NZ509137A - Methods for reducing GnRH levels in prepubertal vertebrates as an alternative to surgical sterilisation - Google Patents

Abstract

Methods for achieving suppression of reproductive behaviour and/or fertility in a vertebrate subject are disclosed. The methods use compositions which include GnRH immunogens, GnRH analogs such as GnRH agonists and antagonists, and GnRH antibodies. The methods are useful for the prolonged suppression of testicular function in males and ovarian function in females.

Description

WO 99/62545 PCT/CA99/00493 509137 GnRH VACCINES FOR SUPPRESSING .. REPRODUCTIVE BEHAVIOR IN ANIMALS Technical Field The present invention relates generally to the production of compositions for hormone modulation. More particularly, the invention is directed to active and passive GnRH immunization to achieve prolonged suppression of reproductive behavior and/or fertility. The invention also relates to the use of GnRH agonists 15 and antagonists to reduce circulating GnRH levels.

Background of the Invention In the adult animal, gonadotropin-releasing hormone (GnRH) is produced in the hypothalamus 20 (Schally et al., Science (1973) 179:341-350) and causes the release of the gonadotropin hormones, luteinizing hormone (LH) and follicle stimulating hormone (FSH), from the pituitary gland. These, in turn, control the gonadal production of sex steroids; 2 5 testosterone in males and estrogen and progesterone in females. Therefore, in adults, the hypothalamic-pituitary-gonadal (H-P-G) axis is responsible for sexual function.

The onset of puberty appears to be driven by 30 the hypothalamus, however the detailed mechanisms of this process are not well understood. In the prepubertal animal, the H-P-G axis is functional and appears to play a key role in the onset of puberty. The first clinical signs of puberty are preceded by 35 increased pulsatile secretion of GnRH, followed by increased pituitary responsiveness to GnRH (Apter D., ■1- IPONZ - 9 JUL 2003 Ann. NY Acad. Sci. (1997) 816:9-21). Gonadotropin secretion from the pituitary gland, particularly secretion of LH, increases progressively during the peripubertal period, ultimately resulting in gonadal 5 stimulation, secretion of sex hormones and progressive occurrence of sexual activity and physical maturation, which are recognized as the events referred to collectively as puberty.

Treatment with GnRH analogues before puberty 10 has been shown to delay the onset of puberty in some species. However, the mechanism by which this occurs has not been well described. In humans, long-term administration of GnRH agonists has been shown to be efficacious in the treatment of precocious puberty by 15 inhibiting progression of puberty (Neely et al., J. Ped. (1992) 121:634-640) . In prepubertal rams, continuous administration of a GnRH agonist using an implant or minipump for 16 weeks immediately prior to puberty inhibited the development of sexual behavior, 20 reduced plasma concentrations of testosterone, retarded testicular and epididymal development and inhibited growth rates for at least 2 months after the normal age at which puberty was expected to occur (Tilbrook et al., Hormones and Behavior (1993) 25 27:5-28). In female dogs, chronic infusions of GnRH agonists between 4 months of age and pubertal pro-estrus at 8-12 months of age, suppressed serum concentrations of FSH and LH (Concannon et al., J. Reproduc. Fertil. Supp. (1993) £7:3-27). However, 30 none of these studies showed a permanent effect on reproductive function once treatment was discontinued.

Active or passive immunization against GnRH has also been shown to delay, but not permanently arrest, the onset of puberty in several species. In 35 heifers, for example, multiple immunizations with a GnRH analogue conjugate vaccine (human serum albumins- Printed from Mimosa 01/03/2001 12:52:03 page -4- Cys-Gly-GnRH) induced and maintained sufficient anti-GnRH titers to delay puberty for 175 days (Prendiville et al., J. Animal Sci. (1995) 23:3030-3037). However, continued suppression of 5 reproductive function was not demonstrated in the face of declining antibody titers. Furthermore, this study did not evaluate whether the heifers were able to become pregnant and reproduce.

Prepubertal immunization with an ovalbumin-10 GnRH analogue conjugate vaccine impaired testes function and affected the development of social and sexual behavior of young bulls until 17 months of age (Jago et al., J. Animal Sci. (1997) 75:2609-2619). After 17 months of age, testicular function and 15 reproductive behavior returned to normal and immunized bulls could not be differentiated from normal untreated bulls of the same age. A study in sheep showed significant delay in testicular growth and function for up to 115 weeks of age when rams were 20 actively immunized against an ovalbumin- GnRH analogue conjugate vaccine soon after birth (prepubertal) or around puberty (peripubertal) (Brown et al., J. Reproduc. Fertil. (1994) 101:15-21). However, 83% of the peripubertally immunized rams had normal 25 reproductive function and hormones by 115 weeks. In the rat, prepubertal passive immunization against GnRH resulted in a decrease in the size of the testis, cellularity of seminiferous tubules and reduced fertility at 100 days of age. However, there was no 30 difference in mating behavior between the immunized and control groups at 100 days of age (Bercu et al., Endo (1977) 101:1871-1879). In ewes, prepubertal vaccination with an ovalbumin GnRH analogue conjugate resulted in hypogonadotropic hypogonadism in 3 of 4 35 animals at 4 years of age. However, only anatomical and hormonal changes were reported. No reproductive Printed from Mimosa 01/03/2001 12:52:03 page -5- performance parameters were assessed in this study. (Brown et al., J. Reproduc. Fertil. (1995) 103:131-135). In contrast, immunization of young boars prepubertally at approximately 21 and 50 days of age 5 has been shown to lead to the development of detectable GnRH antibody titers with no effect on serum testosterone levels as the animals reached puberty and sexual maturity (Manns and Robbins, Proceedings of the EAAP Working Group (1997), EEAP 10 Publication No. 92:137-140).

Thus, the long-term effects of prepubertal GnRH immunization on sexual function and behavior have not been consistent or predictable. Only one study done in male rats showed reduced fertility. No 15 studies have shown reduced fertility in females of any species. Furthermore, no studies have shown reduced fertility in cats, dogs, horses or deer using GnRH immunization in the prepubertal period as a method of long-term sterilization. Additionally, none of the 20 reported studies above demonstrated biologically effective GnRH antibody titers or a reduction in sexual function and behavior after a single immunization.

The ability to achieve permanent 25 sterilization by GnRH immunization prepubertally or peripubertally would be very useful. Prepubertal surgical neutering of animals, in particular puppies and kittens less than 9 weeks of age, has been done extensively in the United States (Goeree, G., Can. 30 Vet. J. (April, 1998) 39:242-243). Studies have compared dogs and cats neutered prepubertally versus peripubertally and found no differences in subsequent growth, bone density or personality between the 2 groups. Male cats neutered prepubertally, which may 35 predispose some cats to urinary calculi later in life, did not show a difference in urethral diameters as Printed from Mimosa 01/03/2001 12:52:03 page -6- compared to those of cats neutered 6 to 12 months of age (Goeree G. , Can. Vet. J. (1998) 3_9:242-243) . No difference in morbidity or mortality associated with the surgical or anesthetic procedure was evident 5 between the 2 groups. However, surgery is expensive, requires special equipment and includes the risk of anesthetic death or postsurgical complications including hemorrhage, wound herniation and infection.

Long-term sterilization achieved by blocking 10 the action of GnRH prepubertally or peripubertally, including by active or passive immunization against GnRH, would be an effective and humane alternative to surgical castration.

Disclosure of the Invention Accordingly, the present invention is directed to the production of compositions for reducing the levels of GnRH in a prepubertal vertebrate. The compositions result in prolonged reduction in reproductive behavior and/or 2 0 fertility, for example, a prolonged suppression of testicular function and/or development in males, or ovarian function and/or development in females. The invention is particularly suitable for use with domestic animals such as cats, dogs and horses, and 25 wild-life, such as deer, and provides a viable and desirable alternative to surgical forms of sterilization that are currently used.

Long-term immunosterilization may be achieved by active or passive immunization against 30 GnRH during the prepubertal or peripubertal period. Without being bound by a particular theory, there appears to be a critical period in early life during which normal and sustained gonadal development requires gonadotropic stimulation, particularly by LH 35 from the pituitary gland. Inhibition of the H-P-G axis by active or passive immunization against GnRH or 9 JUL 2003 by' treatment with GnRH agonists or antagonists (collectively referred to herein as GnRH therapy) prepubertally or peripubertally, results in a reduction in circulating GnRH concentrations which in turn may cause down-regulation of pituitary GnRH receptors and a reduction in gonadatropins during this critical time period. This may lead to long-term impairment of gonadal development and function by the permanent inability of the pituitary gland to respond to GnRH.

Accordingly, in one embodiment, the present invention is directed to the production of a composition for prolonged suppression of reproductive behaviour and/or fertility. The production comprises the use of a nucleic acid encoding 1) a GnRH immunogen, 2) a GnRH analogue, or 3) antibodies that cross-react with endogenous GnRH of a vertebrate subject in the production of a first composition for prepubertal or peripubertal administration to the vertebrate subject. The composition optionally includes an immunological adjuvant, preferably comprising an oil and dimethyldioctadecylammonium bromide.

In certain embodiments, the composition results in a prolonged,, long-term suppression of gonadal development and/or function, such as a suppression of testicular development and/or function in males or prolonged long-term suppression of ovarian development and/or function in females. The production may further comprise the manufacture of a second composition for administration to the vertebrate subject comprising an effective amount of a GnRH immunogen. The GnRH immunogen may be the same or IPONZ - 3 JUL 2003 different in the compositions.

In another embodiment, the invention is directed to the production of a composition for prolonged suppression of reproductive behaviour and/or fertility in a feline, canine, equine or cervine subject. The production comprises the. use. of a GnRH multimer comprising the general formula (GnRH-X-GnRH)y wherein: GnRH is a GnRH immunogen; X is one or more molecules selected from the group consisting of a peptide linkage, an amino acid spacer group, a carrier molecule and [ GnRH] n, where n is an integer greater than or equal to 1; and y is an integer greater than or equal to 1. In yet another embodiment, the invention is directed to the production of a composition for prolonged suppression of reproductive behaviour and/or fertility in a feline subject. The production comprising the use of first and second GnRH multimers for the production of first and second vaccine compositions for use in a method for prolonged suppression of the productive behaviour and/or fertility in a vertebrate subject, said first and second vaccine compositions comprising an adjuvant, said first and second GnRH multimers comprising the general formula (GnRH-X-GnRH)y wherein: GnRH is a GnRH immunogen; X is one or more molecules selected from the group consisting of a peptide linkage, an amino acid spacer group, a leukotoxin polypeptide and [ GnRH] n, where n is an integer greater than or equal to 1; and y is an integer greater than or equal to 1; wherein said first composition is administered IPONZ - 3 JUL 2003 to said subject prepubertally at about 3 to about 15 weeks of age; and second vaccine composition is administered to said subject about 2 to about 10 weeks following administration of the first vaccine composition.

In another embodiment, the invention is directed to the production of a composition for prolonged suppression of reproductive behaviour and/or fertility in a feline subject. The production comprises the use of a first and second GnRH multimers in the manufacture of a first and second vaccine composition comprising an immunological adjuvant which comprises a light mineral oil and dimethyldioctadecylammonium bromide, said first and second GnRH multimers comprising the amino acid sequence depicted in Figures 6A-6F, or an amino acid sequence with at least about 75% sequence identity thereto; wherein said first composition is administered to said subject prepubertally at about 5 to about 12 weeks of age and said second vaccine composition is administered to said subject about 2 to about 10 weeks following administration of the first vaccine composition.

In an additional embodiment, the invention is directed to the production of a composition for suppressing reproductive behaviour and/or fertility in a feline, canine, equine or cervine subject for at least 10 months. The production of a first composition uses an effective amount of a GnRH immunogen. In other embodiments, a second vaccine IPONZ -9 JUL2003 composition is produced which comprises an effective amount of a GnRH immunogen. The GnRH immunogen in the first and second compositions may be the same or different.

In certain embodiments, both the first and second compositions are administered prepubertally, or postpubertally, or the first composition is administered prepubertally and the second composition is administered postpubertally. in other embodiments,, the production further uses additional compositions comprising an effective amount of a GnRH immunogen for administration at least about 6 to about 12 months subsequent to the prior administration. In particular embodiments, the additional compositions are administered at about yearly intervals.

These and other embodiments of the present invention will readily occur to those of ordinary skill in the art in view of the disclosure herein.

Brief Description of the Figures Figure 1 depicts the relationship between GnRH antibody titers (mean + SEM) and serum testosterone in cats immunized with GnRH vaccines. 2 5 Figure 2 shows GnRH antibody titers (mean + SEM) in kittens immunized at 8, 12 and 16 weeks of age using 100 of a GnRH fusion protein described in the examples. GnRH antibodies were measured as % binding in 1:5000 dilution of serum. Arrows represent times 3 0 of immunization.

Figure 3 shows the effect of treatment with leuprolide acetate on serum LH concentrations in 10 month old kittens immunized at 8, 12 and 16 weeks of age with a GnRH vaccine.

Figure 4 shows GnRH antibody titers (mean + SEM) in kittens immunized at 6 and 10 weeks of age fPONZ - 9 JUL 2003 with 100 fig with a GnRH fusion protein described in the examples. GnRH antibodies were measured as % binding in 1:5000 dilution of serum. Arrows represent times of immunization.

Figures 5A and 5B show the nucleotide sequences and amino acid sequences of the GnRH constructs used in the chimeric leukotoxin-GnRH polypeptide gene fusions herein. Figure 5A depicts a single copy of a GnRH decapeptide. Figure 5B depicts 10 a molecule with four copies of a GnRH decapeptide when n=l, and eight copies of GnRH when n=2, etc.

