NZ509193A

NZ509193A - Molecular markers in ryegrass and fescues

Info

Publication number: NZ509193A
Application number: NZ50919301A
Authority: NZ
Inventors: John White Forster; Elizabeth Sian Jones
Original assignee: State Of South Australia As Re; Southern Cross University; Victoria State; Univ Adelaide; Internat Maize And Wheat Impro
Priority date: 1999-12-24
Filing date: 2001-01-03
Publication date: 2001-05-25

Abstract

Simple sequence repeats (SSRs) are identified in ryegrasses and fescues. Primers suitable for amplifying SSRs, methods for identifying SSRs and libraries enriched for SSRs are provided. The SSRs may be used in the selection of genes in grass or cereal breeding, for profiling grass or cereal species varieties or for testing the purity of grass or cereal seed batches.

Description

<div class="application article clearfix" id="description"> PATENTS ACT 1953 COMPLETE SPECIFICATION Molecular markers in ryegrasses and fescues We, State of Victoria as represented by Department of Natural Resources and Environment, of 15th Floor, 8 Nicholson Street, East Melbourne, Victoria 3002, Australia The University of Adelaide, of North Terrace, Adelaide, South Australia 5005, Australia International Maize and Wheat Improvement Center, of Lisboa 27, Apartado Postal 6-641,06600, Mexico, Mexico DF, Mexico -1 INTELLECTUAL PROPERTY OFFICE OF N.Z. - 3 JAN 2001 RECEIVED 21 December 2000 State of South Australia as represented by South Australian Research and Development Institute, of Waite Road, Glen Osmond, South Australia 5064, Australia Southern Cross University, of Military Road, Lismore, New South Wales 2580, Australia HEREBY declare the invention, for which we pray that a patent may be granted to us and the method by which it is to be performed, to be particularly described in and by the following statement: -2- 21 December 2000 3 (c) The present invention relates to simple sequence repeats (SSRs) and, more particularly, to SSRs in ryegrasses and fescues. The invention also relates to primers suitable for amplifying SSRs, methods for identifying SSRs, libraries enriched for SSRs and methods of preparing same, and uses of SSRs. 5 Worldwide permanent pasture is estimated to cover 70% of agriculturally cultivated areas. Ryegrasses (Lolium spp.) together with the closely related fescues (Festuca spp.) are of significant value in temperate grasslands. The commercially most important ryegrasses are Italian or annual ryegrass (L multiflorum Lam.) and perennial ryegrass (L perenne L.). They are the key forage 10 species in countries where livestock production is an intensive enterprise, such as the Netherlands, United Kingdom and New Zealand. The commercially most important fescues are tall fescue (F arundinacea Schreb.), meadow fescue (F pratensis) and red fescue (F. rubra). L. multiflorum is a biennial (var. italicum Beck) or annual (var. 15 westerwoldicum Mansh.) highly palatable, nutritious grass which shows a rapid establishment from seed, a good production in the seeding year and a rapid recovery after defoliation. L. perenne is also a palatable but persistent grass of high tillering density that shows resistance to treading and good response to high nitrogen application. 20 It was probably the first herbage grass to become a crop plant and is the most important forage grass species in temperate regions. In New Zealand, over 7 million hectares are grown to perennial ryegrass providing high quality forage to support 60 million sheep and cattle. In the United States, perennial ryegrass is grown in permanent pastures, particularly in the Pacific Coast and the Southern 25 States. It is also widely used as a turf grass and is a common but minor component of lawn grass mixtures. Tall fescue (Festuca arundinacea Schreb.) is a wind-pollinated, highly self-infertile polyploid perennial cool-season forage, turf and conservation grass. It is indigenous to Europe, also naturally occurring on the Baltic coasts throughout the 30 Caucasus, in western Siberia and extending into China. Introductions have been 4 made into North and South America, Australia, New Zealand, Japan and South and East Asia. Tall fescue has become the predominant cool-season perennial grass species in the United States where it is grown in approximately 14 million 5 hectares. Some of the acreage has resulted from natural seeding, but much of it is due to introduced seedings. Tall fescue is used in pastures, lawns, parks, golf courses and football fields, highway medians and roadsides. It serves as perennial ground cover for millions of acres of erodable land. Tall fescue also provides forage to millions of sheep and cattle in different grassland countries. 10 Thus, tall fescue is important for grazing, stabilizing soil for agriculture and enhancing the environment through multiple uses. Meadow fescue (Festuca pratensis Huds.) is a major cool-season high-yielding forage grass of agricultural importance in the temperate region. It has a wide range of distribution on the northern hemisphere, mainly in Europe. Since 15 meadow fescue has good digestibility, good winter hardiness and longevity under a system with frequent cutting or grazing, it has become an increasingly important crop species in leys and pastures. Red or golf course fescue (Festuca rubra L.) is a fine-leaved, persistent major cool-season turf grass also considered of importance as forage species. 20 Simple sequence repeat (SSR) polymorphisms (also called microsatellites) are based on a 1-7 nucleotide, typically a 1-4 nucleotide, core element that is tandemly repeated. The SSR array is embedded in complex flanking DNA sequences. Microsatellites are thought to arise due to the property of replication slippage, in which the DNA polymerase enzyme pauses and briefly slips in terms 25 of its template, such as short adjacent sequences are repeated. Some sequence motifs are more slip-prone than others, giving rise to variations in the relative numbers of SSR loci based on different motif types. Once duplicated, the SSR array may further expand (or contract) due to further slippage and/or unequal sister chromatid exchange. The total number of SSR sites in eukaryotic genomes 30 is very high, such that in principle such loci are capable of providing tags for any 5 linked gene. Polymorphism in SSRs arises due to differences in the number of tandem repeats and are detected by polymerase chain reaction (PCR). SSR markers are generally abundant and highly informative, because they are co-dominant, and 5 many alleles are found among closely related individuals. However, SSR technology has been relatively little developed for forage and turfgrass species. It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art. In one aspect, the present invention provides a substantially purified or 10 isolated nucleic acid molecule from a ryegrass or fescue species including a simple sequence repeat (SSR). By a SSR is meant a nucleotide sequence including two or more 1-7, more preferably 2-6, most preferably 2-4, nucleotide core elements that are tandemly repeated. 15 In a preferred embodiment, the nucleic acid molecule according to the invention consists essentially of the SSR. The nucleic acid fragment may be of any suitable type and includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide 20 bases, and combinations thereof. The term "isolated means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid fragment present in a living plant is not isolated, but the same nucleic acid fragment separated from some or all of the coexisting 25 materials in the natural system, is isolated. Such nucleic acid fragments could be part of a vector and/or such nucleic acid fragments could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment. 6 The ryegrass species may be of any suitable type, including Italian or annual ryegrass and perennial ryegrass. Preferably the ryegrass species is perennial ryegrass. The fescue may be of any suitable type including tall fescue, meadow 5 fescue and red fescue. Preferably the fescue is tall fescue. Preferably the SSR includes one or more of the following sequences: [CA]n [AGA]n [TA]n [TCT]n [CT]n [CTT]n # [GT]n [AAC]n [GA]n [ACA]n [AC]n [TTG]n [AG]n [TGT]n [AT]n [CAT]n [TC]n [ATC]n [TG]n [TCA]n [GAA]n [ATG]n [CAA]n [TGA]n [TGC]n [GAT]n [TTC]n [TCGC]n # [GTT]n [TATGTG]n [AAG]n [GTTT]n wherein n is the number of repeats and is a number between 2 and approximately 60, more preferably between approximately 5 and approximately 25. In a particularly preferred embodiment of this aspect of the invention, the SSR may have one of the following nucleotide sequences: [CA]38 [TG]45 [CA]10 [TG]27 [CT]8[CA]18 [CA]U [GAA]7 [CA]5 [CAA]6 [TG]18 [CA]33 [CA]33[TA]7 [CA]7 [TGC]6 [TTC]25 [CAA]h [TCGC]6 [TATGTG]13 [GTTT]5 [AC]g [AC]e [TC]15 [CT]19 [CAA]6CGG[CAA]7 [GTT]7GCGATT[GTT]3 [GT]g [CTT]2o [AG]b [CA]9 [CA]4TA[CA]4 [CTT]7 [CA]21 [CA]27 8 or a fragment or variant thereof which is a SSR. Such variants (such as analogues, derivatives and mutants) include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are 5 contemplated so long as the modifications result in a nucleotide sequence which is still a SSR. Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the above mentioned sequence, more preferably at least approximately 90% identity, most preferably at least approximately 95% identity. Preferably the fragment has a size of at least 4 10 nucleotides, more preferably at least 8 nucleotides, most preferably at least 10 nucleotides. In a second aspect of the present invention there is provided a nucleic acid primer suitable for amplifying a SSR in a ryegrass or fescue species. The ryegrass species may be of any suitable type, including Italian or 15 annual ryegrass and perennial ryegrass. Preferably the ryegrass species is perennial ryegrass. The fescue may be of any suitable type including tall fescue, meadow fescue and red fescue. Preferably the fescue is tall fescue. In a particularly preferred embodiment of this aspect of the invention the 20 primer may include one or more of the following nucleotide sequences: 5'-TTGGCTCACTGGGTTT-3' 5'-CGGT AT AGCCCTT AGCCTCG-3' 5'-GAGGCACCGGCCATGGAG-3' 5'-CAAGTGCCACCATAGATACAA-3' 5'-CTGGGTGACCTAGCAGAC-3' 5'-TTTGAAATTCCCTTCTTCCCT-3' 5'-AGGACGAGCCACTCACTTG-3' 5'-CGTGAAGATCACTATAAACACGAAA-3' 25 5' -CGCAGCTT AATTT AGTC-3' 5'-GCTTTGAGTATGTAAAGTT-3' 9 5'-TCTGTGGGTCCTTCTGGAT-3' 5'-TCGGGTGATGATGTTGACTT-3' 5'-ATTGACTGGCTTCCGTGTT-3' 5'-CGCGATTGCAGATTCTTG-3' 5'-TGGAATAACGATGAAAAG-3' 5'-CATCACGAATTAACAAGAG-3' 5'-GGACGAACTGCCGAGACA-3' 5'-CGGGCATGGTGAGAAGGA-3' 5 5'-CGGCCACCCTTGATAGAG-3' 5'-TCGTCAAGGATCCGGAGA-3' or a fragment or analogue thereof which is suitable for amplifying a SSR in a ryegrass or fescue species. In a further aspect of the present invention there is provided a method of identifying a SSR in ryegrass or fescue, said method including preparing a library 10 of ryegrass or fescue genomic DNA enriched for SSRs and identifying clones in said library containing SSRs. The ryegrass species may be of any suitable type, including Italian or annual ryegrass and perennial ryegrass. Preferably the ryegrass species is perennial ryegrass. fescue and red fescue. Preferably the fescue is tall fescue. The clones containing SSRs may be identified by any suitable technique, as would be apparent to those skilled in the art. The library of ryegrass or fescue genomic DNA enriched for SSRs may be 20 prepared by any