine whether a certain treatment is effective in altering an angiogenic process. For instance, if a certain treatment is effective in counteracting an angiogenic process, the amount of an expression product of a marker gene involved in angiogenesis decreases as well 20 over time. In the art, many drugs are known for anti-angiogenic treatment. Thus, one embodiment of the invention provides a method for determining whether a treatment is effective in altering an angiogenic process in an individual comprising obtaining a sample from said individual after initiation of said treatment, and determining whether said sample comprises an 25 expression product of at least one marker gene. Preferably, said marker gene comprises a sequence as depicted in table 1, 2, and/or figures 1-18, or a part or analogue thereof. More preferably, said marker gene comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. In one embodiment, said treatment 30 comprises counteracting angiogenesis in said individual. In yet another WO 02/059558 PCT/NL02/00051 12 embodiment said treatment involves the use of at least one of the following drugs: 2ME2, Angiostatin, Angiozyme, Anti-VEGF RhuMAb, Apra (CT-2584), Avicine, Benefin, BMS275291, Carboxyamidotriazole, CC4047, CC5013, CC7085, CDC801, CGP-41251 (PKC 412), CM101, Combretastatin A-4 5 Prodrug, EMD 121974, Endostatin, Flavopiridol, Genistein (GCP), Green Tea Extract, IM-862, ImmTher, Interferon alpha, Interleukin-12, Iressa (ZD1839), Marimastat, Metastat (Col-3), Neovastat, Octreotide, Paclitaxel, Penicillamine, Photofrin, Photopoint, PI-88, Prinomastat (AG-3340), PTK787 (ZK22584), R0317453, Solimastat, Squalamine, SU 101, SU 5416, SU-6668, 10 Suradista (FCE 26644), Suramin (Metaret), Tetrathiomolybdate, Thalidomide, TNP-470, and/or Vitaxin. However, the artisan can think of more drugs that can be used during said treatment.

In a preferred embodiment, a sample of a method of the invention is 15 a blood sample. Although the location of for instance an angiogenic process can be a tumor or a part of the skin, a blood sample is preferred, among other things because it is much easier to obtain. A blood sample is also often easier to investigate, requiring less expensive and/or specific equipment. Quite surprisingly, we have found that the expression of certain marker genes by 20 hemopoietic cells, like peripheral blood mononuclear cells (PBMC), can be indicative for a process occurring somewhere else in an individual's body. For instance, the presence, or alteration in amount, of an expression product of a marker molecule in PBMC can indicate the presence of a tumor somewhere in the body. In example 10 it is for instance shown that a TIE 1 sequence (tag 15, 25 table 3) or a Salioadhesin or Siglec 1 sequence (tag 32, table 4) are both upregulated in skin tumor and in PBMC cells in a Kaposi's Sarcoma patient. Additionaly, example 8 shows that the absence of expression product of a Keratin 14 sequence (tag 7, table 3) in a blood sample of said patient, whereas Keratin 14 is overexpressed in tumor cells, indicates that said sample was not 30 contaminated with tumor cells. Likewise, the expression of certain marker 13 genes by PBMC can provide another diagnostic indication. The presence or absence of an expression product of a marker gene in PBMC provides adequate information about different aspects and/or processes of an individual's body. Preferably, the amount of expression product in a non-hemopoieteic cell is 5 compared with a reference value. This way an indication is obtained about an increment or decrement of expression in said hemopoietic cell.

In one aspect the invention therefore provides a method for determining whether an individual comprises a non-hemopoietic tumor cell and/or a site of angiogenesis, said method comprising determining whether a 10 hemopoietic cell from said patient comprises an altered amount of an expression product of a marker gene as compared with a reference value. Preferably, said marker gene comprises a gene involved in angiogenesis. More preferably, said gene comprises a sequence as depicted in table 1 or 2, and/or figures 1-18, or a part or analogue thereof. Most preferably, said gene 15 comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. In one embodiment of the invention said hemopoietic cell comprises a peripheral blood mononuclear cell.

In one aspect the invention provides a method of the invention, wherein said expression product is expressed by a PBMC. Preferably, said expression product comprises a TIE 1 sequence, a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof. As these sequences are involved in angiogenesis, the invention also 25 provides a use of a PBMC expressed Keratin 14 sequence, TIE 1 sequence, Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 2, 8 or 17, or a part or analogue thereof, as an indicator for angiogenesis. Likewise, these sequences are involved in the presence of tumor cells. Therefore, a use of a PBMC expressed Keratin 14 sequence, TIE 1 sequence, Salioadhesin or Siglec 30 1 sequence, a sequence as depicted in figure 2, 8, or 17, or a part or analogue 14 thereof, for determining the presence of a tumor cell in an individual, is also herewith provided. Additionally, also described is an isolated Keratin 14 sequence, TIE 1 sequence, Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 2, 8, or 17, or a part or analogue thereof, for use 5 in a diagnostic method. A diagnostic method can be carried out using a diagnostic kit. Therefore, a diagnostic kit comprising a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, or a part or analogue thereof, and/or a proteinaceous molecule capable of specifically binding a protein encoded by said nucleic acid or said part or analogue, is also herewith 10 disclosed. Preferably, said kit comprises a suitable means of detection. The diagnostic kit may comprise a Keratin 14 sequence, and/or a TIE 1 sequence, and/or a Salioadhesin or Siglec 1 sequence, and/or a sequence as depicted in figure 2, 8 or 17, or a part or analogue thereof.

A diagnostic kit is particularly useful for carrying out a method of the invention. Therefore disclosed is a use of a diagnostic kit of the invention for determining whether a treatment is effective in changing the status of a certain set of target cells in an individual and/or altering an angiogenic process in an individual, and 20 also disclosed is a use of a diagnostic kit of the invention for determining whether an individual comprises a tumor cell and/or a site of angiogenesis.

With a marker gene of the invention it is possible to screen for drugs directed against a disease for which said marker gene is indicative. There are 25 many methods available in the art for screening for a specific drug activity. For instance, cells can be incubated with different potential drug compounds, and an expression pattern of a marker gene in said cells before and after exposure to each potential drug compound can be compared. A specific difference in an expression pattern after exposure to a particular potential 30 drug compound shows that said compound is a suitable candidate for the INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 DEC 2004 RECEIVED development of a medicament. Thus also described is a use of an expression product of a gene comprising a sequence as depicted in figure 1-18, table 1 or table 2 as a drugtarget. Preferably, said sequence is a Salioadhesin or Siglec 1, TIE 1, and/or Keratin 14 sequence. A compound capable of altering the activity of Salioadhesin or Siglec 1, TIE 1, Keratin 14, and/or the expression of Salioadhesin or Siglec 1, TIE 1, and/or Keratin 14 in a cell is also herewith provided. Said compound is particularly suitable for the preparation of a medicament.

The present invention also provides a method for determining whether a treatment is effective in altering an angiogenic process in an individual comprising: determining whether a hemopoietic cell obtained from said individual after initiation of said treatment comprises an expression product of at least one marker gene.

The present invention is further explained in more detail by the following examples, which do not limit the invention in any way.

INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 4 DEC 2004 RECEIVED 16 Examples Example 1 In this example a selection of samples for analysis of expression profiles is 5 made.

A 31-year old man was demonstrated to be HIV-1 seropositive in February 1997. The initial CD4 cell count was 25 x 106/1. The patient presented within two months a mucocutanous Herpes simplex infection and an extrapulmonary Cryptococcosis for which specific medication was given. The HIV-1 RNA load 10 at presentation was 15,000 copies/ml and increased to 33,000 copies/ml in three months. Then antiretroviral therapy was started with zidovudine, lamivudine and indinavir. Immediately after start therapy the HIV-1 RNA load dropped below detection limit. In November 1997 the patient presented with gradual appearance of an increasing number of violaceous skin lesions 15 that clinically resembled. Kaposi's Sarcoma. The diagnosis was confirmed by histological examination of one of the lesions. At start of the chemotherapy (bleomycin, vincristine and adriamycine intravenously) KS had progressed to about 150 cutaneous lesions. The interval between the courses of chemotherapy was three weeks and stopped after the fifth course. Several 20 lesions had disappeared by three weeks of therapy and complete remission was gradually reached after one year.

