NZ521434A - Novel allergen - Google Patents

Abstract

A polypeptide encoding an IgE binding antigen (allergen) obtained from Trichostrongylus colubriformis and methods of determining the immune status of a non-human animal to a nematode infection using said allergen.

Description

521434 PATENTS FORM NO. 5 Fee No. 4: $250.00 IPONZ SEP 200) PATENTS ACT 1953 COMPLETE SPECIFICATION After Provisional No: 521434 and 52377^ Dated: 13 September 2002 and 24 January 2003? NOVEL ALLERGEN We AgResearch Limited, a New Zealand company of East Street, Ruakura Campus, Hamilton, New Zealand hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed to be particularly described in and by the following statement: 1 Our Ref: 31230/3 VM PATENTS FORM NO. 5 Fee No. 4: $250.00 PATENTS ACT 1953 COMPLETE SPECIFICATION After Provisional No: 521434 Dated: 13 September 2002 NOVEL ALLERGEN We AgResearch Limited, a New Zealand company of East Street, Ruakura Campus, Hamilton, New Zealand hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed to be particularly described in and by the following statement: 1 Cu Our Ref: 31230/3 VM Intellectual Property Office of NZ ! 5 SEP 2003 received NOVEL ALLERGEN TECHNICAL FIELD The present invention relates to novel allergens. The present invention is broadly directed to novel nematode allergens (polypeptides) and associated amino acid 5 and nucleotide sequences including functional fragments and variants thereof. The invention broadly concerns allergens obtained from, nematodes of the superfamily Trichostrongyloidea. In particular, the present invention concerns the use of the above molecules to identify animals that are naturally resistant to parasitic nematodes to assist with selective breeding of animals that are innately 10 more disposed to develop immune resistance to, in particular but by no means exclusively, nematode infections in sheep and cattle.

BACKGROUND TO THE INVENTION The molecules of the present invention are most preferably, but not necessarily exclusively, derived from Ostertagia circumcincta (Teladorsagia circumcincta) and 15 Trichostrongylus colubriformis and have application in reducing the impact of these nematodes or similar nematodes on animals as discussed herein. For ease of reference only the background to the present invention will now be described in relation to Trichostrongylus colubriformis infection. However, it will be appreciated by those skilled in the art that such description is also of general application to 20 most nematodes of the superfamily Trichostrongyloidea.

Trichostrongylus colubriformis is a nematode parasite which infects the small intestine of sheep and is of significant economic importance in New Zealand and many other countries worldwide. These parasites have a simple life cycle consisting of free-living stages on pasture (egg to infective larvae, L3), and after 25 ingestion, develop through L4-L5-adult in the host gastrointestinal tract. They do 2 Our Ref: 31230/3 VM not have a tissue migratory phase. T. colubriformis live in mucus covered tunnels eroded on the surface of duodenal and intestinal villi.

Presently the only effective means of controlling T. colubriformis and other nematodes that infect sheep is through the use of anthelmintics.

Sheep can develop natural immunity to T. colubriformis following repeated natural infections. Development of immunity to nematode establishment requires at least seven weeks of continuous infection (Dobson et al 1990). Thus, in the past sheep were effectively immunised by two or three periods of truncated infections, each followed by a treatment with an anthelmintic to remove infection 10-14 days later.

However, a major drawback with conventional anthelmintics is that nematode resistance to a broad spectrum of anthelmintics is now becoming increasingly more widespread and is therefore of serious concern. (Waller, 1997; Sangster et al, 1999; Van Wyk etal, 1999).

Various studies have suggested that immunity to T. colubriformis involve the 15 development of Th2-type immune responses involving hypersensitivity type events. These responses include increased mast cell, globule leucocytes and eosinophil numbers in the intestinal mucosa. Elevated serum IgE levels have also been associated with immunity to nematode infections (Shaw et al., 1998a & b). One possible role of parasite-specific IgE in resistance to nematode infection is its 20 involvement in immediate hypersensitivity reactions, where cross-linking of specific IgE on mucosal mast cells by antigen promotes their degranulation, which in sheep results in the formation of globule leukocytes. The resultant release of inflammatory mediators is considered to be a major mechanism involved in the rejection of parasites in immune sheep. The release of inflammatory mediators 25 may cause a deterioration of the intestinal microenvironment and consequent expulsion of nematode parasites. The inflammatory response may also allow the 3 OurRef: 31230/3 VM leakage of immunoglobulins into the intestinal lumen and which may also assist in the expulsion of nematodes from the gastrointestinal tract.

Antigens that elicit hypersensitivity reactions by binding to IgE (i.e. allergens) are therefore useful in diagnostic assays to identify immune animals with a Th2-type 5 hypersensitivity immune response. Thus, such antigens are useful in selective breeding programs for producing animals that are resistant to nematodes.

A major novel allergen of Trichostrongylus colubriformis, Tco-Aspin with a molecular weight of 31 kDa, pi 5.1 on 2-D electrophoresis gels has been identified by the inventors and its nucleotide and polypeptide sequence determined. It 10 shares a degree of homology with a number of proteins identified as nematode aspartyl protease inhibitors. From Onchocerca volvulus an aspartyl protease inhibitor-like protein has been cloned by a number of investigators. Ov33-3 (Lucius, et al., 1988) an immunodominant antigen recognised by 96% of onchocerciasis patients; Oc3.6 (Chandrashekar, et al., 1991); OvD5B (Celine Nkenfou, Thesis, / "Molecular Cloning of Genes Coding Antigens Specific For Onchocerca volvulus: Evaluation of Expressed Proteins For Use In The Diagnosis Of Onchocerciasis" University of Cameroon (1993). Orthologs have been found in Brugia malayi (Bm33) (Dissanayake 1993), Acanthocheilonema viteae (Av33) (Willenbucher, et al., 1993), Dirofilaria immitis (DiT33) (Maja, et al., 1994, Frank et al., 1998), 20 Parelaphostrongylus tenuis (Ptpi) (Duffy et al., 2002) and Ostertagia ostertagi (Claerebout et al.,2002).

Some of these have been used successfully to diagnose important filarial infections of humans including O. volvulus (Chandrashekar, et al., 1991 & 1996) and B. malayi (Chandrashekar, etal., 1994; Dissanayake , etal., 1993).

However, at present there remains a need to identify allergens for nematode infections in animals, particularly sheep and cattle, and which can be used to 4 Our Ref: 31230/3 VM diagnose those animals which are naturally inclined to develop immune resistance to nematode infection. Thus, the existence of such allergens may be useful in selective breeding programs for animals innately more disposed to develop immune resistance.

It is an object of the present invention to address the foregoing problems or at least to provide the public with a useful choice.

Further aspects and advantages of the present invention will become apparent from the ensuing description which is given by way of example only.

All references, including any patents or patent applications, cited in this 10 specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not 15 constitute an admission that any of these documents form part of the common general knowledge in the art, in New Zealand or in any other country.

SUMMARY OF INVENTION The present invention is broadly directed to novel nematode allergens (polypeptides) and associated amino acid and nucleotide sequences including 20 functional fragments and variants thereof to identify animals that are capable of becoming naturally resistant to nematodes. In particular, the present invention concerns the use of these molecules to, assist in selective breeding of animals capable of becoming naturally resistant to nematode infections. More, particularly, the invention is directed towards the use of nucleic acid molecules and 25 polypeptides, which are the same or functional variants of, aspartyl protease inhibitors: (Tco-Aspin), of Trichostrongylus colubriformis; and/or (Oc-Aspin), of OurRef: 31230/3 VM Ostertagia circumcincta; and/or (Hc-Aspin) Haemonchus contortus in identifying animals that are innately more disposed to develop immune resistance to nematodes.

The inventors have identified a number of IgE binding antigens (allergens) of T. 5 colubriformis, O.circumcinta and H.contortus, using western blotting techniques with purified IgE from various immune animals. Using 2-D electrophoresis, the target allergens have been isolated and identified using mass spectrometry. Recombinant allergen proteins were prepared and tested for their ability to bind IgE from the serum of animals with a history of nematode infection.

DISCLOSURE OF INVENTION According to a first aspect of the present invention there is provided an isolated polypeptide comprising: a) an amino acid sequence as set forth in any one of SEQ ID NOs. 1, 3, 5 or 7; or b) a functional fragment or variant of the polypeptides in a) above, wherein the fragment or variant provokes a humoral and/or cellular immunological response in an animal with similar characteristics to that produced by a polypeptide of as outlined in a) above.

According to a second aspect of the present invention there is provided an isolated 20 polypeptide substantially as described above wherein the functional fragment or variant incorporates a B cell or T cell epitope of the polypeptide.

In general the polypeptide may be derived from a nematode parasite of the superfamily Trichostrongyloidea. However, it should also be appreciated that the polypeptide may also be artificially synthesized for example recombinantly 25 synthesized 6 Our Ref: 31230/3 VM In particular, the polypeptide and/or nucleic acid molecule may be selected from a nematode parasite from the genera consisting of Trichostrongylus, Cooperia, Dictyocaulus, Haemonchus, Ostertagia or Teladorsagia.

Preferably, the nematode parasite maybe of the genera Trichostrongylus or Ostertagia preferably selected from the species consisting of either T. colubriformis or O. circumcincta (Teladorsagia circumcincta).

In a third aspect of the present invention there is provided an isolated nucleic acid molecule wherein the molecule: a) comprises a nucleotide sequence as set forth in any one of SEQ ID NOs. 2, 4, 6 or 8; b) is a functional fragment or variant of the molecule(s) in a); or c) is able to hybridise under stringent conditions to the molecule(s) in a) or b); or d) is a complement of the molecule(s) defined in a), b) or c); or e) is an anti-sense sequence corresponding to any of the sequences in a) - d).

In a fourth aspect of the present invention there is provided an isolated nucleic acid molecule encoding a polypeptide substantially as described above.

In a fifth aspect of the present invention there is provided a vector or construct comprising the nucleic acid molecule of the present invention.

In a sixth aspect of the present invention there is provided a host cell which has been transformed with a vector or construct of the present invention.

In an seventh aspect of the present invention there is provided an isolated ligand 7 Our Ref: 31230/3 VM which binds to a polypeptide of the present invention.

In a eighth aspect of the present invention there is provided a probe capable of hybridizing under stringent conditions to a nucleic acid molecule of the present invention.

In a ninth aspect of the present invention there is provided a probe for a polypeptide substantially as described above.

In a tenth aspect of the present invention there is provided a probe for a ligand substantially as described above when said ligand is bound to a polypeptide of the present invention.

In an eleventh aspect of the present invention there is provided a method for determining the immune status of an animal to a nematode infection characterized by steps of: a) obtaining a blood or serum sample from the animal; b) preparing an IgE enriched or IgG depleted preparation of the sample 15 in a); c) contacting the sample at a) with a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs. 1, 3, 5 or 7 or a functional fragment or variant thereof; d) contacting the preparation from c) with a probe for the immuno-20 complex formed by IgE and the polypeptide; e) detecting the probe to identify the immune status of the animal by the presence or absence of the probe.

