<div class="application article clearfix" id="description">
<p class="printTableText" lang="en">22 4 7 <br><br>
Priority Data(s): .. ."S?.. £r. 57?; <br><br>
Publication Date: P.O. Jlournal, No: <br><br>
26 <br><br>
Patents Form No. 5 <br><br>
COMPLETE SPECIFI <br><br>
PATENTS ACT 1 <br><br>
NEW ZEALAND <br><br>
AIDS DIAGNOSIS TEST BASED ON THE DETECTION OF A DIVERSITiuF THE ISOTYPIC RESPONSE, VACCINES AND SEROTHERAPIES <br><br>
I/We, TRANSGENE S.A., 16 rue Henri Regnault/ <br><br>
92400 Courbevoie, France* INSTITUT PASTEUR DE LILLE/ BP 245, 1 rue du Professeur Calmette, 59019 Lille Cedex, France, and INSTITUT PASTEUR, of 25, rue du Docteur Roux, 75015 Paris, France, a French Body corporate, a French National Institute and a French National 'Institute respectively, ;hereby declare the invention, for which I/we pray that a patent may be granted to me/us, and the method by which it is to be performed, to be particularly described in and by the following statement: ;- 1 ;(followed by page la) ;224742 ;The present invention relates to a new test for the diagnosis of AIDS; this test makes it possible to reveal all the classes of antibodies which appear after an infection by the AIDS virus and thus to detect serums which, in the antibody detection kits available at present, appear, wrongly, as seronegative; this test also makes it possible to improve the prognosis of the development of the disease. ;More particularly, the present invention relates to: ;- on the one hand, the use, for diagnostic purposes, of the immunocapture of certain classes of antibodies, ;called isotypes, which are not recognized by the current tests, and ;- on the other hand, the immunodetection of antibodies raised against the F protein of the LAV (or HIV) virus, a protein which does not form part of the current kits and which appears as an important marker of infection by the HIV virus. ;The working hypotheses which have led to the present invention are based on observations and analyses of immune mechanisms which intervene in parasitic diseases, in particular schistosomiasis and toxoplasmosis. ;The studies on the immunogenicity and the protective power of various proteins of the schistosomes have shown that proteins which are excreted/secreted and are transitorily expressed at membrane level play a part in the development of the protective immune response. ;On the other hand, the antibodies raised against the membrane antigens appear more as infection markers than as effectors in the mechanisms of defense against infection. In fact, it seems normal that during a chronic infection, when the parasite survives in the individual in the presence of a concomitant immunity, the surface antigens are not the targets of the immunity since they are essential to the survival of the parasite. Moreover, recent studies have shown that these membrane antigens induced blocking antibodies capable of inhibiting the cytotoxic-dependent response of the antibodies. ;In these models of parasitic infection, the analysis ;(followed by page 2) ;22 4 7 42 ;- 2 - ;of the effector and immunoreguLator mechanisms underlines the importance and the particular role of certain classes of antibodies and provides an illustration of the phenomenon of isotypic restriction and selection. (A recent development in the interpretation, at a molecular level, ;of the phenomena of isotypic restriction is to be found in the paper by Cebra et al. 1984.) ;The studies carried out on schistosomiasis (review by Capron and Capron, 1986) indicate clearly the existence of an isotypic selection in the recognition of certain antigens and the induction, by the same antigen or even the same epitope, of effector isotypes and blocking isotypes (in animal models - Grzych et al. 1984 - and in man - Khalife et al. 1986). ;ALL these observations have made it possible to form the theory that an antibody response, such as is measured globally in the customary tests, is functionally only the result of effector and blocking activities associated with certain isotypes, and that the efficacy of an immune response is as dependent on negative factors of regulation as on positive markers of protection (Capron et al. 1983). ;The original theories derived from these studies can be applied to other chronic infections and, in particular, to viral infections of slow and progressive development such as that of the AIDS virus (HIV). ;In some of its characteristics (length of development, antigenic variation, latency, chronicity, intracellular multiplication, mechanism of escape from the immune response of the host), the HIV virus seems to meet certain infection method criteria of the parasitic models previously studied. Although numerous serological studies have been carried out on infection by the HIV and although the raising of certain classes or subclasses of antibodies has been reported, no comprehensive study has yet been carried out with the aim of determining, for each of the viral proteins, the existence