suitable technique. Preferably it is prepared by a method including providing genomic DNA from a ryegrass or fescue species, a first restriction enzyme, 25 symmetrical adaptors each containing a second restriction enzyme 15 The fescue may be of any suitable type including tall fescue, meadow 10 site, primers complementary to the adaptors, a hybridization membrane carrying bound oligonucleotides, a second restriction enzyme, and 5 a vector; digesting the genomic DNA with the first restriction enzyme; ligating the adaptors to the digested genomic DNA; amplifying the ligated DNA by PCR using the primers; hybridizing the PCR amplified DNA to the membrane; 10 washing the membrane; amplifying the PCR amplified DNA which preferentially hybridized to the membrane; digesting the amplified DNA with the second restriction enzyme; and ligating the digested and amplified DNA into the vector to generate the 15 library. The first restriction enzyme may be of any suitable type. Preferably it is a blunt end restriction enzyme such as Alu\, Dra\, EcoRV, Rsa\, Ssp\, HaeIII or Hinc1. More preferably a plurality of such restriction enzymes is used. The symmetrical adaptors may be of any suitable type. Preferably they 20 each contain a Mlu\ restriction enzyme site. The hybridization membrane may be of any suitable type. Preferably it is a nylon membrane such as Hybond N. The bound oligonucleotides may be of any suitable type. Preferably they include a SSR. More preferably the bound oligonucleotides include one or more of the following sequences: 25 [CA]20: [CT]i5 : [ACT]U : [AGA]I4 : [CAA]U : [CTA]U : [CTT]14 : [GAC]14 : [CAGjio : [AGC]14 : [CAT]14 : [ACA]14: [GA]15 : [GC]1S : [GT]1S : [CA]15 : [CT]15 : [CG]1S : [AT]15 : [TA]15. In a particularly preferred embodiment, the bound oligonucleotides include oligonucleotides having the sequence [CA]n, more preferably [CA]15 and/or [CA]2o- 11 The following mixtures of bound oligonucleotides have been found to be particularly suitable: 1 [CA]20 : [CT]15 : [ACT]U : [AGA]14 : [CAA]U : [CTA]U : [CTT]U : [GAC]14 : [CAG]io : [AGC]U : [CAT]U : [ACA]14. 5 2 [GA]15: [GC]15 : [GT]15: [CA]15 : [CT]15: [CG]iS: [AT]15 : [TA]15. 3 [CA]1S. The PCR amplified DNA may be hybridized to the membrane by any suitable technique, as will be readily apparent to those skilled in the art. Such techniques are described in Maniatis et al, Molecular Cloning: A 10 Laboratory Manual, Cold Spring Harbor, the entire disclosure of which is incorporated herein by reference. Preferably a reduced washing temperature of approximately 45°C to 50°C is used for the post-hybridixation wash(es). For example, a washing temperature of approximately 50°C, preferably in the presence of approximately 0.5 x SSC, may be used with a single [CA]14 15 oligonucleotide filter; or a washing temperature of approximately 45°C, preferably in the presence of approximately 0.5 x SSC, may be used with the mixtures of bound oligonucleotides. The second restriction enzyme may be of any suitable type but should be compatible with the restriction enzyme site in the adaptors. Preferably the second 20 restriction enzyme is Mlu\. The vector may be of any suitable type. Preferably it is a pUC18 derivative such as pJV1. In a further aspect of the present invention there is provided a library of ryegrass or fescue genomic DNA enriched for SSRs. Preferably the library is 25 prepared by a method as described herein above. The ryegrass species may be of any suitable type, including Italian or 12 annual ryegrass and perennial ryegrass. Preferably the ryegrass species is perennial ryegrass. The fescue may be of any suitable type including tall fescue, meadow fescue and red fescue. Preferably the fescue is tall fescue. 5 The SSRs of the present invention have a number of uses including selection of genes in ryegrass and fescue breeding and breeding in other grass and cereal species (such as Italian ryegrass, tall fescue, phalaris, oats, wheat, barley, rice and maize), DNA profiling of ryegrass and fescue varieties and other grass and cereal species and testing the purity of batches of seeds from ryegrass, 10 fescue and other grass and cereal species. Accordingly, in a further aspect of the present invention there is provided a method of selecting for a gene in grass or cereal breeding, said method including identifying a SSR according to the present invention that is closely associated with said gene and selecting for said SSR in said breeding. 15 By "closely associated" is meant that the SSR and the gene are preferentially coinherited. Preferably the SSR and the gene have a genetic map distance of approximately 5 cM or less. Preferably the grass or cereal is a ryegrass or fescue, more preferably perennial ryegrass or tall fescue. 20 The gene may be of suitable type. Preferably the gene is capable of influencing disease resistance, herbage digestibility, nutrient quality, mineral content or drought tolerance. The principle used for the selection of valuable agronomic genes in breeding programs is the association between a polymorphic genetic marker (e.g. 25 an SSRP locus) and a target gene nearby on the same chromosome. This leads to the phenomenon of genetic linkage, so that the marker and the linked gene are preferentially coinherited. The degree of linkage which is required depends on the exact nature of the breeding program. In practice, a map distance of 5 cM 13 (corresponding to 5% recombination leading to disassociation of the target gene and the marker) or less is preferred. Associations between markers and target genes may be established by the construction of a genetic map using a large number of polymorphic genetic 5 markers in a cross showing variation for one or more physical characters. Appropriate analysis may locate the relevant target genes. The closely linked markers may then act as selection "tags" for the transfer of the target genes into unimproved germplasm. In the particular case of resistance to the disease of crown rust, caused by 10 the fungal pathogen Puccinia coronata f.sp. to///, a cross may be made between parents which are respectively resistant and susceptible to this pathogen. A population showing variation for the character may then be used for genetic mapping with SSR markers. The most closely linked markers to the gene or genes for crown rust resistance (ideally one on either side) may then be used for 15 selection of the gene in a donor cross. The same principle may be used for characters showing a more complex genetic basis, such as drought tolerance, herbage digestibility, nutrient content and perenniality. SSR markers may also be used for DNA profiling in order to establish the distinct identity, uniformity and/or stability of a cultivar. This process is more 20 complex for species such as perennial ryegrass and tall fescue than for cereals such as maize and wheat, as perennial ryegrass is an outbreeding species. Consequently, variation must be assessed both within and between cultivars. In this case, either individual SSR alleles may be diagnostic of particular cultivars, or the frequencies of particular alleles may be so dissimilar between cultivars that 25 they act as discriminatory features. Accordingly, in a further aspect of the present invention there is provided a method for DNA profiling grass or cereal species varieties, said method including assessing variation between said varieties of a SSR according to the present invention. 14 Preferably the grass or cereal is a ryegrass or fescue, more preferably perennial ryegrass or tall fescue. Another aspect of DNA profiling relates to the use of SSR markers for detection of seed batch contamination with seed from an undesirable cultivar. As 5 described above, the allele profile of each population may be discriminated, allowing detection of likely contaminated batches. Accordingly, in a further aspect of the present invention there is provided a method for testing the purity of grass or cereal seed batches, said method including assessing variation within said seed batch of a SSR according to the 10 present invention. Preferably the grass or cereal is a ryegrass or fescue, more preferably perennial ryegrass or tall fescue. The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that 15 the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above. In the Figures Figure 1 Frequency distributions of SSR loci by repeat array number for [CA]n 20 repeats. A. Analysis of the LPSSRH library, based on 70 SSR loci. B. Analysis of the LPSSRK library, based on 94 SSR loci. Figure 2 SSR amplification products amplified by locus LPSSRH02D12 for eight genotypes of L.perenne. 1: North African; 2: Aries; 3: Aurora; 4: Victorian; 5: Ellett; 25 6: Yatsyn; 7: Vedette; 8: DH297. The SSR structure in the cloned sequence is [CA]12 and the predicted amplification product size is 219 bp. Six alleles designated A (largest) to F (smallest) are indicated. 15 Figure 3 Segregating polymorphism for SSR alleles detected by locus LPSSRH01H06 in 20 Ft progeny from the p150/112 mapping population. Three alleles are indicated, designated A (largest) to C (smallest). The segregating 5 alleles A and B are derived from the heterozygous parent, while the monomorphic C allele is inherited from DH290. The SSR structure in the cloned sequence is [CA]9 and the predicted amplification product size is 150 bp. Figure 4 SSR ortholocus detection among Poaceae species related to L.perenne. 10 Amplified products were obtained for locus LPSSRH01H06. 1: L. rigidunr, 2: Lmultiflorum; 3: F.pratensis; 4: F.arundinacea; 5: F.rubra; 6: P.aquatica; 7: P. pratensis; 8: A. sativa. Figure 5 Frequency of cross-species amplification by L. perenne SSR loci in related 15 species. LP: L.perenne; LR: L.rigidum; LM: Lmultiflorum; FA: F.arundinacea^ FP: F.pratensis; FR: F.rubra; PP: P.pratensisi PA: P.aquatica; AS: A. sativa. Figure 6 Sequence comparison of SSR ortholoci. Primer pairs designed to locus LPSSRH01H06 amplified sequences from the following related species, detecting 20 the indicated SSR structure (in italics): Lp-clone: L. perenne enrichment library H clone, [GT]i0; Lp-PCR: L. perenne amplification product clone, [GT]6; Lr; L. rigidum, [GT]CT[GT]7; Lm: L multiflorum, [GT]9; Fp: F. pratensis, [GT]GC[GC]3; Fa: F. arundinacea, [GT]GC[GC]4; Fr: F rubra, [GT]3GC[GT]2.; Pp: P. pratensis, [GT]G[GT]4; Pa: P. aquatica, [GT]CT[GT]6; As: A. sativa, [GT]3T[GT]3. DNA 25 sequences were aligned in 5' -» 3' orientation and numbered from bp positions 1 to 191. The primer sequences are indicated in bold. Sequence identities across all taxa are indicated with an asterisk (*). ;16 ;Figure 7 A ;SSR amplification products amplified from locus LPSSRXX0D7 from seven perennial ryegrass genotypes. The SSR structure in the cloned sequence is [CA]i0. 