NZ243851A

NZ243851A - Recombinant viruses and their use in biological insecticides

Info

Publication number: NZ243851A
Application number: NZ243851A
Authority: NZ
Inventors: Peter Daniel Christian; David James Dall; Karl Heinrich Julius Gordon; Terry Nelson Hanzlik; Alagacone Sriskantha
Original assignee: Commw Scient Ind Res Org
Priority date: 1991-08-05
Filing date: 1992-08-05
Publication date: 1995-02-24
Also published as: AU2415092A; EP0598002A1; WO1993003144A1; ZA925875B; JPH07500962A; EP0598002A4

Description

<div class="application article clearfix" id="description"> 'M'MSl Priority Cate(c-): . .r?; & ft/ _ Complete Specification Filed: Class: . Publication Date: ..? .FE B f995 P-O. Journal, No: Patents Form No. 5 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION VIRAL VECTOR-BASED INSECTICIDES AND EXPRESSION SYSTEMS WE, COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION, a body corporate established under the Science and Industry Research Act 1949, AUSTRALIA of Limestone Avenue, Campbell, Australia Capital Territory 2601, AUSTRALIA hereby declare the invention, for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by<t /, V the following statement: , "Z- - l - / 12 OCT 1992" (followed by page la) \ A ^ 4' ? 1 ^ - 3a- .^85 i VIRAL VECTOR-BASED INSECTICIDES AND EXPRESSION SYSTEMS This invention relates to expression systems and biological insecticides, and particularly those comprised of recombinant viruses. Considerable research efforts have, in recent years, been directed at identifying insect viruses and developing methods to utilise these viruses as insecticides. Commercial scale production and distribution of non-engineered baculoviruses has now been achieved, but the relatively slow rate at which wild-type viruses kill insect pests, as compared with chemical insecticides, has led to limited grower acceptance. Methods of genetic manipulation are now being used to i ncrease the pathogenicity of certain virus isolates, most commonly through incorporation into the viral genome of exogenous genes encoding products which rapidly disturb or destroy insect metabolic function. The resultant recombinant viruses will be highly efficacious and will persist indefinitely at, and disseminate from, the site of their environmental release. Despite all assurances of safety there is widespread and considerable public concern about environmental release of any type of genetically modified organism (Tarrant, 1991). Ae a result, future conditions for their use are likely to include the requirement of in-built "recall" or "suicide" mechanisms, designed to ensure that such genetically modified microorganisms are incapable of indefinite persistence in the environment. In addition, non-persistent viruses would pose minimal risk to non-target, geographically distant, susceptible species. It may be appreciated then, that there is a need for -the"- ' development of non-persistent viruses and, accordingly, it o / 12 OCT 1992 " •? <5> :• ' (followed by page 2) - 2 - is an object of the present invention to provide such non-persistent viruses which are suitable for use as insecticides. Members of the baculovirus family, including those belonging to the nuclear polyhedrosis virus (NPV) group, have been found only in arthropods, and commonly infect and kill caterpillars. They are unrelated to any viruses known from humans, other vertebrates or plants, and as such provide ideal candidates for development as specific biological insecticides. Within the Lepidoptera the host range of individual NPV isolates differs, with some strictly confined to a single host, and others able to infect a limited range of species. However in all cases infection of hosts is instigated by ingestion of virus-contaminated food. After entering the caterpillar gut cavity the proteinaceous occlusion bodies (polyhedra) which surround and protect the infective virus particles rapidly dissolve, and virus particles are then able to initiate infection of cells of the midgut wall. Further viral spread from this primary site of infection to other foci within the host is via an alternative type of viral particle which buds through the cell membrane into the haemocoel. This alternative particle tjpe does not become occluded into polyhedra, but immediately goes on to infect other cells within the host; this cell-cell infection cycle is then repeated many times within each host. In the final stages of infection, particles occluded within polyhedra are once again produced, ready for dissemination to another host. Like the NPV's, entomopoxviruses (EFV's) also occur in an infectious occluded form in proteinaceous bodies (spheroids). EPV's also possess characteristics which'' favour their development as recombinant viral -J ,"12 OCT 1992 jj 3 24 3 8 § -j .insecticides. They are DMA viruses which infect various insect pests including beetles and grasshoppers (which are not generally infected by bacu.loviruses) . Stability and persistence of NPV and EPV particles, and concomitant ability of the virus to spread in the field, is entirely dependent on occlusion of the particles into polyhedra or spheroids. Virus particles which fail to become occluded are highly susceptible to destriiction by environmental factors such as desiccation and exposure to sunlight, and are thought to play no significant role in horizontal virus transmission (see Granados and Williams, 1986, for review). Accordingly, in a first aspect, the present .invention provides a replicative insect virus which is characterized, by a reduced capacity, as compared to wild-type virus, to occlude viral particles. In a second aspect, the present invention provides a method of limiting the persistence of an insect virus that method comprising alteration of the genome of the virus to ensure that the resulting altered virus has a reduced capacity, as compared to w.ild-type virus, to occlude viral particles. insert- virus to be altered may be a wild-type, mutant or recombinant virus. The genome may be altered by any of the techniques common in the art .including recombinant DMA techniques. In a third aspect the present invention provides an occluded viral particle comprising all or a portion of at least one insect virus genome, wherein said occluded viral particle, following ingestion thereof by an insect host, - 4 - 24V<ir>i effects a viral infection without producing further occluded viral particles. Hence the invention according to the third aspect provides viral particles which should be capable of establishing only a single round of field infection of insects. Within a host insect the viral particles will not have the capacity to cause production of occlusion bodies, so that the step essential for horizontal transmission to another insect in the field - the occlusion of infectious particles - will not be possible. A single application of viral particles according to the invention may thus lead to a single round of insect deaths and then, disappear