NZ500507A

NZ500507A - Production of an amidated peptide through the use of a fusion protein and release from the fusion protein using an acyl-acceptor

Info

Publication number: NZ500507A
Application number: NZ500507A
Authority: NZ
Inventors: Ian Robert Cottingham
Original assignee: Ppl Therapeutics Scotland Ltd
Priority date: 1997-05-01
Filing date: 1998-05-01
Publication date: 2001-08-31
Also published as: CN1254379A; EP0979291A1; AU7224498A; CA2287204A1; GB9708918D0; WO1998050563A1; JP2001525664A; KR20010012165A

Abstract

A method for the production of a peptide of 3 to 100 amino acids, which comprises the step of expressing the peptide as part of a fusion protein, followed by release of the peptide from the fusion protein by an acyl-acceptor.

Description

<div class="application article clearfix" id="description"> WO 98/50563 PCT/GB98/01281 1 METHODS OF PRODUCTION OF AN AMIDATED PEPTIDE THROUGH THE USE OF A FUSION PROTEIN The present invention is directed to the production of peptides, especially but not exclusively with carboxy-terminal modifications such as amidation, by recombinant means. 5 "Peptide" is a term loosely applied to a chain of ammo acids, arbitrarily applied to sequences of three to over one hundred components, but possibly more, joined via their amino- and carboxy termini There are many examples of naturally occurring peptides which function as hormones, messengers, growth factors, antimicrobials, 10 surfactants etc and a wide variety of medicinal and other applications can be envisaged. Currently, there are at least three major sources of peptides, extraction from natural sources, chemical synthesis and from organisms transformed with recombinant 15 DNA constructs. The advantage of the route using transformed organisms is the biological fidelity of the synthetic process, the ability to synthesise chemically unfavourable sequences, the avoidance of chemical processes, using solvents, etc and, especially with longer peptides, cost-effectiveness. 20 The disadvantage of makmg peptides by recombinant technology is that the organisms used tend to be poor at synthesising, and if necessary secreting, short sequences of amino acids. Therefore, many of the methods considered for industrial use take advantage of fusion proteins where the short peptide sequence is made as either an ammo- or a carboxy-terminal extension on another protein. 25 Although these fusion proteins can be produced m greater quantities, and often purified by exploiting special characteristics of the fusion partner to simplify purification, difficulties can be experienced in recovering the peptide Proteins are chemically stable molecules and therefore require specific cleavage strategies in Printed from Mimosa WO 98/50563 PCT/GB98/01281 2 order to recover integral peptides with defined amino- and carboxy termini. A wide panel of protein cleavage technologies can be envisaged. These range from chemical cleavage at specific amino acids to enzymatic cleavage using 5 sequence-specific enzymes. Examples of chemical cleavage include cyanogen bromide cleavage after methionine residues and hydroxylamine cleavage between the amino acid pair asparagine - glycine. Examples of enzymes suitable for cutting at specific protein sequences mclude enterokmase, which cuts after the sequence (aspartic acid)4 -lysine, and thrombin, which cuts after the basic amino acids lysine 10 or arginine. A common problem with both of these cleavage strategies is that sequence constraints operate on both the presence of internal sites within the peptide and the necessity to generate authentic ammo-termini. For example, cyanogen bromide is 15 only useful when there are no internal methionines in the peptide and thrombin can cut at a number of different sites after basic amino acids. Enzymatic cleavage has additional problems in terms of process economics The enzyme must come from an acceptable and validated source (a common source of enterokmase is calf gut endothelium) and be available m economically acceptable quantity. 