NZ300387A - Adenoviral vector modified to reduce host immune and inflammatory responses and its use in gene therapy treatment - Google Patents

Adenoviral vector modified to reduce host immune and inflammatory responses and its use in gene therapy treatment

Info

Publication number
NZ300387A
NZ300387A NZ300387A NZ30038795A NZ300387A NZ 300387 A NZ300387 A NZ 300387A NZ 300387 A NZ300387 A NZ 300387A NZ 30038795 A NZ30038795 A NZ 30038795A NZ 300387 A NZ300387 A NZ 300387A
Authority
NZ
New Zealand
Prior art keywords
adenoviral
cell
vector
promoter
dna sequence
Prior art date
Application number
NZ300387A
Inventor
Michael Kadan
Mario Goziglia
Bruce Trapnell
Original Assignee
Genetic Therapy Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetic Therapy Inc filed Critical Genetic Therapy Inc
Publication of NZ300387A publication Critical patent/NZ300387A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/70—Vectors containing special elements for cloning, e.g. topoisomerase, adaptor sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/60—Vector systems having a special element relevant for transcription from viruses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biotechnology (AREA)
  • Obesity (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

An adenoviral vector comprises a modified adenoviral genome including an adenoviral 5'ITR, an adenoviral 3'ITR, an adenoviral encapsidation signal, DNA sequence encoding a heterologous protein or polypeptide and a promoter controlling the expression of the DNA sequence encoding heterologous protein or polypeptide. At least a portion of each E1 and E4 DNA sequence has been deleted to eliminate the function of each of the E1 and E4 early protein and at least a portion of at least one of the E2a and E2b DNA sequences has been deleted to eliminate the function of at least one of the E2a and E2b early protein and the vector retains at least a portion of the adenoviral protein.