of a selective or restricted isotypic response. This study is particularly important because the AIDS diagnosis test which is currently used, and which detects the ;presence of antibodies in human serums, does not reveal all the isotypes. In fact, the test comprises, as the indicator of seropositivity, total anti-IgG. These anti-IgG only detect the IgG4 slightly and do not detect the antibodies of classes IgM, IgA and IgE. ;Individuals positive only for the antibodies of these isotypes appear as negative in the test. Thus, certain stages in the development of the disease, in particular the early stages, can give a different isotypic response from the later stages and can thus escape detection. ;It should also be noted that the detection of iso-type antibodies IgG4, IgA and IgM (which correspond generally to blocking antibodies) may explain the low levels of seroneutra Iizing antibodies detected in the serums of pat ients. ;The present invention is based, on the one hand, on the immunocapture, using anti-antibodies specific to isotypes, of IgG1, IgG3 and IgG4, IgM, IgA and IgE raised against the various proteins expressed by the HIV virus, and in particular the proteins encoded by the gag gene and the F gene, or again of the peptides derived from the F protein, in particular the peptides corresponding to the amino acids 45 to 69 and 98 to 112. These peptides can be prepared by in vitro synthesis. ;It is for this reason that the invention also has as its subject two new peptides, of sequence: ;45 to 69 : SSNTAATNAACAWLEAQEEEEVGFP 98 to 112 : EGLIHSQRRQDILDL ;The present invention is based, furthermore, on the detection of an immune response against the F protein of the HIV virus, a protein which does not form part of the current kits, or against the peptides derived from the F protein such as have been defined above. Even if the role of the F protein in the infection mechanism has not yet been established definitiveLy, the detection of an anti-F response makes it possible to improve the diagnosis and to provide indications on the state of development of the disease. ;Finally, the invention is based on the use of new ;9 o A Z' • t t ;4 2 ;10 ;15 ;- 4 - ;proteins as vaccinating agents. ;The present invention relates to a method for in vitro diagnosis of AIDS in a patient, by detection of the antibodies raised against certain proteins specific to the HIV virus in a biological sample from the said patient, following an indirect immunodetection procedure in which: ;a) the said protein or proteins of the HIV virus are fixed, separated, on a support, ;b) the fixed proteins are brought into contact with the biological sample from the said patient which may contain the said antibodies, and c) after the immunocapture of the antibodies, the presence of the fixed antibodies is detected using labeled anti-antibodies, ;a method wherein, among the labeled anti-antibodies providing for the detection, at least one is specific to an isotype. ;More particularly, the invention relates to a method for in vitro diagnosis of AIDS in a patient, by detection of the antibodies raised against F protein specific to the HIV virus or peptides derived from this protein in a biological sample from the said patient, following an indirect immuno-detection procedure in which : ;a) the said protein of the HIV virus or the said peptides derived from this protein are fixed on a support, ;b) these fixed protein or peptides are brought into contact with the biological sample from the said patient which may contain the said antibodies, and after the immunocapture of the antibodies, the presence of the fixed antibodies is detected using labeled anti-antibodies, ;wherein, among the labeled anti-antibodies providing for the detection, at east one is specific to an isotype. ;The indirect immunodetection procedure is known to e expert without it being necessary to describe it in detail. Additional information can be found in the examples. ;g The biological sample tested will in general be a serum. ;The support may be of any type, but most of the time it will be made up of strips of nitrocellulose. ;(followed by page 4a) ;4a ;P P .4 7.1 ;fw /C -1 i •] ;Similarly, the methods for detection of the anti-antibodies are known techniques. The anti-antibodies are labeled by an enzyme, the detection being effected by addition of the substrate of the enzyme, or else the anti-antibodies are labeled by a radioactive isotope. The conditions for implementation of these different steps are known, and some are described in detail in the examples. ;In order to permit a precise analysis providing for a reliable diagnosis/ at least two anti-antibodies will preferably be used. ;It will be preferable to use a set of anti-antibodies covering all the isotypes. ;Among the interesting isotypes which are not detected by the current kits, which detect the total IgG, there may be ;(followed by page 5) ;22 4 7 4 2 ;mentioned the IgM, the IgA and the IgE. ;Similarly, it