NZ250997A - Chimeric human interferon gamma receptor/immunoglobulin polypeptide and its production involving a chimeric dna sequence - Google Patents

Description

Priority Ddsls): ..0:32>.

(Complete Specification Filed: «■„ ! Class: Publication Date: L0.CT.49BS P.O. Journal No: O.3.3.-.

N.Z. PATENT r - - 1 MAR 1994 RECEIVED NEW ZEALAND PATENTS ACT, 1953 No.: Date: COMPLETE SPECIFICATION CHIMERIC HUMAN INTERFERON-GAMMA-RECEPTOR/IMMUNOGLOBULIN POLYPEPTIDES We, F. HOFFMANN-LA ROCHE AG 124 Grenzacherstrasse, CH-4002 Basle, Switzerland, a Swiss Company, hereby declare the invention for which we pry.y that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement:- - 1 -(followed by page la) -la- 0 99 7 CHIMERIC HUMAN INTERFERON-y RECEPTOR/IMMUNOGLOBULIN POLYPEPTIDES Interferon-y (IFNy) is a protein produced by NK cells and activated helper T lymphocytes which has antiviral and antiproliferative activity and which plays a multipotent role in the 10 control of the immune system and of the inflammatory response. It regulates antibodies formation and T lymphocytes or NK cells differentiation. It enhances the expression of Major Histocompatibility Complex (MHC) class I and II structures on several cell types, amplifying their antigen presentation (accessory cells) capacity. Acting IS on phagocytes, fibroblasts, epithelial and endothelial cells, IFNy plays a central role in the activation of non-specific defense mechanisms. It is the main activator of microbicidal and tumoricidal properties of macrophages, enhances phagocytosis, induces ADCC (Antibody Dependent Cellular Cytotoxicity) and modulates the release of 20 polypeptides encoded by MHC class III genes (i.e. complement components and TNFa), proteinase inhibitors (CI inhibitor), ELI, GM-CSF, fibronectin, arachidonic acid metabolites, 1,25-hydroxy-vitamin D3, lysosomal enzymes (IP-30, hydrolases, neutral proteinases, i:e: uPA), and chemotactic factors (IP-10). Finally, IFNy promotes cell-to-25 cell interaction, migration of phagocytes through connective tissue, chemotaxis and adhesion to extracellular matrix glycoproteins (Landolfo and Garotta, J. Immunol. Res. 3, 81-94 [1991]).

Several animal experiments suggest that IFNy plays a crucial role 30 in either the induction or the progression of insulin-dependent diabetes, systemic lupus erythematosus, thyroiditis, multiple sclerosis, fulminant hepatitis, allograft rejection, thrombosis and hemorrhage that follows the generalized Shwartzman-type reaction. Additionally, 0 9.Q IFNy plays a role in the progression of Kawasaki disease (mucocutaneous lymph node syndrome) and in the hypercalcemia observed in some of sarcoidosis patients (IFNy induces the elevation of l,a-sterol-hydroxylase that converts vitamin D3 into its most active 5 form 1,25-dihydroxy-vitamin D3) (Garotta et al., Pharmacol. Res. 21, 5-17 [1989]; Landolfo and Garotta, supra; Gilles et al., Hepatology 16, 655-663 [1992]). In the pathogenesis of AIDS, tissue macrophages play a role in the establishment of a state of chronic infection because they represent an important reservoir for human immunodeficiency 10 virus (HIV). In vitro experiments show that IFNy enhances the expression of mature HIV by infected macrophages and can exacerbate the progression of the disease (Gamer et al., Onkologie 9, 163-166 [1986], Biswas et al., J. Exp. Med., 176, 739-750 [1992]). Finally, IFNy plays an important role in inflammatory neurological 15 diseases or in neurological complications of AIDS, poliovirus infections, Lyme disease and septicemia. IFNy activated macrophages convert L-tryptophan into the neurotoxin quinolinic acid (Heyes et al., Biochem. J. 283, 633-635 [1992]).

The existence of a specific receptor for IFNy (IFNyR) on various cells was demonstrated by cross-linking experiments, by binding of radiolabeled IFNy and by specific competition with unlabeled IFNy. Cross-linked complexes between human IFNy (hlFNy) and human IFNy receptor (hlFNyR) with a. molecular weight (Mr) ranging from 70,000 25 to 165,000 have been described (Rubinstein et al., Immunol. Rev. 97, 29-50 [1987]). Despite this apparent heterogeneity, binding and structural studies on different cell types revealed only one IFNy binding protein with 90 kDa of apparent Mr (p90) and a single class of binding site with a dissociation constant of about 10-11 to 10"10 M 30 (Sarkar and Gupta, Proc. Natl. Acad. Sci. USA 81, 5160-5164 [1984]; Aguet and Merlin, J. Exp. Med. 165, 988-999 [1987]; Calderon et al., Proc. Natl. Acad. Sci. USA 85, 4837-4841 [1988]; Fountoulakis et al., J. Immunol., 143, 3266-3276 [1989]; van Loon A.P.G.M. et ai., J.

Leukocyte Biol., 49, 462-473 [1991]). An additional 50 Kd (p50) 35 component of hlFNyR that can be detected is a proteolytic degradation 0 9 9 - 3 product of the p90 protein (Aguet and Merlin, supra, Sheehan et al., J. Immunol. 140, 4231-4237 [1988]; Fountoulakis et al., supra; van Loon A.P.G.M. et al., supra). Since this p50 component of hlFNyR includes the extracellular domain, the transmembrane region and a portion of the 5 intracellular domain, it is not a natural occurring soluble form of hlFNyR (Foimtoulakis et al., supra; van Loon A.P.G.M. et al., supra). In general, the IFNyR is an ubiquitous membrane anchored protein (Valente et al., Eur. J. Immunol. 22, 2403-2412 [1992]) that seems to be expressed to a lesser extent on normal cells (up to 103 sites per 10 cell) than on tumor cells. Thus, some human carcinoma and B-cell lines were reported to express in the order of 104 binding sites per cell (Uecer et al., Cancer Res. 46, 5339-5343 [1986]; Aguet and Merlin, supra).

IS Molecular cloning and expression of the hlFNyR has been described (Aguet et al., Cell 55, 273-280 [1988]). However, because the natural IFNyR as well as the recombinant IFNyR are membrane anchored proteins, they have the disadvantage that they are insoluble in physiological solution. Consequently, search or design of an IFNy 20 antagonist, and administration of purified IFNyR to mammals to inhibit IFNy binding to its specific receptor thereby preventing, suppressing and/or modulating the course of autoimmune disorders, chronic inflammations, delayed hypersensitivities and allotransplant rejections was difficult to accomplish.