20 Carboxy-terminal amidation is a common post-translational modification found on many biologically active peptides of potential commercial interest. Examples include calcitonin, magainin and etc. . In many instances, for example, calcitonin, the natural amidated peptide is nearly two thousand times as active as the 25 non-amidated version. There are many different chemical and biological methods designed to produce carboxy-terminal amidated peptides. However, as with any extra process step, each Printed from Mimosa 3 (followed by page 3a) has disadvantages in terms of adding to the overall cost of the finished product. This invention describes a method for the production of peptides as amino-terminal extensions of fusion proteins in recombinant systems. We provide novel methods whereby cleavage of the peptide from the fusion protein and modifications of the peptide such as carboxy-amidation can occur as a series of linked reactions in a single process. Such an approach benefits from the low cost and fidelity of synthesis in a biological expression system without the disadvantages posed by the necessity of a separate cleavage step. Thus, in a first aspect, the present invention provides a method for the production of a peptide of 3 to 100 amino acids which comprises the step of expressing the peptide as part of a fusion protein followed by release of the peptide from the fusion protein by an acyl-acceptor. The acyl-acceptor is preferably a sulphur containing reductant. Suitably, at least part of the fusion protein is a molecule capable of catalysing transfer of the peptide, as an acyl moiety, to a suitable acceptor such as a proximal sulphur atom to form the thio-ester. In a further aspect, the present invention provides a DNA construct coding for a fusion protein as defined in the first aspect. In a still further aspect, the present invention provides a host cell transformed with a DNA construct of the invention. In a yet further aspect, the present invention provides a transgenic, non-human, mammal which has incorporated in its genome a DNA construct of the invention. In another aspect, the present invention provides a fusion protein when produced by a method of the invention. INTELLECTUAL PROPERTY OFFICE OF N.Z. 3 1 MAY 2001 RECEIVED u i INTELLECTUAL PROPERTY; OFFICE OF N.Z. 3a 3 1 MAY 2001 (followed by page 4) RECEIVED In preferred embodiments the peptide is chemically modified, eg amidated at its carboxy terminus after release from the fusion protein. Suitably, the amidation step is carried out in the presence of a source of ammonium ions at a suitable pH and the amidation step occurs simultaneously with release of the peptide. Examples of amidated peptides which could be prepared using these methods include Salmon Calcitonin, Human Calcitonin, Lutenising hormone releasing hormone, Oxytocin, Gastrin neuropeptide Y, Vasopressin, Corticotrophin releasing hormone, Growth hormone releasing hormone, Human Calcitonin gene related peptide, Gastrin, D-tyr-ccp-gly, phe-gly-phe-gly, gly-phe-gly, Melanocyte stimulation hormone precursor, Sectetin, Thyrotrophin releasing hormone, Amylin, Substance P, WO 98/50563 PCT/GB98/01281 4 Pancreatic polypeptide, Cholecystokinin, Gastrin secretion factor, phe-his-ile, phe-tyr-tyr, Savagin, Mastoparin M, Caerulein and FMRF amide. However, it is also possible to perform simple hydrolysis of the peptide in the 5 absence of ammonia which would result in the formation of a free carboxyhc acid terminal group. This makes the methods of the present invention suitable for the commercial production of peptides with free carboxy-termini for medicinal or other applications. Examples of such peptides include Hirulog, Magainm, thymosin alpha-1, brain naturetic peptide, atrial naturetic peptide or 10 bactericidal/permeability-increasing protein. The methods of the present invention can for example utilise a commercially available expression vector designed for making proteins as fusion proteins This vector incorporates a modified self-splicing protein, an intein, making it possible to 15 liberate the protein from its fusion partner by a simple chemical reaction. The invention utilises modified chemical conditions/steps to result in cleavage of the fusion protein thereby liberating a desired peptide, which can be modified e.g. by ambition at the carboxy-terminus. 