In a twelfth aspect of the present invention there is provided a method for 8 Our Ref: 31230/3 VM determining the immune status of an animal to a nematode infection characterized by steps of: a) obtaining a blood or serum sample from the animal b) preparing an IgE enriched or IgG depleted preparation of the sample in a); c) exposing the preparation from b) with a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs. 1, 3, 5 or 7 or a functional fragment or variant thereof ; d) washing the preparation from c) to remove any unbound IgE (i.e. IgE that is not bound to the polypeptide); e) detection of immuno-complex formed by the polypeptide and IgE at step c) with monoclonal antibodies to IgE. f) detection of IgE with appropriately labeled anti-antibodies.

Preferably, at step b) the blood or serum is IgE enriched or IgG depleted using ammonium sulphate precipitation or affinity purification of sheep IgE. However, this should not be seen as limiting.

Preferably, the exposure step c) may be performed by coating the polypeptide of SEQ ID NO. 1 onto microtiter plates. However, other suitable methods for exposing are of course envisaged.

In preferred embodiments, the monoclonal antibodies of step d) may be mouse monoclonal antibodies. However, antibodies sourced from other animals may also be used without departing from the scope of the present invention.

Preferably, the sample may be exposed to the polypeptide via an enzyme-linked immunoassay (ELISA) or other suitable type of assay. 9 OurRef: 31230/3 VM According to a thirteenth aspect there is provided a method of determining the immune status of an animal comprising the steps of: a) exposing a portion of the animal's skin to a polypeptide of the b) determining the immune status by the presence or absence of an immune or allergic reaction.

According to a fourteenth aspect there is provided a method for selectively breeding animals resistant to nematode infection characterized by steps of: b) selecting males and females disposed to develop immune resistance to nematodes; c) using selected animals to breed progeny resistant to said infection.

In general, the animal may be selected from sheep, goats, cattle and equines. 15 However, this list should not be seen as limiting as the animal may be any mammal which is prone to infection with nematode parasites.

Preferably the animal may be selected from either cattle or sheep. Most preferably the animal may be a sheep.

In a fifteenth aspect of the present invention there is provided an isolated 20 polypeptide substantially as described above wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 5 having at least 90% homology to SEQ ID NO. 5.

In a sixteenth aspect of the present invention there is provided an isolated nucleic present invention; a) determining the immune status of male and female animals; Our Ref: 31230/3 VM acid molecule substantially as described above wherein the molecule is a functional fragment or variant of SEQ ID NO. 6 having at least 94% homology to SEQ ID NO. 6.

In a seventeenth aspect of the present invention there is provided an isolated 5 polypeptide substantially as described above wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 1 having at least substantially 75% homology to SEQ ID NO. 1.

In an eighteenth aspect of the present invention there is provided an isolated nucleic acid molecule substantially as described above wherein the molecule is a 10 functional fragment or variant of SEQ ID NO. 2 having at least substantially 70% homology to SEQ ID NO. 2.

In a nineteenth aspect of the present invention there is provided an isolated polypeptide substantially as described above wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 3 having at least 80% homology to 15 SEQ ID NO. 3.

In a twentieth aspect of the present invention there is provided an isolated nucleic acid molecule substantially as described above wherein the molecule is a functional fragment or variant of SEQ ID NO. 4 having at least substantially 70% homology to SEQ ID NO. 4.

In a twenty-first aspect of the present invention there is provided an isolated polypeptide substantially as described above wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 7 having at least 80% homology to SEQ ID NO. 7.

In a twenty-second aspect of the present invention there is provided an isolated 25 nucleic acid molecule substantially as described above wherein the molecule is a 11 Our Ref: 31230/3 VM functional fragment or variant of SEQ ID NO. 8 having at least 75% homology to SEQ ID NO. 8.

It is to be clearly understood that the invention also encompasses peptide analogues, which include but are not limited to the following: 1. Compounds in which one or more amino acids is replaced by its corresponding D-amino acid. The skilled person will be aware that retro-inverso amino acid sequences can be synthesised by standard methods; see for example Chorev and Goodman, 1993; 2. Peptidomimetic compounds, in which the peptide bond is replaced 10 by a structure more resistant to metabolic degradation. See for example Olson etal, 1993; and 3. Compounds in which individual amino acids are replaced by analogous structures for example, gem-diaminoalkyl groups or alkylmalonyl groups, with or without modified termini or alkyl, acyl or amine substitutions to modify their charge.

The use of such alternative structures can provide significantly longer half-life in the body, since they are more resistant to breakdown under physiological conditions.

Methods for combinatorial synthesis of peptide analogues and for screening of 20 peptides and peptide analogues are well known in the art (see for example Gallop et al, 1994; Hogan, 1997).

For the purposes of this specification, the term "peptide and peptide analogue" includes compounds made up of units which have an amino and carboxy terminus separated in a 1,2, 1,3, 1,4 or larger substitution pattern. This includes the 20 25 naturally-occurring or "common" a-amino acids, in either the L or D configuration, 12 Our Ref: 31230/3 VM the biosynthetically-available or "uncommon" amino acids not usually found in proteins, such as 4-hydroxyproline, 5-hydroxylysine, citrulline and ornithine; synthetically-derived a-amino acids, such as a-methylalanine, norleucine, norvaline, Co.- and A/-alkylated amino acids, homocysteine, and homoserine; and 5 many others as known in the art.

It also includes compounds that have an amine and carboxyl functional group separated in a 1,3 or larger substitution pattern, such as p-alanine, y-amino butyric acid, Freidinger lactam (Freidinger et al, 1982), the bicyclic dipeptide (BTD) (Freidinger et al, 1982; Nagai and Sato, 1985), amino-methyl benzoic acid (Smythe 10 and von Itzstein, 1994), and others well known in the art. Statine-like isosteres, hydroxyethylene isosteres, reduced amide bond isosteres, thioamide isosteres, urea isosteres, carbamate isosteres, thioether isosteres, vinyl isosteres and other amide bond isosteres known to the art are also useful for the purposes of the invention.

A "common" amino acid is a L-amino acid selected from the group consisting of glycine, leucine, isoleucine, valine, alanine, phenylalanine, tyrosine, tryptophan, aspartate, asparagine, glutamate, glutamine, cysteine, methionine, arginine, lysine, proline, serine, threonine and histidine. These are referred to herein by their conventional three-letter or one-letter abbreviations.

An "uncommon" amino acid includes, but is not restricted to, one selected from the group consisting of D-amino acids, homo-amino acids, N-alkyl amino acids, dehydroamino acids, aromatic amino acids (other than phenylalanine, tyrosine and tryptophan), ortho-, meta- or para-aminobenzoic acid, ornithine, citrulline, norleucine, a-glutamic acid, aminobutyric acid (Abu), and a-a disubstituted amino 25 acids. 13 Our Ref: 31230/3 VM The term "polypeptide", "peptide" and "protein" are all used interchangeably herein to refer to a molecule comprising a chain of one or more amino acids.

The term "variant" as used herein refers to nucleotide and polypeptide sequences wherein the nucleotide or amino acid sequence exhibit: - at least substantially 70%, or at least substantially 75% homology with the nucleotide or amino acid sequences contained in the sequence listing; preferably exhibits at least substantially 80% or 85% homology or greater with said sequences; and - most preferably exhibits a homology selected from substantially 90- 99% homology to the sequences contained in the sequence listing and which may include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology to said; as assessed by GAP or BESTFIT (nucleotides and peptides), or BLASTP 15 (peptides) or BLASTN (nucleotides). The variant may result from modification of the native nucleotide, or amino acid sequence, by such modifications as; insertion, substitution or deletion of one or more nucleotides or amino acids, or it may be a naturally-occurring variant.

Thus, the term variant should be taken to include changes (i.e. conservative 20 substitution) to the nucleotide sequences set forth herein which do not alter the amino acid being coded for, due to the degenerate nature of the genetic code. The term "variant" also includes homologous sequences which hybridise to the sequences of the invention under standard, but most preferably under stringent conditions. 14 Our Ref: 31230/3 VM In general "stringent conditions" for determining the degree of homology may refer to: a) low salt concentrations (i.e. less than 1M, preferably less than 500mM and most preferably less that 200mM); and b) high hybridization temperatures (i.e. at least 30°C, preferably greater than 37°C and most preferably greater than 50°C).

However, as the stringency of hybridization can be affected by other factors including probe composition and the presence of organism solvents, it is the combination of parameters above that, which is important in determining 10 stringency.

For example, stringent hybridization conditions can be defined as 2 x SSC at 65°C, or and for example standard hybridization conditions can be defined as 6 x SCC at 55°C, provided always that the variant is capable of diagnosing nematode infection. Where such a variant is desired, the nucleotide sequence of the native DNA is 15 altered appropriately. This alteration can be effected by synthesis of the DNA or by modification of the native DNA, for example, by site-specific or cassette mutagenesis. Preferably, where portions of cDNA or genomic DNA require sequence modifications, site-specific primer directed mutagenesis is employed, using techniques standard in the art.

The term "isolated" means substantially separated or purified away from contaminating sequences in the cell or organism in which the nucleic acid naturally occurs and includes nucleic acids purified by standard purification techniques as well as nucleic acids prepared by recombinant technology, including PCR technology, and those chemically synthesised. Preferably, the nucleic acid 25 molecule is derived from genomic DNA or the mRNA of the Trichostrongylus colubriformis.

Our Ref: 31230/3 VM The nucleic acid molecule may be an RNA, cRNA, genomic DNA or cDNA molecule, and may be single- or double-stranded. The nucleic acid molecule may also optionally comprise one or more synthetic, non-natural or altered nucleotide bases, or combinations thereof.

A fragment of a nucleic acid is a portion of the nucleic acid that is less than full length and comprises at least a minimum sequence capable of hybridising specifically with a nucleic acid molecule according to the present invention (or a sequence complementary thereto) under stringent conditions as defined below. A fragment of a polypeptide is a portion of the polypeptide that is less than full length 10 but which still retains a biological function of being capable of diagnosing nematode infection. A fragment according to the invention has at least one of the biological activities of the nucleic acid or polypeptide of the invention.

The polypeptides of the invention can be prepared in a variety of ways. For example, they can be produced by isolation from a natural source, by synthesis 15 using any suitable known techniques (such as by stepwise, solid phase, synthesis described by Merryfield (1963), J.Amer.Chem.Soc. Vol 85:2149-2156) or as preferred, through employing DNA techniques.

