NZ219431A

NZ219431A - Dna probe for bovines

Info

Publication number: NZ219431A
Application number: NZ21943187A
Authority: NZ
Inventors: C Bishop; C Cotinot; M Fellous; M Kirszenbaum; M Vaiman
Original assignee: Agronomique Inst Nat Rech; Pasteur Institut; Commissariat Energie Atomique
Priority date: 1986-02-28
Filing date: 1987-02-27
Publication date: 1989-04-26
Also published as: EP0235046B1; FR2603701B2; ES2042591T3; DE3786181T2; AU596642B2; CA1312565C; EP0235046A1; IN167981B; AU6920387A; DE3786181D1; FR2603701A2

Description

<div class="application article clearfix" id="description"> New Zealand Paient Spedficaiion for Paient Number £19431 * 219 4 3 1 Pf- 7 : , Ccrr.pJeto S; .-.v..;.i hiaa:2.7.-2r%.J Cia.sf,: XL?.CuM3>\3 /<SO(J5>3i ^.xzn. j.Qu i. cja.oj»5jcor .CXU£> I ^(*>§3 ,. cLon. KJ5j.| ... PublicMion O...C: — Jf $ "APR• (JJJ P.O. JOLmaf, fc'u: * ' i£ ii fit £l Patents Form No. 5 NSW ZEALAND PATENTS ACT 195 3 COMPLETE SPECIFICATION MOLECULAR PROBES FOR DNA SPECIFIC FOR THE MALE GENCME OF RUMINANTS, ESPECIALLY OF THE SUBFAMILY OF THE BOVINES AND PARTICULARLY OF THE GENUS BOS, THE PROCESS FOR THEIR PREPARATION AND THE USE OF THESE PROBES FOR DETERMINING THE SEX OF RUMINANT EMBRYOS AND FETUSES AND FOR CHECKING THE PRESENCE OF THE Y CHKXDSOME IN A POPULATION OF SPERMATOZOA AND SEPARATING THE S&ID POPULATION INTOTTO GROUPS, RESPECTIVELY COMPRISING THE Y CHROtOSOME AND THE X CHROMOSOME, FOR THEIR APPLICATION TO ARTIFICIAL INSEMINATION. X/We, INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE (INRA) of NAC"1 149 pe de Grenelle, 75007 Paris France, INSTITUT PASTEUR of 28 rue/de Dr ^-Rouo7 75724 Paris Cedex 15, France, and COMMISSARIAT A L1ENERGIE ATOMIQUE (CEA) of 29-33 Rue 4e la Federation, 75015 Paris, France, All are French Public Establishments, i w hereby declare the invention, for which X/we pray bfc^at a patent may be granted to S§/us, and the method by which it is to be performed, to be particularly described in and by the following statement: - 1 - (followed by page 1-a) ■ MOLECULAR PROBES FOR DNA SPECIFIC FOR THE MALE GENOME OF RUMINANTS, ESPECIALLY OF THE SUBFAMILY OF THE BOVINES AND PARTICULARLY OF THE GENUS Bos, THE PROCESS FOR THEIR PREPARATION AND THE USE OF THESE PROBES FOR DETERMINING THE SEX OF RUMINANT EMBRYOS AND FETUSES AND FOR CHECKING THE PRESENCE OF THE Y CHROMOSOME IN A POPULATION OF SPERMATOZOA AND SEPARATING THE SAID POPULATION INTO TWO GROUPS, RESPECTIVELY COMPRISING THE Y CHROMOSOME AND THE X CHROMOSOME, FOR THEIR APPLICATION TO ARTIFICIAL INSEMINATION ABSTRACT OF THE DISCLOSURE A molecular probe having a hybridization profile which reveals the presence of at least one band specific for the male genome of ruminants, especially of the subfamily of the bovines and particularly of the genus Bos- A process for the preparation of a molecular probe for DNA specific for the male genome of said ruminants, by the reassociation of segments of genomic DNA or by synthesis. Application of the said molecular probe for DNA specific for the male genome of said ruminants, to determining the sex of embryos or fetuses of the said ruminants, checking the presence of the Y chromosome in a population of spermatozoa and separating the said spermatozoa into two populations of spermatozoa, respectively bearing the Y chromosome and the X chromosome, for their use in artificial insemination. [followed by page lb) f 219 4 3 1 - 1 b- The present invention relates to the preparation of molecular probes for specific DNA which are useful for determining the sex of ruminant embryos or fetuses, especially of the subfamily of the bovines, and particularly 5 of the genus Bos, exhibiting sequences of DNA specific for the male sex. Determination of the sex of embryos and fetuses is of great interest in several respects. Determination of the sex of human embryos permits early detection of 10 serious genetic diseases linked to the sex of the embryo. Determination of the sex of livestock embryos, on the other hand, is of great economic interest. Sex (male or female) is known to be determined by the sex chromosomes. In mammals, the presence of a 15 Y chromosome is sufficient to produce a male phenotype and it seems that the sex-determining genes present on the Y chromosome behave like a dominant genetic trait. The first step towards early determination of the sex of human embryos therefore consisted of a 20 chromosomal analysis of cultured cells of amniotic fluid. However, as this type of analysis takes two to three weeks, it was found necessary to provide other methods for early determination of the sex of embryos, which were capable of giving quicker results. 25 It was established that not all the Y chromosome was involved in sexual differentiation. It therefore seemed logical to analyze the sequences present on the Y chromosome and the first step in this direction consisted in isolating and cloning the DNA of the Y chromo-30 some. Thus, KUNKEL et al. (especially in BIOCHEM., vol. 18, no. 15, p. 3343-3353, 1979) isolated fragments of 3.4 kilobases (kb) of human male DNA by coupling^with the aid of restriction endonucleases such as Haelll, 35 EcoRI or EcoRII and showed that the repetitious DNA specific for the Y chromosome (DNA Y-it) was present in (followed by uagc 2] - 2 - these 3.4 kb molecules. However, although the work of KUNKEL et al. provides valuable information on the organization of two types of repetitive sequences -respectively specific and non-specific for the Y 5 chromosome - in each 3.4 kb molecule, it cannot be used directly in sex determination. The work of BISHOP et al. (NATURE, vol. 303, 30 June 1983, p. 831-832) was aimed at building a partial library of the Y chromosome using a somatic cell 10 hybrid containing only the human Y chromosome on a murine base, the said hybrid being obtained by the fusion of male human lymphocytes with the murine cell line RAG and containing a modal number of four human Y chromosomes per cell; the authors extracted high- 15 molecular DNA from the hybrid, carried out a partial digestion with the aid of the restriction enzyme Mbol and cloned the 35-50 kb fragments in Escherichia coli bacteria using the cosmid pJB8. To differentiate the clones containing human DNA inserts (derived from Y) 20 from those containing murine DNA, the colonies were 32 tested at low density with P-labeled repetitious human DNA with a view to detecting only the repetitive sequences and creating the intended library. Among the recombinant clones, the authors selected sequences of non-repetitious 25 DNA derived from Y in order to study the organization of the human Y chromosome at the molecular level. This work, which is of decisive scientific interest, is again incapable of being used directly for determining the sex of livestock embryos. 30 Several methods for early determination of the sex of human embryos have been proposed on the basis of the work by KUNKEL et al., i.e. using sequences of DNA specific for the Y chromosome. In particular,, LAU et al. (THE LANCET, 7 January 1984, p. 14-16) proposed a test^ 35 for determining the sex of the human embryo with the aid l\9 A - 3 - of a probe isolated from the 3.4 kb human repetitive sequence derived from the heterochromatin of the Y chromosome (method of KUNKEL et al.). This probe was then hybridized to DNA isolated from a small number of cells originating from 0.2 ml of amniotic fluid. The hybridization frequency is 1000 times greater for the male genomic DNA (isolated from cells of amniotic fluid) than for the female genomic DNA. The so-called "DOT BLOT" method proposed by GOSDEN et al. (THE LANCET, 10 March 1984, p. 540-541) uses a probe specific for the Y chromosome, which is called pHY2,1 and was described earlier by these authors. This probe hybridizes to DNA originating from a biopsy of chorionic villosities from a male human embryo. LAMAR and PALMER (CELL, vol. 37, May 1984, p. 171-177) attempted to develop a general method for cloning the DNA of the Y chromosome in mice. The method proposed by these authors consists in fragmenting female mouse liver DNA by means of sonication and completely digesting male mouse DNA by MbOI. Samples of the fragmented female DNA and the digested male DNA are mixed in a proportion of 100:1. The mixture is denatured and reassociated at a cot value of 1320 in an appropriate buffer: under these conditions, 95% of the DNA is in the form of double strands. These consist of homogeneous female DNA, heterogeneous male-female double strands corresponding to the sequences common to both sexes, and finally male specific duplexes. The double strands are isolated by chromatography on a column of hydroxy- apatite. They are recombined in the plasmid pBR322. The recombinant plasmids are used to transform competent Escherichia coli HB101 bacteria. Approximately 100,000 r s clones (Amp -Tet ) were tested, 3000 of which contained -DNA presumed to be specific for the Y chromosome. Three"1-of these probes proved to be specific for male mice, . 19 4 31 - 4 - which would tend to demonstrate a species specificity of the molecular probes for male DNA. Furthermore, several techniques have been proposed for sorting spermatozoa in order to determine their sex: - so-called physical methods for separating the spermatozoa bearing the X and Y chromosomes respectively, by electrophoresis (Shishito and al., int. J. Fertil., 20, 13-16, 1975), gel filtration, passage through a gradient of albumin (Ericsson and al., Nature, vol. 246: 421-424, 1973), centrifugation, and more particularly cen-trifugation in a density gradient using Percoll (Fertility and Sterility, vol. 40, N° 5, Nov. 1983), ultracentrifugation in a density gradient of sucrose, etc.; - methods for fractionating the sperm into fractions rich in spermatozoa bearing the Y chromosome and/or into fractions rich in spermatozoa bearing the X chromosome, by utilizing the difference in mobility between the spermatozoa bearing the Y chromosome and those bearing the X chromosome, in various media (for example gradients of albumin) (USP 4 009 260), as well as spermatozoa separation methods capable of causing separation according to the density, by utilizing the fact that the density of the Y chromosome is lower than that of the X chromosome (USP 3 894 529), these methods comprising the application of hydrostatic forces (USP 4 092 229 and USP 4 155 831) and centrifugation in a gradient of an appropriate medium, for example Percoll ; it is also possible to separate into different fractions spermatozoa populations by reason of the sexlinked electrical charge resident thereon, aid of an electrostatic charge-bearing material (USP 4 08 3 957) ; falling into the same category as these methods of separation are the methods of cell sorting by flux cytometry, i.e. by deflecting and separating cells identified by their quantity of DNA, by means of an electric field.,.