20 Inteins are proteins which are expressed with flanking protein sequences at both amino- and carboy-termini. The amino- and carboxy-terminal sequences have been named exteins in keeping with the DNA nomenclature of exons and introns. A seemingly typical member of the emerging family of inteins is the VMA1 gene product from yeast. This is approximately SOkDa in molecular mass and contains 25 essential amino acids at the amino terminal (Cysteine) and at the carboxy-terminal (histamine and asparagine). In addition, the carboxy-terminal extein must start with a cysteine. At some point after translation is completed, the amino-terminal peptide bond is broken and the extein transferred to the sulphur atom of the adjacent Printed from Mimosa WO 98/50563 PCT/GB98/01281 5 cysteine to form a thio-ester. This bond is then exchanged with the cysteine at the start of the carboxy-terminal extein and then, with participation of the adjacent asparagine, exchanged with the peptide bond at this end of the intein. The overall effect of these concerted reactions is that the two exteins are seamlessly joined and 5 the intein is released. A detailed understanding of these reactions has emerged following the analysis of a series of mutants where essential groups at either end of the intein and the proximal ends of the exteins have been systematically replaced. This knowledge has enabled 10 the design of mutant inteins where the ammo-terminal extein can be replaced by any other protein and the self-sphcing function has been disabled. However, cleavage of the resulting fusion protein is still possible by the addition of extraneous chemical agents such as the reductant dithiothreitol. The fusion protein is liberated as a thio-ester with the added reductant which gradually hydrolyses to 15 the free acid in solution. Calcitonin is an example of a medically and commercially important peptide suitable for manufacture using the methods described in this invention. It contains thirty-two amino acids and is amidated at the carboxy-terminus. The functional 20 activity and amino acid sequence is highly conserved between species. Thus salmon Calcitonin , which was originally obtained mostly from natural sources but is now made by direct synthesis, is in widespread clinical use. In the past, therapies have focused on Paget's disease and hypocalcaemic shock. However, recently there has been a demand for larger amounts of material to treat osteoporosis in 25 post-menopausal women. This application requires substantive quantities of material which makes the cost of production an increasingly important factor. In order to make Calcitonin using the intein vector it is necessary to prepare Printed from Mimosa WO 98/50563 PCT/GB98/01281 6 complimentary oligonucleotides which encode the Calcitonin sequence flanked by restriction sites designed for insertion at the appropriate site 5' to the modified intern. These sites must be chosen so that the coding sequence of the peptide is in the same coding frame as the rest of the expressed protein. Suitable 5 oligonucleotides can be made by any number of methods, known to those skilled in the art, including most obviously direct synthesis and polymerase chain reaction amplification from a natural sequence using primers designed to contain convenient restriction sites This DNA construct is then transformed into a suitable expression system and the resulting fusion protein harvested 10 In a further refinement of the system the fusion protein also comprises a label, which allows for identification and/or purification of the fusion protein, and thus the peptide, by affinity or other chromatographic methods. Examples of a suitable label mclude a specific chitin-binding domain, or part thereof, a repeat of acidic or 15 basic amino acids, a poly-histidine sequence, glutathione S transferase and lysozyme. For example, the carboxy-terminus of an intein can be fused with a specific chitin-binding domain. This binds tightly to a packed column of chitin beads and can be used for the affinity-purification of the intact fusion protein. After extensive washing, the column can then be treated with an appropriate cleavage 20 reagent and the liberated target peptide eluted. Any expression system which can operate on a commercial scale is suitable although the intein based vector described above is designed for use in E. coli. Other vectors can be designed for optimal use in a particular expression system. 