1: Ellett; 2: Kangaroo Valley; 3: Grasslands Pacific; 4: Victorian; 5: Yatsyn; 6: p150/112 heterozygous parent; 7: doubled haploid DH297. ;Figure 7B ;SSR ortholocus detection among Poaceae species related to L.perenne. Amplified products were obtained for locus LPSSXX0K21. The SSR structure in the cloned sequence is [CA]i0: L.rigidum; 2: L.multiflorum] 3: F.pratensis-, 4: F.arundinacea-, 5: F.rubra-, 6: P.aquatica-, 7: P.pratensis; 8: A. sativa. ;Figure 8 ;Results of sequence annotations of selected LPSSR clones, with numbers related to log™ E value. ;Figure 9 ;Location of the LPSSRH01H06 SSR in the intron of a heavy chain myosin gene. The primer sequences are shown in underline, the SSR in italics, splice junctions with asterisks and translated amino acids are shown beneath the nucleotide sequence. ;Figure 10 ;Segregating SSR alleles detected in the p150/112 reference genetic mapping population (AB x CC) with primer pairs for locus LPSSRH01H06 using (A) autoradiographic detection following 33P end-labelling and (B) detection of FAM-labelled amplifications using the ABI3700 capillary electrophoresis system. ;17 ;Figure 11 ;SSR-based linkage map of perennial ryegrass indicating the location of sixty four LPSSR loci. The remaining framework markers are RFLP and AFLP loci. ;Figure 12 ;5 NIRS analysis (A) allows the detection of calibrated herbage quality characters on the perennial ryegrass linkage map (B). ;Figure 13 ;A. Visual symptom scores for crown rust infection in perennial ryegrass. B. Capillary electrophoretic analysis of replicated resistant and susceptible Fi bulks, 10 showing polymorphism for locus LPSSRK07F08. C. Polymorphism detected by LPSSRK07F08 in decomposed bulk samples. ;EXAMPLE 1 ;Isolation and characterisation of simple sequence repeat (SSR) markers from perennial ryegrass (Lolium perenne L.) using an optimised enrichment 15 library protocol ;SSR enrichment methods were optimised in order to isolate large numbers of simple sequence repeat (SSR) markers for perennial ryegrass (Lolium perenne L.), with the aim of developing a comprehensive set of loci for trait mapping and cultivar identification. Two libraries showing greater than 50% enrichment for a 20 variety of SSR motif types were constructed. Sequence characterisation of 1853 clones identified 859 SSR-containing clones, of which 718 were unique. ;Truncation of flanking sequences limited potential primer design to 366 clones. 100 selected L.perenne SSR (LPSSR) primer pairs were evaluated for amplification and genetic polymorphism across a panel of diverse perennial 25 ryegrass genotypes. The efficiency of amplification was 81 %. A relatively high level of SSR polymorphism was detected (67%), with a range of 2-7 alleles per locus. Mendelian segregation of alleles detected by selected LPSSR locus primer pairs was demonstrated in the F1 progeny of a pair cross. Cross-species ;18 ;amplification was detected in a number of related pasture and turfgrass species, with high levels of transfer to other Lolium species and members of the related genus Festuca. The identity of putative SSR ortholoci in these related species was confirmed by DNA sequence analysis. The LPSSR loci constitute a valuable 5 resource of ideal markers for the molecular breeding of ryegrasses. ;MATERIALS AND METHODS ;Plant Material ;SSR enrichment libraries were constructed from genomic DNA extracted from a single genotype of the perennial ryegrass cultivar Ellett. Screening of SSR 10 primers for genetic polymorphism was performed using single genotypes from the following eight L.perenne accessions: ecotype North African (Morocco); cultivar Aries (New Zealand); cultivar Aurora (Switzerland), cultivar Victorian (Australia); cultivar Ellett (New Zealand); cultivar Yatsyn (New Zealand); cultivar Vedette (New Zealand) and doubled haploid DH297. Herbage from all plants was supplied by Dr. 15 Kevin F. Smith of the Pastoral and Veterinary Institute, Agriculture Victoria-Hamilton, except for DH297 which was supplied as a sterile meristem culture by Dr. Sue Dalton of the Institute of Grasslands and Environmental Research (IGER), Aberystwyth, United Kingdom. ;Mendelian segregation of alleles detected by primer pairs designed to locus 20 LPSSRH01H06 was evaluated using the heterozygous parent and selected Fi progeny from the p150/112 family, which is based on the cross between a multiply heterozygous parent of complex ancestry (including Romanian and Northern Italian ecotypes and the breeding line S23) and double haploid DH290. (Bert et al. 1999.) ;25 Detection of putative SSR ortholoci in related species was performed using single genotypes from the following species: annual ryegrass (Lolium rigidum Gaud, ecotype VLR-1), Italian ryegrass (Lolium multiflorum Lam. cv. Concord), tall fescue (Festuca arundinacea Schreb. cv. Demeter), meadow fescue (Festuca pratensis Huds.), red fescue (Festuca rubra L.), kentucky bluegrass (Poa pratensis 30 L.), phalaris (Phalaris aquatica L. cv. Scirocco) and oats (Avena sativa L.). ;19 ;Herbage from Italian ryegrass and tall fescue was provided by Dr. Kevin F. Smith of the Pastoral and Veterinary Institute, Agriculture Victoria-Hamilton. Herbage from annual ryegrass was provided by Dr. Christopher Preston of the Department of Crop Protection of the University of Adelaide, South Australia. Herbage from 5 phalaris was provided by Dr. Richard Culvenor of CSIRO Plant Industry, Canberra. Seed of kentucky bluegrass was provided by Enco Seed and Turf, Victoria. Genomic DNA from meadow fescue and red fescue was provided by Dr. Odd-Arne Rognli of the Agricultural University of Norway, As, Norway. DNA from all genotypes was extracted using a 1 x CTAB method (Fulton et al. 1995). ;10 Construction of SSR enriched libraries and sequencing ;SSR enriched libraries of L. perenne were constructed using the procedure of Edwards et al. (1996), with modifications as described in the results section. Multiplex enrichment was performed with the oligonucleotides [CA]2o, [CT]i5, [ACT]14, [AGA]i4, [CAA]14i [CTA]14i [CTT]14i [GAC]u, [CAG]10, [AGC]h, [CAT]i4 and 15 [ACA]14 bound to the selection filter. Dinucleotide SSR selection was performed with [GA]i5, [GC]i5> [GT]15i [CA]i5, [CT]i5, [CG]i5, [AT]15 and [TA]15 oligonucleotides, and [CA]n enrichment was carried out with [CA]15 oligonucleotides alone. SSR enriched fragments were cloned into the BssHII site of a modified pUC19 vector (pJV1) provided by Dr. K.J. Edwards, lACR-Long Ashton Research Station, 20 Bristol, UK. ;Plasmids were transformed into Max Efficiency® DH5a™ competent cells (Life Technologies), plated onto LB agar plates (Sambrook et al. 1989), containing 50 ng/ml ampicillin, 50 ng/ml X-galactosidase and 0.5 mM IPTG, and incubated for 16 h at 37 °C. DNA from white colonies was extracted using the Wizard® Plus SV 25 (Promega Co., Madison, Wis., USA) or the QIAprep® turbo (Qiagen) purification kit and sequenced on an ABI automated sequencer (PE Applied Biosystems) using the M13 forward primer and the BigDye™ terminator (PE Applied Biosystems) cycle sequencing kit. ;Classification of SSRs and primer design ;30 Sequences containing at least 5 di-, tri-, tetra-, penta- or hexanucleotide ;20 ;repeats were selected. SSR structure was defined in terms of four categories: pure repeats of the form (N1N2)X or (NiN2N3)x; imperfect repeats of the form (e.g. ;NiN2NiN2N2N1N2N2N2N1N2 etc.); interrupted repeats of the form ;(NiN2)x(N)y(N1N2)z or (N1N2N3)x(N)y(N1N2N3)z and compound repeats of the form 5 (NiN2)x(N3N4)y, (NiN2N3)x(N4N5N6)y or (NiN2)x(N3N4N5)y. This nomenclature resembles that of Weber (1990) except that the term 'interrupted' is used here to denote locus structures previously termed 'imperfect'. The same definition of interrupted repeats was adopted by Peakall et al. (1998). Redundant sequences were defined as clones containing the same repeat sequence or a close variant (> 10 95% similarity) in the 5'- and 3'- flanking sequences. Redundancy across libraries was recorded by equal allocation of occurrence between the relevant libraries. ;Primers were designed to the flanking regions of the SSR using the PrimerPremier 4 program (Premier Biosoft International, Paolo Alto, CA, USA) based on criteria of GC content, melting temperature and absence of secondary 15 structure. Primers were designed in the 16 - 27 nucleotide range to yield amplification products of 70 - 400 bp, and were synthesised by Pacific Oligos (Lismore, NSW, Australia). ;PCR amplification and product electrophoresis ;PCR amplifications were performed in a 20 (xl volume containing 25 ng of 20 genomic DNA, 1 x PCR buffer (Finnzyme, Espoo, Finland), 0.2 mM of each dNTP, 0.5 (o,M of each forward and reverse primer and 0.4 U of DyNAzyme™ II (Finnzyme) DNA polymerase. The forward primer was end-labelled with y-33P-ATP (400 Ci/mmol, Geneworks, Adelaide, SA, Australia). PCR was performed in a MJ PT-200 (MJ Research Inc., Waltham, MA, USA) thermocycler using one of the 25 following touch-down profiles, depending on the Tm value of the primer pairs: (1) 10 cycles of 60 s at 94 °C, 30 s at 65 °C, 60 s at 72 °C with a reduction of the annealing temperature of 1 °C by every cycle, followed by 20 cycles of 30 s at 94 °C, 30 s at 55 °C and 30s at 72 °C; (2) a similar profile as (1) with an initial annealing temperature of 60 °C and a final annealing temperature of 50 °C; (3) a 30 similar profile as (1) with an initial annealing temperature of 55 °C and a final annealing temperature of 45 °C and (4) a similar profile as (1) with an initial ;21 ;annealing temperature of 50 °C and a final annealing temperature of 40 °C. The PCR products were denatured by adding 15 julI of denaturing gel loading buffer (Sambrook et al. 1989) and heating at 94 °C for 5 min. SSR alleles were separated by running PCR products on a denaturing 6% (w/v) acrylamide gel (19:1 5 acrylamide:bis-acrylamide, Amresco, Solon, OH, USA) in 1 x TBE (Sambrook et al. 1989) at 80 W for 5000 Vh using a Biomax™ STS 45i DNA sequencing unit (Kodak). A 100 bp size ladder (Promega Co., Madison, Wis., USA) was included on each gel and the size of amplification products was estimated by extrapolation. Gels were transferred onto Whatman 3 MM paper and dried in a gel dryer (BioRad 10 583) at 80 °C for 45 min. Banding patterns were visualised using a Phosphorimager 400b (Molecular Dynamics, Sunnyvale CA, USA) or by exposing gels for 48 to 72 h to X-ray film (Biomax™ MR, Kodak). ;Primer evaluation ;All primer pairs were screened on the set of 8 diverse genotypes for their 15 ability to yield an amplification product of the expected size and to detect polymorphism. For primers that detected polymorphism, the number of alleles and the polymorphism information content (PIC) of the SSR was calculated as described by Saal and Wricke (1999), based on expected heterozygosity (Hedrick 1985) ;• k ;20 (l) PIC = h i=l where a is the frequency of the i-th allele out of the total number of alleles and kjs the number of different alleles in the sample. ;Cloning and sequencing of PCR amplification products ;To verify the presence of SSR loci, products of successful cross-species 25 amplification were cloned and sequenced. 