The soluble forms of human [shIFNyR] and mouse IFNyR [smIFNyR] were engineered by culturing transformants carrying an expression vector containing a DNA sequence coding for a soluble form of the respective IFNyR and isolating such a soluble IFNyR. The 30 said shIFNyR includes the whole extracellular domain of the natural IFNyR from the N-terminal portion to the transmembrane region (at least amino acids 26-246 of the natural IFNyR sequence), lacks the cytoplasmic and transmembrane domains of the natural IFNy receptor and is capable of specifically binding IFNy (Fountoulakis et 35 al., J. Biol. Chem. 265, 13268-13275 [1990], Gentz et al., Eur. J. 250997 - 4 Biochem. 210, 545-554 [1992] and European Patent Application, Publication No. 393 502). This soluble form of the IFNyR has a molecular mass of about 30-32 kDa, binds IFNy with an affinity of about 10-10 M, is active and stable in vivo, is not immunogenic and 5 can be applied as a drug that specifically neutralizes the endogenous IFNy. Accordingly, it can be used for the therapy of insulin-dependent diabetes, systemic lupus erythematosus, multiple sclerosis, fulminant hepatitis, thyroiditis, allowgraft rejection, septic peritonotis and Shwartzman-type reaction and inflammatory 10 neurological diseases produced by the neurotoxin quinolinic acid released by IFNy activated macrophages. Additionally, the soluble form of the IFNyR can be applied to AIDS patients to delay the chronicization of the infection, to prolong the asymptomatic phase of the disease and to prevent neurological complications. The soluble 15 form of IFNy receptor can be applied as IFNy antagonist to prevent neurological complications of poliovirus infections, Lyme disease and septicemia. However, the soluble form of the IFNyR shows a persistency of only 1-3 hours in the blood and of 6 hours in the lymphoid organs (Ozmen et al., J. Chemotherapy 3, Suppl. 3, 99-102 20 [1991]; Ozmen et al., J. Immunol. Methods 147, 261-270 [1992]; Gentz et al, supra).

By combining the soluble form of the mouse IFNyR with parts of the constant domain of mouse immunoglobulins resulting in chimeric 25 mouse IFNyR-immunoglobulin polypeptides (Kiirschner et al., J. Biol. Chem. 267, 9354-9360 [1992]) increased mouse IFNyR persistency in the blood and the lymphoid organs could be achieved (Kiirschner et al., J. Immunol. 149, 4096-4100 [1992]).

These chimeric mouse IFNyR-immunoglobulin polypeptides have, however, the disadvantage that they cannot be used for administration to humans to inhibit IFNy binding to its specific receptor. To solve this problem DNA sequences coding for chimeric 5 human IFNyR-human immunoglobulin polypeptides have been constructed.

More precisely, the present invention provides DNA sequences comprising a combination of two partial DNA sequences, wherein one 10 of said partial sequences is coding for a fragment of the hlFNyR binding hlFNy, whereby a fragment of the hlFNyR with the whole or a part of the sequence as shown in Figure 1 is preferred, and the other partial sequence is coding for part or all of the constant domains of human immunoglobulin heavy or light chains, whereby heavy chains, IS especially all domains except the first domain of the constant domain of human immunoglobulins, such as IgG, IgA, IgM or IgE and specifically IgG, e.g. IgGl and IgG3, are preferred. A preferred constant domain of human immunoglobulin light chains is, e.g. CK.

The present invention is also concerned with the recombinant chimeric polypeptides coded by such DNA sequences, such as hlFNyR-HG1, hIFNyR-HG3 or hIFNyR-HCK. The chimeric polypeptides may contain amino acid substitutions that do not significantly change the activity of the proteins. Amino acid substitutions in proteins and 25 peptides which do not generally alter the activity of such molecules are known in the art and are described, e.g. by H. Neurath and R.L. Hill in "The Proteins" (Academic Press, New York, 1979, see especially Figure 6, page 14). The most commonly occurring exchanges are: Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, 30 Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly and vice versa.

The recombinant chimeric polypeptides of the present invention can additionally contain sequences of several amino acids which are 35 codcd for by "linker" sequences. These sequences arise as a result 250 99 7 from the expression vectors used for expression of the recombinant chimeric polypeptides.

The recombinant chimeric polypeptides of the present invention 5 can also contain specific sequences that perferably bind to an affinity carrier material. Examples of such sequences are sequences containing at least two adjacent histidine residues (see in this respect European Patent Application Publication No. 282 042). Such sequences bind selectively to nitrilotriacetic acid nickel chelate resins (Hochuli and 10 Dobeli, Biol. Chem. Hoppe-Seyler 368, 748 (1987); European Patent No. 253 303). Recombinant chimeric polypeptides which contain such a specific sequence can, therefore, be separated selectively from the remaining polypeptides. The specific sequence can be linked either to the C-terminus or the N-terminus of the amino acid sequence of the 15 chimeric polypeptide.

Such chimeric polypeptides could have increased half-life in vivo. Increased half-life in vivo has been shown, e.g., for chimeric polypeptides consisting of the first two domains or parts thereof of the 20 human CD4-molecule and different domains of the constant regions of the heavy chain or the light chain of a mammalian immunoglobulin (see Traunecker et al., Nature 331, 84-86 [1988] and European Patent Application, Publication No. 394 827). Additionally, as already mentioned hereinbefore, chimeric mouse IFNyR-immunoglobulin 25 polypeptides show increased half-life in the blood and in the lymphoid organs.

Because the complete DNA sequence of the gene coding for the natural IFNyR is known (Aguet et al., supra) a DNA sequence coding for 30 a fragment of the hlFNyR can be chemically synthesized using standard methods known in the art, preferably solid state methods, such as the methods of Menifield (J. Am. Chem. Soc. 85, 2149-2154 [1963]). Alternatively, fragments of the hlFNyR can be produced from DNA encoding the hlFNyR using methods of DNA recombinant 35 technology (Sambrook et al. in "Molecular Cloning-A Laboratory 0 99 7 Manual", 2nd. ed., Cold Spring Harbor Laboratory [1989]).

Preferably, fragments are prepared including the signal sequence and the extracellular portion of the hlFNyR by polymerase chain 5 reaction (PCR) using plasmids encoding the hlFNyR as described in detail in Examples 5, 6 and 7.

Plasmids suitable for amplification of DNA sequences coding for the IFNyR by PCR are described, for example, in European Patent 10 Appliation, Publication No. 393 502. An especially suitable plasmid is plasmid phlFNyR (Example 2).

The DNA sequences coding for fragments of the hlFNyR can then be integrated into suitable expression vectors containing DNA IS sequences coding for part or all of the constant domains of human immunoglobulin (Ig) heavy or light chains using known methods (Sambrook et al., supra). The Ig constant domains can be provided by expression vectors which have been used to express CD4 as hybrid molecules with Ig constant domains. Such expression vectors include 20 but are not limited to pSV2-derived vectors (see for example German, C. in "DNA Cloning", Vol. II., edt. by Glover, D.M., IRL Press, Oxford, 1985), like pCD4-H|i, pCD4-Hyl, pCD4-Hy3 (described in detail in European Patent Application, Publication No. 394 827).