from the site. It is preferable that the occluded viral particles of the present invention comprise all or a portion of a single virus genome and accordingly, the invention is hereinafter described in relation to this particular embodiment. Nevertheless, it should be appreciated that occluded viral particles comprising multiple .insect virus genome types may have useful advantages over single genome type particles. For example, the insect target range of occluded viral particles may be broadened by utilizing insect viruses with differing target specificities. Accordingly, it should be understood that such multiple genome typs particles are to be considered as included within the scope of the present invention and the preferred embodiments hereinafter described may be equally applicable to such particles. Insect virus genomes suitable for the present invention may be DNA or RNA. Preferably the genome is from a virus selected from the group comprising baculoviruses, entomopoxviruses and occluded reoviruses. More f preferably, the genome is from an NPV (mi-1 - 5 - 24^85i polyhedrosis virus) baculovirus, GV (granulosis virus) baculovirus or Genus A, Genus B and Genus C entomopoxvirus. The insect virus genome may be a recombinant virus genome or may be otherwise mutated. As a result of recombination and/or mutation, the insect virus genome should be rendered incapable of causing the production of occluded viral particles in a host cell. Preferably this is achieved by rendering the insect virus incapable of producing occlusion protein. In the case of a nuclear polyhedrosis virus, this may entail production of a PH~ virus, that is, rendering the NPV so as not to possess a functional copy of the polyhedrin (PH) gene. For entomopoxviruses, this may entail production of a sph" virus, that is, rendering the EPV so as not to possess a functional copy of the spheroidin (sph) gene. To enhance efficacy of the occluded viral particle, the recombinant insect virus may include within a non-essential region of the genome, one or more nucleotide seguences encoding substances that are deleterious to insects. Such substances include, for example Bacillus thuringiensis 6-toxin, insect neurohormones, or insecticidal compounds from wasp or scorpion venom or of heterologous viral origin. When the insect virus genome is to be PH~ or sph", it is preferable that such exogenous sequences are placed at the PH site or sph site (respectively) of the virus under the influence of the strong polyhedrin or spheroidin promoter. In a fourth aspect, the present invention provides a method for preparation of occluded viral particles according to the third aspect, which method includes: providing an insect virus deficient in a functional gene or genes which encode(s) at least one viral '• 12 OCT V592 | - 6 - 24 «i8l)i protein essential for producing occluded viral particles in a host cell, providing a transgenic organism capable of expressing the at least one viral protein not encoded by said insect virus, and infecting or transfecting said transgenic organism with said insect virus. The transgenic organism may be an insect, although more preferably, the transgenic organism is a cultured cell line derived from tissue of a susceptible insect host [for example, clonal Heliothis zea line such as 2D2 (Dall et al., in preparation)]. Preferably the transgenic organism carries a transgene encoding an occlusion protein (e.g. PH+ or sph4) and the insect virus is deficient in that same gene (e.g. PH" or sph"). Estimates of promoter activity, hydrated protein radii and occlusion body volume suggest that transgenic insect cells may require up to 100 functional and expressible copies of the gene(s) essential for producing occluded viral particles (e.g. polyhedrin gene) in order to synthesize sufficient protein for production of occluded viral particles at economic levels. Large numbers of plasmids can be stably integrated into a cell genome following plasmid transfection, through a process known as "illegitimate recombination" (Low, 1988). Cells in which many copies have been integrated can be isolated by application of severe selection pressure. A further strategy for increasing expression of the polyhedrin gene in the transgenic cells will involve introduction of this gene in such a way that it is linked to a selectable and' -J;; ■ 12 OCT s - 7 - amplifiable marker gene. An example of such a selectable, amplifiable gene is that encoding the enzyme dihydrofolate reductase (DHFR) (Kaufman, 1990). Stepwise selection for increasing resistance to methotrexate will result in the amplification of the DHFR gene together with that encoding polyhedrin. After sufficient time has elapsed, the amplified genes will become stably integrated into the chromosome of the cell, so that further selection may no longer be necessary. Up to 2000 copies of a gene linked to the DHFR gene have been shown to be present in cells following amplification by this method (Wurm et al, 1986). Development of suitable transgenic host cells required for the invention will be through cellular transformation with a vector preferably comprising: a promoter element (e.g. the immediate-early 1 (IE-1) promoter element of HaNPV) which is constitutively active within the host cell, derived either from that host genome or of heterologous origin, and controlling the expression of any gene (e.g. the neomycin phosphotransferase I neomycin resistance] gene from transposon tn5) whose product is suitable for use as a selectable marker for cellular transformation. The combination of these two elements is linked to a second promoter arrangement (e.g. the polyhedrin or plO pronto 1 ev element from HaNFV) comprising a promoter element or elements whose activity is either constitutive, or regulated by viral infection of the host cell, or both, in any combination necessary to produce a sufficient level of expression of a gene (e.g. the polyhedrin encoding gene from HaNPV) or genes encoding a product required for the formation of viral occlusion bodies. V *' A <■■>. \\ * - 8 - 243851 A vector such as this may be introduced into the host cell genome by any transforming mechanism, including particle gun bombardment, virally- or bacterially-mediated transformation, direct injection, electroporation and liposome-mediated transfection. In a further aspect, the invention provides an isolated DNA molecule coding for the polyhedrin promoter and/or protein of HaNPV. As described above, the polyhedrin gene is a non-essential region of the baculovirus genome. Accordingly, a DNA molecule (e.g. a tranfer vector) including the HaNPV polyhedrin-coding sequence and/or promoter may be utilised to incorporate, by homologous recombination, desirable exogenous genes (e.g. coding for the substances deleterious to insects as listed above) into the HaNPV or other baculovirus genome. The exogenous gene may include its natural promoter or other suitable promoter, but more preferably it