NO309000B1 - Isolated DNA sequence encoding a mammalian IL-4 receptor - Google Patents

Description

InfinninPlfiPn's background

The present invention relates to an isolated DNA sequence that codes for a mammalian IL-4 receptor (IL-4R), recombinant expression vector, method for the production of IL-4R polypeptide, antibodies that are immunologically reactive with an IL-4R protein , and using IL-4R to detect IL-4R or IL-4R molecules or their interaction in vitro.

Interleukin-4 (IL-4, also known as B-cell-stimulating factor or BSF-1) was originally characterized by its ability to stimulate the proliferation of B-cells in response to low concentrations of antibodies directed against surface immunoglobulin. Later, IL-4 has been shown to have a much wider spectrum of biological activities, including growth co-stimulation of T cells, mast cells, granulocytes, megakaryocytes and erythrocytes. In addition, IL-4 stimulates the proliferation of several IL-2- and IL-3-dependent cell lines, induces the expression of class II major histocompatibility complex molecules on resting B cells, and increases the secretion of IgE and IgGl isotypes by pathway -mulated B cells. Both murine and human IL-4 have been definitively characterized by recombinant DNA technology and by purification of the natural murine protein to homogeneity (Yokota et al., Proe. Nati. Acad. Sciv USA, 83,

p. 5894, 1986, Norna et al., Nature, 319, p. 640, 1986 and Grabstein et al., J. Exp. Med., 163, p. 1405, 1986).

The biological activities of IL-4 are mediated by specific cell surface receptors for IL-4 which are expressed on primary cells and in vitro cell lines of mammalian origin. IL-4 binds to the receptor which then transmits a biological signal to various immune effector cells. Purified preparations of IL-4 receptor (IL-4R) will therefore be able to be used in diagnostic analyzes with regard to IL-4 or IL-4 receptor, and to produce antibodies against IL-4 receptor for use in diagnosis or therapy . In addition, preparations of purified IL-4 receptor can be used directly in therapy to

bind or purify IL-4, thereby providing a means of regulating the biological activities of this cytokine.

Although IL-4 has been thoroughly characterized, little progress has been made in characterizing its receptor. A large number of studies documenting the existence of an IL-4 receptor on a wide range of cell types have been published; however, structural characterization has been limited to estimates of the molecular weight of the protein determined by SDS-PAGE analysis of covalent complexes formed by chemical cross-linking between the receptor and the radiolabeled IL-4 molecules. Ohara et al. (Nature, 325, p. 537, 1987) and Park et al.

(Proe. Nati. Acad. Sei., USA, 84, p. 1669, 1987) first established the presence of an IL-4 receptor by using radioiodinated recombinant murine IL-4 to bind a high-affinity receptor expressed in small number of B and T lymphocytes and a wide range of cells from the haematopoietic lineage. By affinity cross-linking of <1>25I-IL-4 to IL-4R, Ohara et al. and Park et al. receptor proteins with apparent molecular weights of 60,000 and 75,000 daltons. It is possible that the small receptor size observed on the murine cells constitutes a proteolytically cleaved fragment of the naturally occurring receptor. Later attempts by Park et al. (J. Exp. Med., 166, p. 476, 1987) using recombinant human IL-4 extracted

125

from yeast and radioactively labeled with I, showed that human IL-4 receptor is present not only on cell lines of B-,

T and hematopoietic cell lines, but also found on human fibroblasts and cells of epithelial and endothelial origin. IL-4 receptors have since been shown to be present on other cell lines, including CBA/N splenic B cells (Nakajima et al., J. Immunol., 139, p. 774, 1987), Burkitt lymphoma Jijoye- cells (Cabrillat et al., Biochem. & Biophys. Res. Commun., 149, p. 995, 1987), many different hematopoietic and non-hematopoietic cells (Lowenthal et al., J. Immunol., 140, p. 456 , 1988) and murine Lyt-2~/L3T4~ thymocytes. Later, Park et al reported. (UCLA Symposia, J. Cell Biol.,

125

Suppl. 12A, 1988) that I-IL-4-binding plasma membrane receptors of 138-145 kDa in the presence of sufficient protease inhibitors could be identified on several murine cell lines. Thus, considerable disagreement remains regarding the true size and structure of IL-4 receptors.