The specification of European Patent Application, Publication No. 394 827 and the Traunesker et al. reference cited supra contain also data with respect to the further use of these vectors for the expression of chimeric proteins and for the construction of vectors for the expression of chimeric proteins with other immunoglobulin fragments. 30 For the purpose of the present invention the CD4 coding part in these vectors is replaced by a DNA sequence coding for a fragment Of the hlFNyR by methods known in the art and described, e.g., in Sambrook et al. (supra), resulting, for example, in plasmids phuIFNyR-HGl (Example 5), phuIFNyR-HG3 (Example 6) and phuIFNyR-HCK (Example 35 7). 250997 Suitable expression vectors include, for example, vectors such as pBC12MI [ATCC 67109], pSV2dhfr [ATCC 37146], pSVL [Pharmacia, Uppsala, Sweden], pRSVcat [ATCC 37152] and pMSG [Pharmacia, Uppsala]. Preferred vectors for the expression of the chimeric hlFNyR-immunoglobulin polypeptides are pN316 and pN346 type vectors (see Figures 2 and 3) resulting in expression vectors pN316-huIFNYR-HGl, pN316-huIFNyR-HG3 and pN346-huIFNYR-HCK (see Examples 5, 6 and 7), which have been deposited transformed in E. coli K803 under the conditions of the Budapest Treaty for patent purposes at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM) in Braunschweig, Federal Republic of Germany on January 26, 1993, under accession numbers DSM 7421, 7419, 7420 respectively. These vectors are preferably introduced into suitable mammalian host cells, for example, by transfection. __ We agree that, after publication of the present complete specification, we will provide, on request, a declaration authorising the Deutsche Sammlung von Mikroorganismen and Zellkulturen Gmbh to furnish samples of the deposits DSM 7421,7419 and/or 7420 to any authority, natural person or legal entity, on the request of such party.

Mammalian host cells that could be used include, e.g., human Hela, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, CV1 African green monkey kidney cells, quail QC1-3 cells, Chinese hamster ovary (CHO) cells, mouse L cells and the COS cell lines. The CHO cell line (ATCC CCL 61) is preferred.

The DNA sequences coding for the chimeric hlFNYR-immuno-globulin polypeptides can also be integrated into suitable vectors for expression in yeast or insect cells. For the production in insect cells, e.g., the baculovirus-insect cell vector system can be used (for review see Luclow and Summers, Bio/Technology 6, 47-55 [1988]). The chimeric polypeptides produced in insect cells infected with recombinant baculovirus can undergo post-translational processing including N-glycosylation (Smith et al., Proc. Nat. Acad. Sci. USA 82, 8404-8408) and O-glycosylation (Thomsen et al., 12. International Herpesvirus Workshop, University of Philadelphia, Pennsylvania).

The manner in which the expression of the chimeric • hlFfcWl^'oT^ immunoglobulin polypeptides of the present invention is carded out I" «V' '25 0 9 97 depends on the chosen expression vector/host cell system.

Usually, mammalian host cells which contain a desired expression vector are grown under conditions which are optimal for 5 the growth of the mammalian host cells. A typical expression vector contains the promoter element, which mediates the transcription of mRNA, the protein coding sequence, and the signals required for efficient termination and polyadenylation of the transcript. Additional elements may include enhancers and intervening sequences bounded 10 by spliced donor and acceptor sites.

Most of the vectors used for the transient expression of a given coding sequence carry the SV40 origin of replication, which allows them to replicate to high copy numbers in cells (e.g. COS cells) that 15 constitutively express the T antigen required to initiate viral DNA synthesis. Transient expression is not limited to COS cells. Any mammalian cell line that can be transfected can be utilized for this purpose. Elements that control a high efficient transcription include the early or the late promoters from SV40 and the the long terminal 20 repeats (LTRs) from retroviruses, e.g. RSV, HIV, HTLVI. However, also cellular signals can be used (e.g. human-P-actin-promoter).

Alternatively, stable cell lines carrying a gene of interest integrated into the chromosome can be selected upon co-transfection 25 with a selectable marker such as gpt, dhfr, neomycin or hygromycin.

Now, the transfected gene can be amplified to express large quantities of a foreign protein. The dihydrofolate reductase (DHFR) is a useful marker to develop lines of cells carrying more than 1000 copies 30 of the gene of interest. The mammalian cells are grown in increasing amounts of methotrexate. Subsequently, when the methotrexate is withdrawn, cell lines contain the amplified gene integrated into the chromosome. In the expression vectors used in the preferred embodiments of the present invention, the expression is controlled by 35 the Rous sarcoma virus LTR promoter. 250 997 The host cells transfected with a suitable expression vector as well as the expression vectors used for their transfection and expressing the recombinant chimeric polypeptides are also an object of 5 the present invention.

The chimeric polypeptides of the present invention can be purified from the cell mass or the culture supernatants according to methods of protein chemistry which are known in the art such as, for 10 example, precipitation, e.g., with ammonium sulfate, dialysis, ultrafiltration, gelfiltration, ion-exchange chromatography, SDS-PAGE, isoelectric focusing, affinity chromatography like immunoaffinity chromatography, HPLC on normal or reverse systems or the like. Preferably, the chimeric hlFNyR-immunoglobulin polypeptides 15 expressed in mammalian host cells are obtained after affinity chromatography.

The chimeric polypeptides of the present invention as well as their physiologically compatible salts, can be used for the treatment 20 of illnesses in which IFNy is involved in their course, e.g., for the treatment of autoimmune diseases, e.g. type I diabetes or lupus erythematosus or rheumatoid arthritis, chronic inflammations, e.g. Shwartzman Reaction, delayed hypersensitivity, allotransplant rejections, multiple sclerosis, fulminant hepatitis and inflammatory 25 neurological diseases produced by the neurotoxin quinolinic acid released by IFNy activated macrophages. Additionally, the chimeric polypeptides can be applied to AIDS patients to delay the chronicization of the infection, to prolong the asymptomatic phase of the disease and to prevent neurological complications. The chimeric 30 polypeptides can be also used as IFNy antagonist to prevent neurological complications of poliovirus infections, Lyme disease and septicemia and/or the production of corresponding pharmaceutical preparations. They may be administered in pharmaceutical^ acceptable oral, injectable or topical compositions and modes. Dosage 35 and dose rate may parallel that currently being used in clinical - 11 applications of the known IFNs. The pharmaceutical compositions of the present invention contain the chimeric polypeptides or their physiologically compatible salts thereof in association with a compatible pharmaceutical^ acceptable carrier material. Any 5 conventional carrier material can be utilized. The carrier material can be an organic or inorganic one suitable for enteral, percutaneous or parenteral administration. Suitable carriers include water, gelatine, gum arabic, lactose, starch, magnesium stearate, talc, vegetable oils, polyalkylene-glycols, petroleum jelly and the like. Furthermore, the 10 pharmaceutical preparations may contain other pharmaceutically active agents. Additional additives such as flavouring agents, preservatives, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of pharmaceutical compounding.

The pharmaceutical preparations can be made up in any conventional form including: a) a solid form for oral administration such as tablets, capsules, pills, powders, granules and the like; b) a liquid form for oral administration such as solutions, syrups, 20 suspensions, elixirs and the like; c) preparations for parenteral administration such as sterile solutions, suspensions or emulsions; and d) preparations for topical administrations such as solutions, suspensions, ointments, creams, gels, micronized powders, aerosols and the like. The pharmaceutical preparations may be sterilized and/or 25 may contain adjuvants such as preservatives, stabilizers, wetting agents, emulsifiers, salts for varying the osmotic pressure and/or buffers.

Parenteral dosage forms may be infusions or injectable solutions 30 which can be injected intravenously or intramuscularly. These preparations can also contain other medicinally active substances. Additional additives such as preservatives, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of pharmaceutical compounding. 250 99 Such pharmaceutical preparations and the use of the compounds of the present invention for therapeutical purposes are also an object of the present invention.