shall be operatively linked to the strong HaNPV polyhedrin promoter. Thus the invention should also be understood to extend to recombinant HaNPV PH" viruses including an exogenous nucleotide sequence(s) located within the polyhedrin-encoding and/or promoter region. In a still further aspect, the invention provides an isolated DMA molecule coding for the IE-1 promoter and/or protein of HaNPV. In a yet further aspect, the present invention provides a method for controlling the proliferation of pest insects in an area infested by said insects, said method comprising applying over said area an insect virus or occluded viral particle according to the present invention, said insect virus or occluded viral particle f n,, ^ 3 uoct - 9 - 24^85i being in admixture with an agriculturally acceptable carrier. The invention will now be further described by way of the following figures and non-limiting examples. Brief Description of the Figures Figure 1 provides the nucleotide sequence of the HaNPV polyhedrin, gene. The putative polyhedrin protein sequence deduced from this nucleotide sequence is indicated. Figure 2 provides the nucleotide sequence of a portion of the HaNPV IE-1 gene, obtained by PCR as described in Example 1. The putative IE-1 protein sequence deduced from this DNA sequence is indicated. Figure 3 provides the nucleotide sequence homology among baculovirus IE-1 genes at the start site for transcription. The OpNPV sequence shown is from Theilmann and Stewart (1991) and those of the AcNPV are from Guarino and Summers (1987) -[GS], and Chisholm and Henner (1988)-[CH] Gaps have been introduced to maximize homology. Nucleotides shown in upper case are those common to all viruses sequenced. Nucleotides which differ among these sequences are shown in lower case. The underlined nucleotides correspond to the transcription start sites identified for the IE-1 gene. o.;, ' *<■ ,■ : K s ■ * 120CTW92 ! \, *y - 10 - 243851 In the HaNPV sequence, the nucleotide shown in bold type within the homologous block is that which lies nearest the transcription start site identified for the AcNPV. EXAMPLE 1 - OCCLUDED VIRAL PARTICLES COMPRISING PH~ HaNPV Baculoviruses and particularly HaNPV (which attacks Heliothis, a major pest of broadacre crops) are suitable viruses for demonstrating the invention because large scale production may be easily achieved through use of mass reared insect larvae or in cultured insect cells in accordance with the methods reviewed by Shieh, (1989) and Vlak (in press). Both methods have characteristic advantages and disadvantages e.g. while very large quantities of non-engineered NPV can be grown in larvae, difficulties associated with handling of the organisms, maintenance of a contaminant-free rearing environment and downstream product processing, all confer significant disadvantages to this production route. Additionally, highly pathogenic recombinant NFVs would be expected to reach only very low levels before killing the host, thus minimising production yields from this method. Conversely, previously reported yields of virus from cell culture systems have been comparatively low, making "raw" virus more expensive when mass produced in this way. Nevertheless, product quality control, and processing for assessment of alternative formulation efficacies is clearly facilitated by this production strategy. Accordingly the method and product presented in Example 1 was based exclusively on the use of cultured insect cells't~N f A "C ft (• •^t20CTB92* - 11 - 24M Wild-type HaNPV was obtained from Dr. R. Teakle (Queensland Department of Primary Industries, Indooroopilly). The wild-type isolate was passaged twice through 5-day-old Heliothis armiqera larvae maintained on an artificial diet (Teakle and Jensen 1985), and polyhedra purified by differential centrifugation. Production of PH~ HaNPV and Introduction of a Marker Gene The 7.3 kb Xhol-F fragment of genomic DNA from wild-type Heliothis armigera NPV (HaNPV) containing the polyhedrin coding gene (PH), its associated promoter, and flanking sequences in both directions, was cloned into the Sail site of a plasmid derived from pTZ18U (Bio-Rad) (through prior BamHI digestion and endfilling) to give pA44NSl. Site directed mutagenesis was used to replace a viral sequence located around and including the PH translation initiation codon, originally reading 5' ATGTATAC 3', with the sequence 5' AAGGATCC 3'. This mutagenesis deleted the PH translation start site, and introduced a BamHI site into the fragment. BamHI digestion and further endfilling of the construct produced a vector suitable for introduction of the Drosophila esterase-6 (est-6) gene under control of the HaNPV PH promoter element. EcoRI digestion and endfilling of a cloned DNA segment, originally of Drosophila origin, provided an est-6 sequence compatible for cloning into the mutagenised pA44NSl vector. This was accomplished using standard methods of molecular biology (see, for example, Sambrook et al. (1989)) giving pA44NSl/ Drosophila est-6. Cotransfection of native genomic HaNPV DNA and purified pA44NSl/Drosophila est-6 resulted in viral infection of susceptible cultured host cells, and subsequent \ 2 U - 12 - homologous recombination between sequences of replicating viral DNA and the viral sequences on pA44NSl/Drosophila est-6 gave rise to recombinant A44E6 HaNPV (HaNPV PH~erst+). Presence of functional copies of the est-6 gene were detected by enzymatic assays, and the recombinants were isolated by use of standard microbiological methods. Production of PH4 Host Cell Line Cloning of Polyhedrin Gene The polyhedrin gene was specifically amplified by PCR (Polymerase Chain Reaction), from wild-type HaNPV virus DNA as a template. The primers used were: SRI: TATGAAGATATCTGTCGT (at 5' end of promoter) Polyexit TATTTATTGAAGATAACTTG (at 3' end of gene). The oligonucleotide named SRI is located 140 nucleotides upstream of the initiation codon of the polyhedrin gene, and includes the promoter, transcription start site and 5' - untranslated leader of the polyhedrin mRNA. Polyexit is located at the polyadenylation signal, 270 nts downstream of the end of the polyhedrin gene. PCR yielded a fragment of the expected size (1.15 kbp), which was blunt end cloned into the vector pIElneo (Jarvis et al., 1990) which had been cut at the unique EcoRI site, end-filled with Klenow fragment and dephosphorylated. Three recombinant plasmids carrying inserts were selected: these were termed clones 2, 3 and 9. The sequence of the HaNPV polyhedrin gene is provided at Figure 1. Cloning and sequencing the HaNPV IE-1 gene -; . ■ 12 OCT 1992 y t 4 - 13 - 248851 The IE-1 genes from two baculoviruses have been sequenced. These are from the OpNPV (Theilmann and Stewart, 1991) and from the AcNPV by two groups, Guarino and Summers, 1987, -(termed GS below); and Chisholm and Henner, 1988 - (CH below) . Comparison of the sequences from the two viruses showed that there was very little homology at the nucleotide level between them. Three significant blocks of conserved sequences were apparent; the sequences of two are given below, jn addition to the sequences of the primers synthesized for these regions: a) in the promoter, at about nt. - 500 from transcription start 1. OpNPV 5' TGCGG - CCACATCTTTGT 3' AcNPV(GS) TGCGC - CGACATTTTTGT AcNPV(CH) TGCGCGCGACATTTTTGT primer HalElA: 5'- TGCGG.