During chemotherapy several biopsies were taken. The first biopsy was obtained 24 hours after start chemotherapy (named KSl) and the second biopsy after 48 hours (named KS2). All biopsies were flash-frozen in liquid 25 nitrogen immediately after surgical removal and stored at -80°C. Diagnosis of Kaposi's Sarcoma was confirmed histopathologically. 17 Control SAGE libraries KS3 and KS4 were made from frozen material taken at autopsy from two AIDS patients with. Kaposi's Sarcoma, both of which died in 1986 without having had any form of chemotherapy or retroviral treatment.

Example 2 The expression, profiles of the biopsy samples were determined using the SAGE technology. All biopsies were cut with a microtome in 15-20 jim sections and transferred to a tube containing TRIzol. RNA isolation with TRIzol was performed according to the manufacturer's instructions. Poly (A) RNA was obtained using the Micro-FastTrack™ 2.0 mRNA Isolation Kit. cDNA preparation and the subsequent steps were performed as described by Velculescu. Primary analysis of the sequence results was performed using software especially designed for SAGE by the Bioinformatics Laboratory of the Academic Medical Centre, Amsterdam (van Kampen et al. USAGE: a web-based approach towards the analysis of SAGE data. Bioinformatics, in press). The libraries were also analysed using the Human Transcriptome Map (HTM), a program developed in the AMC, which maps TAG's onto human chromosomes (Caron et al. The Human Transcriptome Map reveals a clustering of highly expressed genes in chromosomal domains. Submitted for publication).

We sequenced ~ 47,000 TAG's from the four biopsies, 47,298 TAG's from KS 1 library, 46,671 from the KS 2 library, 49,335 TAG's from the KS3 library, and 48,814 TAG's from the KS4 library. TAG lists (i.e. individual TAG's plus the 25 number of appearance) were compared with each other in USAGE, TAG sequences with the highest counts were identified with the amct2g database available in USAGE (which is an improved TAG identification compared with the SAGEmap database from CGAP (available from GenBank). Secondly, TAG lists were mapped to chromosome locations with the HTM program, and at the 18 same time compared with specific TAG lists (e.g. vascular endothelium, publicly available), and with a compilation of all TAG lists in the SAGEmap database (designated "All" in HTM) TAG's belonging to genes specifically up regulated in KS3 and KS 4 identified (Table 1). Nucleotide 15 was determined 5 from the original diTAG list in USAGE. The TAG sequence of 15 nt. was checked with GenBank (BLAST) to confirm its identification. A few TAG's were eliminated because of ambiguity in the 15th nucleotide, or because of misidentification.

Example 3 Result of the analysis showing the identifiable TAG's derived from known genes with increased expression in Kaposi's Sarcoma SAGE libraries KS3 and KS4 compared to libraries KS1 and KS2. The TAG numbers are first normalized to a level of 100.000 total TAG's sequenced per library to allow 15 comparison between the libraries and comparison with other libraries in the public domain.

The sequence catg precedes each TAG sequence given in column 2 of table 1.

WO 02/059558 PCT/NL02/00051 19 Table 1. Overview of identifiable TAG's over-expressed in SAGE libraries KS3 and KS4.

No.

TAG sequence (5' -> 3') Unigene no.

ID overexpression factor1 1. ccccagtcggc Hsl71596 EphA2 3 2. cttgacatacc Hs 171695 Dual specificity phosphatase 3 3. catcacggatc Hs82112 ELI receptor, type l2 -30 4. ggccaaaggce Hs78436 EphBl >2 . ttgcatatcag Hs82237 AT group D protein -15 6. ccctgttcagc Hs78824 Tie I2 2-5 7. gatcaatcagt Hsl6530 Small ind. cytokine A18 -20 8. gagggtgceaa Hs898 Complement comp. 1QP -10 9. taaacctgctg Hs99923 galectin 7 3-10 . gtggccagagg Hsl420 FGFR3 2-5 11. tctggeccagc Hsl83 DARC (Duffy blood group) 8-10 12. caggtcgctac Hs75066 Translin 2-6 13. gagcagcgccc Hs112408 Psoriasin (S100 A7) > 20 (specific) 14. acttattatgc Hs76152 Decorin 2-10 . eaggcctggcc Hs74649 Cytochrome C oxydase subunit Vic 2-4 16. gtgcggaggac Hsl81062 Serum amyloid Al -14 17. acagcggcaat Hs74316 Desmoplakin -10 18. gatgtgcaega Hsll7729 Keratin 14 -14 19. caggtttcata Hs24395 Small ind. cytokine, B14 (BRAK) -10 . aactctgaccc Hs93675 Decidual protein induced by progesterone2 3-10 ! 1. TAG numbers of appearance were normalized to library sizes of 100.000 TAG's. 2. Identified as Pan Endothelial Markers by St. Croix et al., Genes expressed in human tumor endothelium. 5 Science 289:1197-1202,2000.

PCTWL02/00051 Example 4 Result of the analysis showing the non-identifiable TAG's derived from ESTs of genes with unknown function with increased expression in Kaposi's Sarcoma SAGE libraries KS3 and KS4 compared to libraries KSl and KS2. The TAG numbers are first normalized to a level of 100.000 total TAG's sequenced per library to allow comparison between the libraries and comparison with other libraries in the public domain.

The sequence catg precedes each TAG sequence given in column 2 of table 2.

Table 2. Overview of identifiable TAG's over-expressed in SAGE libraries KS3 and KS4.

No.

TAG sequence (5' -> 3') Unigene no.

ID overexpression factor1 1. aaatcaataca Hs94953 EST 4-10 2. tggtaactggc Hsl08741 EST 4-10 3. tctgcactgag Hsl73789 EST 2-4 4. caggctgctgg Hs60440 EST 4-30 . atgacagatgg Hsl3775 EST -10 6. gcacaacaaga Hs236510 EST 3-10 7. ccacaggagaa Hs23579 EST 4-10 8. ctgtgcggaac Hs46987 EST 2-10 9. gatggctgcct Hsl8104 EST 4-20 . ctccattgcca Hs31869 EST 2-10 11 acctccactgg Hs112457 EST Unique2 1. TAG numbers of appearance were normalized to library sizes of 100.000 TAG's 2. This TAG does not appear in any other SAGE library than our own libraries and seems to be a unique new indicator gene for angiogenesis. 21 Example 5 Kaposi's sarcoma skin tissue was obtained from the same two AIDS patients mentioned in example 1 from whom SAGE libraries KS3 and KS4 were made. Both patients were homosexual men and were infected at the beginning of the 5 H3V-1 epidemic in Europe. Patient 1 born in Indonesia was demonstrated to be HIV-1 positive in 1982. In February 1985 a histological examination confirmed the diagnosis of Kaposi's sarcoma. He died 13 month later and postmortem examination revealed morphological variants of visceral KS. Patient 2 presented in February 1984 at the Academic Medical Centre with progressive 10 KS skin lesions. During follow-up the KS progressed to the intestines, oropharynx, lung, tongue, sinus piriformis and lymph nodes. In March 1986 the patient died and autopsy took place. The biopsies of said two patients were named KS3 and KS4.

Normal adult breast skin tissue was obtained as discarded tissue from . reduction mammoplasties (obtained from the department of plastic Surgery of our hospital). RNA isolated of three breast reductions was used to construct the normal skin expression profile library.

The expression profiles of the biopsy samples were determined using the SAGE technology as described in example 2.

We sequenced ~ 47,000 TAG's from the four biopsies, 49,335 TAG's from the KS3 library, and 48,814 TAG's from the KS4 library. TAG lists (i.e. individual 25 TAG's plus the number of appearance) were compared with each other in USAGE, TAG sequences with the highest counts were identified with the amct2g database available in USAGE (which is an improved TAG identification compared with the SAGEmap database from CGAP (available from GenBank), Secondly, TAG lists were mapped to chromosome locations 30 with the HTM program, and at the same time compared with specific TAG 22 lists (e.g. vascular endothelium, publicly available), and with a compilation of all TAG lists in the SAGEmap database (designated "All" in HTM) TAG's belonging to genes specifically up regulated in KS3 and KS 4 identified (Table 1). Nucleotide 15 was determined from the original diTAG list in USAGE. The TAG sequence of 15 nt. was checked with GenBank (BLAST) to confirm its identification. A few TAG's were eliminated because of ambiguity in the 15th nucleotide, or because of misidentification.

Example 6 Result of the analysis showing the identifiable TAG's derived from known genes with increased expression in Kaposi's Sarcoma SAGE libraries KS3 and KS4 compared to the public libraries of National Center for Biotechnology Information. The TAG numbers are first normalized to a level of 100.000 total TAG's sequenced per library to allow comparison between the libraries and comparison with other libraries in the public domain.