Description

* IMPROVED ADENOVIRAL VECTORS AMD PRODUCER CELLS This invention relates to adenoviral vectors wherein the adenoviral genome has been modified to reduce the host immune and inflammatory responses to the vector. More particularly, this invention relates to adenoviral vectors which are free of all or a part of the adenoviral El and E4 DNA sequences, or are free of all or a part of the adenoviral El and E2 DNA sequences or are free of all or a portion of each of the El, E2, and E4 regions and further may or may not contain some of the E3 region genes operationally linked to a functional promoter, and to producer cells for generating adenoviral particles from such vectors.
Adenovirus genomes are linear, double-stranded DNA molecules about 36 kilobase pairs long. Each extremity of the viral genome has a short seguence known as the inverted terminal repeat (or ITR), which is necessary for viral replication. The well-characterized molecular genetics of adenovirus render it an advantageous vector for gene transfer. The knowledge of the genetic organization of adenoviruses allows substitution of large fragments of viral DNA with foreign sequences. In addition, recombinant adenoviruses are structurally stable and no rearranged viruses are observed after extensive amplification.
BACKGROOND OP THE INVENTION PCT/VS9S/1S947 Adenoviruses thus may be employed as delivery vehicles for introducing desired genes into eukaryotic cells, whereby the adenovirus delivers such genes to eukaryotic cells by binding cellular receptors, internalizing via coated pits, disrupting endosomes, and releasing particles to the cytoplasm followed by nuclear translocation and molecular expression of the adenovirus genetic program.
In general, an adenovirus genome includes the El region, the E2 region, the E3 region, the E4 region, and the major late region as well as several other minor regions. The El region provides functions associated with transformation, transcription upregulation, and control of replication. The E2 region is essential for DNA replication, and other viral functions including transcriptional regulation. The E3 region provides for the adenovirus' defense against the host's immune system. The E3 region encodes proteins which inhibit the host cell's ability to present viral proteins as foreign antigens. The E4 region is essential for several important viral functions, including control of late gene expression, shutting down host cell function by the virus, and virus replication. The major late region encodes the major adenoviral structural proteins.
Adenoviral vectors have been constructed in which at least a majority of the El and E3 sequences have been deleted. The El deletion renders the vector replication defective, the E3 region deletion provides space for insertion of the desired gene into the adenoviral vector without exceeding the maximum acceptable size for a packageable genome. Applicants have found that when such vectors have been placed into target cells or organs in vivo, however, a sharp decrease in expression of the desired gene results at about 1 to 3 weeks post-infection. In addition, it was found that an inflammatory response may develop in a target organ, and that the adenovirus vector may induce a cytotoxic T-lymphocyte (CTL) response directed against the W V y " ' J WO 96/18418 PCT/US95/15947 vector-transduced host cells. This CTL response has the effect of eliminating the host vector transduced cells from the host. Also, the host may develop a neutralizing antibody response to such adenoviral vectors.
It is therefore an object of the present invention to provide an adenoviral vector which minimizes host response to the vector and increases the duration of vector persistence and expression, and to provide producer cell lines which will generate adenoviral particles from such vectors, or at least provides the public with a useful choice BRIEF DESCRIPTION OF THE DRAWINGS The invention now will be described with respect to the drawings, wherein: Figure 1 is a schematic of the construction of plasmid pSE280-El; Figure 2 is a map of plasmid pMAMneo-Luc; Figure 3 is a schematic of the construction of plasmid pMAMneo-El; Figure 4 is a schematic of the construction of plasmid pGRE5-El from pSE280-El and pGRE5-2/EBV; Figure 5 is a map of plasmid pGRE5-El; Figure 6 a schematic of the construction of plasmid pMAMneo-E2A; Figure 7 is a map of plasmid pSE380; Figure 8 is a schematic of the construction of plasmids PSE380-B4 and pSE380-ITR/E4; Figure 9 is a schematic of the construction of plasmid pSE380GRE5/E4; Figure 10 is a map of plasmid pTZ18R; Figure 11 is a schematic of the construction of plasmids pTZE2A and pTZdlE2A; Figure 12 is a schematic of the construction of plasmid pSE380-E3+; Figure 13 is a schematic of the construction of plasmids pSE3 8 0-E3 +E4 + and pTZE3+E4+; Figure 14 is a schematic of the construction of plasmids pTZE3"E4+, pSE280E3'E4 +, and pSPORT-1 E3~E4+; Figure 15 is a map of plasmid pSPORT-1; Figure 16 is a schematic of the construction of plasmid pSPORT - 1E2A"E3'E4 + ; Figure 17 is a map of plasmid pBR322; Figure 18 is a schematic of the construction of plasmids pBR322 -E2A"E3"E4 + and pBRAd5-E2A"E3"E4 + ; Figure 19 is a schematic of the construction of plasmids pSE380-E4" and pSE380E3+E4"; Figure 20 is a schematic of the construction of plasmid pSE380E3+E4" (2) ; Figure 21 is a schematic of the construction of plasmid pSE380E3"E4~ (2) ; Figure 22 is a schematic of the construction of plasmid pSPORTl/E2A'E3"E4" (2) ; Figure 23 is a schematic of the production of an adenoviral vector having the genotype El+, E2A", E3', E4 + ; Figure 24 is a map of pAvS6; Figure 25 is a schematic of the construction of an adenoviral vector having the genotype El", E2A", E3", E4+ by homologous recombination; Figure 26 is a schematic of the production of an adenoviral vector having the genotype El", E2A", E3", E4+ by in vitro ligation and transfection; Figure 27 is a schematic of the production of an adenoviral vector having the genotype El", E2A", E3", E4+ by homologous recombination; Figure 28 is a schematic of the vector Av3nLacZ; Figure 29 is a schematic of the production of am adenoviral vector having the genotype El+, E4"; Figure 30 is a schematic of the production of an adenoviral vector having the genotype El", E2+, E3+, E4" by homologous recombination; S7 f Y I ' 1 „ 'p WO 96/18418 PCT/US95/15947 Figure 31 is a schematic of the production of an adenoviral vector having the genotype El', E2+, E3+, E4" by in vitro ligation and transfection; Figure 32 is a schematic of the generation of Av4nLacZ by homologous recombination; Figure 33 is a schematic of the generation of Av4nLacZ by in vitro ligation; Figure 34 is a schematic of the generation of an Av4 (fourth generation adenovirus) type vector containing a transgene; Figure 35 is a schematic of the construction of plasmid pAvS 6 - CFTR ,* Figure 36 is an immunoprecipitation blot for adenoviral hexon expression in A549 cells infected with an Avl type vector (having a deletion of all or part of the El region), an Av2 vector (having a deletion of all or part of the El region and a temperature-sensitive mutation in the E2a gene) , or an Av3 vector or Ad dl327; Figure 37 is an immunoprecipitation blot for adenoviral hexon expression in El+E2+ cells or El+ cells infected with an Avl vector, an Av2 vector, or an Av3 vector; and Figure 38 is a blot showing adenovirus vector DNA replication in El+E2+ or El+ cells infected with an Avl vector, an Av2 vector, or em Av3 vector.
SUMMARY OF THE INVENTION The present invention provides for an improved adenoviral vector wherein the adenoviral genome has been modified to reduce the host immune and inflammatory response to the vector. Such vector has a reduced viral DNA replication potential and reduced expression of adenoviral genes (e.g., hexon) in comparison to existing adenoviral vectors. Such modification(s) to the adenoviral genome may be effected through deletion(s) and/or mutation(s) of portion(s) of the adenoviral genome.
Specifically, m a first aspect the present invention provides an adenoviral vector, comprising a modified adenovirus genome including an adenoviral 5'ITR, an adenoviral 3'ITR, an adenoviral encapsidation signal, DNA encoding a heterologous '-V r^\ . ->J IV h - 5a- protein or polypeptide, and a promoter controlling the expression of said DNA encoding a heterologous protein or polypeptide, wherein at least a portion of each of the El and E4 DNA sequence has been deleted to eliminate the function of each of the El and E4 early proteins, at least a portion of at least one of the E2a and E2b DNA sequences has been deleted to eliminate the function of at least one of the E2a and E2b early proteins, and said vector retains at least a portion of the adenoviral protein function In a second aspect the present invention provides a stable cell for complementing adenoviral early protein functions for use in the production of adenoviral vectors, comprising a stable cell, including a first DNA sequence encoding the adenoviral El function, said first DNA sequence being under the control of a first inducible promoter; a second DNA sequence encoding the adenoviral E2 function, said second DNA sequence being under the control of a second inducible promoter, and a third DNA sequence encoding the adenoviral E4 function, said third DNA sequence being under the control of a third inducible promoter, said first, second, and third inducible promoters being the same or different In a further aspect the present invention provides a method of expressing a protein or polypeptide in a host, comprising administering to said host the adenoviral vector as described above in the first aspect of the invention.
In a further aspect the present invention provides a method of expressing a protein or polypeptide in a eukaryotic cell, comprising : transducing a eukaryotic cell with the adenoviral vector as described above in the first pasect of the invention In a further aspect the present invention provides a eukaiyotic cell transfected with the adenoviral vector as described above in the first aspect o the invention In a still further aspect the present invention provides the adenoviral vector of the first aspect of the invention for use as a medicament.
In a still further aspect the present invention provides the use of the adenoviral vector of the first aspect of the invention for the preparation of a medicament for the treatment of a disease in a mammal including a human In yet another aspect the present invention provides a method of generating adenoviral particles, comprising. transfecting the stable cell of the second aspect of the invention as described above with the adenoviral vector of the first aspect of the invention as described above In yet another aspect the present invention provides an adenoviral vector particle obtainable by the method described in the paragraph immediatelvra&oye~^^„-_ I ~ 0FW7 Rrr®E| In still yet another aspect the present invention provides a method of effecting gene therapy treatment, comprising I 2 8 SEP |ggg | : -r^.CEM/FD I T7/^ ^ j, V [' ^ ^ >j administering to a host the adenoviral vector particle described immediately above in an amount effect to produce a therapeutic effect in a host.
DETAILED DESCRIPTION OF THE INVENTION The adenoviral vectors described herein include several general types or generations, each of which are described below. These vectors include an adenovirus DNA genome containing an adenovirus 5'ITR, an adenovirus 3'ITR; an adenovirus encapsulation signal; at least one DNA sequence encoding a protein or polypeptide of interest; and a promoter controlling the at least one DNA sequence encoding a protein or polypeptide of interest. One generation of adenoviral vectors (Av3 vectors) contain a deletion of all or part of the El region and also a deletion of all or a part of the E2 region (preferably all or part of the E2a region). A second generation of adenoviral vectors (Av4 vectors) contain a deletion of all or part of the El region and a deletion of all or a part of the E2 region (preferably all or part of the E2a region) , and a deletion of all or a part of the E4 region. A third generation of adenoviral vectors (Av5 vectors) contain a deletion of all or a part of the El region, and a deletion of all or part of the E4 region. Each of these vectors may or may not contain some part of the E3 region operationally linked to a promoter which controls its expression.
In these vectors, the DNA sequence encoding a protein or polypeptide of interest, which is linked operationally to a promoter controlling its expression is sometimes hereinafter referred to as a transgene. Cell T.ines containing adenovirus structural genes under the control of an inducible promoter (i) axe referred to as lEl (El genes) ; iE2a (E2a genes) ,• iEl/E2 (El and E2 genes); (i)El/E4 (El and E4 genes); or iEl/E2a/E4 (El, E2, and E4 genes).
In one embodiment, there is provided an adenoviral vector which includes an adenoviral 5' ITR; an adenoviral 3' ITR; an adenoviral encapsidation signal; at least one DNA sequence encoding a protein or polypeptide of interest; and a promoter controlling the DNA sequence(s) encoding a protein (s) or polypeptide (s) of i " " iral PCT/U S95/15947 vector is free of all or a portion of the adenoviral El (preferably at least all or a portion of Ela) and E4 DNA sequences. In a preferred embodiment, the adenoviral vector also is free of all or a portion of adenoviral Elb DNA sequence. Such a vector is sometimes referred to as an adenoviral E1"E4' vector.
The term "portion" as used herein means that a portion of the DNA sequence of a region (e.g., El, E2, E3, and/or E4) of the adenoviral genome is removed such that the function of such region is eliminated or impaired. For example, a portion of the DNA sequence of a region of the adenoviral genome is removed such that one or more proteins normally encoded by such region are not expressed, or are expressed as a structure which eliminates or impairs the function of such proteins.
The determination of the amount of the DNA sequence of a region which is to be removed is determined by routine experimentation by one skilled in the art given the teachings herein. Preferably, all or substantially all of a coding region is removed.
In one preferred embodiment, at least open reading frame 6 (ORF 6) of the E4 DNA sequence is deleted. In another embodiment, at least open reading frames 3 and 6 of the E4 DNA sequence are deleted.