-.CCACATCTTTGT C G T b) in the middle of the gene: Op: GAGTACACTAACAATTACTACATGGTGGACAATCGCGTGTTTGTGGT GS: GAATATACAAACAATTATTACATGGTAGATAATCGCGTGTTTGTGGT CH: primer HalElB (complementary to the above): ATGTACCATCTGTTAGCGCACAAACACCA- 51 PCR with primers HalElA and HalElB was used to specifically amplify the corresponding segment of the IE-1 gene from the HaNPV. The sequence of the 965 bp PCR product is given in Figure 1. This segment of the gene is^ about 400 bp shorter than the corresponding regions in. .the ■ Br' - 14 - 24;i8[)i aforementioned IE-1 genes, and shows only limited sequence homology with their sequences. There is significant sequence homology around the transcription start site, which is also the longest stretch of homology between those other IE-1 genes (Figure 3). The first methionine encoded by the HaNPV amplicon is located 92 nucleotides downstream of the G marked in bold. This G in the sequence showing homology to the other NPV's around the transcription start site corresponds most closely to the nucleotide initiating transcription of the AcNPV IE-1 gene. The open reading frame which commences at this first AUG traverses the remainder of the PCR-amplified sequence. Northern Analysis of Transcription from the HaNPV IE-1 Gene The IE-1 genes of other NPVs have been shown to be transcribed very early in the viral replication cycle and these promoters are capable of constitutive activity in cells (Jarvis et al., 1990, op cit). Their transcriptional activity is actually more complex, with a significant increase towards later stages of the replication cycle, and it has now been shown for the OpNPV that the IE-1 gene product is capable of auto-trans-activation in certain cell lines (Theilmann and Stewart, 1991). We therefore performed an experiment to show that the gene we identified by PCR amplification was indeed transcribed at early stages. A northern blot of RNA from HaNPV-infected cells taken at different stages post infection (p.i.) was probed with the cloned PCR product. This showed evidence for transcription as early as 8 h'-,4; pi., with an increase to a maximum at 48 h. p.i. (the last - 15 - stage tested). Similar observations have been made with the OpNPV IE-1 gene (Theilmann and Stewart, 1991). Mapping of Gene Probes made from the cloned PCR product were used to detect the restriction fragments of total HaNPV genomic DNA containing the putative IE-1 gene. The probe hybridized to the following restriction fragments: EcoRI fragments A and L or M, EcoRV fragment of 8kb, and Hindi I fragment D. The EcoRI and Hindi 11 fragments have all been completely mapped, so that the gene could be localised to a position at about 81 map units on the complete map of the HaNPV genome, and apparently spanning the junction between the two adjacent EcoRI A and L or M fragments. Fine mapping showed the gene to be located on a 2 kb Dral fragment in this region. Although the IE-1 promoter has been used in the present example, other active constitutive promoters are also suitable. For example, the actin promoter of H. armigera (Rourke and East, unpublished) or the promoter of any other abundantly expressed, but hitherto unidentified, gene in Heliothis spp. A strategy for obtaining such promoters is as follows: make cDNA clones to unselected abundant mRNAs in the cell, and then select those cDNAs which give the strongest bands upon hybridization to Northern blots of the unselected abundant cellular mRNAs. Then use these cDNAs to identify the relevant promoters from a genomic library. Candidate promoters would be further screened in transient expression assays. Appropriate fragments with the desired activity could then be used to drive the selectable gene in expression plasmids. X j .. VO"?'" ■: " \2 1 " '** ■> - 16 - 2 41 i 8 5 i Transformation of Cell-Line The three plasmids (from clone 2, 3 and 9) described above Were used to transform cells of H. zea BCIRL-HZ-AM1 (Mcintosh and Ignoffo, 1981) using the DOTMA reagent (Boehringer Mannheim) as specified by the manufacturer. After overnight transfection, medium and 10% FCS were added and left for 24 h. Selection was then applied by adding G418 (Sigma) to final concentrations of either 1 mg/ml or 0.5 mg/ml, in medium with 10% FCS. 4.5 ml of the filter-sterilized mixture were added to each transformation mix. Three cultures were grown at each of the two antibiotic concentrations. After 2 weeks, with one change of medium, selection pressure was removed in order to allow the surviving cells to grow. Only cells which had been exposed to 0.5 mg/ml G418 survived and grew. After six weeks growth in the absence of selection pressure, a sample of cells containing each of the three transforming plasmids was collected and stored frozen at -196°C. The Neo-resistance selection method proved to be difficult, with the cells showing poor recovery and growth. Further difficulties have been encountered in assessing the production of polyhedrin from the cell lines made with plasmids #2, 3 and 9. Accordingly, future PH + host cell lines will be made with plasmids which include the following: a selectable gene (e.g. the gpt gene or the amplifiable DHFR gene) driven by the AcNPV IE-1 or HaNPV IE-1 promoter; and the polyhedrin promoter and gene. Such plasmids may be used to transform cell lines either in the manner described above or through use • of v"* 0 -12 OCT 5?"" - 17 - 24;<a5i alternative transformation procedures such as electroporation or PEG transformation. Production of Occluded Viral Particles Infection of a PH* cell line with a virus whose genome lacks the polyhedrin gene should induce production of polyhedrin from the transgene in the cell line. Infection of the transformed HZ cells containing PH used budded virus particles of recombinant HaNPV PH", and involved exposure of transformed cells to liquid inoculum containing infectious particles derived from previous viral growth in cultured host cells. Alternative means for achieving infection include exposure of cells to virus particles purified from viral inclusion bodies, and introduction of infectious genetic material into cells through injection or transfection protocols. Results Observations to date, have been virus replication without the formation of polyhedra, and the accumulation of virus-free polyhedra, (the latter even when no virus was present). lleither result has yet been reproduced. It is believed that these results reflect preliminary difficulties in temporal coordination of polyhedrin expression due to one or more of the following reasons: 1. HaNPVPH" infection leads to host protein synthesis being switched off, so that no polyhedrin protein is expressed from the transgene. * \2 OCT 1992 A - 18 - 243851 This phenomena has been observed in baculovirus infection especially at the later stages of virus replication (12-18h pi, i.e. following replication and coinciding with production of extra-cellular (non-occluded) virus). The shut-off of host protein synthesis appears to result from the action of a late viral protein and an active RNA degradation process specific for host RNA's (Ooi and Miller, 1988). 