NZ526544A - Novel Probiotic Strain and Compositions - Google Patents

Abstract

Disclosed is the probiotic strain Lactobacillus reuteri DPC16 or more simply DPC16, its use in compositions and feed additives. DPC16 (and/or its fermentation products) show particular abilities in surviving and colonizing gastrointestinal system, in enhancing immunity, and in providing health benefits to the host.

Description

New Zealand Paient Spedficaiion for Paient Number 526544 S2&SVV- 1 New Zealand Patents Acts 1953 COMPLETE SPECIFICATION Probiotic Strain and Compositions We, MT ALBERT HEALTH RESEARCH LABORATORY, DRAGON PACIFIC LIMITED (currently called BIO ACTIVES RESEARCH NEW ZEALAND LIMITED), Auckland, New Zealand Hereby declare the invention, for which we pray that a patent may be granted to us and the method by which it is to be performed, to be particularly described in and by the following statement: intellectual property office of - 3 JAM RFC ir i v£D Probiotic Strain and Compositions Technical Field The present invention relates to so-called "probiotic" organisms (cells and/or fermentation products), and to compositions containing them, which are useful for promoting or maintaining the health and general well-being of humans and animals.

Background of the Art It is well known that the health and well-being of humans and animals can be positively or negatively influenced by the microorganisms, Which inhabit in the gastrointestinal tract. These microorganisms through the production of toxins, metabolic by-products, short chain fatty acids, and the like affect the physiological condition of the host. The constitution and quantity of the gut microflora can be influenced by conditions or stress induced by disease, life style, travel, and other factors. If microorganisms which positively affect the health and well-being of the individual can be encouraged to populate the gastrointestinal tract, this should improve the physiological well-being of the host.

The introduction of beneficial microorganisms, or probiotics, is normally accomplished by the ingestion of the organisms in drinks, yoghurt, tablets, capsules, and other forms. It is known that it would be desirable to not only deliver probiotic microorganisms to the gastrointestinal tract but also to provide a medium that would function to promote the growth of the microorganisms when they reach the lower part of the gastrointestinal tract.

Disclosure of the Invention By the invention we have identified a novel Lactobacillus reuteri strain (see its 16S rDNA sequence below) hereinafter referred to as strain Lactobacillus reuteri DPC16 (or DPC16), which is currently deposited at New Zealand Reference Culture Collection, Institute of Environmental Science & Research Limited, Kenepuru Science Centre, intellectual property OFFICE 01- - 3 JAM MIS RECEIVED Porirua, New Zealand. The accession number for the strain (also know as Lactobacillus reuteri LIU26 or Lactobacillus reuteri strain Liu 26) is "NZRM 4294".

SEQ ID NO:l Partial Sequence of 16S rDNA of Lactobacillus reuteri DPC16: TGGCTCAGGATGAACGCCGGCGGTGTGCCTAATACATGCAAGTCGTACGCACTGGCCC AACTGATTGATGGTGCTTGCACCTGATTGACGATGGATCACCAGTGAGTGGCGGACGG GTGAGTAACACGTAGGTAACCTGCCCCGGAGCGGGGGATAACATTTGGAAACAGATG CTAATACCGCATAACAACAAAAGCCACATGGCTTTTGTTTGAAAGATGGCTTTGGCTAT CACTCTGGGATGGACCTGCGGTGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGG CGATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACAATGGAACTGAGACACGGTC CATACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGGCGCAAGCCTGATGG AGCAACACCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAGCTCTGTTGTTGGAGAAG AACGTGCGTGAGAGTAACTGTTCACGCAGTGACGGTATCCAACCAGAAAGTCACGGCT AACTACGTGCCAGCAGCCGCGGTAATACGTAGGTGGCAAGCGTTATCCGGATTTATTG GGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACC GAAGAAGTGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCA TGTGTAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTGTC TGGTCTGCAACTGACGCTGAGGCTCGAAAGCATGGGTAGCGAACAGGATTAGATACCC TGGTAGTCCATGCCGTAAACGATGAGTGCTAGGTGTTGGAGGGTTTCCGCCCTTCAGTG CCGGAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCA AAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCTACG CGAAGAACCTTACCAGGTCTTGACATCTTGCGCTAACCTTAGAGATAAGGCGTTCCCTT CGGGGACGCAATGACAGGTGGTGCATGGTCGTCGTCAGCTCGTGTCGTGAGATGTTGG GTTAAGTCCCGCAACGAGCGCAACCCTTGTTACTAGTTGCCAGCATTAAGTTGGGCACT CTAGTGAGACTGCCGGTGACAAACCGGAGGAAGGTGGGGACGACGTCAGATCATCAT GCCCCTTATGACCTGGGCTACACACGTGCTACAATGGACGGTACAACGAGTCGCAAGC TCGCGAGAGTAAGCTAATCTCTTAAAGCCGTTCTCAGTTCGGACTGTAGGCTGCAACTC GCCTACACGAAGTCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGT TCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAAGTCG GTGGCCTAACCATTATGGAGGGAGCCGCCTAAGGCGGGACAGATGACTGGGGTGAAG TCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATC INTELLECTUAL PROPERTY OFFICE O v.Z - 3 JAN '/ma RECL tD DPC16 (and/or its fermentation products) shows particular favorable abilities in surviving and colonizing gastrointestinal system, in enhancing immunity, and in providing health benefits to the host. It has also been demonstrated that this organism (and/or fermentation products) is safe for consumption.