2 nl of unlabelled PCR product was cloned into the pGEM®-T Easy Vector (Promega), transformed using XL 10-Gold ultracompetent cells (Stratagene, La Jolla, CA, USA), plated on LB agar plates (Sambrook et al. 1989), containing 50 ng/ml ampicillin, 50 ng/ml X-galactosidase and 0.5 mM IPTG, and incubated for 16 h at 37 °C. DNA from eight white colonies ;22 ;of each PCR reaction was extracted and sequenced as described above. Sequences containing SSRs were compared to each other using the multiple sequence alignment procedure Clustal W (Thompson et al. 1994). ;RESULTS ;5 Optimisation of SSR enrichment in perennial ryegrass ;Initial construction of SSR enriched libraries was performed according to the method of Edwards et al. (1996). The enrichment level was unacceptably low at 4% (as judged by DNA sequence analysis of 24 randomly selected clones). A high degree of cryptic simplicity (Tautz et al. 1986) was observed in the remaining 10 sequences, consisting of regions with strong base composition bias with scrambled arrangements of repetitive motifs which are thought to be remnants of SSR sequences. ;A larger scale experiment was performed in order to determine whether modifications to the method could improve SSR enrichment levels for perennial 15 ryegrass. The restriction enzyme used for the primary digestion, the hybridisation temperature and the temperature and stringency of the post-hybridisation washes were varied. Dinucleotide repeat enrichment was performed, as they are the most prevalent and polymorphic classes of SSRs in plant genomes. Enrichment was also carried out for [CA]n repeats, which have been successfully isolated from 20 many plant species. In addition, many of the cryptically simple clone sequences found in the first enriched library were rich in C and A nucleotides, indicating that [CA]n SSRs may be common in perennial ryegrass. Barley (Hordeum vulgare L.) was chosen as a control to test the species specificity of enrichment, as the standard method of Edwards et al. (1996) has obtained good results with this 25 species. ;23 TABLE 1 ;SSR enrichment levels in libraries constructed using various modifications to the standard enrichment protocol. ;Species1 ;Restriction enzyme ;Filter2 ;Hybridisation temp. (SC) ;Wash temp. (SC) ;SSC conc.3 ;% SSRs4 ;L perenne ;Rsa\ ;Multiplex ;50 ;50 ;0.5 x ;16 ;L. perenne ;Rsa\ ;Multiplex ;40 ;50 ;0.5 x ;0 ;L. perenne ;Rsa\ ;Multiplex ;50 ;45 ;0.5 x ;60 ;L. perenne ;Rsa\ ;Multiplex ;50 ;50 ;1.0 x ;16 ;L. perenne ;Ssp\ ;Multiplex ;50 ;50 ;0.5 x ;0 ;L. perenne ;Hind ;Multiplex ;50 ;50 ;0.5 x ;0 ;L. perenne ;Rsa\ ;Di ;50 ;50 ;0.5 x ;14 ;L. perenne ;Rsa\ ;CA ;50 ;50 ;0.5 x ;50 ;H. vulgare ;Rsa\ ;Multiplex ;50 ;50 ;0.5 x ;100 ;5 1 Species from which enriched library was made. For L. perenne, a single genotype was selected from the cultivar Ellett. For H. vulgare the cultivar was Galleon ;2 Oligonucleotide repeats bound to capture filter. Multiplex = mixture of di- and trinucleotide repeats; Di = dinucleotide repeats alone; CA = CA repeat alone ;3 Concentration of SSC used in final 3 washes. All libraries had an initial 5 washes at 2 10 x SSC. All washes contained 0.01 % (w/v) SDS ;4 Percentages based on sequencing 5-11 clones per library ;The results are shown in Table 1. Between five and eleven clones were sequenced from each of the libraries. SSR enrichment for barley was 100% 15 efficient showing that the standard protocol may be highly successful for some species. For perennial ryegrass, reduction of the wash temperature improved multiplex enrichment, as did a reduction in the number of selective oligonucleotides to a single [CA]15 oligonucleotide. A reduction in the hybridisation temperature did not improve enrichment, nor did a change in restriction enzyme. ;20 The library based on selection for [CA]n/[TG]n repeats using the single ;24 ;[CA]i5 selection filter, which showed c. 50% enrichment for SSRs, was designated LPSSRH. The library based on multiplex selection for a number of dinucleotide and trinucleotide repeats with a reduced wash temperature was designated LPSSRK and showed an enrichment level of c. 60%. These libraries were selected for large scale SSR discovery in perennial ryegrass. ;Characterisation of SSR loci ;The results of SSR discovery by large scale DNA sequencing are shown in Table 2. ;25 ;TABLE 2 ;Large-scale SSR discovery in different libraries from L perenne. ;Library1 ;Total ;LPSSRH ;LPSSRK ;Other ;Number of clones sequenced ;510 ;1314 ;29 ;1853 ;Clones containing SSR loci2 (percentage of clones sequenced) ;197 (38%) ;648 (49%) ;14 (48%) ;859 (46%) ;Redundant SSR clones3 (percentage of clones containing SSRs) ;48 (24%) ;92 (14%) ;1 (7%) ;141 (16%) ;Unique SSR clones (percentage of clones sequenced) ;149 (29%) ;556 (42%) ;13 (45%) ;718 (39%) ;Truncated (< 25 bp flanking sequence) SSR clones (percentage of unique SSR clones) ;96 (64%) ;248 (45%) ;8 (62%) ;352 (49%) ;Unique, non-truncated SSR clones (percentage of clones sequenced) ;53 (10%) ;308 (23%) ;5 (17%) ;366 (28%) ;1 For description of libraries, see Table 1 5 2 The operational definition of an SSR was the presence of at least five repeats of a di-, tri-, tetra-, penta- or hexanucleotide repeat 3 Duplicate SSRs with >95% sequence similarity ;26 ;A total of 1853 clones from across all libraries produced clear DNA sequence data, for which 859 (46%) contained SSR loci. The level of enrichment was c. 10% lower than that predicted from small-scale sequencing of the two selected libraries, presumably due to sampling error. ;5 Redundancy was most commonly found within the same library, although duplicates across libraries were also observed. The level of redundancy across all libraries was 16% (141 clones). Redundancy may be attributable to allelism, as a outbred multiply heterozygous genotype of L.perenne was used as the source of DNA for library construction, or locus duplication. The 718 unique SSR clones 10 were further classified into truncated and non-truncated categories. The criterion for truncation was the presence of less than 25 bp of either 5'- or 3'-flanking sequence. A total of 366 unique SSRs were non-truncated and were directly accessible to PCR primer design. The two main libraries differed in terms of redundancy and levels of truncation, with LPSSRH showing a higher level of 15 redundancy (24%) and truncation (64%) than LPSSRK (14% redundancy and 45% truncation). ;27 ;TABLE 3 ;Frequency and type of di-, tri- and > tetranucleotide repeats isolated from the L. perenne enriched libraries LPSSRH and LPSSRK. ;LPSSRH ;LPSSRK ;Perfect ;Interrupted ;Imperfect ;Compound ;Total ;Perfect ;Interrupted ;Imperfect ;Compound ;Total ;Dinucleotide ;49% ;28% ;4% ;9% ;90% ;25% ;17% ;7% ;3% ;52% ;Trinucleotide ;4% ;<1% ;3% ;0% ;8% ;22% ;9% ;10% ;4% ;45% ;Tetranucleotide ;<1% ;<1% ;<1% ;0% ;2% ;<1% ;0% ;2% ;0% ;3% ;Total ;54% ;30% ;8% ;9% ;100% ;47% ;26% ;20% ;7% ;100% ;5 1 ;2 ;See Materials and Methods for details of library construction. Percentages are based on a total of 149 unique SSR clones from ;LPSSRH and 556 unique clones from LPSSRK. ;See Materials and Methods for definitions of repeat structure types ;28 TABLE 4 ;Frequency of SSR motif types in libraries LPSSRH and LPSSRK. ;Library ;LPSSRH1 ;LPSSRK1 ;Dinucleotide SSRs2 ;[CA], [AC], [TG], [GT] ;78% ;33% ;[GA], [AG], [CT], [TC] ;3% ;16% ;[AT], [TA] ;0% ;<1% ;[CG], [GC] ;0% ;0% ;Compounds ;9% ;3% ;Trinucleotide SSRs2 ;[GAA], [AAG], [AGA], [TTC], [TCT], [CTT] ;5% ;15% ;[CAA], [AAC], [ACA], [TTG], [TGT], [GTT] ;<1% ;13% ;[CAT], [ATC], [TCA], [ATG], [TGA], [GAT] ;0% ;7% ;Other ;3% ;6% ;Compounds ;0% ;4% ;Tetra ;2% ;3% ;1 See Materials and Methods for details of library construction. Percentages are based on a total of 149 unique SSR clones from LPSSRH and 556 unique SSR clones from LPSSRK ;2 Includes perfect, interrupted and imperfect SSR types. SSRs are divided into motif types with similar nucleotide structures. ;SSR loci were classified in terms of repeat type and structure (Table 3). The LPSSRH library was almost exclusively (90%) composed of dinucleotide repeats, although a number of trinucleotide repeat types were co-selected. The LPSSRK library contained 52% dinucleotide repeats, 45% trinucleotide repeats and 3% >tetranucleotide repeats. Although the majority of SSR loci from both libraries had a perfect repeat structure, significant numbers of interrupted, imperfect and compound loci were also identified. ;29 ;Table 4 shows the proportion of different repeat motifs in each of the structural categories by library. In both the LPSSRH and LPSSRK libraries, the predominant dinucleotide repeat was of the type [CA]n. Figure 1 shows the distribution of motif repeat length for the perfect repeat type [CA]n in each library. ;5 LPSSRH shows variation from n = 5 to n = 53 with a mean value of n = 19, while LPSSRK shows variation from n = 5 to n = 51 with a mean value of n = 11. Across all dinucleotide repeat types, average motif repeat length was higher in LPSSRH (n = 19; range of n = 5-53) than LPSSRK (n = 12; range of 5-51; data not shown). For the trinucleotide SSRs, the mean repeat length was again higher in LPSSRH 10 (n = 17; range of n = 7-27) than LPSSRK (n = 12; range of n = 5-35; data not shown). ;30 ;SSR polymorphism ;TABLE 5 ;A selection of primer sequences designed to SSR loci that yielded amplification products of the expected size across eight L. perenne genotypes. ;SSR ;Primer sequence(5'-3') ;Repeat motif / repeat class ;Expected size (bp) ;Polymorphic ;No. of alleles ;PIC1 ;LPSSRH01A02 ;F ;AAAGACCGCATACGAAGT ;[CA]27 ;131 ;Yes ;5 ;0.78 ;R ;AACCAAAG CCTCAAGACA ;Perfect ;LPSSRH01A07 ;F ;TGGAGGGCTCGTGGAGAAGT ;[GT]9 ;77 ;Yes ;3 ;0.59 ;R ;CGGTTCCCACGCCTTGC ;Imperfect ;LPSSRH01A10 ;F ;GAGGCACCGGCCATGGAG ;[CTT]2O ;152 ;Yes ;4 ;0.72 ;R ;AGGACGAGCCACTCACTTG ;Imperfect ;LPSSRH01D09 ;F ;CAAGTGCCACCATAGATACAA ;[AG]8 ;262 ;No ;1 ;- ;R ;CGTG AAG AT CACT ATAAAC ACG AAA ;Imperfect ;LPSSRH01E10 ;F ;CGCAGCTTAATTTAGTC ;O > ;o ;103 ;Yes ;4 ;0.71 ;R ;GCTTTG AGT ATGT AAAGTT ;Perfect ;LPSSRH01F02 ;F ;TCTGTGGGTCCTTCTGGAT ;[TCGC]6 ;145 ;No ;1 ;- ;R ;TCGGGTGATGATGTTGACTT ;Imperfect ;LPSSRH01H06 ;F ;ATTGACTGGCTTCCGTGTT ;O > ;CO ;150 ;Yes ;4 ;0.59 ;31 ;SSR ;Primer sequence(5'-3') ;Repeat motif / repeat class ;Expected size (bp) ;Polymorphic ;No. of alleles ;PIC1 ;R ;CGCGATTGCAGATTCTTG ;Perfect ;LPSSRH02C11 ;F ;TGGAATAACGATGAAAAG ;[CA]4TA[CA]4 ;198 ;Yes ;7 ;0.82 ;R ;CATCACGAATTAACAAGAG ;Interrupted ;LPSSRK01A03 ;F ;GGACGAACTGCCGAGACA ;[CTT]7 ;247 ;No ;1 ;- ;R ;CGGGCATGGTGAGAAGGA ;Pure ;LPSSRK01A11 ;F ;CG GCCACCCTTG ATAG AG ;[CA]21 ;205 ;Yes ;4 ;0.65 ;R ;TCGTCAAGGATCCGGAGA ;Imperfect ;1 Polymorphism information content as described in materials and methods. ;32 ;TABLE 6 ;Amplification and polymorphism data for different SSR categories across eight L. perenne genotypes. ;Percent successful amplification ;(number/total tested) ;Percent polymorphism ;Range of alleles detected ;Average PIC ;All SSRs ;81% (82/101) ;67% ;2-7 ;0.56 ;By SSR class2: ;Perfect SSRs ;79% (41/52) ;73% ;2-7 ;0.60 ;Interrupted ;81% (21/26) ;67% ;2-7 ;0.51 ;Imperfect SSRs ;88% (15/17) ;60% ;2-4 ;0.55 ;By SSR types*: Dinucleotide repeats 82% (67/82) 72% 2-7 0.56 Trinucleotide repeats 78% (14/18) 50% 2-4 0.55 By repeat number21 5-10 repeats 89% (33/37) 58% 2-5 0.53 11 - 20 repeats 89% (32/36) 72% 2-7 0.57 21-30 repeats 50% (16/32) 69% 2-5 0.61 By library LPSSRH 85% (50/59) 78% 2-7 0.56 LPSSRK 78% (31/40) 52% 2-5 0.57 1 Percentage of successful amplifications 2 Structural classes from which <10 primer pairs were tested (compound, >tetranucleotide repeats, SSRs with >30 repeats) are not described. PCR primers were designed to 101 perennial ryegrass SSR (LPSSR) loci. Primer length varied from 16 to 27 nucleotides (average 20 nucleotides), with a range of G/C contents from 28% to 72% (average 50%, data not shown). The expected sizes of amplification products were estimated from the cloned sequences and varied from 70 bp to 400 bp (average 185 bp, data not shown). The predicted optimal annealing temperatures varied from 46°C to 58°C (average 52°C, data not shown). Primer pairs were tested for their ability to amplify DNA and detect polymorphism across eight perennial ryegrass genotypes. Detailed sequence information of primer composition and amplification data for ten representative primer pairs is shown in Table 