Further investigation of the structure and biological characteristics of IL-4 receptors and the role that IL-4 receptors play in the responses of different cell populations to IL-4 or other cytokine stimulation, or of the methods of using IL-4 receptors effectively in therapy, diagnosis or analysis, has not been possible due to the difficulty in obtaining sufficient quantities of purified IL-4 receptor. No cell lines have previously been known to express high levels of IL-4 receptors constitutively and continuously, and in cell lines known to express detectable levels of IL-4 receptor, the level of expression is generally limited to less than about 2000 receptors per cell. Attempts to purify the IL-4 receptor molecule for use in biochemical analysis or to clone and express mammalian genes encoding IL-4 receptor have thus been hampered by a lack of purified receptor and a suitable source of receptor mRNA.

Summary of the invention

The present invention provides an isolated DNA sequence encoding a mammalian IL-4 receptor (IL-4R), characterized in that the DNA sequence is selected from: (a) a DNA sequence comprising nucleotides -75-2355 in Figures 2A-2C, nucleotides 1-2355 in Figures 2A-2C, nucleotides -75-2400 in Figures 4A-4C or nucleotides 1-2400 in Figures 4A-4C, (b) DNA sequences that can hybridize to a DNA according to ( a) under medium stringency conditions, and encoding an IL-4R polypeptide capable of binding IL-4, and (c) DNA sequences degenerated as a result of the genetic code, into a DNA defined in (a) or (b), and which encodes an IL-4R polypeptide capable of binding IL-4.

The present invention also provides a recombinant expression vector, characterized in that it comprises a DNA sequence according to claims 1-9, as well as a method for producing a mammalian IL-4 receptor polypeptide (IL-4R polypeptide), characterized by a suitable host cell comprising a vector according to claim 11, is cultured under conditions that promote expression of the IL-4R polypeptide, followed by purification of the IL-4R polypeptide.

The human IL-4R molecule is believed to have a molecular weight of between approx. 110,000 and 150,000 M,. and has the following N-terminal amino acid sequence derived from the cDNA sequence and by analogy to the biochemically determined N-terminal sequence in the fully completed, murine protein: MKVLQEPTCVSDYMSISTCEW.

The present invention also provides antibodies that are immunologically reactive with a mammalian IL-4 receptor protein (IL-4R protein), characterized in that the IL-4R protein comprises an amino acid sequence selected from residues 1-785 shown in Figures 2A-2C or residues 1-800 shown in Figures 4A-4C, as well as the use of IL-4R for the detection of IL-4 or IL-4 receptor molecules (IL-4R molecules) or their interaction in vitro, by purifying IL-4R- molecules are bound to IL-4 molecules and bound or unbound IL-4 or IL-4R molecules are measured or detected, wherein said IL-4R is selected from;

a) an IL-4R comprising the amino acid sequence of residues 1-785 shown in Figures 2A-2C, b) an IL-4R comprising the amino acid sequence of residues 1-800 shown in Figures 4A-4C, c) a fragment of IL-4R according to (a) or (b), wherein the fragment can bind IL-4, and d) an IL-4R that can bind IL-4, and which comprises an amino acid sequence that is more than 80% similar to the sequence indicated

in (a) or (b).