Administration of the strain to individuals, who, although exhibiting no disease symptoms, may nevertheless be susceptible to gastroenteric disorders, can help to maintain or indeed enhance their state of health. An example of such occasional disorder is "traveller' s diarrhoea", which may be induced by the stress of travelling or infection by a pathogenic microorganism not previously encountered by the traveller.

Further, the strain can advantageously be administered to animals, such as poultry, pigs, cattle, horses and domestic pets, etc.

More generally, the invention provides DPC16 organisms which are in a food grade condition and which if administered as a single oral dose of 1010 organisms to a human, maintain a faecal excretion rate of more than 104 the organisms per gram of wet faeces from said human for over 5 days post-dosing, and improve the balance of gastrointestinal microflora to a favorable status to human health.

In a further general embodiment, the invention provides DPC16 organisms which are in a food grade condition and which if administered as single daily oral doses each of 109 organisms, over a continuous period of 10 days, to a human, maintain a faecal excretion rate of more than 104 the organisms per gram of wet faeces from said human through the said period, and improve the balance of gastrointestinal microflora to a favorable status to human health.

In addition, the invention provides DPC16 strain (and/or its fermentation products) enhances host immunity and resistance to bacterial and viral pathogens, and other health benefits.

One embodiment of the invention resides in the newly identified strain DPC16. The invention extends to mutants and derivatives of the strain DPC16, which exhibits similar, or greater probiotic efficacy. The invention also extends to the bacterial cell lysate, enzyme, any part of strain DPC16, supernatant (and its extracts) after fermentation or growth of the strain in a medium, or any products of strain DPC16.

INTELLECTUAL PROPERTY OFFICE OF N Z - 3 JAN 2008 RECEIVED A further embodiment of the invention is the use of the strain DPC16 (and/or its fermentation products) in the manufacture of a composition for administration to a human or animal (such as a probiotic capsule, tablet, powder, drink, and other forms, or a probiotic additive in human foods or animal feeds). Such a composition can comprise, for example, organisms and/or products of the strain DPC16 in a pharmaceutically acceptable carrier. There are a variety of carriers, which are suitable for use in this invention including colostrum, milk powder, whey protein, whey powder, propolis, fish oil, omega 3, squalene, mussel extract, collagen, thymus extracts, deer velvet powder, deer blood, polysaccharides, oligosaccharides, starches, sugars, glucans, lecithin, sheep placenta, evening primrose oil, spirulina, etc. The invention is not, however, limited to these particular carriers in the solid, or liquid forms. The person skilled in the art would understand and recognize those carriers, which may be included in the compositions of the invention.

The invention also comprises other edible products such as fermented milk products, e.g. yoghurts, containing strain DPC16. Although strain DPC16 may be used to ferment milk, it is not necessary to use this strain or its products alone. If strain DPC16 is to be incorporated in a probiotic yoghurt, for example, it may be convenient to produce the yoghurt by means of a conventional yoghurt strain, and to add the DPC16 later. Non-milk based products can also be provided, such as soya, fruit juices, etc. The strain can also be incorporated in the aqueous phase of edible emulsions, such as margarine, lowfat spreads, or dressings, and be incorporated in other solid foods such as cheese, bread, etc.

The probiotic compositions will normally be packaged with instructions recommending a mode of administration to the human or animal, e.g. specific dosage quantity and frequency of administration.

Typically, product will contain at least about 103, preferably about 106, and ideally from about 108 to about 1010 DPC16 organisms per day's dose. However, for some of the compositions (in which there are other bioactive ingredients) will contain less level of DPC16 organisms.