The cloning vector may be selected according to the host or host cell to be used. Useful vectors will generally have the following characteristics: (a) the ability to self-replicate; (b) the possession of an appropriately positioned single target for any particular restriction endonuclease; and (c) desirably, carry genes for a readily selectable marker such as antibiotic resistance. 16 Our Ref: 31230/3 VM Two major types of vector possessing these characteristics are plasmids and bacterial viruses (bacteriophages or phages). Presently preferred vectors include the bacteriophage lambda Uni-ZAP™ XR and the modified plasmid pBAD18 vector, AY2-4. Tight regulation, modulation, and high-level expression are 5 characteristics of vectors containing the arabinose PBAD promoter. J. Bacteriol. 177:4121-4130).

The DNA molecules of the invention may be expressed by placing them in operable linkage with suitable control sequences in a replicable expression vector. Control sequences may include origins of replication, a promoter, enhancer and 10 transcriptional terminator sequences amongst others. The selection of the control sequence to be included in the expression vector is dependent on the type of host or host cell intended to be used for expressing the DNA.

Generally, eucaryotic, yeast, insect or mammalian cells are useful hosts. Also included within the term hosts are plasmid vectors. Suitable procaryotic hosts 15 include E. coli, Bacillus species and various species of Pseudomonas. Commonly used promoters such as p-lactamase (penicillinase) and lactose (lac) promoter systems are all well known in the art. Any available promoter system compatible with the host of choice can be used. Vectors used in yeast are also available and well known. A suitable example is the 2 micron origin of replication plasmid.

Similarly, vectors for use in mammalian cells are also well known. Such vectors include well known derivatives of SV-40, adenovirus, retrovirus-derived DNA sequences, Herpes simplex viruses, and vectors derived from a combination of plasmid and phage DNA.

Further eucaryotic expression vectors are known in the art (e.g. P.J. Southern and 25 P.Berg, J. Mol. Appl. Genet. 1 327-341 (1982); S. Subramani et al., Mol.Cell.Biol. 1, 854-864 (1981); R J. Kaufmann and P.A. Sharp, "Amplification and Expression 17 Our Ref: 31230/3 VM of Sequences Cotransfected with a Modular Dihydrofolate Reducase Complementary DNA Gene, J. Mol. Biol. 159, 601-621 (1982); R J. Kaufmann and P.A. Sharp, Mot.Cell.Biol. 159, 601-664(1982); S.I. Scahill et al., "Expressions And Characterization Of The Product Of A Human Immune Interferon DNA Gene In 5 Chinese Hamster Ovary Cells," Proc. Natl. Acad. Sci. USA. 80, 4654-4659 (1983); G. Urlaub and L.A. Chasin, Proc. Natl. Acad. Sci. USA. 77, 4216-4220, (1980).

The expression vectors useful in the present invention contain at least one expression control sequence that is operatively linked to the DNA sequence or fragment to be expressed. The control sequence is inserted in the vector in order 10 to control and to regulate the expression of the cloned DNA sequence. Examples of useful expression control sequences are the Jac system, the trg system, the tac system, the trc system, major operator and promoter regions of phage lambda, the glycolytic promoters of yeast acid phosphatase, e.g. Pho5, the promoters of the yeast alpha-mating factors, and promoters derived from polyoma, adenovirus, 15 retrovirus, and simian virus, e.g. the early and late promoters of SV40, and other sequences known to control the expression of genes of prokaryotic and eucaryotic cells and their viruses or combinations thereof.

A preferred promoter for use herein is the arabinose promoter (Guzman, L., Belin, D., Carson, M. J. and Beckwith, J.,1995. Ref), however, any suitable promoter is 20 included within the scope of the present invention as would be appreciated by a skilled worker.

In the construction of a vector it is also an advantage to be able to distinguish the vector incorporating the foreign DNA from unmodified vectors by a convenient and rapid assay. Reporter systems useful in such assays include reporter genes, and 25 other detectable labels which produce measurable colour changes, antibiotic resistance and the like. In one preferred vector, the p-galactosidase reporter gene is used, which gene is detectable by clones exhibiting a blue phenotype on X-gal 18 Our Ref: 31230/3 VM plates. This facilitates selection. In one embodiment, the p-galactosidase gene may be replaced by a polyhedrin-encoding gene; which gene is detectable by clones exhibiting a white phenotype when stained with X-gal. This blue-white color selection can serve as a useful marker for detecting recombinant vectors.

The term "ligand" refers to any molecule which can bind to another molecule such as a polypeptides or peptide, and should be taken to include, but not be limited to, antibodies, cell surface receptors or phage display molecules.

The term "phage display molecule" refers to a molecule, such as a peptide, protein or antibody; expressed on the cell surface of a bacteriophage or like 10 microorganism, by techniques well known in the art.

It should be appreciated that the term "antibody" encompasses fragments or analogues of antibodies which retain the ability to bind to a polypeptide of the invention, including but not limited to Fr, F(ab)2 fragments, scFv molecules and the like. The antibody may be polyclonal but is preferably monoclonal. In some 15 embodiments the ligand may be a phage display molecule.

"Primers" are short nucleic acids, preferably DNA oligonucleotides 15 nucleotides or more in length, which are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, preferably a 20 DNA polymerase. Primer pairs can be used for amplification of a nucleic acid sequence, e.g. by the polymerase chain reaction (PCR) or other nucleic acid amplification methods well known in the art. PCR-primer pairs can be derived from the sequence of a nucleic acid according to the present invention, for example, by using computer programs intended for that purpose such as Primer (Version 0.5® 25 1991, Whitehead Institute for Biomedical Research, Cambridge, MA). 19 Our Ref: 31230/3 VM "Probes" as used herein refers to a ligand which is labelled in some way (for example, radioactively, fluorescently or immunologically), and which are used to find and mark a target molecule by binding to the target molecule or a molecule associated therewith. In general, the target molecule may be a nucleic acid or 5 polypeptide of the present invention, it may also include a polypeptide of the present invention when complexed (e.g. bound) to another ligand (such as for example an antibody), or the ligand when bound (i.e. associated with) the polypeptide.

For the purposes of this specification it will be clearly understood that the word 10 "comprising" means "including but not limited to", and that the word "comprises" has a corresponding meaning.

The present invention will now be described in detail, by way of reference only, to the following non-limiting examples.

BRIEF DESCRIPTION OF SEQUENCE LlSITING Further aspects of the invention will be apparent from the attached sequence listing, in which: SEQ ID NO. 1 SEQ ID NO. 2 SEQ ID NO. 3 SEQ ID NO. 4 Aspin (Tco-Aspin*) shows the amino acid sequence of T.colubriformis Aspin (Tco-Aspin) shows the nucleotide sequence of T.colubriformis Aspin (Tco-Aspin) shows the amino acid sequence of a truncated T.colubriformis Aspin (Tco-Aspin*) shows the nucleotide sequence of a truncated T.colubriformis Our Ref: 31230/3 VM SEQ ID NO. 5 shows the amino acid sequence of O.circumcincta 0 Aspin (Oc-Aspin) SEQ ID NO. 6 shows the nucleotide seguence of O.circumcincta Aspin (Oc- Aspin) SEQ ID NO. 7 shows the amino acid seauence of H.contortus Asoin (Hc- Aspin) SEQ ID NO. 8 shows the nucleotide sequence of H.contortus Aspin (Hc- Aspin) BRIEF DESCRIPTION OF DRAWINGS Further aspects of the present invention will become apparent from the following description which is given by way of example only and with reference to the accompanying drawings in which: Figure 1 shows one-dimensional immunoblot analysis of T. colubriformis L3 homogenate proteins probed with time-course IgE samples from 15 sheep during the development of immunity to nematode infection.

IgE was purified from serum samples taken at various time-points following weaning of lambs in the field out to 18 months of age. Arrows indicate major antigen bands detected on immunoblots (I- 42 kDa, II- 31-32 kDa, III- 27-31 kDa, IV- 20-21 kDa, V- 2-14 kDa). shows two-dimensional immunoblot analysis of T. colubriformis L3 homogenate proteins. Proteins were subjected to isoelectric focusing (left to right) followed by SDS-PAGE (top to bottom). Immunoblot was probed with affinity purified total IgE antibodies from pooled sera from immune sheep. Spot corresponding to Tco-Aspin is indicated by a circle and Tco-Aspin breakdown product by a Figure 2 21 Our Ref: 31230/3 VM square.

Figure 3 shows two-dimensional gel electrophoresis separation of T. colubriformis L3 homogenate total proteins Coomassie blue stained. Spot corresponding to Tco-Aspin is indicated by a circle and Tco-5 Aspin breakdown product by a square.

Figure 4 shows the alignment of Tco-Aspin with other members of the putative aspartyl protease inhibitor family. Database accession numbers for the previously sequenced members are: (Oo) Ostertagia ostertagi (CAD10783), (Pt) Parelaphostrongylus tenuis 10 (AAG50205), (Ce) Caenorhabditis elegans (AAC46663), (Av) Acanthocheilonema viteae (S23229), (Di) Dirofilaria immitis (AAA70419), (Ov) Onchocerca volvulus (AAA29419). Alignment begins at the putative initiating methionines. The conserved residues RDL of putative YVRDLT sequence motif suggested to be critical for 15 inhibitor function are shown by *. Invariant cysteine residues are marked by A.

Figure 5 shows one dimensional immunoblot of T. colubriformis adult homogenate (lane 1) and L3 homogenate (lane 2) immunostained with rabbit anti Tco-Aspin sera.

Figure 6 shows two-dimensional immunoblot analysis of T. colubriformis L3 homogenate proteins. Proteins were subjected to isoelectric focusing (left to right) followed by SDS-PAGE (top to bottom). Immunoblot was probed with serum from rabbit immunized with purified recombinant Tco-Aspin.

Figure 7 shows one-dimensional SDS-PAGE gel of affinity purified native Tco-Aspin stained with silver stain and corresponding immunoblot 22 Our Ref: 31230/3 VM developed with rabbit anti Tco-Aspin sera.

Figure 8 shows one-dimensional SDS-PAGE gel transferred to PVDF of affinity purified native Tco-Aspin stained with Coomassie blue with segments excised for Edman sequencing (A) and corresponding 5 immunoblot developed with rabbit anti Tco-Aspin sera (B) EXPERIMENTAL EXAMPLE 1 Nematode larvae and antigen preparation Infective larvae (3rd stage) of T. colubriformis (TcL3) were obtained from cultures of 10 faeces taken from monospecifically infected Romney sheep. Somatic antigen (TcL3-Homog) was prepared by homogenising exsheathed larvae under liquid nitrogen in a mortar and pestle. Soluble protein was extracted in 5 mM Tris buffer pH 7.6 with protease inhibitor (Complete, Boehringer Mannheim) added. After centrifugation at 3000 rpm for 10 min, the protein concentration of the supernatant 15 was determined by absorbance at 230/260 nm, before being aliquoted and frozen at -70°C.