Brief description of the drawings

Figure 1 shows restriction maps of cDNA clones containing the coding regions (indicated by a bar) of the murine and human IL-4R cDNAs. The restriction sites EcoRI, PvuII, HincII and Sstl are indicated using respectively the letters R, P, H and S. Figures 2A-C show the cDNA sequence and the deduced amino acid sequence from the coding region of a murine IL-4 receptor, recovered from clone 7B9-2 in the 7B9 library. The N-terminal isoleucine in the complete protein is designated amino acid No. 1. The coding region for the membrane-bound full-length protein from clone 7B9-2 is defined by amino acids 1-785. The ATC codon specifying the isoleucine residue that constitutes the fully formed N-terminus is underlined in position 1 of the protein sequence; the putative transmembrane region in amino acids 209-232 is also underlined. The sequences in the coding regions of clones 7B9-4 and clones CTLL-18 and CTLL-16 from the CTLL 19.4 library are identical to the coding regions of 7B9-2, except for the following. The coding region of CTLL-16 encodes a membrane-bound IL-4 binding receptor defined by amino acids from -25 through 233 (including the putative 25 amino acid signal peptide sequence), but is followed by a TAG terminator codon (not shown ) which ends the open reading frame. The nucleic acid sequence indicates the presence of a splice donor site at this position (indicated by an arrow in Figure 1) and a splice acceptor site near the 3<1-> end (indicated by a second arrow), suggesting that CTLL -16 was derived from an unspliced mRNA intermediate. The clones 7B9-4 and CTLL-18 encode respectively amino acids 23 through 199 and -25 through 199. After amino acid 199, a 114-base pair insertion (identical in both clones and shown by an open box in Figure 1) introduces six new amino acids followed by a termination codon. This form of the receptor is soluble. Figure 3 is a schematic illustration of the high expression mammalian plasmid pCAV/NOT which is described in more detail in Example 8. Figures 4A-C show the coding sequence of a human IL-4 receptor cDNA from clone T22-8 which was obtained from the cDNA library derived from the T cell line T22. The deduced N-terminal methionine in the fully formed protein and the transmembrane region are underlined. Figures 5A-B are a comparison of the deduced amino acid sequences of human (top) and murine (bottom) IL-4 receptor cDNA clones.

Detailed description of the invention

Definitions

As used herein, the terms "IL-4 receptor" and "IL-4R" refer to proteins having amino acid sequences that are substantially similar to the naturally occurring mammalian interleukin-4 receptor amino acid sequences described in Figures 2 and 4, and which are biologically active as defined below, in that they are able to bind interleukin-4 molecules (IL-4 molecules) or transmit a biological signal initiated by means of an IL-4 molecule binding to a cell, or cross-react with anti-IL-4R antibodies raised against IL-4R from natural (ie, non-recombinant) sources. The naturally occurring murine IL-4 receptor molecule is believed to have an apparent molecular weight by SDS-PAGE of approx. 140 kilodaltons (kDa). The terms "IL-4 receptor" or "IL-4R" include, but are not limited to, analogs or subunits of naturally occurring proteins of at least 20 amino acids and exhibiting at least some biological activity common to IL-4R. As used in the specification, the term "full-length" means a protein expressed in a form lacking a leader sequence that may be present in full-length transcripts of a naturally occurring gene. Various bioequivalent protein and amino acid analogues are described in more detail below.

The term "substantially similar", when used to define either amino acid or nucleic acid sequences, means that a particular sequence, e.g. a mutant sequence, varies from a reference sequence by one or more substitutions, deletions or additions, the net effect being that the biological activity of the IL-4R protein is maintained. Alternatively, nucleic acid subunits and analogs are "substantially similar" to the particular DNA sequences described herein if: (a) the DNA sequence is derived from the coding region of a naturally occurring mammalian IL-4R gene;

