NZ207766A - Plant structural gene expression - Google Patents
Plant structural gene expressionInfo
- Publication number
- NZ207766A NZ207766A NZ20776684A NZ20776684A NZ207766A NZ 207766 A NZ207766 A NZ 207766A NZ 20776684 A NZ20776684 A NZ 20776684A NZ 20776684 A NZ20776684 A NZ 20776684A NZ 207766 A NZ207766 A NZ 207766A
- Authority
- NZ
- New Zealand
- Prior art keywords
- dna
- plant
- structural gene
- gene
- promoter
- Prior art date
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Saccharide Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Description
#
207766
Priority D;ite(s): .. !&. ft. 5$.$.
Complete Specification Filed:
Class: QP.I Hif ^ . .S/MJ5/p.9. ... N UHljiiP.
Is 6 MAR 1987'
Publication Date:
P.O. Journal, No:
NEW ZEALAND PATENTS ACT, 1953
No.:
Date:
COMPLETE SPECIFICATION
smrntmouof ArrutwiT UfiBtfl SECTION 24
/-uibA i z&> C*b
PLANT STRUCTURAL GENE EXPRESSION
yWe, AGRIGENETICS RESEARCH ASSOCIATES LIMITED-, a Colorado limited partnership having its place of business at 3375 Mitchell Lane, Boulder, Colorado, U.S.A. 80301-2244,
hereby declare the invention for which ? / we pray that a patent may be granted to no*/us, and the method by which it is to be performed,
^ patent cpnoj'
to be particularly described in and by the following Btatement: ^
j 17 MAY 1984
(followed by page la)
2H7766
o nn —ti u J
PLANT STRUCTURAL GENE EXPRESSION
BACKGROUND Shuttle Vectors
Shuttle vectors, developed by Ruvkun and Ausubel (1981) Nature 289:85-88, provide a way to insert foreign genetic materials into positions of choice in a large plasmid, virus, or genome. There are two main problems encountered when dealing with large plasmids or genomes. Firstly, the large plamsids may have many sites for each restriction enzyme. Unique, site-specific cleavage reactions are not reproducible and multi-site cleavage reactions followed by ligation lead to great difficulties due to the scrambling of the many fragments whose order and orientation one does not want changed. Secondly, the transformation efficiency with large DNA plasmids is very low. Shuttle vectors allow one to overcome these difficulties by facilitating the insertion, often in vitro, of the foreign genetic material into a smaller plasmid, then transferring, usually by in vivo techniques, to the larger piasmid.
A shuttle vector consists of a DNA molecule, usually a plasmid, capable of being introduced into the ultimate recipient bacteria. It also includes a copy of the fragment of the recipient genome into which the foreign genetic material is to be inserted and a DNA segment coding for a selectable trait, which is also inserted into the recipient genome fragment. The selectable trait ("marker") is conveniently inserted by transposon mutagenesis or by restriction enzymes and ligases.
The shuttle vector can be introduced into the ultimate recipient cell typically a bacterium of the genus Aqrobacterium by a tri-parental mating (Ruvkun and Ausubel, supra), direct transfer of a self-mobilizable vector in a bi-parental mating, direct uptake of exogenous DNA by Aqrobacterium cells ("transformation", using the conditions of M. Holsters _et_al_. (1978) Molec. Gen. Genet. 163:181-187), by spheroplast fusion of Aqrobacterium wi.th-:ano.ther
-la-
207766
bacterial cell, by uptake of 1iposome-encapsulated DNA, or infection with a shuttle vector that is based on a virus that is capable of being packaged in vitro. A tri-parental mating involves the mating of a strain containing a mobilizable plasmid, which carries genes for plasmid mobilization and conjugative transfer, with the strain containing the shuttle vector. If the shuttle vector is capable of being mobilized by the plasmid genes, the shuttle vector is transferred to the recipient cell containing the large genome, e.g. the Ti or Ri plasmids of Aqrobacterium strains.
After the shuttle vector is introduced into the recipient cell, possible events include a double cross over with one recombinational event on either side of the marker. This event will result in transfer of a DNA segment containing the marker to the recipient genome replacing a homologous segment lacking the insert. To select for cells that have lost the original shuttle vector, the shuttle vector must be incapable of replicating in the ultimate host cell or be incompatible with an independently selectable plasmid preexisting in the recipient cell. One common means of arranging this is to provide in the third parent another plasmid which is incompatible with the shuttle vector and which carries a different drug resistance marker.
Therefore, when one selects for resistance to both drugs, the only surviving cells are those in which the marker on the shuttle vector has recombined with the recipient genome. If the shuttle vector carries an extra marker, one can then screen for and discard cells that are the result of a single cross-over between the shuttle vector and the recipient plasmid resulting in cointegrates in which the entire shuttle vector is integrated with the recipient plasmid. If the foreign genetic material is inserted into or adjacent to the marker that is selected for, it will also be integrated into the recipient plasmid as a result of the same double recombination. It might also be carried along when inserted into the homologous fragment at a spot not within or adjacent to the marker, but the greater the distance separating the foreign genetic material from the marker, the more likely will be a recombinational event occurring between the foreign genetic material and marker, preventing transfer of the foreign genetic material.
Shuttle vectors have proved useful in manipulation of Aqrobacterium plasinids: see D. J. Garfinkel et _a]_. (1981) Cell 27^:143-153, A. J. M. Matzke and M. D. Chilton (1981) J. Molec. Appl. Genet. _1_:39-49, and 0. Leemans et al. (1981) J. Molec. Appl. Genet. J_: 149-164, who referred to shuttle vectors by the term "intermediate vectors".
207766
Agrobacteri um--0verviev)
Included within the gram-negative bacterial family Rhizobiaceae in the genus Agrobacteri urn are the species A. tumefaciens and A. rhizogenes. These spccies are respectively the causal agents of crown gall disease and hairy root disease of plants. Crown gall is characterized by the growth of a gall of dedifferentiated tissue. Hairy root is a teratoma characterized by inappropriate induction of roots in infected tissue. In both diseases, the inappropriately growing plant tisssue usually produces one or more amino acid derivatives, known as opines, not normally produced by the plant which are catabolized by the infecting bacteria. Known opines have been classified into three families whose type members are octopine, nopaline, and agropine. The cells of inappropriately growing tissues can be grown in culture, and, under appropriate conditions, be regenerated into whole plants that retain certain transformed phenotypes.
Virulent strains of Aqrobacterium harbor large plasmids known as Ti (tumor-inducing) plasmids in A. tumefaciens and Ri (root-inducing) plasmids in A. rhizogenes. Curing a strain of these plasmids results in a loss of pathogenicity. The Ti plasmid contains a region, referred to as T-DNA (transferred-DNA), which in tumors is found to be integrated into the genome of the host plant. The T-DNA encodes several transcripts. Mutational studies have shown that some of these are involved in induction of tumorous growth. Mutants in the genes for tml, tmr, and tms, respectively, result in large tumors (in tobacco), a propensity to generate roots, and a tendency for shoot induction. The T-DNA also encodes the gene for at least one opine synthetase, and the Ti plasmids are often classified by the opine which they caused to be synthesized. Each of the T-DNA genes is under control of a T-DNA promoter. The T-DNA promoters resemble eukaryotic promoters in structure, and they appear to function only in the transformed plant cell. The Ti plasmid also carries genes outside the T-DNA region. These genes are involved in functions which include opine catabolism, oncogenicity, agrocin sensitivity,
replication, and autotransfer to bacterial cells. The Ri plasmid is organized in a fashion analogous to the Ti plasmid. The set of genes and DNA sequences responsible for transforming the plant cell are hereinafter collectively referred to as the transformation-inducing principle (TIP). The designation TIP therefore includes both Ti and Ri plasmids. The integrated segment of a TIP is termed herein "T-DNA", whether derived from a Ti plasmid or an Ri
"3" J/Kft :>&.
207766
plasmid. Recent general reviews of Agrobacterium-caused disease include those by 1). J. Merlo (1982), Adv. Plant Pathol. Jjl39-178 L. W. Ream and M. P. Gordon (1982), Science 218:854-859, and M. W. Bevan and M. D. Chilton (1982), Ann. Rev. Genet. 357-384; G. Kahl and J. Schell (1982) Molecular Biology of PI ant Tumors.
Agrobacteri urn—Infection of Plant Tissues
Plant cells can be transformed by Aqrobacterium in a number of methods known in the art which include but are not limited to co-cultivation of plant cells in culture with Agrobacterium, direct infection of a plant, fusion of plant protoplasts with Agrobacteriun spheroplasts. direct transformation by uptake of free DNA by plant cell protoplasts, transformation of protoplasts having partly regenerated cell walls with intact bacteria, transformation of protoplasts by liposomes containing T-DNA, use of a virus to carry in the T-DNA, microinjection, and the like. Any method will suffice as long as the gene is reliably expressed, and is stably transmitted through mitosis and meiosis.
The infection of plant tissue by Aqrobacterium is a simple technique well known to those skilled in the art (for an example, see D. N. Butcher et al. (1980) in Tissue Culture Methods for Plant Pathologists, eds.: D. S. Ingrams and J. P. Helgeson, pp. 203-208). Typically a plant is wounded by any of a number of ways, which include cutting with a razor, puncturing with a needle, or rubbing with abrasive. The wound is then inoculated with a solution containing tumor-inducing bacteria. An alternative to the infection of intact plants is the inoculation of pieces of tissues such as potato tuber disks (D. K. Anand and G. T. Heberlein (1977) Amer. J. Bot. _64_: 153-158) or segments of tobacco stems (Binns, et__al_.). After induction, the tumors can be placed in tissue culture on media lacking phytohormones. Hormone independent growth is typical of transformed plant tissue and is in great contrast to the usual conditions of growth of such tissue in culture (A. C. Braun (1956) Cancer Res. _16:53-56).
Aqrobacterium is also capable of infecting isolated cells and cells grown in culture, Martori _et__al_. (1979) Nature 277-.129-131 , and isolated tobacco mesophyll protoplasts. In the latter technique, after allowing time for partial regeneration of new cell walls, Aqrobacterium cells were added to the culture for a time and then killed by the addition of antibiotics. Only those
. ' 'k
,w" * '** "i«V
~4" J 7 MAY 1984
,■ &EC&V""
207766
colls exposed to A. tumefaciens cells harboring the Ti plasmid were capable of forming calli when plated on media lacking hormone. Most calif were found to contain an enzymatic activity involved in opine anabolism. Other workers (R. B. Ilorsch and R. T. Fraley (18 January 1983) 15th Miami Winter Symposium) have reported transformations by co-cultivation, leading to a high rate (greater than 101) of calli displaying honnone-independent growth, with 95% of those calli making opines. M. R. Davey _et_ _a]_. (1980) in Ingram and Helgeson, supra, pp. 209-219, describe the infection of older cells that had been regenerated from protoplasts.
Plant protoplasts can be transformed by the direct uptake of TIP plasmids. M. R. Davey et__a]_. (1980) Plant Sci. Lett. JjB:307-313, and M. R. Davey et _al_. (1980) in Ingram and Helgeson, supra, were able to transform Petunia protopl asts with the Ti plasmid in the presence of pol.y-L-al pha-ornithine to a phenotype of opine synthesis and homione-independent growth in culture. It was later shown (J. Draper _et__al_. (1982) Plant and Cell Physiol. 23:451-458, M. R. Davey et_al_. (1982) in Plant Tissue Culture 1982, ed: A. Fujiwara, pp. 515-516) that polyethelene glycol stimulated Ti uptake and that some T-DNA sequences were integrated into the genome. F. A. Krens et al. (1982) Nature 296:72-74, reported similar results using polyethelene glycol following by a calcium shock, though their data suggests that the integrated T-DNA included flanking Ti plamid sequences.
An alternative method to obtain DNA uptake involves the use of liposomes. The preparation of DNA containing liposomes is taught by Papahadjopoulos in US Patents 4,078,052 and 4,235,871. Preparations for the introduction of Ti-ONA via liposomes have been reported (T. Nagata et al. (1982) in Fujiwara, supra, pp. 509-510, and T. Nagata (1981) Mol. Gen. Genet. 184:161-165). An analogous system involves the fusion of plant and bacterial cells after removal of their cell walls. An example of this technique is the transformation of Vinca protoplast by Aqrobacterium spheroplasts reported by S. Hasezawa et (1981) Mol. Gen. Genet. 182:206-210. Plant protoplasts can take up cell wall delimited Aqrobacterium cells (S. Hasezawa et j]_. (1982) in Fujiwara, supra pp. 517-518).
T-DNA can be transmitted to tissue regenerated from a fusion of two protoplasts, only one of which had been transformed (G. J. Wullems et al. (1980) Theor. Appl. Genet. 56.:203-208). As detailed in the section on Regeneration of Plants, T-DNA can pass through meiosis and be transmitted to progeny as a simple Mendelian trait.
207766
Agrobacteri um--Regeneration of Pi ants
Differentiated plant tissues with normal morphology have been obtained from crown gall tumors. A. C. Braun and H. N. Wood (1976) Proc. Natl. Acad. Sci. USA _73:496-500, grafted tobacco teratomas onto normal plants and were able to obtain normally appearing shoots which could flower. The shoots retained the ability to make opines and to grow independently of phytohormones when placed in culture. In the plants screened, these tumor phenotypes were not observed to be transmitted to progeny, apparently being lost during meiosis (R. Turgeon et^_al_- (1976) Proc. Natl. Acad. Sci. USA 73:3562-3564).
Plants which had spontaneouly lost tumorous properties, or which were derived from teratoma seed, were initially shown to have lost all their T-DNA (F.-M. Yang^jJ_. (1980) In Vitro 16.:87-92, F. Yang^t__al_. (1980) Molec. Gen. Genet. 177:707-714 , M. Lemmers et _a]_. (1980) J. Mol. Biol. 144:353-376). However,
later work with plants that had become revertants after hormone treatment (lmg/1 kinetin) showed that plants which had gone through meiosis, though losing T-DNA genes responsible for the transformed phenotype, could retain sequences homologous to both ends of T-DNA (F. Yang and R. B. Simpson (1981)
Proc. Natl. Acad. Sci. USA 78:4151-4155). G. J. Wul lens et al.. (1981) Cell 24_:719-724, further demonstrated that genes involved in opine anabolism were capable of passing through meiosis though the plants were male sterile and that seeningly unaltered T-DNA could be inherited in a Mendelian fashion (G. Wul 1 ems _et jfL (1982) in A. Fujiwara, supra). L. Otten et_al. (1981) Molec. Gen. Genet. 183:209-213, used Tn7 transposon-generated Ti plasmid mutants in the tins (shoot-inducing) locus to create tumors which proliferated shoots.
When these shoots were regenerated into plants, they were found to form self-fertile flowers. The resultant seeds germinated into plants which contained T-DNA and made opines. Similar experiments with a tmr (root-inducing) mutant showed that full-length T-DNA could be transmitted through ineiosis to progeny,
that in those progeny nopaline genes could be expressed, though at variable levels, and that cotransformed yeast alcohol dehydrogenase I gene was not expressed (K. A. Barton _et jn_. (1983) (Cell _32^: 1033-1043). It now appears that regenerated tissues which lack T-DNA sequences are probably descended from untransformed cells which "contaminate" the tumor (G. Ooms jet__§!• (1982)
Cell 30:589-597).