EXAMPLE 2 Two-dimensional gel electrophoresis Sample preparation and isoelectric focusing was performed as described in the 20 manufacturer's instruction manual with slight modifications. Briefly, 900 pi of TcL3-Homog (-360-1920 pg) was precipitated in 3600 pi acetone at -20°C for 30-120 min. After centrifuging at 17000g for 30 min at 4°C, acetone was removed and the precipitate dried. The precipitate was dissolved in -280 pi of rehydration buffer containing 8 M urea, 3 M thiourea, 4% CHAPS, 40 mM dithiothreitol, 0.5% IPG 23 Our Ref: 31230/3 VM buffer (pH 3-10 or pH 4-7) and a trace of bromophenol blue. The solution was used to rehydrate Immobiline DryStrips (13 or 18 cm, pH 3-10 or pH 4-7) at 30V for 30-60 hr on an IPGphor (Amersham Pharmacia Biotech). Proteins were focused at 20°C according to the following voltage protocol: 120V for 2 hr, 500V for 1 hr, 5 1000V for 1 hr, 1000-8000V gradient for 30 min, 8000V for 6.0-8.5 hr (Total Vhr were 52000 to 80000 Vhr). After a standard equilibration step, proteins were run in the second dimension on 10 to 18% linear SDS-Page gels. Proteins in the resolved gels were either stained with Copper (Bio-Rad) or microwave assisted Coomassie blue R-250 (Wong 2000) or transferred to nitrocellulose according to the 10 manufacturer's directions (Bio-Rad).

EXAMPLE 3 Western blotting Proteins transferred to nitrocellulose were initially detected with Ponceau S (Harper & Speicher, 1995) and the membrane marked to assist later identification of 15 proteins in gels for further analysis. All incubations were at room temperature and washing of membranes was with PBS + 0.05% Tween 20, 3 x 5 min. Following blocking with Blotto, nitrocellulose was probed with purified sheep IgE (Shaw et al., 1997) at 10-15 |jg ml"1 overnight. IgE was obtained from sheep infected monospecifically with T colubriformis or field grazing sheep and which showed high 20 levels of immunity as determined by faecal egg count and worm counts (data not shown). Membranes were incubated sequentially with mouse monoclonal anti-ovine IgE antibodies (XB6 & YD3 1/15 dilution of culture supernatant) and horseradish peroxidase-conjugated goat anti-mouse IgG gamma chain specific (1/1000) (Sigma Chemical) before detection with 3-Amino-9-ethylcarbozole. A 25 protein spot corresponding to a strong IgE binding spot on Western blots with molecular weight 33,000 and pi 5.1 (Tco-Aspin) was analysed to determine amino acid sequence information. 24 Our Ref: 31230/3 VM EXAMPLE 4 Protein in-gel digestion Protein spots from Coomassie blue stained gels were identified by comparison with IgE stained companion Western blots. Spots were excised, destained and digested 5 with trypsin (Shevchenko et al., 1996). Briefly, spots were destained in 25 mM NH4HCO3 in 50% acetonitrile (ACN). Spots were then dried by centrifugal evaporation and rehydrated in 25mM NH4HCO3 containing 12.5 pg ml-l trypsin and incubated at 37°C for 16 hr. Peptides were then extracted sequentially with 25 mM NH4HCO3, 50% ACN/0.5% trifluoroacetic acid (TFA)(3 times) and 100% ACN. The 10 combined extracts were dried in a Speedvac, rinsed with milliQ water, then dried again. Extracts were then dissolved in 0.5%TFA. The tryptic digest was cleaned up with ZipTips (Millipore) according to the manufacturer's directions. Peptides were eluted from ZipTips in matrix solution consisting of a saturated solution of a-Cyano-4-hydroxycinnamic acid in 50% ACN/ 0.5% TFA and spotting directly onto Maldi 15 sample plate.

EXAMPLE 5 Protein identification by peptide mass fingerprinting Molecular masses of tryptic peptides from each protein spot were determined on a MALDI-tof instrument equipped with a nitrogen laser at 337 nm (Perceptive 20 Biosystems, Voyager mass spectrometer). All MALDI spectra were externally calibrated using CALMIX 2. Peptide masses were submitted for protein mass database searching at ProFound (URL: http://www.Droteometrics.com/prowl-cqi/ ProFound.exe).

EXAMPLE 6 Our Ref: 31230/3 VM De novo peptide sequencing by electrospray ionization Protein spots were submitted to the Australian Proteome Analysis Facility (APAF, Sydney, Australia) for determination of amino acid sequence from selected peptides. Briefly samples undergo a 16-hour tryptic digest at 37°C. The resulting 5 peptides were purified using a ZipTip to concentrate and desalt the sample. The samples were then analysed by ESI-TOF MS/MS using a Micromass Q-TOF MS equipped with a nanospray source, using either flow injection coupled to a Waters CapLC, or manually acquired using borosilicate capillaries for nanospray acquisition. Data was acquired over the m/z range 400-1800Da to select peptides 10 for MS/MS analysis. After peptides were selected, the MS was switched to MS/MS mode and data collected over the m/z range 50-2000Da with variable collision energy settings. Amino acid sequences were then determined from this data.

EXAMPLE 7 N-terminal amino acid sequencing Crude T. colubriformis L3 protein was separated by 2-D electrophoresis (as in EXAMPLE 2) and electroblotted to PVDF membrane using standard techniques for preparing proteins for sequencing. The PVDF was stained with 0.1% Ponceau S and or 0.025% Coomassie blue R the spots corresponding to allergens on companion Western blots (EXAMPLE 3) were identified and cut out. PVDF spots 20 were then submitted for Edman degradation analysis to establish the amino acid sequence of the amino terminus for as many residues as could be established.

EXAMPLE 8 Molecular Biology The protein spot when subjected to QTOF mass spectrometry yielded the 25 sequence of two peptides, TC41A and TC41I. Also the mature amino terminus of 26 Our Ref: 31230/3 VM the protein was determined by protein sequencing. Forward and reverse degenerate oligonucleotides were designed and used as primers in polymerase chain reaction (PCR) under permissive conditions. T. colubriformis total RNA was prepared with Trizol (GibcoBRL) using manufacturers protocols except the initial 5 extraction was performed by grinding larvae in presence of Trizol under liquid Nitrogen. Total RNA was converted to cDNA by standard procedures using Superscriptll (GibcoBRL) and used as the template in subsequent PCR. The primers used in PCR are listed below.

SL1 GGTTT AATT ACCAAGTTT GA Tco-Aspin TC41 Afor GAACAGCAGGAAATCACCAAYTTAYGARAA Tco-Aspin TC41 Arev TTTTCGTAGTTGGTGATTTCYTGYTGYTC Tco-Aspin TC41 Ifor GGAGARGCTGARCARTT Tco-Aspin TC41 Irev AAYTGYTCAGCYTCNCC TC41 ,sig.5.nde G ATCG G CG CG CC AT ATG G CACC AAG AC AG AACG C 15 Tco-Aspin TC41 .not.3 GATCTGCGGCCG CAT AG ATCCTCGTG CAG AAGTT Tco-Aspin.3.2.not GAATTCGCGGCCGCCTTCTTCTCAAACTCCTTCAACTC Hc-Aspin 5.1 AT GAAGTTGGT CGTRCTSTGCGTT CT GT GT G HO-Aspin 3.1 ATAGATCCTTGTGCAAAAGTTGGGC Hc-Aspin 3. RACE GCATGGTTCAGGGCAACAAGGTC 20 Hc.Aspin.5.Nde GATCGGCGCGCCATATGCTCACTGTGGGCACGATCTCC Hc.Aspin.3.Not GAT CT GCGGCCG CAT AG ATT CT CGT ACAG AAGTT 27 Our Ref: 31230/3 VM Oc.Aspin.5.Nde GATCGGCGCGCCATATGCTTACTGTGGGCACAATCGCT Oc.Aspin.3.Not GATCTGCGGCCG CAT AG AT CCTT GTG C AAAAGTT G PolyTA TTTTTTTTTTTTTTTTTTTTTA PolyTC TTTTTTTTTTTTTTTTTTTTTC PolyTG TTTTTTTTTTTTTTTTTTTTTG PCR reactions were performed with T. colubriformis, H. contortus, and O. circumcincta cDNA with various combinations of these primers, in addition to the nematode spliced leader primer (SL1). PCR conditions using degenerate primers was as follows; 95° for 2', followed by 10 cycles of 95° for 30sec, 35° for 45sec, + 10 1.0° per cycle, 72° for 45sec followed by 30 cycles of 95° for 30sec, 45° for 45sec, + 0.2° per cycle, 72° for 60sec, + 2sec per cycle. Utilizing T. colubriformis cDNA a product of 240bp was observed by agarose gel electrophoresis of products following reactions with the primer combination of SL1 and TC41Arev while all other combinations yielded no detectable PCR product. A product of 740bp was 15 observed by agarose gel electrophoresis of products following reactions with the primer combination of SL1 and HO-Aspin 3.1 with the O. circumcincta cDNA template. A product of 700bp was observed by agarose gel electrophoresis of products following reactions with the primer combination of Hc-Aspin 5.1 and HO-Aspin 3.1 with the H. contortus template. The 3' end of H. contortus Aspin was 20 generated by use of the primers Hc-Aspin 3.RACE and PolyTG in a PCR reaction with the H. contortus cDNA template. PCR products were cloned into pCR2.1 using TA cloning (Invitrogen) and sequenced using ABI 377 automated DNA sequencer (Waikato DNA sequencing facility). Analysis of the T. colubriformis sequence revealed homology to the 5' end of various nematode protease (pepsin) inhibitor 25 mRNAs. It was also noted that a previously identified EST clone (unpublished) had homology to these protease (pepsin) inhibitors at the 3' end. This allowed the 28 Our Ref: 31230/3 VM synthesis of Tco-Aspin specific 5' and 3' primers, TC41.not3 and TC41.sig.5.nde, each containing restriction endonuclease sites for cloning into the expression vector AY2-4. These primers were used to generate the mature Tco-Aspin coding sequence in a PCR reaction using T. colubriformis cDNA as template. The primers 5 TC41.sig.5.nde and Tco-Aspin.3.2.not were used to generate truncated Tco-Aspin (Aspin*) coding sequence in a PCR reaction using T. colubriformis cDNA as template. The primers Hc.Aspin.5.Nde and He.Aspin.3.Not were used to generate the mature Hc-Aspin coding sequence in a PCR reaction using H. contortus cDNA as template. The primers Oc.Aspin.5.Nde and Oc.Aspin.3.Not were used to 10 generate the mature Oc-Aspin coding sequence in a PCR reaction using O. circumcincta cDNA as template. After PCR the products were restricted with the appropriate restriction enzyme and gel purified (Qiagen). The resultant DNA products were digested b appropriate restriction enzymes, cloned into the expression vector AY2-4 and the cloned insert was sequenced.