Figures 6A through 6F show the nucleotide sequence and predicted amino acid sequence of the LKT-GnRH chimeric protein from pCB130. 15 Figure 7 depicts serum testosterone concentrations in kittens immunized at 8, 12 and 16 weeks of age with a GnRH fusion protein described in the examples. Arrows represent time of immunization.

Figure 8 depicts serum estradiol 20 concentrations in kittens immunized at 8, 12 and 16 weeks of age with a GnRH fusion protein described in the examples. Arrows represent time of immunization.

Detailed Description 25 The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology, and immunology, which are within the skill of the art. Such 30 techniques are explained fully in the literature.

See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual; DNA Cloning, Vols. I and II (D.N. Glover ed.); Oligonucleotide Synthesis (M.J. Gait ed.); Nucleic Acid Hybridization (B.D. Hames & 35 S.J. Higgins eds.); B. Perbal, A Practical Guide to Molecular Cloning; the series, Methods In Enzymology Printed from Mimosa 01/03/2001 12:52:03 page -12- (S. Colowick and N. Kaplan eds., Academic Press, Inc.); and Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., Blackwell Scientific Publications).

Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is 10 for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. 1. Definitions 15 In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.

The term "Gonadotropin releasing hormone" or "GnRH" refers to a decapeptide secreted by the 20 hypothalamus which controls release of both luteinizing hormone (LH) and follicle stimulating hormone (FSH) in vertebrates (Fink, G., British Medical Bulletin (1979) 35:155-160). The amino acid sequence of GnRH is highly conserved among 25 vertebrates, and especially in mammals. In this regard, GnRH derived from most mammals including human, bovine, porcine and ovine GnRH (formerly designated LHRH) has the amino acid sequence pyroGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2 (SEQ ID NO:l) 3 0 (Murad et al., Hormones and Hormone Antagonists, in The Pharmacological Basis of Therapeutics. Sixth Edition (1980) and Seeburg et al., Nature (1984) 311:666-668).

As used herein a "GnRH polypeptide" includes 35 a molecule derived from a native GnRH sequence, as well as recombinantly produced or chemically Printed from Mimosa 01/03/2001 12:52:03 page -13- synthesized GnRH polypeptides having amino acid sequences which are substantially homologous to native GnRH and which remain immunogenic, as described below, or which have the ability to act as GnRH agonists or 5 antagonists that bind to, and ultimately down-regulate, GnRH receptors, or otherwise block the action of GnRH such as by competing for GnRH receptors. Thus, the term encompasses derivatives and analogues of GnRH including any single or multiple 10 amino acid additions, substitutions and/or deletions occurring internally or at the amino- or carboxy-termini of the peptide. Accordingly, under the invention, a "GnRH polypeptide" includes molecules having the native sequence as well as analogues of 15 GnRH.

Representative GnRH analogues include an analogue with an N-terminal Gin or Glu residue rather than a pyroGlu residue, an analogue having Asp at amino acid position 2 instead of His (see Figure 5B); 20 a GnRH analogue with an N-terminal addition such as Cys-Gly-GnRH (see, e.g., Prendiville et al., J. Animal Sci. (1995) 73:3030-3037); a carboxyl-containing GnRH analogue (see, e.g., Jago et al., J. Animal Sci. (1997) 75:2509-2619; Brown et al., J. Reproduc. 25 Fertil. (1994) 101:15-21); the GnRH analogue (D-Trp6-Pro9-ethyl amide)GnRH (see, e.g., Tilbrook et al., Hormones and Behavior (1993) 27.:5-28) or (D-Trp6)GnRH (see, e.g., Chaffaux et al., Recueil de Medecine Veterinaire (1985) 161:133-145) ; GnRH analogues with 3 0 the first, sixth and/or tenth normally occurring amino acids replaced by Cys and/or wherein the N-terminus is acetylated and/or the C-terminus is amidated (see, e.g., U.S. Patent Nos. 4,608,251 and 4,975,420); the GnRH analogue pyroGlu-His-Trp-Ser-Tyr-X-Leu-Arg-Pro- Gly-Y-Z (SEQ ID NO: ) wherein X is Gly or a D-amino acid, Y is one or more amino acid residues which may Printed from Mimosa 01/03/2001 12:52:03 page -14- be the same or different, preferably 1-3 Gly residues, and Z is Cys or Tyr (see, UK Patent Publication No. GB 2196969); GnRH analogues described in U.S. Patent No. 5,688,506, including the GnRH analogue Cys-Pro-Pro-5 Pro-Pro-Ser-Ser-Glu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro- Gly (SEQ ID NO: ), pyroGlu-His-Trp-Ser-Tyr-Gly-Leu- Arg-Pro-Gly-Ser-Ser-Pro-Pro-Pro-Pro-Cys (SEQ ID NO: ), pyroGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly- Arg-Pro-Pro-Pro-Pro-Cys (SEQ ID NO: ); the GnRH analogue known as Deslorelin, commercially available from Apeptech (Australia), and Ovuplant™; and molecules with other amino acid additions, substitutions and/or deletions which retain the ability to either elicit formation of antibodies that 15 cross-react with naturally occurring GnRH, or molecules that act as GnRH agonists or antagonists.

Representative agonists of GnRH include the compounds Lupron™ and Lupron Depot™, both available from TAP Pharmaceuticals, Inc. (Deerfield, IL), with 20 the chemical formula 6-Oxo-L-propyl-L-histidyl-L-t rypt ophy1-L-seryl-L-tyrosyl-D-leucyl-L-1eucy1-L-4 arginyl-N-ethyl-L-prolinamide acetate, Zoladex™, a goserelin acetate implant, available from Zeneca Pharmaceuticals (Wilmington, DE). 2 5 Representative antagonists include N- terminus-modified analogues, such as those described in U.S. Patent No. 5,413,990; analogues described in U.S. Patent No. 4,740,500 including an analog with the formula Ac-/3-D-NAL-R2-D-3PAL-Ser-Arg-R6-Leu-Arg-Pro-30 R10, wherein R2 is Cl-D-Phe, F-D-Phe, N02-D-Phe, Br-D-Phe, 3, 4Cl2-D-Phe or Ca Me-Cl-D-Phe; R6 is D-3PAL, D-Trp, For-D-Trp, N02-D-Trp, (imBzl)D-His, D-Tyr or /3-D-NAL, and R10 is Gly-NH2, NHCH2CH3, NHNHCONH2 or D-Ala-NH2, (8-D-NAL is the D-isomer of alanine which is 35 substituted by naphthyl on the /S-carbon atom and D-3PAL is D-alanine which is substituted by pyridyl on Printed from Mimosa 01/03/2001 12:52:03 page -15- the /3-carbon atom with the linkage being to the 3-position on the pyridine ring, NML is a methyl substitution on the alpha-amino group of Leu; the GnRH analogue known as Abaralix (Garnick et al., ENDO s98, 5 p. 108:OR43-1); and the analogue PPI-149 (Praecis, Cambridge, MA).

Thus, the term "GnRH polypeptide" includes a GnRH molecule differing from the reference sequence by having one or more amino acid substitutions, deletions 10 and/or additions and which has at least about 50% amino acid identity to the reference molecule, more preferably about 75-85% identity and most preferably about 90-95% identity or more, to the relevant portion of the native polypeptide sequence in question. The 15 amino acid sequence will have not more than about 1-5 amino acid substitutions, or not more than about 1-3 amino acid substitutions. Particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place 20 within a family of amino acids. In this regard, amino acids are generally divided into four families: (1) acidic -- aspartate and glutamate; (2) basic --lysine, arginine, histidine; (3) non-polar -- alanine, valine, leucine, isoleucine, proline, phenylalanine, 25 methionine, tryptophan; and (4) uncharged polar --glycine, asparagine, glutamine, cystine, serine threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonably predictable that 30 an isolated replacement of leucine with isoleucine or valine, or vice versa; an aspartate with a glutamate or vice versa; a threonine with a serine or vice versa; or a similar conservative replacement of an amino acid with a structurally related amino acid, 35 will not have a major effect on the activity.

Proteins having substantially the same amino acid Printed from Mimosa 01/03/2001 12:52:03 page -16- sequence as the reference molecule, but possessing minor amino acid substitutions that retain the desired activity, are therefore within the definition of a GnRH polypeptide.

A "GnRH polypeptide" also includes peptide fragments of the reference GnRH molecule, so long as the molecule retains the desired activity. Epitopes of GnRH are also captured by the definition.

Particularly contemplated herein are 10 multimers of GnRH including repeating sequences of GnRH polypeptides such as multimers including 2, 4, 8, 16, 32 copies, etc. of one or more GnRH polypeptides, optionally including spacer sequences, such as those described in International Publication Nos. WO 15 98/06848 and WO 96/24675 and shown in Figure 5B herein. Such multimers are described more fully below.

For purposes of the present invention, a GnRH polypeptide may be derived from any of the 20 various known GnRH sequences, described above, including without limitation, GnRH polypeptides derived from human, bovine, porcine, ovine, canine, feline, cervine subjects, rodents such as hamsters, guinea pigs, gerbils, ground hogs, gophers, 25 lagomorphs, rabbits, ferrets, squirrels, reptilian and avian subjects.

A "GnRH peptide" is a GnRH polypeptide, as described herein, which includes less than the full-length of the reference GnRH molecule in question and 30 which includes at least one epitope as defined below. Thus, a vaccine composition comprising a GnRH peptide would include a portion of the full-length molecule but not the entire GnRH molecule in question. Particular GnRH peptides for use herein include, for 35 example, GnRH peptides with 5, 6 or 7 amino acids, particularly those peptides which include the amino Printed from Mimosa 01/03/2001 12:52:03 page -17- terminus or the carboxy terminus, such as GnRH peptides including amino acids 1-5, 1-6, 1-7, 2-8, 3-8, 3-10, 4-10 and 5-10 of the native sequence (see, e.g., International Publication No. WO 88/05308).

By "GnRH multimer" is meant a molecule having more than one copy of a selected GnRH polypeptide, GnRH immunogen, GnRH peptide or epitope, or multiple tandem repeats of a selected GnRH polypeptide, GnRH immunogen, GnRH peptide or epitope. 10 The GnRH multimer may correspond to a molecule with repeating units of the general formula (GnRH-X-GnRH)y wherein GnRH is a GnRH polypeptide, X is one or more molecules selected from the group consisting of a peptide linkage, an amino acid spacer group, a carrier 15 molecule and [GnRH] n, where n is an integer greater than or equal to 1, y is an integer greater than or equal to 1, and further wherein "GnRH" may comprise any GnRH polypeptide. Y may therefore define 1-40 or more repeating units, more preferably, 1-30 repeating 20 units and most preferably, 1-20 repeating units.

Further, the selected GnRH sequences may all be the same, or may correspond to different derivatives, analogues, variants or epitopes of GnRH, so long as they retain the ability to elicit an immune response. 25 Additionally, if the GnRH units are linked either chemically or recombinantly to a carrier, GnRH molecules may be linked to either the 5'-end, the 3'-end, or may flank the carrier in question. Further, the GnRH multimer may be located at sites internal to 30 the carrier. GnRH multimers are discussed in further detail below. The term "GnRH immunogen" refers to GnRH polypeptides, as described above, that elicit an immunological response without an associated immunological carrier, adjuvant or immunostimulant, as 35 well as GnRH polypeptides capable of being rendered immunogenic, or more immunogenic, by way of Printed from Mimosa 01/03/2001 12:52:03 page -18- association with a carrier molecule, adjuvant or immunostimulant, or by mutation of a native sequence, and/or by incorporation into a molecule containing multiple repeating units of at least one epitope of a 5 GnRH molecule. The term may be used to refer to an individual macromolecule or to a homogeneous or heterogeneous population of antigenic macromolecules derived from GnRH. Generally, a GnRH immunogen will elicit formation of antibodies that cross-react with 10 the naturally occurring, endogenous GnRH of the vertebrate species to which such an immunogen is delivered. The term "GnRH immunogen" also refers to nucleic acid molecules, such as DNA and RNA molecules encoding GnRH polypeptides which are capable of 15 expression in vivo, when administered using nucleic acid delivery techniques described further below.

"Homology" refers to the percent identity between two polynucleotide or two polypeptide moieties. Two DNA, or two polypeptide sequences are 20 "substantially homologous" to each other when the sequences exhibit at least about 75%-85%, preferably at least about 90%, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules. As used herein, substantially homologous 25 also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.

Percent "identity" between two amino acid or polynucleotide sequences can be determined by a direct comparison of the sequence information between two 30 molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the 35 analysis, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O. Dayhoff ed., 5 Printed from Mimosa 01/03/2001 12:52:03 page -19- Suppl. 3:353-358, National biomedical Research Foundation, Washington, DC, which adapts the local homology algorithm of Smith and Waterman (1981) Advances in Appl. Math. 2:482-489 for peptide 5 analysis. Programs for determining nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI) for example, the BESTFIT, FASTA and GAP programs, which also rely on 10 the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent identity of a particular 15 nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.

Alternatively, identity can be determined by 20 hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially 25 homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et 30 al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.

An "epitope" refers to any portion or region of a molecule with the ability or potential to elicit, and combine with, a GnRH-specific antibody. For 35 purposes of the present invention, a polypeptide epitope will usually include at least about 3 amino Printed from Mimosa 01/03/2001 12:52:03 page -20- acids, preferably at least about 5 amino acids of the reference molecule. There is no critical upper limit to the length of the fragment, which could comprise nearly the full-length of a protein sequence, or even 5 a fusion protein comprising two or more epitopes of a protein in question.