The sequence catg precedes each TAG sequence given in column 2 of table 3.

WO 02/059558 PCT/NL02/00051 23 Table 3. Overview of identifiable tag's overexpressed in SAGE libraries KS3 and KS4 Tag number Tag sequence Umgene no.

ID overexpressed TAG007 gatgtgcacga Hsl17729 Keratin 14 -14 TAG010 ccccagtcggc Hsl71596 Eph A2 (angiogenesis) 3 TAG011 cttgacatacc Hsl71695 Dual specificity phosphatase 3 TAG012 catcacggatc Hs82112 IL1 receptor, type 1* -30 TAG013 ggccaaaggcc Hs78436 Sorting nexin 17 >2 TAG014 ttgcatatcag Hs82237 AT group D protein -15 TAG015 ccctgttcagc Hs78824 Tie l*(angiogenesis) 2-5 TAG016 gatcaatcagt Hsl6530 Small ind. cytokine A18 -20 TAG017 gagggtgccaa Hs898 Complement eomp. 1QB -10 TAG018 taaacctgctg Hs99923 galectin 7(specific) 3-10 TAG019 gtggccagagg Hsl420 FGFR3 (activated in carcinomas, angiogenesis) 2-5 TAG020 tctggcccagc Hsl83 DAEC (Duffy blood group) 8-1Q TAG021 caggtcgctac Hs75066 Translin(involved in translocations) 2-6 TAG022 gagcagcgccc Hsl12408 Psoriasin (S100 A7) > 20 (specific) TAG033 acttattatgc Hs76152 Decorin (connective tissue) 2-10 TAG034 caggcctggcc Hs288761 Hypothetical protein FLJ21749 2-4 TAG035 gtgcggaggac Hsl81062 Serum amyloid Al -14 TAG036 acagcggcaat Hs74316 Desmoplakin -10 TAG037 caggtttcata Hs24395 Small ind. cytokine, B14 (BRAK) -10 TAG038 aactctgaccc Hs93675 Decidual protein induced by progesterone* 3-10 identified as Pan EndotheKal Markers by St. Croix et al., Genes expressed in human tumor endothelium. Science 289:1197-1202, 2000. 24 Example 7 Result of the analysis showing the non-identifiable TAG's derived from EST's of genes with unknown function with increased expression in Kaposi's Sarcoma SAGE libraries KS3 and KS4 compared to libraries KS1 and KS2. The TAG numbers are first normalized to a level of 100.000 total TAG's sequenced per library to allow comparison between the libraries and comparison with other libraries in the public domain.

The sequence catg precedes each TAG sequence given in column 2 of table 4.

Table 4.

Overview of identifiable tag's over-expressed in SAGE libraries KS3 and KS4 Tag number.

Tag sequence (5'>3') Unigene no.

ID overexpressed TAG023 aaatcaataca Hs94953 EST 4-10 TAG024 tggtaactggc Hsl08741 EST 4-10 TAG025 tctgcactgag Hsl73789 EST 2-4 TAG026 caggctgctgg Hs60440 EST 4-30 TAG027 atgacagatgg Hsl3775 EST -10 TAG028 gcacaacaaga Hs236510 EST 3-10 TAG029 ccacaggagaa Hs23579 EST 4-10 TAG030 ctgtgcggaac Hs46987 EST 2-10 TAG031 gatggctgcct Hsl8104 EST 4-20 TAG032 ctccattgcca Hs31869 EST 2-10 TAG004 acctccactgg Hsl12457 EST Unique* This tag does not appear in any other SAGE library than our own libraries and seems to be unique new indicator gene for angiogenesis,.

The overexpressed TAG's listed in tables 3 and 4 are the same as in tables 1 and 2, respectively. This shows that the expression pattern after treatment is comparable with the expression pattern of healthy individuals with normal expression patterns.

Example 8 Using an RT-PCR based method we were able to determine that TAG 11 (table 2) / TAG 004 (table 4) indeed represents a differently expressed gene. RNA was isolated from a KS lesion and the first strand cDNA synthesis was primed with an oligo(dT) primer with a 5' M13 tail (5'CTA GTT GTA AAA CGA CGG CCA 10 G-(T)24 3'). Ten microliter total RNA was used, plus primer and 5 j-il RT-mix (50 mM Tris, pH 8.3, 75mM KC1, 3 mM MgCk,10 mM DTT), 80 mM dNTPs and 20 units RNAsin were added, followed by an incubation for 3 minutes at 65°C and chilled on ice. The RT reaction starts by adding 5 units AMV RT followed by an incubation of 45 minutes at 42°C. For the PCR we used a 19-base TAG-. 15 specific primer (which consisted of 11 nt identified in the sage with a 5' NLAIII restriction site and 5 inosine nucleotides to increase the annealing temperature of the primers) and the —21M13 primer. The RT-mix was added to 80 pi PCR mixture containing the 100 ng of each primers (-21ml3 PRIMER: 5' GTA AAA CGA CGG CCA GT 3' and 5' III IIC ATG ACC TCC ACT GG 3'), 20 50mM Tris (pH8.3), 20 mMKCl, 0.1 mgBSA per ml, dNTPs (0.1 mM each), 2,4 mM MgCk, and 2 units Taq polymerase. After incubation of 5 minutes at 94°C, the reaction was subjected to 35 cycles of amplification in a thermocycler (9700 Perkin-Elmer). A cycle included denaturation for 1 minute at 95°C, annealing for 1 minute at 55°C and extension for 2 minutes at 72°C. The last cycle was 25 followed by 72°C incubation for 10 minutes.

The amplified fragment was cloned in to an AT plasmid (InvitroGen) and subsequently the insert was sequenced using the dye terminator sequencing kit from Applied Biosystems Inc. The fragment appeared to have a length of 26 102 base pairs and the sequence analysis of the fragment revealed the sequence as depicted in figure 1. This sequence was identical to an EST sequence identified from human foetal heart (GenBank acc. # AI217565 and others), which in turn matched a predicted exon on chromosome 19. A relation 5 with angiogenesis has not been described previously and is new.

Example 9 Confirmation of the identity of tag sequences.

A sequence consisting of 15 nucleotides should be enough to identify a 10 particular specific mRNA or gene. To confirm the identity of the tags we developed a RT-PCR using an oligo24dT primer for the RT-reaction. A 5'primer containing the tag sequence itself is used for second strand synthesis. The oligo24dT primer is extended at the 5'site extended with a —21M13 sequence. In the PCR following the RT-reaction -21M13 primer is used for the 15 amplification together with the 5'primer containing the tag sequence. The 'primer containing the tag sequence is extended with 5 Inosines at its 5'site to enlarge the binding capacity of this primer. The sequence of the amplified fragment can be determined to confirm that this is the gene as identified by the tag sequence. The RT-PCR reactions to confirm the tags were performed on 20 the same tissue samples that were used to prepare the expression profiles of tag sequences.

Procedure: Common buffers used throughout the experiments: lOx RT buffer: - 500 mM TRIS, pH 8.3 - 750 mM KCL - 30 mM MgCk - lOOmMDTT lOx PCR buffer: - 200 mM TRIS pH 8.3 - 500 mM KCL - 1 mg/ml BSA 1 ml TRIzol reagent (Invitrogen Life Technologies, cat. no. 15596) is added to 10-100 mg tissue or approximately 107 cells immediately (tissue is sliced 14|am thick by microtome).

The Total RNA isolation of the samples is performed according to the manufacturers protocol as follows: • Add 0.2 ml of Chloroform (Merck) and shake the tube vigorously by hand for 15 seconds.

• Incubate for 5 minutes at RT.

• Centrifuge the sample at no more than 12,000 x g for 15 minutes at 4°C.

• Transfer 600|ji of the colourless upper aqueous layer to a new tube. The lower organic layer should be red.

• Ad 0.5 ml isopropyl alcohol (Merck) and mix.

• Incubate at room temperature for 10 minutes.

• Centrifuge at no more than 12,000 x g for 15 minutes at 4°C.

• Discard the supernatant and wash the RNA pellet with 1 ml 80% ethanol by vortexing and centrifuge at no more than 7,500 x g at 4°C for 5 minutes and discard the supernatant.

• Place the tube at 56°C for 3 minutes to dry the pellet and proceed with the Poly A+ RNA isolation as described in the next section. 28 The Poly A+ mRNA isolation was performed according to the manual of Micro ■f Fasttrack © 2.0 Poly A+ mRNA 2.0 isolation kit as provided by the manufacturer (Invitrogen Corporation, Carlsbad USA; cat no K1520).