Having now generally described this invention, the same will become better understood by reference to the specific examples, which are included herein for purpose of illustration only and are not intended to be limited unless otherwise specified, in connection with the following figure: Figure 1 displays the nucleic acid sequence of shIFNyR cDNA (SEQ. ID No.2) and the amino acid sequence deduced therefrom (SEQ. ID No.l). Sequences are represented by standard abbreviations for nucleotides and amino acids.

Figure 2 is a schematic drawing of the expression vector pN316. The abbreviations and symbols used are: RSV = rous sarcoma virus LTR sequence (promoter); rppi 3' intron + poly A = rat preproinsulin 3' intron and polyadenylation site; PSV 40 = SV40 viral promoter; mDHFR = mouse DHFR; SV40 poly A = SV40 virus polyadenylation site sequence; ampicillin = (J-lactamase gene that confers resistance to the antibiotic. Restriction enzyme sites which are inactivated by the sub-cloning procedures described in the Examples are indicated in brackets.

Figure 3 is a schematic drawing of the expression vector pN346. The abbreviations and symbols used are: RSV = rous sarcoma virus LTR sequence (promoter); rppi 3' intron + poly A = rat preproinsulin 3' intron and polyadenylation site; PSV40 = SV40 viral promoter; mDHFR = mouse DHFR; SV40 poly A = SV40 virus polyadenylation site sequence; ampicillin -lactamase gene that confers resistance to the antibiotic; CMV = part of Cytomegalovirus enhancer sequence. Restriction enzyme sites which are inactivated by the subcloning procedures described in the Examples are indicated in brackets. 0 Figure 4 is a schematic drawing of the expression vector pN316-^ huIFNYR-HGl. For abbreviations and symbols see legend to Fig. 2.

Figure 5 is a schematic drawing of the expression vector pN316-5 huIFNyR-HG3. For abbreviations and symbols see legend to Fig. 2.

Figure 6 is schematic drawing of the expression vector pN346-huIFNyR-HCK. For abbreviations and symbols see legend to Fig. 3.

Figure 7 displays standard curves for shIFNyR and hIFNyR-HG3.

Example 1 Seqm?nging All cDNAs or fragments thereof obtained by suitable restriction enzyme digests were subcloned in pUC18/19 type vectors (Pharmacia, Uppsala, Sweden). Sequencing was performed using a protocol based on the Sanger procedure and involving Taq polymerase and double 20 stranded DNA.

Example 2 Construction of expression vectors oN346 and pN316 1. Preparation of the fragment containing part of the CMV enhancer.

A fragment containing 232 basepairs of the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 41, 30 521-530 [1985]) was obtained using the Polymerase Chain Reaction (PCR) (Saiki et al.. Science 230, 1350-1354 [1985]).

PCR is based on the enzymatic amplification of a DNA fragment: Two oligonucleotide primers that are oriented with their 3' ends towards 35 each other are hybridized to opposite strands of the target sequence. 0 9.9 Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. The addition of 5 restriction enzyme sites to the 5' end of each primer facilitates cloning of the final PCR product (Scharf et al., Science 233, 1076-1078 [1986]).

The following oligonucleotides have been used to amplify the DNA fragment containing part of the CMV enhancer: 1) 5'- GGGCTCGAG ACCTTATGGGACTTTCCTACTTGG 3* (SEQ. ID No. 8) (forward primer), and 2) 5'- CCCGTCGAC CCTACCGCCCATTTGCGTCAATG 3* (SEQ. ID No. 9) (reverse primer).

The amplified fragment was isolated from an agarose gel using a commercial available kit ("Geneclean", BIO 101 Inc., La Jolla, Ca.). The 20 fragment was then digested with the endonucleases Xhol and Sail (restriction sites in the above primers underlined) and then purified again as described above (Fragment 1). 2. Preparation of the vector fragment The expression vector pK21 which contains the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, March 1985, 438-447) and a polylinker region of the following sequence: ' -AAGCTTGGCCAGGATCCAGCTG ACTGACTGATCGCGAGATC3 ' (seq.id no. 10) 3 '-TTCG'AACCGGTCCTAGGTCGAC TGACTGACTAGCGCTCTAG5 ' (SEQ.ID No. U) that allows the integration of genes of interest (PvuII site underlined) 35 was used. Downstream the cloning sites for the genes this vector contains the 3' intron, the polyadenylation site and termination signal of 2 - the rat preproinsulin gene.

Plasmid pK21 was digested with Xhol and then treated with calf intestinal alkaline phosphatase to remove the phosphate from the 5' 5 ends of the DNA fragments. The dephoshorylated vector was then isolated from an agarose gel as described above (Fragment VI). 3. Preparation of plasmid pN340 Fragment 1 was ligated with fragment VI using T4 ligase.

E.coli HBlOl cells were then transformed and transformants which contained the enhancer fragment in the proper orientation (same orientation as in the CMV enhancer) were identified by restriction IS enzyme mapping and sequencing. The resulting plasmids were named pN340. 4. Construction of the expression vector pN346.

Preparation of fragment F2 Plasmid pN340 was digested with Xhol and Xbal. The Xhol and Xbal fragment contains the promoter (CMV-enhancer fragment plus RSV-LTR), the polylinker region shown above and the 3' intron plus the 25 polyadenylation signal of the rat preproinsulin gene. The fragment was isolated from an agarose gel as described above using Genclean. The sticky ends of this fragment were then filled in using Klenow enzyme (Fragment 2).

Preparation of the vector fragment V2.

Plasmid pN308 which is a derivative of the expression vector pSV2-DHFR (supra), missing the region between the single EcoRI and BamHI restriction sites was digested with PvuII and then treated with calf 35 intestinal alkaline phosphatase. The dephosphorylated vector was then 250997 isolated as described (Fragment V2).

Ligation of fragment F2 and vector V2.

The blunt ended vector fragment V2 and the blunt ended fragment F2 were ligated with T4 ligase.

E.coli HBlOl cells were then transformed and transformants which contained the Fragment 2 in the desired orientation were identified by 10 restriction enzyme analysis and sequencing. The resulting plasmids were named pN346 (Figure 3).

. Construction of the plasmid pN316 The construction of plasmid pN316 was the same as described under paragraph 4 above with the exception that instead of plasmid pN340, plasmid pK21 was used. As a result, plasmid pN316 lacks Fragment 1 (described in paragraph 1) and has only the RSV LTR promoter element (Figure 2).

Construction of plasmid "phlFNyR" Plasmid constructions were carried out as described in the following paragraphs. In case that no specific references or details of 25 preparation are given standard methodology according to Sambrook et al. in "Molecular Cloning - A Laboratory Manual" (2nd ed.), Cold Spring Harbor Laboratory [1989], was used.

The insert from phage Xgtll-hIFNyR-16 (Aguet et al., Cell 55, 30 273-280 [1988]) was excised using EcoRl restriction enzyme under conditions where a partial digestion of the DNA was obtained. The complete insert of about 2,2 kb was ligated into plasmid pUC18 and one of the resulting constructs, plasmid phlFNyR, was chosen for further analysis. 250 99 7 - 17 -Example 3 Transformation of E.coli K803 Transformation of E.coli K803 cells with plasmid phlFNyR (Example 2) was achieved by the heat shock procedure as described in Sambrook et al., supra.