Epitopes in polypeptide molecules can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope 10 Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides 15 corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Patent No. 4,708,871; Geysen et al. (1984) 20 Proc. Natl. Acad. Sci. USA 8JL: 3998-4002; Geysen et al. (1986) Molec. Immunol. 23.:709-715. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional 25 nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra. Computer programs that formulate hydropathy scales from the amino acid sequence of the protein, utilizing the hydrophobic and hydrophilic properties of each of the 20 amino acids, 30 as described in, e.g., Kyte et al., J. Mol. Biol. (1982) 157:105-132; and Hopp and Woods, Proc. Natl. Acad. Sci. USA (1981) 78:3824-3828, can also be used to determine antigenic portions of a given molecule. For example, the technique of Hopp and Woods assigns 35 each amino acid a numerical hydrophilicity value and then repetitively averages these values along the Printed from Mimosa 01/03/2001 12:52:03 page -21- peptide chain. The points of highest local average hydrophilicities are indicative of antigenic portions of the molecule.

By "immunological carrier" is meant any 5 molecule which, when associated with a GnRH immunogen of interest, imparts immunogenicity to that molecule, or enhances the immunogenicity of the molecule. Examples of suitable carriers include large, slowly metabolized macromolecules such as: proteins; 10 polysaccharides, such as sepharose, agarose, cellulose, cellulose beads and the like; polymeric amino acids such as polyglutamic acid, polylysine, and the like; amino acid copolymers; inactive virus particles; bacterial toxins such as toxoid from 15 diphtheria, tetanus, cholera, leukotoxin molecules, and the like. Carriers are described in further detail below.

A GnRH immunogen is "linked" to a specified carrier molecule when the immunogen is chemically 2 0 coupled to, or associated with the carrier, or when the immunogen is expressed from a chimeric DNA molecule which encodes the immunogen and the carrier of interest.

An "immunoconjugate" is a GnRH immunogen 25 such as a GnRH peptide or multimer which is linked to a carrier molecule, as defined above.

The term "leukotoxin polypeptide" or "LKT polypeptide" intends a polypeptide which is derived from a protein belonging to the family of molecules 3 0 characterized by the carboxy-terminus consensus amino acid sequence Gly-Gly-X-Gly-X-Asp (Highlander et al. (1989) DNA j8:15-28) , wherein X is Lys, Asp, Val or Asn. Such proteins include, among others, leukotoxins derived from P. haemolytica and Actinobacillus 35 pleuropneumoniae, as well as E. coli alpha hemolysin (Strathdee et al. (1987) Infect. Immun. 55:3233-3236; Printed from Mimosa 01/03/2001 12:52:03 page -22- Lo (1990) Can. J. Vet. Res. 54:S33-S35; Welch (1991) Mol. Microbiol. 5:521-528). This family of toxins is known as the "RTX" family of toxins (Lo (1990) Can. J. Vet. Res. 54=S33-S35). In addition, the term 5 "leukotoxin polypeptide" refers to a leukotoxin polypeptide which is chemically synthesized, isolated from an organism expressing the same, or recombinantly produced. Furthermore, the term intends an immunogenic protein having an amino acid sequence 10 substantially homologous to a contiguous amino acid sequence found in the particular native leukotoxin molecule. Thus, the term includes both full-length and partial sequences, as well as analogues. Although native full-length leukotoxins display cytotoxic 15 activity, the term "leukotoxin" also intends molecules which remain immunogenic yet lack the cytotoxic character of native leukotoxins.

The nucleotide sequences and corresponding amino acid sequences for several leukotoxins are 20 known. See, e.g., U.S. Patent Nos. 4,957,739 and ,055,400; Lo et al. (1985) Infect. Immun. 50:667-67; Lo et al. (1987) Infect. Immun. 55 :1987-1996; Strathdee et al. (1987) Infect. Immun. 55:3233-3236; Highlander et al. (1989) DNA 8.: 15-28; and Welch (1991) 25 Mol. Microbiol. 5:521-528.

In preferred embodiments of the invention, leukotoxin chimeras are provided having a selected leukotoxin polypeptide sequence that imparts enhanced immunogenicity to one or more GnRH multimers fused 30 thereto.

Particular examples of immunogenic leukotoxin polypeptides for use in the present invention are truncated leukotoxin molecules described in U.S. Patent Nos. 5,476,657 and 5,837,268. These 35 truncated molecules include LKT 352, LKT 111 and LKT 114-. LKT 352 is derived from the lktA gene present in Printed from Mimosa 01/03/2001 12:52:03 page -23- plasmid pAA352 (ATCC Accession No. 68283). The nucleotide sequence and corresponding amino acid sequence of this gene are described in U.S. Patent 5,476,657. The gene encodes a truncated leukotoxin, 5 having 914 amino acids and an estimated molecular weight of around 99 kDa. LKT 111 is a leukotoxin polypeptide derived from the lktA gene present in plasmid pCBlll (ATCC Accession No. 69748). The nucleotide sequence of this gene and the corresponding 10 amino acid sequence are disclosed in U.S. Patent No. 5,837,268. The gene encodes a shortened version of leukotoxin which was developed from the recombinant leukotoxin gene present in plasmid pAA352 (ATCC Accession No. 68283) by removal of an internal DNA 15 fragment of approximately 130 0 bp in length. The LKT 111 polypeptide has an estimated molecular weight of 52 kDa (as compared to the 99 kDa LKT 352 polypeptide), but retains portions of the LKT 352 N-terminus containing T-cell epitopes which are 20 necessary for sufficient T-cell immunogenicity, and portions of the LKT 352 C-terminus containing convenient restriction sites for use in producing fusion proteins for use in the present invention. LKT 114 is derived from the gene present in plasmid pAA114 25 (described in U.S. Patent No. 5,837,268). LKT 114 differs from LKT 111 by virtue of an additional amino acid deletion from the internal portion of the molecule.

The term "immunological adjuvant" refers to 30 an agent which acts in a nonspecific manner to increase an immune response to a particular antigen, thus reducing the quantity of antigen necessary in any given vaccine, and/or the frequency of injection necessary in order to generate an adequate immune 3 5 response to the antigen of interest. See, e.g., A.C. Allison J. Reticuloendothel. Soc. (1979) 26:619-630.

Printed from Mimosa 01/03/2001 12:52:03 page -24- "Native" proteins, polypeptides or peptides are proteins, polypeptides or peptides isolated from the source in which the proteins naturally occur. "Recombinant" polypeptides refer to polypeptides 5 produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide. "Synthetic" polypeptides are those prepared by chemical synthesis.

By "polynucleotide" is meant a sequence of 10 nucleotides including, but is not limited to, RNA such as mRNA, cDNA, genomic DNA sequences and even synthetic DNA sequences. The term also captures sequences that include any of the known base analogues of DNA and RNA.

The term "derived from," as it is used herein, denotes an actual or theoretical source or origin of the subject molecule or immunogen. For example, an immunogen that is "derived from" a particular GnRH molecule will bear close sequence 20 similarity with a relevant portion of the reference molecule. Thus, an immunogen that is "derived from" a particular GnRH molecule may include all of the wild-type GnRH sequence, or may be altered by insertion, deletion or substitution of amino acid residues, so 25 long as the derived sequence provides for an immunogen that corresponds to the targeted GnRH molecule. Immunogens derived from a denoted molecule will contain at least one epitope specific to the denoted molecule.

By "vertebrate subject" is meant any member of the subphylum cordata, including, without limitation, mammals such as ovine, bovine, porcine, equine, cervine subjects, including cattle, sheep, pigs, goats, horses, deer and humans; domestic animals 35 such as domestic canines and felines (dogs and cats); and birds, including domestic, wild and game birds Printed from Mimosa 01/03/2001 12:52:03 page -25- such as cocks and hens including chickens, turkeys and other gallinaceous birds; fish, rodents such as hamsters, guinea pigs, gerbils, ground hogs, gophers, lagomorphs, rabbits, ferrets, squirrels and reptilian 5 subjects. The term does not denote a particular age or gender. Thus, both male and female adult and newborn animals, as well as fetuses and eggs, are intended to be covered.

By "suppression" of reproductive behavior 10 and/or fertility in a vertebrate subject is meant a significant reduction in mating behavior and/or fertility in an animal treated under the invention, as compared to the mating behavior and/or fertility normally expected from a postpubertal animal of the 15 same species. Thus, a suppression in reproductive behavior and/or fertility can result in a reduction in the number of attempted matings, or a reduction in successful matings, such as a reduction in the number of conceptions, in the case of a female, or 20 fertilizations, in the case of a male, as compared to a typical, untreated animal of the same species. The suppression can result in complete sterility of the animal in question.

Without being bound by a particular theory, 25 the effect may be the result of either suppression at the hypothalamic pituitary or suppression at the gonadal level, such as a suppression of testicular development or function in the male and ovarian development or function in the female. 30 By "prolonged" or "long-term suppression" of reproductive behavior and/or fertility is meant a suppression of reproductive behavior and/or fertility, as described above, that persists after GnRH antibody titers have waned, or in the case of a GnRH analogue, 35 such as a GnRH agonist or antagonist, that persists after the circulating blood level of the substance has Printed from Mimosa 01/03/2001 12:52:03 page -26- declined below a pharmacologically active level. Such an effect may be permanent, or persist for six months to one year or more after GnRH antibody titers or the circulating blood level of the GnRH analogue have 5 declined, more preferably eight or ten months to one year or more, even up to the lifespan of the animal. Such a prolonged effect can be readily determined by measuring GnRH antibody titers or blood levels of the analogue using methods well known in the art, such as 10 those described in the examples below.

By "prepubertal" is meant anytime prior to the onset of puberty. The term "prepubertal" also includes the peripubertal period. Under the present invention, the onset of puberty is indicated by the 15 ability of an animal in question to conceive, in the case of a female, e.g., the onset of ovulation, or to fertilize, e.g., the ability to produce sperm, in the case of a male.

The typical timing for the onset of puberty 20 for a given species is well known in the art. The onset of puberty is accompanied by the presence of various circulating hormones in the subject of interest. For example, clinical signs of puberty may be preceded by increased pulsatile secretion of GnRH 25 produced in the hypothalamus, followed by increased pituitary responsiveness to GnRH which causes the release of LH and FSH from the pituitary gland.

These, in turn, control the production of testosterone in males and estrogen and progesterone in females. 30 Gonadotropin secretion, particularly LH, increases progressively during the peripubertal period resulting in gonadal stimulation, secretion of sex hormones and progressive physical maturation. The levels of these hormones associated with puberty are known in the art 35 and will vary from species to species. For a detailed description of puberty and the hormonal changes Printed from Mimosa 01/03/2001 12:52:03 page -27- associated therewith, see, e.g., Apter D., Aim. NY Acad. Sci. (1997) 816:9-21.

Hormone levels, such as LH and FSH levels, can be measured using standard techniques such as 5 radioimmunoassays (see, e.g., Lee et al., J. Reproduc. Fertil. (1976) 46.: 1-6; Bremner et al. , Endocrin. (1980) 106:329-336). as well as highly sensitive immunoflurometric assays (see, e.g., Apter et al., J. Clin. Endocrinol. Metab. (1989) 68.:53-57; Dunkel et 10 al., Pediatr. Res. (1990) 27:215-219; Gon et al., Pediatr. Res. (1992) 33^:535-539; Wu et al. , J. Clin. Endocrinol. Metab. (1991) 72:1229-1237; and the commercially available assay, IFMA, from Delfia, Wallac, Turku, Finland) and immunochemiluminometric 15 assays (see, e.g., Neely et al., J. Pediatr. (1995) 127 :40-46; Pandian et al., Clin. Chem. (1993) 39:1815-1819). Similarly, in females, estradiol secretion can be measured using various well-known assays such as recombinant cell bioassays (see, e.g., Klein, et al., 20 J. Clin. Invest. (1994) 94:2475-2480). 2. General Methods Before describing the present invention in detail, it is to be understood that this invention is 25 not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be 30 limiting.

Although a number of compositions and methods similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are 35 described herein.

Printed from Mimosa 01/03/2001 12:52:03 page -28- Central to the instant invention is the discovery of a method for reducing circulating levels of GnRH, thereby achieving long-term suppression of reproductive behavior and/or fertility, such as 5 suppression of testicular development or function in the male, and ovarian development or function in the female. The method may be accomplished by passively or actively immunizing against endogenous GnRH and/or by using GnRH agonists and antagonists. Although GnRH 10 is generally recognized as "self" and hence nonimmunogenic, the compositions described herein surprisingly provide a means for producing a long-term immunological response in a subject immunized therewith.

If immunization is used, the method entails one or more primary immunizations before the onset of puberty, optionally followed by one or more boosts, with the same or different GnRH composition, to cause a long-term suppression as described above. The 20 boosts may be given prior to, or after the onset of puberty.

The timing of the vaccinations depends on the animal in question which is generally a mammal such as a cat, dog, horse or deer. For example, in 25 these species, a primary vaccination will generally be administered at about 0 to about 35 weeks of age, more preferably about 3 to about 15 weeks, preferably about 5 to about 12 weeks of age, and even more preferably at about 6 to about 10 weeks of age. One or more 30 booster treatments may be given, also prior to puberty, at an appropriate time after the primary immunization, generally at about 2 to about 10 weeks following the primary immunization, preferably at about 3 to about 4 weeks following the primary 35 immunization.

Printed from Mimosa 01/03/2001 12:52:03 page -29- Furthermore, additional immunizations at regular intervals can be given in order to ensure a prolonged effect on reproductive behavior and/or fertility. For example, in one embodiment, additional 5 immunizations are given at least 6 months to 1 year following the second immunization and can be administered annually thereafter.