Roots resulting from transformation from A. rhizogenes have proven relatively easy to regenerate into plantlets (M.-D. ChiIton et_jl- (1982)
Nature 295:432-434. c
-o- ■ —
17 MAY J9S4
207766
Aqrobacterium--Genes on the TIP Plasmids:
A number of genes have been identified within the T-DNA of the TIP pi asm ids. About half a dozen octopine plasmid T-DNA transcripts have been mapped (S. B. Gelvin jet__a]_. (1982) Proc. Natl. Acad. Sci. USA 79^76-80, L. Wi 1 linitzer _et_ _a]_. (1982) EMBO J. J^: 139-146) and some functions have been assigned (J. Leemans _et__al- (1982) EMBO J. J_:147-152). The four genes of an octopine type plasmid that have been well defined by transposon mutagenesis include tms, tmr, and tml (D. J. Garfinkel ,et_jl!_. (1981) Cell 27:143-153). Ti plasmids which carry mutations in these genes respectively incite tumorous calli of Nicotiana tabacum which generate shoots, proliferate roots, and are larger than normal. In other hosts, mutants of these genes can induce different phenotypes (see Chilton, M. D., Ann. Rev. Genet. (1982). The phenotypes of tins and tmr are correlated with differences in the phytohormone levels present in the tumor. The differences in cytokinin:auxin ratios are similar to those which in culture induce shoot or root formation in untransformed callus tissue (D. E. Akiyoshi et _aK (1983) Proc. Natl. Acad. Sci. USA 80^:407-411 ). T-DNA containing a functional gene for either tms or tmr alone, but not functional tml alone, can promote significant tumor growth. Promotion of shoots and roots is respectively stimulated and inhibited by functional tml (L. W. Ream .et jl_. (1983) Proc. Natl. Acad. Sci. USA 80^:1660-1664). Mutations in T-DNA genes do not seem to affect the insertion of T-DNA into the plant genome (J. Leemans jt_jl_. (1982) supra, L. W. Ream et__al_. (1983) supra). The ocs gene encodes octopine synthetase, which has been sequenced by H. De Greve jl_. (1982) J. Mol. Appl. Genet. _1_:499-511. It does not contain introns (intervening sequences commonly found in eukaryotic genes which are posttranscriptionally spliced out of the messenger precursor during maturation of the mRNA). It does have sequences that resemble a eukaryotic transcriptional signal ("TATA box") and a polyadenylation site. As plant cells containing the enzyme octopine synthetase detoxify homo-arginine, the ocs gene may prove to be a useful selectable marker for plant cells that have been transformed by foreign DNA (G. M. S. Van SIogteren et _al_ (1982) Plant Mol. Biol. _1_: 133-142).
Nopaline Ti plasmids encode the nopaline synthetase gene (nos), which has been sequenced by A. Depicker _et__a]_. (1982) J. Mol. Appl. Genet. _1_:561-573. As was found with the ocs gene, nos is not interrupted by introns. It has two putative polyadenylation sites and a potential "TATA box". In contrast to
207766
ocs, nos is preceeded by a sequence which may be a transcriptional signal known as a "CAT box". J. C. McPhersson _al_. (1980) Proc. Natl. Acad. Sci. USA ]1_\2666-2670, reported the in vitro translation of T-DNA encoded mRNAs from crown gall tissues.
Transcription from hairy root T-DNA has also been detected (L. Willmitzer et _al_- (1982) Nol. Gen. Genet. 286:16-22). Functionally, the hairy root syndrome appears to be equivalent of a crown gall tumor incited by a Ti plasinid mutated in tmr (F. F. White and E. W. Nester (1980) J. Bacterid. 144:710-720
In eukaryotes, methylation (especially of cytosine residues) of DNA is correlated with transcriptional inactivation; genes that are relatively under-methylated are transcribed into mRNA. Gelvin et._al_. (1983) Nucleic Acids Res. J_: 159-174, have found that the T-DNA in crown gall tumors is always present in at least one unmethylated copy. That the same genome may contain numerous other copies of T-DNA which are methylated suggests that the copies of T-DNA in excess of one may be biologically inert. (See also G. Poms et al. (1982) Cell 30.:589-597.)
The Ti plasmid encodes other genes which are outside of the T-DNA region and are necessary for the infection process. (See M. Hoisters et__al_. (1980) PI asmid _3:212-230 for nopaline plasmids, and H. De Greve .et _al_. (1981) Plasmid 6_:235-248, D. J. Garfinkel and E. W. Nester (1980) J. Bacteriol 144:732-743, and G. Ooins (1980) J. Bacteriol 144:82-91 for octopine plasmids). Most important are the one genes, which when mutated result in Ti plasmids incapable of oncogenecity. (These loci are also known as vir, for virulence.) The one genes function in trans, being capable of causing the transformation of plant cells with T-DNA of a different plasmid type and physically located on another plasmid (J. Hi 11 e _et__al_. (1982) Pi asmid ]_: 107-118, H. J. Klee et a]_. (1982) J. Bacteriol 150:327-331, M.-D. Chilton (18 January 1983) 15th Miami Winter Symp. Nopaline Ti DNA has direct repeats of about 25 base pairs immediately adjacent to the left and right borders of the T-DNA which might be involved in either excision from the Ti plasmid or integration into the host genome (N. S. Yadav et.al_. (1982) Proc. Natl. Acad. Sci. USA _79_: 6322-6326), and a homologous sequence has been observed adjacent to an octopine T-DNA border (R. B. Simpson et _al_. (1982) Cell 29:1005-1014). Opine catabolism is specified by the occ and noc genes, respectively of octopine- and nopaline-type plasmids. The Ti plasmid also encodes functions f 17 MAY 1984
ai
207766
necessary for its own reproduction including an origin of replication. Ti plasmid transcripts have been detected in A. tumefaciens cells by S. B. Gelvin _et_ _al_. (1981) PI asmid jhl7-29, who found that T-DNA regions were weakly transcribed along with non-T-DNA sequences. Ti plasmid-deternrined characteristics have been reviewed by Merlo, supra (see especially Table II), and Ream and Gordon supra.
Agrobacterium-TIP Piasmid DNA
Different octopine-type Ti plasmids are nearly 100X homologous to each other when examined by DNA hybridization (T. C. Currier and E. W. Nester (1976) J. Bacteriol. 126:157-165) or restriction enzyme analysis (0. Sciaky et al. (1978) PIasmid J_:238-253). Nopaline-type Ti plasmids have as little as 67% homology to each other (Currier and Nester, supra). A survey revealed that different Ri plasmids are very homologous to each other (P. Costantino et al. (1981) PIasmid J5:170-182). N. H. Drummond and M.-D. Chilton (1978) J. Bacteriol. 136:1178-1183, showed that proportionally small sections of octopine and nopaline type Ti plasmids were homologous to each other. These homologies were mapped in detail by G. Engler jt jl_. (1981) J. Mol. Biol. 152:183-208. They found that three of the four homologous regions were subdivided into three (overlapping the T-DNA), four (containing some one genes), and nine (having one genes) homologous sequences. The uninterrupted homology contains at least one tra gene (for conjugal transfer of the Ti plasmid to other bacterial cells), and genes involved in replication and incompatibility. This uninterrupted region has homology with a Sym plasmid (involved in symbiotic nitrogen fixation) from a species of Rhizobium, a different genus in the family Rhizobiaceae (R. K. Prakash _et__al_. (1982)
PI asmid 7_:271-280). The order of the four regions is not conserved, though they are all oriented in the same direction. Part of the T-DNA sequence is very highly conserved between nopaline and octopine plasmids (M.-D. Chilton et al. (1978) Nature 275:147-149, A. Depicker jit__al_. (1978) Nature 275:150-153). Ri plasmids have been shown to have extensive homology among themselves, and to both octopine (F. F. White and E. W. Nester (1980) J. Bacteriol. 144:710-720) and nopaline (G. Risuleo et jil_. (1982) PI asmid 7_:45-51) Ti plasmids, primarily in regions encoding one genes. Ri T-DNA contains extensive though weak homologies to T-DNA from both types of Ti plasmid (L. Wi 1 lmitzer _aT_- (1982) Mol. Gen. Genet. 186:3193-3197). Plant DNA from uninfected Nicotiana glauca contains sequences, referred to as cT-DNA
* 17MAYm4
207766
(cellular T-DNA), that show homology to a portion of the Ri T-DNA (F. F. White et al. (1983) Nature 301:348-350).
It has been shown that a portion of the Ti (M.-D. Chi 1 ton _et__al_- (1977) Cell H:263-271) or Ri (M.-D. Chilton (1932) Nature 295:432-434, F. F. White et ah (1982) Proc. Natl. Acad. Sci. USA 79:3193-3197, L. Willmitzer (1982) Mol. Gen. Genet. 186:16-22) plasmid is found in the DNA of tumorous plant cells. The transferred DNA is known as T-DNA. T-DNA is integrated into the host DNA (M. F. Thomashow et._aL (1980) Proc. Natl. Acad. Sci. USA 77:6448-6452, N. S. Yadav et_jl. (1980) Nature 287:458-461) in the nucleus (M. P. Nuti _et_al. (1980) Plant Sci. Lett. 18:1-6, L. Willmitzer _§!• (1980) Nature 281:359-361 , M.-D. Chi 1 ton et _aK (1980) Proc. Natl. Acad. Sci. USA 77;4060-4064).
M. F. Thomashow ah (1980) Proc. Natl. Acad. Sci. USA 77:6448-6452, and M. F. Thomashow et jK (1980) Cell _19;729-739, found the T-DNA from octopine-type Ti plasmids to have been integrated in two separate sections, TL-DNA and TR-DNA, left and right T-DNAs respectively. The copy numbers of TR and TL can vary (D. J. Merlo et _al_. (1980) Molec. Gen. Genet. 177:637-643). A core of T-DNA is highly homologous to nopaline T-DNA (ChiIton et _al_. (1978) supra and Depicker et _al- (1978) supra), is required for tumor maintenance, is found in TL, is generally present in one copy per cell, and codes for the genes tins, tmr, and tml. On the other hand TR can be totally dispensed with (M. De Beuckeleer _et_jl. (1981) Molec. Gen. Genet. 183:283-288, G. Poms et al. (1982) Cell ^30:589-597), though found in a high copy number (D. J. Merlo et al. (1980) supra). G. Ooms et _§!• (1982) Plasmid 7^15-29, hypothesized that TR is involved in T-DNA integration, though they find that when TR is deleted from the Ti plasmid, A. tumefaciens does retain some virulence. G. Ooms jet al. (1982) Cell 30_:589-597, showed that though T-DNA is occasionally deleted after integration in the plant genome, it is generally stable and that tumors containing a mixture of cells that differ in T-DNA organization are the result of multiple transformation events. The ocs is found in TL but can be deleted from the plant genome without loss of phenotypes related to tumorous growth. The left border of integrated TL has been observed to be composed of repeats of T-DNA sequences which are in either direct or inverted orientations (R. B. Simpson et al. (1982) Cell 29:1005-1014).
In contrast to the situation in octopine-type tumors, nopaline T-DNA is integrated into the host genome in one continuous fragment (M. Lemmers et
If.:.'""' ■■,
L .17 MAY J9S4
vv©S^ar ,
s'
20776&
al. (1980) J. Mol. Biol. 144:353-376 , P. Zambryski jk al_. (1980) Science 209:1385-1391). Direct tandem repeats were observed. T-DNA of plants regenerated from teratomas had minor modifications in the border fragments of the inserted DNA (Lenuners et _al_. supra). Sequence analysis of the junction between the right and left borders revealed a number of direct repeats and one inverted repeat. The latter spanned the junction (Zambryski _et__a]_. (1980) supra). The left junction has been shown to vary by at least 70 base pairs while the right junction varies no more than a single nucleotide (P. Zambryski _et__a]_. (1982) J. Molec. Appl. Genet. J_:361-370). Left and right borders in junctions of tandem arrays were separated by spacers which could be over 130 bp. The spacers were of unknown origin and contained some T-DNA sequences. T-DNA was found to be integrated into both repeated and low copy number host sequences.
N. S. Yadav _et j|l_. (1982) Proc. Natl. Acad. Sci. USA 79.:6322-6326, have found a chi site, which in the bacteriophage lambda augments general recombination in the surrounding DNA as far as 10 kilobases away, in a nopaline Ti plasmid just outside the left end of the T-DNA. R. B. Simpson et al. (1982) Cell 29;1005-1014, have not observed a chi sequence in an octopine Ti plasmid, though the possible rangeof action does not eliminate the possibility of one being necessary and present but outside of the region sequenced. The significance of the chi in the Ti plasmid is not known. If the chi has a function, it is probably used in Aqrobacterium cells and not in the plants, as chi is not found within the T-DNA.
Agrobacterium-Manipulations of the TIP PIasmids
As detailed in the section on Shuttle Vectors, technology has been developed for the introduction of altered DNA sequences into desired locations on a TIP plasmid. Transposons can be easily inserted using this technology (D. J. Garfinkel _et..al_. (1981) Cell .27.: 143-153). J.-P. Hernalsteen et al. (1980) Nature 287:654-656, have shown that a DNA sequence (here a bacterial transposon) inserted into T-DNA in the Ti plasmid is transferred and integrated into the recipient plant's genome. Though insertion of foreign DNA has been done with a number of genes from different sources, to date the genes have not been expressed under control of their own promoters. Sources of these genes include alcohol dehydrogenase (Adh) from yeast (K. A, Barton et al. (1983)), AdhI (J. Bennetzen, unpublished) and zein from corn, interferon and globin from mammals, and the mammalian virus SV40 (J. ScheTp
« WAV
207766
unpublished). M. Mol sters _et_ jl_. (1982) Mol. Gen. Genet. 1135:283-289, have shown that a bacterial transposon (Tn7) inserted into T-DNA could be recovered in a fully functional and seemingly unchanged form after integration into a plant genome.
Deletions can be generated in a TIP plasmid by several methods. Shuttle vectors can be used to introduce deletions constructed by standard recombinant DNA techniques (Cohen and Boyer US Pat. 4,237,224). Deletions with one predetermined end can be created by the improper excision of transposons (B. P. Koekman et _al_. (1979) PI asmid 2^:347-357 , G. Ooms _et_ _al_. (1982) Plasmid _7:15-29). J. Hi 11 e and R. Schilperoot (1981) PI asmid j6_: 151-154, have demonstrated that deletions having both ends at predetermined positions can be generated by use of two transposons. The technique can also be used to construct "recombinant DNA" molecules in vivo.
The nopaline synthetase gene has been used for insertion of DNA segments coding for drug resistance that can be used to select for transformed plant cells. M. Bevan (reported by M.-D. Chilton et jK (18 January 1983) 15th Miami Winter Symp., see also J. L. Marx (1983) Science 219:830) and R. Horsch et^_al_. (18 January 1983) 15th Miami Winter Symp., see Marx, supra, have inserted the kanamycin resistance gene (neomycin phosphotransferase) from Tn5 behind (under control of) the nopaline promoter. The construction was used to transform plant cells which in culture displayed resistance to kanamycin and its analogs such as G418. J. Schell _et _al_. (18 January 1983) 15th Miami Winter Symp.(see also Marx, supra), reported a similar construction, in which the methotrexate resistance gene (dihydrofolate reductase) from Tn7 was placed behind the nopaline synthetase promoter. Transformed cells were resistant to methotrexate. As plant cells containing octopine synthetase are resistant to the toxic chemical homo-arginine, G. M. S. Van Slogteren et jl_. (1982) Plant Mol. Biol. J_:133-142, have proposed using that enzyme as a selectable marker.