The strains can be supplied commercially as a concentrate in an edible carrier. Another alternative is a freeze-dried composition containing DPC16 organisms and/or intellectual propfp OFFICE OF Ni„ - 3 JAN 6 fermentation products. Such compositions can be added to appropriate foodstuffs during manufacture of the foodstuffs, to provide probiotic products. Care should be taken that subsequent processing of the foodstuff does not lead to the loss of the desired probiotic activity.

In order that the nature of the present invention may be more clearly understood, preferred forms thereof will be described with reference to the following examples.

Modes for Carrying out the Invention Example 1: Selection of Probiotic Strain Certain bacterial strains have been shown to have health benefits for humans and animals. Unfortunately, some commonly used "probiotic" bacterial preparations have been found to have little efficacy due to their lack of: 1) resistance to the low pH and high concentration of bile in the digestive tract environment, 2) adhesion with mucosal surfaces of gastrointestinal tract, 3) efficiency in immunomodulation, and 4) ability to reduce the risk of pathogens in the gastrointestinal tract. Accordingly, these aspects have been used as important criteria for our research aiming on identifying new probiotic strains. More than 300 gastrointestinal bacterial isolates from healthy humans were screened to select strains with functional characteristics typical of probiotic bacteria. Following an initial screening of over 18 strains selected from the isolates; one was further identified as a probiotic strain (DPC16). Our results showed that this strain was able to survive at a low pH (3.0) and relatively high bile concentration (1.0%), comparing favorably in these respects to two commercial probiotic strains (Lactobacillus rhamnosus GG and Lactobacillus acidophilus LAI). It was also demonstrated that the strain had abilities to adhere to intestinal epithelial cells, to enhance immune cell activities, and to inhibit the growth of pathogens. The probiotic strain fermentation products (including but not limited to cell free supernatant of growth broth after culturing, reuterin, and others existing in the supernatant) had abilities to adhere to intestinal epithelial cells, to enhance immune cell activities, and/or to inhibit the growth of bacterial and viral pathogens (including but not limited to Salmonella typhimurium, Shigella dysenteriae, Escherichia intellectual PROPERTY office of n.z - 3 JAN 2008 R ECEJ..V £ r> coli 0157:H7, Escherichia coli K88, Campylobacter jejuni, Helicobacter pylori, Yersinia enterocolitica, Listeria moncytogenes, and Staphylococcus aureus, and rotavirus).

Example 2: Growth Media Although the strain DPC16 is able to grow in several nutritional balanced media, MRS medium (De Man et al., 1960) with 0.05% cysteine-HCl and/or a certain level of glycerol was one of the preferred media to be used to grow the strain.

Example 3: Health Promoting Properties After oral administration of DPC16 as a single oral dose of 1010 organisms to a human, it maintained a faecal excretion rate of at least 104 the organisms per gram of wet faeces from said human for more than 5 days post-dosing. Another study demonstrated that oral consumption of the organisms at a single daily doses of 109 organisms, over a continuous period of 10 days to a human, it maintained a faecal excretion rate of at least 104 the organisms per gram of wet faeces from said human through the period. The administration of the probiotic strain and/or its fermentation products improved the balance of gastrointestinal microflora to a favorable status to human health.

The immune enhancing and anti-infection properties of the probiotic strain and/or its fermentation products was also demonstrated in mouse and piglet models. The enhanced immune function included phagocytic activity, activity of natural killer cells, lymphocyte proliferation responses, and systemic as well as mucosal antibody responses. The health benefit to the host included enhanced resistance to pathogenic bacteria (Salmonella typhimurium, Shigella dysenteriae, Escherichia coli 0157:H7, Escherichia coli K88, Campylobacter jejuni, Helicobacter pylori, Yersinia enterocolitica, Listeria moncytogenes, and Staphylococcus aureus) and viruses (rotavirus).

The effects of DPC16 (cells and/or fermentation products) in promoting antioxidant and free radical scavenging activities were also demonstrated using established animal models. Rats (20-month-old for antioxidant activity, 4-month-old for free radical scavenging activity test) were housed under a 12-hour light/dark cycle at a controlled temperature and relative humidity with free access to water and food. After intellectual rropfptv office of n.2 - 3 JAN 2QU8 RFHFIVi ) 8 acclimatization, animals were randomised into different treatment groups on the basis of live weight. The treatment group was fed with probiotic strain. Non-probiotic organism was given to the controls. After four months, the rats were humanely killed, and samples taken for analysis of relevant parameters. The treatment group fed with the probiotic strain had significantly higher antioxidant and free radical scavenging activities, in comparison with the non-probiotic controls. In addition, experiments were conducted using established methods to test the effects of the probiotic strains on cholesterol and blood lipid levels. The results demonstrated that the DPC16 lowered the cholesterol and blood lipid levels. These results suggest that this probiotic strain and/or its fermentation products has health benefits for humans including immunomodulation, anti-infection, anti-aging, and improved heart health.