5. From 101 primer pairs, 82 (81%) produced a clear amplification product within the expected size range and of these 55 (67%) detected polymorphism (Table 6). Between 2 and 7 alleles were 33 detected across the eight genotypes (average 3.5), with polymorphism information content (PIC) values of between 0.2 and 0.8 (average 0.56). A typical amplification profile is shown in Figure 2. A number of factors were evaluated that may have contributed to failure of 5 amplification by specific primer pairs. Frequency of amplification was found to be uncorrelated with either primer length, primer G/C content, calculated annealing temperature or expected fragment size (data not shown). This primer design rating considers primer secondary structure in addition to G/C content and annealing temperature. A lower than average level of amplification was found for SSRs with 10 >21 repeats when analysed across different SSR structural groups (Table 6). When the level of polymorphism within different SSR categories was examined, polymorphism was found to be lowest for imperfect SSRs, trinucleotide SSRs and SSRs with <10 motif repeats (Table 6). Compared with the enriched library LPSSRH, LPSSRK had a larger proportion of each of these categories, hence the 15 overall percent polymorphism for this library was lower. The capacity of LPSSR loci to detect segregating polymorphism in a perennial ryegrass pair cross was evaluated using the locus LPSSRH01H06. Co-dominant polymorphic genetic markers show either a AB x BB or AB x CC cross structure in the p150/112 family, allowing full classification of two genotypic 20 classes in the Fi progeny. This population has been adopted as the current reference genetic mapping family for the International L^/um Genome Initiative (ILGI) (Forster 1999) and has been the subject of intensive mapping with AFLP (Bert et al. 1999) and RFLP markers. As shown in Figure 3, LPSSRH01H06 detects three alleles in a sub-set of p150/112 Ft progeny, with a monomorphic 25 allele contributed by the homozygous DH290 parent and the two segregating alleles showing a ratio in close agreement with Mendelian expectation (1:1). Detection of SSR ortholoci in related species In order to evaluate cross-species amplification by perennial ryegrass SSR locus primer pairs, 50 LPSSR loci were selected from the set of 100 loci screened 30 for polymorphism in perennial ryegrass. Figure 4 shows a set of amplification 34 products produced across all of the related species by the locus LPSSRH01H06. Figure 5 shows the variation for efficiency of cross-species amplification which varies from 80% for annual ryegrass to 12% for oats. In order to demonstrate the presence of bona fide SSR ortholoci in the 5 related species, PCR products were cloned from amplifications using several primer pairs which showed substantial cross-species transfer. Figure 6 shows a DNA sequence alignment for locus LPSSRH01H06, using a single representative clone from each species. The cloned LPSSRH01H06 sequence from enrichment library LPSSRH shows a very high degree of identity with a PCR-derived clone 10 from perennial ryegrass, with divergence confined to the SSR array ([GT]i0 and [GT]6 ) and several individual nucleotide positions in the 3'-region flanking the SSR. Both L.perenne and Lmultiflorum contain perfect [GT]n repeats, while the remaining species contain imperfect SSRs of variable length. The L.perenne sequences contain a c. 30 bp deletion relative to the other sequences immediately 15 downstream from the SSR. Some clone to clone variation was detected, possibly due to PCR errors and/or allelic variation due to heterozygosity. DISCUSSION The data presented here demonstrates that large numbers of SSR loci may be isolated from perennial ryegrass using enrichment library technology. The 20 estimated prevalence of common SSR loci [(GA)n or (CA)n] in perennial ryegrass from this study (one per 350 kb on average) was towards the low end of the reported range for plant taxa (Condit and Hubbell 1991). Nonetheless, such an estimate of prevalence implies the presence of several thousand SSR loci for each common motif type. 25 The procedure of Edwards et al. (1996) required substantial modifications in order to obtain libraries showing greater than 50% SSR enrichment for perennial ryegrass. Modifications of the post-hybridisation washing conditions contributed to substantial improvements in SSR recovery. In this study, reduction in the complexity of the selective oligonucleotide mixture also resulted in improved 30 recovery. Multiplex selection may favour the binding of a single genomic fragment 35 to multiple synthetic oligonucleotide sequences, allowing the capture of sequences which lack SSRs but may show high levels of cryptic simplicity (Tautz et al. 1986). The importance of SSR enrichment optimisation for each target species is clearly demonstrated. 5 Redundancy in SSR enrichment libraries limits the number of effective loci which may be developed. The value of 16% reported here is lower than reported in other studies (24% in tea tree: Rossetto et al. 1999). Clones were considered redundant if they contained >95% similarity in 5'- and 3'-flanking sequence. Some of the redundant clones with variation in their nucleotide composition may prove 10 informative for the design of allele specific single nucleotide polymorphisms (SNPs) or for the detection of duplicated loci. The successful conversion of SSR positive clones into sequence tagged LPSSR loci was highly limited by truncation of the cloned sequences (49%), either within the SSR array itself or within 25 bp of 5'- or 3'- sequence flanking the SSR, 15 such that primer design was difficult. Truncation has been observed in enrichment libraries derived from other species (Cordeiro and Henry 1999). The use of the restriction enzyme flsal may have contributed to the isolation of clones truncated within [CA]n SSR arrays, due to the presence of a 5'-AC-3' motif within the enzyme recognition site (5'-GTAC-3'). The LPSSRH library showed particularly high levels 20 of truncation, probably because this library was rich in [CA]n repeats with an average motif repeat length higher than for the LPSSRK library. Long SSR repeat arrays within small cloned fragments are more likely to be close to the end of insert sequence. The predominant SSR motif isolated in this study was of the type [CA]n. 25 This was anticipated for the LPSSRH library, which was constructed using a [CA]i5 selection filter, but was also found to be the case for the multiplex enriched LPSSRK library. Although [CA]n repeats have been reported to be rare in database surveys (Morgante and Olivieri 1993; Wang et al. 1994), they are apparently present in significant numbers in the perennial ryegrass genome, as reported for 30 other Poaceae genomes (Liu et al. 1995; Saal and Wricke 1999; Cordeiro and Henry 1999). The presence of substantial numbers of the SSR type [GA]n in the 36 LPSSRK library reflects the abundance of this other common dinucleotide motif type. The [AT]n/[TA]n motif, reported to be the most common type in plants (Powell et al. 1996) is normally excluded from enrichment libraries due to its self-complementary nature and is not significantly represented. The most common 5 trinucleotide repeats in LPSSRK were of the type [GAA]n (15%) and [CAA]n (13%). Interrupted, imperfect and compound SSRs were substantially represented in both libraries. The level of polymorphism detected across the panel of perennial ryegrass genotypes (67%) was relatively high, as expected for an allogamous species. 10 Amplification efficiency was lowest for SSRs with >21 repeats, probably due to the inefficiency of in vitro DNA replication over long repetitive regions. Trinucleotide repeats showed lower levels of polymorphism than dinucleotide SSRs, as shown for ISSR markers in rice (Blair et al. 1999). The lower levels of polymorphism detected by interrupted and imperfect SSRs may be associated with the initial 15 stages of mutational decay, so that replication slippage is less likely to occur (Smulders et al. 1997). Increased levels of polymorphism were observed for >10 repeats, consistent with the association between higher repeat length and polymorphism described by Weber (1990). The higher proportion of short, imperfect and trinucleotide repeat types in the enriched library LPSSRK meant that 20 the frequency of polymorphic SSRs that could be isolated was ultimately not much higher than from the LPSSRH library, despite the favourable attributes of LPSSRK in terms of enrichment levels and reduced truncation. Previous studies have demonstrated limited transfer to distantly related species (Whitton et al. 1997) suggesting that effective cross-amplification may be 25 limited to members of the same genus or closely related genera (Lagercrantz et al. 1993; Peakall et al. 1998; White and Powell 1997; Echt et al. 1999; Devey et al. 1999). In this study, high levels of cross-amplification were seen in the two closely related ryegrass species L.rigidum (80%) and L.multiflorum (71%). Amplification was slightly lower in the Festuca species, followed by Kentucky bluegrass, 30 phalaris and oats. Amplification levels reflected the phylogenetic relationships between these species. Both L. rigidum and L. multiflorum are capable of efficient interspecific hybridisation with perennial ryegrass, producing fertile Ft hybrids 37 (Naylor, 1960). The genera Lolium and Festuca are closely related and are capable of forming intergeneric hybrids (Jenkins, 1989). Meadow fescue (F. pratensis) is believed to be closely related to the outbreeding Lolium species (Darbyshire 1993; Xu and Sleper 1994; Stammers et al. 1995; Charmet et al. 5 1997), while some models for the evolution of the allohexaploid species F. arundinacea have invoked the presence of a Lolium-like genome (Borrill, 1976). L. multiflorum, F. pratensis and F. arundinacea have been reported to be much closer related to one another than to F.rubra (Lehvaslaiho et al. 1987). The genus Poa is believed to be allied to the Lolium/Festuca species complex (Yaneshita et 10 al. 1993). The Lolium, Festuca and Poa species are all members of the tribe Poeae. Phalaris and oats are members of the tribe Aveneae which has been placed close to the tribe Poeae in modern phytogenies of the Poaceae (Devos and Gale 1997; Soreng and Davis 1998). DNA sequence analysis of individual cloned amplification products 15 confirmed the presence of SSR repeats in all of the test species for locus LPSSRH01H06, although interrupted SSRs were detected in all of the taxa apart from L. perenne and L. multiflorum. A high degree of sequence conservation was detected in the 3'-flanking region, although single nucleotide differences and various pairwise insertion/deletion polymorphisms distinguished each of the 20 species. This paper reports the isolation and characterisation of a large number of polymorphic SSR markers for perennial ryegrass. The detection of LPSSR polymorphism in the p150/112 reference family will allow the construction of a framework SSR map of L.perenne. These markers will then be used to map and 25 tag genes in trait specific segregating populations for marker assisted breeding, as well as for cultivar identification and seed purity analysis. SSRs will provide an ideal marker system for molecular marker based breeding in perennial ryegrass. EXAMPLE 2 Figure 7 A shows SSR amplification products amplified from locus 30 LPSSRXX0D7 from seven perennial ryegrass genotypes. The SSR structure in the 38 cloned sequence is [CA]i0. Figure 7B shows SSR ortholocus detection among Poaceae species related to L.perenne. Amplified products were obtained for locus LPSSXX0K21. The SSR structure in the cloned sequence is [CA]10: 5 EXAMPLE 3 Development and implementation of SSR technology for perennial ryegrass (Lolium perenne L.) (a) DNA sequence analysis of LPSSR clones The LPSSR clones have been derived from genomic enrichment libraries, 10 and may hence be derived from both genie and non-genic regions of the perennial ryegrass genome. In order to determine the sequence identity of a representative set of clones, insert sequences were analysed using the BLASTN algorithm provided as part of the suite of molecular biology tools at the NCBI Internet site (http://www.ncbi.nlm.nih.gov). A total of 117 LPSSR clones were selected, of 15 which the majority were derived from the LPSSRK library. Sequence searches were conducted against the GenBank database. The E value of the highest sequence match (probability against sequence matching by chance) was determined for each query sequence. Figure 8 shows a graphical representation of the number of clones against the log10 E value. 