M.-D. Chilton et_j}l_. (1983) supra, reported that A. Defremeux has constructed a "mini-Ti plasmid". In the nopaline T-DNA there is normally only one site cut by the restriction enzyme KpnI. A mutant lacking the site was constructed and a KpnI fragment, containing the entire nopaline T-DNA, was isolated. This fragment together with a kanamycin resistance gene was inserted into pRK290, thereby resulting in a plasmid which could be maintained in A. tumefaciens and lacked almost all non-T-DNA Ti sequences. By itself, this plasmid was not able to transform plant cells. However when placed in an
17 MAY 1984 fteCHVfc:.
20776C-
A. tumefaciens strain containing an octopine Ti plasmid, tumors were induced which synthesized both octopine and nopaline. This indicated that the missing nopaline Ti plasmid functions were complemented by the octopine Ti plasmid, and that the nopaline "mini-Ti" was functional in the transformation of plant cells. Chilton .et _aj_. (1983) supra also reported on the construction of a "inicro-Ti" plasmid made by resectioning the mini-Ti with Smal to delete essentially all of T-DNA but the nopaline synthetase gene and the left and right borders. The micro-Ti was inserted into a modified pRK290 plasmid that was missing its Smal site, and employed in a manner similar to mini-Ti, with comparable results.
H. Lorz_et_a]_. (1982) in Plant Tissue Culture 1982, ed: A. Fujwara, pp. 511-512, reported the construction of a plasmid vector, apparently independent of the TIP system for DNA uptake and maintenance, that used the nopaline synthetase gene as a marker.
Phaseolin and gene regulation
In general the genes of higher eukaryotes are highly regulated. A multicellular organism, such as a plant, has a number of differentiated tissues, each with its own specialized functions, each of which requires specialized gene products. One such tissue is the cotyledon. In legumes, the cotyledons usually serve as the storage tissue for the seed, holding reserves of lipid, carbohydrate, minerals, and protein until the seed needs them during germination. In Phaseolus vulgaris L. (also known as the French bean, kidney bean, navy bean, green bean and other names), the major storage protein is known as phaseolin. This protein comprises a small number of molecular species that are extremely homologous and equivalent to one another.
Phaseolin contributes most of the nutrition value of dried beans, often comprising more than 10% of the weight of a dried bean,
Phaseolin is highly regulated during the life cycle of P. vulgaris. The protein is made essentially only while seed is developing within the pod.
Levels rise from the limit of detection to as much as half the seed's protein content, following genetically determined schedules for synthesis. At its peak, phaseolin synthesis can account for over 80% of a cotyledon cell's protein synthesis. At other times and in other tissues, phaseolin synthesis is undetectable. The extreme nature of phaseolin's regulation, coupled with its worldwide nutritional importance, has lead to much interest in the study of phaseolin, its properties, and its regulation.
-13- >''hAY!/0-4
O i i*-1 '■"! r\
/o ■; . » u o
SUMMARY OF THE INVENTION
The invention disclosed herein provides a plant comprising a genetically modified plant cell having a plant structural gene introduced and expressed therein under control of a T-DNA promoter. Further, the invention provides plant tissue comprising a plant cell whose genome includes T-DNA comprising a plant structural gene inserted in such orientation and spacing with respect to a T-DNA promoter as to be expressible in the plant cell under control of the T-DNA promoter. Also provided are novel strains of bacteria containing and replicating T-DNA, as defined herein, the T-DNA being modified to contain an inserted plant structural gene in such orientation and spacing with respect to a T-DNA promoter as to be expressible in a plant cell under control of said T-DNA promoter. Further, the invention provides novel plasmids having the ability to replicate in E. coli and comprising T-DNA, and further comprising a plant structural gene inserted within T-DNA contained within the plasmid, in such manner as to be expressible in a plant cell under control of a T-DNA promoter.
The experimental work disclosed herein is believed to be the first demonstration that plant structural genes are expressible in plant cells under control of a T-DNA promoter, after introduction via T-DNA, that is to say, by inserting the plant structural genes into T-DNA under control of a T-DNA promoter and introducing the T-DNA containing the insert into a plant cell using known means. The disclosed experiments are also believed to provide the first demonstration that plant structural genes containing introns are expressed in plant cells under control of a T-DNA promoter after introduction via T-DNA. These results are surprising in view of the fact that the genes previously reported to be expressible in T-DNA under control of a T-DNA promoter, either endogenous T-DNA genes or inserted foreign genes, lacked introns. The results are unexpected also in view of the prior art failure to demonstrate that a T-DNA promoter could function to control expression of a plant structural gene when the latter is introduced into T-DNA under the proper conditions. The invention is useful for genetically modifying plant tissues and whole plants by inserting useful plant structural genes from other plant species or strains. Such useful plant structural genes include, but are not limited to, genes coding for storage proteins, lectins, disease resistance factors, herbicide resistance factors, insect resistance factors-,
"14" 17 MAY 1934
?'£C?1\'5D
6 t t D b environmental stress tolerance factors, specific flavor elements, and the like. The invention is exemplified by introduction and expression of a structural gene for phaseolin, the major seed storage protein of the bean Phaseolus vulgaris L., into sunflower and tobacco plant cells. Once plant cells expressing a plant structural gene under' control of a T-DNA promoter are obtained, plant tissues and whole plants can be regenerated therefrom using methods and techniques well known in the art. The regenerated plants are then reproduced by conventional means and the introduced genes can be transferred to other strains and cultivars by conventional plant breeding techinques. The introduction and expression of the structural gene for phaseolin, for example, can be used to enhance the protein content and nutritional value of forage crops such as alfalfa. Other uses of the invention, exploiting the properties of other structural genes introduced into other plant species will be readily apparent to those skilled in the art. The invention in principle applies to any introduction of a plant structural gene into any plant species into which T-DNA can be introduced and in which T-DNA can remain stably replicated. In general these species include, but are not limited to, dicotyledenous plants, such as sunflower (family Compositeae), tobacco (family Solanaceae), alfalfa, soybeans and other legumes (family Leguminoseae) and most vegetables.
DETAILED DESCRIPTION OF THE INVENTION
The following definitions are provided, in order to remove ambiguities to the intent or scope of their usage in the specification and claims.
T-DNA: A segment of DNA derived from the tumor-inducing principle (TIP) which becomes integrated in the plant genome. As used herein, the term includes DNA originally derived from any tumor-inducing strain of Agrobacterium including A. tumefaciens and A. Rhizogenes, the inserted segment of the latter sometimes referred to in the prior art as R-DNA. In addition, as used herein the term T-DNA includes any alterations, modifications, mutation, insertions and deletions either naturally occurring or introduced by laboratory procedures, a principle structural requirement and limitation to such modifications being that sufficient of the right and left ends of naturally-occurring T-DNAs be present to insure the expected function of stable integration in the transformed plant cell genome which is
-15" WMAYI9M
207766
characteristic of T-DNA. In addition, the T-DNA must contain at least one T-DNA promoter in sufficiently complete form to control initiation of transcription and initiation of translation of an inserted plant structural gene. Preferably, an insertion site will bo provided "downstream" in the direction of transcription and translation initiated by the promoter, so located with respect to the promoter to enable a plant structural gene inserted therein to be expressed under control of the promoter, either directly or as a fusion protein.
Plant structural gene: As used herein includes that portion of a plant gene comprising a DNA segment coding for a plant protein, polypeptide or portion thereof but lacking those functional elements of a plant gene that regulate initiation of transcription and inititation of translation, commonly referred to as the promoter region. A plant structural gene may contain one or more introns or it may constitute an uninterrupted coding sequence. A plant structural gene may be derived in whole or in part from plant genomic DNA, cDNA and chemically synthesized DNA. It is further contemplated that a plant structural gene could include modifications in either the coding segments or the introns which could affect the chemical structure of the expression product, the rate of expression or the manner of expression control. Such modifications could include, but are not limited to, mutations, insertions, deletions, and "silent" modifications that do not alter the chemical structure of the expression product but which affect intercellular localization, transport, excretion or stability of the expression product. The structural gene may be a composite of segments derived from a plurality of sources, naturally occurring or synthetic, coding for a composite protein, the composite protein being in part a plant protei n.
T-DNA promoter: Refers to any of the naturally occurring promoters of integrated T-DNA. These include, but are not limited to,
promoters of the octopine synthetase gene, nopaline synthetase gene, Tms, Tml and Tmr genes, uepending in part on the TIP
source of the T-DNA. Expression under control of a T-DNA promot
O
16
2077S6
may take the form of direct expression in which the structural gene normally controlled by the promoter is removed and replaced by the inserted plant structural gene, a start codon being provided either as a remnant of the T-DNA structural gene or as part of the inserted plant structural gene, or by fusion protein expression in which part or all of the plant structural gene is inserted in correct reading frame phase within the existing T-DNA structural gene. In the latter
I
case, the expression product is referred to as a fusion protein.
Plant tissue: Includes differentiated and undifferentiated tissues of plants including roots, shoots, pollen, seeds, tumor tissue, such as crown galls, and various forms of aggregations of plant cells in culture, such as embryos and calluses.
PI ant eel 1: As used herein includes plant cells in pi ant a and plant cells and protoplasts in culture.
Production of a genetically modified plant expressing a plant structual gene introduced via T-DNA combines the specific teachings of the present disclosure with a variety of techniques and expedients known in the art. In most instances, alternative expedients exist for each stage of the overall process. The choice of expedients depends on variables such as the choice of the basic TIP, the plant species to be modified and the desired regeneration strategy, all of which present alternative process steps which those of ordinary skill are able to select and use to achieve a desired result. The fundamental aspects of the invention are the nature and structure of the plant structural gene and its means of insertion into T-DNA. The remaining steps to obtaining a genetically modified plant include transferring the modified T-DNA to a plant cell wherein the modified T-DNA becomes stably integrated as part of the plant cell genome, techniques for in vitro culture and eventual regeneration into whole plants, which may include steps for selecting and detecting transformed plant cells and steps of transferring the introduced gene from the originally transformed strain into commercially acceptable
A principle feature of the present invention is the construction of T-DNA having an inserted plant structural gene under control of a T-DNA promoter, as these terms have been defined, supra. The plant structural gene must be cultivars
17
17 MAY 1984
2.07766
inserted in correct position and orientation with respect to the T-DNA promoter. Position has two aspects. The first relates to which side of the promoter the structural gene is inserted. It is known that the majority of promoters control initiation of transcription and translation in one direction only along the DNA. The region of DNA lying under promoter control is said to lie "downstream" or alternatively "behind" the promoter. Therefore, to be controlled by the promoter, the correct position of plant structural gene insertion must by "downstream" from the promoter. (It is recognized that a few known promoters exert bi-directional control, in which case either side of the promoter could be considered to be "downstream" therefrom.) The second aspect of position refers to the distance, in base pairs, between known functional elements of the promoter, for example the transcription initiation site, and the translational start site of the structural gene. Substantial variation appears to exist with regard to this distance, from promoter to promoter. Therefore, the structural requirements in this regard are best described in functional terms. As a first approximation, reasonable operability can be obtained when the distance between the promoter and the inserted structural gene is similar to the distance between the promoter and the T-DNA gene it normally controls. Orientation refers to the directionality of the structural gene. By convention, that portion of a structural gene which ultimately codes for the amino terminus of the plant protein is termed the 5' end of the structural gene, while that end which codes for amino acids near the carboxyl end of the protein is termed the 3' end of the structural gene. Correct orientation of the plant structural gene is with the 5' end thereof proximal to the T-DNA promoter. An additional requirement in the case of constructions leading to fusion protein expression is that the insertion of the plant structural gene into the T-DNA structural gene sequence must be such that the coding sequences of the two genes are in the same reading frame phase, a structural requirement which is well understood in the art. An exception to this requirement, of relevance to the present invention, exists in the case where an intron separates the T-DNA gene from the first coding segment of the plant structural gene. In that case, the intron splice sites must be so positioned that the correct reading frame for the T-DNA gene and the plant structural gene are restored in phase after the intron is removed by post-transcriptional processing. The source of T-DNA may be any of the TIP plasmids. The plant structural gene is inserted by standard techniques well known to those skilled in the art. Differences in rates;of-expression may be
.18_ i
« » o observed when a given plant structural gene is inserted under control of different T-DNA promoters. Different properties, including such properties as stability, inter-cellular localization or excretion, antigenicity and other functional properties of the expressed protein itself may be observed in the case of fusion proteins depending upon the insertion site, the length and properties of the segment of T-DNA protein included within the fusion protein and mutual interactions between the components of the fusion protein that effect folded configuration thereof, all of which present numerous opportunities to manipulate and control the functional properties of the expression product, depending upon the desired end use. Expression of the phaseolin structural gene has been observed when that gene was inserted under control of the nopaline synthetase promoter of pC58, a nopaline plasmid of A. tumefaci ens.
A convenient means for inserting a plant structural gene into T-DNA involves the use of a shuttle vector, as described supra, having a segment of T-DNA (that segment into which insertion is desired) incorporated into a plasmid capable of replicating in E. coli. The T-DNA segment contains a restriction site, preferably one which is unique to the shuttle vector. The plant structural gene can be inserted at the unique site in the T-DNA segment and the shuttle vector is transferred into cells of the appropriate Agrobacterium strain, preferably one whose T-DNA is homologous with the T-DNA segment of the shuttle vector. The transformed Aqrobacterium strain is grown under conditions which permit selection of a double-homologous recombination event which results in replacement of a pre-existing segment of the Ti plasmid with a segment of T-DNA of the shuttle vector.
Following the strategy just described, the modified T-DNA can be transferred to plant cells by any technique known in the art. For example, this transfer is most conveniently accomplished either by direct infection of plants with the novel Agrobacteri um strain containing a plant gene incorporated within its T-DNA, or by co-cultivation of the Aqrobacterium strain with plant cells. The former technique, direct infection, results in due course in the appearance of a tumor mass or crown gall at the site of infection. Crown gall cells can be subsequently grown in culture and, under appropriate circumstances known to those of ordinary skill in the art, regenerated into whole plants that contain the inserted T-DNA segment. Using the method of co-cultivation, a certain proportion of the**-p-T-ant1.cells are
•' • /'.;*/ •» .:r~
transformed, that is to say have T-DNA transferred therein and- IrisSrtecL in the
2-7700
plant cell genome. In either case, the transformed cells must be selected or screened to distinguish than from untransformed cells. Selection is most readily accomplished by providing a selectable marker incorporated into the T-ONA in addition to the plant structural gene. Examples include either dihydrofolate reductase or neomycin phosphotransferase expresssed under control of a nopaline synthetase promoter. These markers are selected by growth in medium containing methotrexate or kanamycin, respectively, or their analogs. In addition, the T-DNA provides endogenous markers such as the gene or genes controlling hormone-independent growth of Ti-induced tumors in culture, the gene or genes controlling abnormal morphology of Ri-induced tumor roots, and genes that control resistance to toxic compounds such as amino acid analogs, such resistance being provided by an opine synthetase. Screening methods well known to those skilled in the art include assays for opine production, specific hybridization to characteristic RNA or T-DNA sequences, or immunological assays for specific proteins, including ELISA (acronym for "jmzyme J_inked jmmunosorbant _assay"), radioimmune assays and "western" blots.
An alternative to the shuttle vector strategy involves the use of plasmids comprising T-DNA or modified T-DNA, into which a plant structural gene is inserted, said plasmids being capable of independent replication in an Agrobacteri um strain. Recent evidence indicates that the T-DNA of such plasmids can be transferred from an Aqrobacterium strain to a plant cell provided the Aqrobacterium strain contains certain trans-acting genes whose function is to promote the transfer of T-DNA to a plant cell. Plasmids that contain T-DNA and are able to replicate independently in an Aqrobacterium strain are herein termed "sub-TIP" plasmids. A spectrum of variations is possible in which the sub-TIP plasmids differ in the amount of T-DNA they contain. One end of the spectrum retains all of the T-DNA from the TIP plasmid, and is sometimes termed a "mini-TIP" plasmid. At the other end of the spectrum, all but the minimum amount of DNA surrounding the T-DNA border is deleted, the remaining portions being the minimum necessary to be transferrable and integratable in the host cell. Such plasmids are termed "micro-TIP". Sub-TIP plasmids are advantageous in that they are small and relatively easy to manipulate directly. After the desired structural gene has been inserted, they can easily be introduced directly into a plant cell containing the trans-acting genes that promote T-DNA transfer. Introduction into an Agrobacterium strain is conveniently accomplished either by transformation of the Aqrobacterium strain or by conjugal transfer from a
17 MAY 1984
2 w't i o Q
donor bacterial cell, the techniques for which are well known to those of ordinary skill.