Our studies have also identified that consumption of probiotic compositions using DPC16, DPC16 cell free cultured supernatant, extracts of DPC16 cells or its cultured supernatant (including but not limited to reuterin), and other products of DPC16 in combination with supporting materials such as colostrum, whey powder, whey protein, milk powder, fish oil, omega 3, squalene, propolis, cartilage extract, thymus extract, deer velvet and/or deer blood powder, collagen, starch, polysaccharides, oligosaccharides can confer health benefits as mentioned above. Some combinations (including Probiotics-Colostrum, Probiotics-Whey Protein, Probiotics-Propolis, Probiotics-Omega 3, Probiotics-Squalene, Probiotics-Whey Powder, Probiotics-polysaccharides, Probiotics-Oligosaccharides, Probiotics-Collagen, etc) can provide a better health benefits, in comparison with the use of the probiotic strain alone. Human clinical trials have also verified the health benefits of the probiotics as mentioned above. Representative research results about the health benefits of the combinations are given below: Health-vromotins: Properties ofProbiotics-Colostrum The studies demonstrate the health benefits of dietary supplement tablets containing DPC16 (cells and/or fermentation products) and colostrum powder. The key components of the tablets include DPC16 cells with either 1) colostrum powder, or 2) colostrum powder fortified with calcium, or 3) colostrum powder fortified with vitamins and intellectual PROPEPtv office of n.2 - 3 JAN 201)5 rTN-IT* /^.fr i.t. .~v minerals. During the experimentation, the tablets were ground to a fine powder and then used for in vitro and in vivo studies. Observed health benefits included immune-enhancing and anti-infection properties. Enhanced immune function was demonstrated by the activity of phagocytes and natural killer cells, lymphocyte proliferation, and systemic as well as mucosal antibody responses. Anti-infection properties were demonstrated by enhanced resistance to pathogenic bacteria (Campylobacter jejuni, Helicobacter pylori, Salmonella typhimurium, Escherichia coli 0157:H7, Staphylococcus aureus, Listeria moncytogenes) and rotavirus. Additional health benefits were also observed including lowering cholesterol and blood lipid levels, and enhanced antioxidant and free radical scavenging activities. Significantly enhanced body weight gain was also observed. The studies suggest that the Probiotics-Colostrum tablets are health promoting dietary supplements.

Health-vromotins Proverties ofProbiocavs The studies have demonstrated health benefits of a dietary supplement capsule (Probiocaps) mainly containing DPC16 (cells and/or fermentation products) and whey protein powder. During the experimentation, the capsules were broken and then used for in vitro and in vivo studies. Observed health benefits include immune-enhancing and anti-infection properties. Enhanced immune function was demonstrated by the activity of phagocytes and natural killer cells, lymphocyte proliferation, and systemic as well as mucosal antibody responses. Anti-infection properties were demonstrated by enhanced resistance to pathogenic bacteria (Campylobacter jejuni, Helicobacter pylori, Salmonella typhimurium, Escherichia coli 0157:H7, Staphylococcus aureus, Listeria monocytogenes) and rotavirus. Other health benefits were also observed including the lowering of cholesterol and blood lipid levels, and enhanced antioxidant and free radical scavenging activities. Our studies suggest that the Probiocaps is a health-promoting dietary supplement. intellectual prop^ptv office of n - 3 JAN't- Health-vromotins Properties of Probiovolis Our studies have demonstrated the health benefits of dietary supplement capsule (Probiopolis capsule) or drink (Probiopolis drink) mainly containing DPC16 (cells and/or fermentation products) and propolis. In these experiments, the Probiopolis capsules were broken and then used for in vitro and in vivo studies, while the Probiopolis drink (liquid form) was used in original or diluted strengths for in vitro and in vivo studies. Health benefits included immune-enhancing and anti-infection properties. Enhanced immune function was demonstrated by the activity of phagocytes and natural killer cells, lymphocyte proliferation, and systemic as well as mucosal antibody responses. Anti-infection properties were demonstrated by enhanced resistance to pathogenic bacteria and rotavirus. A significant reduction (P<0.01) in translocation of bacteria to the liver of infected animals was observed with Probiopolis treatment in comparison with the controls. Other health benefits were also observed including enhanced antioxidant and free radical scavenging activities. The results suggest that Probiopolis capsule or drink can enhance human health.