Example 4 Isolation of Plasmid DNA Plasmid DNA from transformed E.coli K803 cells (Example 3) was prepared using a standard procedure /Birnboim and Doly, Nucl. Acids Res. 7, 1513 (1979); Sambrook et al., 1989, supra). The insert coding 15 for soluble hlFNyR was cut out of plasmid phlFNyR and sequenced as described in Example 1. The complete nucleic acid sequence of shIFNyR and the amino acid sequence deduced therefrom are shown in Fig. 1.

Example 5 Construction of a chimeric human IFNvR-IpGl (HG H molecule In the first step, a polymerase chain reaction (PCR) was performed using plasmid phlFNyR as a template and the following primers: 1) 5'-AATTCGAGCTCGTAGCAGCATGGCTCTCCTCTTTC 3' (SEQ. ID NO.3) matching 24 nucleotides of the hlFNyR cDNA sequence (8 residues of the 5' untranslated (5'-UT) and 16 nucleotides of the hlFNyR coding region), containing a SacI restriction enzyme site, and 2) 5'-TTAAGCTTACTTACC ACCTTTTATACTGCTATTGA-3' (SEQ. ID. NO.4) matching the last 20 nucleotides of the coding region of shIFNyR and containing in addition 15 residues among which three nucleotides code for the first amino acid residue of the hinge region in the HGyl -is- 25 0 9 9 7 molecule, and the others a splicing site followed by a Hindlll recognition site.

The PCR was performed using Taq Polymerase, under conditions as described by the manufacturer (Perkin-Elmer, Cetus, USA).

After phenol extraction and ethanol precipitation, the PCR product was resuspended in an appropriate buffer, and was digested by the SacI and Hindlll restriction enzymes by methods described in the art.

The PCR fragment was then ligated into Sacl-Hindlll digested and gel purified pCD4-Hyl vector generating plasmid phuIFNyR-HGl.

Plasmid phuIFNyR-HGl was cleaved with SacI and Kpnl IS enzymes. Then it was resuspended in an appropriate buffer and blunt-ended by Klenow Polymerase using standard procedures. The resulting fragment was purified and ligated into PvuII opened expression vector pN316. Hindlll restriction enzyme digests of the resulting plasmids were performed and a construct harbouring approximately 20 2.55 and 0.95 kb fragments was selected. This construct was designated pN316-huIFNyR-HGl. A schematic drawing of this construct is shown in Fig. 4.

Example 6 Construction of a chimeric human !FNvR-IgG3 (HG3t molecule The same protocol as described in Example 5 was used with 30 the following exceptions: The PCR 3' linker used was: '-AATTCGAGCTC ACCTTTTATACTGCTATT GA (SEQ ID NO.5) 35 SacI i9 - 25 0 99 # which creates one extra restriction site as indicated. The first 18 nucleotides downstream the SacI site match with the last 6 amino acids of soluble hlFNyR (positions 245 to 240 of the hlFNyR sequence, 5 starting with Met as No. 1, as indicated in Aguet et al., supra). The last two nucleotides match with the 3 rd and 2nd nucleotide of the codon for the amino acid in the position No. 239 of the hlFNyR.

Furthermore, a SacI digest was used instead of a Sacl/Hindlll 10 double digest of the PCR product and pCD4-Hy3 was used as a source of the immunoglobulin gene part. The pCD4-Hy3 was digested with SacI and then the PCR fragment was ligated into the SacI digested pCD4-Hy3 vector. A construct containing an approximately 7.2 Kb Kpnl / SacII fragment was selected and designated phuIFNyR-HG3.

In addition, for ligation with expression vector pN316 the hlFNyR-IgG3 chimeric gene construct was digested with Kpnl (which cleaves the DNA several nucleotides upstream of the SacI site which was originally introduced by the 5'-PCR primer; see Example 5 and SphI 20 prior to endpolishing with T4 DNA Polymerase.

Hindlll / SacII restriction enzyme double digests of the resulting plasmids were performed and a construct yielding a 2.3 kb fragment among other bands was selected. This contract was designated pN316-25 huIFNyR-HG3. A schematic drawing of this construct is shown in Fig. 5.

Example 7 Construction of a chimeric human IFNvR-HCtc molecule The same protocol as described in Example 5 was used with the following exceptions: A human genomic X-phage library prepared as described by 35 Sambrook et al., supra was used as a source of the genomic 0 9 immunoglobulin k light chain constant region. A X-clone containing the human immunoglobulin k light chain gene was digested with Hindlll and BamHI enzymes and a 5.4 kb fragment containing a genomic Ck gene segment was purified and subsequently ligated into the 5 Bluescript KS~ plasmid (Stratagene, La Jolla, Ca.) generating plasmid pBS-HCic.

The plasmid phuIFNyR-HGl as described in Example 5 was used as a source for the hlFNyR fragment. This plasmid was opened at the 10 SacI site and blunt ends were created using T4 DNA polymerase. Xhol recognition sites were added to the blunt ends by ligation of 2 synthetic palindromic oligonucleotides having the sequences: '-CCGCTCGAGCGG (Seq. ID No.6) 15 3'-GGCGAGCTCGCC (Seq. ID No.7) These oligonucleotides were obtained from Promega, Madison. The plasmids obtained after ligation of the Xhol recognition site containing the hlFNyR fragment was then digested with Xhol and 20 Hindlll.

The resulting fragment was gel-purified and subsequently ligated into XhoI/Hindlll-opened plasmid pBS-HCx: described above generating plasmid phuIFNyR-HCic.

Plasmid phuIFNyR-HCic was digested with Xhol and BamHI thereby excising the hybrid gene construct of about 6,2 kb in length. This fragment was blunt ended and purified as described.

The resulting hlFNyR-HCic chimeric gene construct was then ligated with PvuII-opened pN346 vector DNA yielding plasmid pN346-huIFNyR-HCk. A schematic drawing of this construct is shown in Fig. 6.

Selection of the plasmid constructs with preferred orientation of 0 99 7 the insert was done as in Example 5, taking into account differences in the fragment length: the preferred construct being characterized by 0.85 and 6.8 kb, but not by 2.25 and 5.4 kb fragments (the remaining fragment being constant).