If multiple immunizations are used, e.g., at least two vaccinations, the animal may be immunized 10 postpubertally in order to achieve a prolonged effect.

The vaccine compositions of the present invention are administered directly to the animal in question (active immunization) or to laboratory animals in order to produce antibodies which in turn 15 can be used to immunize the animal in question (passive immunization). Additionally, passive immunization can be achieved using monoclonal antibodies, monospecific antisera, as well as preparations including hybrid antibodies, altered 20 antibodies, F(ab')2 fragments, F(ab) fragments, Fv fragments, single domain antibodies, chimeric antibodies, humanized antibodies, and functional fragments thereof, described in greater detail below.

GnRH Immunoconiuqates As explained above, GnRH is an endogenous molecule and, as such, it may be desirable to further increase the immunogenicity of the GnRH polypeptides (or multimers described below) by linking them to 30 carriers to form GnRH immunoconjugates. This is especially necessary if the GnRH immunogen will be administered to the same species from which it is derived.

Suitable carriers are generally polypeptides 35 which include antigenic regions of a protein derived from an infectious material such as a viral surface Printed from Mimosa 01/03/2001 12:52:03 page -30- protein, or a carrier peptide sequence. These carriers serve to non-specifically stimulate T-helper cell activity and to help direct an immunogen of interest to antigen presenting cells (APCs) for 5 processing and presentation at the cell surface in association with molecules of the major histocompatibility complex (MHC).

Several carrier systems have been developed for this purpose. For example, small peptide haptens 10 are often coupled to protein carriers such as keyhole limpet hemocyanin (Bittle et al. (1982) Nature 298:30-33), bacterial toxins such as tetanus toxoid (Muller et al. (1982) Proc. Natl. Acad. Sci. U.S.A. 79:569-573), ovalbumin, leukotoxin polypeptides, and sperm 15 whale myoglobin, to produce an immune response. These coupling reactions typically result in the incorporation of several moles of peptide hapten per mole of carrier protein.

Other suitable carriers for use with the 20 present invention include VP6 polypeptides of rotaviruses, or functional fragments thereof, as disclosed in U.S. Patent Number 5,071,651. Also useful is a fusion product of a viral protein and one or more epitopes from GnRH, which fusion products are 25 made by the methods disclosed in U.S. Patent No. 4,722,840. Still other suitable carriers include cells, such as lymphocytes, since presentation in this form mimics the natural mode of presentation in the subject, which gives rise to the immunized state. 3 0 Alternatively, the GnRH immunogens may be coupled to erythrocytes, preferably the subject's own erythrocytes. Methods of coupling peptides to proteins or cells are known to those of skill in the art.

Delivery systems useful in the practice of the present invention may also utilize particulate Printed from Mimosa 01/03/2001 12:52:03 page -31- carriers. For example, pre-formed particles have been used as platforms onto which immunogens can be coupled and incorporated. Systems based on proteosomes (Lowell et al. (1988) Science 240:800-802) and immune 5 stimulatory complexes (Morein et al. (1984) Nature 308:457-460) are also known in the art.

Carrier systems using recombinantly produced chimeric proteins that self-assemble into particles may also be used with the present invention. For 10 example, the yeast retrotransposon, Ty, encodes a series of proteins that assemble into virus like particles (Ty-VLPs; Kingsman et al. (1988) Vaccines .6:304-306). Thus, a gene, or fragment thereof, encoding the GnRH immunogen of interest may be 15 inserted into the TyA gene and expressed in yeast as a fusion protein. The fusion protein retains the capacity to self assemble into particles of uniform size. Other useful virus-like carrier systems are based on HBsAg, (Valenzuela et al. (1985) Bio/Technol. 20 3.:323-326; U.S. Patent No. 4,722,840; Delpeyroux et al. (1986) Science 233:472-475). Hepatitis B core antigen (Clarke et al. (1988) Vaccines 88 (Ed. H. Ginsberg, et al.) pp. 127-131), Poliovirus (Burke et al. (1988) Nature 332 :81-82), and Tobacco Mosaic Virus 25 (Haynes et al. (1986) Bio/Technol. 4:637-641).

Especially preferred carriers include serum albumins, keyhole limpet hemocyanin, ovalbumin, sperm whale myoglobin, leukotoxin molecules as described above, and other proteins well known to those skilled 30 in the art. For example, chimeric systems using a leukotoxin polypeptide, as defined above, such as a Pasteurella haemolytica leukotoxin (LKT) polypeptide fused to the antigen of interest, can also be used herein. In this regard, the nucleotide sequences and 35 corresponding amino acid sequences for several leukotoxin carriers are known. See, e.g., U.S. Patent Printed from Mimosa 01/03/2001 12:52:03 page -32- Nos. 5,422,110, 5,708,155, 5,723,129 and International Publication Nos. WO 98/06848 and WO 96/24675. Particular examples of immunogenic leukotoxin polypeptides for use herein include LKT 342, LKT 352, 5 LKT 111, LKT 326 and LKT 101 which are described in the patents and publications cited above.

Particularly preferred are LKT 111 and LKT 114. The gene encoding LKT 111 was developed from the recombinant leukotoxin gene present in plasmid pAA352 10 (ATCC Accession No. 68283) by removal of an internal DNA fragment of approximately 1300 bp in length. The LKT 111 polypeptide has an estimated molecular weight of 52 kDa (as compared to the 99 kDa LKT 352 polypeptide), but retains portions of the LKT 352 N-15 terminus containing T-cell epitopes which are necessary for sufficient T-cell immunogenicity, and portions of the LKT 352 C-terminus containing convenient restriction sites for use in producing the fusion proteins of the present invention. LKT 114 20 differs from LKT 111 by virtue of an additional amino acid deletion from the internal portion of the molecule. See, e.g., U.S. Patent No. 5,837,268 and International Publication Nos. WO 98/06848 and WO 96/24675 for descriptions of these molecules. 25 Protein carriers may be used in their native form or their functional group content may be modified by, for example, succinylation of lysine residues or reaction with Cys-thiolactone. A sulfhydryl group may also be incorporated into the carrier (or antigen) by, 30 for example, reaction of amino functions with 2-iminothiolane or the N-hydroxysuccinimide ester of 3-(4-dithiopyridyl propionate. Suitable carriers may also be modified to incorporate spacer arms (such as hexamethylene diamine or other bifunctional molecules of similar size) for attachment of peptide irrtmunogens.

Printed from Mimosa 01/03/2001 12:52:03 page -33- Carriers can be physically conjugated to the GnRH immunogen of interest, using standard coupling reactions. Alternatively, chimeric molecules can be prepared recombinantly for use in the present 5 invention, such as by fusing a gene encoding a suitable polypeptide carrier to one or more copies of a gene, or fragment thereof, encoding for a selected GnRH immunogen. The GnRH portion can be fused either 5' or 3' to the carrier portion of the molecule, or 10 the GnRH portion may be located at sites internal to the carrier molecule.

The GnRH immunogens can also be administered via a carrier virus which expresses the same. Carrier viruses which will find use herein include, but are 15 not limited to, the vaccinia and other pox viruses, adenovirus, and herpes virus. By way of example, vaccinia virus recombinants expressing the proteins can be constructed as follows. The DNA encoding a particular protein is first inserted into an 20 appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells which are simultaneously infected with vaccinia. Homologous 25 recombination serves to insert the vaccinia promoter plus the gene encoding the desired immunogen into the viral genome. The resulting TK—recombinant can be selected by culturing the cells in the presence of 5-bromodeoxyuridine and picking viral plaques resistant 3 0 thereto.

GnRH Multimers Immunogenicity of the GnRH immunogens may also be significantly increased by producing 35 immunogenic forms of the molecules that comprise multiple copies of selected epitopes. In this way, Printed from Mimosa 01/03/2001 12:52:03 page -34- endogenous GnRH may be rendered an effective autoantigen.

Accordingly, in one aspect of the invention, vaccine compositions containing GnRH immunogen 5 multimers are provided in either nucleic acid or peptide form.

The GnRH multimer will have more than one copy of selected GnRH immunogens, peptides or epitopes, as described above, or multiple tandem repeats of a 10 selected GnRH immunogen, peptide or epitope. Thus, the GnRH multimers may comprise either multiple or tandem repeats of selected GnRH sequences, multiple or tandem repeats of selected GnRH epitopes, or any conceivable combination thereof. GnRH epitopes may be 15 identified using techniques as described in detail above.

For example, the GnRH multimer may correspond to a molecule with repeating units of the general formula (GnRH-X-GnRH)y wherein GnRH is a GnRH 20 immunogen, X is selected from the group consisting of a peptide linkage, an amino acid spacer group, a carrier molecule and [GnRH]n, where n is an integer greater than or equal to 1, y is an integer greater than or equal to 1, and further wherein "GnRH" may 25 comprise any GnRH immunogen. Thus, the GnRH multimer may contain from 2-64 or more GnRH immunogens, more preferably 2-32 or 2-16 GnRH immunogens.

Further, the selected GnRH immunogen sequences may all be the same, or may correspond to 30 different derivatives, analogues, variants or epitopes of GnRH so long as they retain the ability to elicit an immune response. Additionally, if the GnRH immunogens are linked either chemically or recombinantly to a carrier, GnRH immunogens may be 35 linked to either the 5'-end, the 3'-end, or may flank the carrier in question. Further, the GnRH multimer Printed from Mimosa 01/03/2001 12:52:03 page -35- may be located at sites internal to the carrier. One particular carrier for use with the present GnRH multimers is a leukotoxin polypeptide as described above.

As explained above, spacer sequences may be present between the GnRH moieties. For example, Ser-Gly-Ser trimers and Gly-Ser dimers are present in the GnRH multimers exemplified herein which provide spacers between repeating sequences of the GnRH 10 immunogens. See, e.g., Figure 5B. The strategic placement of various spacer sequences between selected GnRH immunogens can be used to confer increased immunogenicity on the subject constructs.

Accordingly, under the invention, a selected spacer 15 sequence may encode a wide variety of moieties such as a single amino acid linker or a sequence of two to several amino acids. Selected spacer groups may preferably provide enzyme cleavage sites so that the expressed multimer can be processed by proteolytic 20 enzymes in vivo (by APCs, or the like) to yield a number of peptides, each of which contain at least one T-cell epitope derived from the carrier portion, and which are preferably fused to a substantially complete GnRH polypeptide sequence.

The spacer groups may be constructed so that the junction region between selected GnRH moieties comprises a clearly foreign sequence to the immunized subject, thereby conferring enhanced immunogenicity upon the associated GnRH immunogens. Additionally, 30 spacer sequences may be constructed so as to provide T-cell antigenicity, such as those sequences which encode amphipathic and/or a-helical peptide sequences which are generally recognized in the art as providing immunogenic helper T-cell epitopes. The choice of 35 particular T-cell epitopes to be provided by such spacer sequences may vary depending on the particular Printed from Mimosa 01/03/2001 12:52:03 page -36- vertebrate species to be vaccinated. Although particular GnRH portions are exemplified which include spacer sequences, it is also an object of the invention to provide one or more GnRH multimers 5 comprising directly adjacent GnRH sequences (without intervening spacer sequences).

The GnRH multimeric sequence thus produced renders a highly immunogenic GnRH antigen for use in the compositions of the invention. 10 The GnRH polypeptides, immunoconjugates and multimers can be produced using the methods described below, and used for nucleic acid immunization, gene therapy, protein-based immunization methods, and the like.

Nucleic Acid-Based Immunization Methods Generally, nucleic acid-based vaccines for use with the present invention will include relevant regions encoding a GnRH immunogen, with suitable 20 control sequences and, optionally, ancillary therapeutic nucleotide sequences. The nucleic acid molecules are prepared in the form of vectors which include the necessary elements to direct transcription and translation in a recipient cell. 25 In order to augment an immune response in an immunized subject, the nucleic acid molecules can be administered in conjunction with ancillary substances, such as pharmacological agents, adjuvants, or in conjunction with delivery of vectors encoding 30 biological response modifiers such as cytokines and the like. Other ancillary substances include, but are not limited to, substances to increase weight gain, muscle mass or muscle strength, such as growth hormones, growth promoting agents, beta antagonists, 35 partitioning agents and antibiotics.

Printed from Mimosa 01/03/2001 12:52:03 page -37- Nucleotide sequences selected for use in the present invention can be derived from known sources, for example, by isolating the same from cells or tissue containing a desired gene or nucleotide 5 sequence using standard techniques, or by using recombinant or synthetic techniques.

Once coding sequences for the GnRH immunogens have been prepared or isolated, such sequences can be cloned into any suitable vector or 10 replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. Ligations to other sequences, e.g., ancillary molecules or carrier molecules, are performed using 15 standard procedures, known in the art. One or more GnRH immunogen portions of the chimera can be fused 5' and/or 3' to a desired ancillary sequence or carrier molecule. Alternatively, one or more GnRH immunogen portions may be located at sites internal to the 20 carrier molecule, or such portions can be positioned at both terminal and internal locations in the chimera.

Alternatively, DNA sequences encoding the GnRH immunogens of interest, optionally linked to 25 carrier molecules, can be prepared synthetically rather than cloned. The DNA sequences can be designed with appropriate codons for the particular sequence. The complete sequence of the immunogen is then assembled from overlapping oligonucleotides prepared 30 by standard methods and assembled into a complete coding sequence. See, e.g., Edge (1981) Nature 292:756; Nambair et al. (1984) Science 223:1299: and Jay et al. (1984) J". Biol. Chem. 259:6311.