Bacteria containing either the Tco-Aspin/ AY2-4, Tco-Aspin*/ AY2-4, Hc-Aspin/ AY2-4 or Oc-Aspin/ AY2-4 construct were grown in LB broth at 37°C to an optical density (600nm) of 0.8 at which time protein synthesis was induced by the addition of 0.2% L(+)arabinose (BDH). Induction proceeded for 16 hr at 30 at which time the induced bacteria were pelleted and resuspended in 300mM NaCI/50mM P04 pH 20 8.0 buffer containing 1mg/ml lysozyme and incubated on ice for 1 hr. The bacteria were sonicated and the solution clarified by centrifugation to yield a soluble bacterial fraction. Recombinant protein was immobilized to Ni-NTA resin (Qiagen), washed with 300mM NaCI/50mM P04 pH 8.0 buffer containing 20mM imidazole to remove the contaminating E. coli proteins after which the recombinant protein was 25 eluted by the addition of 100mM imidazole. The recombinant protein was subsequently dialyzed versus 300mM NaCI/50mM P04 pH 8.0 buffer to remove the imidazole and the protein concentration determined. Recombinant Tco-Aspin was also purified from the insoluble, inclusion body fraction. In this case the bacterial 29 Our Ref: 31230/3 VM pellet following centrifugation of the lysed bacteria was solubilised in 8M urea, 300mM NaCI/50mM P04 pH 8.0 buffer and applied to the Ni-NTA column equilibrated in the same buffer. After washing with several column volumes, the column was washed in the same buffer without urea prior to elution in imidazole as 5 above.

EXAMPLE 9 Immunisation of Rabbits New Zealand white rabbits were immunized with purified 6-his tagged recombinant protein. Immunizing doses consisting of 100 |jg of Tco-Aspin mixed with Montanide 10 ISA50 at a ratio of 6 parts Montanide: 5 parts aqueous solution were injected intra muscularly and subcutaneously. Four weeks later a second immunizing dose prepared exactly as the first, was administered by the same route. The rabbit was bled by heart puncture under anesthetic 10 days after the second immunization. After clotting for 1 hour at room temperature the blood was centrifuged at 1300g 15 for 15 minutes. The serum was collected and stored at -20°C until needed. This serum is referred to as anti Tco-Aspin.

EXAMPLE 10 Affinity purification of native Tco-Aspin IgG was purified from the sera of a rabbit immunised for Tco-Aspin by Protein G 20 sepharose affinity using standard techniques. Purified antibody was bound to NHS-activated sepharose (Amersham Pharmacia) as per the manufacturer's protocols. TcL3-homog was passed through the immobilised rabbit antibody column at 0.5-2.0 ml/min. The column was washed with buffer (20 mM phosphate buffer, 500 mM NaCI, pH 7.0) until a baseline was reached at absorbance of 280 25 nm. The bound native Tco-Aspin was eluted with either 0.1 M glycine or formic acid Our Ref: 31230/3 VM pH 3.0. The elutant was neutralised with 1M Tris or ammonium hydrogen carbonate pH 8.0. Eluted fractions were vacuumed dried before analysis by 1-D electrophoresis.

EXAMPLE 11 Enzyme immunoassay for specific IgE and IgGi to recombinant proteins Antigen-specific lgG1 and IgE were detected by ELISA as described previously (Shaw et al 1998a). The optimal concentration of soluble recombinant for coating the plates with Tco-Aspin having the amino acid sequence SEQ ID NO. 1 was determined to be 0.2 and 5 pg ml"1 in PBS for IgE and lgG1 assays respectively. 10 To get an indication of antibody levels in field sheep, serum samples were obtained from AgResearch's selectively bred Romney sheep lines selected for high (susceptible) or low (resistant) faecal nematode egg count. Samples were also taken at the same time from an unselected control flock. Results were expressed as mean absorbance in O.D. units. For statistical analysis antibody O.D values 15 were loge transformed to normalise the distributions.

Specific IgE immunoassay method: Serum samples were pre-treated by precipitating 500 (xl of serum with 500 jul of 76% saturated ammonium sulphate in distilled water. Samples were vortexed for 10 sec, repeated at 15 min, and then after 30 min centrifuged in a microcentrifuge 20 (10 min at 13,000 rpm). The supernatant was collected and diluted 1:1 in distilled water plus 0.1% Tween 20 in preparation for assay. Wells of microtiter plates (Costar EIA/RIA plate (#9017), Corning Incorporated, Corning, NY, USA) were coated for 2 hours at 37°C with optimally diluted recombinant Tco-Aspin (0.2pg ml" 1,100 pi) in PBS pH 7.2. Following 3 washes with 0.05% (v/v) Tween 20 in distilled 25 water (water-T20), plates were blocked for 5 min in 5% skim milk powder in PBS. Plates were washed 6 times in water-T20. Microtiter plates were then incubated 31 Our Ref: 31230/3 VM with precipitated serum supernatant (100 jal per well in duplicate) overnight at room temperature. Following 6 washes in PBS-Tween 20, plates were incubated sequentially with mouse monoclonal antibody to ovine IgE (1/15 culture supernatant XB3/YD3, Shaw et al, 1998), goat anti-mouse gamma chain specific 5 peroxidase conjugate (Sigma, St. Louis, Mo, USA). The enzyme substrate 3,3'5,5' tetramethylbenzidine was added and incubated for 30 min. The reaction was stopped 2N H2S04. Plates were read using a 450 nm filter. A sheep was deemed Tco-Aspin IgE positive if its mean absorbance value was greater than 6 times the mean of assay blank wells plus 2 standard deviations.

EXAMPLE 12 Skin Testing Skin testing was performed on AgResearch's 2002 born selectively bred Romney sheep lines. Monthly skin testing and serum sampling occurred from weaning until lambs were around 6 months of age (April 2003). Sheep were injected 15 intradermally at either of two sites, the relatively wool-free area of the inside thighs, or occasionally the flank (after clipping of wool). Native or recombinant Tco-Aspin (0.1-10 (jg) in PBS was injected using 26 gauge needles. Wheal and flare reactions were observed and measured approximately 30 min after injection. For the majority of the skin testing, 0.15-0.3 |jg of Tco-Aspin was injected. The 20 injection site located on the inside upper rear leg area has minimal wool coverage which aided injection and reaction evaluation. Using a tuberculin syringe with a 26 gauge x V2 inch needle, 100 |jl of PBS containing Aspin was injected intra-dermally. Typically if injected correctly, a small distinctive bubble formed at the injection site. The time and sheep tag number was then recorded. Injection of other animals then 25 continued for around 20 minutes. Reading of reactions was carried in the order of injection. The sheep were located, caught, turned over and injection site identified. 32 Our Ref: 31230/3 VM Reactions were scored on a scale of 0-4 (Table 1). A score of 0 or 1 is regarded as negative. A score of 2 or more is regarded as positive.

Table 1. Value and description of scoring used to assess skin testing reaction.

Score Description 0 No reaction 1 Slight swelling only (no reddening) 2 Large swelling & no reddening 3 Swelling, and reddening 4 Large swelling, red and heat The reaction was measured using a vernier caliper by reading the longest diameter of the reaction wheal and its transecting diameter, in millimeters. The area of skin test reaction was calculated by multiplying these 2 values (mm2) EXAMPLE 13 Pepsin inhibition assay The inhibition of haemoglobin digestion activity of porcine pepsin (Kageyama 1998) was used to determine activity of native and recombinant Tco-Aspin. Pepstatin was used as a positive control.

Results and discussion To identify allergenic proteins, TcL3-homogenate was separated 15 electrophoretically, electroblotted and immunostained with affinity purified ovine 33 Our Ref: 31230/3 VM IgE. Previous studies using 1-D SDS-Page gels had identified protein bands at approximate molecule weights of 12-14, 20-21, 27-31, 31-32 and 42 kDa as being associated with allergic immunity to T. colubriformis infections in field grazing sheep (Figure 1). Using 2-D electrophoresis technology, a protein spot 5 corresponding to a strong IgE binding spot on Western blots with molecular weight 33,000 and pi 5.1 (Tco-Aspin) (Figure 2) was cut out from Coomassie blue stained 2-D gel (Figure 3) and analysed to determine amino acid sequence information. No positive match to known proteins was obtained using peptide mass fingerprinting with peptide masses obtained from the 33kDa/pl 5.1 spot. De novo peptide 10 sequencing was possible from 2 tryptic peptides obtained from the isolated spot. These are; TC41A; 884.9 [M+2H]2+ SASEQQE[L/I]TNYEK and TC41I; 737.46 [M+3K]3+ GEAEQFL. A N- terminal sequence of LTVGTI was obtained by Edman degradation of the 33kDA/pl 5.1 spot following its transfer to a PVDF filter.

Preparation of recombinant Aspartyl protease inhibitor (Tco-Aspin) Forward and reverse degenerate oligonucleotide primers were designed from the internal peptide sequences and used in PCR in combination with each other or with primers corresponding to the nematode splice leader sequence and polyT. A PCR product from T. colubriformis cDNA was obtained using the primers TC41Arev and SL1. This product was TA cloned (InVitroGen) into the plasmid pCR2.1 and the 20 insert was sequenced. Analysis of the sequence revealed that this cDNA was from the same gene as a partial cDNA clone previously sequenced from a T. colubriformis cDNA library (unpublished). The overlapping, combined cDNAs encode a protein (Tco-Aspin) with strong homology to proteins of the aspartyl protease inhibitor family that contains the peptides identified by sequencing of the 25 33kDa/pl 5.1 spot (see below). The primers TC41.sig.5.nde and TC41.not.3 were synthesized based on DNA sequences at the amino- and carboxyl terminus of the Tco-Aspin coding region. These primers were used in a PCR with a T. 34 Our Ref: 31230/3 VM colubriformis cDNA template to obtain a complete copy of the coding DNA for Tco-Aspin. The resultant PCR product was sequenced and cloned into the expression vector AY2-4 containing the arabinose promoter, a polyHis domain, and a monoclonal epitope tag. The plasmid was transfected into E. coli bacteria and 5 successful transfectants were identified by ampicillin resistance. The recombinant bacteria were grown in culture and induced for expression of Tco-Aspin with arabinose. Recombinant Tco-Aspin was found in both the soluble protein fraction and in the insoluble, inclusion body fraction following induction. The soluble Tco-Aspin was directly purified by immobilised metal affinity chromatography (IMAC). 10 The insoluble fraction was solubilised in a chaotropic agent and then purified by IMAC.

Aspartyl protease inhibitor (Tco-Aspin) This cDNA sequence of 684 base pairs (SEQ ID NO. 2) codes for a protein of 228 amino acids (SEQ ID NO. 1) with a predicted molecular mass of 25,414 Da and a 15 calculated pi of 5.31. The N-terminus amino acid sequence contains a putative signal peptide (SignalP V1.1; http://www.cbs.dtu.dk/services/SianalP/index.htmn with a suggested cleavage site between residues 15 and 16 (alanine-alanine). N-terminal sequencing showed that the mature protein's N-terminus is LTVGTI suggesting that further processing removes the amino acids APRQKR. The 20 putative mature protein of 215 amino acids, without the signal sequence and amino acids APRQKR, would have a predicted molecular mass of 23056.77 Da and pi of 4.93. The sequence does not contain predicted N-glycosylation sites.