Regeneration is accomplished by resort to known techniques. An object of the regeneration step is to obtain a whole plant that grows and reproduces normally but which retains integrated T-DNA. The techniques of regeneration vary somewhat according to principles known in the art, depending upon the origin of the T-DNA, the nature of any modifications thereto and the species of the transformed plant. Plant cells transformed by an Ri-type T-DNA are readily regenerated, using techniques well known to those of ordinary skill, without undue experimentation. Plant cells transformed by Ti-type T-DNA can be regenerated, in some instances, by the proper manipulation of hormone levels in culture. Preferably, however, the Ti-transformed tissue is most easily regenerated if the T-DNA has been mutated in one or both of the Tmr and Tms genes. Inactivation of these genes returns the hormone balance in the transformed tissue towards normal and greatly expands the ease and manipulation of the tissue's hormone levels in culture, leading to a plant with a more normal hormone physiology that is readily regenerated. In some instances, tumor cells are able to regenerate shoots which carry integrated T-DNA and express T-DNA genes, such as nopaline synthetase, and which also express an inserted plant structural gene. The shoots can be maintained vegetatively by grafting to rooted plants and can develop fertile flowers. The shoots thus serve as parental plant material for normal progeny plants carrying T-DNA and expressing the plant structural gene inserted therein.
Examples
The following Examples utilize many techniques well known and accessible to those skilled in the arts of molecular biology and manipulation of TIPs and Agrobacteri um; such methods are not always described in detail. Enzymes are obtained from commercial sources and are used according to the vendor's recommendations or other variations known to the art. Reagents, buffers and culture conditions are also known to those in the art. Reference works containing such standard techniques include the following: R. Wu, ed. (1979) Meth. Enzymol. j>8; J. H. Miller (1972) Experiments in Molecular Genetics; R. Davis et. al_. (1980) Advanced Bacterial Genetics; and R. F. Schleif and P. C. Wnesink (1982) Practical Methods in Molecular Biology.
■;l:/ MAY :?S4
9 ' "v /">
' ■ i » O O
In the Examples, special symbols are used to clarify sequences.
Sequences that do or could code for proteins are underlined, and codons are separated with slashes (/). The positions of cuts or gaps in each strand caused by restriction endonucleases or otherwise are indicated by the placement of asterisks (*). (In one Example a double-stranded DNA molecule is represented by a single line flanked by asterisks at the sites of restriction enzyme cuts; the approximate position of a gene is there indicated by underlined "X"'s under the single line.) With the exception of the plasmid lie, plasmids, and only plasmids, are prefaced with a "p", e.g., p3.8 or pKS4. Cells containing plasmids are indicated by identifying the cell and parenthetically indicating the the plasmid, e.g., A. tumefaciens(pTi15955) or K802(pKS4-KB). Table 1 provides an index useful for identifying plasmids and their interrelationships. Table 2 provides an index of deposited strains.
Fig. 39 provides a useful comparison of the constructions described in Examples, 11, 12, and 14. Fig. 40 sets forth the genetic code and is useful for interpreting sequences. The nucleotide sequence of an important T-DNA gene, tml, though not used in these Examples, is set forth in Fig. 41*, it is useful in designing constructions not described herein.
Exampl e
A fusion protein gene was constructed consisting of the octopine synthetase promoter, the amino terminal 90 amino acids of the structural gene for octopine synthetase, a 3 amino acid overlap between the two genes, and all of phaseolin except for codons encoding its first 11 amino acids. Prior to the start of construction, a clone of pTi15955 T-DNA, p233, (the sequences defined by p203 and p303, in pBR322, see Fig. 1) was sequenced from the BamHI site to the Pvu.II site. This includes all of the octopine synthetase gene (Fig. 2). The octopine synthetase sequence and reading frame were found to be as follows near a site cut by the restriction enzyme EcoRI:
EcoRI
'...ATG/GGC/CAG/CAA/GG*A/ATT/CTT...3'
3' TAC CCG GTC GTT CC T TAA*GAA...5'
...Met Gly Gin Gin Gly He Leu... 84 85 86 87 88 89 90
Vtf r.\TENTOmaf
— «■" I—■
-22- 17 MAY 1984
2077GG
Cleavage with EcoRI yields a fragment with the following end:
...ATG/GGC/CAG/CAA/GG 3'
...TAC CCG GTC GTT CCTT 5'
The structural gene for the bean seed storage protein phaseolin (previously sequenced, Fig. 3) contains an EcoRI site near its 5' (amino terminal) end as follows:
Cleavage with EcoRI yields a fragment with an end as follows:
' A/ATT/CTT/TTC...
3' GAA AAG...
These two fragments, after ligation, form the following structure:
EcoRI
...ATG/GGC/CAG/CAA/GG*A/AT T/CTT/TTC...
...TAC CCG GTC GTT CC T TA*A GAA AAG...
...Met Gly Gin Gin Gly lie Leu Phe...
84 85 86 87 88 89 90 octopine synthetase
12 13 14 15 phaseolin
Hot only are the same reading frames preserved, but there are no intervening stop signals generated.
So in short, the EcoRI/BamHI restriction endonuclease fragment of the Phaseolin gene was 1igated at the EcoRI site to the octopine synthase gene of the T-DNA of pTi15955. This fusion gene contains the ocs promoter, the first 90 amino acids of octopine synthetase, the phaseolin gene minus its promoter and its first 11 amino acids, and a three amino acid junction identical to sequences present in both parent proteins.
1.1 Removal of the EcoRI site from pBR322
The EcoRI site in pBR322 was removed by digesting with EcoRI, filling in with T-4 DNA polymerase, blunt end ligation and transformation into E. coli strain HB101. Selection of transformants was made with ampicillin and colonies were screened by isolating small amounts of plasmid DNA (D. Horowitz (1982) in Molecular Cloning, C.S.H.) and selecting a clone without an EcoRI site called pBR322-R.
EcoRI
...CTG/TTG/CTG/GG*A/ATT/CTT/TTC... ...GAC AAC GAC CC T TAA*GAA AAG... ...Leu Leu Leu Gly He Leu Phe...
» t i LLU L CTU UCU u I J 1 i C LCU i IIC« » »
9 10 11 12 13 14 15
w t / HAY ;984
207766
1.2 Cloning of the BamHI T-DNA fragment into pBR322-R
p203 (Fig. 42) was isolated and digested with BamHI. The 4.7kbp fragment of T-DNA was isolated by agarose gel electrophoresis and ligated into the BamHI site of pBR322-R. This plasmid was transformed into E. coli strain HB101 and selected for using ampicillin resistance and tetracycline sensitivity. A positive clone was selected and called pKS169.
1.3 Removal of the EcoRI sites and fragments from the octopine synthetase gene pKS169 was isolated and digested with EcoRI. An 8.6kbp fragment was isolated by agarose gel electrophoresis and purified. This fragment had the 2 small (0.36kbp and 0.2kbp) fragments in the ocs gene removed.
1.4 Isolation of the EcoRI fragment containing the phaseolin gene DNA fragment and the kanamycin resistance qerie pKS4-KB (Fig. 7) was purified and digested with EcoRI. A 4.8kbp fragment was isolated using 3.0kbp EcoRI/BamHI phaseolin gene fragment ligated at the BamHI site to a 1.85kbp DNA fragment containing the kanamycin resistance gene encoding neomycin phosphotransferase II (NPTII).
1.5 Ligation of the phaseolin gene to the octopine synthase
The phaseolin/NPTII fragment was then ligated at the EcoRI sites to the EcoRI fragment described in Example 1.3. The ligated DNA was transformed into HB101 and colonies were selected on ampicillin and kanamycin. A colony named pKS-B17-KB3.0 (Fig. 43) was selected that contained a plasinid that had the correct orientation (i.e., the phaseolin gene ligated to the ocs gene in the correct direction and reading frame). This was ascertained by the restriction mapping of plasmids from a small number of colonies. DNA sequence of the appropriate region was determined to verify the construction.
1.6 Transfer of the T-DNA fragment containing the EiPTII, phaseolin and ocs DNA into pRK290
pRK290, a broad host range plasmid, was digested with BglII and ligated to a 9.1kbp BamHI fragment containing the T-DNA,-the. N^lxg^^T and
_?4- 17 MAY 1984
O ■ •"' v n
*■ • iuU
phaseolin DNA from pKS-B17-KB3.0. This was accomplished by partially digesting pKS-B17-KB3.0 with BamHI and isolating a 9.1kbp fragment from 6 other bands from an agarose gel electrophoresis. After ligation and transformation into E. coli strain K802, colonies were selected on kanamycin and tetracycline. A colony was selected that had the desired restriction pattern and was labeled pKS-0S-KB3.0.
1.7 Replacment of octopine synthetase on pTi15955 with the octopine synthetase phaseolin fusion protein gene
Using triparental mating of A. tumefaciens (streptomycin resistant), E. coli(pKS-0SI-KB3.0), and E. coli(pRK2013). we selected for colonies resistant to streptomycin, kanamycin, and tetracycline. One colony was mated with E, coli (pPHlJl). A colony was selected that is resistant to kanamycin and gentamycin. This was shown to be A. tumefaciens with pl5955-12A, a pTi15955 that has the phaseolin gene and kanamycin resistance gene engineered into the EcoRI site of the ocs gene by restriction enzyme mapping, and filter hybridization of electrophoretically separated restriction fragments (Example 19). An analogous triparental mating is done with A. tumefaciens(pTiA66). Shoots transformed by the resulting plasmid, pA66-12A, are shown to contain phaseolin as described above.
1.8 Crown gall formation and expression
Sunflower plants were inoculated with the engineered Ti plasmid. Crown galls were established in tissue culture. Expression was tested by running ELISAs and by filter hybridization to electrophoretical ly separated mRNA ("Northern blots", Example 19). RNA of the expected size was detected with hybridization probes to both the phaseolin and octopine synthetase genes, and comprised about 0.5% of total poly(A)5+4 RNA. Poly (A)5+4 RNA isolated from galls directed the in vitro synthesis of a protein of the expected size which was precipitatab]e by antibodies raised against phaseolin.
Example 2_
A fusion protein gene similar to that taught in Example 1 was constructed from phaseolin and nopaline synthetase, under control of the latter gene's promoter. It contained the nopaline synthetase promoter, and encoded the first 59 amino acids of nopaline synthetase (of whixh.the,..l.as.t residue was
207766
synthetically added), a one amino acid junction, and all of the phaseolin structural gene except for its first 12 amino acids. Prior to the start of construction, a clone of pTiC58 T-DNA (pCF44A, Fig. 6) was sequenced from the Bgl11 site on the extreme left through the middle HindIII site, which is outside of the T-DNA region. This included all of the nos gene (Fig. 4). The nopaline synthetase sequence and reading frame were found to be as follows near a site cut by the restriction enzyme CIal:
CI al
' ...CCA/GGA/T*CG/ATC/TCA...3'
31...GGT CCT A GC*TAG ACT...5'
...Pro Gly Ser lie Ser...
56 57 58 59 60
Cleavage with CIal yields a fragment with the following end:
...CCA/GGA/T 3'
...GGT CCT AGC 5'
As stated in Example 1, the following phaseolin EcoRI site:
EcoRI
...CTG/GG*fl7fiTT/CTT/TT C...
...GAC CC T TAA*GAA AAG...
...Leu Gly lie Leu Phe...
11 12 13 14 15
can be cleaved to following structure:
' A/ATT/CTT/TTC...
3' GAA AAG...
The following two linkers a) 5' CGATCCC 3'
b) 5' AATTGGGAT 3'
can be annealed to form the following structure
' CGATCCC 3' (a
3' TAGGGTTAA 5' (b rfJ.M'VWrOPRCg'
17 MAY 1984
which can link together the DNA fragments to form the following structure:
New Linker ...CCA/GGA/T*CG/ATC/CC*A/ATT/CTT/TTC...
...GGT CCT A GC*TAG GG T TAA*GAA AAG...
...Pro Gly Ser lie Pro He Leu Phe...
56 57 58 59 nopaline synthetase
13 14 15 phaseolin
Note that the linker serves several functions: a new amino acid is introduced; part of the deleted sequence of nopaline synthetase is reconstructed; two incompatable restriction sites are made compatable, and an open reading frame is preserved.
So in short, the EcoRI/BamHI restriction fragment of the phaseolin gene was ligated to the Clal site of the nopaline synthase gene after a linker converted the EcoRI site to a CIal site. The fusion gene contained the nopaline synthetase promoter, the first 58 amino acids of nopaline synthetase, a linker which reconstructed some of the nopaline synthetase sequence and inserted a novel amino acid, and all of phaseolin except for the first twelve amino acid residues.
2.1 Synthesis of Linkers
The following two linkers were synthesized:
a) 5" CGATCCC 3'
b) 5' AATTGGGAT 3'
These were synthesized by the methods of Example 17. The oligonucleotide a) and b) were annealed together to form the structure
' CGATCCC 3' (a
3' TAGGGTTAA 5' (b
2.2 Preparation of the shuttle vector pKS-nopIV, whose construction was described in Fig. 6, is pRK290 with nopaline T-DNA cloned into its Bg 111 site. Its nopaline T-DNA contains a sing!e CIal site resulting from deletion between the Clal site in nos and the CI al site downstream outside the nos gene (Figs. 5 and 6). We purified pKS4-KB (Fig. 7) and digested with EcoRI. The 4.8kbp kan/bean resistance fragment
'• f-"n n i i I) k>
was purified by gel electrophoresis. This fragment contains the EcoRI/BamHI phaseolin DNA fragment (referred to as bean in the label kan/bean) ligated at the BainHI site to the BamHI/EcoRI fragment of the kanamycin resistance gene (kan) of Tn5.
We ligated Clal linearized pKS-nopIV with purifed kan/bean fragment and the linkers from Example 2.1. E. col 1 K802 was transformed and selected for kanamycin and tetracycline resistant colonies. Two orientations were present, one with phaseolin DNA ligated to nopaline synthetase gene and the other with kanamycin resistance gene ligated next to nopaline synthetase gene.
Restriction site mapping was used to determine which cells contained a plasmid, pNNNl, having the desired orientation as shown in Fig. 8.
2.3 Replacement of the nopaline synthetase gene on pTiC58 with the modified phaseolin
A triparental mating (see Background-Shuttle Vectors) with A. tumefaciens-strR C58, E. coli(pRK2013), and E. coli(pNNNl) was used to insert the construction into a Ti plasmid. We selected for A. tumefaciens cells resistant to streptomycin, kanamycin and tetracycline. The selected transformants were mated with E. coli(pPHlJl) and colonies resistant to kanamycin and gentamycin were selected.
2.4 Crown Gall Formation and Expression
Sunflowers were inoculated and crown galls established in tissue culture. Expression was tested by ELISA and hybridization to mRNA as described in Examples 17 and 20.
Exampl e _3
The aim of this example is to reconstruct the complete phaseolin gene coding sequence from the ATG translational start signal to the EcoRI site which can then be ligated to the remainder of the structural gene. A Clal site will be constructed at the 5' end so the gene can be easily recovered. The following two oligonucleotide sequences will be synthesized:
' > - , !