2. A position effect such that the polyhedrin transgene present on the host cell chromosome cannot be transcribed in this location by the RNA polymerase responsible for transcription of the late NPV genes. 3. A significant basal (constitutive) level of expression from the polyhedrin promoter in virus free Friesen and Miller (1985, 1986) detected polyhedrin-related RNA's as early as 6 h p.i. but low-level constitutive expression is unlikely to be a problem in normally infected cells, since it would only occur for a few ho\irs before the cells began to make polyhedrin in large amounts. In contrast, the PH + transgenic cells might be able to express polyhedrin at levels from the polyhedrin promoter for extensive periods (i.e. until infected). Accumulation of polyhedrin and associated formation of virus-free polyhedra could affect either cell viability or virus replication, or both. Accordingly, production of occluded viral particles may be readily achieved by making one or more of the following modifications to the method above. cells o - 19 - i (A) Inactivation of the gene encoding the late viral protein responsible for the shut-off of host protein synthesis. This modification involves identifying the virus gene(s) causing the effect, followed by mutagenesis of the gene(s) to either abolish its activity or to make its function temperature sensitive. The gene may be readily identified by several ways including random mutagenesis of the virus genome by any of a number of standard techniques, followed by assay for a block of the virus-induced shut-off (preferably, this block would be temperature-sensitive). Efficient screening could be achieved by constructing a transgenic cell line carrying a selectable marker transgene (e.g. Neo) transcribed from a constitutive promoter, and applying Neo selection at some optional point (e.g. upon baculovirus infection). Virus able to induce the host protein shut-off would thereby prevent the cells expressing neo-resistance and therefore lead to cell death; only those cells replicating virus unable to induce the host protein shut-off would be able to express the resistance gene and survive. This strategy would probably require infection with highly diluted virus to ensure infection by a single-virus genome only. This may be achieved by the standard procedure known as end-point dilution. A candidate gene for inactivation in this modification is that which encodes a viral-induced 39 kd protein that has been observed to associate with chromatin at late times (approx 10 h p.i.: Friesen and Miller, 1986; Wilson and Miller, 1986). Such an association could be a factor in the shut-off of host protein synthesis, through a direct negative effect ,;/> ■u if 12 OCT 1992 bi - 20 - on host gene transcription. This suggests a direct, easily-testable approach: the appropriate viral gene is mutated to become temperature sensitive, allowing selective inactivation of the function in the transgenic cells which produce occluded virus. Temperature sensitive mutants which are unable to make the transition to later stages of the virus life-cycle have been described (Miller et al, 1983; Gordon and Carstens, 1984). Recombinant NPV's according to this modification may also be useful as expression systems for useful exogenous genes. (B) Providing the host cell with a transgene at an extra-chromosomal position. The promoters for both major very late proteins, plO and polyhedrin, of AcNPV, have been shown to exhibit virus-inducible activity when present on plasmids transfected into virus-infected insect cells (Knebel et al., 1985, Rankin et al. 1988, and Qin et al. 1989). These findings suggest that the very late viral genes do not need to be actually on the viral genome to be active and that transgenes located on plasmids capable of replication within the insect cell or on engineered mini-chromosomes, would be ^ capable of producing polyhedrin by escaping the virus-induced host protein synthesis shut-off. Such expression systems have been developed for yeast (derived from the 2 micron circle; Romanos et al. 1992) or plants (derived from viruses e.g. geminivirus; Kanevski et al. 1992). \2 CCtfi'37- ! - 21 - ^'J,5 arii This approach may also overcome the problem listed at (2) above. An easy test for testing whether the RNA polymerase responsible for the transcription of late viral genes cannot transcribe genes on the host chromosomes may be done by inserting a reporter gene (e.g. GUS) under the control of the viral polyhedrin promoter into a transfectable plasmid, and then by illegitimate recombination into the host chromosome, and comparing its expression before and after infection with wild-type or PH~-HaNPV. If expression from the transgene in the cell's chromosomes is not observed, it may be necessary to investigate whether virus replication is responsible for making the transgene inaccessible to the virus-induced RNA polymerase. Simple experimentation will involve expressing the gene for the virus-induced RNA polymerase under a normal promoter from a transfectable plasmid. Once again expression of a reporter gene (e.g. GUS) under the control of the polyhedrin promoter, initially cloned in a transfectable plasmid, and subsequently in the host chromosome will be compared before and after transfection with the plasmid expressing the gene for the virus RNA polymerase. An alternative to placing the transgene on a plasmid or mini-chromosome would be to have a chromosomally-sjted transgene excised from the chromosome at the appropriate stage of viral replication using an inducer or transposition based either in the virus or elsewhere. With sufficient chromosomal copies, it should be possible to have enough free plasmid-like DNAs available carrying the polyhedrin gene. Any episomal DNA carrying the polyhedrin gene may have to carry little or no-''' ' .o_ i ' < > sequence homology with the virus in order to prevent 'a O ,i ^20CT»92"' - 22 - 2<i385i recombination and the attendant risk of re-inserting the polyhedrin gene into the virus. It should be noted that Weyer and Possee (1987) found no evidence for recombination between a transfected plasmid carrying the plO-promoter/CAT gene construct and the virus (which actually also carried the plO promoter) in infected cells. (C) Transfecting PH4 host cells with a mixture of full-length genome virus and defective virus. Lee and Krell (1992) have observed that upon multiple serial