25 For example, if a mammalian expression system was chosen, then protein-encoding regions should have optimised codon usage for that particular system. Expression could also be improved by use of a smaller affinity tag for identification and/or purification such as a repeat of acidic or basic amino acids as described above, to Printed from Mimosa WO 98/50563 PCT/GB98/0J281 7 permit resolution from contaminating proteins by ion-exchange chromatography or by the inclusion of a poly-histidine sequence for purification on a metal chelate matrix. A further modification which could improve secretion ftom a mammalian system (the current E. coh vector is designed for intracellular protein production) 5 would be to add a secretory leader sequence to the calcitonin to promote secretion into the media or into the milk of transgenic animals. Suitably, such a leader sequence should be removed during the secretory process by natural processing enzymes. 10 Examples of expression systems which could be used to express peptide fusion proteins include bacteria (E.coli, B.subtihs etc.), yeast (S. cerevisiae, P.pastorahs etc.), insect cells (S. frugiperda), mammalian expression systems (Chinese hamster ovary, baby hamster kidney etc.), transgenic mammalian expression in milk or other body fluids (preferably pig, cow, sheep, goat, rabbit etc) and plants (potato, 15 corn, etc). In the case of an E.coli expression system, the initiator methionine will be retained in the expression product. Thus, where the peptide of interest is one which does not include an additional methionine in its sequence, this initiator methionine can be removed using cyanogen bromide. One example of such a peptide is Calcitonin. 20 Expression could be optimised for any of these systems, and for intracellular or extracellular production, by the appropriate selection of leader sequence, codon usage, intern or mutant thereof, and purification strategy. The skilled person will appreciate that this invention is not tied to any particular manifestation of intein or 25 any species as a source. For instance, it may not be necessary to use a whole intein molecule, much of the sequence may be irrelevant to the desired process and perhaps most of the molecule is functionally unnecessary. Indeed, other proteins outside the definition of "intein" may be capable of transferring the peptide bond at Printed from Mimosa WO 98/50563 PCT/GB98/01281 8 the carboxy-terminus of the target peptide to an appropriate thiol group thus creating the thio-ester group which is necessary for cleavage with concomitant amidation. 5 Thio-esters are relatively reactive rhnmiral groups, compared to either peptide bonds or oxygen-esters, and are therefore readfly converted to amides under mild reactive conditions. There are two points in the normal cleavage and release pathway during which the fused peptide can be converted to a carboxy-terminal amide The first and probably most suitable pomt is after the peptide has been 10 released from the fusion partner by the addition of a thiol reagent. The preferred reagent is dithiothreitol but any number of sulphur-containing reductants could also function effectively. This reaction is essentially a thiol-interchange reaction where the thiol-ester formed between the carboxy-terminus of the peptide and the sulphur of the intein cysteine is transferred to one of the dithiothreitol sulphur atoms. As 15 with any chemical reaction, the acyl shift reaction, between the amine of the cysteine at the amino-terminus of the intein and the sulphur of the same amino acid residue, is an equilibrium. With the yeast intein described above this equilibrium is shifted in favour of the amine group and the thio-ester is a minor component 20 The added thiol reagent removes this thio-ester species and therefore drives the reaction in the direction of making more thio-ester until effectively all of the peptide is released as free thio-ester. The released thio-ester is relatively stable to hydrolysis by water (which would generate the unwanted free acid) and is thus suitable for cleavage by any chemical conditions which will promote amide 25 formation. The second point where the peptide exhibits a thio-ester is to the intern itself but as described above, this species is a minor component However, even here it would Printed from Mimosa WO 98/50563 PCT/GB98/01281 9 be possible to design chemical conditions to allow simultaneous release of the peptide as an amidated species The conditions expected to favour thio-ester cleavage with concomitant amidation 5 are many and the following is only