Subsequently the isolated poly A+ RNA was used as input for analysis in a RT-PCR reaction. The RT-PCR reactions started with the following mixture of ingredients: 21M13POLYT primer (100 ng/pl) 1.25 pi x RT buffer 2.0 pi 100 mM dNTP (Pharmacia) 0.8 pi U RNAsin (Roche) 0.3 pi dHzO (Baker) 0.65 pi • Add 10 pi of Poly A+ mRNA dilution to 5 pi of RT-mix.

• To anneal the primer to the template incubate the reaction mixture at 65°C for 5 minutes followed by cooling down to room temperature.

• Add 5pi lU/pl AMV-RT to the reaction mixture and perform the Reverse Transcription by incubating at 42°C for 45 minutes.

• After the Reverse Transcription immediately incubate the mixture at 95°C for 5 minutes to stop the reaction. Then let the reaction cool down to room temperature.

• Add 80 pi of PCR-mix to each reaction mixture (total volume is 100 pi). Prepare the PCR-mix per reaction as follows: - 5' primer (100 ng/pl), see table 5 1.0 pi - 21M13 (100 ng/pl) 1.0 pi - lOx PCR buffer 8.0 pi - 100 mM MgCh 2.1 pi - Amplitaq 5U/pl (Perkin Elmer) 0.4 pi - dEfeO (Baker) 67.5pi 29 • PCR amplification was performed in a 9700 DNA thermal cycler (Perkin Elmer) according to the following program. - 5 minutes 95 °C -1 minute 95 °C; 1 minute 55 °C; 2 minutes 72 °C, for 35 cycles -10 minutes 72 °C The TA-cloning of the RT-PCR products was performed according to the manual of TOPO TA Cloning® kit as provided by the manufacturer (Invitrogen Corporation, Carlsbad USA; cat no K4600) using the pCR® II-TOPO® Dual promoter vector and the TOP 10 One Shot® Cells.

Screening of the clones was performed using PCR with SP6 and T7 primers. As follows: • Resuspend the colony in 50jnl dEfeO (Baker). Add 1 |jl of this bacteria suspension to 10 pi of PCR mixture.

• Prepare the PCR-mixture per reaction as follows: • PCR amplification was performed in a 9700 DNA thermal cycler (Perkin Elmer) according to the following program. - 5 minutes 95 °C - 30 seconds 95 °C; 30 seconds 55 °C; 1 minutes 72 °C, for 25 cycles - 10 minutes 72 °C • Run 5 |4l of the Colony-PCR product on a 1.5% agarose lxTBE gel stained with EthidiumBromide.

SP6 (100 ng/yl) T7 (100 ng/fil) lOx PCR buffer 100 mM MgCb 0.10 pi 0.10 pi 1.00 ill 0.20 jul 0.08 pi 0.04 pi 7.48 p! 100 mM dNTP's (Pharmacia) Amplitaq 5U/|ul (Perkin Elmer) dEfeO (Baker) • Visualise the amplification products on a UV-illuminator to identify insert-containing clones.

Clones containing insert were sequenced from both directions using SP6 and T7 primers and the ABI Prism Big-Dye terminator cycle sequencing kit (Perkin Elmer Applied Biosystems, Foster City, Calif USA).

Table 5: Primers used for tag confirmation Tag name Sequence ID -21M13POLYT CTA GTT GTA AAA CGA CGG CCA GTT TTT T*PT TTT TTT TTT TTT TTT T RT-primer TAG007 in lie ATG GAT GTG CAC G keratin 14 TAG010 IE IIC ATG CCC CAG TCG GC ephrin A2 (angiogenesis) TAG011 UI IIC ATG CTT GAC ATA CC dual specificity phosphatase TAG012 HI IIC ATG CAT CAC GGA TC IL1 receptor, type 1 TAG013 m IIC ATG GGC CAA AGG CC Sorting Nexin 17 (SNX17) TAG014 01 IIC ATG TTG CAT ATC AG AT group D protein TAG015 III IIC ATG CCC TGT TCA GC Tie 1 (angiogenesis) TAG016 III IIC ATG GAT CAA TCA GT small ind. Cytokine A18 TAG017 III IIC ATG GAG GGT GCC AA complement comp. 1Q beta TAG018 m IIC ATG TAA ACC TGC TG galectin 7 (11 nt tag) TAG019 III IIC ATG GTG GCC AGA GG FGFR3 (11 nt tag) TAG020 01 IIC ATG TCT GGC CCA GC DARC TAG021 m IIC ATG CAG GTC GCT AC Translin TAG022 III IIC ATG GAG CAG CGC CC Psoriasin (S100 A7) (11 nt tag) TAG033 III IIC ATG ACT TAT TAT GC Decor in TAG034 III IIC ATG CAG GCC TGG CC Hypothetical protein FLJ21749 TAG035 IU IIC ATG GTG CGG AGG AC Serum amyloid TAG036 III IIC ATG ACA GCG GCA AT Desmoplakin TAG037 in IIC ATG CAG GTT TCA TA Small ind. Cytokine, B14 (BRAK) TAG038 III IIC ATG AAC TCT GAC CC Decidual protein induced by progesterone TAG023 IH IIC ATG AAA TCA ATA CA EST Unigene no. Hs94953 TAG024 IH IIC ATG TGG TAA CTG GC EST Unigene no. Hsl08741 TAG025 III IIC ATG TCT GCA CTG AG EST Unigene no. Hsl73789 TAG026 III IIC ATG CAG GCT GCT GG EST Unigene no. Hs60440 TAG027 III IIC ATG ATG ACA GAT GG EST Unigene no. Hsl3775 TAG028 III IIC ATG GCA CAA CAA GA EST Unigene no. Hs236510 TAG029 in IIC ATG CCA CAG GAG AA EST Unigene no. Hs23579 (PIG) TAG030 III IIC ATG CTG TGC GGA AC EST Unigene no. Hs46987 TAG031 III IIC ATG GAT GGC TGC CT EST Unigene no. Hsl8104 TAG032 III IIC ATG CTC CAT TGC CA Hs31869 siglec-1 or sialoadhesin TAG004 m IIC ATG ACC TCC ACT GG EST Unigene no. Hsll24557 PCTML02/00051 32 Results of Confirmation of tag sequences: Of 18 tag sequences that were analysed with the protocol as described in this example 14 were confirmed with sequences analysis using the RT-PCR with the oligo24dT primer and the tag-based primer as described above (tags 5 designated 004, 007, 011, 012, 014, 015, 016, 017, 022, 025, 029, 030, 032, 036 in table 5). Four tag sequences could not be confirmed based on this method (designated 010, 013, 018, 019). This was probably due to the fact that the tag-based primer was not specific enough or that the polyA tail of the mRNA was not long enough. For one tag an alternative more specific 5'primer was 10 designed to perform a RT-PCR together with -21M13POLYT (tag designated 004). For tagOlO a complete specific primer set was designed to perform as well the Reverse Transcription as the amplification. Other tags were confirmed by using a specific RT-PCR primer set followed by a Nested PCR with a specific nested primer set (tags designated 013, 018, 019). Sequence 15 results of all confirmations are listed below and in the figures. The tag sequence in the mRNA sequence if present is shown in bold fonts.

TAG004 (EST AI217565, genbank number BE466728): Confirmed with protocol from this example. 20 CATGACCTCCACTGGAAGAGGGGGCTAGCGTGAGCGCTGATTCTCAACCT ACCATAACTCTTTCCTGCCTCAGGAACTCCAATAAAACATTTTCCATCCA (Figure 1) TAG007 (keratin 14, genbank number XM_008578): Confirmed with protocol from this example.