„-.. - 5 - followed by a study of the sorted cellB, for example by the attachment of other labeled ligands, optical or electron microscopy, functional tests in vitro, etc. (Application in Cell Biology, chap. 25;471-483, 1980) ; and 5 - immunological methods, some of which use antibodies which are selectively reactive with spermatozoa bearing either the X chromosome or the Y chromosome, the said antibodies being agglutinated and inactivated, thus releasing a fraction of spermatozoa homogeneously 10 bearing the chromosome opposite in type to that which reacted with the above-mentioned antibody, it also being possible for the fraction fixed to the antibody to be released from the latter, if appropriate, especially in the case where the antibody is fixed to 15 a solid phase made up of an immunoabsorbent material (USP 4 191 749, USP 3 687 806, USP 4 085 205). The publications in which the pre-cited methods are also described are the following : - SHILLING E. In : "Sex-ratio at birth prospects 20 for Control." (C.A. KIDDY and H.D. HAFS. Eds) Am. Soc. Animal. Sci.pp. 76-84 (1971) - MEISTRICH M.L. J. Cell. Physiol., &£, 239-312 (1972) - RHODE W. et al. , J. Repro. Fertil. 42, 587-591 (1975) 25 - STEENO 0. et al., Andrologia, 1_, 95-97 (1975) - BHATTACHARYA B.C. et al., Ind. J. Exp. Biol., 610-611 (1976) - SHASTRY P.R. et al., Nature, 269, 58-60 (1977) - SHILLING E., THORMAHLEN D. Zuchthyg, 1_1, 113-121 30 (1976) - ADIMOELJA A. et al., Andrologia 9, 289-292 (1977) - BHATTACHARYA B.C. et al., Int. J. Fertil., 22, 30-35 (1977) - SCHILLING E., THORMAHLEN D. Andrologia, 9, 74-78 3 5 (1977) ,<V" i *> ■ 0 L '4\ i? 0m - 6 - - PERTOFT H. et al., Anal. Biochem. 88, 271-282 (1978) - SCHILLING E. et al., Andrologia 10, 215-217 (1978) 5 - QUINLIVAN W.L.G., Fertil. Steril., 34, 307-308 (1980) -QUINLIVAN W.L.G. et al., Fertil. Steril, 37, 104-107 (1982) -CORSON S.L. et al., Fertil. Steril, 40, 384-385 10 (1983) - KANEKO S. et al., Fertil. Steril 40, 661-665 (1983) - BEAL W.E. et al., J. Anim. Sci., 58, 1432-1436 (1984) 15 - KAKENO S. et al., Biomed. Res., 5, 187-194 (1984) - UEDA K. et al., Dev. Growth Differ. 28, suppl. Abst. 79 (1986) - ERICSSON R.J. et al. Nature, 246, 421-424 (1973) - ROSS A. et al. Nature, 253, 354-355 (1975) 20 - SHISHITO S .et al., Int. J. Fertil., 20, 13-16 (1975) - BROER K.H. et al., Andrologia, 9, 74-78 (1977) - DMOWSKI W.P. et al., Fert. and Steril. , 31, 52-57 (1979) 25 - QUINLIVAN W.L.G. et al., Fertil. Steril. 31_, 104-107 (1982) - KNAACK J. et al., Tierzucht 27, 156-159 (1973) - LANG J.L., Chemtech. March, 189-192 (1973) - SHIRAI M. et al., Tohoku. J. Exp. Med., JL1_3 30 273-281 (1974) - MOORE H.D.M. et al., Reprod. Fertil., 44, 329-332 (1975) - BATTACHARYA B.C. et al., Int. J. Fertil. 24, 256-259 (1979) 35 - HAMMERSTEDT R.H. et al., Arch. Biochem. Biophys. 194, 565-580 (1979) . 2 1 9 4 3 1 - 7 - BENNETT D. and BOYSE E.A. Nature, 246, 308-309 (1973) - BENNETT D. et al. Nature, 257, 237-238 (1975) - SILVERS W.K. and WATCHEL S.S., Science, 195, 5 956-960 (1977) - HANCOCK R. J.T., Biol. Reprod., 18, 510-515 (1978) - SHALEV A., Diss Abst B, 40, 5538 (1980) - HEDGE U.C. et al. J. Reprod. Immunol. 2, 351-357 (1981) 10 - WATCHET S.S. Theriogenology, 24, 419-429 (1984) - GLEDHILL B.L. et al., In : Flow Cytometry and Sorting (M. Melamed, P. Mullaney and Mendelsohn, eds) John Wiley and Sons, Inc. N.Y. pp 471-484 (1979) 15 - MORUZZI J.F., J. Reprod.Fert, 57, 319-323 (1979) - EVENSON D.P. et al., Science, 210, 1131-1133 (1980) - EVENSON D.P. et al., Chromosoma, 2§.» 225-238 (1980) 20 _ GROGAN W.M. et al. , J. Histochem. Cytochem. , 29, 738-746 (1981) - STEEN H.B. et al., Cytometry, 2, 129 (1981) - PINKEL D. et al., Science, 218, 904-905 (1982) - PINKEL D et al., Cytometry, 3, 1-9 (1982) 25 - BENAR0N et al., Cytometry, 5^ (1982) - GARNER D.L. et al, Biol. Reprod. , 28, 312-321 (1983) - GLEDHILL B.L. et al., 10th Int. Congr. Anim. Reprod. 30 - PINKEL D. et al. , J. Anim. Sci., 60, 1303-1307 (1985) - JOHNSON L.A., et al. , Gamete Res. in press (1986) - JOHNSON L.A. and PINKEL D., Cytometry, 7, in 35 press (1986) - JOHNSON L.A. , Beltsville Symp. Agric. Res., X, (in press) M. Nijhoff publ. (1986) - SHETTLES L.B., Int.. J. Gynaecol. Obstet, 8, 643-647 (1970) - DOWNING D.C. and BLACK D.L. Fertil. Steril., 27, 1191-1193 (1976) - MUEHLEIS P.M. and LONG S.Y. Fertil. Steril., 27, 1438-1445 (1976) - PORSTMANN T. and SCHMECHTA H. Dermatol. Monats-schr., 165, 28-35 (1979) - BARLOW P. and VOSA C.G., Nature, 226, 961-962 (1970) - BEATTY R.A., Cytogenet cell Genet., 18i, 33-49 (1977) - ERICSSON R.J. et al., In : Clinics in Andrology, vol. I_, (J.C. Emperaire, A. Audebert, E.S.E. Hafez, eds). Martinus Nijhoff, The Hague pp 98-111 (1980) - KIDDY C.A. and HAFS H.D., Sex ratio at birth. Prospect and control. Am. Soc. Anim. Sci. publ. (1971) - COUROT M., Le choix du sexe est-il possible chez les mammiferes ? In : "La Flcondation" pp 113-130, Masson publ. (1975) - RINEHART W. , Sex Preselection not yet practical. Population reports series I 2 pp 11 (1975) - AMANN R.P. and SEIDEL G.E., Prospect for Sexing Maminalina Sperm, pp 288 Colorado Ass. Univ. Press, publ. (1982). The spermatozoa sorting methods proposed in the prior art share the disadvantage of having a relatively large margin of uncertainty as regards their reliability in fact, the sorting processes do not give 100% homo--geneous fractions of one or other chromosome, so that the sorting quality can only be checked in practice by . /. -v; i? - 9 - carrying out artificial insemination, which is the ultimate aim (the efficiency of in vitro fertilization being rather low in practice). Moreover, in order to know whether the deviation of the "sex ratio" has a 5 significant value in connection with a fraction of spermatozoa isolated by any one of the sorting methods recommended in the prior art, it is necessary to have carried out a large, statistically significant number of inseminations, which can prove expensive and time-10 consuming. It is therefore essential to have access to a means by which the fractions of spermatozoa obtained by any one of the sorting methods proposed according to the prior art can be checked immediately, so as to 15 limit or even eliminate any risk of error at the stage of carrying out artificial insemination using the sorted fractions in question. One object of the present invention was to provide molecular probes for DNA specific for the male 20 genome of ruminants, especially of the subfamily of the bovines and particularly of the genus Bos, exhibiting sequences of DNA specific for the male sex, and a method for determining the sex of these animals with the aid of the above-mentioned probes, which satisfactorily meet the needs 25 of the art in question insofar as they make it possible to determine the sex of said ruminant embryos from a small number of embryonic cells not exceeding 500 to 1000, enabling the sex of the embryos to be determined at an early stage of development with a reliability factor of 100 %. 30 Another object of the present invention was to provide a method for immediately checking the proportion of spermatozoa bearing the Y chromosome in a fraction of a population of spermatozoa separated by any —— appropriate sorting method, using the molecular probe 35 according to the present invention. (L •• r - 10 - The present invention relates to a molecular probe for DNA specific for the male genome of ruminants especially of the subfamily of the bovines and particularly of the genus Bob, the said probe having a hybridization profile -5 determined by hybridization of the said probe with male genomic DNA digested by an appropriate enzyme - which reveals the presence of at least one band specific for the male genome of the ruminants in question, in particular when the hybridization profile - determined by hybridization of the 10 said probe with male genomic DNA digested by EcoRI - reveals the presence of a band of the order of 7 kb which is specific for the male genome of the genus Bos. In an advantageous embodiment of the molecular probe according to the present invention, said probe compri-15 ses 49 base pairs having the following 5'-3' nucleotide sequence : 5J. 31 ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT as well as its conplementary, or a fragment of the said sequence 20 containing at least 11 consecutive nucleotides or any other fragment presenting at least 70 % homology with that latest, the said probe being designated by the name b.c.1.2. According to another advantageous embodiment of the molecular probe according to the present invention, 25 said probe is repeated at least 2000 times in the male genome of the genus Bos .■ Its nucleotide sequence was determined by the method of MAXAM and GILBERT [METHODS ENZYMOL., 65, 499 (1 977 ) ] . 30 Hybridization of the probe b.c.1.2. with male genomic DNA digested by EcoRI reveals the presence of a band of 7 kilobases (kb) which is absent in female genomic DNA. The present invention also relates to processes 35 for the preparation of a molecular probe for DNA specific * - 11 - for the male genome of ruminants, especially of the subfami-, ly of the bovines and particularly of the genus Bos. According to one feature of the present invention, a process for the preparation of a molecular probe 5 of this type, where genomic DNA segments which have been made single-stranded are reassociated from a mixture of male and female DNA in which the female DNA is in large excess (of the order of 100 parts per part of male DNA), comprises: - a first step in which female genomic 10 DNA of the said ruminants, is cut by means of sonication into fragments of 200 to 550 base pairs (bp) and then mixed, in a proportion of the order of 100:1, with male genomic DNA of same ruminants, digested by the endonuclease SAU 3A in order to release restriction fragments with sticky ends, 15 having a size of between 40 and 1650 bp ; - a second step in which the said mixture of DNA, after extraction, in a manner known per se, with a phenol/chloroform/isoamyl alcohol mixture and precipitation with ethanol, is denatured at 100°C and then reassociated at 68°C for 22 hours in a 20 buffer containing 2 mol/1 of (NH^^SO^, 50 imol/1 of sodium phosphate (pH = 6.8) and 5 irrol/1 of EDTA ; - a third step in which the reassociated double-stranded DNA is mixed with a plasmid such as the plasmid pUC9 (Ampr-Lac Z+), which has first been unwound by the endonuclease BamHI and dephosphorylated 25 with alkaline phosphatase, in the presence of the ligase T which effects the insertion of DNA into the plasmid, by contact for 16 hours at 16°C; - and a fourth step in which the recombinant plasmids obtained in the previous step are used to transform