In another embodiment, there is provided an adenoviral vector which includes an adenoviral 5' ITR; an adenoviral 3' ITR: an adenoviral encapsidation signal; at least one DNA sequence encoding a protein or polypeptide of interest; and a promoter controlling the DNA sequence(s) encoding a protein(s) or polypeptide(s) of interest. The adenoviral vector is free of all or a portion of the adenoviral El and all or a portion of E2 (preferably at least all or a portion of E2a) DNA sequences. In a preferred embodiment, the adenoviral vector also is free of all or a portion of the adenoviral Elb DNA sequence. Such vector is sometimes referred to as an adenoviral E1*E2" vector.
In another embodiment, all or a portion of the E2b DNA sequence is deleted. In yet another embodiment, all or a portion of the E2a and E2b DNA sequences are deleted.
In another preferred embodiment, there is provided an adenoviral vector which includes an adenoviral 5' ITR; an adenoviral 3' ITR; an adenoviral encapsidation signal; at least one DNA sequence encoding a protein or polypeptide of interest; and a promoter controlling the DNA sequence(s) encoding the protein(s) or polypeptide(s) of interest. The adenoviral vector is free of all or a portion of the adenoviral El (including Ela and Elb), E2, and E4 DNA sequences. Such vector is sometimes referred to as an adenoviral El"E2"E4" vector. Preferably, such vector is free of at least open reading frame 6 of the E4 DNA sequence.
In one preferred embodiment the vector is free of all or a portion of the E2a DNA sequence. Such vector is sometimes referred to as an adenoviral El"E2a'E4" vector. In another embodiment, the vector is free of all or a portion of the E2b DNA sequence.
In one embodiment, the adenoviral vectors hereinabove described also include at least a portion of the adenoviral E3 DNA sequence, operationally linked to a promoter which allows expression of E3 region genes in the transduced host cells, and which enables the adenovirus to retain some or all of its immune defense system. The amount of the E3 DNA sequence included in the adenoviral vector is, in general, an amount of the E3 DNA sequence which will enable the adenoviral vector to evade or disable the host's immune response. Preferably, all of the genes of the E3 region are included in the vector, except the gene encoding the 11.6 Kda protein that causes cell lysis.
In another embodiment, the above-mentioned adenoviral vectors do not contain the E3 region genes.
The vectors of the present invention in a preferred embodiment are adenoviral particles wherein the genetic material contained in the virus lacks the genetic material which is specified as having been deleted.
Thus, in accordance with a preferred embodiment of the invention, the genome of the adenoviral vector contains the early regions (El, E2, E3 and E4) and the major late regions to the extent necessary not to impair the function of the proteins encoded thereby, except for all or a portion of the regions which are specified as having been deleted from the genetic material of the adenovirus. Thus, if an adenoviral vector is defined as being free of all or a portion of El and E2, then such vector would contain the E3 and E4 regions to the extent necessary not to disrupt or substantially impair the function of the protein encoded thereby. All other regions, including the major late regions and minor transcriptional units, would also be present to the extent necessary not to disrupt or substantially impair the function of the proteins encoded thereby.
The adenoviral vector may be derived from any known adenovirus serotype, including, but not limited to, Adenovirus 2, Adenovirus 3, and Adenovirus 5.
The adenoviral vector, in general, also includes DNA encoding at least one therapeutic agent. The term "therapeutic" is used in a generic sense and includes treating agents, prophylactic agents, and replacement agents.
DNA sequences encoding therapeutic agents which may be placed into the adenoviral vector include, but are not limited to, the CFTR gene; genes encoding interferons such as Interferon-a, Interferon-S, and Interferon-7 ; genes encoding interleukins such as IL-1, IL-16, and Interleukins 2 through 14; genes encoding GM-CSF; genes encoding adenosine deaminase, or ADA; genes which encode cellular growth factors, such as lymphokines, which are growth factors for lymphocytes; genes encoding clotting factors such as Factor VIII and Factor IX; T-cell receptors,* the LDL receptor, ApoE, ApoC,ApoAI and other genes involved in cholesterol transport and metabolism; the alpha-1 antitrypsin (alAT) gene; lung surfactant protein genes, such as the SP-A, SP-B, and SP-C genes; the insulin gene, negative selective markers or "suicide" genes, such as viral thymidine kinase genes, such as the Herpes Simplex Virus thymidine kinase gene, the cytomegalovirus virus thymidine kinase gene, and the varicella-zoster virus thymidine kinase gene; Fc receptors for antigen-binding domains of antibodies, and antisense sequences which inhibit viral replication, such as antisense sequences which inhibit replication of hepatitis B or hepatitis non-A non-B virus.
The DNA sequence (or transgene) which encodes the therapeutic agent may be genomic DNA or may be a cDNA sequence. The DNA sequence also may be the native DNA sequence or an allelic variant thereof. The term "allelic variant" as used herein means that the allelic variant is an alternative form of the native DNA sequence which may have a substitution, deletion, or addition of one or more nucleotides, which does not alter substantially the function of the encoded protein or polypeptide or fragment or derivative thereof. In one embodiment, the DNA sequence may further include a leader sequence or portion thereof, a secretory signal or portion thereof and/or may further include a trailer sequence or portion thereof.
The DNA sequence encoding at least one therapeutic agent is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the Rous Sarcoma Virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; and the ApoAI promoter. It is to be understood, however, that the scope of the present invention is not to be limited to specific foreign genes or promoters.
Such vectors may be assembled by direct in vitro ligation from combinations of plasmids containing portions of modified or unmodified virus genome or plasmids and fragments derived directly from a linear adenoviral genome, such as the Adenovirus 5 genome (ATCC No. VR-5) or Adenovirus 5 derived viruses containing mutations or deletions as described herein.
In another alternative, the vectors can be assembled by homologous recombination, within a eukaryotic cell, between a plasmid clone containing a portion of the adenoviral genome (such as the Adenovirus 5 genome or the adenovirus 5 E3-mutant Ad dl327 (Thimmapaya, et al., Cell, Vol. 31, pg. 543 (1983)) with the desired modifications, and a second plasmid (such as, for example pAvS6, as shown in Figure 24) , containing the left adenoviral ITR, an El region deletion, and the desired trans gene. Alternatively, homologous recombination may be carried out between a plasmid clone and a fragment derived directly from a linear adenovirus (such as Adenovirus 5, or Ad dl327 or an Adenovirus 5 derived virus containing mutations or deletions as described herein) genome.
The vector then is transfected into a cell line capable of complementing the function of any essential genes deleted from the viral vector, in order to generate infectious viral particles. The cell line in general is a cell line which is infectable and able to support adenovirus or adenoviral vector growth, provide for continued virus production in the presence of glucocorticoid hormones, and is responsive to glucocorticoid hormones (i.e., the cell line is capable of expressing a glucocorticoid hormone receptor). Cell lines which may be transfected with the essential adenoviral genes, PCT/VS9S/1S947 and thus may be employed for generating the infectious adenoviral particles include, but are not limited to, the A549, KB, and HEp-2 cell lines.
Because the expression of some viral genes may be toxic to cells, the El region, as well as the E2a, E2b, and/or E4 regions, may be under the control of an inducible promoter. Such inducible may include, but are not limited to, the mouse mammary tumor virus (MMTV) promoter (Archer, et al., Science. Vol. 255, pgs. 1573-1576 (March 20, 1992)); the synthetic minimal glucocorticoid response element promoter GRE5 (Mader, et al., Proc. Nat. Acad. Sci.. Vol. 90, pgs. 5603-5607 (June 1993)); or the tetracycline-responsive promoters (Gossen, et al., Proc. Nat. Acad. Sci.. Vol. 89, pgs. 5547-5551 (June 1992)). In another alternative, the El region is under the control of an inducible promoter, and the E2a, E2b, and/or E4 regions are under the control of their native promoters. In such alternative, the native promoters are transactivated by expression of the El region.
In one embodiment, the cell line includes the entire adenoviral E4 region with its native promoter region, and the Ela region or the entire El region (including the Ela and Elb regions) under the control of a regulatable or inducible promoter, such as, for example, the mouse mammary tumor virus (or MMTV) promoter, which is a hormone inducible promoter, or other such promoters containing glucocorticoid responsive elements (GRE's) for transcriptional control. In another embodiment, the E4 DNA sequence also is expressed from a regulatable promoter, such as the MMTV promoter. The El and E4 DNA sequences may be included in one expression vehicle, or may be included in separate expression vehicles. Preferably, the expression vehicles are plasmid vectors which integrate with the genome of the cell line.
In one embodiment, the producer cell line includes a first plasmid which includes the Ela or the entire El DNA sequence tmder the control of an inducible promoter (such as the MMTV promoter) , and a second plasmid including the E4 DNA sequence under the control of its native promoter. In such an embodiment, the producer cell line is transduced with the adenoviral vector which does not include the El and E4 DNA sequences. The cells then are exposed to an inducing agent, (such as, for example, dexamethasone when an MMTV promoter is employed), which activates the inducible promoter, such as the MMTV promoter, thereby initiating expression of the El DNA. The expression of the El DNA provides for transactivation of the E4 promoter, thereby providing for expression of the E4 DNA. The expression of the El and E4 DNA thus enables the generation of infectious adenoviral particles.
In another embodiment, the producer cell line includes a first plasmid which includes the Ela or the entire El DNA sequence under the control of an inducible promoter (such as the MMTV promoter or a promoter containing a glucocorticoid responsive element), and a second plasmid including the E4 DNA sequence under the control of an inducible promoter (such as the MMTV promoter or a promoter containing a glucocorticoid responsive element). The producer cell line then is transduced with the adenoviral plasmid vector which does not include the El and E4 DNA sequences. The cells then are exposed to the inducing agent (such as, for example, dexamethasone), which activates the promoters (such as the MMTV promoters or promoters containing a glucocorticoid responsive element) controlling the El and E4 DNA sequences, thereby initiating expression of the El and E4 DNA sequences, whereby the expression of such sequences enables the generation of the infectious adenoviral particles. It is to be under stood, however, that the inducible or regulatable promoters controlling the El and E4 DNA sequences need not be identical.
In another embodiment, an adenoviral vector wherein the Ela or entire El DNA sequence, and the E2a DNA sequence, or E2a and E2b DNA sequences, have been deleted, is transfected into a cell line capable of complementing the function of the Ela or entire El, and E2a or E2a and E2b DNA sequences, as well as any other essential genes deleted from the viral vector, in order to generate infectious viral particles. In one embodiment, the cell line includes the Ela or entire El region under the control of a promoter which may be its native promoter or a regulatable promoter, such as, for example, the mouse mammary tumor virus (or MMTV) promoter, or other such promoters containing glucocorticoid responsive elements (GRE's) for transcriptional control. The cell line also includes the adenoviral E2a region or E2a and E2b regions under the control of its native promoter region, or a regulatable promoter such as those hereinabove described. The Ela or entire El, and E2a or E2a and E2b DNA sequences, may be included in one expression vehicle, or may be included in separate expression vehicles.
In one embodiment, the producer cell line includes a first plasmid including the El DNA sequence under the control of a promoter containing a glucorticoid responsive element, and a second plasmid including the E2a DNA sequence under the control of the MMTV promoter. The producer cell line is transduced with the adenoviral plasmid vector which does not include the El and E2a DNA sequences. The cells then are exposed to a glucocorticoid hormone such as dexamethasone for activation of the El promoter and for activation of the MMTV promoter, thereby initiating expression of the El and E2a DNA sequences and enabling the generation of infectious adenoviral particles.
In another embodiment, the producer cell line includes a first plasmid including the El DNA sequence under the control of an inducible promoter (such as the MMTV promoter or other promoters containing a glucocorticoid responsive element) , and a second plasmid including the E2a DNA sequence under the control of its native promoter. Expression of the PCT/U S95/15947 El and E2a DNA sequences is accomplished by the same approach as carried out with respect to the producer cell line including the El DNA sequence under the control of an inducible promoter, and the E4 DNA sequence under the control of its native promoter.
In yet another embodiment, the producer cell line includes a first plasmid including the El DNA sequence under the control of the MMTV promoter, and a second plasmid including the E2a DNA sequence under the control of the MMTV promoter. Expression of the El and E2a DNA sequences, leading to the generation of infectious adenoviral particles, is accomplished by exposing the cells to dexamethasone, thereby activating the MMTV promoters controlling the El and E2a DNA sequences.