is preferable to be able to detect the different isotypes separately, in order to improve the prognosis of the development of the disease. ;Among the fixed proteins there may be one or more of the proteins corresponding to the GAG, POL, ENV gene and the peptides derived from these proteins and/or the F protein or the peptides derived from the F protein. ;Of course, these different proteins are separated by polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred, as is customary, onto nitrocellulose membrane, but it is possible to provide for other separation treatments. ;In some cases these proteins can be obtained by genetic recombination, for example the env protein, the F protein and the p25 protein; it is this type of protein which will be used more particularly in the method of the i nven t i on. ;In the methods according to the invention, in addition to the kits comprising at least one or more proteins of the HIV virus which have been previously isolated and are chosen from among the proteins corresponding to the gene: ;- GAG (p55, p40, p25, p18 and p13) ;- POL ;- ENV (gp160, gp120 and gp40) ;- F protein, ;and at least one anti-antibody specific to an isotype chosen from among IgG1, IgG3, IgG4, IgA, IgM, IgE, the following kits are more particularly interesting: ;- the diagnosis kits which comprise at Least the F protein and the env protein and at Least one anti-antibody specific to the isotypes IgGl, IgG4, IgA, IgM or Ig£, and ;- the diagnosis kits which comprise at least the env protein, the p25 protein or the protein corresponding to the GAG gene and at Least one anti-antibody specify to the isotype IgA, IgE, IgG1, IgG3, IgG4 and/or IgM. ;Of course, it is always possible to add other isotypes. ;Similarly, kits containing the F protein or ;22 4 7 4 2 ;peptides derived from the Latter among the detectable antigens (ELISA or Western Blot) can make it possible to reach an early diagnosis and to eliminate certain false negatives In this case, anti-antibodies specific to the different isotypes or total anti-IgG can be used. ;Moreover, the detection of these isotypes makes it possible to contemplate vaccines against AIDS which have innovatory features compared to the current ideas. In fact as has been indicated previously, some of the induced antibodies are of the effector type while others are of the blocking type. Only the antigens producing a response of the effector type can permit immunization. ;It is for this reason that the present invention relates to vaccines intended for the treatment and prevention of conditions associated with the presence of an HIV virus in a patient, wherein the vaccinating agent used is an HIV virus antigenic protein modified in order to induce effector and non-blocking isotype antibodies. ;Among these HIV virus antigenic proteins there will preferably be chosen the modified proteins capable of inducing antibodies of the effector type. ;The proteins to be modified will be, as previously, those corresponding to the GAG, POL, ENV gene, ;the F or Q protein or the peptides derived from these prote ins. ;Finally, the use of news serotherapies may be envisaged. In fact, a passive transfer of effector antibodies produced in man - without his necessarily having been exposed to the HIV - or in animals or culture cells may be envisaged in the treatment of the seropositive individuals who are asymptomatic or show clinical signs. ;It is known that such a therapy has beneficial effects in the treatment of parasitic infections (experimental schistosomiasis) or the treatment of tumors (colorectal cancer) both in man and in animals. ;It is also possible to envisage the preparation and use of monoclonal antibodies. ;The present invention thus relates to the use of effector antibodies, especially of particular isotypes ;O ;10 ;15 ;20 ;25 ;30 ;- 7 ;22 4 7 4 2 ;with a seroneutraLizing and/or cytotoxic effect, against the proteins of the HIV virus in the treatment of AIDS. The effector antibodies can be obtained by immunization using proteins modified as described previously, or by separation of the natural isotypes and elimination of the blocking isotypes. ;On the other hand, in cases where antibodies with a blocking activity have been detected in seropositive individuals, the injection of antibodies directed against these blocking antibodies may be envisaged. These antibodies may be of animal origin. ;The following figures illustrate the examples: ;Figure 1 ;Figure 2 ;Figure 3 ;Figure 4 ;35 Figure 5 ;Electrophoresis, on 15 % acrylamide gel/SDS, of the extracts of bacteria transformed by the plasmids pTG959 (1), control, and pTG1166 (2), carrying the F gene. ;Immunocapture and specific detection of the antibodies of cLass IgA in the serum of 27 patients. The control strip shown with the IgG (control for the LAV-BLOT test) indicates the position and the nature of the various proteins of the HIV. ;Immunocapture and specific detection of the antibodies of class IgM in the serum of 22 