Escherichia 30 coli cells which have been made highly competent, the recombinant clones (Ampr-Lac Z ) being obtained in a proportion of about 200 clones for 2 ml of bacterial cell suspension. In one advantageous embodiment of the process for €Tve prepara-35 tion of the molecular probe according to the in vent-fort/^ /■ the bacterial cells of Escherichia coli are made highly competent, prior to the insertion of the recombinant plasmids, by treatment for ten minutes at 0°C with a medium comprising 10 mmol/1 of K-Mes (pH = 6.2), 100 mmol/1 of RbCl2, 45 mmol/1 of MnCl2 and 3 mmol/1 of£co(NH^)&Jci3. In another advantageous embodiment of the process according to the present invention, the transformed bacteria are spread over a gelose medium containing ampicillin and X-gal (or 5-bromo-4-chloro-3-indolyl-ji-D-galactopyrano-side) at a low concentration in dimethylformamide, the isolated bacterial colonies (Amp -Lac Z ) are individually subcultured and then amplified with a view to preparing minilyzates, each isolated plasmid is then digested by the endonuclease PvuII, labeled with one or more radioisotopes and hybridized with genomic DNA originating from said ruminants, and the DNA of these animals is digested by the endonuclease EcoRI, which generates restriction fragments of variable size. In an advantageous arrangement of this embodiment, these fragments are separated by electrophoretic migration on agarose gel. According to another feature of the process for the preparation of a molecular probe for DNA specific for the male genome of ruminants , especially for the subfamily of the bovines and particularly of the genus Bos, a probe of this type is obtained by synthesis; in the method of synthesis, the nucleotide sequence which the said probe comprises is synthesized by the phosphoramidite technique in solid phase. In a preferred embodiment of the process for synthesizing the oligonucleotide which forms part of the composition of the molecular probe according to the invention, the actual synthesis is followed by a purification step which consists in separating out the--,, desired oligonucleotide of a given size, associated « - 13 - with oligonucleotides of intermediate eize, by electrophoresis on a polyacrylamide gel, and then identifying the band of the desired pure oligonucleotide with the aid of an aluminum foil coated with silica gel, which 5 is fluorescent at 254 nm, cutting out this band and eluting the DNA in an appropriate solution, and then recovering the pure DNA synthesized. In another preferred embodiment of the process for synthesizing the molecular probe according to the 10 invention, the latter is labeled with one or more radioisotopes, after purification of the synthesized oligonucleotide. The present invention also relates to the use of the molecular probes for DNA specific for the male genome of ru-15 minants, especially of the subfamily of the bovines and particularly of the genus Bos, for determining the sex of embryos and fetuses of the said ruminants, in which determination process a probe according to the invention, hybridized to a filter prehybridized in an appropriate manner known per se, when 20 the said probe is reassociated with genomic DNA of said ruminants - male and female - transferred beforehand onto an appropriate filter after having been isolated by electrophoresis on agarose gel, hybridizes exclusively to the male genomic DNA and this hybridiza-25 tion is demonstrated by autoradiography and/or by means of a non-radioactive probe, by the presence of hybridization signals in the form of bands £ SOUTHERN, J. Mol. Biol., 98, 503 (1975)]- In an advantageous embodiment of the sex determination 30 method according to the invention, the DNA to be recognized is contained in lymphocytes of the above-mentioned ruminants. In another advantageous embodiment of the sex determination method according to the invention applied-to fetuses, the DNA to be recognized is contained in cells issued from 35 ammniotic or allantoldic fluid or from chorionic villosities 21 « 4 $ I - 14 - of the above-mentioned ruminants. According to the invention, said cells or similar of the above-mentioned ruminants are deposited on a membrane (dot-blot) in the form of drops after having been sonicated. 5 In yet another advantageous embodiment of the sex determination method according to the invention, the DNA to be recognized is contained in the Y chromosome of the said ruminants, observed at the metaphase stage, in which case the sex is determined by so-called in situ hybridization. 10 In a further embodiment of the sex determination method according to the invention, the DNA to be recognized is contained in nuclei of cells of the said ruminants at the interphase stage, in which case the sex is determined by so-called in situ hybridization, 15 In the in situ hybridization according to the inven tion, a biopsy of 5 to 20 cells from an embryo of said ruminants is brought into contact with the molecular probe according to the invention for effecting the labeling of said cells by hybridization with said probe labeled with one or more radioisotopes 20 or with a non-radioactive probe,then the hybridization is revealed by an appropriated cytoimmunochemical method. The present invention also relates to a process for directly and immediately checking the proportion of spermatozoa bearing the Y chromosome in a population of spermatozoa 25 of ruminants, especially of the sub-family of the bovines and more particularly the genus Bos, wherein the spermatozoa of the said population are brought into contact with the molecular probe according to the invention in order to label the said spermatozoa by hybridization with the said probe suitably 30 labeled, and the hybridized spermatozoa are then revealed, by an appropriated cytoimmunochemical method. In one advantageous embodiment of the checking process according to the present invention, the -hybridization of the spermatozoa with the molecular probe f . 35 specific DNA is effected in situ directly with the spermatozoa. f1313 1 - 15 - In another advantageous embodiment of the checking process according to the present invention, the hybridization is effected between the molecular probe for specific DNA and the DNA isolated from sperma-5 tozoa of ruminants of the genus Bos. In an advantageous arrangement of the embodiment in which the hybridization is effected in situ, the spermatozoa are subjected, prior to the hybridization step, to a chemical decondensation process comprising 10 essentially three steps, namely: hypotonic shock, proteolytic digestion and reduction of the disulfide bridges. In yet another advantageous embodiment of the checking process according to the present invention, a 15 probe labeled with one or more radioisotopes, or a non-radioactive probe, is used as the molecular probe for specific DNA. The process for checking the proportion of spermatozoa bearing the Y chromosome in a population 20 of spermatozoa, according to the present invention, makes it possible to measure the proportion of Y chromosomes present in this population. According to the present invention, this possibility of determining the quantity of Y-specific 2 5 DNA in spermatozoa, by means of the probe for specific DNA according to the invention, is utilized to develop a process for sorting the X and Y spermatozoa according to their DNA content, the various separation steps of this process being themselves checked by means 3 of the molecular probe specific for the ruminant Y chromosome according to the invention. As a consequence, the present invention also relates to a process for sorting the spermatozoa bearing the X chromosome and the spermatozoa bearing the Y 35 chromosome in a population of spermatozoa, which com-' 5 10 15 20 25 30 - 16 - prises the following steps: - 1) labeling the DNA contained in the spermatozoa with a vital stain specific for DNA (for example ethidium bromide, acridine, Hoechst stain 33342 or DAPI); - 2) sorting, by cytofluorometry, into two fractions of X and Y spermatozoa according to the quantity of DNA which they contain; - 3) checking the quality of the sorting operation carried out in the 2nd step of the process by using the process for checking the proportion of spermatozoa bearing the Y chromosome in the fraction of Y spermatozoa separated out by sorting, according to the present invention; - 4) immunizing rodents (mice or rats) with the checked fractions, which may have been re-sorted following the check, with a view to producing monoclonal or polyclonal antibodies; 5) checking the specificity of the said antibodies, by means of agglutination, spermatotoxicity, indirect immunofluorescence and flux cytometry tests, in order to obtain specific immunological reagents recognizing antigenic determinants controlled by the chromosome of the desired sex and expressed at the surface of the spermatozoa, which reagents are capable of being used to separate live spermatozoa bearing the X chromosome or the Y chromosome; - 6) and separating the fractions of spermatozoa respectively bearing the X chromosome and the Y chromosome in a population of spermatozoa, with the aid of the said immunological reagents. In one advantageous embodiment of the sorting process according to the present invention, the immunization of rodent mammals, which constitutes the 4th_steDs of the sorting process, is followed by collection of the polyclonal antibodies resulting from the said immunization and by absorption of these antibodies on spermatozoa of the opposite sex to that used for immunization, the specificity of these antibodies being checked on— spermatozoa of the desired sex, and the said antibodie"s~v - 17 - then being purified if appropriate. In another advantageous embodiment of the sorting process according to the present invention, the X and Y spermatozoa separated by cytofluorometry are 5 used to prepare monoclonal antibodies specific for the X and Y chromosomes. The present invention further relates to the specific immunological reagents recognizing antigenic determinants controlled by the X or Y chromosome used 10 to obtain the said reagents, and expressed at the surface of the spermatozoa, the said reagents consisting of the antibodies obtained by carrying out the above process, tested for their specificity and purified if appropriate. In addition to the foregoing provisions, the 15 invention also includes other provisions which will become apparent from the following description. The invention will be understood more clearly with the aid of the following additional description, which refers to examples of how the present invention 20 can be put into practice. It must be clearly understood, however, that these examples are given solely in order to illustrate the object of the invention without in any way implying a limitation. 