20 In summary, 93% of the sequence produce short (c. 20 bp) and low level (E > 10"2) matches to database accessions, with the majority matching human, Drosophila melanogaster and Caenorhabditis elegans gDNA sequences. This probably reflects the high abundance of such sequences in public databases due to the completion of complete genome sequencing projects for these species. No 25 significant matches to chloroplast DNA sequences were obtained. This observation is significant as chloroplast SSRs have been demonstrated to reveal little polymorphism within species (Weising and Gardner, 1999) and show maternal inheritance, being consequently inappropriate for use in linkage map construction. There were also few matches to known repetitive DNA sequences. 39 This is also of significance as SSR loci have been demonstrated to frequently co-locate with dispersed repetitive sequences in species such as barley (Ramsay et al., 1999). PCR primers designed to SSR-flanking sequences that have a repetitive nature may produce anomalous patterns due to the very different 5 stoichiometry of binding ratio compared to primers designed to unique sequences. Several dispersed repetitive sequence families have been described for perennial ryegrass (Perez-Vicente et al., 1992) A single selected LPSSR clone (LPSSRYXX03) showed a very high level of match (E = 10"114) to the pLPBB2-123 repeat family (Jenkins et al., 2000). This family is apparently derived from a 10 retrolement and is present in c. 9 x 104 copies in the haploid L.perenne genome. The frequency of incidence in the LPSSR clones is close to random expectation (based on a sequence length of c. 1 kb and haploid genome size of 1.6 x 109 bp). There was also a single match (E = 3 x 10"6) to the long terminal repeat of the barley BARE-1 retroelement. 15 Single matches were also observed to three known genie sequences: a maize APETALA-2 like gene (E = 4 x 10"15), a human DEAD/H box polypeptide (E = 2 x 10"7) and an Arabidopsis thaliana myosin heavy chain gene (E = 2 x 10"9). The sequence similarity with the myosin gene was detected using primer pairs specific for locus LPSSRH01H06. Further analysis of the query sequence using 20 the BLASTX algorithm to determine amino acid sequence alignment revealed the location of the SSR in an intron (Figure 9). (b) Construction of an SSR-based linkage map (i) Screening for SSR polymorphism in the reference population The construction of an SSR-based genetic map of perennial ryegrass is 25 being progressed using a reference population (p150/112) which has been adopted for core map development by the International Lolium Genome Initiative (ILGI). The family is based on a pair-cross between a heterozygous parent of complex descent (9982(1) [seed collection Romania 1980] x 3613 [early Northern Italian x Melle or S23]) and a double haploid parent (DH290) at IGER, UK (Bert et 30 al., 1999). 183 progeny were germinated. Clonal replicates of the population were established at several ILGI participant laboratories including AV-La Trobe, PBC. 40 Genomic DNA was extracted from all of the plants. Efficiently amplified LPSSR loci have been screened for genetic polymorphism in a panel consisting of the heterozygous parent and six F-i progeny. The screening was performed by 33P end-labelling of amplification primers and autoradiographic detection following vertical polyacrylamide gel electrophoresis. The current status of the polymorphism screen is shown in Table 7. 41 SSR Category Number of loci Number of polymorphic loci Frequency of polymorphic loci All SSRs 309 101 32.7% Perfect SSRs 152 63 41.4% Interrupted SSRs 86 11 25.6% Imperfect SSRs 50 10 22.0% Dinucleotide repeats 210 73 34.8% Trinucleotide repeats 95 27 28.4% n<6 repeats 29 7 24.1% n<10 repeats 186 50 26.9% n>10 repeats 123 51 41.5% LPSSRH library 93 36 38.7% LPSSRK library 214 64 29.9% Table 7: Current status of screening for genetic polymorphism in p150/112 reference family 5 The 309 amplified loci were obtained from 407 primer pairs (75.9% amplification efficiency). This value varied from 85.3% to 71.1% across different SSR categories. As seen for the general polymorphism screen (see Jones et al., in press), lower levels of genetic polymorphism are detected in this single cross with interrupted/imperfect SSRs, trinucleotide repeats and n < 10 repeats, all of which 10 are prevalent in the LPSSRK enriched library. A comparison of the two libraries reveals a higher yield of polymorphic clones from LPSSRH, which was the rationale for further locus discovery from this library in order to increase the number of polymorphic loci to c. 100. Co-dominant polymorphic genetic markers are expected to show AB x BB 42 or AB x CC segregation structures in the p150/112 family, and both have been observed. A number of apparent duplicate loci have also been detected. (ii) Genetic mapping of SSR loci in reference population High-throughput genetic mapping of polymorphic markers has been 5 performed for selected using automated capillary electrophoresis of fluorochrome labelled PCR-products. An ABI3700 96-channel DNA sequencer provides the operating platform for this work. Sets of triplexed markers based on the pooling of PCR products have been designed, with amplification primers labelled with the dyes FAM, HEX and NED. Figure 10 shows a comparison of data obtained by 10 autoradiographic detection and equivalent data from the fluorescence detection system. Segregation data was obtained for up to 155 F1 progeny of the p150/112 family. The SSR data was combined with RFLP and AFLP data (which are public domain markers) obtained through the activities of four member institutions of ILGI 15 and a combined genetic map was constructed (Figure 11). A total of 64 SSR loci were assigned to seven linkage groups, with between 4 and 13 loci per linkage group. A total of 47 loci corresponded to dinucleotide SSR arrays and 17 loci corresponded to trinucleotide SSR arrays. Segregation data for a further 30 LPSSR loci has now been obtained and 20 will be analysed in order to complete the SSR-based reference linkage map with a density of c. 100 loci. (c) Tagging of genes in trait-specific mapping families of perennial ryegrass (i) Herbage quality characters The reference mapping family p150/112 has been used for the analysis of 25 genetic variation of herbage quality characters. Leaf material was harvested from F-\ progeny genotypes and was dried and milled. Near infra-red spectroscopy analysis (NIRS) was used to derive calibrations for sub-components for herbage quality such as crude protein content (CP), water soluble carbohydrate (SolCHO), in vivo dry matter digestibility (IVVDMD) and neutral detergent fibre (NDF). Analysis of variance analysis (ANOVA) was used to relate variation for the calibrated character to the inheritance of allelic variants of molecular markers at specific chromosomal locations. Figure 12 shows the presence of two quantitative trait loci (QTLs) for NDF located between the SSR loci LPSSRK11E11 and LPSSRK10H05 on linkage group 1 of the reference map. QTLs of smaller effect for soluble carbohydrate and crude protein content are also located in this region of the linkage map. — The SSR markers have been demonstrated to allow the dissection of a key herbage digestibility trait, as NDF content is correlated with cell wall content and with lignin concentration, as well as providing linked markers for marker-assisted selection. (ii) Crown rust resistance Crown rust (Puccinia coronata f.sp. lolii) is an economically important pathogen of perennial ryegrass causing damaging losses in herbage yield and quality. Resistance to this pathogen has been demonstrated in a number of varieties and is an important breeding objective for pasture grass breeders. In order to map and 'tag' genes for crown rust resistance, crosses were made between selected individual plants from the base varieties Vedette (relatively resistant) and Victorian (relatively susceptible). This is described as a pseudo-testcross mapping family, consisting of the Ft progeny of the cross between two multiply heterozygous individuals. The parents and progeny were screened by inoculation with spores from a rust isolate from Hamilton, Victoria, and scored for a number of disease symptoms. The distribution of resistant and susceptible plants in the Fi generation suggested that a major gene may contribute to resistance. In the case of simple genetic control, a bulked segregant analysis (BSA; Michelmore et al., 1991) may be used. Genomic DNA samples from 10-15 individuals from each group were pooled and SSR markers were screened for genetic polymorphism between the bulked groups, which were replicated. 44 As shown in Figure 13, locus LPSSRK07F08 detects a consistent difference between the resistant and susceptible bulks. This is expected of genetic loci which are closely linked to the target gene. Decomposition of the bulked samples into groups of individuals also reveals a clear separation of the two groups whpn ____ 5 analysed with this locus. Other SSR loci failed to reveal such differences, with essentially identical patterns between bulked samples. This study demonstrates the tagging of a crown rust gene determinant, providing the means for marker assisted selection for the trait in varietal improvement. REFERENCES 10 Documents referred to herein are for reference purposes only and the inclusion of such references should not be taken as an indication that this form part of the common general knowledge in the art, nor that they would have been ascertained, understood or regarded as relevant to the invention disclosed herein by a person skilled in the art at the priority date. 15 Allen, M.J., Collick, A. and Jeffreys, A.J. (1994) Use of vectorette and subvectorette PCR to isolate transgene flanking DNA. PCR methods and applications 4:71-75. Bert PF, Charmet G, Sourdille P, Hayward MD, Balfourier F (1999) A high-density molecular map for ryegrass (Lolium perenne) using AFLP markers. Theor 20 Appl Genet 9: 445-452 Blair MW, Panaud O, McCouch SR (1999) Inter-simple sequence repeat (ISSR) amplification for analysis of microsatellite motif frequency and fingerprinting in rice (Oryza sativa L.). Theor Appl Genet 98: 780-792 Borrill M (1976) Temperate grasses. In: Simmons NW (ed) Evolution of 25 Crop Plants. Longman, London pp 137 -142 Brohede J, Ellegren H (1999) Microsatellite evolution: polarity of substitutions within repeats and neutrality of flanking sequences. Proc Roy Soc Lond B: 26: 825-833 45 Charmet G, Ravel C, Balfourier F (1997) Phylogenetic analysis in the Festuca-_Lo!ium complex using molecular markers and ITS rDNA. Theor Appl Genet 94: 1038-1046 Condit R, Hubbell SP (1991) Abundance and DNA sequence of two-base 5 repeat regions in tropical tree genomes. Genome 34: 66-71 Cordeiro GM, Henry RJ (1999) Microsatellite sequences as useful genetic markers in sugarcane. 