meant to illustrate a representitive selection of the possible reagents and reactions. Chemically, amides can be formed by the cleavage of thio-esters with ammonia and related compounds. This requires conditions where the positive charge of the carbonyl is enhanced (which is an effect of the adjacent sulphur atom) and the lone pair of electrons on the nitrogen of 10 ammonia are available. In aqueous solution the positively-charged ammonium ion, provided by a salt such as ammonium phosphate or sulphate, is in equilibrium with uncharged ammonia, the reactive species, and the concentration of free ammonia is thus increased with a lowering of the hydrogen ion concentration. It is therefore expected that the reaction promoting the formation of the amide product, although 15 likely to proceed at relatively low pH values, for example pH 4.0 to 6.0, will occur more rapidly as the pH is increased in the range 6.0 to 9.0 or even 10.0, where the equilibrium is shifted significantly in favour of ammonia formation. The optimal range will be a compromise between the highest pH which will be 20 tolerated by the peptide substrate itself and the lowest pH whereby the reaction still proceeds at an acceptable rate. This optimum range will be determined by the sequence of the peptide itself and other factors relatmg to the properties of the fusion partner and to process-related, especially purification, issues. Similar conditions and constraints are likely to apply whether the cleavage/amidation 25 reactions occur simultaneously or sequentially. There are many other chemical conditions which can be envisaged by those skilled in the art, both in aqueous and non-aqueous systems, which could achieve the desired reactions. The above is meant simply as an illustration of a suitable method and is not intended to exclude Printed from Mimosa WO 98/50563 PCT/GB98/01281 10 these other possible approaches. The invention will now be described by way of the following examples, which should not be construed as limiting the invention in any way. 5 Example 1: Glycine Extended Salmon Calcitonin 1.1. Cloning Strategy Vector pCYBl, obtainable from New England Biolabs, containing a Ndel site for 10 translation initiation and a Sapl site directly adjacent to the intein, was used to clone and express glycine extended salmon calcitonin (sCT-G). The sCT-G coding sequence was synthesised as two complementary single stranded oligonucleotides of 103bases and 104bases. The codon usage was optimised for expression in E.coli. Annealing of the two strands produced 5' overhangs 15 complementary to the Ndel (5' end) and the Sapl site (3' end). The double stranded oligonucleotide was inserted into pCYBl digested with Ndel and Sapl. The expression of the fusion gene is under the control of the promoter and is regulated by IPTG due to the presence of a laclq gene on the vector. 20 1.2. Fusion Protein Expression and Analysis The pCYBl vector containing sCT-G was transfected into DH5-a, cells grown, induced with IPTG, harvested and lysed by sonication. Expressed fusion was captured on chitin agarose which was washed and then boiled in SDS-PAGE sample buffer. The supernatant was run on 16% SDS-PAGE gels and the protein 25 visualised with coomassie stain or electroblotted to PVDF membrane for N-terminal sequencing. The sequence analysis indicated that the sCT-G was N-terminally truncated at two positions; Ser2 and Thr6. Printed from Mimosa WO 98/50563 PCT/GB98/01281 11 1.3. Fusion Protein Cleavage and Peptide Amidation Chitin agarose bound fusion was washed with 20mM Hepes pH 8.0, 40mM DTT (cleavage buffer A) or with cleavage buffer A supplemented with 3.0M ammonium bicarbonate (cleavage buffer B) and incubated at 4°C overnight. 5 Released sCT-G was washed from the column and captured on a cation exchange resin then eluted with a salt step. C18 RP-HPLC analysis after digestion with trypsin showed that the product formed with cleavage buffer B contained greater than 90% amidated C-terminus while the product with cleavage buffer A had a mixture of carboxyhc C-terminus and an adduct extended by a smgle Cys 10 residue, presumably from the intein N-terminus (Figure 1) Example 2 : Leutenizing Hormone Releasing Hormone (LHRH) 2.1 Cloning Strategy 15 Cloning was preformed exactly as described for sCT-G except that the oligonucleotides contained the LHRH coding sequence (Tan, L and Rousseau, P. Biochem Biophys. Res. Com. 109: 1061-1071 (1982)) 20 2.2. Fusion Protein Expression and Analysis As described for sCT-G. N-terminal sequencing demonstratred the LHRH was extended at the N-terminus by a single Met residue, retained from the E.coli initiation signal. 