(b) the DNA sequence is able to hybridize to DNA sequences according to (a) under medium stringency conditions and

which encode biologically active IL-4R molecules, or DNA

sequences which are degenerate as a result of the genetic code of the DNA sequences defined in (a) or (b), and which encode biologically active IL-4R molecules. Substantially similar analogue proteins will be more than approx. 30% identical to the corresponding sequence in the naturally occurring IL-4R. Sequences with lesser degrees of similarity but comparable biological activity are considered to be equivalents. Preferably, the analogue proteins will be more than approx. 80% identical to the corresponding sequence in the naturally occurring IL-4R, in which case they are defined as "substantially identical". When defining nucleic acid sequences, all nucleic acid sequences capable of encoding substantially identical amino acid sequences are considered to be substantially identical to a reference nucleic acid sequence. Percentage similarity can be determined e.g. by comparing sequence information using the GAP computer program, version 6.0, available from the University of Wisconsin Genetics Computer Group (UWGCG). The GAP program uses the assembly method of Needleman and Wunsch (J. Mol. Biol., 4j}, p. 443, 1970), as revised by Smith and Waterman (Adv. Appl. Math., 2> p* 482, 1981). Briefly, the GAP program defines similarity as the number of contiguous symbols (ie, nucleotides or amino acids) that are similar, divided by the total number of symbols in the shorter of the two sequences. The preferred error parameters for the GAP program include: (1) a uniform comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess, Nucl. Acids Res., 1£, p. 6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation,

pp. 353-358, 1979, (2) an addition of 3.0 for each hole and an additional 0.10 addition for each symbol in each hole, and (3) no end hole addition.

"Recombinant" as used herein means that a protein is derived from recombinant (eg, microbial or mammalian) expression systems. "Microbial" refers

to recombinant proteins made in bacterial or fungal (eg yeast) expression systems. As a product, "recombinant microbial" defines a protein produced in a microbial expression system that is substantially free of naturally occurring endogenous substances. Protein expressed in most bacterial cultures, e.g. E. coli, will be free of glycan. Protein expressed in yeast may have a glycosylation pattern different from that expressed in mammalian cells.

"Biologically active", as used in the specification as a characterization of IL-4 receptors, means that a particular molecule shares sufficient amino acid sequence similarity with the embodiments of the present invention described herein to be capable of to bind detectable amounts of IL-4, transfer an IL-4 stimulus to a cell, e.g. as a component of a hybrid receptor construct, or cross-react with anti-IL-4R antibodies raised against IL-4R from natural (ie non-recombinant)

sources. Preferably, biologically active IL-4 receptors within the scope of the present invention are capable of binding more than 0.1 nmol of IL-4 per nmol receptor, and preferably more than 0.5 nmol IL-4 per nmol receptor in standard binding assays (see below).

"DNA sequence" refers to a DNA molecule in the form of a separate fragment or as a component of a larger DNA construct, which has been derived from DNA isolated at least once in substantially pure form, i.e. free of contaminating, endogenous materials, and in an amount or concentration that enables the identification, manipulation and recovery of the sequence and its constituent nucleotide sequences by standard biochemical methods, e.g. using a cloning vector. Such sequences are preferably provided in the form of an open reading frame that is not interrupted by internal, untranslated sequences, or introns, which are usually present in eukaryotic genes. Genomic DNA containing the relevant sequences can also be used. Sequences of untranslated DNA may be present 5' or 3' from the open

reading frame where they do not affect the manipulation or expression of the coding areas.

"Nucleotide sequence" refers to a heteropolymer of deoxyribonucleotides. DNA sequences encoding the proteins provided by this invention can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, thereby providing a synthetic gene capable of being expressed in a recombinant transcription unit .

"Recombinant expression vector11 refers to a replicable DNA construct used either to amplify or express DNA encoding IL-4R, and which comprises a transcription unit comprising a composition of (1) a genetic element or elements with a regulatory role in gene expression, e.g. eg promoters or "enhancers", (2) a structural or coding sequence that is transcribed into mRNA and translated into protein, and (3) appropriate transcription and translation initiation and translation termination sequences. Structural elements intended for use in yeast expression systems preferably comprise a leader sequence that enables extracellular secretion of translated protein by a host cell. Alternatively, when recombinant protein is expressed without a leader or transport sequence, an N-terminal methionine residue may be included. This residue may subsequently be cleaved from the expressed , recombinant protein, whereby a final product is obtained.