passages (up to 81 in total) of AcNPV, most of the viral DNA contained in the extracellular virus particles was in the form of defective genomes consisting only of a highly reiterated 2.8 kbp fragment derived from map units 85.0 to 87.2 of AcNPV. This segment contains the important cis-acting elements sufficient for viral DNA replication and packaging, with all trans-acting factors required for replication apparently supplied by a small amount of full-length genome still present in the virus preparations. At this stage in the passaging, all the virus produced was the extracellular form; almost none of the infected cells produced any polyhedrin by 3 days p.i. and only some of the cells showed any cytopathic effects. These observations indicate that a mixture of mainly a defective genome virus with a small amount of full-length genome virus may not induce the shut-off of host gene expression at all, or only at later stages in the intracellular viral replication cycle. The absence of polyhedra production is likely to be due to the loss of the polyhedrin gene from the , ' ' 12 OCT 1992 - 23 - 24 , i) I defective genomes, which comprise most of the viral DNA available for transcription. Such defective genomes are likely to be suitable vectors for toxin genes, and it should be possible to achieve production of polyhedra containing mainly defective virus. The full-length genome to be used would lack the polyhedrin gene. (D) Driving the PH transgene with a virus-induced cellular promoter. A cellular gene, SF21, has been found to be activated by baculovirus infection (Mainprize et al., unpublished, cited in Fresen & Miller, 1986). Thus, in this modification the host cell would be transfected with a vector substantially as described above but with the polyhedrin promoter replaced by the SF21 or another virus-induced cellular promoter. Other virus-induced genes may be isolated by making DNA clones to mRNA's induced at the desired very late stages of virus replication and then screening by probing against virus DNA. Any cDNA probes which do not hybridize to virus DNA would be selected. To avoid any potential viral-induced RNA degradation problem, it is preferable to modify such virus-induced cellular promoters to include the consensus sequences identified at the 5'-ends of late baculovirus mRNA (Miller, 1988). (E) Repressing the polyhedrin transgene transcription by promoter occlusion. The basal (constitutive) level of transcription may be easily investigated using a reporter gene (e. g>N r ^ r* ■ J - y 12 OCT 1992 - 24 - 'i t S O ') I GUS) in both transient expression studies and transgenic cell experiments. If the basal transcription level is significant then this modification would involve placing the polyhedrin gene within suitable proximity to a host gene such that polyhedrin transcription is repressed via promoter occlusion or some other mechanism. This repression would cease to function when host gene transcription is reduced at late and very late stages of infection. (F) Transfecting the PH+ host cells with PH HaNPV at low MO I . The rate of reduction of host protein synthesis is dependent on the multiplicity of infection (MOI). At higher MOI's, host proteins are more rapidly reduced than at lower MOI's (Maruniak and Summers, 1981). It is therefore preferable for our strategy to determine the lowest possible MOI capable of yielding economically viable titres of occluded virus. A virus capable, whether naturally or through modification, of replicating rapidly at late stages and accumulating high amounts of polyhedra, after infection at a lower MOI, would overcome the present dif.fi cul ties. Other alternative modifications may be made including exploiting the apparent reduction in splicing capability at very late stages of NPV infection. The leader sequence of the polyhedrin mRNA could be modified to incorporate a splicing donor site, and the sequence of the polyhedrin open reading frame modified in a non-deleterious manner to create a splice acceptor site. In this strategy it may also be necessary to make other minor modifications to generate other sequences needed for splicing (e.g. the / * 12 OCT 1992 2<i;j85i - 25 - lariat site-upstream of the splice acceptor) (Padgett et al. 1986). As a result of these changes to the polyhedrin gene, splicing would destroy the polyhedrin mRNA in uninfected cells, and at early to late stages of infection, but not at very late stages. Isolating Occluded Viral Particles Occluded viral particles of recombinant HaNPV will be released into the tissue culture medium by virally-induced lysis of infected cells, and may also remain associated with unlysed cells or lysed cell debris. Liquid medium will be removed from the culture, and remaining cellular material will be mechanically or enzymatically separated from its solid support. Occluded viral particles will be purified from these sources by processes which may involve differential centrifugation. EXAMPLE 2 OCCLUDED VIRAL P^TICLES COMPRISING HaEPVsph" Like mammalian poxviruses, EPVs replicate in the cytoplasm of infected cells. Nonetheless, it is preferable for the present invention that in the transgenic cell line, the trans (encoding, for example, spheroidin) gene will be expressed in the nucleus at the appropriate stage in the virus life-cycle. The strategy involves expressing a molecular switch (e.g. the transcription factor IE-1 gene of HaNPV under the control of a late HaEPV promoter) in the recombinant sph~EPV in order to switch on spheroidin gene transcription in the nucleus. Production of sph HaEPV and Introduction of Marker Gene . > ,t and Transactivator Gene ni} 1 \2 OCT 1992 - 26 - Using published sequence data (Vialard et al. 1990), oligonucleotide primers were designed for use in the polymerase chain reaction (PCR). Using restriction-digested genomic DNA prepared from an EPV of Heliothis armigera (HaEPV) as template, a fragment of the HaEPV spheroidin (sph) gene was then amplified. This fragment was used as template for synthesis of radioactively-labelled probe, which, in turn, was used in Southern blotting protocols to localise the sph gene to a restriction fragment, of identifiable size. From this work it was established that the gene is located in a 4.9 kilobase (kb) Bglll fragment, and on an EcoRI fragment of approximately 9 kb. This Bglll fragment was subsequently cloned and sequenced. The bacterial reporter gene GUS was placed between the sph promoter and gene, in a Bam HI site which had been created by site-directed mutagenesis of the cloned Bglll genomic fragment. The resultant DMA fragment is then used, together with isolated, but unaltered, genomic HaEPV DNA, or infectious HaEPV virions, to cotransfect or infect/transfect cultured Helicoverpa BCIRL-Hz-AMI cells using DOTMA reagent (Boehringer Mannheim). Replication of HaEPV in the cotransfected cells should be accompanied by the phenomenon of homologous recombination, resulting in the integration of a