Example 8 Transfection of CHO-dhfrcells and expression of chimeric hlFNyR-Ig polypeptides CHO-dhfr-cells were cultured in alpha-minimal essential medium (alpha - MEM, GIBCO/BRL, Paisley, Scotland) containing 5% Fetal Bovine Serum (FBS). The cells were plated into dishes (35 mm in diameter) to give a monolayer of approximately 90% confluence on the 15 day of transfection. Prior to transfection the culture medium was aspirated and the monolayers washed with phosphate buffered saline (PBS), pH7,2, containing 0.14 M NaCl and 15 mM phosphate. One ml of alpha-MEM without FBS was added and the plates maintained at 37°C for three hours. The transfection mixture consisted of 10 jil Lipofectin 20 (GIBCO, Gaithersburg, MD, U.S.A.), 1 p.g pSV2-Neo plasmid DNA (Southern and Berg, J. Mol. Appl. Genet. 1, 327-341 [1982]) and 5 ng of either huEFNyR-HGl, huEFNyR-HG3 or huIFNyR-HCK DNA. The mixtures were added to the cells and after 5 hours 1 ml of alpha-MEM containing 10% FBS was added to each dish. Then the cells were 25 cultured for 24 hours. For selection, the cells were trypsinized and resuspended in selection medium consisting of alpha minus MEM (alpha-MEM missing nucleosides) and 1 mg/ml of G418 (GIBCOBRL, Paisley, Scotland) and plated into culture dishes (100 mm diameter). The dishes were incubated for 12 days. Well developed colonies were 30 picked and transferred into 12-multiwell dishes. The supernatants of these clones were analyzed for the presence of the hIFNyR-Ig polypeptides by a specific ELISA (for details see Example 10, Figure 7 and Table I). The best producing clones were then amplified by successive passage in increasing concentrations of methotrexate (MTX, 35 Sigma, St. Louis, MO), beginning at 0.01 p.M up to 80 jiM MTX. The 250 yield of the secreted hlFNyR-Ig polypeptides reached the level of 10-20 ng/ml.

Example 9 Purification of the hlFNvR-Ip polypeptides The hlFNyR-HGl and huIFNyR-HG3 hybrid proteins were purified 10 from supernatants of CHO cells using a protein G column (5 ml Protein G Sepharose 4 Fast Flow, Pharmacia LKB, Uppsala). Hybrid protein hlFNyR-HCt was purified using an anti-human IFNyR receptor column which had been produced by coupling 60 mg of monoclonal antibody yR46 to 3g CNBr activated Sepharose 4B (Pharmacia LKB, Uppsala) 15 according to the manufacturer's instructions and packed into a column. Alternatively, hlFNyR-HCk was affinity purified on an anti-human k Ig light chain affinity column produced as described above. Volumes of 2 liters supernatant were loaded at a flow rate of 50 ml per hour. The proteins were eluded with 0.1 M Glycin-HCl, pH2.8. Fractions of 1.5 ml 20 were collected, analyzed by the ELISA for hlFNyR-Ig hybrid molecules and by SDS-PAGE under reduced conditions.

Example 10 Detection of hlFNvR-Tg polypeptides bv ELISA Supernatants of transfected CHO cells were assayed for the presence of the hlFNyR-Ig polypeptides by using the monoclonal antibodies yR46 and yR89 in an ELISA that detects hlFNyR. These mono-30 clonal antibodies had been produced against the native human IFNy receptor as described by Garotta et al., in J. Biol. Chem. 265, 6908-6915 [1990]. Both monoclonal antibodies bound only the non-reduced form of the human IFNy receptor, recognized structural epitopes of the extracellular region of human IFNy receptor and in- hibited IFNy 35 binding to cell-bound human IFNy receptor. The antibody yR46 is an 23 0 9 9 IgM that detects an epitope between amino acids 26-133 while the antibody yR89 is an IgGl that reacts with another epitope located between amino acids 70-210. Monoclonal antibodies yR46 were affinity purified on an Anti-Mouse-IgM-Agarose column (Sigma, 5 St.Louis, MO) according to the manufacturer's instructions. Monoclonal antibodies yR89 were affinity purified on protein G column (Pharmacia LKB, Uppsala) according to the manufacturer's instructions.

A stock solution of antibody yR46 was diluted with 0.1M Na-10 phosphate buffer, pH 6.5 to give 10 p.g/ml of pure antibody solution. 100 n-1 of this solution containing 1 jig of pure antibody were distributed in Maxisorp microtiter plates (Nunc, Naperville, II) to coat the flat-bottomed plastic wells. The coating reaction was performed overnight at 15-25°C. The residual binding capacity of plastic was then 15 blocked by adding to each well 250 p.1 of blocking buffer (TRIS/HC1 0.2 M, pH 7.5) containing 10 mg/ml of Bovine serum albumine (BSA) and by incubating the microtiter plates at room temperature for 24 hours (h) at 15-25°C. The supernatants containing the hlFNyR-Ig polypeptides hIFNyR-HG3, hIFNyR-HG1 or hlFNyR-HCK expressed by trans-20 fected CHO cells, were diluted 1:5, 1:50, 1:500, 1:5000 with test buffer (TRIS/Acetate 0.05 M, pH 6.2) containing 5% Foetal Bovine serum (FSA). The standard solutions were diluted with test buffer to have 30 ng/ml, 10 ng/ml, 3 ng/ml, 1 ng/ml, 0.3 ng/ml and 0.1 ng/ml of soluble hlFNyR, hIFNyR-HG3, hlFNyR-HGl or hrFNyR-HCK. Before the test, the 25 blocking buffer was poured off from the coated plates and a volume of 200 }il from each sample or standard dilution was distributed in 3 wells of coated plates. Finally, 50 p.1 (100 ng/ml) yR89 antibody conjugated with peroxidase (Gallati et al., J. Clin. Chem. Biochem. 20, 907-914, [1982]) were added to each well. After 16-24 h at 15-25°C, the 30 plates were washed 6-8 times with deionized water and 200 jil of a tetramethylbenzidine/H202 solution (0.01 M 3,3',5,5'-tetramethyl-benzidine, 0.08 M H2O2 in 10% aceton, 90% ethanol) diluted 1:20 with substrate buffer (K-citrate, 0.03 M, pH 4.1) were added into each well. After 10 minutes at 15-25°C, the enzymatic reaction was stopped by 35 adding 100 jil of 5% sulphuric acid to each well and the colour was . 24. 25 0-9 9 then red at 540 nm wave length using a photometer (Titertek Multiskan MC, from Flow Laboratories, Woodcock Hill, U.K.). The concentration of hlFNyR-Ig polypeptides expressed by transfected CHO cells was determined on the basis of the proper standard curve with shIFNyR (for results see Table I below and Fig.7).

Table I DETERMINATION OF hlFNyR-Ig POLYPEPTIDE CONCENTRATION BY A SPECIFIC ELISA Receptor Sample Reciprocal mOD Hg/ml protein of Dilution 450 nm hIFNyR-HG3(*) 21 200 981 0.40 22 1,000 1091 2.24 23 ,000 578 .60 hIFNyR-HGl(*) 11 200 862 3.48 12 1,000 288 4.84 13 ,000 822 8.27 hlFNyR-HCk(*) 31 200 1271 .28 32 1,000 662 1.304 33 ,000 1035 .61 sMFNyR(A) 1 200 437 0.11 2 1,000 598 0.78 3 ,000 871 2.85 *) Data calculated on MFNyR-HG3 standard curve A) Data calculated on shIFNyR standard curve - 25 - - - ~ ^ Example 11 Analysis of hlFNvR-Ip polypeptides bv SDS-PAGE and Immunohlot SDS-PAGE was performed on 7.5% gels. The samples were loaded in sample buffer with or without reducing agents for reducing or non-reducing SDS-PAGE, respectively. Bands were stained with Coomassie blue R-250 (Sigma, St.Louis, MO) or blotted to nitrocellulose and 10 visualized by monoclonal antibodies yR46 or yR89 (Garotta et al., supra) and iodinated sheep Ig anti-mouse Ig (Amersham, Little Chalfont, U.K.) or by affinity purified anti human IFNy receptor rabbit antibodies (Valente et al., Eur. J. Immunol. 22, 2403-2412 [1992]) and iodinated donkey Ig anti-rabbit Ig (Amersham, Little Chalfont, U.K.). 15 The molecular weights of each of the hlFNyR-Ig polypeptides are summarized in Table II and III below.