11th Australian Plant Breeding Conference Proceeding, Adelaide, April 1999. Volume 2: 208-209 Darbyshire S.J (1993) Realignment of Festuca subgenus Schedonorus with 10 the genus Lolium (Poaceae). Novon 3: 239 - 243. Devey ME, Sewell MM, Uren TL, Neale DB (1999) Comparative genetic mapping in the loblolly and radiata pine using RFLP and microsatellite markers. Theor Appl Genet 99: 656-662 Devos KM, Gale MD (1997) Comparative genetics in the grasses. Plant Mol 15 Biol 35: 3-15 Echt CS, Vendranin GG, Nelson CD, Marquardt P (1999) Microsatellite DNA as shared markers among conifer species. Canad Journ Forest Res 29: 365-371 Edwards, K.J., Barker, J.H.A., Daly, A., Jones, C. Karp, A. (1996) 20 Microsatellite libraries enriched for several microsatellite sequences in plants. BioTechniques 20:758-759. Fisher, P.J., Gardner, R.C. and Richardson, T.E. (1996) Single locus microsatellites isolated using 5'-anchored PCR. Nucl. Acids. Res. 24:4369-4371. Forster JW (1999) The International Lolium Genome Initiative. Plant and 25 Animal Genome VII. W100. 46 Fulton TM, Chunwongse J, Tanksley SD (1995) Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Molec Biol Rep 13:207-209 Hedrick PW (1985) Genetics of populations. Jones & Bartlett Publ. Inc., 5 Boston, Mass. Jenkins G (1989) Chromosome pairing and fertility in plant hybrids. In: Fertility and Chromosome Pairing: Recent Studies in Plants and Animals (ed. Gillies CB) CRC Press pp 109 -135. Jenkins, G., Head, J. and Forster, J.W. (2000) Probing meiosis in hybrids of 10 Lolium (Poaceae) with a discriminatory repetitive genomic sequence. Chromosoma 109: 280-286. Jones, E.S., Dupal, M.P., Kolliker, R., Drayton, M.C. and Forster, J.W. Development and characterisation of simple sequence repeat (SSR) markers for perennial ryegrass (Lolium perenne L.). Theoretical and Applied Genetics, in 15 press. Lagercrantz U, Ellergren H, Andersson L (1993) The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Res 21: 1111-1115 Lehvaslaiho H, Saura A, Lokki J (1987) Chloroplast DNA variation in the 20 grass tribe Festuceae. Theor Appl Genet 74: 298-302 Liu ZW, Jarret RL, Kresovich S, Duncan RR (1995) Characterisation and analysis of simple sequence repeat (SSR loci) in seashore paspalum (Paspalum vaginatum Swartz.). Theor Appl Genet 91: 47-52 Michelmore, R.W., Paran, I. and Kesseli, R.V. (1991) Identification of 25 markers linked to disease resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proceedings of the National Academy of Sciences USA 88: 9828- 47 9832. Morgante M, Olivieri AM (1993) PCR-amplified microsatellites as markers in plant genetics. Plant Journal 3: 175-182 Naylor B (1960) Species differentiation in genus Lolium. Heredity 15: 219 - 5 223 Peakall R, Gilmore S, Keys W, Morgante M, Rafalski A (1998) Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Mol Biol Evol 15: 1275-1287 10 Perez-Vicente, R., Petris, L., Osusky, M., Potrykus, I. and Spangenberg, G. (1992) Molecular and cytogenetic characterisation of repetitive DNA sequences from Lolium and Festuca: applications in the analysis of Festulolium hybrids. Theoretical and Applied Genetics 84:145-154. Powell W, Morgante M. Andre C, Hanafey M, Vogel J, Tingey S, Rafalski A 15 (1996) The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol Breed 2: 225-238 Ramsay, L., Macaulay, M., Cardie, L., Morgante, M., degli Ivanissevich, S., Maestri, E., Powell, W. and Waugh, R. (1999) Intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements in barley. Plant Journal 17: 415-425. Rossetto M, McLauchlan A, Harriss FCL, Henry RJ, Baverstock PR, Lee LS, Maguire TL, Edwards KJ (1999) Abundance and polymorphism of microsatellite markers in the tea tree (Melaleuca alternifolia. Myrtaceae). Theor Appl Genet 98: 1091-1098 25 Saal B, Wricke G (1999) Development of simple sequence repeats in rye (Secale cereale L.). Genome 42: 964-972 20 48 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory Press, Plainview, New York Smulders MJM, Bredemeijer G, Rus-Kortekaas W, Arens P, Vosman P (1997) Use of short microsatellites from database sequences to generate 5 polymorphisms among Lycopersicon esculentum cultivars and accessions of other Lycopersicon species. Theor Appl Genet 97: 264-272 Soreng RJ, Davis, J I (1998) Phylogenetics and character evolution in the grass family (Poaceae): Simultaneous analysis of morphological and chloroplast DNA restriction site character sets. Botanical Review 64: 1-85 10 Stammers M, Harris J, Evans GM, Hayward MD, Forster JW (1995) Use of random PCR (RAPD) technology to analyse phylogenetic relationships in the Lolium / Festuca complex. Heredity 74:19 - 27 Tautz D (1989) Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res 17: 6463-6471 15 Tautz D, Trick M, Dover GA (1986) Cryptic simplicity in DNA is a major source of genetic variation. Nature 322: 652-656 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids 20 Res 22: 4673-4680 Wang Z, Weber JL, Zhong G, Tanksley SD (1994) Survey of plant short tandem DNA repeats. Theor Appl Genet 88: 1-6 Weber JL (1990) Human DNA polymorphism based on length variations in simple-sequence tandem repeats. In: Davies KE, Tilghman SM (eds) Genetic and 25 physical mapping. Volume I Genome analysis. Cold Spring Harbour Laboratory Press, Plainview, New York 49 Weising K. and Gardner, R.C. (1999) A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledenous angiosperms. Genome 42: 9-19. 5 White G, Powell W (1997) Cross-species amplification of SSR loci in the Meliacea family. Mol Ecol 6: 1195-1197 Whitton J, Rieseberg LH, Lingerer MC (1997) Microsatellite loci are not conserved across the Asteraceae. Mol Biol Evol 14: 204-209 Xu WW, Sleper DA (1994) Phylogeny of tall fescue and related species 10 using RFLPs. Theor Appl Genet 88: 909 - 913 Yaneshita M, Ohmura T, Sasakuma T, Ogihara Y (1993) Phylogenetic relationships of turfgrasses as revealed by restriction fragment analysis of chloroplast DNA. Theor Appl Genet 87:129-135 Finally, it is to be understood that various alterations, modifications and/or 15 additions may be made without departing from the spirit of the present invention as outlined herein. It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features. </div>

Claims

<div class="application article clearfix printTableText" id="claims"> What is claimed: 50 1. A substantially purified or isolated nucleic acid molecule/from a ryegrass or fescue species including a simple sequence repeat (SSRj/said SSj including two or more tandemly repeated nucleotide core elements m between 2 5 and 6 nucleotides in length. 2. said SSR. A nucleic acid molecule according to claim 1 consisting essentially of 3. A nucleic acid molecule according toyclaim 1 of 2 wherein said nucleic acid molecule is isolated from a ryegrass species selected from the group 10 consisting of Italian or annual ryegrass and perennial ryegrass. 4. A nucleic acid molecule according to /flaim 1 or 2 wherein said nucleic acid molecule is isolated from aiescue snecies selected from the group consisting of tall fescue, meadow fescue and red/fescue. 5. A nucleic acid molecme according to claim 1 or 2 wherein said SSR 15 includes one or more nucleotide/sequences selected from the group consisting of: \ c < 0 1 1 / [AAG]n \ c < I— III 1 / [AGA]n [CT]n / y ' [TCT]n [GT]n / / [CTT]n [GA]n / / [AAC]n [AC]n / / [ACA]n [ag/ / [TTG]n mh / [TGT]n [TC]n / [CAT]n [TG]n/ [ATG]n [GA^n [TCAjn J^AA]n [ATG]n C o 0 i— I., J [TGAJn [TTC]n [GAT]n [GTT]n [TCGC]i s.c? /'T~ I-J IP \ri ,C', a ;; c 004757831v2.doc 50 What is claimed: 1. A method of identifying a SSR, said method including preparing a library of ryegrass or fescue genomic DNA enriched for SSRs and identifying clones 5 in said library containing SSRs, wherein said library is prepared by a method including: providing genomic DNA from a ryegrass or fescue species, a first restriction enzyme, 10 symmetrical adaptors each containing a second restriction enzyme site, primers complementary to the adaptors, a hybridization membrane carrying bound oligonucleotides, a second restriction enzyme, and 15 a vector; digesting the genomic DNA with the first restriction enzyme; ligating the adaptors to the digested genomic DNA; amplifying the ligated DNA by PCR using the primers; hybridizing the PCR amplified DNA to the membrane; 20 washing the membrane; amplifying the PCR amplified DNA which preferentially hybridized to the membrane; digesting the amplified DNA with the second restriction enzyme; and ligating the digested and amplified DNA into the vector to generate the 25 library, wherein the SSR is an SSR including five or more repeated nucleotide core elements of between 2 and 6 nucleotides in length, wherein at least two of the repeated core elements are tandemly repeated, and excluding SSRs from a ryegrass species amplified by a nucleic acid primer 51 [TATGTG]n [GTTT]n / wherein n is the number of repeats and is a number between 2 and approximately 60. / 6. A nucleic acid molecule according to claim 5 wheren/said SSpf includes a nucleotide sequence selected from the group consisting on: / r—-i O > i—-j CO CO [TATGTGW [CA]10 [GIHfc/ / [CT]8[CA]18 [AC]g / / [GAA]7 [ac% / [CAA]6 TO15 / [TG]45 /[CT]19 / [TG]27 / [CAA]^GG[CAA]7 o > 4*. / [GTF]7GCGATT[GTT]3 [CA]5 / mb CO CD / /ICTTlso [CA]33 / / [AG]s [CA]33[TA]7 j ' / [CA]9 [CA]7 / / [CA]4TA[CA]4 [TGC]s / / [CTT]7 [TTC]25 / / [CA]21 \ < < o ' [CA]27 [TCGC]6 / / or a fragment or variant thereof which fragment or variant is a SSR. 7. A nucleic.acid primer suitable for amplifying a SSR according to claim 1. / / A nocleic acid primer according to claim 7 wherein said primer includes a nucleotide sequence selected from the group consisting of: ^-TTGGCXCACTGGGTTT-3' 5'-CTGGGTG ACCT AGCAG AC-31 5'-CG0T AT AG CCCTT AG CCT CG -3' 5'-TTT G AAATT CCCTT CTT CCCT-3' H3AGGCACCGGCCATGGAG-3' 5'-AGGACGAGCCACTCACTTG-3' 004757831v2.doc ! 51 I i1 ; M r pair selected from the group consisting of: 5'-CACCTCCCGCTGCATGGCATGT-375'-TACAACGACATGTCAAGG-3' 5'-GGTCTGGTAGACATGCCTAC-375'-TACCAGCACAGGCAGGTTC-3' 5'-TGCTGTGGCTCTTGTGAC-375'-AGCCGAGGCTCAGCTCGA-3' 5 5'-AGAGACCAT CACCAAGCC-375-T CT GGAAGAAGATTT CCTT G-3' 5'-GCAACTT CTATCGAGTTG-375'-GAGGCT CGAT CTT CACGGA-3' 5'-CTACAATGCATTCGTGCA-375'-TAGAGGCACCCGCGCCCT-3'. 2. A method according to claim 1, wherein said first restriction enzyme is a blunt end restriction enzyme or plurality of blunt end restriction enzymes. 10 3. A method according to claim 2, wherein said blunt end restriction enzyme(s) are selected from the group consisting of A!u\, Dra\, EcoRV, Rsa\, Sspl, HaeIII and H/nc1. 