"Recombinant microbial expression system" means a substantially homogeneous monoculture of suitable host micro-organisms, e.g. bacteria such as E. coli, or yeast such as S. cerevisiae, which have stably integrated a recombinant transcription unit into chromosomal DNA or carry the recombinant transcription unit as a component of a present plasmid. In general, cells that make up the system are progeny from a single stock transformant. Recombinant expression systems will, as they are referred to here, express heterologous protein after induction of the regulator elements bound to the DNA sequence or the synthetic gene to be expressed.

Proteins and analogues

The present invention provides essentially homogeneous, recombinant mammalian IL-4R polypeptides mainly free of contaminating, endogenous materials and possibly without associated glycosylation according to a naturally occurring pattern. The naturally occurring, murine and human IL-4 receptor molecules are recovered from cell lysates as glycoproteins with an apparent molecular weight by SDS-PAGE of approx. 130-145 kilodaltons (kDa). Mammalian IL-4R according to the present invention includes, for example, primate, human, murine, canine, feline, bovine, ovine, equine and porcine IL-4R. Derivatives of IL-4R within the scope of the invention also include different structural forms of the primary protein which retain biological activity. Due to the presence of ionizable amino and carboxyl groups, an IL-4R protein can e.g. be in the form of acidic or basic salts, or in neutral form. Individual amino acid residues can also be modified by oxidation or reduction.

The primary amino acid structure can be modified by forming covalent or aggregate conjugates with other chemical residues, such as glycosyl groups, lipids, phosphate, acetyl groups and the like, or by creating amino acid sequence mutants. Covalent derivatives are produced by attaching specific functional groups to IL-4R amino acid side chains or to the N- or C-termini. Other derivatives of IL-4R within the scope of the invention include covalent or aggregate conjugates of IL-4R or fragments thereof with other proteins or polypeptides, such as by synthesis in recombinant culture as N-end or C-end fusions. E.g. the conjugated peptide may be a signal (or leader) polypeptide sequence in the N-terminal region of the protein which co-translationally or post-translationally directs transfer of the protein from its site of synthesis to its site of function within or outside the cell membrane or wall ( eg the oc-factor leader in yeast). IL-4R protein fusions may comprise peptides added to facilitate purification or identification of the IL-4R (eg, poly-His). The amino acid sequence of IL-4 receptor can also be bound to the peptide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (Hopp et al., Bio/Technology, S_,

pp. 1204, 1988). The latter sequence is highly antigenic and provides an epitope reversibly bound by a specific monoclonal antibody, which enables rapid analysis and easy purification of expressed recombinant protein. This sequence is also specifically cleaved by bovine mucosal enterokinase in the residue immediately following the Asp-Lys pair. Fusion proteins attached to this peptide may also be resistant to intracellular degradation in E. coli.

IL-4R derivatives can also be used as immunogens, reagents in receptor-based immunological assays, or as binding agents for affinity purification procedures of IL-4 or other binding ligands. IL-4R derivatives can also

obtained by means of cross-linking agents, such as M-maleimido-benzoylsuccinimide esters and N-hydroxysuccinimide, in cysteine-

and lysine residues. IL-4R proteins can also be covalently bound through reactive side groups to various insoluble substrates, such as cyanobromide-activated, bisoxirane-activated, carbonyldiimidazole-activated or tosyl-activated agarose structures, or by adsorption to polyolefin surfaces (with or without glutaraldehyde cross-linking). Once bound to a substrate, IL-4R can be used to bind (for assay or purification purposes) anti-IL-4R antibodies or IL-4 selectively.