17 MAY 1984
a) 5' AATTCCCAGCAACAGGAGTGGAACCCTTGCTCTCATCAT 3'
b) 5' CGATGATGAGAGCAAGGGTTCCACTCCTGTTGCTGGG 3'
These can be rennealed to form the following structure:
Clal EcoRI
51 CG/ATG/ATG/AGA/GCA/AGG/GTT/CCA/CTC/CTG/TTG/CTG/GG
TAC TAC TCT CGT TCC CAA GGT GAG GAC AAC GAC CCT TAA Met Met Arg Ala Arg Val Pro Leu Leu Leu Leu Gly lie 1 2 3 4 5 6 7 8 9 10 11 12 13
As stated in Example 1, the following phaseolin EcoRI site:
...CTG/GG*A/ATT/CTT/TTC...
...GAC CC T TAA*GAA AAG...
Leu Gly lie Leu Phe 11 12 13 14 15
can be cleaved to following structure:
51 A/ATT/CTT/TTC...
3' GAA AAG...
Ligation of this end to the synthetic double-stranded oligonucleotide described above results in a structural gene encoding a complete phaseolin polypeptide, with CIal sticky-ends inmediately ahead of the start of the coding sequence.
3.1 Synthesis of linkers
The following two linkers were synthesized by the method of Example 17:
a) 5' AATTCCCAGCAACAGGAGTGGAACCCTTGCTCTCATCAT 3'
b) 5' CGATGATGAGAGCAAGGGTTCCACTCCTGTTGCTGGG 3'
They were annealed to form the following structure:
' CGATGATGAGAGCAAGGGTTCCACTCCTGTTGCTGGG 3' (b
3' TACTACTCTCGTTCCCAAGGTGAGGACAACGACCCTTAA 5' (a
0 , p n
•' i i Ob
3' 5'
(a (b
• rATSVl" QFFiCtf
17 MAY 1984
-29- ""T
(A , r—... ^ ^
' i u o
3.2 Construction of complete phaseolin gene and kanamycin resistance gene cloned in pKS-noptV
Clal linearized pKS-nopIV is ligated with reannealed linker from Example 3.1 and purified kan/bean EcoRI fragment from KS4-KB (see Example 2.2). E.
coli K8Q2 is transformed and selected for tetracycline and kanamycin resistant colonies. Again, though two orientations are possible, only one is phaseolin gene ligated next to the nopaline synthetase gene. The correct orientation is selected after endonuclease mapping the clones.
3.3 Crown gall formation and expression
The homologous recombination and crown gall tissue performed as outlined in Example 21, and the testing of phaseolin gene expression is as in Examples 19 and 20.
Example £
The purpose of this construction is to teach how to construct a Shuttle Vector to be used in pTi system for expressing foreign genes in crown gall cells, the foreign gene being under control of the nos promoter, part of which is chemically synthesized, and is missing codons for the nopaline synthetase gene. Prior to the start of construction, a clone of pTiC58 T-DNA (pCF44A) was sequenced to discover the nos promoter (Fig. 4).
4.1 Isolation of the 5' portion of the nos promoter pCF44A is cut with Mol, religated, and labeled pCF44B, which has the following structure:
Bglll Clal Clal Sstll Sstll Sstll Bglll
.. .* 1160bp * 1300 * 355 * 620 * 420 * 1155bp *..
* * XXXXXXXXX*XXXXXXXX* * * *
3' nopaline 5'
synthetase culture isolation is crown gall tissues for
■1? MAY 1934
207766
This new plasmid is of the Sstll fragments. The resulting plasmid, pCF44C
Bglll Clal Clal Sstll Bglll
.. .* 1160 * 1300 * 355 * 1155 *...
* * XXXXXXXXXXXXXXX*XXXXXXXXX* *
3' nopaline 5'
synthetase is digested with Bgl 11, and a 3.6kbp fragment is inserted into the Bglll site of pRK290. A colony selected for hybridization to T-DNA in a Grunstein-Hogness assay is labeled pKS-nopV, digested with CIal, and religated, forming pKS-nopVI.
Bgl 11 Cla. I Sst 11 Bgll I
...* 1160bp * 355 * 1155bp *...
* *XXXXXXXXX* *
'
This is digested with Clal and Sstll giving a 22kbp linearized vehicle and a 355bp fragment. These are easily separated by centrifugation through a salt gradient. After the small fragment is digested with Hinfl the 149bp SstII/Hinfl and the 208bp Clal/HinfI fragments are isolated by gel electrophoresis.
4.2 Synthesis of 1 inkers
The following two linkers were synthesized by the method of Example 17:
a) 5' AGTCTCATACTCACTCTCAATCCAAATAATCTGCCATGGAT 3'
b) 5' CGATCCATGGCAGATTATTTGGATTGAGAGTGAGTATGAG 3'
They were annealed together to form the following structure:
' AGTCTCATACTCACTCTCAATCCAAATAATCTGCCATGGAT 3' (a 3' GAGTATGAGTGAGAGTTAGGTTTATTAGACGGJACCTAGC 5' (b
This sequence has a Hinfl site on the left, and Ncol and Clal sites on the right. An alternate sequence will have a Bel I site between the Ncol and Clal sites. The sequence is identical to that found in T-DNA except for the underlined bases which replace an A-T base pair with a C-G base pair.
17 MAY J984
2., . n n
« t OH)
4.3. Assembly of pNNN2
The 22kbp Clal/Sstll vehicle is ligated as shown in Fig. 9 with the 149bp SstlI/Hinf1 fragment and the synthetic linker, forming the following structure:
Hinfl synthetic linker Ncol Clal
'...149bp...TAG*AGT CTCATACTCACTCTCAATCCAAATAATCTGC*CATG GAT*CG AT...1160bp...3' 3' T-DNA ATC TCA*GAGTATGAGTGAGAGTTAGGTTTATTAGACG GTAC*CTA GC*TA...T-DNA....5*
4.4 Insertion and expression of a phaseolin gene pNNN2, the plasmid constructed in Example 4.3 (Fig. 9) is cut with Cl al, mixed with the Clal/EcoRI linker synthesized in Example 4.2 and electrophoretically purified EcoRI/Clal kan/bean fragment from pKS4-KB,
ligated, transformed, isolated, and restriction mapped. The appropriate plasmid, pNNN4, is transferred and tested for expression as described iri Examples 21, 19 and 20.
4.5 Insertion and expression of a phaseolin gene lacking introns
The procedure outlined in Example 4.4 is repeated with the substitution for pKS4-KB of a pcDNA31 or pMC6-cDNA-derived analog of pKS4-KB. (see Example 9).
4.6 Insertion and expression of a phaseolin cDNA
This construction is analogous to Example 10 in its use of cDNA, a single stranded Pstl linker, and the PstI kan fragment, and is analogous to Examples 4.1, 4.2 and 4.3 in the use of the semisynthetic nos promoter.
Characterization, transfer and testing of expression is as described in Example 4.4.
pNNN2, the plasmid constructed in Example 4.3 (Fig. 9) is cut with Clal, mixed with and ligated to the Clal/EcoRI linker synthesized in Example 4.2, the electrophoretically purified 1.7kbp EcoRI/PstI bean fragment isolated from pKS4-KB, the electrophoretically purified 0.93 kbp Pstl Tn5 kan fragment, and the single-stranded Clal/Pstl linker 5'CGAATT3', previously synthesized by the method of Example 17.
s •*' MAY jytf.J
Example 5.
The purpose of this construction is to ligate the phaseolin gene from the EcoRI site to BamHI site, into the active T-DNA gene that lies across the Hindl11 sites on p403 whose mRNA is labeled 1.6 on the map, shown in Fig. 1. The sequence (see Fig. 10) was determined from the Hi ndl11 site of p401 past the Clal site to its right (see Fig. 11). There is an open reading frame that starts between the Hindi 11 and Clal site going toward the Hindi11 site (see the 1450bp mRNA mapped in Fig. 11). The Clal site is in the untranslated leader of the mRNA of the gene spanning the Hindlll sites. We create a promoter vehicle by cutting out the Clal fragment in the middle of p403. This is possible because the internal Clal sites are not methylated in some E. coli strains, whereas the Clal site next to the EcoRI site is methylated.
The phaseolin gene is now ligated into the Clal site bringing with it an ATG. This can be acaomplished by using pKS4-3.0KB. The base sequence from the Clal site of pBR322 through the EcoRI site of phaseolin is as follows:
Clal EcoRI
'...AT*C/G AT/GAT/AAG/CTG/CTG/TCA/AAC/ATG/AG*A/ATT/CTT/TTC.. .3'
3' TA G C*TA CTA TTC GAC GAC AGT TTG TAC TC T TAA*GAA AAC...5'
Met Arg/Ile Leu Phe...
13 14 15 ...derived from pBR322/phaseolin...
Note the open reading frame and the ATG. There are 18bp between the Clal site and the translational start signal (ATG). This compares to 12bp from the Clal site to the start of the T-DNA gene:
Clal
'...AT*CG A/TGG/ACA/TGC/TGT/ATG...3'
3' TA GC*T ACC TGT ACG ACA TAC...5'
Met...
Again, note the open reading frame and the ATG. Thus, ligation into the Clal site of the promoter clone should create an active phaseolin gene in T-QNA,. The phaseolin gene has a substitution of 2 amino acids for the naturally occuring amino terminal 12 residues.
.1 Construction of a Promoter vehicle pKSIII, which is a pRK290 clone corresponding to the T-DNA clone p403 (see Fig. 1), is digested with Clal and then religated. The ligation mix is transformed into K802 and selected for kanamycin resistance. Plasmids are isolated by doing "minipreps" (plasmid preparations fram^mall volume cell
t7 NAY 1984
2 . t—.o r>
i i L* U
cultures) and restriction maps are obtained to prove the structure. The new vehicle, pKS-proI, is not able to be digested by Hi ndl 11 but can be linearized by Clal (Fig. 12). pKS-proI is purified and linear molecules are produced by digestion with Clal.
.2 Ligation of a partial phaseolin gene to a kanamycin resistance
A 3.0kbp fragment containing extensive 3' flanking sequences and all but the extreme 5' coding sequences of the phaseolin gene was obtained by elution from an agarose gel after electrophoresis of an Hindl11 and BamHI digest of p7.2 (Fig 13), a pBR322 subclone of the phaseolin genomic clone 177.4 whose construction was described in Example 6.1. This was mixed with and ligated to a 3.0kbp kanamycin resistance Hindlll/BamHI fragment similarly isolated from pKS4 (Fig. 18), and HindIII-1inearized pBR322. After restriction mapping of plasmids isolated from ampicillin resistant transformants, a plasmid having the structure shown in Fig. 7 was labeled pKS4-KB.
.3 Purification of the kan/bean fragment from pKS4-3.0KB
pKS4-KB (Fig. 7) is digested with Clal and the 4.9kbp fragment purified by agarose gel electrophoresis.
.4 Ligation of Clal kan/bean resistance gene into Clal digested pKS-ProI
pKS-proI is linearized by digestion with Clal and the kanamycin resistance gene/bean fragment from Example 5.3 are ligated together and transformed into K802. Kanamycin resistant transformants are selected and plasmids isolated by "minipreps" are restriction mapped to detect one having the proper orientation. The plasmid is labeled pKSProI-KB (Fig. 14).
.5 Transformation and expression
Cells containing pKS-proI-KB are mated with Agrobacterium cells containing pTi15955 or pTiA60 or other appropriate TIP plasmids. After selection of recombinants with kanamycin, plants are inoculated and crown galls are established in tissue culture. Testing for the synthesis of phaseolin is as described in Examples 19 and 20.
;i /n AY 1984 '
>• ■
r\ ■ r- r> 6- . i Oli
Exampl e
This example teaches manipulations of a gene for phaseolin, the major seed storage protein of the bean Phaseolus vulgaris L., preparatory to further manipulations which insert the phaseolin gene into vectors described in various other examples.
6.1 Subcloning of a phaseolin gene
A genomic clone of phaseolin in a Charon 24A AG-PVPhl77.4 (or 177.4; S. M. Sun _et _a]_. (1981) Nature 289:37-41 , J. L. SI ightom _et jl_. (1983) Proc. Natl. Acad. Sci. USA 80; Fig. 15) was digested with BglII and BamHI. The 3.8kbp fragment carrying the phaseolin gene and its flanking sequences, isolated by agarose gel electrophoresis, was mixed with and ligated to BamHI-linearized pBR322. The mixture was transformed into HB101, and colonies resistant to ampicillin and sensitive to tetracycline were selected. Plasmid isolated from these clones was restriction mapped. A plasmid having the structure shown in Fig. 16 was selected and labeled AG-pPVPh3.8 (or alternatively, p3.8). The ligation of Bglll and BamHI sites with each other inactivates both sites.
Another subclone of 177.4 was constructed by digestion with EcoRI, isolation of a 7.2kbp fragment containing extensive 3" flanking sequences and all but the extreme 5' end of the phaseolin gene, and isolated after ampicillin selection of HB101 transfonnants were restriction mapped. A plasmid having the insert oriented so that the Hi ndl11 site of pBR322 was adjacent to the 5' end of the phaseolin gene and distal to the 3' untranslated region was labeled AG-pPVPh7.2 (or p7.2; Fig. 13; Sun _et__a]_. and SI ightom et al., supra).
6.2 Cloning and isolation of a kanamycin resistance gene pRZ102 (R. A. Jorgenson et _al_. (1979) Molec. gen. Genet. 177:65-72), a ColEl plasmid carrying a copy of the transposon Tn5, was digested with BamHI and Hi ndl11, mixed with pBR322 (Fig. 17) previously linearized with the same two enzymes, ligated, and transformed into K802. Plasmids, isolated from transfonnants selected for resistance to both ampicillin and kanamycin were restriction mapped and one having the structure shown in Fig. 18 was labeled pKS-4.
i 7 MAY 1984
C) • r»-« r> r*
' > i t \J v/
6.3 Linkage of the phaseolin gene with _a kanamycin resistance p3.8 was digested with Clal and BamHI, and a 4.2kbp fragment containing the phaseolin gene and some pBR322 sequences was isolated by agarose gel electrophoresis. This was mixed with a Clal/BamHI fragment of Tn5 carrying a kanamycin resistance (neomycin phosphotransferase II) gene from pKS4 (Fig. 18) and pBR322 (Fig. 17) which had been linearized with Clal. The mixture was ligated and transformed into K802. After selection of colonies resistant to ampicillin and kanamycin, plasmids were isolated and restriction mapped. A colony having the structure shown in Fig. 19 was labeled pKS-KB3.8.
The construction of another useful plasmid, pKS4-KB, is described in Example 5.2.
Example 7_
This example is analogous to the construction described in Example 5, except for the substitution of a cDNA clone for the genomic clone of phaseolin. This construction will result in a gene lacking introns.
7.1 Construction of pKS4-KB2,4 (analogous to pKS4-KB)
After pMC6 (Fig. 20) is digested with EcoRI and BamHI, a 2.4kbp phaseolin cDNA fragment is isolated by centrifugation through a salt gradient or gel electrophoresis. A 1.9kbp fragment containing a gene for kanamycin resistance is purified from a EcoRI and BamHI digest of pKS4 (Fig. 18), mixed with the cDNA fragment and EcoRI-linearized pBR322, ligated, and transformed into K802. Colonies are selected for kanamycin resistance, and after plasmid isolation and restriction mapping, a plasmid as shown in Fig. 21 is labeled pKS4-KB2.4.
7.2 Ligation of the Clal kan/bean DNA into Clal digested pKS-ProI
pKS4-KB2.4 is digested with Clal and ligated with Clal-linearized pKS-prol (Fig. 12). After transformation, selection, plasmid isolation and characterization, the desired construction, having the phaseolin sequences adjacent to the T-DNA promoter, is transferred to a Ti plasmid. Inoculation and testing is as described in Examples 21, 19, and 20.