Example 12 Inhibition of IFNv binding to Raii cells bv hlFNvR-Ig polypeptides The binding capacity of the hlFNyR-Ig polypeptides expressed in CHO cells was determined by inhibition of IFNy binding to Raji cell surface receptor. Solutions containing the hlFNyR-Ig polypeptides 25 (hIFNyR-HG3, hlFNyR-HGl and hlFNyR-HCk) were serially diluted with HBSS (Hank's basal salt solution; GIBCO/BRL, Paisley, U.K. and supplemented with 1% BSA and 15 mM HEPES) and 50 p.1 of each solution were distributed in triplicate into the wells of polystyrene U-bottomed microtiter plates (Costar, Cambridge, MA). 50 p.1 iodinated 30 IFNy 2ng (200 U) of a preparation with 2x10* dpm/ng was added to each well after dilution in HBSS. Then 100 p.1 of HBSS medium containing 106 Raji cells (ATCC CCL 86) were added. After incubation for 90 minutes at 0°C, the plates were centrifuged for 5 minutes at 100 x g, the supernatant with unbound radioactive IFNy was discarded 35 and the cells were washed twice with washing buffer (Hank's basal salt solution additioned with 0.1% BSA, 15 mM HEPES and 0.01% Triton X 100). Then the cells were resuspended in 200 |xl washing buffer, transferred to flexible U-bottomed PVC microtiter plates (Dynatech, Chantilly, VA) and once more centrifuged. The flexible plates were cut 5 and the radioactivity in each well was determined. IFNy was iodinated using the chloramine T procedure (Greenwood et al., Biochem. J. 89, 114-123 [1963]).

Scatchard's analysis (Scatchard Ann. N.Y. Acad. Sci. 51, 660-672 10 [1949]) wis performed with increasing doses (0.4-9 ng) of iodinated IFNy, incubated with 106 Raji cells. The amount of non-specific binding was determined in the presence of an excess of cold IFNy (10 |ig per ml). The capacity to inhibit the binding of IFNy to Raji cells of the different receptor proteins is summarized in Table II below.

Table II Inhibition Of IFNy Binding To Raji Cells Receptor protein MW Binding IC50 IC50 expressed kDa sites ng/ml nM hIFN7R-HG3 184 2 24 0.13 MFNyR-HGl 170 2 29 0.17 hlFNyR-HCic 82 1 42 0.51 shIFNyR 31 1 100 3.23 MW is the molecular mass evaluated by non-reducing SDS-PAGE.

IC50 is the concentration that produces 50% inhibition of the binding of 3 ng of iodinated IFNy to 106 Raji cells. 27_ 25 0 09 Example 13 Inhibition of the antiviral activity of IFNy bv hlFNvR-Ig polypeptides The binding capacity of hlFNyR-Ig polypeptides expressed in CHO cells was determined by the inhibition of antiviral activity exerted by IFNy. Solutions containing hlFNyR-Ig polypeptides (hIFNyR-HG3, hlFNyR-HGl or hIFNyR-HCK) were serially diluted with Minimal 10 Essential Medium (MEM) from GIBCO/BRL supplemented with 5% FBS. SO til of each dilution were distributed in triplicate to wells of tissue culture grade flat-bottomed microtiter plates (Costar). Then 25 p.1 IFNy solution containing 0.25 pg of IFNy (1 U/ml of a preparation of IFNy with a specific activity of 108 U/mg) were added to each well. After 1 15 h at room temperature the IFNy activity therein was determined by the cytopathic effect (CPE) reading method according to Armstrong (Methods in Enzymology, S. Pestka ed., Vol. 78, page 38, Academic Press New York [1981]). Accordingly, 50 jxl of a WISH cell (ATCC CCL 25) suspension (4x10s cells/ml) in 5% FBS-containing MEM were 20 placed in each well of the 96-well microplates and incubation was conducted in a carbon dioxide gas incubator (5% C02) at 37°C. After 24 h the culture supernatants were discarded and 100 H-l of MEM medium with 2% FBS and 1000 plaque forming units of Encephalomyocarditis (EMC) Virus (ATCC VR-129B) were added to each well. The plates were 25 incubated for 90 minutes at 37°C, the medium discarded and substituted with 100 nl 2% FBS-containing MEM. About 24 h later, when the cells in wells not containing IFNy show 100% CPE, the medium was discarded and the remaining adherent cells were washed with PBS. Then 100 nl of a crystal violet solution (1% crystal violet, 30 10% ethanol in water) were added to each well. After 5 minutes, the unbound dye was removed by washing with water before the stained monolayers were dried. Finally, the dye associated with the cells was extracted in 100 jil methylcellosolve and quantitated by reading the absorbance at 550 nm in a Titertek Multiskan MC (Flow Laboratories, 35 Woodcock Hill, U.K.). Since the amount of dye is proportional to the 0 99 number of cells present per well, the obtained absorbance readings are a measure for the protection of IFNy against the viral cytopatic effect. The capacity of the hlFNyR-Ig polypeptides hIFNyR-HG3, hlFNyR-HGl or hlFNyR-HC* to inhibit the antiviral activity exerted by IFNy is summarized in Table III below.