25 30 EXAMPLE 1 PREPARATION OF PROBES ACCORDING TO THE INVENTION The technique used enables the DNA present in the male genome and absent in the female genome to be cloned and has thus made it possible to build a library of DNA specific for the male bovine. BUILDING THE LIBRARY OF DNA SPECIFIC FOR THE MALE 1 mg of female genomic DNA originating from peripheral lymphocytes is cut by means of sonicatiofi; "-: 35 into fragments of 200 to 550 base pairs (bp). 10 pg of 0 - 18 - male genomic DNA originating from peripheral lymphocytes are digested by the endonuclease SAU 3A (Boehringer), thus releasing restriction fragments with sticky ends, having a size of between about 40 and 1650 bp. 5 These two types of fragment are mixed in the following proportion: female DNA : male DNA = 100 : 1. After extraction with a phenol/chloroform/ isoamyl alcohol mixture and precipitation with absolute ethanol, the mixture of the two DNA's is denatured at 10 100°C for 10 min. and then reassociated at 68°C for 22 hours in a buffer containing 2 mol/1 of (NH^^SO^, 50 mmol/1 of sodium phosphate (pH = 6.8) and 5 mmol/1 of EDTA. An aliquot (1 jig) of reassociated double- stranded DNA is mixed with 100 ng of the plasmid pUC9 r 15 (Amp -Lac Z ), which has first been unwound by the endonuclease BamH1 (Boehringer) and dephosphorylated with alkaline phosphatase (CIP Boehringer). The insertion of the male bovine DNA into the plasmid is effected with the ligase (Biolabs) at 16°C for 16 hours. 20 The recombinant plasmids are used to transform 2 ml of Escherichia coli-JM83 bacteria which have been made highly competent by treatment with a medium containing 10 mmol/1 of K-Mes (pH = 6.2), 100 mmol/1 of RbCl^i 45 mmol/1 of MnCl^ and 3 mmol/1 of ^CofNH^) CI ^, 25 for 10 min. at 0°C. The bacteria transformed in this way are spread over LB-Agar medium containing 100 jig/ml of ampicillin and 2 jjl/ml of X-gal (5-bromo-4-chloro-3-indolyl-jb-D-galactopyranoside) at a concentration of 2% in dimethylformamide. Approximately 200 clones 30 (Ampr-Lac Z ) were obtained. EXAMPLE 2 ANALYSIS OF THE LIBRARY To investigate the presence of male bovine DNA 35 inserts, each clone is individually subcultured and - 19 plasmids are isolated from the bacteria by means of minilyzate. Each isolated plasmid is digested by the endonuclease PvuII(Boehringer) and analyzed by electrophoresis in 1% agarose gel (30 volts - 16 h). Fifty of the 200 clones analyzed contain bovine DNA (insert). The specificity of the inserts produced in this way was demonstrated by hybridization with male and female genomic DNA (lymphocytes) digested by the endonuclease EcoRI (Boehringer) and transferred, after electrophoresis, onto DBM paper or HYBOND membranes (AMERSHAM) by SOUTHERN'S technique. Hybridization of the probe b.c.1.2. with male genomic DNA digested by EcoRI reveals the presence of a band of 7.0 kilobases (kb) which is absent in the female genomic DNA. This result was confirmed by 4 studying 12 male and 13 female animals (p<ClO ). EXAMPLE 3 PREPARATION OF THE BOVINE GENOMIC DNA The male and female bovine DNA is purified from 7 5 x 10 peripheral lymphocytes. The cells are incubated at 42°C for 18 hours, with slow stirring, in 10 ml of lysis solution [10 mmol/1 of Tris-HCl pH 7.5, 10 mmol/1 of ethylenediaminetetraacetate-Na^ (EDTA), 50 mmol/1 of NaCl, 0.4% of sodium dodecyl-sulfate plus 2 mg of proteinase K (Boehringer)]. 1 mg of ribonuclease A (Boehringer) in 1 ml of 10 mM Tris-HCl pH 7.5, containing 1 mmol/1 of EDTA, is added in 1 hour at 37°C, this being followed by a second digestion by proteinase K (1 mg, 1 h at 42°C). The lyzates are extracted 3 times with 1 5 ml of a mixture made up of phenol, chloroform and isoamyl alcohol (3:1:0.01 v/v), saturated with 0.2 mol/1 of Tris-HCl pH 7.5. The aqueous phases are washed 3 times^ with a chloroform/isoamyl alcohol solution (1:0.04). * 219 4 3 - 20 - The DNA is precipitated with 2 volumes of absolute ethanol in the presence of 150 mmol/1 of NaCl, and washed with an 80% solution of ethanol in water. DIGESTION BY THE RESTRICTION ENDONUCLEASES 5 15 jjg samples of bovine DNA are digested at 37°C for 18 hours by the restriction endonuclease EcoRI (Boehringer) in an incubation buffer containing 100 mmol/1 of Tris-HCl, 50 mmol/1 of NaCl and 10 mmol/1 of MgCl2, pH 7.5. Complete digestion is obtained with a total of 10 6-10 units per pg of DNA, added in 3 portions. The digested DNA fragments are subjected to electrophoretic separation in 0.7% agarose gel in a buffer containing 0.04 mol/1 of Tris-CH^COOH pH 8 and 0.002 mol/1 of EDTA. The gel is calibrated by including a sample of phage-Lambda DNA digested by Hindlll. TRANSFER The DNA fragments contained in the gel are depurinated for 15 min. at room temperature in 0.25 M HC1, denatured in 0.5 M NaOH + 1.5 M NaCl and then 20 neutralized by being passed successively through 1.5 M phosphate buffer pH 5.5 (3 x 15 min.) and then 0.15 M pH 5.5 (2 x 15 min.). A "Nylon" membrane (Hybond-N Amersham or Pall-Biodyne-A Flobio) is then placed on the gel and the DNA fragments contained in the gel are 25 transferred onto the membrane by capillarity. After transfer for 16 hours in 20 x SSC, the membrane is washed in 2 x SSC, dried in air and then placed in an oven at 80°C for 2 hours. LABELING THE PROBE WITH 32P 30 100 to 200 ng of the probe b.c.1.2., in a volume of 1 to 5 pi, are added to the following reaction mixture: 50 pmol of dATP (1 pi), 50 pmol of dTTP (1 pi), 50 pmol of dCTP (1 ^jl), 50 pCi of <*-32P-dGTP pi) and 2 pi of a reaction buffer containing 500 mmol/1 of ""* 35 Tris-HCl pH 7.5, 500 mmol/1 of HgCl^ and 100 mmol'/l'of f 1 9: 4 3 r> - 21 - ^-mercaptoethanol. The reaction is performed at 16°C for 1 hour 30 min. and then stopped by the addition of 200 pi of a solution containing 10 mmol/1 of Tris-HCl pH 7.5, 80 mmol/1 of EDTA and 0.5% of sodium dodecyl-5 sulfate. The radiolabeled probe is separated from the nucleotides by passage through a column (10 cm x 1 cm) of Sephadex G100 (Pharmacia) and eluted with a buffer containing 10 mmol/1 of Tris-HCl pH 7.5 and 1 mmol/1 of 10 EDTA. The fractions of eluate containing the most radioactivity are then pooled. PREHYBRIDIZATION AND HYBRIDIZATION The filters (blots) are prehybridized at 42°C for 4-10 hours with a mixture containing 50% v/v of 15 deionized formamide, 1 mol/1 of NaCl, 0.2% of Denhart1s solution, 2.5% of dextran sulfate, 0.1% of sodium dodecyl-sulfate and 0.5 mg/ml of sonicated salmon sperm DNA. Hybridization is effected in the same mixture, 20 except that the dextran sulfate is at 5% and the NaCl 32 at 0.5 mol/1. The P-radiolabeled probe, denatured at 100°C for 10 min., is added to the hybridization mixture at a rate of 1 x 10® cpm/ml, which represents about 10 ng of probe per ml. Hybridization is effected at 25 42°C for at least 18 hours. After hybridization, the filters are washed firstly at 65°C for 30 min. in a buffer containing 2 x SSC (0.3 mol/1 of NaCl and 0.03 mol/1 of sodium citrate) + 0.1% of SDS and then for a further 30 min. in the same buffer diluted 10-fold 30 (0.2 x SSC). The filters are then placed in a cassette equipped with "Cronex" intensifiers (DUPONT), which is brought into contact with a KODAK XAR-5 film for autoradiography at -70°C for 6 to 24 hours. DEHYBRIDI ZATION ^ U f' 35 This is effected by washing the filters at 3 ft ' i 'V r 5 10 15 20 25 30 iin - 22 - for 30 min. with 0.4 M NaOH and then in a solution con-taining:0.2 mol/1 of Tris-HCl pH 7.5, 0.1% (v/v) of sodium dodecyl-sulfate and 0.1 x SSC. PREPARATION OF THE DOT-BLOTS 1 ) Genomic DNA dot-blot The genomic DNA of male and female bovines was sonicated for 5 min. (Branson Sonifier B-15) and then diluted with sonicated salmon sperm DNA in proportions such that the total quantity of DNA deposited was 2 jig. The concentration range of bovine DNA was 1 jig, 0.5 jig, 0.25 jig, 0.1 jig and 0.05 jig for a 1 pi deposit. After deposition of the DNA on Pall-Biodyne A membranes, the latter are treated with 0.5 N NaOH + 1.5 N NaCl for 5 min. and then neutralized with 1.5 M phosphate buffer pH 5.5 for 2x5 min. and 0.3 M phosphate buffer pH 5.5 for a further 5 min. The membranes are subsequently dried on a Whatman 3MM and the DNA is then fixed at 80°C for 2 hours. The ready-to-use filters are stored in the prehybridization solution at 4°C. 2) Dot-blot of the bovine cells The peripheral lymphocytes of the male and female bovine were sonicated for 6 minutes and then treated with proteinase K (Boehringer) for 1 hour at 42°C, the dilution range corresponding to 1 x 106, 5 x 105, 1 x 105, 5 x 104, 1 x 104 and 5 x 103 cells in 2 pi. The sonicated salmon sperm DNA is added to make the total DNA up to 2 jig. After deposition of the DNA on a Pall-Biodyne A membrane, the treatment is identical to that of the genomic DNA dot-blot. Hybridization of the dot-blots and visualization of the signals are the same as for blots in general. - 23 - 2194 EXAMPLE 4 SYNTHESIS OF THE OLIGONUCLEOTIDE AND PURIFICATION OF THE SYNTHESIZED OLIGONUCLEOTIDE The chemical synthesis of the oligonucleotide 5 corresponding to the predetermined sequence was carried out with the aid of an "Applied Biosystems" automatic synthesizer by the phosphoramidite technique in the solid phase. As the reaction is 95-97% efficient at each 10 stage, it is necessary to purify the final product (the probe b.c.1.2. - 49 mer) to remove the intermediate oligonucleotides. About 7 mg of the mixture of oligonucleotides in 60 jil of H^O are separated by electrophoresis in a gel containing 20% of polyacrylamide + 15 8 mol/1 of urea, at 700 V, 38 mA, for 3 hours. The band corresponding to the 49 mer is identified with the aid of an aluminum foil coated with silica gel, which is fluorescent at 254 nm (Merck). This part of the gel is cut out and the DNA is then eluted in 1.5 ml 20 of a solution containing 0.5 mol/1 of CH^COONH^ + 5 mmol/1 of EDTA, at 37°C for 16 hours, with stirring. The supernatant is concentrated to about 300 jil and the urea is removed by chromatography on a 10 cm x 1 cm column of Sephadex G-50 (Pharmacia) equilibrated 25 with a buffer containing 10 mmol/1 of Tris-HCl pH 7.5 + 1 mmol/1 of EDTA. The DNA isolated in this way is lyophilized and stored at -20°C. RADIOACTIVE LABELING (32P) OF THE SYNTHESIZED PROBE b.c.1.2. (single-stranded) 30 10 to 20 pmol of the probe b.c.1.2., in a volume of 3 jilf are added to 23 jil of a reaction mixture made up of 100 mmol/1 of dithiothreitol (2.5 jil), 10 mmol/1 of spermidine (2.5 jjI), an incubation buffer containing 500 mmol/1 of Tris-HCl pH 7.5 + 100 mmol/1 of MgCl 32 2 35 (2.5 jjI), 100 pCi (f- P) of adenosine triphosphate - ? 