Computer searches with the predicted amino acid sequence revealed significant homologies with aspartyl protease inhibitors of Ostertagia ostertagi (CAD10783): 25 (% identity/% similarity) (86%/90%), Parelaphostrongylus tenuis (AAG50205): (71 %/83%), Caenorhabditis elegans (AAC46663): (50%/68%), Acanthocheilonema viteae (S23229): (40%/59%), Dirofilaria immitis (AAA70419): (42%/57%), Our Ref: 31230/3 VM Onchocerca volvulus (AAA29419): (42%/60%). A Clustal sequence alignment of Tco-Aspin with other members of the putative aspartyl protease inhibitor family is shown in Figure 4. These proteins share more distant homology to a known aspartyl protease inhibitor from the intestinal nematode Ascaris suum (Martzen et 5 al, 1990). Structural features common to the nematode Aspins include the presence of a signal peptide sequence and the conservation of all four cysteine residues in the mature protein. The YVRDLT sequence motif, suggested as being of crucial functional importance in several filarial nematode inhibitors (Willenbucher J et al. 1993), is not well conserved in Tco-API-1 as this protein retains only a 10 shortened RDL motif at the equivalent position. Related inhibitors from O. volvulus, Ov33 (Tume et al. 1997) and A. suum, PI-3 (Martzen etal, 1990, Kageyama 1998) inhibit the in vitro activity of aspartyl proteases such as pepsin and cathepsin E. Using porcine pepsin, we were able to demonstrate a similar inhibitory activity with affinity purified native Tco-Aspin.

Rabbit antiserum to recombinant Tco-Aspin was applied to 1-D blots of TcL3 and Tc-adult homogenate (Figure 5). This identified strong staining bands in TcL3 homogenate at 31 and 22 kDa. Considerably weaker bands of the same molecular weights were seen on the adult homogenate. When rabbit antiserum produced to Tco-Aspin was applied to a 2-D blot of TcL3 homogenate, a series of closely 20 placed spots of 32.2-34.5 kDa and pi 4.9-5.7 (Figure 6) were identified. These correspond in localisation to the original spot submitted for amino acid sequencing. A spot at 58.8 kDa, pi 5.6 is thought to be non-specific binding. An additional spot at 22.9 kDa, pi 5.7 was stained with rabbit anti Tco-Aspin antiserum and considered to be a breakdown product of Tco-Aspin.

Affinity purified native Tco-Aspin isolated from crude TcL3-homogenate and run on 1-D SDS-page gels (Figure 7) ran as 2 bands of molecular weight 31.3 and 21.8 kDa. 36 Our Ref: 31230/3 VM The 22 kDa antigen that was identified by probing of a 2-D blot of crude TcL3-homogenate, and that was affinity purified from the same material with rabbit anti-Tco-Aspin antibody, is probably a truncated product of Tco-Aspin. Attempts to identify this spot (see Figures 3 & 4: square) by amino acid sequencing techniques 5 failed to produce a result due to insufficient amount of protein in gels. An abundant neighbouring protein positioned below the 22 kDa Tco-Aspin truncated product on 2-D gels was submitted for amino acid sequencing. Following sequencing of the T. colubriformis DNA coding for this protein, it was shown as having homology to a Caenorhabditis elegans hypothetical protein Y5F2A.1. No significant IgE binding 10 could be demonstrated to a recombinant version of this protein. Approximately 40 pg of affinity purified native Tco-Aspin, was concentrated and loaded onto to a 1-D SDS-page gel. The gel was transferred to PVDF and stained to identify affinity purified products (Figure 8). Along with the 31 and 22 kDa protein bands, a third lower molecular weight band was also identified. Each of these three bands were 15 excised and submitted for N-terminal sequencing. Edman sequencing revealed that each had the same N-terminal amino acid sequence of LTVGTI. This shows that these proteins are truncated products of Tco-Aspin, likely generated by proteolytic cleavage at the C-terminal end and that the N-terminal end of Tco-Aspin is not degraded. Thus we conclude that the 20-21 kDa band identified by 20 screening of sheep developing immunity to nematode infections (Figure 1) is a truncated product of Tco-Aspin.

In an effort to prepare a recombinant version of the 20-21 kDa truncated Tco-Aspin (Tco-Aspin*) an expression vector was generated expressing a Tco-Aspin peptide lacking the sixty-five amino acids C-terminal to the double lysines at position 164-25 165 of the protein sequence. The molecular weight of this peptide is proportional to that of native Tco-Aspin truncated product (20-21 kDa). 37 Our Ref: 31230/3 VM In developing an ELISA for Tco-Aspin, maximal reactivity with purified IgE from immune sheep was achieved with either soluble Tco-Aspin, or, after reduction, with both soluble and insoluble forms. Optimal protein concentration for coating microtitre plates was found to be 0.2 pg ml"1 for specific IgE assays and 2.5 pg ml"1 5 for specific IgGi assays using soluble Tco-Aspin. Ostertagia circumcincta (Oc-Aspin) (SEQ ID NO. 5), Haemonchus contortus (Hc-Aspin) (SEQ ID NO. 7) and truncated Tco-Aspin* (SEQ ID NO. 3) recombinant Aspins were also produced. Optimal protein concentration for specific IgE assays was found to be 0.25 pg ml"1 for Oc-Aspin and Tco-Aspin* and 5 pg ml"1 for Hc-Aspin.

Immunoreactivity of selection line sheep toward recombinant allergen Specific IgE response to Tco-Aspin in nematode-infected sheep IgE and lgG1 responses to recombinant Tco-Aspin were measured in lambs from lines selectively bred for resistance (R) or susceptibility (S) to nematode parasite infection at AgResearch's Wallaceville Animal Research Centre (Morris et al., 15 2000). An unselected control (C) line was also maintained. Lambs from all three lines grazed together on worm-infected pasture. Table 2 shows that the R-line lambs had significantly higher levels of anti-Tco-Aspin IgE than did S- or C-line lambs in serum samples taken in January and March when the lambs were approximately four and six months of age. In contrast, anti-Tco-Aspin lgG1 levels 20 were significantly different only between the R and S lines of sheep. These results show that specific IgE reactivity in lambs to the nematode allergen Tco-Aspin as early as 4 months of age can be used to identify animals that are better able to develop effective nematode worm immunity. 49% of R-line sheep were Tco-Aspin IgE positive in January and this increased to 58% by March. By contrast, 3% and 25 5% of S-line lambs, and 18% and 28% of the control line, respectively, were positive in January and March. Very similar results were obtained for R-line samples when they were assayed on native Tco-Aspin (data not shown). 38 Our Ref: 31230/3 VM Table 2 Mean specific antibody results in January or March (Optical Density values, back-transformed) for Wallaceville Selection Line male lambs born in 2001.

Sheep Line Tco-Aspin Tco-Aspin Tco-Aspin Tco-Aspin Number of IgE Jan IgE Mar IgGj Jan IgGj Mar sheep Susceptible 0.001a 0.049a 0.559b 0.300a 37 Controls 0.022a 0.047a 0.641NS 0.471NS 49 Resistant 0.200 0.390 0.688 0.529 51 Test for Line difference from Resistant-Line sheep, where a P<0.001; P<0.05; NS Not significant.

Consistent with the selection-line differences in Table 2, a strong negative genetic correlation (Table 3) was found between log transformed Tco-Aspin (IgE) and log transformed faecal egg count (FEC). For example, the genetic correlation of 10 logeTco-Aspin January (lgE+1) with loge(FECJanuary+100) was 0.44 (s.e. 0.12; P < 0.001), and with loge(FECMarch+100) was 0.51 (s.e. 0.12; P < 0.001). (The genetic correlation indicates the degree to which genes controlling the expression of one performance measure in an animal are also associated with the expression of another performance measure.) No significant genetic correlations were found 15 between specific IgE response to Aspin and dag scores, and (not shown) no significant genetic correlations were found between anti-Tco-Aspin lgG1 levels and FEC at four or six months of age, or between anti-Tco-Aspin lgG1 levels and dag scores. 39 Our Ref: 31230/3 VM Table 3. Genetic correlations between measured antibody traits (Tco-Aspin IgE), skin-test traits and loge Faecal Egg Count (FEC), breech soiling score (dag score) or live-weight gain (weaning to January, or January to April).

Genetic correlation with l09e(FECjan+10 0) l09e(FECMar'*'100 ) Dag score 1 (Jan) Dag score 2 (Mar) Gain (Wng to Jan) Gain(Jan to Apr) loge(7co-API-1 IgE Jan+1) -0.44 s.e. 0.12a -0.51 s.e. 0.12a 0.18 s.e. 0.16NS 0.02 s.e. 0.1 6ns -0.25 s.e. 0.17 NS -0.15 s.e. 0.18NS loge(7"CO-API-1 IgE Mar+l) -0.37 s.e. 0.09a -0.44 s.e. 0.09a 0.11 s.e. 0.12NS -0.04 s.e. 0.1 2ns -0.13 s.e. 0.13 NS 0.02 s.e. 0.14ns Skin test score (April) -0.04 s.e. 0.14 NS -0.16 s.e. 0.15 NS Negative/Positive score (April) -0.08 s.e. 0.16 NS -0.12 s.e. 0.17ns loge(Area Apni+1000) -0.00 s.e. 0.15 NS -0.15 s.e. 0.15ns a P<0.001 NS- not significant 40 Our Ref: 31230/3 VM It was then hypothesised that Tco-Aspin and perhaps aspartyl protease inhibitors from other gastro-intestinal nematodes, might have efficacy in an intradermal skin test aimed at rapidly identifying sheep disposed to develop immune resistance to nematodes under field conditions. Table 4 shows that, from an evaluation of the skin test with 218 selection-line animals, those in the R, C and S lines responded significantly differently to the skin test, whether measuring allergic area, using a 0-4 score, or defining a negative/positive criterion for allergy. These three measures were also significantly negatively associated with FEC measured in six-month animals (P < 0.063 for area, and P < 0.005, at least for test score (0-4) and negative/positive test outcome). Table 4 also shows that the R-line animals were not significantly different in response from the resilient-line lambs (the latter being bred for their ability to continue growing without the need for anthelmintic treatment when under serious nematode challenge). 41 Our Ref: 31230/3 VM Table 4. Summary of least squares analyses on skin-test traits in ewe lambs, using area measurement, test score, and negative/positive response.