patients. The control strip shown with the IgG (control for the LAV-BLOT test) indicates the position and the nature of the various proteins of the HIV. ;Immunocapture and specific detection of the antibodies of class IgE in the serum of 4 patients. The control strip shown with the IgG (control for the LAV-BLOT test) indicates the position and the nature of the various proteins of the HIV. ;Immunocapture and specific detection of the antibodies of isotype IgG1 in serum of 25 patients. The control strip shown with the IgG (control for the LAV-BLOT test) indicates the position and the nature of the various ;X ;22 47 4 2 ;c ;G ;G ;- 8 ;proteins of the HIV. ;Figure 6 : Immunocapture and specific detection of the antibodies of isotype IgG3 in the serum of 25 patients. The control strip shown with the 5 IgG (control for the LAV-BLOT test) indicates the position and the nature of the various proteins of the HIV. ;Figure 7 : Immunocapture and specific detection of the antibodies of isotype IgG4 in the serum of 25 10 patients. The control strip shown with the ;IgG (control for the LAV-BLOT test) indicates the position and the nature of the various proteins of the HIV. ;Figure 8 : Immunocapture and specific detection of the 15 isotypes IgG1, IgG3, IgG4, IgA, IgM and IgE in the serum of several specific patients (the responses in patients no. 6 and no. 20 are analyzed in example 3). ;Figure 9 : Immunocapture and detection of the antibodies 20 raised against the F protein of the HIV virus in the serum of 43 patients. The F protein fixed on the nitrocellulose was produced by genetic engineering in E. coli. The antibodies are shown with total anti-IgG. ;25 Figure 10 : Detection of the antibodies raised against the ;F protein of the HIV virus in the serums of 2 patients monitored over a period of time (3 samp Ii ngs) . ;Figure 11A : Isotypic distribution of the antibodies recog-30 nizing the F antigen and the peptides derived from F in the serum of 6 seronegative individuals at risk. ;11B : Isotypic distribution of the antibodies recognizing the peptides derived from F in the serums of 21 individuals exhibiting anti-F antibodies. ;35 Example I ;Study of the isotypic response of individuals infected by the HIV virus. ;22 4 7 4 2 ;The study involves more than 100 samples of serums recognized as positive in the rapid diagnosis tests using the ELISA technique (tests marketed by Abbott, Organon, Diagnostics Pasteur, Welcome), tests currently used in blood transfusion centers. ;The antigenic specificity of the response (that is to say against the ENV, GAG or POL proteins) is analyzed by "LAV-BLOT" (kit marketed by Diagnostics Pasteur). ;The test is based on the principle of the indirect ELISA on nitrocellulose sensitized with viral proteins. The proteins of the inactivated LAV virus are separated by electrophoresis on polyacrylamide gel in a dissociating and reducing medium and then transferred onto nitrocellulose membrane. The implementation of the test comprises the following steps: ;- Pre-cut nitrocellulose strips are saturated using skimmed milk in order to avoid non-specific adsorptions. ;- Each sample to be tested or control serum is incubated with a nitrocellulose strip. If anti-LAV antibodies are present, they bind to the viral antigens fixed on the strip. ;- After washing, an anti-IgG human antibody, labeled with peroxidase, is added and incubated. It binds to the anti-LAV antibodies held on the solid support. ;- The activity of the complexes bound to the nitrocellulose is revealed, after washing, by addition of the substrate of the enzyme. ;- The presence of anti-LAV antibodies in the serum is seen by the appearance of specific colored bands. The position of the colored bands corresponds to the molecuLar weights of the viral proteins fixed on the nitrocellulose. The proteins recognized by the test are: GP160, precursor of GP110; GP110, envelope of the virus; P68, polymerase; P55, precursor of the internal proteins (GAG); GP41, transmembrane protein; P 4 0, precursor of the internal proteins; P34, endonuc lease; P25, P18 and P13 internal proteins. ;- The interpretation of the results is carried out by aligning the strips from the test with that of the seropositive control. ;The LAV-BLOT test detects the antibodies of class ;- 10 - ;IgG. If antibodies of another sub-type are fixed on the nitrocellulose strips, they are not detected. ;The test can then be improved by the detection of IgA, IgM and IgE; moreover, among the antibodies of class IgG, the detection can be refined by specifically detecting the isotypes IgG1, IgG3 or lgG4. ;The basic technique of the study is based on the use, in the "Western Blot" test, of monoclonal antibodies directed against the classes or the subclasses of human antibodies, with the exception of IgG2, of which the monoclonal antibody is recognized as lacking in activity. ;For each serum which justifies a detailed analysis, it is thus expedient to carry out 6 tests in parallel on