1 9 ' 3 24 - ATP 3000 Ci/mmol (Amersham) - and 20 U of T4 polynucleotide kinase (Boehringer). After incubation for 30 min. at 37°C, the reaction is stopped with 2 jil of 400 mM EDTA and the labeled oligonucleotide is separated 5 from the ATP by column chromatography with Sephadex G-50. EXAMPLE 5 SEQUENCING 10 - PREPARATION OF THE PLASMID b.c.1.2. FOR THE SEQUENCING OF ITS 2 STRANDS a) Lower strand (direction 3' >5') Thirty micrograms of the plasmid b.c.1.2. are digested by the endonuclease Hindlll for 3 hours at 15 37°C. The enzyme is removed by extraction with a phenol/chloroform/isoamyl alcohol mixture (3:1:0.01 v/v). The DNA is subsequently precipitated in 1 volume of isopropanol in the presence of 0.3 mol/1 of CH^COONa and then washed in an 80% solution of ethanol in water. 20 The DNA of the unwound plasmid is labeled in the 3'-position, via the terminal enzyme transferase, 32 with P-dideoxyadenosine triphosphate (SA = 3000 Ci/ mmol) by the technique of kit no. N 4020 from AMERSHAM. DNA of the plasmid 40 ji 1 25 ddATP (125 jiCi ) 13 pi Amersham buffer x 10 10 jil Distilled water 95 jjI AMERSHAM enzyme solution 5 jil Incubation: 1 hour at 37°C. 30 The labeled plasmid is subsequently separated from the nucleotide by passage over Sephadex G75 and then digested by the endonuclease EcoRI, which generates 2 fragments having respective sizes of 2.6 and O^-kb. The 0.1 kb fragment, containing the insert b.c.1.2., 35 is isolated by electrophoresis in 2% agarose gel. It r i v ''J - 25 - is then purified by passage over glass wool and extraction with a phenol/chloroform/isoamyl alcohol mixture. The purified fragment is sequenced by MAXAM and GILBERT's method modified by the company N.E.N. 5 The fragments to be sequenced are analyzed by electrophoresis in 0.2 mm of a gel containing 5%, 8% and 12% of polyacrylamide, on a Macrophore LKB cell (GAROFF and ANSORGE, Analytical Biochemistry, 115 (450-457) 1980]. Depending on the concentrations, the migration 10 times were 6 h—7 h and 2 h. The gels are then fixed with 10% acetic acid for 10 min., washed with water and then dried at room temperature. 219 4 3 1 - 26 - Autoradiography of the gel is effected on a URNO HS 90 film for exposure times of 24, 48 and 72 hours. b) Upper strand (direction 5' >3') 5 The techniques are the same, except that the first digestion enzyme is EcoRI and the second is PVU II. Determination of the nucleotide sequence of the probe b.c.1.2., obtained from peripheral lymphocytes of 10 mammals of the genus Bos, which is composed of the following 49 base pairs: 5J. 21 ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT made it possible to synthesize the probe according to 15 the invention, as described in Example 4 above. The probe b.c.1.2. according to the invention has a high sensitivity since tests carried out on PALL BIODYNE membranes showed that a quantity of 50 ng of bovine DNA is sufficient to give a positive signal. 20 EXAMPLE 6 DETERMINATION OF THE DNA BAND SPECIFIC FOR THE Y CHROMOSOME IN A GIVEN POPULATION OF SPERMATOZOA A. Preparation of DNA from bovine sperm Each straw, containing about 15 to 20 x 10® 25 frozen spermatozoa, is immediately immersed in a water bath at 37°C for about 30 seconds. The contents of each straw are then diluted in 1 to 2 ml of sterile PBS. Each tube is centrifuged at 500 g for 10 min. The supernatant is removed and the residue is taken up in 30 1 to 2 ml of sterile PBS. This washing process is repeated 4 times. After the last centrifugation, the residue of spermatozoa is resuspended in 10 ml of a lysis buffer containing 0.01 mol/1 of Tris-HCl pH 8.0, 0.1 mol/1 of NaCl, 0.01 mol/1 of EDTA, 1% of SDS and 2% ? 1 K - 21 - of f-mercaptoethanol. This buffer is preheated to 50°C. After incubation for 30 minutes at 50°C, 2 mg of proteinase K (final concentration: 200 jjg/ml) are added to each tube and incubation is continued for 2 5 hours at 50°C, with slow stirring. The mixture is then extracted for 15 minutes at room temperature with 15 ml of a solution consisting of 50% of phenol saturated with 0.2 mol/1 of Tris pH 7.5 and 50% of chloroform/isoamyl alcohol (24:1). 10 The lower organic phase is removed and extraction is repeated a further twice. The aqueous phase is then extracted 2 to 3 times for 15 minutes at room temperature with a chloro-form/isoamyl alcohol mixture (24:1). After the last 15 extraction, the aqueous phase is centrifuged at 2000 g for 30 minutes to remove all the chloroform and the precipitated proteins. The clarified supernatant is then mixed with 2^ volumes of absolute ethanol which has been cooled beforehand at -20°C for 15 minutes. 20 When the DNA has precipitated, it is recovered with a sterile pipette and washed for 5 min. in 70% ethanol. The excess alcohol is evaporated off and the DNA is dissolved in a sterile buffer containing 0.001 mol/1 of Tris-HCl pH 8.0 and 0.0001 mol/1 of EDTA. 25 B. Digestion by the restriction endonucleases 15 jig samples of bovine spermatozoa DNA are digested at 37°C for 18 hours by the restriction endonuclease EcoRI (Boehringer) in an incubation buffer containing 100 mmol/1 of Tris-HCl, 50 mmol/1 of NaCl 30 and 10 mmol/1 of MgCl^, pH 7.5. Complete digestion is obtained with a total of 6-10 units per jig of DNA, added in 3 portions. The digested DNA fragments are subjected to electrophoretic separation in 0.7% agarose gel in a buffer containing 0.04 mol/1 of Tris-CH^COOH 35 pH 8 and 0.002 mol/1 of EDTA. The gel is calibrated by including a sample of phage-Lambda DNA digested by Hind III. Transfer The DNA fragments contained in the gel are depurinated for 15 min. at room temperature in 0.25 M HC1, denatured in 0.5 M NaOH + 1.5 M NaCl and then neutralized by being passed successively through 1.5 M phosphate buffer pH 5.5 (3 x 15 min.) and then 0.15 M pH 5.5 (2 x 15 min.). A "Nylon" membrane (Hybond-N Amersham or Pall-Biodyne-A Flobio) is then placed on the gel and the DNA fragments contained in the gel are transferred onto the membrane by capillarity. After transfer for 16 hours in 20 x SSC, the membrane is washed in 2 x SSC, dried in air and then placed in an oven at 80°C for 2 hours. 32 Labeling the probe with P 100 to 200 ng of the probe b.c.1.2., in a volume of 1 to 5 pi, are added to the following reaction mixture 50 ^imol of dATP (1 jil), 50 jimol of dTTP (1 jil), 50 jimol of dCTP (1 jil), 50 pCi of eC-32P-dGTP (5 pi) and 2 pi of a reaction buffer containing 500 mmol/1 of Tris-HCl pH 7.5, 500 mmol/1 of MgC^ and 100 mmol/1 of ^-mercapto-ethanol. The reaction is performed at 16°C for 1 hour 30 minutes and then stopped by the addition of 200 jil of a solution containing 10 mmol/1 of Tris-HCl pH 7.5, 80 mmol/1 of EDTA and 0.5% of sodium dodecyl-sulfate. The radiolabeled probe is separated from the nucleotides by passage through a column (10 cm x 1 cm) of Sephadex G100 (Pharmacia) and eluted with a buffer containing 10 mmol/1 of Tris-HCl pH 7.5 and 1 mmol/1 of EDTA. The fractions of eluate containing the most radioactivity are then pooled. C. Prehybridization and hybridization The filters (blots) are prehybridized at 42°C for 4-10 hours with a mixture containing 50% v/v of 2194 - 29 - deionized formamide, 1 mol/1 of NaCl, 0.2% of Denhart's solution, 2.5% of dextran sulfate, 0.1% of sodium dodecyl-sulfate and 0.5 mg/ml of sonicated salmon sperm DNA. 5 Hybridization is effected in the same mixture, except that the dextran sulfate is at 5% and the NaCl at 32 0.5 mol/1. The P-radiolabeled probe, denatured at 100°C for 10 min., is added to the hybridization mixture at a rate of 1 x 10^ cpm/ml, which represents about 10 10 ng of probe per ml. Hybridization is effected at 42°C for at least 18 hours. After hybridization, the filters are washed firstly at 65°C for 30 min. in a buffer containing 2 x SSC (0.3 mol/1 of NaCl and 0.03 mol/1 of sodium citrate) + 0.1% of SDS and then for a 15 further 30 min. in the same buffer diluted 10-fold (0.2 x SSC). The filters are then placed in a cassette equipped with "Cronex" intensifiers (DUPONT), which is brought into contact with a KODAK XAR-5 film for autoradiography at -70°C for 6 to 24 hours. 20 D. Results The bovine spermatozoa DNA digested by the restriction enzyme EcoRI and then hybridized with the radiolabeled probe b.c.1.2. has an analogous hybridization profile to that obtained with the other bovine cell 25 types tested by the inventors. EXAMPLE 7 DETERMINING OF THE SEX OF BOVINE EMBRYOS BY IN SITU HYBRIDIZATION WITH AN ADN BIOTIN-LABELED PROBE (NON-RADIOACTIVE PROBE). 30 A. Preparation of the cells The cells used come from bovine embryos of 7-8 days old. After been dissected, the cells are deposited on slide and incubated for 10 to 15 minutes in a fixative so lution, such as a mixture of alcohol/acetic acid (3:1 v/v) 35 then dried in air. The slides are used immediately or, ( 2 19 4 - 30 - in case of a later sex determining, kept at -4°C and sheltered from dust. B. Labeling the probe with biotin A fragment of the plasmid pUC9 containing the 5 insert b.c.1.2. is used, the whole fragment amounting to 350 bp. The 350 bp fragment is obtained by digestion by the restriction enzyme PVUII, purified by electrophoresis on agarose gel and extracted from the gel by absorption onto a DEAE NA45 membrane (Schleicher and 1 0 Schuell). The probe is labeled with biotin by nick translation using the following constituents in a final volume of 0.050 ml: dATP, dGTP and dCTP 0.2 mmol of each 15 BRL DNA Polymerase I 0.4 unit/pl DNase I 40 pg/jjl DNA to be labeled 1 pg Biotin-labeled dUTP 0.4 mmol Incubation is carried out for 90 minutes at 15°C and the reaction is stopped with 300 mmol/1 of 20 Na2EDTA + 5% Of SDS (BRL protocol) After labeling, the probe is purified by gel filtration on a column of Sephadex G-100. The various fractions collected are analyzed separately with the aid 25 of the system streptavidine-alkaline phosphatase (DNA Detection System BRL ref. B239 SA). The positive fractions are mixed and the activity of the pool is measured by comparison with a known quantity of biotin-labeled DNA. 3Q C. Technique of hybridization on slides The slides are incubated with 90 to 100 pi of hybridization liquid and covered with a plastic film (to prevent evaporation). „— . After denaturation for 10 min. in an oven at 35 100°C, the slides are placed in a moist chamber and incubated at 42°C for 16 hours. r, 7 - 31 - The final composition of the hybridization liquid is as follows: 4 x SSC 1 mmol/1 of EDTA 5 25 mmol/1 of Tris-HCl pH 7.3 1 x Denhardt 10% of dextran 50% of deionized formamide Probe: 80 ng/ml of hybridization medium 10 (1 x SSC = 0.15 M NaCl, 0.015 M Na citrate) (1 x Denhardt = 0.02% of BSA or 0.02% of skimmed milk powder, 0.02% of polyvinylpyrrolidone and 0.02% of Ficol1) After removal of the plastic film, the slides 15 are washed successively in the following solutions: 2 x SSC (30 minutes at room temperature), then 0.1 x SSC (30 minutes at 42°C), 2 x SSC (15 minutes at room temperature) and finally PBS pH 7.4, to which 0.1% v/v of Triton x - 100 and 0.5% (w/v) of skimmed milk powder 20 (Regilait) have been added. D. Developing The slides, which are still moist after the excess fluid has been removed, are then incubated for 1 hour at 37°C with an antibiotin goat antibody or an 25 antibiotin rabbit antibody. This antibody is sold in a form purified by affinity chromatography (Vector Laboratories ref. SP-3000) and is used in our tests as a 1:350 dilution in PBS pH 7.4 + 0.1% (v/v) of Triton x - 100 + 0.5% (w/v) of skimmed milk powder. 