In yet another embodiment, an adenoviral vector, wherein the El, E2a, and E4 DNA sequences have been deleted, is transfected into a cell line which includes the adenoviral El, E2a, and E4 regions. If the vector also includes a deletion of the E2b DNA sequence, the cell line also will include the E2b region. Each of the El, E2a, and E4 regions may be under the control of their native promoters, or any or all of the El, E2a, and E4 regions may be under the control of an inducible or regulatory promoter, such as those hereinabove described. The El, E2a, and E4 DNA sequences may be included in one expression vehicle, or the El, E2a, and E4 DNA sequences may each be included in separate expression vehicles, or two of the El, E2a, and E4 DNA sequences may be included in one expression vehicle, and the other of the El, E2a, and E4 DNA sequences may be included in another expression vehicle. Expression of the El, E2a and E4 DNA sequences may be accomplished by employing approaches similar to those hereinabove described.
Uses of the adenoviral vector particles of the present invention include the transduction of eukaryotic cells in vivo or in vitro as part of a gene therapy procedure, and the transduction of cells in vitro for the in vitro production of desired proteins or therapeutic agents.
In one embodiment, the adenoviral vector particles are administered in vivo in an amount effective to provide a therapeutic effect in a host.
In one embodiment, the vector may be administered in an amount of from 1 plaque forming unit to about 1014 plaque forming units, preferably from about 106 plaque forming units to about 1013 plaque forming units. The host may be a mammalian host, including human or non-human primate hosts.
The infectious adenoviral vector particles are administered to the lung when a disease or disorder of the lung (such as, for example, cystic fibrosis) is to be treated. Such administration may be, for example, by aerosolized inhalation or brochoscopic instillation, or via intranasal or intratracheal instillation.
In another embodiment, the infectious adenoviral vector particles are administered systemically, such as, for example, by intravenous administration (such as, for example, portal vein injection or peripheral vein injection), intramuscular administration, intraperitoneal administration, intratracheal administration, or intranasal administration.
The adenoviral vector particles may be administered in combination with a pharmaceutically acceptable carrier suitable for administration to a patient. The carrier may be a liquid carrier (for example, a saline solution), or a solid carrier, such as, for example, microcarrier beads.
Cells which may be infected by the infectious adenoviral particles include, but are not limited to, primary cells, such as primary nucleated blood cells, such as leukocytes, granulocytes, monocytes, macrophages, lymphocytes (including T-lymphocytes and B-lymphocytes) , totipotent stem cells, and tumor infiltrating lymphocytes (TIL cells); bone marrow cells; endothelial cells; activated endothelial cells; epithelial cells; lung cells; keratinocytes; stem cells; hepatocytes, including hepatocyte precursor cells; fibroblasts; mesenchymal cells; mesothelial cells; parenchymal cells; vascular smooth muscle cells; brain cells and other neural cells; gut enterocytes; gut stem cells; and myoblasts.
The infected cells are useful in the treatment of a variety of diseases including but not limited to adenosine deaminase deficiency, sickle cell anemia, thalassemia, hemophilia, diabetes, a-antitrypsin deficiency, brain disorders such as Alzheimer's disease, phenylketonuria and other illnesses such as growth disorders and heart diseases, for example, those caused by alterations in the way cholesterol is metabolized and defects of the immune system.
In one embodiment, the adenoviral vector particles may be used to infect lung cells, and such adenoviral vector particles may include the CFTR gene, which is useful in the treatment of cystic fibrosis. In another embodiment, the adenoviral vector may include a gene(s) encoding a lung surfactant protein, such as SP-A, SP-B, or SP-C, whereby the adenoviral vector is employed to treat lung surfactant protein deficiency states.
In another embodiment, the adenoviral vector particles may be used to infect liver cells, and such adenoviral vector particles may include gene(s) encoding clotting factor(s), such as Factor VIII and Factor IX, which are useful in the treatment of hemophilia.
In another embodiment, the adenoviral vector particles may be used to infect liver cells, and such adenoviral vector particles may include gene(s) encoding polypeptides or proteins which are useful in prevention and therapy of an acquired or an inherited defect in hepatocyte (liver) function. For example, they can be used to correct an inherited deficiency of the low density lipoprotein (LDL) receptor.
In another embodiment, the adenoviral particles may be used to infect liver cells, whereby the adenoviral particles include a gene encoding a therapeutic agent employed to treat acquired infectious diseases, such as diseases resulting from viral infection. For example, the infectious adenoviral particles may be employed to treat viral hepatitis, particularly hepatitis B or non-A non-B hepatitis. For example, an infectious adenoviral particle containing a gene encoding an anti-sense gene could be employed to infect liver cells to inhibit viral replication. In this case, the infectious adenoviral particle, which includes a vector including a structural hepatitis gene in the reverse or opposite orientation, would be introduced into liver cells, resulting in production in the infected liver cells of an anti-sense gene capable of inactivating the hepatitis virus or its RNA transcripts. Alternatively, the liver cells may be infected with an infectious adenoviral particle which includes a gene which encodes a protein, such as, for example, a-interferon, which may confer resistance to the hepatitis virus.
In yet another embodiment, an adenoviral vector in accordance with the present invention may include a negative selective marker, or "suicide" gene, such as the Herpes Simplex Virus thymidine kinase (TK) gene. Such a vector may be employed in the treatment of tumors, including cancerous and non-malignant tumors, by administering the adenoviral vector to a patient, such as, for example, by direct injection of the adenoviral vector into the tumor, whereby the adenoviral vector transduces the tumor cells. After the cells are transduced with the adenoviral vector, an interaction agent, such as, for example, ganciclovir, is administered to the patient, whereby the transduced tumor cells are killed.
In another embodiment, the viral particles, which include at least one DNA sequence encoding a therapeutic agent, may be administered to an animal in order to use such animal as a model for studying a disease or disorder and the treatment thereof. For example, an adenoviral vector containing a DNA sequence encoding a therapeutic agent may be given to an animal which is deficient in such therapeutic agent. Subsequent to the administration of such vector containing the DNA sequence encoding the therapeutic agent, the animal is evaluated for expression of such therapeutic agent. From the results of such a study, one then may determine how such adenoviral vectors may be administered to human patients for the treatment of the disease or disorder associated with the deficiency of the therapeutic agent.
In another embodiment, the adenoviral vector particles may be employed to infect eukaryotic cells in vitro. The eukaryotic cells may be those as hereinabove described. Such eukaryotic cells then may be administered to a host as part of a gene therapy procedure in amounts effective to produce a therapeutic effect in a host.
Alternatively, the vector particles include a gene encoding a desired protein or therapeutic agent may be employed to infect a desired cell line in vitro. whereby the infected cells produce a desired protein or therapeutic agent in vitro.
EXAMPLES The invention now will be described with respect to the following examples; however, the scope of the present invention is not intended to be limited thereby.
Example 1 Development of Cell Lines for Complementation of El"/E2a" or E17E4' Vectors Construction of plasmid having Adenovirus 5 El sequence. The Adenovirus 5 genome was digested with Seal enzyme, separated on an agarose gel, and the 6,095 bp fragment comprising the left end of the virus genome was isolated. The complete Adenovirus 5 genome is registered as Genbank accession #M73260, incorporated herein by reference, and the virus is available from the American Type Culture Collection, Rockville, Maryland, U.S.A., under accession number VR-5. The Seal 6,095 bp fragment was digested further with Clal at bp 917 and Bglll at bp 3,328. The resulting 2,411 bp Clal to Bglll fragment was purified from an agarose gel and ligated into the superlinker shuttle plasmid pSE280 (Invitrogen, San Diego, CA), which was digested with Clal and Bglll, to form pSE280-E. (Figure 1}.
Polymerase chain reaction (PCR) was performed to synthesize DNA encoding an Xhol and Sail restriction site contiguous with Adenovirus 5 DNA bp 552 through 924. The primers which were employed were as follows: ' end, Ad5 bp 552-585: ' - GTCACTCGAGGACTCGGTC - GACTGAAAATGAGACATATTATCTGCCACGGACC - 3 ' 3' end, Ad5 bp 922-891: ' - CGAGATCGATCACCTCCGGTACAAGGTTTGGCATAG- 3 ' This amplified DNA fragment (sometimes hereinafter referred to as Fragment A) then was digested with Xhol and Clal, which cleaves at the native Clal site (bp 917) , and ligated to the Xhol and Clal sites of pSE280-E, thus reconstituting the 5' end of the El region beginning 8 bp upstream of the ATG codon.
PCR then was performed to amplify Adenovirus 5 DNA from bp 3,323 through 4,090 contiguous with an EcoRI restriction site. The primers which were employed were as follows: 5' end, Ad5 bp 3323-3360: ' - CATGAAGATCTGGAAGGTGCTGAGGTACGATGAGACC - 3 ' 3' end, Ad5 bp 4090-4060: ' - GCGACTTAAGCAGTCAGCTG -AGACAGCAAGACACTTGCTTGATCCAAATCC - 3 ' This amplified DNA fragment (sometimes hereinafter referred to as Fragment B) was digested with Bglll, thereby cutting at the Adenovirus 5 Bglll site (bp 3,382) and EcoRI, and ligated to the Bglll and EcoRI sites of pSE280-AE to reconstruct the complete Ela and Elb region from Adenovirus 5 bp 552 through 4,090. The resulting plasmid is referred to as pSE280-El (Figure 1).
The intact Ela/Elb region was excised from pSE280-El by cutting with EcoRI, blunting with Klenow and cutting with Sail. The 3,567 bp fragment was purified from an agarose gel and ligated to the expression plasmid pMAMneo (Clonetech, Palo Alto, CA) , which was prepared similarly by cutting with Xhol at bp 3,405 of pMAMneo Luc (Figure 2), blunting with Klenow, and cutting with Sail at bp 1,465. The 8,399 bp fragment was gel purified, phosphatased, and ligated to the Ela/Elb fragment hereinabove described to form pMAMneo-El. (Figure 3.) Bacterial transformants containing the final pMAMneo-El construct were identified. Plasmid DNA was prepared and purified by banding in CsTFA. Circular plasmid DNA was linearized at the Xmnl site within the ampicillin resistance gene of pMAMneo-El, and purified further by phenol/chloroform extraction and ethanol precipitation prior to use for transfection of cells.
An alternative construction containing the intact Ela/b region under the control of the synthetic promoter GRE5 was prepared as follows. The intact Ela/b region was excised from pSE280-El, which was modified previously to contain a BamHI site 3' to the El gene, by digesting with Xhol and BamHI. The Xhol to BamHI fragment containing the Ela/b fragment was cloned into the unique Xhol and BamHI sites of PCT/U S95/15947 pGRE5-2/EBV (Figure 4, U.S. Biochemicals, Cleveland, Ohio) to form pGRE5-El (Figure 5).
Construction of plasmid including Adenovirus 5 B2a sequence.
The Adenovirus 5 genome was digested with BamHI and Spel, which cut at bp 21,562 and 27,080, respectively. Fragments were separated on an agarose gel and the 5,518 bp BamHI to Spel fragment was isolated. The 5,518 bp BamHI to Spel fragment was digested further with Smal, which cuts at bp 23,912. The resulting 2,350 bp BamHI to Smal fragment was purified from an agarose gel, and ligated into the superlinker shuttle plasmid pSE280, and digested with BamHI and Smal to form pSE280-E2 BamHI-Smal (Figure 6).
PCR then was performed to amplify Adenovirus 5 DNA from the Smal site at bp 23,912 through 24,730 contiguous with Nhel and EcoRI restriction sites. The primers which were employed were as follows: ' end, Ad5 bp 24,732-24,708: 5'-CACGAATTCGTCAGCGCTTCTCGTCGCGTCCAAGACCC-3' 3' end, Ad5 bp 23,912-23,934: 5'-CACCCCGGGGAGGCGGCGGCGACGGGGACGGG-3' This amplified DNA fragment was digested with Smal and EcoRI, and ligated to the Smal and EcoRI sites of pSE280-E2 Bam-Sma to reconstruct the complete E2a region from Ad5 bp 24,730 through 21,562. The resulting construct is pSE280-E2a. (Figure 6.) In order to convert the BamHI site at the 3' end of E2a to a Sail site, the E2a region was excised from pSE280-E2a by cutting with BamHI and Nhel, arid recloned into the unique BamHI and Nhel sites of pSE280. (Figure 6.) Subsequently, the E2a region was excised from this construction with Nhel and Sail in order to clone into the Nhel and Sail sites of the pMAMneo multiple cloning site in a 5' to 3' orientation, respectively. The resulting construct is pMAMneo E2a. (Figure 6).
Bacterial transformants containing the final pMAMneo-E2a were identified. Plasmid DNA was prepared and purified by-banding in CsTFA. Circular plasmid DNA was linearized at the Xmnl site within the ampicillin resistance gene of pMAMneo-E2a, and further purified by the phenol/chloroform extraction and ethanol precipitation prior to use for transfection of cells. Alternatively, the plasmid was linearized with Belli, which cuts in the reading frame of the neoR gene, thereby inactivating it. This form of the plasmid was used where co-transfection with an alternative selectable marker was required.
Construction of plasmid including Adenovirus 5 ITR/E4 region.
The Adenovirus 5 genome was digested with Spel, which cuts at bp 27,082, and the two fragments separated on an agarose gel. The 8,853 bp fragment comprising the right end of Adenovirus 5 was isolated.