portion of the reporter-containing construct into the genome of the virus. This process will thus give rise to a recombinant virus (recHaEPV) which will carry the GUS gene in place of the native viral sph gene. Expression of the reporter gene will be driven by the sph promoter, and may be detected by standard enzymic assays. Detection of GUS activity significantly above control background levels will indicate the generation of recHaEPV. *uor- - 27 - 4 <5 8 i) i In the final construct the HaEPV will carry the IE-1 gene in place of the GUS gene. The IE-1 gene may be placed 3' to the spheroidin promoter in a manner similar to that described above for the GUS gene. The IE-1 gene may further include a nuclear localisation signal (e.g. from SV40 T antigen). Insertion may be facilitated by using PCR primers carrying appropriate restriction sites. The resultant plasmid will then be used to cotransfect (with genomic HaEPV DNA or infectious HaEPV virions) cultured ffelicoverpa cells as described above. Production of sph+ Host Cell Line The sequence of the AcNPV delayed early (DE) gene has been published (Guarino and Summers 1986a). This gene provides a promoter suitable for expressing the spheroidin coding sequence in a host cell. Alternatively the HaEPV or a heterologous spheroidin promoter or the promoter from the Ha NPV DE gene may be used. The HaNPV DE gene may be isolated by designing appropriate primers from the AcNPV DE sequence and amplifying the DE gene by PCR. The DE genes are capable of being significantly trans-activated by the IE-1 gene product, especially when the promoter is placed adjacent to a copy of the homologous repeat (hr) sequences present on the baculovirus genome (Guarino and Summers, 1986b; Theilmann and Stewart, 1991). Constructs carrying the spheroidin encoding sequences linked to the DE or other suitable promoter and a selectable marker gene will be used to transfect a host cell in a manner similar to that described in Example 1. Production of Occluded Viral Particles . , ? ; \2 0CT \~fP- - 28 - 2 4 ■'* 8 Infection of the sph cell line with the recombinant IE-1+ sph~ HaEPV should induce production of spheroidin from the transgene in the cell line. Infection may be initiated by several methods including the use of budded virus particles by exposure of cells to liquid inoculum containing infectious particles derived from previous viral growth in cultured host cells. It is possible that problems analogous to those encountered for NPV may also apply to EPV. If so, the modifications to the method of production required to produce EPV-containing occluded viral particles according to the invention may be analogous to those proposed in Example 1. However, HaEPV is capable of growing persistently in vitro in cells of H. zea and does not induce any obvious processes leading to cell death and disintegration, even after 14 days p.i. Thus it is expected that occluded viral particles according to the invention may be readily produced by infecting transgenic sph-* H. zea cells (particularly, strain BCIRL-Hz-AMI) with sph~ HaEPV without the difficulties encountered with NPV. Occluded viral particles may be purified from these sources by processes which may involve differential centrifugati on. TEST METHODS - TISSUE CULTURE_TRIALS Different transgenic host cell lines may give rise to variation in the number of occluded viral particles produced per host cell; the mean number of infectious viruses occluded within each particle; and the ease of, liberation of viruses from occluded viral particles. I uoc> - 29 - 24^651 Those cells lines exhibiting the most desirable balance of characteristics will be selected by simple quantification of the number of occluded viral particles produced following inoculation with standard amounts of HaNPV PH or HaEPVsph", and determination of host cell TCID50 of viruses liberated from a given number of occluded viral particles under standard processing conditions. Small-scale laboratory and glasshouse trials using target insects may also provide important indications of the suitability of selected methods for large scale viral particle production and subsequent use in the field. In these trials, insects would be raised on an artificial diet containing occluded viral particles, thus allowing a rapid and sensitive bioassay of the infectivity and non-persistence of the viral particles. References Chisholm, G.E. and Henner, D.J., 1988 J. Virol. 62 : 3193-3200 Friesen, P.D. & Miller L.K., (1985) J. Virol. 54: 392-400 Friesen P.D. & Miller, L.K. (1986) Current Topics in Microbiology and Immunology, 131: Granados, R.R. & Williams, K.A. 1986. In vivo infection and replication of baculoviruses in "The Biology of Baculoviruses" Vol. 1. Guarino L.A. and Summers, M.D., (1986a) J. Virol. 57: 563-571 _ t. Guarino, L.A. and Summers, M.D. (1986b) J. Virol. 60: 215-223 J'.j V i «>• i \ - 30 - Guarino L.A. and Summers, M.D. (1987) J. Virol. 61: 2091-2099 Jarvis, D.L., Fleming, J.G.W., Kovacs, G.R., Summers, M.D., Guarino, L.A. (1990) Bio/Technology 8:950-955 Kanevski, I.F., Takur, S., Cosowsky, L. , Sunter G., Brough C., Bisaro D. and Maliga P. (1992) The Plant Journal 2: 457-463 Kaufman, R. J. 1990 Methods in Enzymology 185, 537-566. Knebel D., Luebbert H., Doerfler W. (1985) EMB0 J 4:1301-1306 Lee H.Y. and Krell, P.J. (1992) J. Virol. 66: 4339-4347 Low, K. 1988 The Recombination of Genetic Material. Academic Press, New York Maruniak J.E. & Summers M.D. (1981) Virology 109: 25-34 Miller, L.K., Trimarchi R.E., Browne D. , Pennock G.D. (1983) Virology 126: 376-380 Miller, L.K. (1988) Ann. Rev. Microbiol. 42: 177-199 Mcintosh, A.H. and Ignoffo G.M. (1983) J. Invertebr. Pathol. 38: 395-403 Ooi, B.G. & Miller L.K. (1988) Virology 166: 515-523 Qin J., Liu, A., Weaver, R.F. (1989) J. Gen. Virol 70:1273-1279 vi. i 2-18851 - 31 - Rankin, C., Ooi B.G. & Miller, L.K. (1988) Gene 70:39-49 Romanos, M.A., Scorer, C.A. and Clare, J.J. (1992) Yeast 8: 423-488 Rourke and East, unpublished Sambrook, J. et al. (1989) Molecular Cloning: a laboratory Manual, Second Edition, Cold Spring Harbor Laboratories Press. Shieh, T.R. (1989) Industrial Production of Viral Pesticides Adv. Virus. Res. 36, 315-343. Tarrant, D. (1991) Weekend Australian Magazine October 13-14 pp 29-40. Teakle R.E. and Jensen J.M. (1985) Heliothis punctiqer. In Singh, P. and Moore R.F. (eds) Handbook of insect rearing, Vol. 2 Elsevier, Amsterdam, PP. 313-322. Theilman D.A. and Stewart S. (1991) Virology 180:492-508 Vialard, J.E., Yuen, L. &. Richardson, C.D. (1990) J. Virol. 64:5804-5811 Vlak, J.M. Genetic Engineering of Baculoviruses for Insect Control. in press in 'Molecular Approaches to Fundamental and Applied Entomology'. Oakeshott, J.G. & Whitten, M.J., eds. SpringerVerlag, New York. Weyer U. and Possee R.D. (1987) Nucl. Acids Res. 16:3635-3653 Wilson M.E. and Miller, L.K. (1986) Virology 151: 315-328 , ■ c r - 32 - Wurm, F. M. et. al. (1986) Proc. Natl. Acad. Sci. USA 83, 5414-5418. </div>