Health-promoting Properties of Probio-Omesa 3 and Probio-Saualene Our studies have further demonstrated the health benefits of dietary supplement capsules (Probio-Omega 3 or Probio-Squalene) mainly containing DPC16 strain (cells and/or fermentation products) and Omega 3 or Squalene. In these experiments, the Probio-Omega 3 or Probio-Squlene capsules was broken and then used for in vitro and in vivo studies. Health benefits included immune-enhancing and anti-infection properties. Enhanced immune function was demonstrated by the activity of phagocytes and natural killer cells, lymphocyte proliferation, and systemic as well as mucosal antibody responses. Anti-infection properties were demonstrated by enhanced resistance to pathogenic bacteria and rotavirus. Other health benefits were also observed including enhanced antioxidant and free radical scavenging activities. The results suggest that Probio-Omega 3 and Probio-Squlene capsules can enhance human health.

Example 4: Safety Assessment intellectual propfptv office of \.i - 3 JAN RFOF D

Claims (5)

11 To evaluate their safety, a series of experiments were carried out both in vitro and in vivo. The ability of DPC16 (cells and/or fermentation products) and/or compositions (mentioned in Example 3) to degrade gastric mucin in vitro was investigated using SDS-PAGE and petri dish techniques. The total carbohydrate and protein concentrations in mucin suspensions inoculated with test strain were measured. In addition, the acute, subacute and chronic oral toxicity of the probiotic strain and/or compositions were assessed in BALB/c mice. The results of these experiments showed that the probiotic strain and/or compositions had no mucinolytic activity in vitro. SDS-PAGE analysis did not reveal any de novo fragments in the mucin solution incubated with test probiotics, and no mucinolytic zone was demonstrated on agarose petri dishes inoculated with test probiotics. In addition, toxicity trials demonstrated that they had no adverse effects on animal health. These results suggest that DPC16 (cells and/or fermentation products) and/or compositions are non-pathogenic and non-toxic and are safe for human consumption. Additional safety studies have been carried out in vivo. These include experiments to test the acute, sub-acute and chronic oral toxicity of combinations of DPC16 (or its products) and colostrum (Probiotics-Colostrum), whey protein (Probiocaps), propolis (Probiopolis Capsule or Probiopolis Drink), Omega 3 (Probio-Omega 3), or squalene (Probio-Squalene) as mentioned above in animal models and to evaluate the safety using human subjects. The results indicate that the Probiotics-Colostrum, Probiocaps, Probiopolis, Probio-Omega 3, or Probio-Squalene had no adverse effects on animal and human subjects, suggesting that the health-promoting dietary supplements containing DPC16 and/or its products (Probiotics-Colostrum, Probiocaps, Probiopolis, Probio-Omega 3, and Probio-Squalene) are safe for human consumption. intellectual propertv office of n.z - 3 JAN 2008 RECEIVE 12 Claims

1. A probiotic strain Lactobacillus reuteri comprising a 16S rDNA sequence of SEQ ID NO:l (also know as Lactobacillus reuteri DPC16).

2. Compositions comprising the probiotic strain of claim 1 and/or its fermentation products and a carrier.

3. Compositions of claim 2 comprising whole cells, cell lysatse, and fermentation products, supernatant and extracts thereof after fermentation or growth of said cells in a medium, or products from said probiotic strain of claim 1.

4. The above compositions comprising a pharmaceutically or commercially acceptable carrier/s including colostrums, whey protein, whey powder, propolis, royal jelly, collagen, thymus extracts, deer velvet powder, omega 3, squalene, fish oil, mussel extract, polysaccharides, oligosaccharides, kiwifruit extracts, fruit freeze dry powder, starches, sugars, glucans, gelatin, milk powder, vegetable extracts/freeze dry powder, liquid milk, fermented milk, and fruit juice.

5. A capsule, tablet, powder, drink, yoghurt, milk, juice, any other feed or feed additive for human or animal consumption containing the probiotic strain of claim 1, or cell lysatse of the strain, or supernatant (or its extracts) after fermentation or growth of the cells in a medium, or any fermentation product(s) of the organism. Applicant: Mt Albert Health Research Laboratory Dragon Pacific Limited (Currently called Bioactives Research New Zealand Limited) Date: 22 October 2004 Owner: The Weidapac Trust (Trustee: Weidapac Trustee Limited) INTELLECTUAL PROPERTY OFFICE OF N.Z. - 3 JAN 21)08 RECEIVED