CATGGATGTGCACGATGGCAAGGTGGTGTCCACCCACGAGCAGGTCCTT CGCACCAAGAACTGAGGCTGCCCAGCCCCGCTCAGGCCTAGGAGGCCCC CCGTGTGGACACAGATCCCACTGGAAGATCCCCTCTCCTGCCCAAGCACT TCACAGCTGGACCCTGCTTCACCCTCACCCCCTCCTGGCAATCAATACAG 30 CTTCATTATCTGAGTTGCTAAAAAAAAAAAAAAAAAAAAAAAAA (Figure 2) WO 02/059558 PCT/NL02/00051 33 TAG010 (ephrin A2, genbank number XM_002088): The RT-PCR with the 5'primer designed on the catg-site (the original primer shown in table 5) gave no confirmation. Most probably the tag-based primer is 5 not specific enough. Ephrin A2 specific primers were used for confirmation. The tag sequence is not included in the Ephrin specific RT-PCR. ATCTACCAGCTCATGATGCAGTGCTGGCAGCAGGAGCGTGCCCACCGCCC CAAGTTCGCTGACATCGTCAGCATCCTGGACAAGCTCATTCGTGCCCCTG ACTCCCTCAAGACCCTGGCTGACTTTGACCCCCGCGTGTCTATCCGGCTC 10 CCCAGCACGAGCGGCTCGGAGGGGGTGCCCTTCCGCACGGTGTCCGAGT GGCTGGAGTCCATCAAGATGCAGCAGTATACGGAGCACTTC (Figure 3) TAG011 (dual specificity phosphatase, genbank number XM_003720): 15 Confirmed with protocol from this example.

CATGCTTGACATACCTACCAGTATTATTCCCGACGACACATATACATATG AGAATATACCTTATTTATTTTTGTGTAGGTGTCTGCCTTCACAAATGTCAT TGTCTACTCCTAGAAGAACCAAATACCTCAATTTTTGTTTTTGAGTACTGT ACTATCCTGTAAATATATCTTAAGCAGGTTTGTTTTCAGCACTGATGGAAA 20 ATACCAGTGTTGGGTTTTTTTTTAGTTGCCAACAGtTGTATGTTTGCTGAT TATTTATGACCTGAAATAATATATTTCTTCTTCTAAGAAGACATTTTGTTAC ATAAGGATGACTTTTTTATACAATGGAATAAATTATGGCATTTCTATTG (Figure 4) TAG012 (IL1 receptor, type 1, genbank number XM_002686): Confirmed with protocol from this example.

CATGCATCACGGATCAATAGACTGTACTTATTTTCCAATAAAATTTTCAA ACTTTGTACTGTT (Figure 5) WO 02/059558 PCT/NL02/00051 34 TAG013 (ephrin Bl, genbank numbers XM_002535, BC002524): The RT-PCR with the 5'primer designed on the catg-site (the original primer shown in table 5) gave no confirmation. Most probably the tag-based primer is not specific enough. Ephrin Bl specific primers were used for confirmation. 5 The tag sequence is included in the 3'primer of the Ephrin Bl specific RT-PCR fragment. The Nested PCR fragment is shown here and is just located upstream of the tag sequence.

AACTTGCCCTGTGCCTGTGTCCCCCATGCTAGGGGCGGAGGGGTCTTTTC CTTCTTCTTTCCTACCTACCCCTTTTCTCTTGGCCAGGGGCCTCGTATCCT 10 ACCTTTCCTTGTCCCCTGGGCTGGCTGCACAGAGGATTGCCCCTTCTCTTT TCAGAGCTGGCCCTCGATGCCAAATTAGCATTTAGTATTTTGCTCAAAGTC TAAGGGACC (Figure 6) TAG014 (AT group D protein, genbank numbers XM_006184, AF230388): Confirmed with protocol from this example.

CATGTTGCATATCAGGGTGCTCAAGGATTGGAGAGGAGACAAAACCAGG AGCAGCACAGTGGGGACATCTCCCGTCTCAACAGCCCCAGGCCTATGGGG GCTCTGGAAGGATGGGCCAGCTTGCAGGGGTTGGGGAGGGAGACATCCA 20 GCTTGGGCTTTCCCCTTTGGAATAAACCATTGGTCTGTCACAAAAAAAAAA AAAAAAAAAAAAAAA (Figure 7) TAG015 (TIE 1, genbank number XM 002037): Confirmed with protocol from this example.

CATGCCCTGTTCAGCTACTCCCACTCCCGGCCTGTCATTCAGAAAAAAAT AAATGTTCTAATAAGCTCCAAAAAAAAAAAAAAAAAAAAAAAA (Figure 8) TAG016 (small ind. Cytokine A18, genbank numbers XM_008451, Y13710, AF111198): Confirmed with protocol from this example.

CATGGATCAATCAGTGTGATTAGCTTTCTCAGCAGACATTGTGCCATATG 5 TATCAAATGACAAATCTTTATTGAA.TGGTTTTGCTCAGCACCACCTTTTAA TATATTGGCAGTACTTATTATATAAAAGGTAAACCAGCATTCTCAAAAAAA AAAAAAAAAAA (Figure 9) TAG017 (complement comp. 1Q beta, genbank number XMJ310666): Confirmed with protocol from this example.

CATGGAGGGTGCCAACAGCATCTTTTCCGGGTTCCTGCTCTTTCCAGAT ATGGAGGCCTGACQTGTGGGCTGCTTCACATCCACCCCGGCTCCCCCTGC CAGCAACGCTCACTCTACCCCCAACACCACCCCTTGCCCAGCCAATGCAC 15 ACAGTAGGGCTTGGTGAATGCTGCTGAGTGAATGAGTAAATAAACTCTTC AAGGCC (Figure 10) TAG018 (galectin 7, genbank numbers NM_002307, U06643): 20 The RT-PCR with the 5'primer designed on the catg-site (the original primer shown in table 5) gave no confirmation. Most probably the tag-based primer is not specific enough. Galectin 7 specific primers were used for confirmation. The 5'primer used in the Galectin 7 specific RT-PCR contains the tag sequence. The tag sequence is included in the 5'primer of the Galectin 7 25 specific RT-PCR fragment. The Nested PCR fragment is shown here and is just located downstream of the tag sequence.

CGGCTGGACACGTCGGAGGTGGTCTTCAACAGCAAGGAGCAAGGCTCCT GGGGCCGCGAGGAGCGCGGGCCGGGCGTTCCTTTCCAGCGCGGGCAGCC CTTCGAGGTGCTCATCATCGCGTCAGACGACGGCTTCAAGGCCGTGGTTG 36 GGGACGCGCAGTAGCACCACTTCCGCC (Figure 11) TAG019 (FGFR3, genbank numbers NM_022965, NM_000142): 5 Tbe RT-PCR with the 5'primer designed on the catg-site (the original primer shown in table 5) gave no confirmation. Most probably the tag-based primer is not specific enough. FGFR3 specific primers were used for confirmation. The tag sequence is not included in the Ephrin specific RT-PCR. The Nested PCR fragment is shown here and is located upstream of the tag sequence. 10 CACAACCTCGACTACTACAAGAAGACAACCAACGGCCGGCTGCCCGTGAA GTGGATGGCGCCTGAGGCATTATTTGACCGAGTCTACACTCACCAGAGTG ACGTCTGGTCCTTTGGGGTCCTGCTCTGGGAGATCTTCACGCTGGGGGGC TCCCCGTACCCCGGCATCCCTGTGGAGGAGCTCTTCAAGCTGCTGAAGGA GGGC 15 (Figure 12) TAG022 (Psoriasin (S100 A7), genbank number XM_048120): Confirmed with protocol from this example.

CATGGAGCAGCGCCCTGTTCCGGGGGCAGCCAGTGACCCAGCCCCACC 20 AATGGGCCTCCAGAGACCCCAGGAACAATAAAATGTCTTCTCCCACC (Figure 13) TAG025 (EST Unigene no. Hsl73789, genbank numbers XM_018404, AL137262): Confirmed with protocol from this example.

CATGTCTGCACTGAGAAACTGCATTTCAGTAGCATTTGTCATCCAGCCG GAAGTTAAAGCACACTTACTTTATTCACCTATTTTTATAATAAACGTTCTT GCTGCTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (Figure 14) WO 02/059558 PCT/NL02/00051 37 TAG029 (PIG, genbank numbers XM_011453, AJ251830): Confirmed with protocol from this example.

CATGCCACAGGAGAATTCGGGGATTTGAGTTTCTCTGAATAGCATATAT ATGATGCATCGGATAGGTCATTATGATTTTTTACCATTTCGACTTACATAA TGAAAACCAATTCATTTTAAATATCAGATTATTATTTTGTAAGTTGTGGAA AAAGCTAATTGTAGTTTTCATTATGAAGTTTTCCCAATAAACCAGGTATTC TAAACTTGAAAAAAAAAAAAAAAAAAAAAAAA (Figure 15) TAG030 (EST Unigene no. Hs46987, genbank numbers DG151190, BG057289, BE858276, AV681759, BE503169): Confirmed with protocol from this example.