the nitrocellulose strips from the LAV-BLOT kit and then to detect the fixed antibodies by means of specific anti-antibodies. Each strip is shown with an anti-antibody. The anti-IgA are sold by TAGO-BIOSOFT; the anti-IgM are sold by MILES; the anti-IgG1, lgG3 and IgG4 are sold by Seward. ;- The first step in the adsorption of the patients' serum on the strips is carried out in accordance with the directions from the supplier (LAV-BLOT): after saturation of the nitrocellulose in the presence of PBS + 5 % milk, pH 7.4, the serums diluted to 1/501h are incubated with continuous stirring, at room temperature for one hour and then at 4°C for one night. The strips are then washed 3 times for a period of 10 minutes. The antibody specific to each class or subclass is then added. ;- Detection of IgM and IgA: ;The anti-IgA monoclonal antibody (sold by TAGO-BIOSOFT), specific to Fc, is used in a dilution of 1/1,000; the anti-IgM monoclonal antibody (sold by MILES), specific to Fc, is used in a dilution of 1/1,000; these antibodies are labeled with peroxidase; after incubation at room temperature for 3 hours, the strips are washed 3 times and the peroxidase activity is then detected by a color reaction with 60 mg HRP (HRP-color: 4-chIoro-1-naphtho I, supplied by BIO-RAD) + 20 ml ethanol + 100 ml PBS. ;- Detection of the IgG of subclass 1, 3 or 4: ;The anti-IgG1, anti-IgG3, anti-IgG4 monoclonal antibodies ;22 4 7 4 2 ;(sold by Seward) are used in a dilution of 1/500. These antibodies are not labeled. ;After 3 hours of incubation, the fixed antibodies are detected by an "anti-mouse" antibody Labeled with peroxidase (antibody supplied by Diagnostics Pasteur). After 3 washes, the peroxidase activity is detected as in the above test. ;- Detection of IgE: ;The first step in the sdsorption of the serum of the patients is extended for a period of 5 hours (instead of one); the anti-IgE monoclonal antibody (sold by TAGO-BIOSOFT) is used in a dilution of 1/250. This antibody is labeled with peroxidase. It is detected as described above. ;After the peroxidase reaction, the strips are aligned with the positive control from the LAV-BLOT kit in order to localize which antigens have fixed the specific antibodies. Figure 8 illustrates this experiment. The results are discussed in Example 3. ;Example 2 ;Development of a test for immunodetection of the F antigen of the HIV virus. ;The F antigen of the HIV virus does not figure among the proteins which are fixed on the nitrocellulose strips from the LAV-BLOT kit. ;A similar test can be prepared with purified F antigen prepared after genetic engineering and expression in E. coli. ;The coding sequence of the F protein was inserted in a vector M13:M13TG170 (French Patent 86/08,698). A BamHI site was created upstream of the ATG of initiation, by localized mutagenesis with the following oligonucleotide: ;5' GCCACCCATAGGATCCCAAAATCCTTT 3' ;The construction carrying the mutation is called M13TG1106. The coding sequence of the F protein is recovered in the form of a BamHI-Hind111 fragment and is ;22 4 7 4 2 ;introduced into a plasmid constructed in order to permit the expression of a foreign gene in E. coli, under the dependence of the thermoinductible promoter P|_ of the phage \. The plasmid pTG959 is used for example, but another vector could also be used. (The plasmid pTG959 derives from the plasmids pTG908 and pTG956 described in French Patent 83/00,909 or PCT/FR84/00,014; the rbs-cll sequence of the pTG908 was replaced by the synthetic rbs sequence of pTG956, after deletion of an Hpal-Ndel fragment which shortens the N gene. The useful elements in this construction are the following: ;P|_-N '-synthetic r bs-ATG-C 11 '-po I y I i n k e r ... ;.t ;BamHi site ;The coding sequence to be expressed is introduced into the polylinker.) ;The resulting plasmid is called pTG1166. ;After transformation of the E. coli strain TGE901, the induction of the culture at 42°C provides for an expression of the F protein at a level of 20 % of the total proteins (see Figure 1). ;The F protein is recovered after centrifugation of the culture (10 minutes at 6,000 r.p.m.) and sonication of the pellet taken up in 10 ml of PBS (for 500 ml of starting culture) for 8 minutes continuously. The pellet is then taken up in 2 ml of PBS + 0.2 % SDS. After incubation for 10 minutes at 25°C, the preparation is centri-fuged (10 minutes at 10,000 r.p.m.) and the supernatant is recovered. The operation is repeated twice successively on the remaining pellet. The supernatants of the 3 extractions are subjected to electrophoresis on 15 % ;acrylamide gel/SOS. It can be seen (Figure 1) that it is the second extraction which provides the purest protein (about 70 %), at a concentration of about 1 yg/ul. ;The protein thus purified is transferred from the gel onto nitrocellulose. The nitrocellulose is then cut into strips in-order to carry out the immunodetection tests. An immunodetection test was thus carried out which was similar