The coding sequence is then placed under the 35 control of suitable control elements for expression in suitable host tissue in vivo. The choice of control Printed from Mimosa 01/03/2001 12:52:03 page -38- elements will depend on the subject being treated and the type of preparation used. Thus, if the subject's endogenous transcription and translation machinery will be used to express the immunogens, control 5 elements compatible with the particular subject will be utilized. In this regard, several promoters for use in mammalian systems are known in the art. For example, typical promoters for mammalian cell expression include the SV40 early promoter, a CMV 10 promoter such as the CMV immediate early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), and the herpes simplex virus promoter, among others. Other nonviral promoters, such as a promoter derived from the murine 15 metallothionein gene, will also find use for mammalian expression.

Typically, transcription termination and polyadenylation sequences will also be present, located 3' to the translation stop codon. Preferably, 20 a sequence for optimization of initiation of translation, located 5' to the coding sequence, is also present. Examples of transcription terminator/polyadenylation signals include those derived from SV40, as described in Sambrook et al., 25 supra, as well as a bovine growth hormone terminator sequence. Introns, containing splice donor and acceptor sites, may also be designed into the constructs for use with the present invention.

Enhancer elements may also be used herein to 30 increase expression levels of the constructs.

Examples include the SV40 early gene enhancer (Dijkema et al. (1985) EMBO J. 4:761), the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus (Gorman et al. (1982) Proc. Natl. 35 Acad. Sci. USA 79:6777) and elements derived from Printed from Mimosa 01/03/2001 12:52:03 page -39- human CMV (Boshart et al. (1985) Cell 41:521), such as elements included in the CMV intron A sequence.

Once prepared, the nucleic acid vaccine compositions can be delivered to the subject using 5 known methods. In this regard, various techniques for immunization with antigen-encoding DNAs have been described. See, e.g., U.S. Patent No. 5,589,466 to Feigner et al.; Tang et al. (1992) Nature 358:152; Davis et al. (1993) Hum. Molec. Genet. 2.:1847; Ulmer 10 et al. (1993) Science 258:1745; Wang et al. (1993) Proc. Natl. Acad. Sci. USA 90:4156; Eisenbraun et al. (1993) DNA Cell Biol. 12:791; Fynan et al. (1993) Proc. Natl. Acad. Sci. USA 90:12476; Fuller et al. (1994) AIDS Res. Human Retrovir. 10:1433; and Raz et 15 al. (1994) Proc. Natl. Acad. Sci. USA 91:9519.

General methods for delivering nucleic acid molecules to cells in vitro, for the subsequent reintroduction into the host, can also be used, such as liposome-mediated gene transfer. See, e.g., Hazinski et al. 20 (1991) Am. J. Respir. Cell Mol. Biol. 4:206-209; Brigham et al. (1989) Am. J. Med. Sci. 298:278-281; Canonico et al. (1991) Clin. Res. 3_9:219A; and Nabel et al. (1990) Science 249:1285-1288. Thus, the nucleic acid vaccine compositions can be delivered in 25 either liquid or particulate form using a variety of known techniques. Typical vaccine compositions are described more fully below.

Protein-Based Delivery Methods 30 Protein-based compositions can also be produced using a variety of methods known to those skilled in the art. In particular, GnRH polypeptides can be isolated directly from native sources, using standard purification techniques. Alternatively, the 35 polypeptides can be recombinantly produced using nucleic acid expression systems, well known in the art Printed from Mimosa 01/03/2001 12:52:03 page -40- and described in, e.g., Sambrook et al., supra. GnRH polypeptides can also be synthesized using chemical polymer syntheses such as solid phase peptide synthesis. Such methods are known to those skilled in 5 the art. See, e.g., J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984) and G. Barany and R. B. Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, 10 Academic Press, New York, (1980), pp. 3-254, for solid phase peptide synthesis techniques.

GnRH polypeptides for use in the compositions described herein may also be produced by cloning the coding sequences therefor into any 15 suitable expression vector or replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. Examples of recombinant DNA vectors for cloning, and host cells which they can 20 transform, include the bacteriophage lambda (E. coli), pBR322 (E. coli) , pACYC177 (E. coli) , pKT230 (gram-negative bacteria), pGV1106 (gram-negative bacteria), pLAFRl (gram-negative bacteria), pME290 (non-E. coli gram-negative bacteria), pHV14 (E. coli 25 and Bacillus subtilis), pBD9 (Bacillus), pIJ61 (Streptomyces), pUC6 (Streptomyces), YIp5 (Saccharomyces), YCpl9 (Saccharomyces) and bovine papilloma virus (mammalian cells). See, generally, DNA Cloning: Vols. I & II, supra; Sambrook et al., 30 supra; B. Perbal, supra.

For example, the coding sequences for porcine, bovine and ovine GnRH have been determined (Murad et al. (1980) Hormones and Hormone Antagonists, in The Pharmacological Basis of Therapeutics. Sixth 35 Edition), and the cDNA for human GnRH has been cloned so that its sequence has been well established Printed from Mimosa 01/03/2001 12:52:03 page -41- (Seeburg et al. (1984) Nature 311: 666-668) .

Additional GnRH polypeptides of known sequences have been disclosed, such as the GnRH molecule occurring in salmon and chickens (International Publication No. WO 5 86/07383, published 18 December 1986). Particular GnRH coding sequences for use with the present invention are shown in Figures 5A and 5B herein. The GnRH coding sequence is highly conserved in vertebrates, particularly in mammals, and porcine, 10 bovine, ovine and human GnRH sequences are identical to one another.

Portions of these sequences encoding desired GnRH polypeptides, and optionally, a sequence encoding a carrier protein, can be cloned, isolated and ligated 15 together using recombinant techniques generally known in the art. See, e.g., Sambrook et al., supra.

The gene can be placed under the control of a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator, so that the 20 DNA sequence of interest is transcribed into RNA by a suitable transformant. The coding sequence may or may not contain a signal peptide or leader sequence. The polypeptides can be expressed using, for example, the E. coli tac promoter or the protein A gene (spa) 25 promoter and signal sequence. Leader sequences can be removed by the bacterial host in post-translational processing. See, e.g., U.S. Patent Nos. 4,431,739; 4,425,437; 4,338,397. Ancillary sequences, such as those described above, may also be present. 30 In addition to control sequences, it may be desirable to add regulatory sequences which allow for regulation of the expression of the polypeptide sequences relative to the growth of the host cell. Regulatory sequences are known to those of skill in 35 the art, and examples include those which cause the expression of a gene to be turned on or off in Printed from Mimosa 01/03/2001 12:52:03 page -42- response to a chemical or physical stimulus, including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.

An expression vector is constructed so that the particular coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that 10 the coding sequence is transcribed under the "control" of the control sequences (i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence). Modification of the sequences encoding the particular GnRH polypeptide may 15 be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it can be attached to the control sequences in the appropriate orientation; i.e., to maintain the reading frame. The control sequences and other 20 regulatory sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning vectors described above. Alternatively, the coding sequence can be cloned directly into an expression vector which already contains the control 25 sequences and an appropriate restriction site.

In some cases, it may be desirable to add sequences which cause the secretion of the polypeptide from the host organism, with subsequent cleavage of the secretory signal. It may also be desirable to 30 produce mutants or analogues of the polypeptide.

Mutants or analogues may be prepared by the deletion of a portion of the sequence encoding the reference polypeptide, or if present, a portion of the sequence encoding the desired carrier molecule, by insertion of 35 a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for Printed from Mimosa 01/03/2001 12:52:03 page -43- modifying nucleotide sequences, such as site-directed mutagenesis, and the like, are well known to those skilled in the art. See, e.g., Sambrook et al., supra; DNA Cloning, Vols. I and II, supra; Nucleic 5 Acid Hybridization, supra; Kunkel, T.A. Proc. Natl. Acad. Sci. USA (1985) 82:448; Geisselsoder et al. BioTechniques (1987) 5:786; Zoller and Smith, Methods Enzymol. (1983) 100:468; Dalbie-McFarland et al. Proc. Natl. Acad. Sci USA (1982) 79:6409. 10 The GnRH polypeptides can be expressed in a wide variety of systems, including insect, mammalian, bacterial, viral and yeast expression systems, all well known in the art. For example, insect cell expression systems, such as baculovirus systems, are 15 known to those of skill in the art and described in, e.g., Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter 20 alia, Invitrogen, San Diego CA ("MaxBac" kit).

Similarly, bacterial and mammalian cell expression systems are well known in the art and described in, e.g., Sambrook et al., supra. Yeast expression systems are also known in the art and described in, 25 e.g., Yeast Genetic Engineering (Barr et al., eds., 1989) Butterworths, London.

A number of appropriate host cells for use with the above systems are also known. For example, mammalian cell lines are known in the art and include 30 immortalized cell lines available from the American Type Culture Collection (ATCC), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells 35 (e.g., Hep G2), Madin-Darby bovine kidney {"MDBK") cells, as well as others. Similarly, bacterial hosts Printed from Mimosa 01/03/2001 12:52:03 page -44- such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs. Yeast hosts useful in the present invention include inter alia, Saccharomyces 5 cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pas tori s, Schizosaccharomyces pombe and Yarrowia lipolytica. Insect cells for use with baculovirus 10 expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni.

Depending on the expression system and host 15 selected, the GnRH polypeptides are produced by growing host cells transformed by an expression vector described above under conditions whereby the polypeptide is expressed. The expressed polypeptide is then isolated from the host cells and purified. If 20 the expression system secretes the polypeptide into growth media, the product can be purified directly from the media. If it is not secreted, it can be isolated from cell lysates. The selection of the appropriate growth conditions and recovery methods are 25 within the skill of the art.

Once obtained, the GnRH polypeptides, with or without associated carrier, may be formulated into compositions, such as vaccine compositions as described further below, in order to elicit antibody 30 production, or block the action of GnRH in a subject vertebrate.

Antibody Production The subject GnRH immunogens can be used to 35 generate antibodies for use in passive immunization methods. Typically, peptides useful for producing Printed from Mimosa 01/03/2001 12:52:03 page -45- antibodies will usually be at least about 3-5 amino acids in length, preferably 7-10 amino acids in length.

Antibodies against the subject immunogens 5 include polyclonal and monoclonal antibody preparations, monospecific antisera, as well as preparations including hybrid antibodies, altered antibodies, F(ab')z fragments, F(ab) fragments, Fv fragments, single domain antibodies, chimeric 10 antibodies, humanized antibodies, and functional fragments thereof, which retain specificity for the target molecule in question. For example, an antibody can include variable regions, or fragments of variable regions, which retain specificity for the molecule in 15 question. The remainder of the antibody can be derived from the species in which the antibody will be used. Thus, if the antibody is to be used in a human, the antibody can be "humanized" in order to reduce immunogenicity yet retain activity. For a description 20 of chimeric antibodies, see, e.g., Winter, G. and Milstein, C. (1991) Nature 349:293-299; Jones, P.T. et al. (1986) Nature 321:522-525 ; Riechmann, L. et al. (1988) 132:323-327; and Carter, P. et al. (1992) Proc. Natl. Acad. Sci. USA 89:4285-4289. Such chimeric 25 antibodies may contain not only combining sites for the target molecule, but also binding sites for other proteins. In this way, bifunctional reagents can be generated with targeted specificity to both external and internal antigens. 3 0 If polyclonal antibodies are desired, a selected mammal, (e.g., mouse, rabbit, goat, horse, etc.) is immunized with the desired antigen, or its fragment, or a mutated antigen, as described above. Prior to immunization, it may be desirable to further 35 increase the immunogenicity of a particular immunogen.

Printed from Mimosa 01/03/2001 12:52:03 page -46- This can be accomplished in any one of several ways known to those of skill in the art.

For example, immunization for the production of antibodies is generally performed by mixing or 5 emulsifying the protein in a suitable excipient, such as saline, preferably in an adjuvant such as Freund's complete adjuvant, or any of the adjuvants described below, and injecting the mixture or emulsion parenterally (generally subcutaneously or intramuscu-10 larly). The animal is generally boosted 2-6 weeks later with one or more injections of the protein in saline, preferably using Freund's incomplete adjuvant, or the like. Antibodies may also be generated by in vitro immunization, using methods known in the art. 15 Polyclonal antisera is then obtained from the immunized animal and treated according to known procedures. See, e.g., Jurgens et al. (1985) J.

Chrom. 348.: 363-370 . If serum containing polyclonal antibodies is used, the polyclonal antibodies can be 20 purified by immunoaffinity chromatography, using known procedures.

Monoclonal antibodies are generally prepared using the method of Kohler and Milstein, Nature (1975) 256:495-96, or a modification thereof. Typically, a 25 mouse or rat is immunized as described above.

However, rather than bleeding the animal to extract serum, the spleen (and optionally several large lymph nodes) is removed and dissociated into single cells. If desired, the spleen cells may be screened (after 30 removal of nonspecifically adherent cells) by applying a cell suspension to a plate or well coated with the protein antigen. B-cells, expressing membrane-bound immunoglobulin specific for the antigen, will bind to the plate, and are not rinsed away with the rest of 35 the suspension. Resulting B-cells, or all dissociated spleen cells, are then induced to fuse with myeloma Printed from Mimosa 01/03/2001 12:52:03 page -47- cells to form hybridomas, and are cultured in a selective medium (e.g., hypoxanthine, aminopterin, thymidine medium, "HAT"). The resulting hybridomas are plated by limiting dilution, and are assayed for 5 the production of antibodies which bind specifically to the immunizing antigen (and which do not bind to unrelated antigens). The selected monoclonal antibody-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow 10 fiber reactors), or in vivo (as ascites in mice).