25 2.3. Fusion Protein Cleavage and Peptide Amidation The LHRH fusion was treated in the same manner as the sCT-G fusion until the final cation capture step. The column wash was applied directly to an elecrospray Printed from Mimosa WO 98/50563 PCT/GB98/01281 12 mass spectrometer and the data reconstructed to give the mass of the parent ion (Figure 2). LHRH from cleavage buffer B (as described in example 1) resulted in a parent ion with a mass of 133IDa consitent with the Met extended, amidated molecule. LHRH from cleavage buffer A (as described in example 1) gave a 5 parent ion mass of 1332 Da consistent with the Met extended free acid. The difference of IDa is the expected mass difference between an amide and carboxyhc acid. EXAMPLE 3 10 Cloning of Human Amylin The IMPACT I (Litem Mediated Purification with an Affinity Chitin-binding Tag) protein purification system from New England Biolabs (NEB) offers 4 E. coll expression vectors, which differ in their available cloning sites Human Amylin 15 is cloned using the NEB vector pCYBl, which contains a Ndel site for translation initiation and a Sapl site directly adjacent to the intein. The Human Amylin sequence is synthesised as two complementary single stranded oligo nucleotides of 115 and 116 bases respectively. The codon usage is 20 optimised for expression m E. coli. Annealing of the two strands produces 5' overhangs complementary to the Ndel (5' end) and the Sapl site (3' end). The double stranded oligo nucleotide can be inserted directly into pCYBl which has previously been digested with both Ndel and Sapl. 25 PCYBl: 5' CAT ATG GCT AGC GGC TCT TCC TGC TTT 3' Printed from Mimosa WO 98/50563 PCT/GB98/01281 13 3' GTATACCGATCG CCG AGA AGG AGC AAA 5' Ndel Sapl 5 Human Amylin: Ndel BspMI CATATGAAATGCAACACCGCGACCTGCGCGACCCAGCGCCTGGCG GTATACTTTACGTTGTGGCGCTGGACGCGCTGGGTCGCGGACCGC AACTTCCTGGTGCATAGCAGCAACAACTTCGGCGCGATCCTGAGC TTGAAGGACC ACGT ATCGTCGTTGTTGA AGCCGCGCT AGGACTCG 15 AGCACCAACTGGGCAGCAACACCTATTGCTTT TCGTGGTTGACCCGTCGTTGTGGATAACGAAA EXAMPLE 4 20 General Protcol for expressing peptide fusion proteins m E.coli and purification of fusion protein and released peptide Expression in bacteria requires transformation of cells with an expression construct using any one of a range of standard methods (Maniatis et al, supra). 25 After cell growth, it is usual to induce expression of the target fusion protein using a combination of an inducible promoter, for example the p-galactosidase promoter, and a small molecule inducer such as IPTG. The fusion protein is then recovered after cell harvesting and breakage and then purified by affinity 10 Mbol Ddel Printed from Mimosa WO 98/50563 PCT/GB98/01281 14 chromatography. Most usually, this involves passing the clarified cell lysate through a column of an appropriate affinity matrix displaying a ligand to which the fusion protein binds. Contaminants are then washed from the matrix before either specific elution of the fusion protein or cleavage of the bound fusion 5 protein in situ. For instance, with the Impact vector described in Examples 2 and 3, the fusion protein containing lysozyme would be purified by cation exchange chromatography. In this case, cleavage in situ is probably not an option, unless cleavage conditions can be found which do not promote elution of the fusion protein. Under these circumstances, cleavage m solution phase would be 10 required. Cleavage of the fusion protein whilst bound to a matrix simplifies the subsequent purification of the peptide. Cleavage of the fusion protein can be done by the direct addition of a thiol acyl-acceptor, such as lOmM DTT, to yield a thioester intermediate, which can 15 subsequently be converted to the amide by treatment with ammonia salts at a pH above 6.0. Simultaneous cleavage and conversion t an amide may also be possible with the addition of a suitable mixture of acceptor thiol and ammonia salt. 20 Released peptide is then further purified, if necessary, using conventional techniques such as solvent partitioning and HPLC. Printed from Mimosa </div>