CATGCTGTGCGGAACTGCGTCAGGGCAAATGTCACAGCAGGATTTCCCC AACCCAGCTCCATCATCACAGACACAGAGGGCTGCAGGGGAGGCCTGCCC ACTGTTTTGTCGACTCTGCCCTCCTCTGGCAGCATAGATCCTTAGGTGCTC AATAAAGGTGTGCTGTATTGAAAAAAAAAAAAAAAAAAAAAAAA (Figure 16) TAG032 (SialoAdhesin, also called Siglec 1, genbank number XM_016245): 20 Confirmed with protocol from this example. ® CATGCTCCATTGCCAGACTCTTGCTGGGAGCCCGTCCAGAATGTCCTCC CAATAAAACTCCATCCTATGACGCAAAAAAAAAAAAAAAAAAAAAAAA (Figure 17) TAG036 (Desmoplakin, genbank numbers XM_004463, NM_004415, AF139065): Confirmed with protocol from this example.

CATGACAGCGGCAATCTTTTCTTTGGTCAAAGTTTTCTGTTTATTTTGCT TGTCATATTCGATGTACTTTAAGGTGTCTTTATGAAGTTTGCTATTCTGGC 30 AATAAACTTTTAGACTTTAAAAAAAAAAAAAAAAAAAAAAAA WO 02/059558 PCT/NL02/00051 38 (Figure 18) Example 10 Determination of the gene expression levels of the tag sequences in skin 5 samples To get a feeling for the use of the tag sequences as markers for angiogenesis process skin samples with (5 different samples) and without (2 control samples) Kaposi's Sarcoma lesions were analysed for the expression level of the genes identified by the tag sequences.

Procedure: 1 ml TRIzol reagent invitrogen Life Technologies, cat. no. 15596) is added to 10-100 mg tissue or approximately 107 cells immediately (tissue is sliced 14pm thick by microtome).

• Incubate for 5 minutes at RT.

• Centrifuge the sample at no more than 12,000 x g for 15 minutes at 4°C.

• Transfer 600pl of the colourless upper aqueous layer to a new tube. The lower organic layer should be red.

• Ad 0.5 ml isopropyl alcohol (Merck) and mix.

• Incubate at room temperature for 10 minutes. 26 • Centrifuge at no more than 12,000 x g for 15 minutes at 4°C.

• Place the tube at 56° C for 3 minutes to dry the pellet and proceed with 30 the DNase treatment as described in the next section. 39 To make sure no genomic DNA exists in the Total RNA isolate we perform a DNase treatment. Protection of RNA against RNase activity of DNase I is done by the addition of RNasin to the DNase reaction. The DNase treatment was 5 performed as follows: • After TRizol Total RNA isolation resuspend the pellet in 88 pi dEfeO.

• Add sequentially to the RNA solution: pi lOx DNase Buffer (Ambion) 1 pi 40U/pl RNasin (Roche) 10 1 pi 10 U/pl DNase I (Roche) • Incubate at 37°C for 1 hr.

• Raise sample volume to 200pl by adding 100 pi dHfeO.

• Add. 200 pi cold Phenol/Chloroform pH8 (PC8) and mix thoroughly.

• Centrifuge full speed for 5 minutes at room temperature in a 15 microcentrifuge.

• Transfer the aqueous top layer to a new microcentrifuge tube add sequentially: 3 pi glycogen (Roche) 100 pi 10 M ammonium acetate 20 - 700 pi 100% ethanol • Mix thoroughly and centrifuge at 25,000 x g for 15 minutes at 4°C and decant the supernatant.

• Wash twice by adding 700 pi 80 % ethanol. Mix thoroughly and centrifuge at 25,000 x g for 5 minutes at 4°C and decant the supernatant.

• Dry the pellet for 5 minutes at 56°C and resuspend in 11 pi dH^O.

• Dilute 1 pi of the RNA isolate in 140 pi dBfeO and calculate the RNA concentration and yield of the isolate through OD260 measurement. The yield of DNase treated Total RNA should at least be 13.5pg for the determination of the complete TAG expression profile. 40 • Prepare a solution of the RNA isolate with a concentration of 50 ng/pl. This is the starting RNA solution for the series of dilution for the TAG specific RT-PCR.

Per sample of DNase treated Total RNA 18 TAG specific RT-PCR/Nested PCR reactions are performed in series of dilution of the RNA. For each sample five control RT-PCR's will be performed in series of dilution namely HIV-1 GAG (SK39/145), GAPDH +RT (in duplo) and no-RT reaction (in 10 duplo). The following dilution scheme was used to derived the samples in serial dilution that are analysed with the RT-PCR: 1. 270 pi 50 ng/pl DNase treated Total RNA DNase treated. pi 50 ng/pl solution as input in RT-PCR of each primerset = 500ng. 15 2. 27 pi 50ng/pl Total RNA lOx diluted = 270 pi 5 ng/pl. pi 5 ng/pl solution as input in RT-PCR of each primerset = 50 ng. 3. 27 pi 5 ng/pl Total RNA lOx diluted = 270 pi 0.5 ng/pl. pi 0.5 ng/pl solution as input in RT-PCR of each primerset = 5 ng. 4. 27 pi 0.5 ng/pl Total RNA lOx diluted = 270 pi 0.05 ng/pl. 10 pi 0.05 ng/pl solution as input in RT-PCR of each primerset = 0.5 ng. . 27 pi 0.05 ng/pl Total RNA lOx diluted = 270 pi 0.005 ng/pl. pi 0.005 ng/pl solution as input in RT-PCR of each primerset = 0.05 ng. 6. 27 pi 0.005 ng/pl Total RNA lOx diluted = 270 pi 0.0005 ng/pl. 10 pi 0.0005 ng/pl solution as input in RT-PCR of each primerset = 0.005 ng. 7. 27pl 0.0005 ng/pl Total RNA lOx diluted = 270 pi 0.00005 ng/pl. pi 0.00005 ng/pl solution as input in RT-PCR of each primerset = 0.0005 ng. 8. 27 pi 0.00005 ng/pl Total RNA lOx diluted = 270 pi 0.000005 ng/pl. 41 pi 0.000005 ng/pl solution as input in RT-PCR of each primerset = 0.00005 ng.

TAG specific RT-PCR on Total RNA series of dilution using AMV-RT was performed as follows. The reverse Transcription Reactions of all the TAGs on DNase treated Total RNA in series of dilution are performed in 96 wells PCR plates. Ten pi of each Total RNA dilution is used as input for the RT PCR. The reaction volume of the Reverse Transcription is 20 pi and contains dNTP's, MgC12 and RNasin.

• Prepare the RT-mix per reaction as follows: • Add 10 pi of Total RNA dilution to 5 pi of RT-mix.

• Add 5pl lU/pl AMV-RT to the reaction mixture and perform the Reverse Transcription by incubating at 42°C for 45 minutes.

• After the Reverse Transcription immediately incubate mixture at 95°C for 5 minutes to stop the reaction. Then let the reaction cool down to room temperature.

• Add 80 pi of PCR-mix to each reaction mixture (total volume is 100 pi). Prepare the PCR-mix per reaction as follows: 3' primer (100 ng/pl) see table 6 x RT buffer 100 mM dNTP (Pharmacia) U RNAsin (Roche) &h2o (Baker) 1.25 pi 2.0 pi 0.8 pi 0.3 pi 0.65 pi ' primer (100 ng/pl) see table 6 1.0 pi lOx PCR buffer 8.0 pi 100 mM MgCb 1.9 pi 42 Amplitaq 5U/pl 0.4 pi dH20 (Baker) 68.7pl • PCR amplification is performed in a 9700 DNA thermal cycler (Perkin Elmer) according to the following program. - 5 minutes 95 °C -1 minute 95 °C; 1 minute 55 °C; 2 minutes 72 °C, for 35 cycles -10 minutes 72 °C Subsequent to this first round of amplification a second round, nested, 10 amplification was performed. TAG specific second round nested PCR on RT-PCR product was performed as follows: Add 5 pi of the TAG RT-PCR product in 45 pi of the Nested-PCR mix. • Prepare the Nested-PCR mix per reaction as follows: ' nested primer (100 ng/pl), see table 7 0.5 pi 3' nested primer (100 ng/pl), see table 7 0.5 pi lOx PCR buffer 5.0 pi 100 mM MgCL 1.25 pi 100 mM dNTP (Pharmacia) 0.4 pi Amplitaq 5U/pl 0.2 pi cfflfeO (Baker) 37.15pl The combination of primers used for amplification of the genes identified by the tags and the length of the amplified fragment is given in table 8.