See, e.g., M. Schreier et al. , Hybridoma Techniques (1980); Hammerling et al., Monoclonal Antibodies and T-cell Hybridomas (1981); Kennett et al., Monoclonal Antibodies (1980); see also U.S. Patent Nos. 15 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,452,570; 4,466,917; 4,472,500, 4,491,632; and 4,493,890.

Panels of monoclonal antibodies produced against the GnRH immunogen of interest, or fragment thereof, can be screened for various properties; i.e., for isotype, 20 epitope, affinity, etc.

Functional fragments of the antibodies can also be made against the GnRH immunogen of interest and can be produced by cleaving a constant region, not responsible for antigen binding, from the antibody 25 molecule, using e.g., pepsin, to produce F(ab')2 fragments. These fragments will contain two antigen binding sites, but lack a portion of the constant region from each of the heavy chains. Similarly, if desired, Fab fragments, comprising a single antigen 30 binding site, can be produced, e.g., by digestion of polyclonal or monoclonal antibodies with papain. Functional fragments, including only the variable regions of the heavy and light chains, can also be produced, using standard techniques. These fragments 35 are known as Fv.

Printed from Mimosa 01/03/2001 12:52:03 page -48- Chimeric or humanized antibodies can also be produced using the subject immunogens. These antibodies can be designed to minimize unwanted immunological reactions attributable to heterologous 5 constant and species-specific framework variable regions typically present in monoclonal and polyclonal antibodies. For example, if the antibodies are to be used in human subjects, chimeric antibodies can be created by replacing non-human constant regions, in 10 either the heavy and light chains, or both, with human constant regions, using techniques generally known in the art. See, e.g., Winter, G. and Milstein, C. (1991) Nature 349:293-299; Jones, P.T. et al. (1986) Nature 321:522-525; Riechmann, L. et al. (1988) 15 332:323-327; and Carter, P. et al. (1992) Proc. Natl. Acad. Sci. USA 89=4285-4289.

GnRH Compositions Once the above GnRH polypeptides or 20 antibodies are produced, they are formulated into compositions for delivery to a vertebrate subject. The relevant GnRH molecule is administered alone, or mixed with a pharmaceutically acceptable vehicle or excipient. Suitable vehicles are, for example, water, 25 saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, the vehicle may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants in the case of vaccine compositions, which 30 enhance the effectiveness of the vaccine. Suitable adjuvants are described further below. The compositions of the present invention can also include ancillary substances, such as pharmacological agents, cytokines, or other biological response modifiers. 35 As explained above, vaccine compositions of the present invention may include adjuvants to further Printed from Mimosa 01/03/2001 12:52:03 page -49- increase the immunogenicity of the GnRH immunogen. Adjuvants may include for example, emulsifiers, muramyl dipeptides, avridine, aqueous adjuvants such as aluminum hydroxide, chitosan-based adjuvants, and 5 any of the various saponins, oils, and other substances known in the art. For example, compounds which may serve as emulsifiers herein include natural and synthetic emulsifying agents, as well as anionic, cationic and nonionic compounds. Among the synthetic 10 compounds, anionic emulsifying agents include, for example, the potassium, sodium and ammonium salts of lauric and oleic acid, the calcium, magnesium and aluminum salts of fatty acids (i.e., metallic soaps), and organic sulfonates such as sodium lauryl sulfate. 15 Synthetic cationic agents include, for example, cetyltrimethylammonium bromide, while synthetic nonionic agents are exemplified by glyceryl esters (e.g., glyceryl monostearate), polyoxyethylene glycol esters and ethers, and the sorbitan fatty acid esters 20 (e.g., sorbitan monopalmitate) and their polyoxyethylene derivatives (e.g., polyoxyethylene sorbitan monopalmitate). Natural emulsifying agents include acacia, gelatin, lecithin and cholesterol.

Other suitable adjuvants can be formed with 25 an oil component, such as a single oil, a mixture of oils, a water-in-oil emulsion, or an oil-in-water emulsion. The oil may be a mineral oil, a vegetable oil, or an animal oil. Mineral oil, or oil-in-water emulsions in which the oil component is mineral oil 3 0 are preferred. In this regard, a "mineral oil" is defined herein as a mixture of liquid hydrocarbons obtained from petrolatum via a distillation technique; the term is synonymous with "liquid paraffin," "liquid petrolatum" and "white mineral oil." The term is also 35 intended to include "light mineral oil," i.e., an oil which is similarly obtained by distillation of Printed from Mimosa 01/03/2001 12:52:03 page -50- petrolatum, but which has a slightly lower specific gravity than white mineral oil. See, e.g., Remington's Pharmaceutical Sciences, supra. A particularly preferred oil component is the oil-in-5 water emulsion sold under the trade name of EMULSIGEN PLUS"" (comprising a light mineral oil as well as 0.05% formalin, and 3 0 mcg/mL gentamicin as preservatives), available from MVP Laboratories, Ralston, Nebraska. Suitable animal oils include, for example, cod liver 10 oil, halibut oil, menhaden oil, orange roughy oil and shark liver oil, all of which are available commercially. Suitable vegetable oils, include, without limitation, canola oil, almond oil, cottonseed oil, corn oil, olive oil, peanut oil, safflower oil, 15 sesame oil, soybean oil, and the like.

Alternatively, a number of aliphatic nitrogenous bases can be used as adjuvants with the vaccine formulations. For example, known immunologic adjuvants include amines, quaternary ammonium 20 compounds, guanidines, benzamidines and thiouroniums (Gall, D. (1966) Immunology 1^:369-386). Specific compounds include dimethyldioctadecylammonium bromide (DDA) (available from Kodak) and N,N-dioctadecyl-N,N-bis(2-hydroxyethyl)propanediamine ("avridine"). The 25 use of DDA as an immunologic adjuvant has been described; see, e.g., the Kodak Laboratory Chemicals Bulletin 56(1):l-5 (1986); Adv. Drug Deliv. Rev. 5,(3) : 163-187 (1990); J. Controlled Release 7:123-132 (1988); Clin. Exp. Immunol. 28 (2):256-262 (1989); 30 J. Immunol. Methods .97 (2): 159-164 (1987); Immunology 58.(2) :245-250 (1986); and Int. Arch. Allergy Appl. Immunol. 68.(3) :201-208 (1982) . Avridine is also a well-known adjuvant. See, e.g., U.S. Patent No. 4,310,550 to Wolff, III et al., which describes the 35 use of N,N-higher alkyl-N',N'-bis(2- hydroxyethyl)propane diamines in general, and avridine Printed from Mimosa 01/03/2001 12:52:03 page -51- in particular, as vaccine adjuvants. U.S. Patent No. 5,151,267 to Babiuk, and Babiuk et al. (1986) Virology 159:57-66, also relate to the use of avridine as a vaccine adjuvant.

Particularly preferred for use herein is an adjuvant known as "VSA-3" which is a modified form of the EMULSIGEN PLUS™ adjuvant which includes DDA (see, allowed U.S. Patent Application Serial No. 08/463,837).

Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art. See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania, 18th edition, 1990. The composition or 15 formulation to be administered will contain a quantity of the GnRH polypeptide adequate to achieve the desired state in the subject being treated.

The compositions of the present invention are normally prepared as injectables, either as liquid 20 solutions or suspensions, or as solid forms which are suitable for solution or suspension in liquid vehicles prior to injection. The preparation may also be emulsified or the active ingredient encapsulated in liposome vehicles or other particulate carriers used. 25 The compositions may also be prepared in solid form. For example, solid particulate formulations can be prepared for delivery from commercially available needleless injector devices. Alternatively, solid dose implants can be provided for 30 implantation into a subject. Controlled or sustained release formulations may also be used and are made by incorporating the GnRH polypeptides into carriers or vehicles such as liposomes, nonresorbable impermeable polymers such as ethylenevinyl acetate copolymers and 35 Hytrel® copolymers, swellable polymers such as hydrogels, or resorbable polymers such as collagen and Printed from Mimosa 01/03/2001 12:52:03 page -52- certain polyacids or polyesters such as those used to make resorbable sutures.

Furthermore, the polypeptides may be formulated into compositions in either neutral or salt 5 forms. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the active polypeptides) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, 10 oxalic, tartaric, mandelic, and the like. Salts formed from free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, 15 trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

The composition is formulated to contain an effective amount of the GnRH polypeptide, the exact amount being readily determined by one skilled in the 20 art, wherein the amount depends on the animal to be treated, in the case of a vaccine composition, the capacity of the animal's immune system to synthesize antibodies, and the degree of immunoneutralization of GnRH desired. For purposes of the present invention, 25 formulations including approximately 1 /xg to about 2 mg, more generally about 5 fig to about 800 fig, and even more particularly, 10 ng to about 400 /zg of GnRH polypeptide per mL of injected solution should be adequate to raise an immunological response when 30 administered. If a peptide-carrier chimera is used, the ratio of immunogen to carrier in the vaccine formulation will vary based on the particular carrier and immunogen selected to construct such molecules.

For example, if a leukotoxin-GnRH chimera is 35 used, the ratio of GnRH to leukotoxin in the vaccine formulation will vary based on the particular Printed from Mimosa 01/03/2001 12:52:03 page -53- leukotoxin and GnRH polypeptide moieties selected to construct those molecules. One preferred vaccine composition contains a leukotoxin-GnRH chimera having about 1 to 90% GnRH, preferably about 3 to 80% and 5 most preferably about 10 to 70% GnRH polypeptide per fusion molecule. Increases in the percentage of GnRH present in the LKT-GnRH fusions reduce the amount of total antigen which must be administered to a subject in order to elicit a sufficient immunological response 10 to GnRH.

The subject is administered one of the above-described compositions e.g., in a primary immunization, before puberty, in at least one dose, and optionally, two or more doses. The primary 15 administration(s) is followed with one or more boosts with the same or different GnRH composition either prepubertally, postpubertally, or both, in order to result in a prolonged suppression of testicular development or function in males or ovarian 20 development or function in females.

Any suitable pharmaceutical delivery means may be employed to deliver the compositions to the vertebrate subject. For example, conventional needle syringes, spring or compressed gas (air) injectors 25 (U.S. Patent Nos. 1,605,763 to Smoot; 3,788,315 to Laurens; 3,853,125 to Clark et al.; 4,596,556 to Morrow et al.; and 5,062,830 to Dunlap), liquid jet injectors (U.S. Patent Nos. 2,754,818 to Scherer; 3,330,276 to Gordon; and 4,518,385 to Lindmayer et 30 al.), and particle injectors (U.S. Patent Nos. ,149,655 to McCabe et al. and 5,2 04,253 to Sanford et al.) are all appropriate for delivery of the compositions.

Preferably, the composition is administered 35 intramuscularly, subcutaneously, intravenously, subdermally, intradermally, transdermally or Printed from Mimosa 01/03/2001 12:52:03 page -54- transmucosally to the subject. If a jet injector is used, a single jet of the liquid vaccine composition is ejected under high pressure and velocity, e.g., 1200-1400 PSI, thereby creating an opening in the skin 5 and penetrating to depths suitable for immunization.

Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present 10 invention in any way. 3. Experimental Example 1 Construction of PCB130 Plasmid pCB130 was used to produce a GnRH fusion protein for use in the examples described below. This GnRH construct contains 8 tandem repeats of the GnRH sequence fused to both the 5' and 3' ends 20 of a DNA sequence coding for a carrier leukotoxin polypeptide. Each alternating GnRH sequence has a change in the fourth base in the sequence from cytosine to guanosine. This results in a single amino acid change in the second amino acid of the GnRH 25 molecule from His to Asp. See, Figures 5A and 5B. The leukotoxin portion of the construct encodes a shortened version of leukotoxin which was developed from the recombinant leukotoxin gene present in plasmid pAA352 (ATCC Accession No. 68283 and described 30 in U.S. Patent 5,476,657) by removal of an internal DNA fragment of approximately 1300 bp in length. The leukotoxin polypeptide has an estimated molecular weight of 52 kDa and contains convenient restriction sites for use in producing the fusion proteins of the 35 present invention. The chimeric construct is under the control of the Tac promoter and induction is Printed from Mimosa 01/03/2001 12:52:03 page -55- controlled through the use of Lac I. The GnRH-leukotoxin fusion protein produced by plasmid pCB130 is shown in Figures 6A through 6F.

Plasmid pCB130 was prepared as follows. The 5 leukotoxin gene was isolated as described in U.S.

Patent Nos. 5,476,657 and 5,837,268. In particular, to isolate the leukotoxin gene, gene libraries of P. haemolytica Al (strain B122) were constructed using standard techniques. See, Lo et al., Infect. Immun., 10 supra; DNA CLONING: Vols. I and II, supra; and Sambrook et al., supra. A genomic library was constructed in the plasmid vector pUC13 and a DNA library constructed in the bacteriophage lambda gtll. The resulting clones were used to transform B. coli 15 and individual colonies were pooled and screened for reaction with serum from a calf which had survived a P. haemolytica infection and that had been boosted with a concentrated culture supernatant of P. haemolytica to increase anti-leukotoxin antibody 20 levels. Positive colonies were screened for their ability to produce leukotoxin by incubating cell lysates with bovine neutrophils and subsequently measuring release of lactate dehydrogenase from the latter.