The 8,853 bp right end fragment was digested further with StuI at bp 31,956 and Eco47-III at bp 35,503. Fragments were separated on an agarose gel and the 3,547 bp StuI to Eco47-III fragment was isolated. This fragment was ligated to the superlinker shuttle plasmid pSE380 (Invitrogen) (Figure 7) , digested with StuI and Eco47-III to construct PSE380-E4 (Figure 8).
PCR was performed to amplify Adenovirus 5 DNA from bp 35,499 through the right ITR ending at bp 35,935, and contiguous with a BamHI restriction site. The PCR primers which were employed were as follows: ' end, Ad5 bp 35,935-35,908: 5' -GTGGGATCCATCATCAATAATATACCTTA7TTTGGA- 3 ' 3' end, Ad5 bp 35,503-35,536: 5' -ATACAGCGCTTCCACAGCGGCAGCCATAACAGTC- 3 ' This amplified DNA was digested with BamHI and Eco47-III, which cuts at the Adenovirus 5 Eco47-III site bp 35,503, and ligated to the unique BamHI and Eco47-III sites of PSE380-E4 to form pSE380-ITR/E4. (Figure 8.) Construction of a plasmid containing the E4 region under the control of an inducible promoter.
A plasmid expressing all of the adenovirus 5 E4 open reading frames under the control of the glucocorticoid inducible GRE5 promoter, and containing a puromycin resistance gene under the control of the control of the SV40 promoter was constructed as follows.
The construct pSE380-E4 (Figure 8) was cut with Eco47-3 and BamHI and ligated to a synthetic oligonucleotide of 33 bp, which includes the Eco47-3 site at Adenovirus 5 bp 35,503 through the E4 ORF1 ATG at bp 35,522. The resulting construct, pSE380E4-ATG (Figure 9) contains all E4 open reading frames without a promoter. The E4 ORF's were excised from pSE380E4/ATG as an Xhol to BamHI fragment and ligated to the Xhol and Bglll sites within the multiple cloning site of the expression shuttle plasmid pSE380GRE5/SV40PuroR, to generate pGRE5/E4Puro (Figure 9) . The expression shuttle plasmid pSE380GRE5/SV40PuroR was constructed from pSE380 (Figure 7) , the GRE5 promoter excised from pGRE5/EBV (Figure 4), and a puromycin resistance gene.
Transfection and selection of cells.
In general, this process involved the sequential introduction, by calcium phosphate precipitation, or other means of DNA delivery, of two plasmid constructions each with a different viral gene, into a single tissue culture cell. The cells were transfected with a first construct and selected for expression of the associated drug resistance gene to establish stable integrants. Individual cell clones were established and assayed for function of the introduced viral gene. Appropriate candidate clones then were transfected with a second construct including a second viral gene and a second selectable marker. Transfected cells then were selected to establish stable integrants of the second construct, and cell clones were established. Cell clones were assayed for functional expression of both viral genes.
In order to determine the most suitable cell lines for the above-mentioned transfections, sequential transfections and selections were carried out with the following parental cell types: A549 (ATCC Accession No. CCL-185); Hep-2 (ATCC Accession No. CCL-23); or KB (ATCC Accession No. CCL-17).
Appropriate selection conditions were established for both G418 and hygromycin B for all three cell lines by standard kill curve determination.
Transfection of cell lines with plasmids including El and B2a regions. pMAMneo-E2a was digested with Belli to linearize the plasmid within the neoR reading frame and inactivate the gene. The cell lines hereinabove described were co-transf ected with the linear pMAMneo"-E2a and a selectable marker plasmid consisting of a eukaryotic expression cassette containing an SV40 promoter, a hygromycin resistance gene, and a polyadenylation signal cloned into the multiple cloning site of a pTZ18R (Figure 10), at a 10:1 molar ratio. 48 hours after transfection, the cells were placed under hygromycin selection and maintained in selection until drug resistant colonies arose. The clones were isolated and screened for E2a expression by staining for E2a protein with a polyclonal antiserum, and visualizing by immunofluorescence. E2a function was screened by complementation of the temperature-sensitive mutant Ad5tsl25 virus which contains a temperature-sensitive mutation in the E2a gene. (Van Der Vliet, et al., J. Virology. Vol. 15, pgs. 348-354 (1975)). Positive clones were identified and transfected with pMAMneoEl linearized with Xmnl within the ampicillin resistance gene. The cells were selected for G418 resistance. G418-resistant colonies were screened for El expression by staining with a monoclonal antibody for the El protein (Oncogene Sciences, Uniondale, N.Y.). El function was assayed by ability to complement an El-deleted vector such as pAvS6 (Figure 20) described hereinbelow.
In a preferred alternative, pMAMNeo-E2a was linearized with Xmnl with the AmpR gene, introduced into cells by transfection, and cells were selected for stable integration of this plasmid by G418 selection. Clones expressing the E2a gene were identified and used for transfection with the 7 kb EcoRV to Xmnl fragment from pGRE5-El (Figure 5) , which contains the GRE5 promoted Ela/b region plus the hygromycinR gene. Cells were selected for hygromycin resistance and assayed for both Ela/b and E2a expression.
Transfection of cell lines with plasmids including El and E4 regions.
Circular plasmid pSE380-E4 was co-transfected into the cell lines hereinabove described with a hygromycin resistance plasmid as described above at a 10:1 molar ratio, 48 hours after transfection, the cells were placed under hygromycin selection and maintained in selection until drug resistant colonies arose. The clones then were isolated and screened for E4 function. Specifically, clones were tested for their ability to complement the Adenovirus 5 mutant dl 1011 (Bridge, et al. Virology. Vol. 193, pgs. 794-801 (1993)), which contains a deletion of all E4 open reading frames, and to produce infectious virus of the E4" genotype. Positive clones were identified and transfected with pMAMneoEl linearized with Xmnl within the ampicillin resistance gene. The cells then were selected for G418 resistance. G418-resistant colonies then were screened for El function.
Transfection of cells containing the inducible El and inducible E2a plasmids with an inducible E4 expression plasmid.
In the preferred alternative described above for the generation of cells containing pMAM-neo/E2a and pGRE5-El, clones were identified that inducibly express both viral genes. These cell lines are modified further by transfection PCT/U S95/15947 with the pGRE5/E4/SV40Purot plasmid (Figure 9) and selection for puromycin resistant colonies. Cell clones are selected, expanded, and analyzed for inducible E4 function by assaying for dexamethasone-dependent complementation of the E4 deleted virus Ad5dll011. (Bridge, et al., Virology. Vol. 193, pgs. 794-801 (1993)). In another alternative, the E4 gene would be operationally linked to a tetracycline-inducible promoters.
Example 2 Development of Vectors with Deletions of El/B2a or E1/E4 Intermediates for construction of a vector with E2A deletion Subcloning of Adenovirus 5 E2 region.
Adenovirus 5 genomic DNA was cut with BamHI (bp 21,562) and Spel (bp 27,082) restriction enzymes, and the 5,520 bp BamHI to Spel fragment was isolated from an agarose gel. The 5,520 bp BamHI to Spel fragment was ligated to the pTZ18R plasmid (Pharmacia, Piscataway, NJ) (Figure 10) , which was modified previously to contain an Spel site at bp 186, to generate plasmid pTZE2A. (Figure 11.) Deletion of the E2A open reading frame. pTZE2A was cut with BamHI (bp 8,391) and Smal (bp 2,350) restriction enzymes, corresponding to bp 21,562 and 23,912 of Adenovirus 5. The 6,041 bp and 2,350 bp BamHI/Smal fragments were isolated from an agarose gel. The 2,350 bp BamHI/Smal fragment was digested with Dral restriction enzyme (bp 22,442 of Adenovirus 5), and the 880 bp Dral to BamHI fragment was isolated from an agarose gel. The 880 bp Dral/BamHI fragment was ligated to the 6,041 bp BamHI/Smal fragment via a cohesive BamHI to BamHI and blunt ended Smal to Dral ligation, thereby generating plasmid pTZdlE2A. (Figure 11.) Such plasmid includes the Adenovirus 5 E2A region in which 1,470 bp of the E2A region, corresponding from the Dral site (bp 22,442) to the Smal site (bp 23,912) have been deleted.
Subcloning of the Adenovirus 5 E3 region.
The Adenovirus 5 genome was digested with Spel (at bp 27,082). The 8,853 bp fragment comprising the right end of Adenovirus 5 was isolated. The 8,853 bp right end fragment of Adenovirus 5 was digested with StuI (bp 31,956). The 4,874 bp Spel/StuI fragment was isolated. This fragment was ligated to the plasmid pSE380 (Invitrogen) which was digested with StuI and Spel, in order to generate pSE380-E3+. (Figure 12.) Combining the E3 and E4 regions.
The plasmid SE380-E3+ was digested with Spel and StuI, and the 4,874 bp fragment was ligated to the pSE380-ITR/E4 plasmid (Figure 8) , which was digested with Spel and StuI, to generate pSE380-E3+E4+. (Figure 13.) The E3+/E4+ fragment then was excised as an 8,943 bp Spel to BamHI fragment from pSE380-E3+E4+, and recloned into the Spel and BamHI sites of pTZ18R, previously modified to remove the Xbal site, to generate pTZE3+E4+. (Figure 13.) Deletion within the E3 region.
The plasmid pTZE3+E4+ was digested with Xbal, in order to delete 1,878 bp of the E3 region between the Xbal sites at bp 28,592 and 3 0,470 of the Adenovirus 5 genome, to generate pTZE3"E4+. (Figure 14.) The plasmid pTZE3*E4+ was digested with Spel and BamHI and ligated into the Spel and BamHI sites of the pSE280 plasmid to form pSE280-E3"E4+. The pSE280-E3"E4+ plasmid was digested with BamHI, blunted, and recircularized to remove the BamHI site. The E3E4+ containing fragment was removed by restriction digestion with Spel and Sail and ligated to the pSPORT-1 (Figure 15) (Gibco/BRL, Gaithersburg, MD) plasmid digested with Spel and Sail, to generate pSPORTlE3"E4+. (Figure 14.) Combining the E2A region with the EV/B4+ region.
The plasmid pSPORT-lE3"E4 + was digested with Spel and BamHI, and ligated to the BamHI/Spel fragment from plasmid pTZdlE2A, to generate pSP0RT-lE2A"E3"E4+. (Figure 16.) Construction containing an E2A region deletion and a modified E3 region In another alternative, the pSPORTl/E2A-E3+E4+ (Figure 16) may be modified by inserting an Xbal fragment containing a heterologous promotor, such as SV40, operationally linked to all or a part of the E3 region open reading frames into the unique Xbal site to generate pSP0RTl/E2A-E3 + *E4+. 21.
Incorporation of E2A'E3'E4+ regions into a circular. non-infectious Adenovirus 5 plasmid.
Plasmid pSPORT-lE2A"E3"E4+ was digested with BamHI and Sail. The fragment containing the E2A'E3'E4+ sequences was ligated to plasmid pBR322 (Figure 17) (Life Technology, Gaithersburg, MD) digested with BamHI and Sail, to generate pBR322E2A'E3E4+. (Figure 18.) The Adenovirus 5 genome was digested with Clal (bp 917) and BamHI (bp 21,562) , and the 20,645 bp fragment was ligated to the plasmid pBR322E2A~E3~E4+ (which also was digested with Clal and BamHI), to generate pBRAd5E2A"E3"E4+. (Figure 18.) Intermediates for construction of a vector with an E4 deletion.
The plasmid pSE380-ITR/E4 was digested with BpU1102 (bp 33,129) and Eco47-3 (bp 35,503) to remove all E4 open reading frames, to generate pSE380-E4". (Figure 19.) The E4 region (StuI to BamHI) of plasmid pSE380-E3+E4+ was removed and replaced with the StuI to BamHI fragment from pSE380-E4", in order to incorporate the E4 deletion and generate pS^380-E3+E4\ (Figure 19.) In a preferred alternative, a larger E4 region deletion is made which reduces a 60 amino acid reading frame initiated from the E4 ORF1 ATG of pSE380E4" to seven amino acids. This preferred modification, referred to as pSE380E4'(2) is constructed as shown in Figure 20. pSE380E4" is cut with Bpu 1102 (Adenovirus 5 bp 33,129) and Aflll (Adenovirus 5 bp 33,104), blunt ended by filing in 5' overhangs with Klenow, and religating to form pSE380E4'(2) . This alternative E4 region deletion then is excised as a StuI to BamHI fragment and substituted for the StuI to BamHI fragment in pSE380E3+E4+ (Figure 13) to generate pSE380E3+E4"(2) , as shown in Figure 20.
As a further modification, the Xbal region between Adenovirus 5 bp 28,592 and 30,470 is deleted from pSE380E3+E4" (2) in order to generate pSE380E3"E4"(2) , as shown in Figure 21.
In another alternative, the Xbal region between Ad5 bp 28,592 and 30,470 in pSE380E3+E4(2); Figure 21, may be replaced with an Xbal fragment containing a heterologous promotor, such as SV40, operationally linked at some or all of the E3 region open reading frames, to create pSE380E3+*E4-(2) .
Combining deletions within the E2A. E3. and E4 regions into a single plasmid An Adenovirus 5 DNA fragment containing both the E3 region deletion and E4 region deletion in tandem is excised from pSE380E3'E4" (2) by digestion with Spel (Adenovirus 5 bp 27,082) and Sail (Figure 22). This fragment is substituted for the unique Spel to Sail fragment in pSPORTl/E2A"E3"E4 + (Figure 16) to form pSPORTl/E2A"E3"E4" (2) , as shown in Figure 22.
In another alternative, the unique Spel to Sail fragment in pSPORTl/E2A-E3-E4+ (Figure 16) may be replaced with the Spel to Sail fragment excised from pSE380E3+*E4-(2) to create pSPORTl/E2A-E3+*E4-(2).
Virus Vector Production Production of a vector with the genotype B1+E2A"E3~E4+.
The plasmid pSPORT-lE2A"E3'E4+ is digested with BamHI and Sail, and the fragment containing the E2A~E3'E4+ sequences is purified from an agarose gel. The unique BamHI site corresponds to the BamHI site at bp 21,562 of Adenovirus 5. The purified fragment is ligated in vitro to the left side BamHI fragment of the Adenovirus 5 genome (21,562 bp). The ligation mixture then is transfected into an appropriate cell line capable of complementing the vector E2A deletion for production of an El+E2'E3'E4+ Adenovirus 5 vector. (Figure 23.) Production of a Vector with the genotype B1+E2A-E3+*E4+ In a manner analogous to that described above and shown in Figure 23, the BamHI to Sail fragment may be isolated from pSPORTl/E2A-E3+*E4+ and used in the ligation with the Ad5 21,562 bp left end BamHI fragment to generate an Ad5 virus with the genotype E1+E2A-E3+*E4.
Production of a vector with the genotype E1~E2A'E3"E4+.