Claims

<div class="application article clearfix printTableText" id="claims"> 342>"8£>f 33 WHAT HWE CLAIM IS:

1. A replicative insect virus characterized by a reduced capacity, as compared to wild-type virus, to occlude viral particles.

2 _ A replicative recombinant insect virus characterized by a reduced capacity, as compared to wild-type virus, to occlude viral particles.

3. A virus according to claim 1 or 2 further characterized in that it is a virus selected from the group consisting of baculoviruses, entomopoxviruses and occluded reoviruses.

4. A virus according to claim 3 further characterized in that it is a virus selected from the group consisting of NPV baculoviruses, GV baculoviruses and Genus A, Genus

B and Genus C entomopoxviruses.

5. A method for limiting the persistence of an insect virus comprising alteration of the genome of the virus to ensure that the resulting altered virus has a reduced capacity, as compared to wild-type virus, to occlud® viral particles.

6. A melliod according to c.l aim 5 wherein alteration of the genome is by recombinant DMA techniques or mutation by a chemical mutagen or mutagenizing light.

7. A method according to claim 5 or 6 wherein the insect virus is selected from the group consisting of baculoviruses, entomopoxviruses and occluded reoviruses.

8. A method according to claim 7 wherein the insect virus is selected from the group consisting of

- 34 -

*4

i baculoviruses, GV baculoviruses and Genus A, Genus B /

and Genus C entomopoxviruses.

9. An occluded viral particle comprising all or a portion of at least one insect virus genome, wherein said occluded viral particle, following ingestion thereof by an insect host, effects a viral infection without producing further occluded viral particles.

10. An occluded viral particle according to claim 9 wherein the at least one insect virus genome is a genome from a virus selected from the group consisting of baculoviruses, entomopoxviruses and occluded reoviruses.

11. An occluded viral particle according to claim 10 wherein the at least one insect virus genome is a genome from a baculovirus.

12. An occluded viral particle according to claim 11 in which the genome is from a NPV or GV baculovirus.

13. An occluded viral particle according to claim 10 wherein the at least one insect virus genome is a genome from a entomopoxvirus.

14. An occluded viral particle according to claim 13 in which the genome is from a Genus A, Genus B or Genus C entomopoxvirus.

15. An occluded viral particle according to any one of claims 9 to 13 wherein the at least one insect virus genome is incapable of producing occlusion protein.

16. An occluded viral particle according to claim 11 or 12 wherein the at least one baculovirus genome is incapable of producing polyhedrin.

17. An occluded viral particle according to claim 13 0^.14

(■ '■ '<_•> \

wherein the at least one entomopoxvirus genome is/ ^

incapable of producing spheroidin. •

K ' *

v

-35 - ^ ^ 81'

^ /

18. An occluded viral particle according to any one of claims 9 to 17 wherein the at least one insect virus genome includes one or more exogenous nucleic acid sequences encoding substances that are deleterious to insects.

19* An occluded viral particle according to any one of claims 9 to 18 comprising all or a portion of a single insect virus genome.

20. a method for the preparation of occluded viral particles according to any one of claims 9 to 19/ which method comprises:

providing an insect virus deficient in a functional gene or genes which encode (s) at least one viral protein essential for producing occluded viral particles in a host cell;

providing a transgenic organism capable of expressing the at least one viral protein not encoded by said insect virus; and infecting or transfecting said transgenic organism with said insect virus.

21. A method according to claim 20 wherein the transgenic organirm is a cultured insect cell line.

22. t\ method according to claim 20 or 21 wherein the transgene(s) encoding the at least: one viral protein not encoded by said insect virus in the transgenic organism is provided at an extra-chromosomal location.

23. A method according to claim 20, 21 or 22 wherein the insect virus is a PH" baculovirus and the transgenic organism is FH+.

0

■>

36

24. A method according to claim 20, 21 or 22 wherein the insect virus is an sph" entomopoxvirus and the transgenic organism is sph'.

25. A method according to claim 23 wherein the transgenic organism has multiple expressible copies of PH.

26. A method according to claim 24 wherein the transgenic organism has multiple expressible copies of sph.

27. A method according to any one of claims 20 to 26 wherein the insect virus is also deficient in a functional gene or gene(s) encoding viral protein(s) responsible for the shut-off of host protein synthesis.

28. A method according to any one of claims 20 to 27 wherein infection or transfection of said transgenic organism with said insect virus is by a mixture of full-length genome and defective forms.

29. A method according to any one of claims 20 to 28 wherein the transgene(s) encoding the at least one viral protein not encoded by said insect virus in the transgenic organism is operatively linked to a virus induced cellular promotpr.

30. A method according to claim 2 9 in which the promoter is the SF21 promoter.

31. A met-bod according to any one of claims 20 to 28 wherein the transgene(s) encoding the at least one viral protein not encoded by said insect virus in the transgenic organism is operatively linked to a late viral promoter and located at a site within the host's genome such that transcription from the transgene is repressed by promoter occlusion.

fi

24 3 8 5 1

- 37 -

32 A method according to any one of claims 20 to 31

wherein infection or transfection of the transgenic organism with said insect virus is at a low multiplicity of infection (MOI).

33. An isolated DMA molecule comprising the nucleotide sequence of the HaNPV polyhedrin promoter and/or HaNPV polyhedrin encoding region.

34_ An isolated DNA molecule comprising all or part of the nucleotide sequence substantially as shown in Figure 1.

35. A recombinant HaNPV PH~ including an exogenous nucleotide sequence located within the polyhedrin-encoding and/or promoter region.

36. A recombinant HaNPV PH" according to claim 35 wherein the exogenous nucleotide sequence encodes a substance that is deleterious to insects.

37. A recombinant HaNPV PH according to claim 36 wherein the exogenous nucleotide sequence encodes a substance selected from the group consisting of Bacillus thuvingiensis 5-toxin, .insect neurohormones and insecticidal compounds from wasp or scorpion venom or of other heterologous viral origin.

38. A recombinant HaNPV PH ~ according to any one of claims 35 to 37 wherein the exogenous nucleotide sequence is operatively linked to the HaNPV polyhedrin promoter.

39. A method for controlling the proliferation of pest insects in an area infested by said insects, said method comprising applying over said area an insect virus according to any one of claims 1 to 4 and 35 tP-

i *v-'

V -

- 38 -

38, or an occluded viral particle according to any one of claims 9 to 19, said insect virus or occluded viral particle being in admixture with an agriculturally acceptable carrier.

40. An isolated DNA molecule comprising the nucleotide sequence of the HaNPV IE-1 promoter and/or the HaNPV IE-1 encoding region.

41. An isolated DNA molecule comprising all or part of the nucleotide sequence substantially as shown in Figure

42. A replicative insect virus as claimed in claim 1 and substantially as herein described with reference to any one of the Examples and Drawings.

43. An occluded viral particle as claimed in claim 9 and substantially as herein described with reference to any of the Examples and Drawings.

44. A method for limiting the persistence of an insect virus as claimed in claim 5 and substantially as herein described with reference to any one of the Examples and Drawings.

2 .

COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION

By their Attorneys BALDWIN. SON & CAREY

</div>