Several positive colonies were identified and these recombinants were analyzed by restriction endonuclease mapping. One clone appeared to be identical to a leukotoxin gene cloned previously. See, Lo et al., Infect. Immun., supra. To confirm 30 this, smaller fragments were re-cloned and the restriction maps compared. It was determined that approximately 4 kilobase pairs of DNA had been cloned. Progressively larger clones were isolated by carrying out a chromosome walk (5' to 3' direction) in order to 35 isolate full-length recombinants which were approximately 8 kb in length. The final construct was Printed from Mimosa 01/03/2001 12:52:03 page -56- termed pAA114. This construct contained the entire leukotoxin gene sequence. lktA, a MaeI restriction endonuclease fragment from pAA114 which contained the entire 5 leukotoxin gene, was treated with the Klenow fragment of DNA polymerase I plus nucleotide triphosphates and ligated into the Smal site of the cloning vector pUC13. This plasmid was named pAA179. From this, two expression constructs were made in the ptac-based 10 vector pGH432:lacI digested with Smal. One, pAA342, consisted of the 5'-AhaIII fragment of the lktA gene while the other, pAA345, contained the entire Mael fragment described above. The clone pAA342 expressed a truncated leukotoxin peptide at high levels while 15 pAA345 expressed full length leukotoxin at very low levels. Therefore, the 3' end of the lktA gene (Styl SairiHI fragment from pAA345) was ligated to Styl BairiHI-digested pAA342, yielding the plasmid pAA352. The P. haemolytica leukotoxin produced from the pAA352 20 construct is hereinafter referred to as LKT 352.

Plasmid pAA352 was then used to prepare a shortened version of the recombinant leukotoxin polypeptide. The shortened LKT gene was produced by deleting an internal DNA fragment of approximately 25 1300 bp in length from the recombinant LKT gene as follows. The plasmid pCB113, (ATCC Accession No. 69749 and described in U.S. Patent No. 5,837,268) which includes the LKT 352 polypeptide, was digested with the restriction enzyme BstBl (New England 30 Biolabs). The resultant linearized plasmid was then digested with mung-bean nuclease (Pharmacia) to remove the single stranded protruding termini produced by the BstBl digestion. The blunted DNA was then digested with the restriction enzyme Nael (New England 35 Biolabs), and the digested DNA was loaded onto a 1% agarose gel where the DNA fragments were separated by Printed from Mimosa 01/03/2001 12:52:03 page -57- electrophoresis. A large DNA fragment of approximately 6190 bp was isolated and purified from the agarose gel using a Gene Clean kit (Bio 101), and the purified fragment was allowed to ligate to itself 5 using bacteriophage T4 DNA ligase (Pharmacia). The resulting ligation mix was used to transform competent E. coli JM105 cells, and positive clones were identified by their ability to produce an aggregate protein having an appropriate molecular weight. The 10 recombinant plasmid thus formed was designated pCBlll, (ATCC Accession No. 69748), and produces a shortened leukotoxin polypeptide (hereinafter referred to as LKT 111) fused to four copies of GnRH polypeptide.

Plasmid pCB114 has the multiple copy GnRH sequence 15 (corresponding to the oligomer of Figure 5B) inserted twice. Both these plasmids are described in U.S. Patent No. 5,837,268 and produce shortened leukotoxin polypeptides termed LKT 111 and LKT 114, respectively.

A recombinant LKT-GnRH fusion molecule having two 8 copy GnRH multimers, one arranged at the N'-terminus of LKT 114 and the other arranged at the C'-terminus of LKT 114, was constructed from the LKT-GnRH fusion sequence obtained from the pCB114 plasmid 25 by ligating the multiple copy GnRH sequence (corresponding to the oligomer of Figure 5B) twice at the 5' end of the LKT 114 coding sequence. A synthetic nucleic acid molecule having the following nucleotide sequence: 5' —ATGGCTACTGTTATAGATCGATCT—3' (SEQ ID NO: ) was ligated at the 5' end of the multiple copy GnRH sequences. The synthetic nucleic acid molecule encodes an eight amino acid sequence (Met-Ala-Thr-Val-Ile-Asp-Arg-Ser) (SEQ ID NO: ).

The resulting recombinant molecule thus contains in 35 the order given in the 5' to 3' direction: the synthetic nucleic acid molecule; a nucleotide sequence Printed from Mimosa 01/03/2001 12:52:03 page -58- encoding a first 8 copy GnRH multimer; a nucleotide sequence encoding the shortened LKT peptide (LKT 114); and a nucleotide sequence encoding a second 8 copy GnRH multimer.

The recombinant molecule was circularized, and the resulting molecule was used to transform competent E. coli JM105 cells. Positive clones were identified by their ability to produce an aggregate protein having a molecular weight of approximately 74 10 KDa. The recombinant plasmid thus formed was designated pCB13 0 which produces the LKT 114 polypeptide fused to 16 copies of GnRH polypeptide. The nucleotide sequence of the recombinant LKT-GnRH fusion of pCB130 is shown in Figures 6A through 6F.

Example 2 Purification of LKT-antigen Fusions The recombinant LKT-GnRH fusion from Example 1 was purified using the following procedure. Five to 20 ten colonies of transformed E. coli strains were inoculated into 10 mL of TB broth supplemented with 100 fig/mL of ampicillin and incubated at 37°C for 6 hours on a G10 shaker, 220 rpm. Four mL of this culture was diluted into each of two baffled Fernbach 25 flasks containing 400 mL of TB broth + ampicillin and incubated overnight as described above. Cells were harvested by centrifugation for 10 minutes at 4,000 rpm in polypropylene bottles, 500 mL volume, using a Sorvall GS3 rotor. The pellet was resuspended in an 3 0 equal volume of TB broth containing ampicillin which had been prewarmed to 37°C (i.e., 2 x 400 ml), and the cells were incubated for 2 hours as described above. 3.2 mL of isopropyl-B,D-thiogalactopyranoside (IPTG, Gibco/BRL), 35 500 mM in water (final concentration = 4 mM), was added to each culture in order to induce synthesis of Printed from Mimosa 01/03/2001 12:52:03 page -59- the recombinant fusion proteins. Cultures were incubated for two hours. Cells were harvested by centrifugation as described above, resuspended in 30 mL of 50 mM Tris-hydrochloride, 25% (w/v) sucrose, 5 pH 8.0, and frozen at -70°C. The frozen cells were thawed at room temperature after 60 minutes at -70°C, and 5 mL of lysozyme (Sigma, 20 mg/mL in 250 mM Tris-HCl, pH 8.0) was added. The mixture was vortexed at high speed for 10 seconds and then placed on ice 10 for 15 minutes. The cells were then added to 500 mL of lysis buffer in a 1000 mL beaker and mixed by stirring with a 2 mL pipette. The beaker containing the lysed cell suspension was placed on ice and sonicated for a total of 2.5 minutes (5-3 0 second 15 bursts with 1 minute cooling between each) with a Braun sonicator, large probe, set at 100 watts power. Equal volumes of the solution were placed in Teflon SS34 centrifuge tubes and centrifuged for 20 minutes at 10,000 rpm in a Sorvall SS34 rotor. The pellets 2 0 were resuspended in a total of 100 mL of sterile double distilled water by vortexing at high speed, and the centrifugation step repeated. Supernatants were discarded and the pellets combined in 20 mL of 10 mM Tris-HCl, 150 mM NaCl, pH 8.0 (Tris-buffered saline) 25 and the suspension frozen overnight at -20°C.

The recombinant suspension was thawed at room temperature and added to 100 mL of 8 M Guanidine HCl (Sigma) in Tris-buffered saline and mixed vigorously. A magnetic stir bar was placed in the 30 bottle and the solubilized sample was mixed at room temperature for 30 minutes. The solution was transferred to a 2000 mL Erlenmeyer flask and 1200 mL of Tris-buffered saline was added quickly. This mixture was stirred at room temperature for an 35 additional 2 hours. 500 mL aliquots were placed in dialysis bags (Spectrum, 63.7 mm diameter, Printed from Mimosa 01/03/2001 12:52:03 page -60- 6,000-8,000 MW cutoff, #132670, from Fisher scientific) and these were placed in 4,000 mL beakers containing 3,500 mL of Tris-buffered saline + 0.5 M Guanidine HC1. The beakers were placed in a 4°C room 5 on a magnetic stirrer overnight after which dialysis buffer was replaced with Tris-buffered saline + 0.1 M Guanidine HC1 and dialysis continued for 12 hours. The buffer was then replaced with Tris-buffered saline + 0.05 M Guanidine HC1 and dialysis continued 10 overnight. The buffer was replaced with Tris-buffered saline (no guanidine), and dialysis continued for 12 hours. This was repeated three more times. The final solution was poured into a 2000 mL plastic roller bottle (Corning) and 13 mL of 100 mM PMSF (in 15 ethanol) was added to inhibit protease activity. The solution was stored at -20°C in 100 mL aliquots.

To confirm that the fusion protein had been isolated, aliquots of each preparation were diluted 20-fold in double distilled water, mixed with an equal 20 volume of SDS-PAGE sample buffer, placed in a boiling water bath for five minutes and run through 12% polyacrylamide gels. Recombinant leukotoxin controls were also run. The fusion protein was expressed at high levels as inclusion bodies.

Example 3 Immunization of Mature Cats by GnRH Vaccination The following experiment utilizes an 30 immunological approach to demonstrate the use of GnRH vaccines in order to achieve prolonged immunological castration. Five mature male cats were immunized twice, 67 days apart, with a GnRH vaccine. In particular, vaccines derived from cultures containing 35 the pCB130 plasmid described above were formulated to contain 50 fj.g of the GnRH multimer fusion molecules Printed from Mimosa 01/03/2001 12:52:03 page -61- (36 fig total of GnRH) in a . 5 mL final volume of VSA-3 adjuvant, (a modified EMULSIGEN PLUS™ adjuvant which contains a light mineral oil and dimethyldioctadecyl-ammonium bromide, see, allowed U.S. Patent Application 5 Serial No. 08/463,837). Following immunization, GnRH titers were measured as % binding at 1:5000 dilution and testicular size determined.

As can be seen in Figure 1, immunization of mature male cats with the GnRH immunogen induced GnRH 10 antibody titers, which resulted in a decline of serum testosterone concentration to undetectable levels. A significant reduction in testicular size compared to pretreatment values was also seen. Biologically effective GnRH titers, i.e. the level of titer which 15 results in significant suppression of serum testosterone, was achieved within 35 days of vaccination and had a duration of effect of at least 300 days after the primary immunization.

Example 4 Immunocastration of Prepubertal Cats bv GnRH Vaccination at 8. 12 and 16 Weeks of Age A vaccine derived from cultures containing the pCB130 plasmid described above was formulated to 25 contain 100 fig of the GnRH multimer fusion molecules (72 fig total of GnRH) in a 0.25 mL final volume of VSA-3 adjuvant. Seven kittens (six females and one male) from two litter groups were immunized with the vaccine at 8, 12 and 16 weeks of age. Each litter 30 group included one age- and sex-matched untreated control kitten.

Immunological activity of the GnRH fusion protein vaccine was assayed by measuring anti-GnRH antibody titers using a standard radioimmunoassay 35 procedure at a 1:5000 serum dilution. As can be seen in Figure 2, anti-GnRH antibody titers increased Printed from Mimosa 01/03/2001 12:52:03 page -62- dramatically in the immunized animals and remained at levels significantly in excess of the minimal amount required to produce a biological effect (approximately 30% binding in Figure 2).

Biological activity of the GnRH fusion protein vaccine was also assayed by measuring serum testosterone concentration in the males and serum estradiol concentration in the females using standard radioimmunoassay procedures. 10 In particular, testosterone was measured using a Coat-A-Count Total Testosterone Kit™ (Diagnostic Products Corporation, Los Angeles, CA). The kit is a solid phase RIA designed for the quantitative measurement of testosterone in serum, 15 based on testosterone-specific antibody immobilized to the wall of a polypropylene tube. 125I-labeled testosterone was competed for 3 hours at 37°C with testosterone in the test sample for antibody sites. The tube was decanted to separate bound from free, and 2 0 counted in a gamma counter. The amount of testosterone present in the test sample was determined from a calibration curve.

The results are shown in Figure 7. As can be seen, serum testosterone was nearly absent in the 25 immunized group as compared to the control group.

Serum estradiol was measured using a Double Antibody Estradiol Kit™ (Diagnostic Products Corporation, Los Angeles, CA). The test is a sequential radioimmunoassay in which the test sample 3 0 was preincubated with anti-estradiol antibodies.

After incubation with 125I-labelled estradiol for 3 hours, separation of bound from free was achieved by the PEG-accelerated antibody method. The antibody-bound fraction was precipitated and counted and test 35 sample concentrations were read from a calibration Printed from Mimosa 01/03/2001 12:52:03 page -63- curve. The antibodies were highly specific for estradiol.

The results are shown in Figure 8. As can be seen, there was not a significant difference 5 between the control and immunized animals. This is likely due to the fact that estrogen levels in animals of the age tested is far below those levels at maturity and is so low that a difference between the levels in control and immunized animals cannot be 10 detected.

Mating and androgen dependent behavior was assessed by exposing the male kittens to a queen in estrus at approximately 9 months of age, by which age males would normally be sexually active. Reproductive 15 function in the females was assessed by exposing the female kittens to an intact male cat at approximately 10 months of age by which time the females would normally be sexually active. No sexual behavior was evident in 9 month old male kittens when exposed to a 20 queen in estrus.