30 After washing for 15 minutes at room temperature in PBS pH 7.4 + 0.1% (v/v) of Triton x - 100 + 0.5% (w/v) of skimmed milk powder, the slides are incubated for 1 hour at 37°C with a conventional anti-goat rabbit antibody or a conventional anti-rabbit goat antibody 219 4 - 32 - coupled to peroxidase (Biosys ref. BI 2403) as a 1:40 dilution in PBS pH 7.4 + 0.1% of Triton + 0.5% of skimmed milk powder. The slides are then washed for two times 15 minutes in PBS pH 7.4, which this time contains 0.1% (v/v) of Tween 20, and finally for 5 minutes in PBS pH 7.4. They are incubated for 5 to 8 minutes at room temperature with a solution of diaminobenzidine (DAB SIGMA ref. D 8001) containing 0.5 mg/ml in PBS pH 7.4 containing 0.01% of ft The amount of precipitate formed by the reaction of the peroxidase with the DAB is increased by the successive precipitation of gold and silver salts in accordance with the process described by BURNS et al. (Journal Clinical Pathology, 1985, 25.' 1085-1092): In a first stage, 50 to 100 jjI of a 2.5 mM solution of Na chloroaurate (NaAuCl. BDH ref. 301 25 2R) 4 are deposited on each slide and the slides are incubated for 5 min. at room temperature. After washing for 5 min. in distilled water, the slides are incubated for 5 min. at room temperature with 50 to 100 pi of a 0.1 M solution of Na sulfide (Na2S, SIGMA ref. S 2006), rinsed for 5 min. with distilled water and incubated for 4 to 8 minutes with 100 to 300 pi of silver reagent. The composition of the silver reagent is as follows: A Na carbonate 0.24 mol/1 (SIGMA ref. S 4132) B1 Ammonium nitrate 13 mmol/1 (SIGMA ref. A 9642) B2 Silver nitrate 6 mmol/1 (BDH ref. 303873N) B3 Dodecatungstosilicic acid 1.5 mmol/1 (BDH ref. 305453R) B4 37% formaldehyde 0.6 pl/ml (SIGMA ref. F 1635) The silver reagent is prepared by successively-mixing solutions B1 , B2, B3 and B4, with stirring. The .'- 6 *) 1 94 3 - 33 - mixture obtained is added in a proportion of 1:1 to solution A and the reagent prepared in this way is used immediately . After treatment with the silver reagent, the 5 slides are washed with distilled for 15 minutes and then in 1 % (v/v) acetic acid for 2 times 15 minutes and finally stained for 1 minute with a 1 % solution of Pyronin Y (SIGMA ref. P 7017) in 1^0, rinsed for a few seconds in distilled water, dried in hot air and mounted 10 in DPX. E. Results of the spermatozoa After in situ hybridization, the presence of a specific label can be detected on the spermatozoa. The background is negligible. An increase in the volume of the 15 head of the spermatozoa is evidence of their decondensation. After in situ hybridization, the presence of the labeling is observed with an optical microscope. The specific labeling is detectable on about 80 to 100 % of the male cells and is totally absent with the female cells. 20 The labeling appears as a brown-black precipate at nuclei of male cells level. EXAMPLE 8 CHECKING THE QUALITY OF THE SORTING OF A POPULATION OF SPERMATOZOA BY IN SITU HYBRIDIZATION ON SPERMATOZOA WITH 2 5 A BIOTIN-LABELED DNA PROBE WITH A DNA PROBE SPECIFIC TO THE GENUS OF THE MALE SEX A. Preparation of the cells The cells used are bull spermatozoa frozen and stored in liquid nitrogen. One straw, i.e. about 30 13,000,000 live spermatozoa, is defrozen. The straws are reheated for 30 seconds at 37°C and the sperm is then diluted in 1 ml of sterile PBS. A series of centrifugations are carried out in order to remove the maximum amount of freezing medium,.,. 35 The suspension of spermatozoa in PBS is first centri- * v., - 34 - fuged for 10 min. at 500 g, the supernatant is sucked off and the spermatozoa are taken up in 1 ml of 0.11 M sodium citrate. The mixture is centrifuged for 10 min. at 500 g. The supernatant is sucked off, the residue is 5 taken up in 1 ml of 0.11 M sodium citrate + 5 % of DMSO and the mixture is centrifuged for 10 min. at 500 g. The supernatant is sucked off and the residue is resuspended in 1 ml of 0.11 M sodium citrate + 15 % of DMSO. The mixture is centrifuged for 10 min. at 500 g. The 10 supernatant is sucked off and the residue is resuspended in 1 ml of 0.11 M sodium citrate + 50 % of DMSO. The mixture is centrifuged for 10 min. at 500 g. The supernatant is sucked off and the residue is resuspended in 1 ml of 0.11 M sodium citrate in 0.1 M Tris-HCl pH 7.4. 15 The mixture is centrifuged for 10 min. at 500 g. The super natant is sucked off and the residue is resuspended in 250 ill of the same buffer. At this step, the cells can be either deposited on a slide (30 to 40 ul of spermatozoa suspension on each 20 slide) and treated by in situ hybridization with a biotin-labeled probe, or deposited on filters and hybridizated by the technique of the dot-blot with a probe labeled with one of the radioactive nucleotides. B. Subtreatement of the slides for the in situ hybridiza 25 tion. After depositing the spermatozoa, the slides are dried in air and the spermatozoa are decondensed by the following procedure. 1) They are subjected to a hypotonic shock with 30 the aid of a 0.08 M solution of potassium chloride for 5 min. at room temperature. The spermatozoa are then fixed in a methanol/acetic acid mixture (3:1) for 30 min. To remove the activity of the endogenous peroxidase, the slides are treated with methanol + 3.3 % of ^ 35 min. and then rinsed in absolute ethanol for 10 min^: xylene for 10 min. and absolute ethanol for 10 miri. 1) L* " I _ r* - 35 - 2) After drying in air, a solution of 40 U of papain (activated with 2 mmol of sodium sulfide in 0.1 M Tris pH 8.6) (or proteinase K or trypsin) is deposited on each slide. 5 3) After incubation for 15 min. at 37°C, the slides are rinsed briefly in PBS and then incubated for 15 min. at room temperature in a 0.1 M solution of Tris pH 8.6 containing 1 % of DMSO or SDS and 40 mmol of an agent for reducing disulfide bridges, such as dithio-10 threitol, 8-mercaptoethanol or the like. The slides are subsquently washed for 3 times 5 min. in PBS and then dried in air. At this stage, the slides are ready for denaturation and in situ hybridization. C. Technique of hybridization on slides 15 The slides are incubated with 90 to 100 pi of hybridization liquid and covered with a plastic fill (to prevent evaporation). After denaturation for 10 min. in an oven at 100°C, the slides are placed in a moist chamber and 20 incubated at 42°C for 16 hours. The final composition of the hybridization liquid is as follows: 4 x SSC 1 mmol/1 of EDTA 25 mmol/1 of Tris-HCl pH 7.3 1 x Denhardt 10% of dextran 50% of deionized formamide Probe: 80 ng/ml of hybridization medium 30 (1 x SSC = 0.15 M NaCl, 0.015 M Na citrate) (1 x Denhardt = 0.02% of BSA or 0.02% of skinuned milk powder, 0.02% of polyvinylpyrrolidone and 0.02% of Ficoll) After removal of the plastic film, the slides^ ^ 35 are washed successively in the following solutions: 21 94 ; - 36 - 2 x SSC (30 minutes at room temperature)/ then 0.1 x SSC (30 minutes at A2°C), 2 x SSC (15 minutes at room temperature) and finally PBS pH 7.4, to which 0.1% v/v of Triton x - 100 and 0.5% (w/v) of skimmed milk powder (Regilait) have been added. D. Developing The slides, which are still moist after the excess fluid has been removed, are then incubated for 1 hour at 37°C with an antibiotin goat antibody or an antibiotin rabbit antibody. This antibody it sold in a form purified by affinity chromatography (Vector Laboratories ref. SP-3000) and is used in our tests as a 1 :350 dilution in PBS pH 7.4 ♦ 0.11 (v/v) of Triton x - 100 4 0.5% (w/v) of skimmed milk powder. After washing for 15 minutes at room temperature in PBS pH 7.4 + 0.1% (v/v) of Triton x - TOO + 0.5* (w/v) of skimmed milk powder, the slides are incubated for 1 hour at 37°C with a conventional anti-goat rabbit antibody or a conventional anti-rabbit goat antibody coupled to peroxidase (Biosys ref. BI 2403) as a 1:40 dilution in PBS pH 7.4 ♦ 0.1% of Triton + 0.5% of skimmed milk powder. The slides are then washed for two times 15 minutes in PBS pH 7.4, which this time contains 0.1% (v/v) of Tween 20, and finally for 5 minutes in PBS pH 7.4. They are incubated for 5 to 8 minutes at room temperature with a solution of diaminobenzidine (DAB SIGMA ref. D 8001) containing 0.5 mg/ml in PBS pH 7.4 containing 0.01% of H2°2* The amount of precipitate formed by the reaction of the peroxidase with the DAB is increased by the successive precipitation of gold and silver salts in accordance with the process described by BURNS et al. (Journal Clinical Pathology, 1985, 35, 1085-1092): 20 25 30 - 37 - In a first stage, 50 to 100 pi of a 2.S mM solution of Na chloroaurate (NaAuCl^ BDH ref. 30125 2R) are deposited on each slide and the slides are incubated for 5 min. at room temperature. After washing for 5 5 min. in distilled water, the slides are incubated for 5 min. at room temperature with 50 to 100 pi of a 0.1 M solution of Na sulfide (Na2S, SIGMA ref. S 2006), rinsed for 5 min. with distilled water and incubated for 4 to 8 minutes with 100 to 300 pi of silver reagent. 10 The composition of the silver reagent it as follows: A Na carbonate 0.24 mol/1 (SIGMA ref. S 4132) B1 Ammonium nitrate 13 mmol/1 (SIGMA ref. A 9642) B2 Silver nitrate 6 nunol/1 (BDH ref. 303873N) 15 B3 Dodecatungstosilicic acid 1.5 mmol/1 (BDH ref. 305453R) B4 37% formaldehyde 0.6 jil/ml (SIGMA ref. F 1635) The silver reagent is prepared by successively mixing solutions B1, B2, B3 and B4, with stirring. The mixture obtained is added in a proportion of 1:1 to solution A and the reagent prepared in this way is used immediately. After treatment with the silver reagent, the slides are washed with distilled H^O for 15 minutes and then in 1% (v/v) acetic acid for 2 times 15 minutes and finally stained for 1 minute with a 1% solution of Pyronin Y (SIGMA ref. P 7017) in H^O, rinsed for a few seconds in distilled water, dried in hot air and mounted in DPX. Altough the foregoing description has referred essentially to the function of the probe b.c.1.2. in determining the sex of bovine embryos, checking the presence of the Y chromosome in a populatiori~~of 3 5 spermatozoa and separating the said population int:d~™T*'-.. </div>