The present invention also includes IL-4R with or without associated glycosylation according to a naturally occurring pattern. IL-4R expressed in yeast or mammalian expression systems, e.g. C0S-7 cells, with respect to molecular weight and glycosylation pattern, can be similar to or significantly different from the naturally occurring molecules, depending on the expression system. Expression of IL-4R DNAs in bacteria, such as E. coli, yields non-glycos-ylated molecules. Functional mutant analogs of mammalian IL-4R with inactivated N-glycosylation sites can be prepared by oligonucleotide synthesis and ligation or by site-specific mutagenesis techniques. These analog proteins can be produced in a homogeneous form with reduced carbohydrate in good yield by using yeast expression systems. N-glycosylation sites in eukaryotic proteins are characterized by the amino acid triplet Asn-A^-Z where A^ is an amino acid other than Pro, and Z is Ser or Thr. In this sequence, asparagine provides a side chain amino group for covalent attachment of carbohydrate. Such a site can be eliminated by replacing Asn or the residue Z with another amino acid, removing Asn or

Z, or insert a non-Z amino acid between A^ and Z, or

an amino acid other than Asn between Asn and A^.

IL-4R derivatives can also be obtained by mutations of IL-4R or its subunits. An IL-4R mutant is, as referred to herein, a polypeptide homologous to IL-4R,

but which has an amino acid sequence that differs from naturally occurring IL-4R due to a deletion, insertion or substitution. Like most mammalian genes, mammalian IL-4 receptors are thought to be encoded by multi-exon genes. Alternative mRNA constructs attributable to different post-transcriptional mRNA splicing events, and which share large areas of identity or similarity with the herein claimed cDNAs, are considered to be within the scope of the present invention.

Bioequivalent analogues of IL-4R proteins can be constructed by e.g. to make different substitutions of residues or sequences or to remove terminal or internal residues or sequences not needed for biological activity. E.g. cysteine residues can be removed or replaced with other amino acids to prevent the formation of incorrect, intramolecular disulfide bridges after renaturation. Other methods of mutagenesis include modification of neighboring dibasic amino acid residues to promote expression in yeast systems where KEX2 protease activity is present. In general, substitutions should be made conservative, i.e. they

most preferred substitute amino acids are those which have physicochemical characteristics similar to those of the residue to be substituted. When a deletion or insertion strategy is adopted, the potential effect of the deletion or insertion on biological activity should also be considered.

their.

Subunits of IL-4R can be constructed by removing terminal or internal residues or sequences. Particularly preferred subunits include those in which the transmembrane region and the intracellular region of the IL-4R have been removed or replaced with hydrophilic residues to facilitate secretion of the receptor into the cell culture medium. The resulting protein is a soluble IL-4R molecule that can retain its ability to bind IL-4. Certain examples of soluble IL-4R include polypeptides with substantial identity to the sequence of amino acid residues 1-208 of Figure 2A, and residues 1-207 of Figure 4A.

Mutations in nucleotide sequences engineered for expression of analogous IL-4Rs must of course preserve the reading frame phase of the coding sequences and will preferably not create complementary regions that could hybridize to produce secondary mRNA structures, such as loops or hairpins, which would adversely affect translation of the receptor mRNA. Although a mutation site can be predetermined, it is not necessary that the type of mutation per se be predetermined. For selection with regard to optimal characteristics for mutants in a particular site, e.g. random mutagenesis is performed in the target codon and the expressed IL-4R mutants can be screened for the desired activity.

Not all mutations in the nucleotide sequence encoding IL-4R will be expressed in the final product, e.g. nucleotide substitutions can be made to increase expression, primarily to avoid secondary structure loops in the transcribed

mRNA (see EPA 75.444A), or to provide codons that are more readily translated by the selected host, e.g. the well-known E. coli preference codons for E. coli expression.

Mutations can be introduced at specific sites by synthesizing oligonucleotides containing a mutant sequence flanked by restriction sites that allow ligation to fragments of the naturally occurring sequence. After ligation, the resulting reconstructed sequence encodes an analog with the desired amino acid insertion, substitution, or deletion.

Alternatively, oligonucleotide-directed, site-specific mutagenesis methods can be used to provide an altered gene with specific codons altered according to the required substitution, deletion or insertion. Exemplary methods for making the changes indicated above are described by Walder et al. (Gene, 4_2, p. 133, 1986), Bauer et al. (Gene, 3_7, p-73/ 1985), Craik (BioTechniques, January 1985, pp. 12-19), Smith et al.