Pituitary responsiveness to exogenous GnRH was assessed by a GnRH challenge test performed when the immunized kittens were 10 months of age. LH concentrations were measured by a radioimmunoassay 25 procedure. The purpose of the GnRH challenge test was to determine if the pituitary gland in immunized kittens was responsive to exogenous GnRH. In the normal animal, the exogenous GnRH analogue, leuprolide acetate, binds to GnRH receptors in the pituitary and 3 0 results in an immediate increase in serum LH concentrations. If GnRH receptors are down-regulated or other post-translation effects are occurring, the pituitary will not respond to exogenous GnRH and serum LH concentrations will remain constant. In vitro 35 studies have shown that leuprolide has minimal cross-reactivity with GnRH antibodies so any reduction in Printed from Mimosa 01/03/2001 12:52:03 page -64- the action of leuprolide, demonstrated by no change in LH concentrations, is likely at the receptor or post-translational level.

Four immunized kittens (3 females, 5 designated cats 1-3 and 1 male, designated cat 4), one non-immunized female littermate and one non-immunized adult female were tested. A catheter was inserted into the cephalic vein of each animal. Leuprolide (1 mg/ml) was diluted to 100 mg/ml with 0.9% NaCl. 10 Animals were subcutaneously administered the leuprolide solution at a dose of 10 mg/kg body weight at T=0. Blood was drawn from the catheter immediately prior to test material administration, and at T=30, 60, 90, and 150 minutes. 1.5 ml of blood was obtained 15 from each cat at each sampling point. Catheters were flushed with heparinized saline after each sampling point.

Blood was centrifuged, sera extracted and frozen at -20°C until sample analysis. LH 20 concentrations were analyzed using a sequential radioimmunoassay as follows. The radioactive ligand was bovine LH iodinated with I125 and the antibody was raised in rabbits using bovine LH as the immunogen. The antibody did not cross-react with growth hormone, 25 FSH or prolactin. Highly purified bovine LH, provided by the National Institutes of Health, U.S., was used as the reference standard. The test sample was preincubated with bovine anti-LH antibodies. After incubation with I12S-labelled LH for 3 hours, 30 separation of bound from free was achieved by the PEG-accelerated double antibody method. The antibody-bound fraction was precipitated and counted and test sample concentrations were read from a calibration curve. All samples were run within a single assay 35 which had a within assay coefficient of 15%.

Printed from Mimosa 01/03/2001 12:52:03 page -65- Animals were also monitored on a daily basis in the morning for signs of estrus behavior (vocalizing, lordosis, rolling etc) until 10 days after T=0.

As can be seen in Figure 3, LH levels in the immunized animals did not significantly increase over pretreatment values. LH levels in the non-immunized animals, on the other hand, increased significantly within 30 minutes after administration of the 10 leuprolide and remained elevated for at least 2 % hours.

The control adult female showed signs of estrus within 5 days after the test. None of the kittens showed signs of estrus and the immunized male 15 kitten showed no signs of sexual behavior. The lack of sexual behavior seen in these kittens at an age when the onset of sexual function was expected could be attributed to the continued high circulating levels of GnRH antibodies binding to endogenous GnRH and 20 preventing activation of the pituitary GnRH receptors. Low levels of endogenous GnRH are also required for the maintenance of normal concentrations of pituitary GnRH receptors. The removal of GnRH by circulating antibodies may result in down-regulation of the 25 pituitary receptors, with subsequent inability of the pituitary to respond to exogenous GnRH.

A prolonged reduction in the number of pituitary GnRH receptors may have a permanent effect on the maturation of hypothalamic-pituitary-gonadal axis and 30 lead to long-term sterilization. To assess whether the down-regulation of receptors is permanent, this test can be repeated again when antibody titers have declined.

Since prepubertal gonadal development 35 appears to be more sensitive than the postpubertal gonad to withdrawal of gonadotropin stimulation, Printed from Mimosa 01/03/2001 12:52:03 page -66- immunization of the prepubertal or peripubertal animal, followed by a second immunization 1 to 2 months later, should result in a long-term sterilization effect.

Vaginal cytology to assess the reproductive cycle is also obtained.

Example 5 Immunocastration of Prepubertal Cats bv GnRH 10 Vaccination at 6 and 10 Weeks of Age The GnRH vaccine described above was used to immunize two kittens (one female and one male) from one litter group at 6 and 10 weeks of age. The litter group also included one age- and sex-matched untreated 15 control kitten. Serum antibody titers to GnRH, serum testosterone concentrations, serum estradiol concentrations and LH concentrations in response to an exogenous GnRH challenge test were measured as described above. Additionally, pituitary 20 responsiveness to exogenous GnRH is assessed by a GnRH challenge test, also as described above. Mating and androgen dependent behavior is assessed by exposing the male kittens to a queen in estrus at approximately 9 months of age, by which age males would normally be 25 sexually active. Reproductive function in the females is assessed by exposing the female kittens to an intact male cat at approximately 10 months of age by which time the females would normally be sexually active. Vaginal cytology to assess the reproductive 3 0 cycle is also obtained.

As can be seen in Figure 4, anti-GnRH antibody titers increased dramatically in the immunized animals and remained at levels significantly in excess of the minimal amount required to produce a 35 biological effect (approximately 30% binding in Figure 4) .

Printed from Mimosa 01/03/2001 12:52:03 page -67- Deposits of Strains Useful in Practicing the Invention A deposit of biologically pure cultures of the following strains was made with the American Type Culture Collection (ATCC), 10801 University Boulevard, 5 Manassas, VA. The accession number indicated was assigned after successful viability testing, and the requisite fees were paid. The deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of 10 Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of viable cultures for a period of thirty (3 0) years from the date of deposit and at least five (5) years after the most recent request for 15 the furnishing of a sample of the deposit by the depository. The organisms will be made available by the ATCC under the terms of the Budapest Treaty, which assures permanent and unrestricted availability of the cultures to one determined by the U.S. Commissioner of 20 Patents and Trademarks to be entitled thereto according to 35 U.S.C. §122 and the Commissioner's rules pursuant thereto (including 37 C.F.R. §1.12). Upon the granting of a patent, all restrictions on the availability to the public of the deposited cultures 25 will be irrevocably removed.

These deposits are provided merely as convenience to those of skill in the art, and are not an admission that a deposit is required under 35 U.S.C. §112. The nucleic acid sequences of these 3 0 plasmids, as well as the amino acid sequences of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with the description herein. A license may be required to make, use, or sell the deposited 35 materials, and no such license is hereby granted.

Printed from Mimosa 01/03/2001 12:52:03 page -68- Strain No. pAA352 in E. coli W1485 pCB113 in E. coli JM105 5 pCBlll in E. coli JM105 Deposit Date ATCC March 30, 1990 68283 February 1, 1995 69749 February 1, 1995 69748 Accordingly, novel methods for reducing the levels of GnRH in prepubertal vertebrates have been disclosed. Although preferred embodiments of the 10 subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims.

Printed from Mimosa 01/03/2001 12:52:03 page -69-

Claims (41)

We Claim:

1. Use of a nucleic acid encoding 1) a GnRH immunogen, 2) a GnRH analogue, or 3) antibodies that cross-react with endogenous GnRH of a vertebrate subject, in the manufacture of a first composition for prepubertal or peripubertal administration to the vertebrate subject to result in prolonged suppression of reproductive behavior and/or fertility in the vertebrate subject.

2. The use of claim 1, wherein said first composition comprises an effective amount of a GnRH immunogen.

3. The use of claim 2, wherein the first composition further comprises an immunological adjuvant.

4. The use of claim 3, wherein the immunological adjuvant comprises an oil and dimethyldioctadecylammonium bromide.

5. A use of a GnRH multimer comprising the general formula (GnRH-X-GnRH)y wherein: GnRH is a GnRH immunogen; X is one or more molecules selected from the group consisting of a peptide , linkage, an amino acid spacer group, a carrier molecule and [GnRH]n, where n is an integer greater than or equal to 1; and y is an integer greater than or equal to 1, for prepubertal or peripubertal administration to a vertebrate subject to result in prolonged suppression of reproductive behavior and/or fertility in the vertebrate subject.

6. The use of claim 5, wherein the carrier molecule is a leukotoxin polypeptide.

7. The use of claim 1, wherein said GnRH analog is a GnRH agonist or antagonist. -68- iPONZ - s JUL 2003

8. The use of claim 1, wherein said antibodies are polyclonal.

9. The use of claim 1, wherein said antibodies are monoclonal.

10. The use of claim I, further comprising administering to said vertebrate subject a second composition comprising an effective amount of a GnRH immunogen, a GnRH analogue, or antibodies that cross-react with endogenous GnRH of said vertebrate subject.

11. The use of claim 2, further comprising administering to said vertebrate subject a second composition comprising an effective amount of a GnRH immunogen.

12. The use of claim 11, wherein said first and second composition comprise the same GnRH immunogen.

13. The use according to any of claims 1-12, wherein said vertebrate is selected from the group consisting of a feline subject, a canine subject, an equine subject and a cervine subject.

14. The use of claim 13, wherein said first composition is administered to said vertebrate subject at about 3 to about 15 weeks of age.

15. The use of claim 14, wherein said second composition is administered to said vertebrate subject about 2 to about 10 weeks following administration of the first composition.

16. The use of claim 1, wherein prepubertal administration results in a prolonged, long-term suppression of testicular development and/or function in males, or a prolonged long-term suppression of ovarian development and/or function in females.

17. Use of first and second GnRH multimers for the manufacture of first and second vaccine compositions for use in a method for prolonged suppression of reproductive behavior and/or fertility in a vertebrate subject, said first and second -69- IPONZ -9 JUL2003 vaccine compositions comprising an adjuvant, said first and second GnRH multimers comprising the general formula (GnRH-X-GnRH)y wherein: GnRH is a GnRH immunogen; X is one or more molecules selected from the group consisting of a peptide linkage, an amino acid spacer group, a leukotoxin polypeptide and [GnRH]n, where n is an integer greater than or equal to 1; and y is an integer greater than or equal to 1, wherein said first composition is administered to said subject, prepubertally at about 3 to about 15 weeks of age, and said second vaccine composition is administered to said subject about 2 to about 10 weeks following administration of the first vaccine composition.

18. The use of claim 17, wherein said first and second vaccine compositions comprise the same GnRH multimer.

19. The use of claim 18, wherein said GnRH multimer comprises the amino acid sequence depicted in Figures 6A-6F or an amino acid sequence with at least about 75% sequence identity thereto.

20. The use of claim 18, wherein said GnRH multimer comprises the amino acid sequence depicted in Figures 6A-6F.

21. Use of first and second GnRH multimers in the manufacture of first and second vaccine compositions for use in a method for prolonged suppression of reproductive behavior and/or fertility in a feline subject, said first and second vaccine compositions comprising an immunological adjuvant which comprises a light mineral oil and dimethyldioctadecylammonium bromide, said first and second GnRH miltimers comprising the amino acid sequence depicted in Figures 6A-6F or an amino acid sequence with at least about 75% sequence identity thereto, wherein said first composition is administered to said subject, prepubertally at about 5 to about 12 weeks of age, and said second vaccine composition is administered to said subject about 2 to about 10 weeks following administration of the first vaccine composition. -70- IPONZ - S JUL 2003

22. The use of claim 21, wherein said GnRH multimer in said first and second vaccine compositions comprises the amino acid sequence depicted in Figures 6A-6F.

23. Use of nucleic acid encoding a first GnRH immunogen in the manufacture of a first vaccine composition for use in a method of suppressing reproductive behavior and/or fertility in a feline, canine, equine or cervine subject for at least 10 months.

24. The use of claim 23, further comprising administering to said subject a second vaccine composition comprising an effective amount of a GnRH immunogen.

25. The use of either of claims 23 or 24, wherein the first and/or second vaccine composition is administered prepubertally.

26. The use of either of claims 23 or 24, wherein the first and/or second vaccine composition is administered postpubertally.

27. The use of claim 24, wherein the first vaccine composition is administered prepubertally and the second vaccine composition is administered postpubertally.

28. The use of claim 24, wherein said GnRH immunogen in said first and second vaccine compositions is the same.

29. The use of claim 24, wherein said GnRH immunogen in said first and second vaccine compositions is different.

30. The use of either of claims 23 or 24, wherein said first and/or second vaccine composition further comprises an immunological adjuvant.

31. The use of claim 30, wherein the immunological adjuvant in said first and/or second vaccine composition comprises an oil and dimethyldioctadecylammonium bromide. _71. IPONZ - 9 JUL 2003

32. The use of claim 23, further comprising administering additional vaccine compositions comprising an effective amount of a GnRH immunogen at least about 6 to about 12 months subsequent to the prior administration.

33. The use of claim 32, wherein said additional vaccine compositions are administered at about yearly intervals.

34. The use of claim 24, wherein said GnRH immunogen in said first and second vaccine compositions are encoded by one or more nucleic acid molecules.

35. The use according to claim 5 wherein the GnRH multimer is encoded by a nucleic acid molecule.

36. The use of claim 35 wherein the carrier molecule is a leukotoxin polypeptide.

37. The use of claim 35 wherein said vertebrate is selected from the group consisting of a feline subject, a canine subject, an equine subject and a cervine subject.

38. The use of claim 35, wherein said first composition is administered to said vertebrate subject at about 3 to about 15 weeks of age.

39. The use of claim 35, wherein said second composition is administered to said vertebrate subject about 2 to about 10 weeks following administration of the first composition.

40. The use according to any one of claims 1, 5, 17 or 21, substantially as herein described with reference to any one of examples 1 to 5 and/or figures 1 to 8. -72- IPONZ - 9 JUL 2003

41. The use according to any one of claims 1 to 39, substantially as herein described with reference to any one of examples 1 to 5 and/or figures 1 to 8. BIOSTAR INC. y Its Attorneys ALDWIN SHELSTON WATERS -73 - IPONZ "3 JUL2003