to the LAV-8L0T but specific to the F protein. ;224742 ;- 13 - ;The strips are then incubated with the serums of patients to be studied, following the same protocol as for the LAV-BLOT. ;The fixed antibodies can then be detected, as in the LAV-BLOT, with total anti-IgG labeled with peroxidase (Figure 9). ;The immunodetection can also be carried out on several strips in paraLlel, for each serum, in order to detect the antibodies of different isotypes, as described in Example 1. ;The F antigen can also be replaced by peptides derived from the latter which correspond to important epitopes. These peptides can be synthesized in vitro using conventional methods. ;Two peptides in particular have been chosen corresponding to the amino acids 45 to 69 and 98 to 112 of the sequence of the F antigen. The sequence of these peptides is the following: ;45 to 69: SSNTAATNAACAWLEAQEEEEVGFP 98 to 112: EGLIHSQRRQDILDL ;The advantage of the peptides synthesized in vitro lies in the complete absence of contaminants of bacterial origin and thus in their high specificity. ;Example 3 ;Analysis of the isotypic response against the various proteins of the HIV in the serums of patients who are infected or "at high risk". ;In a study involving a series of serums from infected patients (from 22 to 111 serums according to the tests - see Figures 2 to 8), the class and subclass response or isotypic response was analyzed, according to the methodology described in Example 1. ;The isotypes detected are the IgA (Figure 2), IgM (Figure 3), IgE (Figure 4), IgG1 (Figure 5), IgG3 (Figure 6) and IgG4 (Figure 7). ;Table I summarizes the percentages of positive ;22 4 7 4 2 ;- 14 - ;responses, observed for the various isotypes against the ENV, GAG and POL proteins, with 22 serums which give clear responses in the previous figures- ;Table II summarizes the percentages of positive responses observed in particular for the isotypes IgA, IgM and IgE, on a larger number of samples (111 or 85). ;Table 1 ;Response in anti-HIV antibodies: % of positive serums among 22 serums. ;Ant i gen ;IgGl ;IgG3 ;Isotype IgG4 IgA ;IgM ;IgE ;ENV ;54 % ;0 % ;13 % ;9 % ;4 * <br><br>
0 % <br><br>
GAG <br><br>
54 % <br><br>
45 % <br><br>
0 % <br><br>
63 % <br><br>
36 % <br><br>
8 % <br><br>
POL <br><br>
40 % <br><br>
0 % <br><br>
18 % <br><br>
45 % <br><br>
36 % <br><br>
6 % <br><br>
Table II <br><br>
Response in anti-HIV antibodies. <br><br>
(number of serums analyzed: n = 111 or n = 85) <br><br>
Anti Qen <br><br>
IgA <br><br>
Isotype IgM <br><br>
igE <br><br>
X total of serums, all together positive i sotypes <br><br>
EMV <br><br>
2 % <br><br>
1 % <br><br>
o % <br><br>
27 <br><br>
% <br><br>
GAG <br><br>
44 % <br><br>
33 % <br><br>
8 « <br><br>
76 <br><br>
« <br><br>
POL <br><br>
12 % <br><br>
9 % <br><br>
6 % <br><br>
44 <br><br>
% <br><br>
% total of positive <br><br>
46 % <br><br>
34 % <br><br>
11 % <br><br>
serums n-111 <br><br>
n=lll n=85 <br><br>
Analysis of these results reveals a very clear isotypic restriction. <br><br>
1) The response directed against the ENV antigens is <br><br>
r <br><br>
22 4 7 4 2 <br><br>
- 15 - <br><br>
relatively restricted to the subclass IgG1; an I g G 4 response is aLso observed, which is sometimes significant. <br><br>
2) A positive response directed against the GAG proteins is observed with almost all the isotypes, with the exception of the IgG4. The IgA and IgM responses are very clear (especially to P25); the IgE responses are more rare. <br><br>
3) The response directed against the POL proteins (P34 and P 6 8) is never of the IgG3 type; all the other isotypes <br><br>
^ 10 are represented. <br><br>
v—' The GAG and POL proteins stimulate the IgA and <br><br>
IgM responses considerably (and, in addition, the IgG). Moreover, the production of IgA or IgM antibodies can be observed in the absence of recognition by the IgG (Table 15 II and Figure 8: patients No. 6 and No. 20). <br><br>
The detection of an IgA or IgM response in the absence of an IgG response underlines one of the limits of the diagnosis test which is currently used and in which these patients appear, wrongly, to be seronegative. 20 Moreover, the important response of the IgA, IgM <br><br>
and IgG4 type of several serums makes it possible to contemplate an eventual improved study of the immune response. <br><br>
It is known, in fact, that the IgA, IgM and IgG4 anti--v bodies are often blocking antibodies (in particular in <br><br>
25 the case of parasitic diseases, as described above). <br><br>
Moreover, these IgA and IgM antibodies are, in 95 and 97 % of cases (Table II), directed against the GAG proteins (especially P25), that is to say the internal pro-y. teins, which strengthens the analogy with the parasitic <br><br>
^^ 30 diseases. (It should be noted that the presence of blocking antibodies may explain the low levels of sero-neutralizing antibodies detected in the serums.) <br><br>