„3
6
2:;77GG
Example
This example teaches a method of removing the introns from a gene. This is the same as placing a cDNA in a genomic environment. Restriction enzyme sites are found, or created by site specific mutagenesis, in exons on both the 5' and 3' extremities of the unprocessed transcript. These sites exist in both the genomic clones and cDNA. The intervening intron-containing DNA can be removed from the genomic clone and be replaced with the corresponding intronless cONA clone fragment spanning the two sites. The reverse operation is also possible: intron-containing genomic sequences can be placed in a cDNA environment. One inserts an internal fragment of the genomic clone into a corresponding gap cut out of a cDNA clone. This latter strategy is analogous, though often technically more difficult as the introns may contain sites susceptible to the enzymes chosen to create the exchanged fragment. This difficulty can be overcome by careful selection of conditions of partial digestion and by purification of the desired fragment by agarose gel electrophoresis. Further elaborations of this strategy include the manipulation of individual introns within a gene while leaving other introns and exons unaffected, and the stepwise exchange of sequences when inconvenient intervening restriction sites are present within introns as discussed above.
8.1 Replacement of a fragment containing phaseolin's introns with cDNA
p3.8, a plasmid clone of the phaseolin gene and its flanking sequences, was digested respectively partially and to completion with EcoRI and SacI, and a 6.4kbp fragment, containing the pBR322 vector and both the 5' and 3' ends of the gene, was isolated by agarose gel electrophoresis. pcDNA31, a pBR322 plasmid clone of cDNA made from phaseolin mRNA, was digested respectively partially and to completion with SacI and EcoRI, and a 1.33kbp fragment, containing the entire phaseolin cONA except for sequences at the extreme 5' and 3' ends, was isolated by agarose gel electrophoresis. These two fragments were ligated together and transformed into HB101. After selection of colonies, growth of cells, and plasmid isolation, restriction mapping identified a plasmid having the desired structure. This plasmid was labeled p3.8-cDNA (Fig. 22).
'• hi'tfT*0,'riw4
17 MAY 1934
8.2 Use of p3.8-cDNA
Note that p3.8-cDNA can substitute for the genomic DNA source, e.g., p3.8, used in other Examples and that when so used will result in analogous constructions differing in that they are lacking introns. Alternatively, this strategy can be used to remove introns from constructions already made.
Example 9_
This example teaches the expression of an intronless gene. The phaseolin cDNA is prepared as described in Example 8, but a gene that naturally lacks introns could also be used.
An analogous construction to those taught in Example 8 is used. pKS4-KB and pMC6 are digested with EcoRI and SacI as taught in Example 8 and as described there, the cDNA insert is ligated into the pKS4-KB fragment containing the vector and the 5' and 3' extremities of the phaseolin gene. The new plasmid, pKS4-KBc, is used in constructions in an analogous manner to pKS4-KB.
Example 10
The purpose of this example is to teach the placement within T-DNA of the cDNA for a Phaseolus vulgaris lectin under the control of a T-DNA gene promoter, the transfer of this construction to a plant cell, and the detection of this construction's expression within plant tissue.
This construction utilizes a single-stranded linker to connect the sticky-ends resulting from digestion with the restriction enzymes Pstl and Hindi 11. When Pstl11 and Hindlll sites
Pstl Hindl11
'...C TCCA*G...3' 5'...A*AGCT T...3'
31...G*ACGT C...5' 3' T TCGA*A...5'
are cleaved to form the following ends:
Pstl Hi ndl11
'...CTGCA AGCTT...3'
3' G A...5'
2-77GG
and are mixed together in the presence of a linker of appropriate sequence
'...CTGCA AGCTT 3'
3' G A...5'
+
3'ACGTTCGA5'
they can be ligated together to form the following suture:
Hindi II
'...C TGCA^AGCT T 3'
3'...G*ACGT TCGA*A...51
Note that a Hindi 11 site is reconstructed.
The lectin cDNA is obtained from a plasmid clone, pPVL134, ATCC39181,
that was constructed by poly C-tailing double-stranded cONA followed by insertion into Pstl cut, G-tailed pBR322. This clone as described by L. Hoffman ^t _al_. (1982) Nucleic Acids Res.10:7819-7828.
.1 Synthesis of the linker
The linker 5'AGCTTGCA3' is synthesized by the method of Example 17.
.2 Construction of a clone containing lectin cDNA and a kanamycin resistance gene pPVL134 is digested with Bell and Pstl, and the intermediate-sized fragment containing the lectin coding sequence, 3' untranslated region, and a
C/G tail is isolated by elution from an agarose gel after separation by electrophoresis. pBR325 is digested with Bell and Hindi 11 and the largest fragment is isolated after sedimentation through a salt gradient. The
Bel I/Hi ndl11 pBR325 vector is mixed with and ligated to the BelI/PstI lectin fragment and the PstI/Hi ndl11 linker prepared in Example 10.1. E. coli K802
is transformed, selected for drug resistance and presence of lectin sequences,
and the plasmid isolated from such cells is labeled lie. The largest fragment resulting from HindiII and BamHI digestion of lie is mixed with and ligated to the kanamycin resistance gene-carrying Hindlll/BamHI fragment of pKS-4 which is previously isolated by agarose gel electrophoresis (Fig. 23). K802 is transformed, colonies are selected for kanamycin resistance, plasmids are isolated and characterized by restriction mapping. The desired plasinid is labeled pL-B.
^.PATo-rror-.c^
17 MAY 1934 -39- ...
2*~- "v n /-> « I 'OlJ
.3 Change of a Clal site to BamHI site in pKS-proi pKS-proI, whose construction was described in Example 5.1 (see Fig. 12) is digested with Clal. This cut is located between the promoter and ATG translation start signal of the 1.6kbp transcript (see Fig. 1). The sticky-ends are converted to blunt-ends by filling in by DNA polymerase I. BamHI linkers are ligated into the gap, trimmed to expose BamHI sticky-ends,
ligated, and transformed into K802. Colonies harboring the desired plasmid, pKS-proIA (Fig. 24), are selected after "miniprep" plasmid isolations and a characterization by restriction enzyme mapping.
.4 Insertion of lectin and kanamycin resistance genes into pKS-proIA
pL-B (Example 10.2) is digested with Bel I and BamHI, and the fragment carrying the kanamycin resistance gene and lectin sequences is eluted from an agarose gel after electrophoretic separation. This fragment is mixed with and ligated to BamHI linearized pKS-proIA. The ligation mixture is transformed into K802. Plasmids are isolated from kanamycin resistant colonies, characterized by restriction mapping, and the desired construction labeled pLK-proIA (Fig. 25).
.5 Expression in plants pLK-proIA is transferred to a Ti plasmid by a triparental mating (Example 21) of K802(pLK-proIA), E. col i(2013),and A. tumefaciens (pTi15955) (streptomycin resistant). After additional conjugational transfer of pPHlJl into the Agrobacterium, double-homologous recombinants are selected by growing cells on kanamycin, streptomycin, and gentamycin. Lectin is detected by ELISA with the appropriate antibodies.
Exainpl e 11
The purpose of this example is to generate a Ti plasmid with a deletion from the tms ("shooting" locus) through the tmr ("rooting" locus) of pTi15955 and other octopine Ti plasmids. This derivative is useful because cells transformed by it are easier to regenerate to whole plants than cells transformed by pTi15955 with intact tms and tmr genes.
The tms-tmr deleted pT115955 is ultimately changed in two ways: the in activation of tms-tmr and the insertion of a foreign gene. Should these two changes be located at different points of the T-DNA, each change is inserted
' * J
independently by different shuttle vectors. Each shuttle vector dependent change is selected independently which will necessitate use of at least two markers selectable in Agrobacteri um. In addition to the usual kanamycin resistance, this example utilized a chloramphenicol resistance derived from pBR325.
11.1 Construction of a chloramphenicol resistance gene clone pBR325 is digested with HincII and blunt end ligated with Hi ndlII linkers. The resultant preparation is digested with HindIII, religated, selected for chloramphenicol resistance (cam). and labeled pKS-5 which will serve as a source of the Hindi II/BclI fragment which contains the cam gene (Fig. 26).
11.2 Construction of a pBR322 clone of T-DNA with a deletion and a cam gene
A 9.2kbp linear DNA fragment is isolated from a complete Hi ndl11 and partial BamHI digest of p203. The fragment carrying the cam gene is isolated from pKS-5, mixed with the 9.2kbp linear fragment, ligated, transformed into E. coli, selected for chloramphenicol resistance, and labeled pKS-0ct.Cam203 (Fig. 27).
pKS-oct.Cam203 is a plasmid clone that can now be used to construct a number of deletion TL mutants of pTi15955. It contains the right hand arm of TL and a resistance gene to the left of the right arm. We can attach various left-hand arms of TL to the left of the cam gene (Hindl 11 site). For instance, if pl02 is attached the deletion is 5.2kbp long and includes all of tms and tmr. If pl03 is attached the deletion is 3.2kbp long and includes part of tms and all of tmr. See Fig. 1.
pKS-oct.Cam203 is digested with Hi ndl 11. pl02 or pl03 is digested with Hindi 11 and the 2.2kbp or 2.0kbp T-DNA fragment is isolated and ligated with the linearized pKS-oct.Cam203, transformed, isolated yielding pKS-oct.delII (Fig. 28) or pKS-oct.del I (Fig. 29), respectively. These constructions are moved into A. tumefaciens by mating, homologous recombinations, and selection for chloramphenicol resistance. Alternatively, one moves the constructions into pRK290 by use of established methods by linearizing the construction carrying plasmids with BamHI and 1igating into the Bglll site of pRK290 (Fig. 30).
i WMAY;9S4
21 l~
'■i i lOu
Example 12
The Ti plasmid is mutated in this example by deleting the T-DNA between the Hpal site in tmr to the Smal site in tml. The Ti plasmids that can be modifed include pTi15955 , pTiB6, pTiA66 and others. This construction is diagrammed in Fig. 31.
12.1 Isolation of the cam gene pKS-5 (Fig. 26) is digested with Hindlll and B'cll. The smallest fragment is isolated after separation on an agarose gel, as taught in Example 11.
12.2 Construction of _a pBR322 cl one of T-DNA with _a deletion
The right hand arm of the T-DNA deletion is constructed by insertion of Bgl11 sites into the Smal sites of p203 (see Fig. 1). p203 is digested by Smal, ligated with Bglll linkers, digested with Bglll, religated, and transformed into K802. In an alternative construction, BamHI linkers may be substituted for Bgl11 linkers and the appropriate BamHI partial digest products are isolated.) The resultant plasmid is labeled p203-BglII, and is digested with Bgl11 and Hindi II. The large BglII/Hi ndl11 vector containing fragment is ligated with the chloramphenicol resistance fragment whose isolation was described in Example 12.1. Chloramphenicol resistance is selected for after transformation into K802. The resultant plasmid is labeled p2f (Fig. 31).
12.3 Construction of left-hand arm of T-DNA deletion clone
Hindi II sites are inserted into the Hpal site of p202 by digestion with Hpal and ligation with Hindlll linkers. After unmasking of the Hi ndl11 sticky ends by digestion with that restriction enzyme, the 2kbp Hpal fragment which now bears Hindlll ends is isolated. Hindlll digested Hindlll-ended Hpal fragment and transformed into K802. After a colony containing the desired construction is isolated, and characterized, the plasmid is labeled p3e (Fig. 32).
12.4 Construction of the T-DNA deletion clone
The left-hand arm of the clone is obtained by purifying a 2kbp fragment of a Hindlll digest of p3e by elution from an agarose gel after electrophoresis. p2f is cut by Hindlll, treated with alkaline phosphatase,
O r. i~
£» >' » i Ju mixed with the 2kbp fragment, ligated, transformed into K802, and selected for chloramphenicol resistance. Plasmids are isolated from individual colonies and characterized by restriction mapping. A plasmid having the two arms in the desired tandem orientation is chosen and labeled pKS-Oct.del III (Fig. 33).
pKS-oct.del III is moved into A. tumefaciens by mating, and homologous recombinants are selected with chloramphenicol. Sunflower and tobacco roots and shoots are inoculated as described in other Examples and the tumors generated are tested for opines.
Example 13
This example teaches a construction deleting tmr and tml that provides an alternative to that taught in Example 12.
13.1 Construction of a chloramphenicol resistant fragment with a Bgl11 site pBR325 is digested with HincII, blunt-end ligated with BglII linkers, digested with BglII, and religated (Fig. 34). Chloramphenicol resistance is selected for after transformation of either K802 or GM33. The resultant plasmid, pKS-6 serves as a source of the BglII/BclI fragment carrying the cam gene.
13.2 Construction of the tmr, tml deletion clone p203 is digested with Hpal and Smal. After blunt end ligation with BglII linkers, it is digested with Bgl11 to expose the Bglll sticky-ends, religated, and transformed into K802. The desired construction is identified and labeled p2 (Fig. 35).
13.3 Construction of the T-DNA deletion clone (pKS-oct.del Ilia)
The BglII fragment carrying the cam gene is isolated from pKS-6 and ligated into Bqlll-cut p2. Chloramphenicol resistance is selected for after transformation of K802. The resultant plasmid is labeled pKS-oct.del III a (Fig. 36), and is tested as described in Example 12.4.
Example 14
The purpose of this construction is to provide an example of the mutation of the tmr locus only at the Hpal site by insertion of the chloramphenicol
"43" S 7 MAY 1934
resistance gene. This gene is isolated as the Bglll/Bcll fragment from pKS-6, and is ligated into the Hpal site of p203 after that site is changed to a Bgl11 site.
14.1 Conversion of the Hpal site to a Bglll site p203 is digested with Hpal, ligated to BglII linkers, trimmed with BglII and religated. After transformation of K802, colonies are selected and screened by restriction mapping for insertion of BglII sites (Fig. 37).
14.2 Isolation of the cam gene pKS-6 is digested with BglII and Bell. The smallest fragment is isolated by agarose gel electrophoresis.
14.3 Construction of the mutated T-DNA clone
The modified p203 from Example 14.1 is digested with BglII, ligated with the purified cam gene from Example 14.2 and transformed into K802. Chloramphenicol resistance is selected for, and after isolation from the resistant transformants and characterization by restriction enzyme mapping, the plasmid is labeled pKS-oct.tmr (Fig. 38).
Example 15
Regeneration in this example involves carrot tumors incited by an Ri-based TIP plasmid and is effected essentially as described by M. D. Chilton et al_. (1982) Nature 295:432-434.
.1 Infection with hair.y root
Carrot disks are inoculated with about 10594 bacteria in 0.1ml of water. One to 1.5 cm segments of the ends of the roots obtained are cut off, placed on solid (1-1.5% agar) Monier medium lacking hormones (D. A. Tepfer and J. C. Tempe (1981) C.R. Hebd. Seanc. Acad. Sci., Paris 295:153-156), and grown at 25°C to 27°C in the dark. Cultures uncontaminated by bacteria are transferred every 2 to 3 weeks and are subcultured in Monier medium lacking hormones and agar.
.2 Regeneration of roots to plants
The cultured root tissue described in Example 9.1 is placed on solidified (0.3% agar) Monier medium supplemented with 0.36pM 2,4-D and 0.72uM kinetin. After 4 weeks, the resulting callus tissue is placed in liquid Monier medium lacking hormones. During incubation at 22 to 25°C on a shaker (150 r.p.m.) for one month, the callus disassociates into a suspension culture from which embryos differentiate, which, when placed in Petri dishes containing Monier medium lacking hormone, develop into plantlets. These plantlets are grown in culture, and after "hardening" by exposure to atmospheres of progressively decreasing humidity, are transferred to soil in either a greenhouse or field pi ot.
.3 Use of non-hairy root vectors
Ti-based vectors which do not have functional tmr genes are used instead of the Ri-based vectors as described in Examples 15.1 and 15.2. Construction of suitable deletions is described in Examples 12, 13, and 14.