Claims

<div class="application article clearfix printTableText" id="claims"> - 38 - two groups, respectively comprising the Y chromosome and the X chromosome, for their use in artificial insemination, it will easily be understood that this function can be extended to other animals insofar as they exhibit sequences of DNA specific for the male sex which are similar to those in said bovine embryos, likewise, the function of the probe b.c.1.2. as described above is given solely by way of a non-limiting example and can extend to the investigation of other sequences specific for the male sex. As is apparent from the foregoing text, the invention is in no way limited to those methods of implementation, embodiments and methods of application which have now been described more explicitly ; on the contrary, it encompasses all the variants thereof which may occur to those skilled in the art, without departing from the framework or the scope of the present invention. e i LMol WHAT WE CLAIM IS:- 39

1. A molecular probe for DNA specific for the male genome of ruminants, especially of the subfamily of the bovines and particularly of the genus Bos, the said probe having a 5 hybridization profile - determined by hybridization of the said probe with male genomic DNA digested by an appropriate enzyme - which reveals the presence of at least one band specific for the male genome of the ruminants in question, in particular when the hybridization profile - determined 10 by hybridization of the said probe with male genomic DNA digested by EcoRI - reveals the presence of a band of the order of 7 kb which is specific for the male genome of the genus Bos.

2. The molecular probe as claimed in claim 1, which 15 comprises 49 base pairs having the following 5'-3' nucleotide sequence : 11 31 ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT as well as its caiplementary, or a fragment of the said sequence 20 containing at least 11 consecutive nucleotides or any other fragment presenting at least 70 % homology with the above sequence, the said probe being designated by the name b.c.1.2.

3. The molecular probe as claimed in claim 1, the said 25 probe being repeated at least 2000 times in the male genome of the genus Bos.

4. A process for the preparation of a molecular probe for DNA specific for thenale genome of ruminants, especially the subfamily of the bovines and particularly of the 30 genus Bos, where genomic DNA segments which have been made single-stranded are reassociated from a mixture of male and female DNA in which the female DNA is in large excess, of the order of 100 parts per part of male DNA, the said process comprising : - a first step in which female genomic 35 DNA, originating from peripheral lymphocytes of the said < i V . f yp 2194 3 1 40 ruminants, is cut by means of sonication into fragments of 200 to 550 base pairs (bp) and then mixed, in a proportion of the order of 100:1, with male genomic DNA of same ruminants* digested by the endonuclease SAU 3A in order to release restriction fragments with sticky ends, having a size of between 40 and 1650 bp; - a second step in which the said mixture of DNA, after extraction, in a manner known per se, with a phenol/ chloroform/isoamyl alcohol mixture and precipitation with ethanol, is denatured at 100°C and then reassociated at 68°C for 22 hours in a buffer containing 2 mol/1 of (NH^), 50 mmol/1 of sodium phosphate (pH = 6.8) and 5 mmol/1 of EDTA; - a third step in which the reassociated double-stranded DNA is mixed with a plasmid such as the plasmid pUC9 (Ampr-Lac Z+) , which has first been unwound by the endonuclease BamHI and dephosphorylated with alkaline phosphatase, in the presence of the ligase T , which effects the insertion of DNA into the plasmid, by contact for 16 hours at 16°C; - and a fourth step in which the recombinant plasmids obtained in the previous step are used to transform Escherichia coli cells which have been made highly competent, the recombinant clones (Ampr-Lac Z ) being obtained in a proportion of about 200 clones for 2 ml of bacterial cell suspension.

5. The process as claimed in claim 4# wherein the bacterial cells of Escherichia coli are made highly competent, prior to the insertion of the recombinant plasmids, by treatment for 10 minutes at 0°C with a medium comprising 10 mmol/1 of K-Mes (pH = 6.2), 100 mmol/1 of RbCl^, 45 mmol/1 of MnCl^ and 3 mmol/1 of ^o(NH^)^Cl^.

6. The process as claimed in claim 4, wherein the transformed bacteria are spread over a gelose medium containing ampicillin and X-gal (or 5-bromo-4-chlor6'-3-indolyl-^-D-galactopyranoside ) at a low concentration ""arT'5' dimethylformamide. f""s 5 '"*9^ 41

7. The process as claimed In claim 4, wherein the isolated bacterial colonies (Ampr-Lac Z ) are individually subcultured and then amplified with a view to preparing minilyzates, each isolated plasmid is then digested by 5 the endonuclease PvuII, labeled with one or more radioisotopes and hybridized with genomic DNA originating from said ruminants, and the DNA of these animals is digested by the endonuclease EcoRI, which generates restriction fragments of variable size. 10

8. The process as claimed in claim 7, wherein the resulting restriction fragments of variable size are separated by electrophoretic migration on agarose gel.

9. A process for the preparation of a molecular probe for DNA specific for the male genome of ruminants, 15 especially for the subfamily of the bovines and particularly of the genus Bos, wherein the said probe is synthesized by the phosphoramidite method in solid phase.

10. The process as claimed in claim 9, wherein the synthesis of the oligonucleotide which forms part of 20 the composition of the molecular probe is followed by a purification step which consists in separating out the oligonucleotide, associated with oligonucleotides of intermediate size, by electrophoresis on a poly-acrylamide gel, and then identifying the band of the 25 desired pure oligonucleotide with the aid of an aluminum foil coated with silica gel, which is fluorescent at 254 nm, cutting out this band and eluting the DNA in an appropriate solution, and then recovering the pure DNA synthesized. 30 ll. The process as claimed in claim 10, wherein the synthesized oligonucleotide is labeled with one or more radioisotopes after purification.

12. Application of the molecular probe as claimed in claim 1 for determining the sex of ruminant embryos or 35 fetuses, especially of the subfamily of the bovines and r I A " ; .. U; 'i O -l 42 particularly of the genus Bos, wherein the said probe, hybridized to a filter prehybridized in an appropriate manner known per se, when the said probe is reassociated with genomic DNA of said ruminants 5 - male and female - transferred beforehand onto an appropriate filter after having been isolated by electrophoresis on agarose gel, hybridizes to the male genomic DNA and this hybridization is demonstrated by autoradiography and/or by means of a non-radioactive 10 probe, by the presence of hybridization signals in the form of a specific 7 kb band.

13. Application as claimed in claim 12, wherein the DNA to be recognized is contained in lymphocytes of the above-mentioned ruminants. 15 14. Application as claimed in claim 12, wherein the DNA to be recognized is contained in cells issued from amniotic or allantoic fluid or from chorionic villosities of the above-mentioned ruminants.

15. Application as claimed in claim 12, wherein cells 20 or similar containing the DNA to be recognized are deposited on a membrane (dot-blot) or an appropriate filter.

16. Application as claimed in claim 12, wherein the DNA to be recognized is contained in the Y chromosome 25 of the said ruminants, observed at the metaphase stage, in which case the sex is determined by so-called in situ hybridization.

17. Application as claimed in claim 12, wherein the DNA to be recognized is contained in nuclei of cells of the said 30 ruminants at the interphase stage, in which case the sex is determined by so-called in situ hybridization.