• PCR amplification is performed in a 9700 DNA thermal cycler (Perkin Elmer) according to the following program. - 5 minutes 95 °C -1 minute 95 °C; 1 minute 55 °C; 2 minutes 72 °C, for 25 cycles 43 -10 minutes 72 °C • Run 10 pi of the Nested-PCR product on a 1.5% agarose lxTBE gel stained with EthidiumBromide.

• Visualization of the TAG amplified fragments in the dilution series on a UV-illuminator reveals the level of expression by determining the highest dilution still giving a positive signal. 44 Table 6. RT-PCR primer design for first round amplification.

S'TAGO^GENl ' !3'TAG029GENE Sequence ggc ctt taa cac ccc gtt cct. tgg tag gtt gagaatcagcgc tca 1agg aga cca aag gtc gct act gca ICAGTOC TOGGTG CGA^GAC<^"^"' ^ CAG^'^'ATOCAGTOCT_ . gtg ctc cgt ata ctg ctg cat ^ agtggg TAOATC aag tcc atc tga cactgg tat totc c a tcagtg ct"~"" taa AGTTGTj3ct gcttoapt'gga"" ^cacq t^gcctct ctttgc aot" ctc tac ccc aga gga att tac aga ' ^"^^(JCAATCA cag ]^C TCT ggc aac aag cag aag gcg gtc a~ tga'tct tga gct gca gct gct cct ; gaatgtgct ggt CGGaga gaa *"t' ggca^m/^jagagc t 7 * i.ttc tct ggc tgcccagcatca tga ^CAGGc)^^(yr^^cs^: tctact'act~t^""cct~acc a'" "l?n tgt tgg ggg tag agt gag cgt tgc t "igcaggt , j ^CTCAGAAMTCCT^GGAG^y' jctg acc gag'gac AACGTOATO AAG A" icat gat cat^a'g^"(^"gtg1»t " .....J |tag030gm_ llS'T^GOSOGENE^ li5TA^2(pNir^ |3TAG^2GENE^ |5TAGH6GENE' 3tag036gene lgqaacactcaagctgagag _ itct'ctg"gag" gcc cat tgg t ' |ltg ggg tca gga aca jct hgc aga .l-cc ggc tgg atg^ acaaatgctact] iotcaggtyr atctgg gctc^fca" " ^tca taa tga cctatc c(s tgc at' jctt gcamg atagga gag gctcca " ijatt gag cac cta agg atc tat gct ''" tree gaatca ggg acc aac agg aga_ iTOGg^nrTO^^GCT: iatt tag cag sg ttc^tat tgg gca ......... J "I iact isat'tag cxc ttc aga cgc act 45 Table 7. Nested-PCR primer design. k -/'"Primer Sequence .. •>■ ||5'TAG004GENE-2 CAT CGA CAA ATT GCG ATC T i3TAG004GENE-2 55'TAG007GENE-2J CGC TAG CCC CCT CTT CCA GT _ J AGG AGA TGA TTG GCA GCG T _ j J3'TAG007GENE-2 iGGA GGA GGT CAC ATC TCT GGA T | jS'TAGOlOGENE^ ij3TA^10G|NE-2' feTAQDiiG¥NE-2_ fS'TAGoilGEM-l |3'TA(Sl2GENE:2 i!5;m^l3GEK|-2 ii3'TAG013^>S"-2 :3Ti^014GENE^2 fe'TA^lSGENE-S; S3TAGO]^E^:2 |5'TA^1^6GE?TO-2 3'TAG016GENE-2 ?TA^17GENE-2 3'TAGO 17 GENE-2 ||5'TA^8GENE^F ISopi^SSi. ipTA^19G|M-|_ :!57TAG^2GENg-2" fe¥AG022QEl5^2" ij5^G025GENE-2' psfASMGENE-F ||5TAG029GE^2" ;(|iag<^ENE¥ :|5'TAG030GENE;2 teTAG030GENE^2^ feTTAG03l2G|S-r fTA^32(^M|:2 i^%AG036GENE;2 |gAGMfSSE£ i5TAG036GENE-2. 3'TAG036GENE-2. jccaagt tcg ctg acatcg t jjtgc tgg gga gcc gga tag aca "-igaa ^A^^ACtC^Z^Z. Z TAT AOTTAC^O'SA Gtl" 1 tcc aag act atg^a ^'l7 7 ^MTMctcgtga'^^T jAACttg cccTOT^TOTGT".'.1 ctt ctg cga gctgcatct ca "" __ ! agt gac agc tcc gtc t aga gga ggt tta tgt g^'ga II." (act^tccca^^ ijgt cctcgtctg cacicat"II" 7" &TGTAT ttc tgg acc cac ¥' 1gtc acc ttctgt_gactat gcc t '"^galggt cag gcc tcc ata tct ]cgg ctg sicaogtcas 71" in _ js^goa agt ggt ggt act i sc aac ctc gac tac tac a gcc ctc ctt cag cag ctt jttc aca aat aca cca gac gtg at j«¥«cgc tgc tcc atg gct ctg ct 1tgc c^ga^ggggt ggc t '*' 7l feretcagtg'cagacYtgtggct . 'Bag^ct'tct'^t^tto'caa'ct" " "" j^AT^^ATO ^G^AA^T71II "'"fictaatgcatgtaga asct^tj." iisgg^g^tto am cafi t"" J^CTTCliCTGG^TAGTC^CTlZ. '•wrssv-JE-'i: jagt ctg gca atg gag cat ga ifrgp. acc ttg act tca t _i7.1 ..Tjrcc aag tgt act gcttat7i77i l jcmgtagtc act tgg gag t~ "" " "" aacagc'ottac¥ . -. -.1 -»4£i 46 Table 8 Primer combinations and amplified fragment length in the Tag specific Nested PCR reactions Name 'primer name 3'primer name PCR fragment fTAG004 TAG007 fTAGOlO |tagoii [MG012 "TAG013 |TAG()14~ |!TAGp25 ] JTAG016 vr v... -3> isj-i&r i- TAG017 •..—va • J;TAG018 :TAG019 ' ' TAG004gene-2 15' TAG007gene-2.1 |5^AG010|ene-2 '"|5'"TAG6iigene-2 jfe' TAG012gene-2 js' TAG0i8gene-2 p' TAG014gene-2 §' TAG015gene-2 ~ 15' TAGO 16gene-2 2" 3' TAG004gene-2 ■sr.' .use «' i v ssssi — _|3;TAG0°7gene:2 L. , •J 3' TAGoiOgene-2 ^ ;3'TAG0ngene-2 ■ITAG025 |iTAG029 !iTAG03b TAG032 ifFAG036 lg TAGO 18gene-2 §5' TAG019gene-2 'fe'TA^2^Bn»-2 |5' TAG029gene-2 Jp' TAGQ3pgene-2 J5' TAG032gerie-2 life' T4G03§ie5i^r." IS' TAG014gene-2 _ 13' TAG016gene-2 _ - '' '^TACW^n^^ I 7lFr^pl9^ne-2_ ^ Il3' TAG022gene-2 . - Ji .

I |3'_TAG025gene-2 ;• "i?'. TAG^0|^ne-2~ "" ' TAG032gene-2"' ""I " ;|3'TAG036gene-2 n . -H 182 211 108' 239 197 212 243_ 131 •asasr-stt 219 IS] 175] 204 238 183] 141 179~ 223 191 t ... j .. ( j i Results The results of determination of the expression levels of the genes identified by the tag sequences are depicted in figure 19. The data clearly indicate that a number of the genes identified by the tag sequences have a higher expression in the skin samples with Kaposi's Sarcoma lesions compared to normal skin: tag007, tagOlO, tag012, tag013, tag014„ tag015, tag016, tag017, tag022, tag029, tag030, tag032 and tag036. 47 Example 11 Determination of the gene expression levels of the tag sequences in peripheral blood mononuclear cell (PBMC) samples To get a feeling for the use of the tag sequences as markers for angiogenesis 5 process in samples not from the location of the angiogenesis process, i.e. the Kaposi's Sarcoma in the skin or another tumour in the body but at an accessible sample from the blood (PBMC's) the expression of 5 tag identified genes was determined in PBMC samples. The PBMC samples were from the blood of patients with (4 different samples) and without (2 control samples) 10 Kaposi's Sarcoma lesions and were analysed for the expression level of 5 tag identified genes in PBMC's.