Back- transformed T ransformed Trait name No Sig. effects Line LS mean LS mean area ± area s.e. cov.' Log (Area+1000) 67 58 41 52 218 Line, P < 0.0004 81 (Resistant) 249 2 (Control) 181 ** 82 (Susceptible) 167 *** 85 (Resilient) 245 n.s. 7.130 s.e. 0.013 7.074 s.e. 0.014 7.062 s.e. 0.016 7.127 s.e. 0.014 Test score (0 to 4) 67 (Not transformed) 58 41 52 218 Line, P < 0.0003 81 (Resistant) 2 (Control) 82 (Susceptible) *** 85 (Resilient) n.s.

LS mean 1.866 s.e. 0.124 1.328 s.e. 0.133 1.122 s.e. 0.158 1.807 s.e. 0.140 Line, P < Negative/Positive 67 0.0005 81 (Resistant) (Neg test=scores 0,1; 58 Pos test=scores 2 -4) 41 52 218 2 (Control) 82 (Susceptible) *** 85 (Resilient) n.s.

LS mean 0.642 s.e. 0.059 0.362 s.e. 0.064 0.317 s.e. 0.076 0.596 s.e. 0.067 Correlation (covariance) with log (FEC2) in Lines 2, 81 and 82 only; P< 0.01; P< 0.001. 42 Our Ref: 31230/3 VM These results extend previous work in which we reported a negative genetic correlation between FEC and IgE responses of R- and S-line lambs exposed to nematode challenge while grazing (Shaw et al., 1999). However, unlike the previous work where specific IgE to a crude mixture of TcL3 ES antigens showed a positive genetic correlation to the level of breech soiling ("dag score") in March, there was no such correlation between Tco-Aspin specific IgE and dag score in the present study. This suggests that selection of sheep for resistance to parasite infection, based on increased specific IgE levels to Tco-Aspin, should not lead simultaneously to increased breech soiling. The formation of dags in the breech area is brought about by diarrhoea thought to be associated with inflammatory responses to nematode infections and is particularly evident on some resistant-line sheep (Bisset et al., 2001). We have thus confirmed that it is possible to establish more practical tests to measure IgE levels specific for defined allergens, apart from ELISA, and these may be used effectively as part of a selective breeding program.

Animal resources used in the studies for Tables 2- 4: Table 2: (Least squares analysis)_137 born-2001 Resistant (R), Susceptible (S) & Control (C)-line ram lambs.

Table 3: (Genetic correlations from ASREML analyses) Rows 1 & 2: ELISA results for b'89-91 (n=709) Progeny-Test lambs, plus b'2001 (n=592) lambs, with all FEC and Dag-score data at Wallaceville from 1979-2001. (N.B. no ASPinlgE(Jan) for b'89 Prog Test lambs; only March) Rows 3-5: Skin test results for b'2002 lambs (223 Ewe lambs from all lines of ewe lambs at Wallaceville (Lines 2, 22, 42, 81, 82 & 85), plus 42 R-line ram lambs, with all FEC data from 1979-2002). 43 Our Ref: 31230/3 VM Table 4: (Least squares analysis) 218 ewe lambs from R, S, C and Resilience lines.

Comparison of Tco-Aspin Skin Test with specific IgE ELISA Score correlation with ELISA: The association between skin test score, negative (score 0-1) or positive (score 2-4) and ELISA negative or positive (sample rated IgE positive if its mean absorbance value was greater than the mean of assay blank wells plus 2 standard deviations) was determined using Chi square test.

Table 5a. Ram lambs significance of association between score Neg/Pos and ELISA at different cut-offs (1 to 10 times the mean of the assay blank wells plus 2 standard deviations (Bkgd)) 16/12/0 21/01/0 /02/0 18/03/0 17/04/0 Bkgd x 2 3 3 3 3 1 0.153 1.000 1.000 1.000 1.000 2 0.008 a 0.007 a 0.003 a 0.113 1.000 3 0.042 a 0.000 a 0.002 a 0.049 a 0.143 4 0.018a 0.001 a 0.006 a 0.022 a 0.017 a 0.328 0.000 a 0.002 a 0.004 a 0.004 a 6 0.328 0.000 a 0.000a 0.029 a 0.040 a 7 0.172 0.000 a 0.000 a 0.036 a 0.040 a 8 0.172 0.001a 0.000 a 0.007 a 0.013a 9 0.172 0.000 a 0.000 a 0.003 a 0.008 a 0.060 0.003a 0.000a 0.003 a 0.002 a a P< 0.05 Table 5b. Ewe lambs significance of association between score Neg/Pos and ELISA at different cut-offs (1 to10 times the mean of assay blank wells plus 2 standard deviations (Bkgd)) 18/12/0 22/01/0 /02/0 14/03/0 Bkgd x 2 3 3 3 2/04/03 1 0.321 0.210 1.000 0.205 1.000 2 0.001 a 0.008 a 0.000 a 0.084 0.015 a 3 0.068 0.000 a 0.000 a 0.012a 0.050 4 0.075 0.005 a 0.000 a 0.005 a 0.001 a 0.985 0.001 a 0.000a 0.002 a 0.001 a 6 0.624 0.000 a 0.000 a 0.007 a 0.003 a 7 0.624 0.000 a 0.000a 0.007a 0.004 a 8 0.159 0.000 a 0.000 a 0.004 a 0.001 a 44 Our Ref: 31230/3 VM 9 0.159 0.001a 0.002a 0.001a 0.003a 0.159 0.002a 0.007a 0.001a 0.002a a P<0.05 Except at weaning (December), these results suggest that an ELISA value greater than four times the mean background value for an ELISA plus two standard deviations would be significantly associated with a positive skin test reaction.

The chi-square for scores (negative versus positive) falling in the top vs. bottom half of the rank list for ASP IgE (March) was 61.5 (i.e. P<0.0001). Table 6 shows that log(ELISA IgE) and log(Skin test) are closely correlated (P<0.0001) in samples taken on ewe or lambs at about 6 months of age.

Area correlation with ELISA: Prior to analysis, loge(Area measurement+100) and loge(corrected ELISA value + 1) were calculated. The skin test measurement was analyzed using least squares, with sex as a fixed effect and loge(ELISA IgE) for the relevant date as a covariate.

Table 6. Test of the association (significance test) between log(ELISA IgE) and log(Skin test area in mm2 + 100) Date Sex N R2 accounted for Significance Regression of Records by model test* log(area+100) on log (ELISA IgE) 2/4/03, Ewe + Ram 109 0.17 P < 0.0001 0.79 ±- 0.17 18/3/03 17/4/03 Ram 42 0.43 P < 0.0001 0.65 ±-0.11 45 Our Ref: 31230/3 VM We conclude that ELISA IgE and Skin Reaction Area are significantly associated The selection line differences in 2002 born lambs (Resistant vs Susceptible) for Aspin IgE, both January and March, were highly significant (P<0.0001). The selection line differences in Area were significant (P<0.001) Heritability of Aspin specific IgE ELISA and skin test Table 7 Heritability Aspin IgE (January) 0.1802 se 0.054 o o o V Q.

Aspin IgE (March/April) 0.347 se 0.0662 P< 0.0001 Skin test score (April) 0.3857 se 0.1735 P< 0.05 Skin test Neg/Pos (April) 0.2808 se 0.1638 Not Significant Skin test Area (April) 0.3421 se .01757 P< 0.053 These results show that both the ELISA and skin test are heritable traits Comparison of different nematode Aspins Coding sequence for Aspins from O. circumcincta (Teladorsagia circumcincta) and H. contortus was obtained and recombinant proteins expressed. The coding DNA was inserted into bacterial expression vectors and the corresponding recombinant proteins were produced and purified as described previously for Tco-Aspin. The amino acid sequences of the three Aspins are very similar. Homologies with Tco- 46 Our Ref: 31230/3 VM Aspin for Ostertagia circumcincta are (% identity/% similarity) (87.1%/89.8%) and Haemonchus contortus (84.9%/87.6%) Serum samples from Resistant line ram lambs born in 2001 were used to compare the reactivity of IgE to various native and recombinant Aspin preparations (Table 8).

Table 8. Specific IgE reactivity of 2001 born Resistant line ram lambs (N=48) in March 2001 to various Aspin preparations Rec. Tco Rec. Rec. Tco- Native Rec. Oc- Rec. Hc-Aspin 1 Tco- Aspin* Tco- Aspin Aspin Aspin 2 Aspin Number 29 29 22 28 42 13 positive % positive 60.4 60.4 45.8 58.3 87.5 27.1 Native and recombinant Tco-Aspin identified around 58-60% of the resistant line ram lamb as Aspin IgE positive. Of those serum samples positive to native Aspin, recombinant Tco-Aspin and Oc-Aspin identified 96.4% and Hc-Aspin 42.9%. Oc-Aspin identified a further 27.1% serum samples as Aspin IgE positive. The truncated form of Tco-Aspin (Tco-Aspin*) identified 45.8% of resistant line ram lambs, 71.4% of those animals identified by native Tco-Aspin. This comparison between Tco-Aspin & Tco-Aspin* suggests that most of the IgE epitopes are found on the truncated form of Tco-Aspin. We conclude that recombinant Tco-Aspin is as effective as native T. colubriformis Aspin in identifying Aspin IgE positive animals. Recombinant O. circumcincta may be of better use in that it identifies a greater number of sheep as Aspin positive animals. H. contortus Aspin is less useful in identifying Aspin positive animals Aspects of the present invention have been described by way of example only and 47 Our Ref: 31230/3 VM it should be appreciated that modifications and additions may be made thereto without departing from the scope of the appended claims. 48 Our Ref: 31230/3 VM References Chandrashekar R, Masood K, Alvarez RM, Ogunrinade AF, Lujan R, Richards FO, Weil GJ. Molecular cloning and characterization of recombinant parasite antigens for immunodiagnosis of onchocerciasis. J Clin Invest. 1991; 88(5):1460-6.

Chandrashekar R, Ogunrinade AF, Weil GJ. Use of recombinant Onchocerca volvulus antigens for diagnosis and surveillance of human onchocerciasis. Trop Med Int Health 1996 0ct;1(5):575-80 Choreo and Goodman, Acc. Chem. REs., 1993 26 266-273 Claerebout E, Geldhof P, Vercauteren I, De Maere V, Smith WD, Knox DP, Vercruysse J, Identification of protective antigens of Ostertagia ostertagi. (Novel approaches meeting III (Mordun 1-5 July 2002) Dobson RJ, Waller PJ, Donald AD. Population dynamics of Trichostrongylus colubriformis in sheep: the effect of infection rate on the establishment of infective larvae and parasite fecundity. Int J Parasitol. 1990; 20(3):347-52.