The DNA of the E1+E2"E3"E4+ Adenovirus 5 vector is purified and digested with Clal. This restriction enzyme cuts the Adenovirus 5 genome at bp 917. The right side fragment is purified and co-transfected with pAvS6 (including a reporter gene or a trans-gene) into a double complementing cell line as capable of providing both El and E2A functions in trans. pAvS6 (Figure 24) is a shuttle plasmid which includes an adenoviral 5' ITR, and adenoviral encapsidation signal, an Ela enhancer sequence; a promoter,- a tripartite leader sequence, a multiple cloning site for the insertion of foreign genes; a poly A signal; and a DNA segment corresponding to the Adenovirus 5 genome which is no longer than from base 3329 to base 6246 of the genome. pAvS6 is described further in published PCT Application No. W094/23582, published October 27, 1994. Homologous recombination between the virus DNA fragment and pAvS6 results in a linear virus genome with the genotype El' (trans gene) E2a"E3"E4+. (Figure 25.) This vector may be plaque PCT/VS9S/15947 purified further using a double complementing cell line, El+/E2a+.
In another alternative, a vector with the genotype El"E2A" E3"E4+ may be generated by ligating the left ITR through BamHI fragment of a pre-existing El" vector to the BamHI/SalI fragment of pSPORT-lE2A"E3'E4" (Figure 26) to generate directly an El" (reporter or trans-gene) E2A"E3"E4+ virus which will replicate when transfected into an appropriate complementing cell line. This approach, however, requires that the reporter or trans-gene does not contain a BamHI site.
In yet another alternative (Figure 27), plasmid pBRAdS-E2A"E3"E4+ is co-transf ected with pAvS6 (containing a reporter gene or a trans-gene) , into a double complementing cell line, to generate by homologous recombination an El" (reporter or trans-gene) E2A"E3'E4+ vector. The vector is plaque purified using a double complementing cell line.
As an example of the practice of these methods, a vector with the genotype El"E2a*E3'E4 + was generated using the adenoviral plasmid vector pAvS6nLacZ (described in PCT application No. W095/09654) , which contains a nuclear localizing beta-galactosidase cDNA. The resulting vector, Av3nLacZ (Figure 28) , was generated by homologous recombination as outlined in Figure 25.
In another alternative, the vector Av3nLacZ can be used as a starting material for the production of other vectors. Av3nLacZ contains two Clal sites, one within the lacZ coding region and one at the 3' end of lacZ within the polyadenylation signal. (Figure 28) . By digesting Av3nLacZ with Clal and recombining with pAvS6/transgene as described in Figure 25, other Av3-type vectors are made. This approach provides advantages in that no El+ vector backbone is present in the recombination, and new recombinant vectors can be selected as B-gal negative when X-gal is included in the agar overlay during plaque purification.
WO 96/18418 PCT/US95/15947 Production of a vector with the genotype E1-E2A-B3+*E4+ In a manner analogous to that described above and shown in Figure 25, DNA from the virus E1+E2A-E3+*E4+ is digested with Clal and the right side fragment used to co-transfect with pAVS6/transgene into E1/E2A expressing cells to generate, by homologous recombination, a vector with the genotype E1-E2A-E3+*E4+.
In another alternative, and in a manner analogous to that shown in Figure 26, the left end BamHI fragment from a pre-existing El- vector may be ligated directly to the BamHI/Sall fragment from a pSP0RTl/E2A-E3+*E4+ and transfected into E1/E2A expressing cells to generate a vector with the genotype E1-, transgene, E2A-E3+*E4+.
Production of a vector with the genotype E1+E4".
A purified Adenovirus 5 fragment from bp 1 to the Spel site (bp 27,082), containing terminal protein on the 5' end, was ligated to the Spel/BamHI fragment purified from plasmid pSE380-E3+E4" containing the E4 region deletion. The in vitro ligation mixture is transfected into an E4+ cell line to produce an Adenovirus 5 E1+E4" vector. (Figure 29.) Alternatively, pSE380E3+E4~ (2) , as shown in Figure 20, is used to generate an El+E3+E4'(2) virus with the E4 deletion in the same manner as outlined in Figure 29. In another alternative, pSE380E3*E4* (2) , as described in Figure 21, is used in the same manner to generate an E1+E3"E4"{2) adenovirus.
Production of a vector with genotype B1*E4~.
The DNA of the Adenovirus 5 E1+E4" genome is purified and digested with Clal restriction enzyme. The right side fragment is purified and co-transfected with pAvS6 (containing a reporter or trans-gene) into a double complementing cell line expressing El and E4. Homologous recombination between the E4" viral fragment and pAvS6 will result in a vector with the genotype El* (reporter or trans-gene) E2A+E3+E4". The vector (Figure 30) is plaque purified using a double complementing cell line.
In another alternative, the Spel/BamHI fragment from SE380-E3+E4' is ligated directly to the left end fragment of a pre-existing El" vector digested with Spel to generate an El" (reporter or trans-gene)) E4" vector. (Figure 31.) This approach, however, requires that the reporter or trans-gene does not contain an Spel site.
In other alternatives, by using either the homologous recombination or the in vitro ligation approaches described above (Figures 30 and 31), and the El+E3+E4"(2) or E1+E3"E4"(2) viruses hereinabove described, transgene-containing vectors of the types El"(transgene) E3+E4'(2) or El"(transgene) E3'E4"(2) are generated.
Example 3 Production of an Adenovirus vector with the genotype El". E2A". E3". E4".
Adenovirus vectors with deletions in 3 essential genes (El, E2A, E4), referred to as triple deletion vectors or AV4 generation vectors are constructed as follows. Using Av3nLacZ as a starting material, AV4nLacZ is generated by either homologous recombination or in vitro ligation. Using AV4nLacZ as a starting material, any other transgene containing Av4 type vector can be constructed.
In one alternative, the unique BamHI to Sail fragment from pSPORTl/E2A"E3"E4" (2) is isolated and co-transf ected with the left end fragment of Av3nLacZ cut at the unique Srfl restriction site (bp 27,098 of AV3nLacZ (Figs. 28, 32) into a triple complementing cell line (as described in Example 1 hereinabove) expressing El, E2A, and E4 viral genes. Homologous recombination between the these two DNA fragments in the overlapping region between BamHI and Srfl will result in a vector with the genotype El", nLacZ, E2A", E3", E4' (Fig. 32) .
In another alternative, the unique Srfl to Sail fragment from pSPORTl/E2A"E3'E4" (2) may be isolated and directly ligated to the left end fragment of AV3nLacZ cut with Srfl at bp 27,098 to yield a vector with the genotype El", nLacZ, E2A", E3", E4*. This ligation mixture may then be transfected into the triple complementing cell line (El+, E2A+, E4 + ) to produce AV4nLacZ (Fig. 33).
In another alternative, AV4 vectors containing transgenes other than nLacZ are constructed. Purified DNA from Av4nLacZ is digested with Clal (See Fig. 34) , and the right end viral fragment is purified. This fragment is co-transfected with the desired pAVS6/transgene construct into triple complementing cells (Ei+, E2A+, E4+) and by homologous recombination to yield an AV4 type vector with the genotype El' , transgene, E2A", E3", E4' (Fig. 34) .
Production of an Adenovirus vector with the genotype E1-E2A-E3+*B4-In one alternative, and in a manner analogous to the process shown in Figure 32, a unique BamHI/Sall fragment from pSPORTl/E2A-E3+*E4-(2) may be isolated and co-transfected with the left end fragment of AV3nLacZ cut at the unique Srfl restriction site into cells expressing El, E2A, and E4 in order to generate, by homologous recombination, a vector with the genotype El-,nLacZ,E2A-E3+*E4(2) or AV4nLacZE3+*.
In another alternative, and in a manner analogous to the process shown in Figure 33, the unique Srfl to Sail fragment from pSPORTl/E2A-E3+*E4-(2) may be isolated and used to ligate directly to the left end fragment of AV3nLacZ cut with Srfl. The ligation product is then transfected into cells expressing El, E2A, and E4 to generate a vector with the genotype E1-,nLacZ,E2A-E3+*E4-(2), or AV4nLacZE3+*.
In another alternative, AV4 vectors containing a transgene other than nLacZ and containing the modified E3+* region can be generated in a fashion analogous to that shown in Figure 34. AV4nLacZE3+* is cut with Clal and co-transf ected with pAV6/transgene into cells esqpressing El, E2A, and E4 to generate a vector with the genotype E1-, transgene, E2A-E3+*E4-(2).
Example 4 Development of Recombinant Adenovirus Vectors with Deletions of El/E2a. or E1/E4 or El/E2a/B4 which express the normal human CFTR cDNA. pAvS6 (Figure 24) was linearized with EcoRV. The normal human CFTR cDNA sequence (nucleotides 75 to 4,725; for numbering see Gen Bank accession number M28668) was removed from plasmid pBQ4-7 (Figure 35) by PstI digestion followed by blunting of the CFTR cDNA ends with T4 polymerase (pBQ4-7 was provided by L.-C.Tsui, the Hospital for Sick Children, Toronto, Canada.) This CFTR cDNA was then inserted into the linearized pAvS6 plasmid so as to create an operational linkage between the RSV promoter and the 5' end of the coding sequence of the CFTR cDNA. The resulting plasmid pAvS6 CFTR (Figure 35) was linearized by digestion with Kpnl and cotransfected into El/E2a, E1/E4 or El/E2a/E4 expressing cells along with the large Clal fragment of Av3LacZ for El"/ E2", Av5LacZ for El"/E2'/E4", or the large Clal fragment from Av4nLacZ, respectively, as described above. iEl/E2a cells cotransf ected as described above were then overlaid with agent and cultured in a humidified atmosphere containing 5% C02 at 37°C until formation of virus plaques. Plaques were picked and the recombinant adenovirus vectors further plaque-purified, amplified and titered as previously described (Rosenfeld, et al., Cell. Vol. 68, pgs. 143-155 (1992) . Adenoviral vectors are evaluated for deletion of Ad genes El/E2a, E1/E4 or E1/E2/E4 and inclusion of part or all of the normal human CFTR cDNA as previously described (Mittereder, et al., Human Gene Therapy. Vol. 5, pgs. 717-729 (1994) . The ability of such CFTR expressing adenovirus vectors to correct the CI" secretory defect of CF epithelial cell lines was tested as previously described. (Mittereder, et al., 1994) .
Example 5 Demonstration that El/E2a-deleted vectors have reduced expression of adenoviral late gene products.
This example demonstrates that third generation vectors which harbor deletions in all or part of El/E2a with or without deletions of E3 region sequences have reduced potential for elicitation of a host immune response. The expression of hexon gene was measured by metabolic labeling. Further, this expression was compared among a first generation vector (e.g., E1/E3 deleted), a second generation vector (e.g., El deleted containing a temperature sensitive mutation in the E2a gene (Englehardt, et al., Proc. Nat. Acad. Sci. . Vol. 91, pgs. 6196-6200 (1994)) and the third generation vector described above.
To evaluate the performance of these vectors with regard to the decrease in late gene expression due to E2a deletion, A549 cells were infected with AvlLacZ4 (50-500 iu/cell) Av2Lucl, which is an El deleted vector containing a temperature sensitive mutation in the E2a gene, and a luciferase gene. (50-500 iu/cell). or Av3LacZl (500-3000 in/cell) and cultured in a humidified atmosphere with 5% Co2 at 37°C. As controls, either iEl/E2a cells or 293 cells (expressing the inducible El and E2a regions of Ad5) were infected with AvlLacZ4, Av2Lucl or Av3LacZi at an approximate multiplicity of infection (M.O.I.) of 10 infectious units (iu) per cell. Media was then changed to methionine-free DMEM containing 3sS-Met (Mittereder, et al., 1994) and cultured for an additional 24 hours. Metabolically labelled cells were then washed in phosphate buffered saline, lysed and then scraped into 800 (il of Ripa buffer containing antiproteases (PMSF, leupeptide and proteinase). After thorough mixing to homogenize the cells, 35S-Met incorporation into labeled protein was quantified by routine tricholoracetate precipitation. Aliquots of each incubation containing 3xl06 cpm were immunoprecipitated using anti-adenovirus 5 hexon antibody and evaluated using SDS-page as previously described (Mittereder, et al., Human Gene Therapy. :717-729, 1994). The results show that, at 37°C, normal body temperature, Av3LacZl demonstrated markedly reduced hexon gene expression in A549 cells even at a high MOI (Figure 36) and 293 cells (Figure 37, lanes 6-8) than did either AvlLacZ4 or Av2Lucl. As a control, all three vectors express similar amounts of hexon in El/E2a expressing cells which complement the various adenoviral gene deletions within the vector (Figure 36, lanes 1-3). This demonstrates that the third generation vectors have improved (decreased) expression of adenoviral backbone genes.
Example 6 Demonstration that El/E2a-deleted vectors have reduced replication of the adenoviral DNA genome.
In order to demonstrate that third generation (El"/E2a ) vectors with or without deletions of the E3 region sequences have improved characteristics with respect to residual viral DNA replication, metabolic labeling of vector infected cells with 32P was conducted. These experiments were carried out in a manner analogous to that described in Example 5 above. To evaluate the replication defect of these vectors, 293 and iEl/E2 cells were infected with AvlLacZ4, Av2Lucl or Av3LacZl at approximately 10 infectious vinits per cell and cultured as above. P04-free media containing 32P-orthophosphate and cultured for an additional 8 hours. Cells were then washed in phosphate buffered saline then lysed in 0.8 ml of Hirt solution. Viral DNA was purified, digested with Xbal restriction enzyme and subjected to a agarose gel electrophoresis and autoradiography as previously described. (Mittereder, et al., 1994).
The result demonstrate the Av3LacZl undergoes significantly less replication than Av2Lucl or AvlLucl (Figure 38) . Thus, third generation adenoviral vectors have improved function in relation to adenovirus vector DNA replication.
The disclosure of all patents, publications, (including published patent applications) , and database accession numbers and depository accession numbers referenced in this specification are specifically incorporated herein by reference in their entirety to the same extent as if each such individual patent, publication, and database accession number, and depository accession number were specifically and individually indicated to be incorporated by reference.
It is to be understood, however, that the scope of the present invention is not to be limited to the specific embodiments described above. The invention may be practiced other than as particularly described and still be within the scope of the accompanying claims. «• t—/ ^ v •• .•