A development in the immune response towards these blocking isotypes could thus be an indicator of an 35 unfavorable prognosis in the development of the disease. <br><br>
Example 4 Detection of the of the HIV virus antibodies directed against the F protein in the serum of patients who are infected <br><br>
22 4 7 42 <br><br>
- 16 - <br><br>
or "at high risk". <br><br>
The methodology described in Example 2 was applied to the analysis of a series of patient serums. <br><br>
A series of 43 serums was analyzed and shown globally with total anti-IgG. The results are shown in Figure 9. The response directed against the F protein is clearly visible; the background noise corresponds to non-specific responses against the proteins of E. coli which are fixed on the strips (the F protein extracted from E. coli being only 70 % pure, as described in Example 2). <br><br>
A more precise study was carried out on a limited number of serums and also reveals an isotypic restriction: <br><br>
Isotype Response in anti-F antibodies <br><br>
(among 11 serums) <br><br>
IgG1 90 % <br><br>
IgG3 0 % <br><br>
IgG4 36 % <br><br>
IgA 63 % <br><br>
IgM (notsignificant) <br><br>
IgE 28 % <br><br>
The isotypic response raised against F thus resembles at the same time the response against the surface proteins (ENV) and against the internal proteins (GAG), since a strong IgGl and IgG4 and IgA response is observed. There is no IgG3 response, and the IgM response is weak or absent. <br><br>
Analysis of the serum from several patients who were monitored during the period and since the start of their seroconversion shows that the anti-F antibodies appear very early (see Example 5). The detection of these antibodies is therefore of great interest in the establishment of the diagnosis of AIDS. <br><br>
Example 5 <br><br>
Early detection of antibodies against the F protein of the HIV virus. <br><br>
22 4 7 4 2 <br><br>
- 17 - <br><br>
A preliminary analysis of the serums from several patients considered a priori to be "at high risk" and who were monitored during the period shows that the seroconversion against the F protein takes place very early, at the same time as or even before the seroconversion against the GAG proteins. <br><br>
Figure 10 shows the detection of the anti-F antibodies (shown with total anti-IgG) in 3 successive serum samples from 2 patients "at high risk". <br><br>
Patient 1 (strips 73, 74, 75 corresponding to the samples of 4/12/1985, of 17/6/1986 and of 2/8/1986) is slightly positive as from the second sample and extremely positive at the third sample. The same 3 serums analyzed by a routine ELISA test (at the blood transfusion center) were negative, slightly positive and positive. <br><br>
Patient 2 (strips 83, 84, 85 corresponding to the samples of 5/1/1987, of 20/1/1987 and of 12/2/1987) is slightly positive as from the first sample and clearly positive thereafter. <br><br>
The same 3 serums analyzed by the ELISA test were negative, slightly positive or very uncertain (ELISA supplied by Organon (+) Pasteur (jO and Welcome (-)) and positive or uncertain (Welcome) according to the test. <br><br>
The same serums had been confirmed in the Western Blot test (supplied by Du Pont de Nemours): the first sample was negative for all the antigens, the second was uncertain, slightly positive for P18, P25, P55 and P68, and the third was positive. <br><br>
For one of these patients, the study was made more thorough by detection of the DNA of the HIV virus in the mononucleated blood cells, and the test proved positive [> 1 cell in 100,000 positive by the PCR technique (polymerase chain reaction)]. <br><br>
This result underlines the importance of the detection of the antibodies raised against the F protein: <br><br>
they give a clear and very early response, which thus makes it possible to make an early diagnosis of AIDS seropositivity for individuals carrying the virus who are currently considered seronegative in the tests carried <br><br>
22 4 7 4 2 <br><br>
- 18 - <br><br>
out at present in the blood transfusion centres. <br><br>
Another study involving 6 high-risk subjects, <br><br>
who were seronegative according to the customary techniques, was carried out by radioimmunological determination of the presence of isotype antibodies IgG1, I g G 4 , IgM, IgA and IgE directed against the F protein. The 2 peptides 45-69 and 98-112 derived from F were also included in the test. This study confirms that it is possible to detect an early seroconversion (and thus an infection by the virus) in individuals considered to be healthy. <br><br>
The radioimmunoIogica I determination is carried out using the recombinant F protein produced in E. coli and purified to more than 90 % or one of the synthetic peptides adsorbed on a solid surface. Briefly, 5 ng of peptide (or of recombinant F protein) are incubated for 72 h in 250 ul of 0.015 M carbonate/0.035 M bicarbonate, <br><br>