4. A method according to any one of claims 1 to 3, wherein said bound oligonucleotides include one or more of the following sequences: 15 [CA]20 : [CThs : [ACT]I4 : [AGA]14 : [CAA]14 : [CTA]14 : [CTT]14 : [GAC]14 : [CAG]10 : [AGC]14 : [CAT]14 : [ACA]14 : [GA]1S : [GC]15 : [GT]15 : [CA]1S : [CT]I5 : [CG]is : [AT]I5 : [TA]I5. 5. A method according to any one of claims 1 to 4, wherein the SSR is identified from a ryegrass species selected from the group consisting of 20 Italian or annual ryegrass and perennial ryegrass. 6. A method according to any one of claims 1 to 4, wherein said SSR is identified from a fescue species selected from the group consisting of tall fescue, meadow fescue and red fescue. mw ,iHW 5'-CAAGTGCCAGCATAG ATACAA-3' 52 5'-CGTGAAGATCACTATAAACACGAAA-3' 5'-CGCAGCTTAATTTAGTC-3' 5'-GCTTTGAGTATGTAAAGTT-3'/ 5'-TCTGTGGGTCCTTCTGGAT-3' 5'-TCGGGTGATGATGTTGACTT-3' 5'-ATTGACTGGCTTCCGTGTT-3' 5'-CGCGATTGCAGAl ~G-3' 5 5-TGGAATAACGATGAAAAG-3' 5'-CATCACGAA7T AACAAQAG-3' 5'-GGACGAACTGCCGAGACA-3' 5'-CGGGCA7GGTGAGAAGGA-3' S'-CGGCCACCCTTGATAGAG-S' S'-TCGTCAAGGATZCGGAGA-S' or a fragment or analogue thereof which/fragment px analogue is suitable for amplifying a SSR in a ryegrass or fescue/species. 10 9. A method of identifying a SSR afccording to claim 1, said method including preparing a library of Ryegrass of fescue genomic DNA enriched for SSRs and identifying clones in/said librarVcontaining SSRs. 10. A method ajzcording ttyclaim 9 wherein said library is prepared by a method including 15 providing genofnic DNA fp6m a ryegrass or fescue species, a first restriction enzyme, /symmetrical adaptors each containing a second restriction enzyme 20 '25 site, primefs complementary to the adaptors, a hybridization membrane carrying bound oligonucleotides, second restriction enzyme, and a vector; Resting the genomic DNA with the first restriction enzyme; ligating the adaptors to the digested genomic DNA; amplifying the ligated DNA by PCR using the primers; 004757831v2.doc 52 7. A method according to any one of claims 1 to 6 wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [CA]n [TA]n c I— o [GT]n 1 1 Q > zs [AC]n [AG]n [AT]n [TC]n [TG]n [GAA]n [CAAJn [TGC]n [TTC]n [GTT]n [AAGJn t 1 > Q > [TCT]n [CTT]n [AAC]n [ACA]n [TTG]n [TGT]n [CAT]n [ATC]n [TCA]n [ATG]n [TGA]n [GAT]n [TCGC]r [TATGTG]n [GTTT]n wherein n is the number of repeats and is a number between 5 and approximately 60. 8. A method according to claim 7, wherein said SSR includes a nucleotide sequence selected from the group consisting of: [CA]38 o > «■■ —1 o [CT]s [CA]18 [GAA]7 [CAA]6 [TG]45 [TG]27 111 "1 o > [CA]5 [TG]i8 [CA]33 [CA]33[TA]7 [CA]t [TGC]6 [TTC]25 [CAA]14 53 hybridizing the PCR amplified DNA to the membrane; / washing the membrane; / amplifying the PCR amplified DNA which preferentially hybridized to the/ membrane; / / 5 digesting the amplified DNA with the second restriction enzyme; and / ligating the digested and amplified DNA into the vector to generate the library. / / 11. A method according to claim 10 wherein said first restriction enzyme is a blunt end restriction enzyme or plurality of blunt srid restriction enzymes. 10 12. A method according to claim 11 ^wherein sara blunt end restriction enzyme(s) are selected from the group consisting of AluyDra\, EcoRV, Rsa\, Sspl, Haelll and Hincl. / / 13. A method according to any one ofaims 10-12 wherein said bound oligonucleotides include one or mop of the following sequences: 15 [CA]20 : [CT]15 : [ACT]14 : [AG#ff4 : [CAM& : [CTA]14 : [CTT]14 : [GAC]U : [CAG]10 : [AGC]i4 : [CAT]i4 : [ACA]iyfGA]15: raC]i5: [GT]15 : [CA]15: [CT]15: [CG]1S : [AT]is : [TAlis- / / 14. A library of ryegrass or fescue genomic DNA enriched for SSRs and prepared by a method according to claim 10. 20 15. /A methoa of selecting for a gene in grass or cereal breeding, said method including identifying a SSR according to claim 1 that is closely associated with sara gene sfich that said SSR and said gene are preferentially coinherited, and/selectingior said SSR in said breeding. / 16/ A method according to claim 15 wherein the SSR and the gene have a genetic map distance of approximately 5 cM or less. / 17. A method according to claim 15 or 16 wherein said grass or cereal is /a ryegrass or fescue. / 18. A method according to any one of claims 15 to 17 wherein said gene siqejms s\ an6o|bub jo juaiubejj i|oii|m joajam an6o|bub jo luaiubejj e jo ,£-V9V00001V00W01001-,S .e-ovovivonooovooooo-.s ,£-V99W9V91991V09990-,9 ,e-VOV9VOOOOlOWOOV90-,S ,e-0V0W0WIlW00V01VQ-S ,e-0WW91V90WlW091-,S ,e-oiioiivovoonvoooo-,s .e-iioiooonoooiovonv-.s 01- ,e-110V01101V01V0100901-,S ,£-JLV99i011001999±910J.-,9 ,e-119VW191V19V911109-,S ,£-019Vll±WI109V090-,9 1e-VW90V0VWlV10V01V9W9190-,S 1S-W0V1V9V1V00V00919W0-,S (£-9110V010V009V90V99V-,S ,£-9V991V009900V099V9-,S ,£-10001101100011VW9111-,S 1£-901009V110009VlV1990-,9 ,£-0V9V09V100V9199910-19 •S-11190910V0109911-.S :jo 6u!is!su00 dnoj6 am wojj. papa|as jaiuud e Aq payi|diue s! aSS P!BS ujajaqM 'g oj i suijep |0 auo Aue oj 6inpjoooe poijjaiu v '6 ass e s! lueuea jo }uaiu6ejj ljojijm joajam jubijba jo }uaiu6bj^ b jo ^[VOl IVOlVllVQ] 8[9V] 6[19] z[WQ]9909[WQ] Hoi] 6[QV] £49191V1] Z2IVQ] zIllO] 6[vo] ozLLLO] £[119]11V909Z[119] 64io] 9[QV] s[llJL9] 9[090l] £9 sip Si OOP"ZAJ.£8ZSZWO 54 / is capable of influencing disease resistance, herbage digestibility, nutriem quality, / mineral content or drought tolerance. / / 19. A method according to claim 18 wherein said gene is capable of influencing neutral detergent fibre (NDF) content. / / 5 20. A method according to claim 18 whereiprsaid gengr is capable of influencing crown rust resistance. / / 21. A method for DNA profiling grasp or cereaj/species varieties, said method including assessing variation between said varices of a SSR according to claim 1. / / 10 22. A method according ty'claim 21 ywherein said grass or cereal is a ryegrass or fescue. / / 23. A method for testing the purity of grass or cereal seed batches, said method including assessh*g variatioj/within said seed batch of a SSR according to claim 1. / / 15 24. A method according to claim 23 wherein said grass or cereal is a ryegrass or fescue. / 25/ A nujzffeic acid molecule according to claim 1, substantially as hereinbefore described with reference to any one of the examples. 004757831v2.doc 54 for amplifying a SSR in a ryegrass or fescue species. 10. A substantially purified or isolated nucleic acid molecule, wherein said nucleic acid molecule is purified or isolated from a library of ryegrass or fescue genomic DNA enriched for SSRs according to a method of any one of claims 1 to 9, the nucleic acid molecule consisting essentially of said 11. A nucleic acid molecule according to claim 10 , wherein said nucleic acid molecule is isolated from a ryegrass species selected from the group consisting of Italian or annual ryegrass and perennial ryegrass. 12. A nucleic acid molecule according to claim 10 , wherein said nucleic acid molecule is isolated from a fescue species selected from the group consisting of tall fescue, meadow fescue and red fescue. 13. A nucleic acid molecule according to claim 10 , wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: SSR. [CA]n [CT]n [GA]n [AG]n [TC]n [GAA]n [TGC]n [GTT]n [AGA]n [CTT]n [ACA]n [TGT]n [ATC]n [ATG]n [TA]n [GT]n [AC]n [AT]n [TG]n [CAA]n [TTC]n [AAG]n [TCT]n [AAC]n [TTG]n [CAT]n [TCA]n [TGA]n 26. A method according to claim 9 substantially a hereinbefoj* described with reference to any one of the examples. DATED: 23 March 2001 Freehills Carter Smith Bjs e Patent Attorneys for thj Applicants: State of Victoria as represent* Department, onment Natural Resources and The University (^Adelaide Internationaljsffaize and WHeat Improvement Center State of South Austria as represented by South Australian Research and Development Institute Sptithern Cross University Debra Tulloch 20 004757831v2.doc 55 [GAT]n [TATGTG]r [TCGC]n [GTTT]n 14. wherein n is the number of repeats and is a number between 5 and approximately 60. A nucleic acid molecule according to claim 10, wherein said SSR includes a nucleotide sequence selected from the group consisting of: [CA]38 [CT]8[CA]18 [CAA]6 [TG]27 [CA]S [CA]33 [CA]7 [TTC]25 [TCGC]6 [GTTT]5 [AC]e [CT]19 [GTT]7GCGATT[GTT]3 [CTT]2o [CA]g [CTT]7 [CA]27 [CA]10 [GAA]7 [TG]45 [CA]h [TG]18 [CA]33[TA]7 [TGC]6 [CAA]14 [TATGTG]13 [AC]g [TC]15 [CAA]6CGG[CAA]7 [GT]9 [AG]S [CA]4TA[CA]4 [CA]21 or a fragment or variant thereof which fragment or variant is a SSR. 15. A nucleic acid primer suitable for amplifying the SSR according any one of claims 10 to 14, wherein the primer pair is selected from the group consisting of: 5'-TTGGCTCACTGGGTTT-375'-CTGGGTGACCTAGCAGAC-3' 004757831v2.doc 5'-CGGTATAGCCCTTAGCCT CG-375'-TTT GAAATT CCCTT CTT CCCT-3' 5'-GAGGCACCGGCCATGGAG-375'-AGGACGAGCCACTCACTTG-3' 5'-CAAGT G CCACCAT AG AT AC AA-3' /5'-CGT G AAG AT C ACTAT AAACACG AAA-3' 5'-CGCAGCTTAATTTAGTC-3' / 5'-GCTTTGAGTATGTAAAGTT-3' 5'-TCTGTGGGTCCTTCTGGAT-3' / 5'-TCG G GT GAT GAT GTT G ACTT-3' 5'-ATTGACTGGCTTCCGTGTT-3' / 5'-CGCGATTGCAGATTCTTG-3' 5'-TGGAATAACGATGAAAAG-3' / 5'-CATCACGAATTAACAAGAG-3' 5'-GGACGAACTGCCGAGACA-3' / 5'-CGGGCATGGTGAGAAGGA-3' 5'-CGGCCACCCTTGATAGAG-3' / 5-TCGTCAAGGATCCGGAGA-3' or a fragment or analogue thereof which fragment or analogue is suitable for amplifying the SSR in a ryegrass or fescue species 16. A library of ryegrass or fescue genomic DNA enriched for SSRs and prepared by a method according to any one of claims 1 to 9. 17. A method of selecting for a gene in grass or cereal breeding, said method including identifying a SSR according to a method of any one of claims 1 to 9 that is closely associated with said gene such that said SSR and said gene are preferentially coinherited, and selecting for said SSR in said breeding. 18. A method according to claim 17 wherein the SSR and the gene have a genetic map distance of approximately 5 cM or less. 19. A method according to claim 17 or 18 wherein said grass or cereal is a ryegrass or fescue. 004757831v2.doc 57 >v! ' .! > I1! " 20. A method according to any one of claims 17 to 18 wherein said gene is capable of influencing disease resistance, herbage digestibility, nutrient quality, mineral content or drought tolerance. 21. A method according to claim 20 wherein said gene is capable of influencing 5 neutral detergent fibre (NDF) content. 22. A method according to claim 20 wherein said gene is capable of influencing crown rust resistance. 23. A method for DNA profiling grass or cereal species varieties, said method including assessing variation between said varieties of the SSR according 10 to any one of claims 10 to 14. 24. A method according to claim 23 wherein said grass or cereal is a ryegrass or fescue. 25. A method for testing the purity of grass or cereal seed batches, said method including assessing variation within said seed batch of the SSR 15 according to any one of claims 10 to 14. 26. A method according to claim 25 wherein said grass or cereal is a ryegrass or fescue. 27. A nucleic acid molecule according to claim 10, substantially as hereinbefore described with reference to any one of the examples. 20 28. A method according to claim 1 substantially as hereinbefore described with reference to any one of the examples. ABSTRACT The present invention relates to simple sequence repeats (SSRs) and, more particularly, to SSRs in ryegrasses and fescues. The invention also relates to primers suitable for amplifying SSRs, methods for identifying SSRs, libraries 5 enriched for SSRs and methods of preparing same, and uses of SSRs. </div>