Exampl e 16
Regeneration in this example involves tobacco tumors incited by a Ti-based TIP plasmid and is effected essentially as described by K. A. Barton et al_. (1983) Cell.
16.1 Infection with crown gall
Tobacco tissue is transformed using an approach utilizing inverted stem segments first described by A. C. Braun (1956) Cane. Res. _16_:53-56. Stems are surface sterilized with a solution that was 7% commercial Chlorox and 80% ethanol, rinsed with sterile distilled water, cut into 1cm segments, placed basal end up in Petri dishes containing agar-solidified MS medium (T.
Murashige and F. Skoog (1962) Physiol. Plant. J_5:473-497) lacking hormones. Inoculation is effected by puncturing the cut basal surface of the stem with a syringe needle and injecting bacteria. Stems are cultured at 25°C with 16 hours of light per day. The calli which develop are removed from the upper surface of the stem segments, are placed on solidified MS medium containing 0.2 mg/ml carbenicillin and lacking hormones, are transferred to fresh MS-carbenicillin medium three times at intervals of about a month, and are tested to ascertain whether the cultures had been ridden of bacteri_a. The axeipic
17 MAY 1934
2:- t~ l~; f>
< I u tissues are maintained on solidified MS media lacking supplements under the culture conditions (25°C; 16 hr.:8 hr. 1ight:dark) described above.
16.2 Culture of transformed tissue
Clones are obtained from the transformed axenic tissues as described by A. Binns and F. Meins (1979) Planta 145:365-369. Calli are converted into suspensions of cells by culturing in liquid MS having 0.02 mg/1 naphthalene acetic acid (NAA) at 25°C for 2 or 3 days while being shaken at 135 r.p.m., and filtering in turn through 543 and 213pm stainless steel meshes. The passed filtrate is concentrated, plated in 5ml of MS medium containing 0.5% melted agar, 2.0 mg/1 NAA, 0.3 mg/1 kinetin and 0.4 g/1 Difco yeast extract at a density of about 8 x 10534 cells/ml. Colonies reaching a diameter of about 1mm are picked by scalpel point, placed onto and grown on solidified MS medium having 2.0 mg/1 NAA and 0.3 mg/1 kinetin. The resulting calli are split into pieces and tested for transformed phenotypes.
16.3 Regeneration of plants
Transformed clones are placed onto solidified MS medium having 0.3 mg/1 kinetin, and cultured as described in Example 16.1. The shoots which form are rooted by putting them on a solid (1.0% agar) medium containing 1/10 strength MS medium salts, 0.4 mg/1 thiamine, lacking sucrose and hormones, and having pH of 7.0. Rooted plantlets are grown in culture, hardened as described in Example 15.2, and are transferred to soil in either a greenhouse or field plot.
16.4 Vectors used
The methods described in Examples 16.1, 16.2 and 16.3 are suitable Ti-based vectors lacking functional tmr genes. Construction of suitable deletions is described in Examples 12, 13, and 14. These methods are also effective when used with Ri-based vectors. The method described in Example 16.1 for infection of inverted stem segments is often useful for the establishment of TIP transformed plant cell lines.
Example 17
The techniques for chemical synthesis of DNA fragments used in these Examples utilize a number of techniques well known to those skilled in
I <"L)u the art of DMA synthesis. The modification of nucleosides is described by H. Schallor et ji]_. (1963) J. Amer. Chem. Soc. 85:3820, and H. Buchi and H. G. Khorana (1965) J. Amer. Chem Soc. 87_:2990. The preparation of deoxynucleoside phosphorainidites is described by S. L. Beaucage and M. H. Caruthers (1981) Tetrahedron Lett. 22^1859. Preparation of solid phase resin is described by S. P. Adams _et__al_. (1983) J. Amer. Chem. Soc. Hybridization procedures useful for the formation of double-stranded synthetic linkers are described by J. J. Rossi _et jl_. (1982) J. Biol. Chem. 257:11070.
Example 18
Phaseolin is the most abundant storage protein (approximately 50% of the total seed protein) of Phaseolis vulgaris. Transfer of the functional phaseolin gene to alfalfa plants and translation of the phaseolin m-RNA into stored phaseolin is of significant economic value since it introduces storage protein into leaf material to be used as fodder. Alfalfa is a valuable plant for the transfer and expression of the phaseolin gene because of its acceptance as cattle fodder, its rapid growth, its ability to fix nitrogen through Rhizobial symbiosis, its susceptibility to crown gall infection and the ability to regenerate alfalfa plants from single cells or protoplasts.
This example teaches the introduction of an expressible phaseolin gene into intact alfalfa pi ants.
18.1 Construction of shuttle vector
Alfalfa plants are regenerated from crown gall tissue containing genetically engineered Aqrobacterium plasmids as described hereafter. In the first step we construct a "shuttle vector" containing a tmr5-4 and a tms5-T-DNA mutant linked to a phaseolin structural gene under control of a T-DNA promoter. This construction is, in turn, linked to a nopaline synthetase promoter which has a functional neomycin phosphotransferase (NPTII) structural gene (kanamycin resistance) downstream (reported by M. D. Chilton, et_ jl_. (18 January 1983) 15th Miami Winter Symposium; see also 0. L. Marx (1983) Science 219:830 and R. Horsch ^t _a]_. (18 January 1983) 15th Miami Winter Symposium). This type of construction is illustrated in Example 1.
18.2 Transfer to Aqrobacterium and plant cells
The "shuttle vector" is then transformed by conventional techniques (Example 21) into a strain of Aqrobacterium containing a Ti plasmid such as pTi15955. Bacteria containing recombinant plasmids are selected and co-cultivated with alfalfa protoplasts which are regenerated cell walls (Marton et_a]_. (1979) Nature 277:129-131; 6. J. Wul 1 ems _et__al_. (1981) Proc. Nat'l Acad. Sci. (U.S.A.) 78:4344-4348; and R. B. Horsch and R. T. Fraley (18 January 1983) 15th Miami Winter Symposium).
Cells are grown in culture and the resulting callus tissue is tested for the presence of the appropriate mRNA by Northern blotting (Example 19) and for the presence of the appropriate proteins by ELISA tests (Example 20) (see J. L. Marx (1983) Science 219:830; R. 8. Horsch and R. T. Fraley (18 January 1983) 15th Miami Winter Symposium).
18.3 Plant regeneration
Alfalfa plants are then regenerated from callus tissue by methods similar to those previously used by A. V. P. Dos Santos _et__al_- (1980) Z. Pflanzenphysiol. 99^:261-270, T. J. McCoy and E. T. Bingham (1977) Plant Sci. Letters Kh59-66 and K. A. Walker _el_a]_. (1979) Plant Sci. Letters 16:23-30. These regenerated plants are then propagated by conventional plant breeding techniques forming the basis for new commercial varieties.
Example 19
In all Examples, RNA was extracted, fractionated, and detected by the following procedures.
19.1 RNA extraction
This procedure was a modification of Silflow et_^l_. (1981) Biochemistry 13:2725-2731. Substitution of LiCl precipitation for CsCl centrifugation was described by Murray _et_al_. (1981) J. Mol. Evol. 17:31-42. Use of 2M LiCl plus 2M urea to precipitate was taken from Rhodes (1975) J. Biol. Chem. 25:8088-8097.
Tissue was homogenized using a polytron or ground glass homogenizer in 4-5 volumes of cold 50mM Tris-HCl (pH8.0) containing 4% p-amino salicylic acid, 1% tri-isopropyl napthalene sulfonic acid, lOmM dithiothreitol (freshly made)
l -JfhA'r
2077G0
and lOmM Na-metabisulfite (freshly made). An octanol was used as needed to control foaming. An equal volume of Tris-saturated phenol containing 1% 8-hydroxyquinoline was added to the homogenate which was then shaken to emulsify and centrifuged at 20,000-30,000g for 15 minutes at 4°C. The aqueous upper phase was extracted once with chioroform/octanol (24:1) and centrifuged as above. Concentrated LiCl-urea solution was then added to a final concentratio of 2M each and the mixture was left to stand at 20°C for several hours. The RNA precipitate was then centrifuged down and washed with 2M LiCl to disperse the pellet. The precipitate was then washed with 70% ethanol-0.3M Na-acetate and dissolved in sufficient sterile water to give a clear solution. One half volume of ethanol was added and the mixture put on ice for 1 hour, after which it was centrifuged to remove miscellaneous polysaccharides. The RNA precipitate was then recovered and re-dissolved in water or in sterile no salt poly(U) buffer.
19.2 Poly(U)/Sephadex chromatography
Two poly(U) Sephadex (trademark: Pharmacia, Inc., Uppsala, Sweden) buffers were used; the first with no salt containing 20mM Tris, lmM EDTA and 0.1% SDS, and the second with 0.1M NaCl added to the first. In order to obtain a good match at A42605, a 2x stock buffer should be made and the salt added to a portion. After adjusting the final concentrations, the buffers were autoclaved.
Poly(U) Sephadex was obtained from Bethesda Research Laboratories and lgm poly(U) Sephadex was used per lOOpg expected poly(A)RNA. The poly(U) Sephadex was hydrated in no salt poly-U buffer and poured into a jacketed column. The temperature was raised to 50°C and the column was washed with no salt buffer until the baseline at 260mm was flat. Finally the column was equilibrated with the salt containing poly(U) buffer at 40°C. The RNA at a concentration of less than 500yg/ml was then heated in no salt buffer at 65°C for 5 minutes, after which it was cooled on ice and NaCl added to a concentration of 0.1M. The RNA was then placed on the column which should be run at no more than lml/min until the optical density has fallen to a steady baseline. The column temperature was then raised to 60°C and the RNA was eluted with no salt poly(U) buffer. The RNA will usually wash off in three column volumes. The eluted RNA was then concentrated with secondary butanol to a convenient volume after addition of NaCl to lOmM, and precipitated with 2 volumes ethanol. The ethanol precipitate was dissolved in water and NH445-acetate added to 0.1M,
v.r:'
"49" 17 MAY 1984
..XiiVED
207766
followed by re-precipitation with ethanol. Finally the RNA was redissolved in sterile water and stored at -70°C.
19.3 Formaldehyde RNA gels
The method used followed that of Thomas (1980) Proc. Nat'l. Acad. Sci. (U.S.A) 77:5201 and Hoffman, et .al.. (1981) J. Biol. Chem. 256:2597.
0.75-1.5% agarose gels containing 20mM Na-phosphate (pH 6.8-7.0) were cast. If high molecular weight aggregate bands appeared, then the experiments were repeated with the addition of 6% or 2.2M formaldehyde (use stock solution of 36%) to the gels. The formaldehyde was added to the agarose ater cooling to 65°C. Addition of formaldehyde caused visualization with ethidium bromide to be very difficult. The running buffer was lOmM Na-phosphate (pH 6.8-7.0).
Prior to electrophoresis, the RNA was treated with a denaturing buffer having final concentrations of 6% formaldehyde, 50% formannde, 20mM Na-phosphate buffer and 5mM EDTA. The RNA was incubated in the buffer at 60°C for 10-20 minutes. The incubation was terminated by addition of stop buffer. For a 20pl sample, 4pl 50% glycerol, lOmM EDTA, 5mM Na-phosphate and broinphenol blue were added.
Submerged electrophoresis was used. The RNA was loaded before the gel was submerged, and run into the gel at 125mA for 5 minutes. The gels were then submerged and the current reduced to 30mA (overnight) or 50mA (6-8 hours). The buffer was recirculated and the electrophoresis was done in a cold room.
19.4 "Northern" blots
If the gel was to be blotted to detect a specific RNA, it was not stained; but a separate marker lane was used for staining. Staining was with 5ug/ml ethidium bromide in 0.1M Na-acetate and destaining was for several hours in 0.1M Na-acetate. Treatment in water at 60-70°C for 5-10 minutes prior to ,+aining helped visualization.
A gel to be blotted was soaked for 15 minutes in lOx standard saline citrate (SSC)-3% formaldehyde. If large RNA molecules were not eluting from the gel then a prior treatment in 50mM NaOH for 10-30 minutes helped to nick the RNA. If base treatment was used, the gel should be neutralized and soaked in SSC-formaldehyde before blotting. Transfer of the RNA to
;
"50" *MAY !984 '
■ ;tV£D I
2r=770C
nitrocellulose was done by standard methods.
Prehybridization was done at 42°C for a minimum of 4 hours in 50% formamide, 102 dextran sulfate, 5x SSC, 5x Denhardt's, lOOyg/ml denatured carrier DNA, 20yg/m1 poly(A), 40mM Na-phosphate (pH 6.8-7.0) and 0.2% SDS. Hybridization was done by addition of the probe to the same buffer with overnight incubation. The probe was not be used at more than approximately 5 x 10554 c.p.m./ml.
After hybridization, the nitrocellulose was washed a number of times at 42°C with 2x SSC, 25mM Na-phosphate, 5mM EDTA and 2mM Na-pyrophosphate followed by a final wash for 20 minutes at 64°C in lx SSC. Best results were obtained if the filter was not dried prior to autoradiography and the probe could be removed by extensive washing in ImM EDTA at 64°C.
Example 20
"Western" blots, to detect anitgens after SDS-polyacryamide gel electrophorsis, were done essentially as described by R. P. Legocki and D. P. S. Verma (1981) Analyt. Biochem. Ill:385-392.
Micro-ELISA (_enzyme-_l_inked jmmuno-_sorbant jssay) assays were done using Immulon-2 type plates with 96 wells by the following steps:
.1 Binding antibody to plates
On Day 1, the wells were coated with 1:1000 dilution of antibody (rabbit antiphaseolin IgG) in coating buffer. 200^1/well incubated at 37°C for 2-4 hours. The plates were covered with Saran Wrap. Then the plates were rinsed three times with phosphate buffered saline-Tween (PBS-Tween) allowing a 5 minute waiting period between each rinse step. Then 1% bovine serum albumin (BSA) was added to rinse and, after addition to the well, left to sit for 20 minutes before discarding. Rinsing was repeated five times more with PBS-Tween.
.2 Tissue homogenization
The tissue was sliced up into small pieces and then homogenized with a polytron using lgm of tissue/ml phosphate buffered saline-Tween-2% polyvinyl pyrol1idone-40 (PBS-Tween-2% PVP-40). All samples were kept on ice before and after grinding and standard phaseolin curves were obtained. One standard
• • ATTi.lY OFHta
17 MAY 1984
*
2077GG
curve was done in tissue homogenates and one standard curve was also done in buffer to check the recovery of phaseolin when ground in tissue. Following centrifugation of the homogenized samples, lOOvil of each sample were placed in a well and left overnight at 4°C. To avoid errors, duplicates of each sample were done. The plates were sealed during incubation.
.3 Binding enzyme
After the overnight incubation, the antigen was discarded and the wells were washed five times with PBS-Tween allowing 5 minutes between each rinse.
A conjugate (rabbit anti-phaseolin IgG alkaline phosphatase-1 inked) was the diluted 1:3000 in PBS-Tween-2% PVP containing 0.2%BSA and 150yl was added to each well; followed by incubation for 3-6 hours at 37°C. After the incubation, the conjugate was discarded and the wells were rinsed five times with PBS-Tween, allowing five minutes between each rinse as before.
.4 Assay
Immediately before running the assay, a 5mg tablet of p-nitrophenyl phosphate (obtained from Sigma and stored frozen in the dark) was added per 10ml substrate and vortexed until the tablet was dissolved. 200ul of the room temperature solution was quickly added to each well. The reaction was measured at various times, e.g. t=0, 10, 20, 40, 60, 90 and 120 minutes, using a dynatech inicro-elisa reader. When p-nitrophenyl phosphate, which is colorless, was hydrolysed by alkaline phosphatase to inorganic phosphate and p-nitrophenol, the latter compound gave the solution a yellow color, which could be spectrophotometrically read at 410nm. The lower limit of detection was less than O.lng.