18. Application as claimed in claim 12, wherein in the in situ hybridization, a biopsy of 5 to 20 cells from an enbryo of said ruminants is brought into contact with the 35 molecular probe for effecting the labeling of said cells by i 04o 1 43 hybridization with said probe labeled with one or nore radioisotopes or with a non-radioactive probe, then the hybridization is revealed by an appropriated cytoimmunochemical method. 5 19. Application of the molecular probe as claimed in claim 2 for determining the sex of ruminant embryos or fetuses, especially of the subfamily of the bovines and particularly of the genus Bos, wherein the said probe, hybridized to a filter prehybridized in an 10 appropriate manner known per se, when the said probe is reassociated with genomic DNA of said ruminants - male and female - transferred beforehand onto an appropriate filter after having been isolated by electrophoresis on agarose gel, hybridizes to the male 15 genomic DNA and this hybridization is demonstrated by autoradiography and/or by means of a non-radioactive probe, by the presence of hybridization signals in the form of a specific 7 kb band.

20. Application as claimed in claim 19, wherein the 20 DNA to be recognized is contained in lymphocytes of the above-mentioned ruminants.

21. Application as claimed in claim 19, wherein the DNA to be recognized is contained in cells issued from amniotic or allantoic fluid or from chorionic 25 villosities of the above-mentioned ruminants.

22. Application as claimed in claim 19, wherein cells or , ; similar containing the DNA to be recognized are deposited on a membrane (dot-blot) or an appropriate filter. 23 . Application as claimed in claim 1 9, wherein the 30 DNA to be recognized is contained in the Y chromosome of the said ruminants, observed at the metaphase stage, few in which case the sex is determined by so-called in situ hybridization.

24. Application as claimed in claim 19, wherein the 35 DNA to be recognized is contained in nuclei of cells of the said 44 ruminants at the interphase stage, in which case the sex is determined by so-called in situ hybridization.

25. Application as claimed in claim 19, wherein in the in situ hybridization, a biopsy of 5 to 20 cells from an 5 enbryo of said ruminants is brought into contact with the molecular probe for effecting the labeling of said cells by hybridization with said probe labeled with one or more radioisotopes or with a non-radioactive probe, then the hybridization is revealed by an appropriated cytoimmuno-10 chemical method.

26. A process for directly and immediately checking the proportion of spermatozoa bearing the Y chromosome in a population of spermatozoa of ruminants, especially of the subfamily of the bovines and more particularly of the genus 15 Bos, wherein the spermatozoa of the said population are brought into contact with a probe for DNA specific for the male genome of ruminants, especially of the genus Bos, the said probe having a hybridization profile -determined by hybridization of the said probe with male 20 genomic DNA digested by an appropriate enzyme - which reveals the presence of at least one band specific for the male genome or the ruminants in question, in particular when the hybridization profile - determined by hybridization of the said probe with male genomic DNA digested by 25 EcoRI - reveals the presence of a band of the order of 7 kb which is specific for the male genome of the genus Bos, in order to label the said spermatozoa by hybridization with the said probe suitably labeled and the hybridized spermatozoa are then revealed 30 by an appropriated cytoimmunochemical method. 2 7. The checking process as claimed in claim 26, wherein the hybridization of the spermatozoa with the molecular probe for specific DNA is effected in situ directly with the spermatozoa. 35 28. The checking process as claimed in claim 26, wherein .' ! I "! r\ < 45 the hybridization is effected between the molecular probe for specific DNA and the DNA isolated from spermatozoa of ruminants of the genus Bos.

29. The checking process as claimed in claim 28, wherein the spermatozoa are subjected, prior to the hybridization step, to a chemical decondensation process comprising essentially three steps, namely: hypotonic shock, proteolytic digestion and reduction of the disulfide bridges. 30- A process for directly and immediately checking the proportion of spermatozoa bearing the Y chromosome in a population of spermatozoa of ruminants of the subfamily of the bovines and more particularly of the genus Bos, wherein the spermatozoa of the said population are brought into contact with a probe for DNA specific for the male genome of ruminants, especially of the genus Bos, which comprises 49 base pairs having the following 5'-3* nucleotide sequence: 5* 3' ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT as well as its complementary, or a fragment of the said sequence containing at least 11 consecutive nucleotides or any_ other fragment presenting at least 70 % homology with the above sequence, the said probe being designated by the name b.c.1.2., in order to label the said spermatozoa by hybridization with the said probe suitably labeled and the hybridized spermatozoa are then revealed by an appropriated cytoimmunochemical method.

31. The checking process as claimed in claim 30, wherein the hybridization of the spermatozoa with the molecular probe for specific DNA is effected in situ directly with the spermatozoa.

32. The checking process as claimed in claim 30, wherein the hybridization is effected between the molecular probe for specific DNA and the DNA, isolated 46 from spermatozoa of ruminants of the genus Bos.

33. The checking process as claimed in claim 32, wherein the spermatozoa are subjected, prior to the hybridization step, to a chemical decondensation process 5 comprising essentially three steps, namely: hypotonic shock, proteolytic digestion and reduction of the disulfide bridges.

34. The molecular probe for DNA specific for the male genome of ruminants, especially of the genus Bos, as 10 claimed in claim 1, which is labeled with one or more radioisotopes.

35. The molecular probe for DNA specific for the male genome of ruminants, especially of the genus Bos, as claimed in claim 1, which is a non-radioactive probe. 15 36. The molecular probe for DNA specific for the male genome of ruminants, especially of the genus Bos, as claimed in claim 2, which is labeled with one or more radioisotopes.

37. The molecular probe for DNA specific for the male 20 genome of ruminants, especially of the genus Bos, as claimed in claim 2, which is a non-radioactive probe.

38. A process for sorting the spermatozoa bearing the X chromosome and the spermatozoa bearing the Y chromosome in a population of spermatozoa, which comprises the 25 following steps: - 1) labeling the DNA contained in the spermatozoa with a vital stain specific for DNA; 2) sorting, by cytofluorometry, into two fractions of X and Y spermatozoa according to the quantity of DNA which they contain; - 3) checking the quality of the 30 sorting operation carried out in the 2nd step above by using the process for checking the proportion of spermatozoa bearing the Y chromosome in the fraction of Y r*~~ spermatozoa separated out by sorting, as claimed in claim 26; - 4) immunizing rodents (mice or rats) with 35 the checked fractions, which may have been re-sorted following the check, with a view to producing monoclonal or polyclonal antibodies; - 5) checking the specificity of the said antibodies, by means of agglutination, spermatotoxicity, indirect immunofluorescence and flux cytometry tests, in order to obtain specific immunological reagents recognizing antigenic determinants controlled by the X or Y chromosomes and expressed at the surface of the spermatozoa, which reagents are capable of being used to separate live spermatozoa bearing the X chromosome or the Y chromosome; - 6) and separating the fractions of spermatozoa respectively bearing the X chromosome and the Y chromosome in a population of spermatozoa, with the aid of the said immunological reagents. 3 9. The sorting process as claimed in claim 38, wherein the immunization of rodent mammals, which constitutes the 4th step of the sorting process, is followed by collection of the polyclonal antibodies resulting from the said immunization and by absorption of these antibodies on spermatozoa of the opposite sex to that used for immunization, the specificity of these antibodies being checked on spermatozoa of the desired sex, and the said antibodies then being purified if appropriate.

40. The sorting process as claimed in claim 38, wherein the X and Y spermatozoa separated by cytofluorometry are used to prepare monoclonal antibodies specific for the X and Y chromosomes.

41. Specific immunological reagents recognizing antigenic determinants controlled by the X or Y chromosomes used to obtain the said reagents, and expressed at the surface of the spermatozoa, the said reagents consisting of the antibodies obtained by carrying out the process as claimed in claim 38, tested for their specificity and purified if appropriate.

42. A process for sorting the spermatozoa bearing the. » <T: 48 X chromosome and the spermatozoa bearing the Y chromosome in a population of spermatozoa, which comprises the following steps: - 1) labeling the DNA contained in the spermatozoa with a vital stain specific for DNA; 5 2) sorting, by cytofluorometry, into two fractions of X and Y spermatozoa according to the quantity of DNA which they contain; - 3) checking the quality of the sorting operation carried out in the 2nd step above by using the process for checking the proportion of sper-10 matozoa bearing the Y chromosome in the fraction of Y spermatozoa separated out by sorting, as claimed in claim 30; - 4) immunizing rodents (mice or rats) with the checked fractions, which may have been re-sorted following the check, with a view to producing monoclonal 15 or polyclonal antibodies; - 5) checking the specificity of the said antibodies, by means of agglutination, spermatotoxicity, indirect immunofluorescence and flux cytometry tests, in order to obtain specific immunological reagents recognizing antigenic determinants 20 controlled by the X or Y chromosomes and expressed at the surface of the spermatozoa, which reagents are capable of being used to separate live spermatozoa bearing the X chromosome or the Y chromosome; - 6) and separating the fractions of spermatozoa respectively 25 bearing the X chromosome and the Y chromosome in a population of spermatozoa, with the aid of the said immunological reagents.

43. The sorting process as claimed in claim 42, wherein the immunization of rodent mammals, which constitutes the 4th 30 step of the sorting process, is followed by collection of the polyclonal antibodies resulting from the said immunization and by absorption of these antibodies—on. spermatozoa of the opposite sex to that used for immuni- . zation, the specificity of these antibodies being 35 checked on spermatozoa of the desired sex, and the said . ' 11: >\ O i 49 antibodies then b<.ling purified if appropriate. 4 4. The sorting process as claimed in claim 42, wherein the X and Y spermatozoa separated by cytof luorometry are used to prepare monoclonal antibodies specific for the 5 X and Y chromosomes. 4 5. Specific immunological reagents recognizing antigenic determinants; controlled by the X or Y chromosomes used to obtain the said reagents, and expressed at the surface of the spermatozoa, the said reagents consisting 10 of the antibodies obtained by carrying out the process as claimed in claim 42, tested for their specificity and purified if appropriate. 4 6. A moleculer probe for DNA specific for the male genome of ruminants substantially as herein described with reference to the examples. 4 7. A process for the preparation of a moleculer probe for DNA specific for the male genome of ruminants as herein described with reference to the examples. 4 8. Application of the molecular probe as claimed in claim 12 or 19, as herein before described with reference to the examples. 4 9. A checking process as claimed in claim 26 or 30 as hereinbefore described with reference to the examples.

50. A sorting process as claimed in claim 38 or 42 as hereinbefore described with reference to the examples.

51. Specific immunological reagents as claimed in claim 41 or 44 substantially as hereinbefore described with reference to the examples. INSTITUT NATIONAL DE LA RECHERCHE AGROMONIQUE INSTITUT PASTEUR and COMMISSARIAT A L'ENERGIE ATOMIQUE (CEA) (ALDKIiJ S»Nj & </div>