at pH 9.6, in finned tubes (Nunc). All the incubations are carried out at room temperature. The tubes are then decanted, saturated with 250 ul of 3 % PBS-BSA for 2 hours, and then washed. The serum to be tested, diluted to 1/50th in a final volume of 250 ul of 3 % PBS-BSA, is introduced overnight, and 2 washings in PBS are then carried out. Finally, a human anti-isotype antibody, radiolabeled with iodine-125 (about 100,000 counts for 15 to 20 ng of antibody) is introduced overnight into a final volume of 250 ul of 3 % P8S-BSA. These human anti-isotype antibodies are either rabbit polyclonal antibodies purified by affinity and directed against the human isotype IgM, IgA or IgE (respectively specific to the U, ot or e chain) (Miab, Uppsala, Sweden); or monoclonal mouse antibodies directed against the human subclass IgGl or IgG4 (Seward, U.K.). Two washings in 0.1 % PBS/Tween are then carried out and the residual radioactivity fixed in the tube is counted in a gamma counter (LKB). <br><br>
The results are assessed as the percentage of fixed radioactivity. Ten human serum controls, taken from healthy subjects who are seronegative in respect of the structural and non-structural proteins (F and Sor) of the HIV (tested by western Blot), are studied at the same <br><br>
22 4 7 4 2 <br><br>
- 19 - <br><br>
time. The upper Limit of the normal (non-specific fixation) is calculated as the mean fixation obtained with the control serums, plus twice the standard deviation from the mean. <br><br>
It will be possible, for diagnostic purposes, for the detection of antibodies directed against the 45-69 peptide to be adapted to a simpler technique of the ELISA or Dot Blot type. <br><br>
The radioimmunological determination shows that the anti-F antibodies of isotype IgM and IgA (early response) and IgG 1 all (IgM and IgG1) and almost all (IgA) recognize the 45-69 peptide of F. This peptide is thus of diagnostic interest to the extent that it makes it possible to detect 3 major isotypes of the anti-F antibodies, both when these antibodies are present isolated (n = 6) and in seropositive individuals by means of conventional techniques (n = 8) (21 serums studied in total, in 14 individuals) (Figs. 11A and 11B) . <br><br>
The 98-112 peptide is not recognized by any anti-F antibody of isotype IgM, is recognized by a small proportion of the antibodies of isotype IgA, by a large proportion of the IgG4, and by the majority of the IgE. <br><br>
It is also recognized by a rat monoclonal antibody of isotype IgG2a, designated FM-ji, obtained from rats immunized by the recombinant F protein. <br><br>
As shown above, the tests for rapid diagnosis (ELISA, supplied by Abbott, Organon, Diagnostics Pasteur, Welcome ...) or for precise diagnosis by Western Blot (Diagnostics Pasteur, Du Pont de Nemours ...) can give false seronegative results. <br><br>
Moreover, the diagnosis kits marketed at present are prepared with proteins purified from inactivated HIV virus; these tests are thus very expensive. <br><br>
In the analysis of the antigenic specificity of the antibody response, it appears that all the positive serums give a response against the GAG proteins (except in the terminal stages of the disease). <br><br>
It would thus be possible to replace all the viral proteins adsorbed in the nitrocellulose by the GAG <br><br>
- 20 - <br><br>
proteins, in particular P25, and ENV. Since these 2 proteins have already been expressed by genetic engineering (French Patents 86/05,043 and 86/16,787), it is possible to use these purified proteins under conditions which are much more economical and less dangerous than the purification from the virus. <br><br>
- A simple, clear and early diagnosis test can comprise the GAG, Env and F proteins (prepared in vitro by genetic engineering). <br><br>
- A test for detailed analysis of the isotypic response, permitting a progressive study during the course of the disease, should comprise <br><br>
. the immunocapture of the antibodies raised against all the proteins of the HIV virus, including the F protein or peptides derived from this . and the detection of the fixed antibodies by means of the anti-antibodies specific to all the isotypes. <br><br>
The analysis, over a period of time, of the isotypic response could also lead to a new vaccine strategy. <br><br>
22 4 7 4 2 <br><br>
- 21 -REFERENCES <br><br>
Cebra, J.J., Komisar, J.L. and Schweitzer, P.a. Ann. Rev. Immunol. 2, 493-548 (1984). <br><br>
Capron, M. and Capron, A. Parasitology Today 2, 69 (1986). Grzych, J.M., Capron, M., Dissous, C. and Capron, A.J. <br><br>
Immunol. 133, 998 (1984). <br><br>
Khalife, J., Capron, M., Capron, A., Grzych, J.M., <br><br>
Butterworth, A.E., Dunne, D.W. and Ouma, J.H. J. Exp. <br><br>
Med. 164, 1626-1640 (1986). <br><br>
Capron, M., 1983, and Haque, A., Capron, A., Ouaissi, A., Kouememi, L., Lejeune, J.P., Bonnel, B. and Pierce, R., <br><br>
1983, in the report of the Antwerp Symposium: "From parasitic infection to parasitic disease" - Contributions to microbiology and immunology vol. 7, Ed. Gigasse and Van Marck p. 1 and 2 and p 9 to 21. <br><br></p>
</div>