Example 21
Triparental matings were generally accomplished as described below; other variations known to those skilled in the art are also acceptable. E. coliK802 (pRK290-based shuttle vector) was mated with E. coli(pRK2013) and an A. tumefaciens strain resistant to streptomycin. The pRK2013 transferred to the shuttle vector carrying strain and mobilized the shuttle vector for transfer to the Aqrobacterium. Growth on a medium containing both streptomycin and the drug to which the shuttle vector is resistant, often either kanamycin or chloramphenicol, resulted in the selection of Aqrobacterium cells containing
2I-7V6G
shuttle vector sequences. A mating of these cells with E. c'oli(pPHlJl) resulted in the transfer of pPHlJl to the AgrobacteriuiTi cells. pPHlJl and pRK290-based shuttle vectors cannot coexist for long in the same cell. Growth on gentamycin, to which pPHlJl carries a resistance gene, resulted in selection of cells having lost the pRK290 sequences. The only cells resistant to streptomycin, gentamycin, and either kanamycin or chloramphenicol are those which have Ti plasmids that have undergone double-homologous recombination with the shuttle vector and now carry the desired construction.
tML PATENT CifrtCg
~53~ 17 MAY 1984
Plasmid, Bacterium, Made or Used Shown in
Strain, Etc. in Example: Figure:
Charon 24A 6.1
ColEI 6.2
GM33 6.2
HB101 8,1, 6.1
K802 ubiquitous
? ^
i 2
pA66-12A 1.7
pBR322 17
vjpgR322-R 1.1
VpBR325 34, 26
| I
ii I
?pcDNA31 22, 15
o}
j -<
H i 3 \ }
'* ! oo i iL,..., „ c
•e* : ..pEF44A 2 6
pCF448 4.1
PCF44C 4.1
pJS3.8
TABLE 1
Made Out Of References, Comments,
or Synonyms bacteriophage vector based on lambda
E. coli E. coli
E. coli, W. B. Wood U9WTJ. Mol. Biol. 16:118.
pTiA66, pKS-0SI-KB3.0
F. Bolivar, et al. (1978) Gene 7T9T113.
pBR322
F. Bolivar (1978)
Gene ±: 121-136.
pBR322/phas. cDNA equivalent to pMC6
pRK290, pTiC58
pCF44A
pCF448
= p3.8
Plasmid, Bacterium, Strain, Etc.
Made or Used in Example:
Shown ■ Fiqure:
pKS-B17-KB3.0
1.5
43
pKS-KB3.8
6.3
19
pKS-nopIV
(2)
pKS-nopV
.1
pKS-nopVI
.1
9
pKS-oct.cam203
11.2
27
pKS-oct.del I
11.2
39, 29
pKS-oct.delII
11.2
39, 28
pKS-oct.del III
12.4
33
pKS-oct.delllla
13.3
39, 36
pKS-oct.tmr
14.3
39, 38
jpKS-0S-KB3.0
1.6
?pKS-proI
.1
24, 12
^pKS-proIA
.3
24
,jpKS-proI-KB
.4
14
pKS4
6.2
18
PKS4-KB2.4
7.1
21
pKS4-KB
.2
7
Made Out Of pKS4-KB, pKS169 pBR322, pKS-4, p3.8 pCF44A, pRK290 pCF44c, pRK290 pKS-nopV pKS-5, p203 pKS-oct.cam203, pl03 pKS-oct.cam203, pl02 p2f, p3e pKS-6, p2 pKS-6, p203 PKS-B17-KB3.0, pRK290 pKSlll pKS-proI
pKS-proI, pKS4-KB pBR322, pRZ102 pBR322, pKS4, pMC6 pBR322, pKS4, p7.2
References, Comments,
or Synonyms
= p2f p2f-rt./p3e-ft.
to
=pKS4-3.0KB, =pKS4-KB3.0
C3
■\
U;
C\
*»4
:s
CO 4*.
Plasmid, Bacterium,
Strain, Etc.
pKS-KBc pKS-5
pKS-6
pKSlll pKS-169
pL-B
pLK-proIA
pMC6
pNNNl pNNN2
pNNN4
jssj pPHlJl
Made or Used in Example:
9
11.1
13.1 (5.1)
1.2
.2 10.4 14.5, 9
2.2
4.3
4.4 21
Shown in
Fiqure:
26 34 12
23 25 20
8
9
PPBL134
(10)
23
References, Conroents,
or Synonyms equivalent to pMC36
used to eliminate shuttle vector, same exclusion group as pRK290, carries gene for resistance to gentamycin, P.R. Hirsh (1973) Thesis, Univ. E. Anglia.
T
Nf
Plasmid, Bacterium,
Strain, Etc.
pRK290
Made or Used in Example common
Shown i n
Fiqure:
PRK2013
21
PRZ102 pTiA66
(6.2) 1, 5, 12
IS
. 5?
*
f CJ t -ft
|SjpTiB6 lpTiC58 pTi15955 P2
(12) (2, 4) common 13.2
6
1, 11 35
Made Out Of
References, Comments,
or Synonyms
G. Ditta, et al (1980) Proc. Nat. Acad. Sci. USA 77:7347-7357.
used to mobilize the shuttle vector, carries tra genes that mobilize a mob site on pRK290 for conjugal tonal transfer of pRK290 to Aqrobacterium. D. H. Figurski & D. R. Helinski, (1979)
Proc. Nat. Acad. Sci. USA 76:1648-1652.
ColEl, Tn5 = p7.2
octopine-type plasmid, pTiA6 with a natural insertion in tms pTiB6
nopaline-type plasmid octopine-type plasmid p203
Plasmid, Bacterium,
Strain, Etc.
P2f p2f-rt./p3e-lft.
p2f-rt./pl02-lft.
p2f-rt./pl03-lft.
p3e p3.8
p3.8-cDNA p7.2
Made or Used in Example:
12.2
12.5
12.5
12.3
6.1
8.1
6.1
Shown in
Fiqure:
31 39 39 39
32
22, 16
22
13
p202 p203
| ^1^203-Bgl II 01
03
15955-12A lie 177.4
1, 2, 11, 12, 13, 14
12.2
1.7
.1
(6.1)
32
31, 35, 36, 42
31
11 def, 2 def
2 def
23 15
#
Made Out Of pKS5, p203-Bgl11
p2f, pl02 p2f, pl03 pBR322, p202 pBR322, 177.4 pcDNA31, p3.8 pBR322, 177.4
pBR322, pTi15955 pBR322, pTi15955
p203
pBR322, pTi15955
pBR322, pTi15955 pTiA66, pKS-0SI-KB3.0 pBR325, pPVL134 Charon 24A/phas. gene
References, Comments,
or Synonyms
?pKS-oct.cam203
= pKS-oct.cam203
= pJS3.8
= pSS7.2, S. M. Sun, et al. (1981) Nature "257712-41.
{O
- 7
-3
C:>
AG-PVPhl77.4, S. M. °
Sun et al. (1981)
Nature "2^9:37-41.
20776G
Claims (23)
1. A DNA vector comprising T-DNA as herein before defined on page 15 having a plant structural gene inserted therein under control of a T-DNA promoter as herein before defined at pages 16-17.
2. A DNA vector according to Claim 1 wherein the plant structural gene comprises an intron.
3. A DfIA vector according to Claim 1 wherein the plant structural gene is under control of a promoter selected from the group of T-DNA genes consisting of tmr, tml_, tms, nopaline synthetase, octopine synthetase, or the "1.6" transcript.
4. A DNA vector according to Claim 1 wherein the plant structural gene comprises cDNA.
5. A DNA vector according to Claim 1 wherein the T-DNA is modified by alteration or deletion of tms or tmr.
6. A bacterial strain containing and replicating a DNA vector according to any one of Claims 1-5.
7. The bacterial strain of Claim G selected from Agrobacterium tumefaciens or Agrobacteri um rhi zogenes.
8. A bacterial strain according'to Claim 6 wherein the DNA vector comprising T-DNA and having a plant structural gene inserted therein under control of a T-DNA promoter is selected from the group: pKS4, p3.8, pcDNA 31 or pPVL 134.
9. A method for genetically modifying a plant cell, comprising the steps of: (a) insertinq a plant structural gene into T-DNA as herein before defined on page 15 comprising a T-DNA promoter as herein before defined at pages 16-17, the promoter and the plant structural gene being in such position and orientation with respect to each other that the plant structural gene is expressible in a plant cell under control of the T-DNA promoter, thereby forming a T-DNA promoter/plant structural gene combination, and then n 207766 (b) transferring the T-ONA promoter/plant structural gene combination into a plant cell.
10. A method according to Claim 9, further comprising after execution of step (b) the step of: (c) detecting expression of the plant structural gene in a plant cell containing the T-DNA promoter/plant structural gene combination.
11. A method according to Claim 9, wherein the plant structural gene comprises one or more introns.
12. A method according to Claim 9, wherein the plant structural gene encodes a seed storage protein.
13. A method according to Claim 9, wherein the plant structural gene encodes phaseolin.
14. A method according to Claim 9, wherein the T-DNA promoter/plant structural gene combination is maintained and replicated prior to step (b) as part of a shuttle vector.
15. A method according to Claim 9, wherein the promoter of step (b) is selected from the group consisting of tmr, tml, tms, nopaline synthetase, octopine synthetase, and "1.6" transcript promoters.
16. A method according to Claim 9, wherein the plant structural gene is fused to a T-DNA structural gene, whereby the T-DNA structural gene/plant structural gene combination encodes a fusion protein comprising T-DNA-encoded protein and plant protein sequences.
17. A method according to Claim 9, wherein the cell is from a dicotyledonous pi ant.
18. A method according to Claim 17, wherein the dicotyledonous plant is a member of the Compositeae or the Leguminoseae. 17 MAY 1984 (j o a 207766
19. A plant cell produced according to the method of any one of Claims 9-18.
20. Plant tissue comprising cells produced according to the method of any one of Claims 9-18.
21. Plants comprising plant cells produced according to the method of any one of Claims 9-18.
22. A DNA vector comprising T-DNA having a plant structural gene inserted therein under control of a T-DNA promoter substantially as herein described with reference to the accompanying drawings.
23. A method for genetically modifying a plant cell substantially as herein described with reference to the Examples. By t-ljs/tiielr iL .rorised A. J. PARK, it SON. r.r o ■ * 'C2 6 JAN 1987
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US48561483A | 1983-04-15 | 1983-04-15 |
Publications (1)
Publication Number | Publication Date |
---|---|
NZ207766A true NZ207766A (en) | 1987-03-06 |
Family
ID=23928821
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NZ20776684A NZ207766A (en) | 1983-04-15 | 1984-04-06 | Plant structural gene expression |
Country Status (8)
Country | Link |
---|---|
JP (2) | JP2559355B2 (en) |
AR (1) | AR245956A1 (en) |
AU (1) | AU572502B2 (en) |
BR (1) | BR8401783A (en) |
CA (1) | CA1340714C (en) |
ES (1) | ES531626A0 (en) |
NZ (1) | NZ207766A (en) |
PT (1) | PT78415B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NZ207765A (en) * | 1983-04-15 | 1987-03-06 | Lubrizol Genetics Inc | Plant expression of transferred dna(t-dna)from plasmids associated with agrobacterium sp |
NZ210093A (en) * | 1983-11-18 | 1988-11-29 | Lubrizol Genetics Inc | Genetic modification of plant cells by octopine t-dna promoters and/or polyadenylation sites; dna vectors, bacterial strains and plant tissue |
US4771002A (en) * | 1984-02-24 | 1988-09-13 | Lubrizol Genetics, Inc. | Transcription in plants and bacteria |
DK162399C (en) * | 1986-01-28 | 1992-03-23 | Danisco | PROCEDURE FOR EXPRESSION OF GENES IN BELGIUM PLANT CELLS, DNA FRAGMENT, RECOMBINED DNA FRAGMENT AND PLASMID FOR USE IN EXERCISING THE PROCEDURE |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3381568D1 (en) * | 1983-01-13 | 1990-06-21 | Max Planck Gesellschaft | METHOD FOR INTRODUCING EXPRESSIVE GENES IN PLANT CELL GENENOMES AND AGROBACTERIUM STEMS CONTAINING HYBRID TI PLASMIDE VECTORS USED IN THIS METHOD. |
JPS60500795A (en) * | 1983-01-17 | 1985-05-30 | モンサント カンパニ− | genetically transformed plants |
NZ207765A (en) * | 1983-04-15 | 1987-03-06 | Lubrizol Genetics Inc | Plant expression of transferred dna(t-dna)from plasmids associated with agrobacterium sp |
-
1984
- 1984-04-06 NZ NZ20776684A patent/NZ207766A/en unknown
- 1984-04-11 CA CA 451767 patent/CA1340714C/en not_active Expired - Lifetime
- 1984-04-12 AR AR29626884A patent/AR245956A1/en active
- 1984-04-12 PT PT7841584A patent/PT78415B/en unknown
- 1984-04-13 ES ES531626A patent/ES531626A0/en active Granted
- 1984-04-13 AU AU26840/84A patent/AU572502B2/en not_active Ceased
- 1984-04-16 BR BR8401783A patent/BR8401783A/en not_active IP Right Cessation
- 1984-04-16 JP JP59077452A patent/JP2559355B2/en not_active Expired - Lifetime
-
1994
- 1994-04-12 JP JP6073581A patent/JP2574130B2/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
ES8505228A1 (en) | 1985-05-16 |
AR245956A1 (en) | 1994-03-30 |
PT78415A (en) | 1984-05-01 |
AU572502B2 (en) | 1988-05-12 |
PT78415B (en) | 1986-05-27 |
JP2559355B2 (en) | 1996-12-04 |
AU2684084A (en) | 1984-10-18 |
JPS60210988A (en) | 1985-10-23 |
BR8401783A (en) | 1984-11-20 |
JP2574130B2 (en) | 1997-01-22 |
ES531626A0 (en) | 1985-05-16 |
JPH07163356A (en) | 1995-06-27 |
CA1340714C (en) | 1999-08-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5591605A (en) | Plant structural gene expression | |
EP0122791B2 (en) | Plant gene expression | |
US5504200A (en) | Plant gene expression | |
US5668298A (en) | Selectable marker for development of vectors and transformation systems in plants | |
US5463174A (en) | Transformation and foreign gene expression in Brassica species | |
US5750871A (en) | Transformation and foreign gene expression in Brassica species | |
US8273954B1 (en) | Genetically transformed plants | |
EP0270615B1 (en) | TRANSFORMATION AND FOREIGN GENE EXPRESSION IN $i(BRASSICA) SPECIES | |
US6048730A (en) | Selectable marker for development of vectors and transformation systems in plants | |
EP0126546B1 (en) | Plant structural gene expression | |
WO1985004899A1 (en) | Methods and vectors for transformation of plant cells | |
US20220170033A1 (en) | Plant explant transformation | |
EP0145338B1 (en) | Octopine t-dna promoters | |
AU706650B2 (en) | Genetic modification of plants | |
Bretagne-Sagnard et al. | Selection of transgenic flax plants is facilitated by spectinomycin | |
EP0174166A1 (en) | Disarmed T-DNA | |
NZ207766A (en) | Plant structural gene expression | |
CA1341254C (en) | Method for genetically modifying a plant cell for plant structural gene expression | |
CA1340713C (en) | Plant gene expression | |
JP2573797C (en) | ||
Stefanov | Tissue And Organ Specific Expression of Developmentally Regulated Chimeric Genes in Transgenic Plants |