Claims (16)

WHAT WE CLAIM IS:
1. An adenoviral vector, comprising a modified adenovirus genome including an adenoviral 5'ITR, an adenoviral 3'ITR, an adenoviral encapsidation signal, DNA encoding a heterologous protein or polypeptide, and a promoter controlling the expression of said DNA encoding a heterologous protein or polypeptide, wherein at least a portion of each of the E1 and E4 DNA sequence has been deleted to eliminate the function of each of the E1 and E4 early proteins, at least a portion of at least one of the E2a and E2b DNA sequences has been deleted to eliminate the function of at least one of the E2a and E2b early proteins, and said vector retains at least a portion of the adenoviral protein function.
2. The vector of Claim 1 wherein at least a portion of the E2a DNA sequence has been deleted to eliminate the function of the E2a early protein, and wherein said vector retains the function of the E2b early protein.
3. The vector of claim 1 or 2, wherein the adenoviral protein function is E3 early protein function.
4. The vector of claim 1 or 2, wherein the adenoviral protein function is major late protein function.
5. A stable cell for complementing adenoviral early protein functions for use in the production of adenoviral vectors, comprising: _ a stable cell, including a first DNA sequence encoding the adenoviral E1 function, said first DNA sequence being under the control of a first inducible promoter; a second DNA sequence encoding the adenoviral E2 function, said second DNA sequence being under the control of a second inducible promoter; and a third DNA sequence encoding the adenoviral E4 function, said third DNA sequence being under the control of a third inducible promoter, said first, second, and third inducible promoters being the same or different.
6. The cell of claim 5, wherein the second DNA sequence encoding the adenoviral E2 function, is a DNA sequence encoding the adenoviral EzteluVicoTrcFI I 2 8 SEP I RECFlVm % -41 - 7 *
7 The cell of Claim 5 or 6 wherein at least one of said inducible promoters is a promoter containing a glucocorticoid responsive element.
8. The cell of Claim 7 wherein said inducible promoter is a GRE5 promoter.
9. The cell of Claim 7 wherein said inducible promoter is an MMTV promoter.
10.The cell of Claim 5 or 6 wherein at least one of said inducible promoters is an antibiotic-responsive promoter.
11 The cell of Claim 10 wherein said antibiotic-responsive promoter is a tetracycline-responsive promoter.
12.The cell of Claim 5 or 6 wherein said first inducible promoter is a GRE5 promoter, said second inducible promoter is an MMTV promoter, and said third inducible promoter is a tetracycline-responsive promoter
13 The cell of Claim 5 or 6 wherein said cell is a human epithelial-like cell.
14.The cell of Claim 13 wherein said cell is an A549 cell.
15.The cell of Claim 13 wherein said cell is a KB cell.
16 The cell of Claim 13 wherein said cell is a Hep-2 cell.
17. A method of expressing a protein or polypeptide in a eukaryotic cell in vitro, comprising: transducing a eukaryotic cell with the adenoviral vector of any of Claims 1 to 4.
18. A eukaryotic cell transfected with the adenoviral vector of any of Claims 1 to 4. v:?s 2001 "42~ S 7
19. The adenoviral vector of any of Claims 1 to 4 for use as a medicament.
20. Use of the adenoviral vector of any of Claims 1 to 4 for the preparation of a medicament for the treatment of a disease in a mammal including a human.
21. A method of generating adenoviral particles, comprising: transfecting the stable cell of claim 5 with the adenoviral vector of any of Claims 1 to 4.
22. An adenoviral vector particle obtained by the method of claim 21.
23. An adenoviral vector as claimed in claim 1 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.
24. A cell as claimed in claim 5 substantially as herein described with reference to any example thereof and with or without "reference to the accompanying drawings.
25. A eukaiyotic cell as claimed in claim 18 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. intellectual property office of N.z. 1 i JUN 2001 Received 43
26. The adenoviral vector as claimed in claim 19 substantially as herein de^^ibed with reference to any example thereof and with or without reference to the accompanying drawings. thereof and with or without reference to the accompanying drawings.
28. A method as claimed in claim 21 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.
29. The adenoviral vector particle as claimed in claim 22'substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. 27 Use as claimed in claim 20 substantially as herein described with reference to any example ,> "E:<ec~"' l pr:>: ~tc < OlTICE OF N Z. I 1 i1 2001
NZ300387A 1994-12-12 1995-12-07 Adenoviral vector modified to reduce host immune and inflammatory responses and its use in gene therapy treatment NZ300387A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US35508794A 1994-12-12 1994-12-12
US45840395A 1995-06-02 1995-06-02
PCT/US1995/015947 WO1996018418A1 (en) 1994-12-12 1995-12-07 Improved adenoviral vectors and producer cells