Claims

<div class="application article clearfix printTableText" id="claims"> ■> ,\Xt 30 u 3 u i. INTELLECTUAL PROPERTY OFFICE OF N.Z. 3 1 MAY 2001 RECEIVED

1. A method for the production of a peptide of 3 to 100 amino acids, which comprises the step of expressing the peptide as part of a fusion protein, followed by release of the peptide from the fusion protein by an acyl-acceptor.

2. A method as claimed in claim 1 wherein the acyl-acceptor is a sulphur containing reductant.

3. A method as claimed in claim 1 or claim 2 wherein at least part of the fusion protein is a molecule capable of catalysing transfer of the peptide, as an acyl moiety to a suitable acceptor.

4. A method as claimed in claim 3 wherein the acceptor is a proximal sulphur atom to form a thio-ester.

5. A method as claimed in any one of claims 1 to 4 wherein the peptide is amidated at its carboxy terminus after release from the fusion protein.

6. A method as claimed in claim 5 wherein the amidation step is carried out in the presence of a source of ammonium ions at a suitable pH.

7. A method as claimed in claim 5 or claim 6 wherein the amidation step occurs simultaneously with release of the peptide.

8. A method as claimed in any one of claims 1 to 7 wherein the peptide is Salmon Calcitonin, Human Calcitonin, Lutenising hormone releasing hormone, Oxytocin, Gastrin neuropeptide Y, Vasopressin, Corticotrophin releasing hormone, Growth hormone releasing hormone, Human Calcitonin gene related peptide, Gastrin, D-tyr-trp-gly, phe-gly-phe-gly, gly-phe-gly, Melanocyte stimulation hormone precursor, Sectetin, Thyrotrophin releasing hormone, Amylin, Substance P, Pancreatic polypeptide, Cholecystokinin, Gastrin secretion factor, phe-his-ile, phe-tyr-tyr, Savagin, Mastoparin M, Caerulein or FMRF amide.

15

What We Claim Is:

16

INIELLETTUAT PROPER OFFICE OF N.Z.

d 1 MAY 2001 RECEIVED

9. A method as claimed in claim 8 wherein the peptide is Salmon Calcitonin or Human calcitonin.

10- A method as claimed in any one of claims 3 to 9 wherein the fusion protein 5 comprises at least part of a modified intein sequence.

11. A method as claimed in claim 10 wherein the modification of the intein sequence, or part thereof, results in disablement of the self-splicing function.

10 12. A method as claimed in claim 10 or claim 11 wherein the intein sequence, or part thereof, is derived from the VMA1 gene from yeast.

13. A method as claimed in any one of claims 1 to 4 wherein the peptide is released from the fusion protein by hydrolysis.

15

14. A method as claimed in claim 13 wherein the peptide is Hirulog, Magainin, thymosin alpha-1, brain naturetic peptide, atrial naturetic peptide or bactericidal/permeability-increasing protein.

20

15. A method as claimed in any one of claims 1 to 14 wherein the fusion protein comprises a label, which allows for identification and/or purification of the fusion protein by affinity or other chromatographic methods.

25

16. A method as claimed in claim 15 wherein the label is an affinity label.

17. A method as claimed in claim 16 wherein the affinity label comprises a specific chitin-binding domain, or part thereof, a repeat of acidic or basic amino acids, a poly-histidine sequence, glutathione synthetase and lysozyme.

17

INTELLECTUAL PROPERTY OFFICE OF N.Z.

d 1 MAY 2001 RECEIVED

18. A method as claimed in any one of claims 1 to 17 wherein the fusion protein is expressed in bacteria, yeast, plant tissue, including whole plants, insect cells, mammalian cells or in a body fluid of a transgenic mammal.

19. A method as claimed in claim 17 wherein the fusion protein is expressed in E.coli or B.subtilis.

20. A method as claimed in claim 19 wherein the fusion protein is expressed in E.coli and wherein the peptide is treated with cyanogen bromide if it does not contain a methionine in its sequence.

21. A method as claimed in claim 17 wherein the fusion protein is expressed in S.cerevisiae or P.pastoralis.

22. A method as claimed in claim 17 wherein the fusion protein is expressed in Chinese hamster ovary cells or baby hamster kidney cells.

23 . A method as claimed in claim 17 wherein the fusion protein is expressed in transgenic potato tissue or transgenic corn tissue.

24 • A method as claimed in claim 17 wherein the fusion protein is expressed in the milk of a transgenic pig, cow, sheep, goat or rabbit.

25 • A method as claimed in claim 17 wherein the fusion protein is expressed in insect cells, e.g. in the S. frugiperda cells.

26 ■ A method as claimed in any one of claims 1 to 25 wherein the sequence

19

INTELLECTUAL PROPERTY OFFICE OF N.Z.

3 1 HAY 2001 RECEIVED

37. A DNA construct as defined in claim 29 substantially as herein described with reference to any example thereof and with or without reference to the accompanying Figures.

38. A host cell as defined in claim 31 substantially as herein described with reference to any example thereof and with or without reference to the accompanying Figures.

39. A transgenic, non-human, mammal as defined in claim 33 substantially as herein described with reference to any example thereof and with or without reference to the accompanying Figures.

</div>