The procedure of the example was identical as described in example 10, with the exception that PBMC samples were used (approximately 10 million cells 15 per sample, ranging from 2.5 to 50 million) instead of skin biopsies. The genes that were analysed are identified by tag007, tag017, tagOlO, tag013, tag015, tag029 and tag032. The results of the analysis are depicted in figure 20. It is clear from these data that the elevated expression in the tumour sites of the genes identified by tag015 (TIE 1) and tag032 (Salioadhesin or Siglec 1) is 20 paralleled in the blood cell fraction, i.e. PBMC.

Results The data clearly show that the over expression of the gene identified by tag007 25 (Keratin 14) in skin samples (see example 5) is not paralleled in blood. In contrast, in the samples tested in this example the gene identified by tag007 is not expressed at all in the blood compartment. This shows that no tumour cells expressing tag007 are present in blood. As a consequence, measurement of tag007 in the blood could be a good indicator for the presence of these tumour WO 02/059558 PCT/NL02/00051 48 cells in the blood, and thus a marker for circulating cancer cells that can cause metastasis.

The up regulation of genes identified by tag015 (TIE 1) and tag032 (Saliodhesin or Siglec 1) in skin samples is clearly paralleled in the blood. 5 These two tags are higher expressed in blood from patients with tumours compared to healthy individuals. This up-regulation is due to up-regulation of expression in typical blood cells. The up-regulation cannot be due to the presence of tumour cells that express tag015 and tag032 in the blood, because the absence of expression of the gene identified by tag007 in the blood shows 10 that no tumour cells are present in blood, as explained above. This means that measurement of expression of tag015 and/or tag032 in the blood indicates the presence of a tumour somewhere else in the body. Furthermore, measurement of expression of genes identified by tag015 and/or tag032 during anti-tumour therapy and/or anti-angiogenesis therapy can be used to monitor the efficacy of 15 this treatment.

Conclusions The paralleled up-regulation of the genes identified with tag015 (TIE 1) and tag032 (Salioadhesin or Siglec 1) in both the tumour and the blood, enables the 20 monitoring of the efficacy of a therapy aimed at decreasing the growth of a tumour, in particular anti-angiogenic tumour treatment. This follows the reasoning that if these two genes are markers in PBMC for blood vessel formation in a tumour in another site in the body, these two markers in blood will also decrease with the decrease of this blood vessel growth at the tumour 25 site.

The genes identified by tag007 (Keratin 14), tag015 (TIE 1) and tag032 (Salioadhesin or Siglec 1) have different expression in the blood of patients with a tumour compared to normal individuals. Therefore these genes, in particular the expression thereof, can be used to screen a population at risk for 30 the presence of tumour in individual members of that population. 49 All the genes identified by tags in this study that have changed expression levels comparing normal to tumour tissue, i.e. tag007, tagOlO, tag012, tag013, tag014, tag015, tag016, tag017, tag022, tag029, tag030, tag032 andtag036 are encoding potential target molecules for therapeutic compound with anti-angiogenic effects applicable in tumour treatment, and/or these genes encode potential target molecules that can be potential target molecules for therapeutic compounds that stimulate the growth of blood vessel, for instance in the treatment of heart and coronary disease. 50 Brief description of the drawings Figure 1: Sequence involved in angiogenesis. A change of expression of this sequence after a certain treatment indicates that said treatment is effective. This sequence is identical to an EST sequence identified from human foetal heart (GenBank acc. # AI217565 and others), which in turn matches a predicted exon on chromosome 19. A relation with angiogenesis has not been described previously.

Figure 2-18: Sequences which are identified by name and Genbank numbers (NCBI database). Other identification can be found in tables 1-4 (Unigene numbers) that can be found in the SAGE databases of NCBI.

Figure 19. Mean expression levels and standard deviation depicted as log dilution factor that still is positive starting with 500 ng of total RNA isolated from 5 skin samples with Kaposi's Sarcoma (light bars) and 2 control, normal skin samples (dark bars).

Figure 20. Mean expression levels and standard deviation depicted as log dilution factor that still is positive starting with 500 ng of total RNA isolated from 4 PBMC samples of patients with Kaposi's Sarcoma (light bars) and 2 control, normal PBMC samples (dark bars). 51

Claims

WHAT WE CLAIM IS:

1. A method for determining whether a treatment is effective in changing a status of a certain set of target cells in an individual comprising: - determining whether a hemopoietic cell obtained from said individual after initiation of said treatment comprises an expression product of at least one marker gene.

2. A method according to claim 1, wherein said target cells comprise a tumor cell.

3. A method according to claim 1 or 2, wherein said hemopoietic cell has been obtained within a week of initiation of said treatment.

4. A method according to any one of claims 1-3, wherein said hemopoietic cell has been obtained within two days of initiation of said treatment.

5. A method according to any one of claims 1-4, wherein said marker gene comprises a gene involved in the generation, maintenance and/or breakdown of blood vessels.

6. A method according to any one of claims 1-5, wherein said marker gene comprises a sequence as depicted in table 1 or 2.

7. A method according to any one of claims 1-6, wherein said marker gene comprises a sequence as depicted in figure 1-18, or a part or analogue thereof.

8. A method according to any one of claims 1-7, wherein expression of said marker gene is quantified.

9. A method according to any one of claims 1-8, further comprising comparing expression of said marker gene with a reference.

10. A method according to any one of claims 2-9, wherein said tumor comprises Kaposi's Sarcoma.

11 • Use of a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, or a part or analogue thereof, in an expression product detection method wherein a hemopoietic cell of a blood sample is investigated.

12. Use of a proteinaceous molecule capable of specifically binding a protein encoded by a nucleic acid comprising a sequence as depicted in figure 1-18 and/or table 1 or 2, or a part or analogue thereof, in a detection method ^ wherein a hemopoietic cell of a blood sample is investigated. INTELLECTUAL PROP OF N.Z. - 8 JUL 52

13. A use according to claim 11 or claim 12 for determining the presence of a tumor cell in an individual.

14. A use according to claim 11 or claim 12 for determining the presence of a site of angiogenesis in an individual.

15- A use according to claim 11 for determining whether a treatment is effective in changing the status of a certain set of target cells in an individual.

16. A use according to any one of claims 11-15, for determining whether a treatment is effective in counteracting a tumor in an individual.

17. A use according to claim 13 or 16, wherein said tumor comprises Kaposi's Sarcoma.

18. A method according to any one of claims 1 -10 or a use according to any one of claims 11-17, wherein said hemopoietic cell comprises a peripheral blood mononuclear cell.

19. A method for determining whether an individual comprises a tumor cell and/or a site of angiogenesis comprising: determining whether a hemopoietic cell obtained from said individual comprises an expression product of at least one marker gene.

20. A method according to claim 19, wherein said marker gene comprises a sequence as depicted in table 1 or 2 and/or figure 1-18, or a part or analogue thereof.

21. A method for determining whether an individual comprises a non-hemopoietic tumor cell and/or a site of angiogenesis, said method comprising determining whether a hemopoietic cell from said patient comprises an altered amount of an expression product of a marker gene as compared with a reference value.

22. A method according to claim 21, wherein said marker gene comprises a gene involved in angiogenesis. INTELLECTUAL PROPERTY OFFICE OF N.2. - 8 JUL 2005 RECEIVED 53

23. A method according to claim 21 or 22, wherein said gene comprises a sequence as depicted in table 1 or 2, and/or figures 1-18, or a part or analogue thereof.

24. A method according to any one of claims 21 -23, wherein said hemopoietic cell comprises a peripheral blood mononuclear cell.

25. A method for determining whether a treatment is effective in altering an angiogenic process in an individual comprising: determining whether a hemopoietic cell obtained from said individual after initiation of said treatment comprises an expression product of at least one marker gene.

26. A method according to claim 25, wherein said treatment comprises counteracting angiogenesis in said individual.

27. A method according to claim 25 or claim 26, wherein said marker gene comprises a sequence as depicted in table 1, or table 2, or figures 1-18, or a part or analogue thereof.

28. A method according to any one of claims 25-27, wherein said hemopoietic cell comprises a peripheral blood mononuclear cell.

29. A method according to any one of claims 1-10 or 18-28, wherein said expression product comprises a TIE I sequence; a Salioadhesin or Siglec 1 sequence, a sequence as depicted in figure 8 or 17, or a part or analogue thereof.

30. A method according to claim 1 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

31.' A use according to claim 11 or claim 12 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. 54 A method according to claim 19 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. A method according to claim 21 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. A method according to claim 25 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. END OF CLAIMS