Duffy MS, MacAfee N, Burt MD, Appleton JA. An aspartyl protease inhibitor orthologue expressed by Parelaphostrongylus tenuis is immunogenic in an atypical host. Clin Diagn Lab Immunol 2002 Jul;9(4):763-70 Frank GR, Mondesire RR, Brandt KS, Wisnewski N. Antibody to the Dirofilaria immitis aspartyl protease inhibitor homologue is a diagnostic marker for feline heartworm infections. J Parasitol 1998 Dec;84(6):1231-6 Freidinger, R.M., Perlow, D.S., Veber, D.F., J. Org. Chem. 1982, 59, 104-109 Gallop, M.A., Barrett, R.W., Dower, W.J., Fodor, S.P.A. and Hogan, Jr., J.C. Nature Biotechnology, 1997 15 328-330. 49 Our Ref: 31230/3 VM Harper S & Speicher DW. Detection of proteins on blot membranes. Current Protocols in Protein Science. 1995. 10.8.7.

Hong XQ, Santiago Mejia J, Kumar S, Perler FB, Carlow CK. Cloning and expression of DiT33 from Dirofilaria immitis: a specific and early marker of heartworm infection. Parasitology. 1996; 112 (3):331-8.

Kageyama T. Molecular cloning, expression and characterization of an Ascaris inhibitor for pepsin and cathepsin E. Eur J Biochem. 1998; 253(3):804-9.

Lucius R, Erondu N, Kern A, Donelson JE. Molecular cloning of an immunodominant antigen of Onchocerca volvulus. J Exp Med. 1988; 168(3): 1199-204.

Martzen MR, McMullen BA, Smith NE, Fujikawa K, Peanasky RJ. Primary structure of the major pepsin inhibitor from the intestinal parasitic nematode Ascaris suum. Biochemistry. 1990; 29(32):7366-72.

Mejia SJ, Nkenfou C, Southworth MW, Perler FB, Carlow CK. Expression of an Onchocerca volvulus Ov33 homolog in Dirofilaria immitis:potential in immunodiagnosis of heartworm infection.Parasite Immunol. 1994; 16(6):297-303.

Morris, C.A., Vlassoff, A., Bisset, S.A., Baker, R.L., Watson, T.G., West, C.J., Wheeler, M. Continued selection of Romney sheep for resistance or susceptibility to nematode infection: estimates of direct and correlated responses. Animal Science 2000; 70: 17-27.

Nagai, U„ Sato, K. Tetrahedron Lett. 1985, 26, 647-650.

Olson et al., J. Med. Chem., 1993 36 3039-3049.

Sangster and Gill, Pharmacology of Anthelmintic Resistance Parasitology Today. 1999, Vol 15, No. 4 50 Our Ref: 31230/3 VM Shaw RJ, Grimmett DJ, Donaghy MJ, Gatehouse TK, Shirer CL, Douch PGC. Production and characterisation of monoclonal antibodies recognising ovine IgE. Veterinary Immunology and Immunopathology. 1996; 51: 3-4 235-251.

Shaw RJ, McNeill MM, Gatehouse TK, Douch PGC. Quantification of total sheep IgE concentration using anti-ovine IgE monoclonal antibodies in an enzyme immunoassay. Veterinary Immunology and Immunopathology. 1997; 57: 3-4 253-265.

Shaw RJ, Gatehouse TK, McNeill MM. Serum IgE responses during primary and challenge infections of sheep with Trichostrongylus colubriformis. International Journal for Parasitology. 1998; 28: 2 293-302.

Shaw RJ, Morris CA, Green RS, Wheeler M, Bisset SA, Vlassoff A, Douch PGC. Genetic and phenotypic parameters for Trichostrongylus colubriformis-specific immunoglobulin E and its relationships with anti-Trichostrongylus colubriformis antibody, immunoglobulin G1, faecal egg count and body weight traits in grazing Romney. Livestock Production Science. 1999; 58: 25-32.

Shevchenko A, Wilm M, Vorm O, Mann M, Anal. Chem. 1996, 68, 850-858 Smythe, M.L., von Itzstein, M., J. Am. Chem. Soc. 1994, 116, 2725-2733 Van Wyk, Stenson, Van Der Merwe, Vorster, Viljoen. Anthelmintic Resistence in South Africa: Surveys indicate an extremely serious situation in sheep and goat farming. 1999.

Waller, Anthelmintic Resistance. Veterinary Parasitology, 1997, 391-412.

Wong C, Sridhara S, Bardwell JCA, Jakob U. Heating greatly speeds Coomassie blue staining and destaining. BioTechniques 2000; 28:426-432. 51 Our Ref: 31230/3 VM Willenbucher J, Hofle W, Lucius R. The filarial antigens Av33/Ov33-3 show striking similarities to the major pepsin inhibitor from Ascaris suum. Mol Biochem Parasitol. 1993; 57(2):349-51. 52 Our Ref: 31230/3 VM intellectual property office of n.z. 0 5 DEC 2003 received

Claims (25)

WHAT WE CLAIM IS:

1. An isolated polypeptide comprising: a) an amino acid sequence as set forth in any one of SEQ ID NOs. 1, 3, 5 or 7; or b) a functional fragment or variant of the polypeptides in a) above, wherein the fragment or variant provokes a humoral and/or cellular immunological response in an animal with similar characteristics to that produced by a polypeptide as outlined above.

2. An isolated polypeptide as claimed in claims 1 wherein the functional fragment or variant incorporates a B cell or T cell epitope of the polypeptide.

3. An isolated nucleic acid molecule wherein the molecule: a) comprises a nucleotide sequence as set forth in any one of SEQ ID NOs. 2, 4, 6 or 8; b) is a functional fragment or variant of the molecule(s) in a); or c) is able to hybridise under stringent conditions to the molecule(s) in a) or b); or d) is a complement of the molecule(s) defined in a), b) or c); or e) is an anti-sense sequence corresponding to any of the sequences in a) - d).

4. An isolated nucleic acid molecule encoding a polypeptide as claimed in either claim 1 or 2.

5. A vector or construct comprising the nucleic acid molecule as claimed in 53 Our Ref: 31230/14 .1 - -'r^prrcy Office of NZ - 1 MAR 2004 claim 4. received

6. An isolated cell which has been transformed with a vector or construct as claimed in claim 5.

7. An isolated ligand selected from the group consisting of: antibodies, cell surface receptors or phage display molecules which bind to a polypeptide as claimed in either claim 1 or 2.

8. A probe capable of hybridizing under stringent conditions to a nucleic acid molecule as claimed in either claim 3 or 4.

9. A probe for a polypeptide as claimed in either claim 1 or 2.

10. A probe for the ligand of claim 7 when the ligand is bound to the polypeptide.

11. A method for determining the immune status of a non-human animal to a nematode infection characterized by steps of: a) obtaining a blood or serum sample from the animal; b) preparing an IgE enriched or IgG depleted preparation of the sample in a); c) contacting the sample at a) with a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs. 1, 3, 5 or 7 or a functional fragment or variant thereof; d) contacting the preparation from c) with a probe for the immuno-complex formed by IgE and the polypeptide; e) detecting the probe to identify the immune status of the animal by the presence or absence of the probe. 54 Our Ref: 31230/14

12. A method for determining the immune status of a non-human animal to a nematode infection characterized by steps of: a) obtaining a blood or serum sample from the animal b) preparing an IgE enriched or IgG depleted preparation of the sample in a); c) exposing the preparation from b) with a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs. 1, 3, 5 or 7 or a functional fragment or variant thereof; d) washing the preparation from c) to remove any unbound IgE (i.e. IgE that is not bound to the polypeptide; e) detection of immuno-complex formed by the polypeptide and IgE at step c) with monoclonal antibodies to IgE. f) detection of IgE with appropriately labeled anti-antibodies.

13. A method of determining the immune status of a non-human animal comprising the steps of: a) exposing a portion of the animal's skin to a polypeptide comprising the amino acid sequence of SEQ ID NOs. 1, 3, 5 or 7 or a functional fragment or variant thereof; b) determining the immune status by the presence or absence of an immune or allergic reaction.

14. A method for selectively breeding animals resistant to nematode infection characterized by steps of: a) determining the immune status of male and female animc 55 Is* — - - -- - "'ITEllECTUAL property OFFICE OF N.Z. U 5 DEC 2003 ur Ref: 31230/14 received b) selecting males and females disposed to develop immune resistance to nematodes; c) using selected animals to breed progeny resistant to said infection. wherein the animal is non-human.

15. An isolated polypeptide as claimed in either claim 1 or 2 wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 5 having at least 90% homology to SEQ ID NO. 5.

16. An isolated nucleic acid molecule as claimed in claim 3 wherein the molecule is a functional fragment or variant of SEQ ID NO. 6 having at least 94% homology to SEQ ID NO. 6.

17. An isolated polypeptide as claimed in either claim 1 or 2 wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 1 having at least substantially 75% homology to SEQ ID NO. 1.

18. An isolated nucleic acid molecule as claimed in claim 3 wherein the molecule is a functional fragment or variant of SEQ ID NO. 2 having at least substantially 70% homology to SEQ ID NO. 2.

19. An isolated polypeptide as claimed in either claim 1 or 2 wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 3 having at least 80% homology to SEQ ID NO. 3.

20. An isolated nucleic acid molecule as claimed in claim 3 wherein the molecule is a functional fragment or variant of SEQ ID NO. 4 having at least substantially 70% homology to SEQ ID NO. 4.

21. An isolated polypeptide as claimed in either claim 1 or 2 wherein the polypeptide is a functional fragment or variant of SEQ ID NO. 7 having at least 80% homology to SEQ ID NO. 7.

22. An isolated nucleic acid molecule as claimed in claim 3 wherein the molecule is a functional fragment or variant of SEQ ID NO. 8 having at least 75% homology to SEQ ID NO. 8. intellectual property office of n.z. e 5 DEC 2003 56

23. The use of a ligand to bind to a polypeptide as claimed in claim 1 and 2.

24. A method of determining the immune status of a non-human animal substantially as described herein with reference to any example thereof.

25. A method of selectively breeding animals resistant to nematode infection substantially as described herein with reference to any example thereof. AGRESEARCH LIMITED by their Attorneys 57 intellectual property office of n.z. 0 5 DEC 2003 r e g)£ k&ef)3o/i ABSTRACT The present invention is broadly directed to novel nematode allergens (polypeptides) and associated amino acid and nucleotide sequences including functional fragments and variants thereof to identify animals that are capable of becoming naturally resistant to nematodes. In particular, the present invention concerns the use of these molecules to, assist in selective breeding of animals capable of becoming naturally resistant to nematode infections. More, particularly, the invention is directed towards the use of nucleic acid molecules and polypeptides, which are the same or functional variants of, aspartyl protease inhibitors: (Tco-Aspin), of Trichostrongylus colubriformis; and/or (Oc-Aspin), of Ostertagia circumcincta; and/or (Hc-Aspin) Haemonchus contortus in identifying animals that are innately more disposed to nematodes. Is 5 SEP 2003 58 Our Ref: 31230/3 VM