Table III Inhibition Of IFNy Antiviral Activity Receptor protein MW Binding IC50 IC50 expressed kDa sites Hg/ml nM hEFNyR-HG3 184 2 2.0 11 hlFNyR-HGl 170 2 4.4 26 hEFNyR-HCic 82 1 nd nd shIFNyR 31 1 6.7 216 MW is the molecular mass evaluated by non-reducing SDS-PAGE IC50 is the concentration that produces 50% inhibition of antiviral activity exerted by 10 U/ml (5 ng/ml) of IFNy. nd = not done 40 45 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: F. HOFFMANN-LA ROCHE AG (B) STREET: Grenzacherstrasse 124 (C) CITY: Basle (D) STATE: BS (E) COUNTRY: Switzerland (F> POSTAL CODE (ZIP): CH-4002 (G) TELEPHONE: 061 - 688 42 56 (H) TELEFAX: 061 - 688 13 95 (I) TELEX: 962292/965542 hlr ch (ii) TITLE OF INVENTION: Chimeric Human Interferon-Gamma Receptor/Immunoglobulin Polypeptides (iii) NUMBER OF SEQUENCES: 11 (iv) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO) (vi) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: EP 93810170.6 (B) FILING DATE: 05-MAR-1993 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 245 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (v) FRAGMENT TYPE: N-terminal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: Met 1 Ala Leu Leu Phe Leu Leu Pro Leu 5 Val 10 Met Gin Gly Val Ser 15 ' Arg Ala Glu Met Gly Thr Ala Asp Leu Gly 20 25 Pro Ser Ser Val Pro 30 Thr Pro Thr Asn Val Thr lie Glu Ser Tyr Asn 35 40 Met Asn Pro lie Val 45 Tyr Trp 250897 40 Glu Tyr Gin lie Met Pro Gin Val Pro Val Phe Thr Val Glu Val Lys 50 55 60 Asn Tyr Gly Val Lys Asn Ser Glu Trp lie Asp Ala Cys lie Asn Leu 65 70 75 80 Ser His His Tyr Cys Asn lie Ser Asp His Val Gly Asp Pro Ser Asn 85 90 95 Ser Leu Trp Val Arg Val Lys Glu Arg Val Gly Gin Lys Glu Ser Ala 100 105 110 Tyr Ala Lys Ser Glu Glu Phe Ala Val Cys Arg Asp Gly Lys lie Gly 15 115 120 125 Pro Pro Lys Leu Asp lie Arg Lys Glu Glu Lys Gin lie Met lie Asp 130 135 140 lie Phe His Pro Ser Val Phe Val Asn Gly Asp Glu Gin Glu Val Asp 145 150 155 160 Tyr Asp Pro Glu Thr Thr Cys Tyr lie Arg Val Tyr Asn Val Tyr Val 165 170 175 Arg Met Asn Gly Sex Glu lie Gin Tyr Lys lie Leu Thr Gin Lys Glu 180 185 190 Asp Asp Cys Asp Glu lie Gin Cys Gin Leu Ala lie Pro Val Ser Ser 30 195 200 205 Leu Asn Ser Gin Tyr Cys Val Ser Ala Glu Gly Val Leu His Val Trp 210 215 220 Gly Val Thr Thr Glu Lys Car Lys Glu Val Cys lie Thr lie Phe Asn 225 230 235 240 Ser Ser lie Lys Gly 245 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: 45 (A) LENGTH: 735 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 50 (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO 55 (viii) POSITION IN GENOME: (C) UNITS: bp 40 45 50 55 0 9 9 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: ATGGCTCTCC TCTTTCTCCT ACCCCTTGTC ATGCAGGGTG TGAGCAGGGC TGAGATGGGC 60 ACCGCGGATC TGGGGCCGTC CTCAGTGCCT ACACCAACTA ATGTTACAAT TGAATCCTAT 120 AACATGAACC CTATCGTATA TTGGGAGTAC CAGATCATGC CACAGGTCCC TGTTTTTACC 180 GTAGAGGTAA AGAACTATGG TGTTAAGAAT TCAGAATGGA TTGATGCCTG CATCAATCTT 240 TCTCATCATT ATTGTAATAT TTCTGATCAT GTTGGTGATC CATCAAATTC TCTTTGGGTC 300 AGAGTTAAAG AAAGGGTTGG ACAAAAAGAA TCTGCCTATG CAAAGTCAGA AGAATTTGCT 360 GTATGCCGAG ATGGAAAAAT TGGACCACCT AAACTGGATA TCAGAAAGGA GGAGAAGCAA 420 ATCATGATTG ACATATTTCA CCCTTCAGTT TTTGTAAATG GAGACGAGCA GGAAGTCGAT 480 TATGATCCCG AAACTACCTG TTACATTAGG GTGTACAATG TGTATGTGAG AATGAACGGA 540 AGTGAGATCC AGTATAAAAT ACTCACGCAG AAGGAAGATG ATTGTGACGA GATTCAGTGC 600 CAGTTAGCGA TTCCAGTATC CTCACTGAAT TCTCAGTACT GTGTTTCAGC AGAAGGAGTC 660 TTACATGTGT GGGGTGTTAC AACTGAAAAG TCAAAAGAAG TTTGTATTAC CATTTTCAAT 720 AGCAGTATAA AAGGT 735 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ANTI-SENSE: YES (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: AATTCGAGCT CGTAGCAGCA TGGCTCTCCT CTTTC 35 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 40 45 250 9 9 (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: YES (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: TTAAGCTTAC TTACCACCTT TTATACTGCT ATTGA 35 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: YES (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: AATTCGAGCT CACCTTTTAT ACTGCTATTG A 31 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: YES (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: CCGCTCGAGC GG (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: YES (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7 CCGCTCGAGC GG (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTK: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 GGGCTCGAGA CCTTATGGGA CTTTCCTACT TGG (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: CCCGTCGACC CTACCGCCCA TTTGCGTCAA TG (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base paics (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: AAGCTTGGCC AGGATCCAGC TGACTGACTG ATCGCGAGAT C (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (viii) POSITION IN GENOME: (C) UNITS: bp (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: GATCTCGCGA TCAGTCAGTC AGCTGGATCC TGGCCAAGCT T 250997

Claims (18)

WHAT WE CLAIM IS:

1. A DNA sequence comprising a combination of two partial DNA sequences, one partial sequence coding for a fragment of the human interferon-y receptor which fragment binds human interferon-y and the other partial sequence coding for part or all of the constant domains of human immunoglobulin heavy or light chains.

2. A DNA sequence according to claim 1, wherein the other partial sequence codes for part or all of the constant domain of IgG, IgA, IgM, IgE or C*.

3. A DNA sequence according to claim 1 or 2, wherein one partial sequence codes for a fragment of the human inteiferon-y receptor which binds human interferon-y and the other partial sequence codes for part or all of the constant domain of IgG or for part or all of the constant domain of CK.

4. A DNA sequence according to claim 3 wherein the other partial sequence codes for part or all of the constant domain of IgGl or IgG3.

5. A vector comprising a DNA sequence as claimed in any one of claims 1 to 4.

6. A vector as claimed in claim 5 capable of directing expression in a compatible prokaryotic, insect or mammalian host cell.

7. A prokaryotic, mammalian or insect host cell transformed with a vector as claimed in claim 5 or 6.

8. A recombinant protein coded for by a DNA sequence as claimed in any one of claims 1 and 4.

9. A recombinant protein as claimed in claim 8 selected from the group consisting of hlFNyR-HGl, hIFNyR-HG3 or hlFNyR-HC*.

10. A process for the production of a protein as claimed in claim 8 or 9 which process comprises cultivating a transformed host as claimed in claim 7 in a suitable medium and isolating said protein. £ A fa r

11. A pharmaceutical composition which contains one or more compounds according to claim 8 or 9, if desired in combination with additional pharmaceutically ,\\ active agents and pharmaceutically acceptable carrier materials. \ * 250997 -36-

12. The use of a compound according to claim 8 or 9 for the preparation of pharmaceutical compositions.

13. The use of a compound according to claim 8 or 9 for the preparation of a medicament for the treatment of illnesses.

14. The use of a compound according to claim 8 or 9 for the preparation of a medicament for the treatment of autoimmune diseases, chronic inflammations, delayed hypersensitivity, allotransplant rejections, multiple sclerosis and fulminant hepatitis, inflammatory neurological diseases, and neurological complications of AIDS, poliovirus infections, lyme disease and septicemia.

15. A recombinant protein according to claim 8 or 9 whenever prepared by a process as claimed in claim 10.

16. A DNA sequence according to claim 1, substantially as hereinbefore described with reference to the Examples.

17. A recombinant protein as claimed in claim 8, substantially as hereinbefore described with reference to the Examples.

18. A process for the production of a protein as claimed in claim 8, substantially as hereinbefore described with reference to the Examples.