Publications (1)

Publication Number Publication Date
NZ300387A true NZ300387A (en) 2001-07-27

Family

ID=26998695

Family Applications (1)

Application Number Title Priority Date Filing Date
NZ300387A NZ300387A (en) 1994-12-12 1995-12-07 Adenoviral vector modified to reduce host immune and inflammatory responses and its use in gene therapy treatment

Country Status (6)

Country Link
EP (1) EP0797454A4 (en)
JP (1) JPH10510987A (en)
AU (1) AU709498B2 (en)
CA (1) CA2206683A1 (en)
NZ (1) NZ300387A (en)
WO (1) WO1996018418A1 (en)

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995034671A1 (en) 1994-06-10 1995-12-21 Genvec, Inc. Complementary adenoviral vector systems and cell lines
PT787200E (en) * 1994-10-28 2005-08-31 Univ Pennsylvania IMPROVED ADENOVIRUS AND METHODS FOR THEIR USE
US5998205A (en) 1994-11-28 1999-12-07 Genetic Therapy, Inc. Vectors for tissue-specific replication
US6638762B1 (en) 1994-11-28 2003-10-28 Genetic Therapy, Inc. Tissue-vectors specific replication and gene expression
IL116816A (en) * 1995-01-20 2003-05-29 Rhone Poulenc Rorer Sa Cell for the production of a defective recombinant adenovirus or an adeno-associated virus and the various uses thereof
US5872154A (en) * 1995-02-24 1999-02-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant adenovirus
US6251957B1 (en) 1995-02-24 2001-06-26 Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant virus
US5756283A (en) * 1995-06-05 1998-05-26 The Trustees Of The University Of Pennsylvania Method for improved production of recombinant adeno-associated viruses for gene therapy
US6281010B1 (en) 1995-06-05 2001-08-28 The Trustees Of The University Of Pennsylvania Adenovirus gene therapy vehicle and cell line
US6265212B1 (en) 1995-06-15 2001-07-24 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
DK0833934T4 (en) 1995-06-15 2012-11-19 Crucell Holland Bv Packaging systems for human recombinant adenovirus for use in gene therapy
US6783980B2 (en) 1995-06-15 2004-08-31 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
WO1998032860A1 (en) * 1997-01-28 1998-07-30 Baxter International Inc. Methods for highly efficient generation of adenoviral vectors
US6403370B1 (en) 1997-02-10 2002-06-11 Genstar Therapeutics Corporation Oncolytic/immunogenic complementary-adenoviral vector system
CA2294649C (en) * 1997-06-23 2007-09-25 University Of Saskatchewan Bovine adenovirus type 3 genome
US6670188B1 (en) 1998-04-24 2003-12-30 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6682929B2 (en) 2001-07-23 2004-01-27 Genvec, Inc. Adenovector complementing cells
US20030158112A1 (en) 2002-02-15 2003-08-21 Johns Hopkins University School Of Medicine Selective induction of apoptosis to treat ocular disease
US7364727B2 (en) 2002-07-22 2008-04-29 Cell Genesys, Inc. Metastatic colon cancer specific promoter and uses thereof
CA2421269A1 (en) 2002-08-09 2004-02-09 President And Fellows Of Harvard College Methods and compositions for extending the life span and increasing the stress resistance of cells and organisms
US7977049B2 (en) 2002-08-09 2011-07-12 President And Fellows Of Harvard College Methods and compositions for extending the life span and increasing the stress resistance of cells and organisms
US7026164B2 (en) 2003-07-03 2006-04-11 Cell Genesys, Inc. Adenovirus packaging cell lines
EP1670925B1 (en) 2003-10-02 2013-05-01 Crucell Holland B.V. Packaging cells for recombinant adenovirus
CN103237889B (en) * 2010-08-16 2017-04-05 萨克生物研究学院 Adenoviruss assemble method
JP6576326B2 (en) 2013-03-14 2019-09-18 ソーク インスティテュート フォー バイオロジカル スタディーズ Oncolytic adenovirus composition
KR20170036085A (en) 2014-07-31 2017-03-31 더 보드 오브 리젠츠 오브 더 유니버시티 오브 오클라호마 High isomerohydrolase activity mutants of mammalian rpe65
AU2017223589B2 (en) 2016-02-23 2023-08-03 Salk Institute For Biological Studies Exogenous gene expression in therapeutic adenovirus for minimal impact on viral kinetics
CA3013637A1 (en) 2016-02-23 2017-08-31 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
WO2018111767A1 (en) 2016-12-12 2018-06-21 Salk Institute For Biological Studies Tumor-targeting synthetic adenoviruses and uses thereof
MX2021014525A (en) * 2019-05-30 2022-03-17 Gritstone Bio Inc Modified adenoviruses.

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU680459B2 (en) * 1992-12-03 1997-07-31 Genzyme Corporation Gene therapy for cystic fibrosis
FR2705686B1 (en) * 1993-05-28 1995-08-18 Transgene Sa New defective adenoviruses and corresponding complementation lines.
CA2162497A1 (en) * 1993-06-10 1994-12-22 Sheila Connelly Adenoviral vectors for treatment of hemophilia
WO1995034671A1 (en) * 1994-06-10 1995-12-21 Genvec, Inc. Complementary adenoviral vector systems and cell lines
FR2724945B1 (en) * 1994-09-27 1996-12-27 Centre Nat Rech Scient VIRAL VECTORS AND USE IN GENE THERAPY
FR2726285B1 (en) * 1994-10-28 1996-11-29 Centre Nat Rech Scient ADENOVIRUSES CONTAINING VIABLE CONTAMINANT PARTICLES, PREPARATION AND USE
US5872005A (en) * 1994-11-03 1999-02-16 Cell Genesys Inc. Packaging cell lines for adeno-associated viral vectors

Also Published As

Publication number Publication date
EP0797454A1 (en) 1997-10-01
CA2206683A1 (en) 1996-06-20
JPH10510987A (en) 1998-10-27
AU4511196A (en) 1996-07-03
WO1996018418A1 (en) 1996-06-20
EP0797454A4 (en) 2001-12-05
AU709498B2 (en) 1999-09-02

Similar Documents

Publication Publication Date Title
AU709498B2 (en) Improved adenoviral vectors and producer cells
US6156497A (en) Recombinase-mediated generation of adenoviral vectors
EP1032696B1 (en) Vector for tissue-specific replication and gene expression
AU735806B2 (en) Adenoviruses having altered hexon proteins
JP3565859B2 (en) Improved adenovirus and uses thereof
JP3299761B2 (en) Complementary adenovirus vector systems and cell lines
Lieber et al. Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first-generation vectors in vitro and in vivo
WO1997025446A9 (en) Recombinase-mediated generation of adenoviral vectors
US6228646B1 (en) Helper-free, totally defective adenovirus for gene therapy
US20080103109A1 (en) Vectors for tissue-specific replication
US6350575B1 (en) Helper viruses for the preparation of recombinant viral vectors
WO1996017053A9 (en) Vectors for tissue-specific replication
JP2000106875A (en) Use of adenovirus e4 leading frme for improving expression of target gene
US20020019051A1 (en) Chimeric adenoviral vectors
JP2007530004A (en) Subgroup B adenoviral vectors for treating diseases
Zhang Adenoviral vectors: development and application
AU3345801A (en) Recombinase-mediated generation of adenoviral vectors

Legal Events

Date Code Title Description
PSEA Patent sealed
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)