(Genetic Engineering: Principles and Methods, Plenum Press, 1981) and US Patent Nos. 4,518,584 and 4,737,462.

Expression of recombinant IL-4R

The present invention provides recombinant expression vectors comprising synthetic or cDNA-derived DNA fragments encoding mammalian IL-4R or bioequivalent analogs operably linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral or insect genes. Such regulatory elements include a transcription promoter, an eventual operator sequence to regulate transcription, a sequence that codes for suitable mRNA-ribosome binding sites, and sequences that regulate the termination of transcription and translation, and which are described in more detail below. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants may additionally be incorporated. DNA regions are operatively linked when they are functionally related to each other. E.g. DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor that participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it regulates transcription of the sequence; or a ribosome binding site is operatively bound to a coding sequence if it is positioned in such a way that it enables translation. Generally, operationally bound means contiguous and, in the case of secretarial managers, contiguous and in reading frame.

DNA sequences encoding mammalian IL-4 receptors to be expressed in a microorganism will preferably not contain introns that would prematurely terminate transcription of DNA into mRNA; however, premature termination of transcription may be desirable, e.g. when it would result in mutants with advantageous C-terminal truncations, e.g. deletion of a transmembrane region so that a soluble receptor is obtained that is not bound to the cell membrane. Due to code degeneracy, there can be considerable variation in nucleotide sequences encoding the same amino acid sequence; exemplary DNA embodiments are those corresponding to the nucleotide sequences shown in the figures.

Other embodiments include sequences capable of

to hybridize to the sequences of the figures under medium stringency conditions (50°C, 2 X SSC), and other sequences that hybridize or degenerate to those described above, which encode biologically active IL-4 receptor polypeptides.

Transformed host cells are cells that have been transformed or transfected with IL-4R vectors constructed using recombinant DNA techniques. Transformed host cells usually express IL-4R, but host cells transformed for the purpose of cloning or amplifying IL-4R DNA need not express IL-4R. Expressed IL-4R will be deposited in the cell membrane or secreted into the culture supernatant, depending on the selected IL-4R DNA. Suitable host cells for expression of mammalian IL-4R include prokaryotes, yeast or higher eukaryotic cells under the control of correct promoters. Prokaryotes include gram-negative or gram-positive organisms, e.g. E. coli or bacilli. Higher eukaryotic cells include established cell lineages of mammalian origin as described below. Cell-free translation systems could also be used to produce mammalian IL-4R using RNAs derived from the DNA constructs of the present invention. Suitable cloning and expression vectors for use with bacterial, fungal, yeast and mammalian cell hosts are described by Pouwels et al.

(Cloning Vectors: A Laboratory Manual, Elsevier, New York,

1985).

Prokaryotic expression hosts can be used for expression of IL-4Rs that do not require extensive proteolytic and disulfide processing. Prokaryotic expression vectors generally comprise one or more phenotype selectable markers, e.g. a gene that codes for proteins that confer antibiotic resistance or add an autotrophic need, and an origin of replication recognized by the host to ensure amplification in the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhymurium, and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be used as desired.

Useful expression vectors for bacterial use may comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well-known cloning vector pBR322 (ATCC 37017). Such commercial vectors include e.g. pKK223-3 and pGEM1. These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed. E. coli is usually transformed using derivatives of pBR322, a plasmid derived from an E. coli species (Bolivar et al., Gene, 2, p. 95, 1977). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides a simple means of identification of transformed cells.

Promoters commonly used in recombinant microbial expression vectors include the 3-lactamase (penicillinase) and the lactose promoter system (Chang et al., Nature, 275, p. 615, 1978 and Goeddel et al., Nature, 281,

p. 544, 1979), the tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res., 8, p. 4057, 1980 and EPA 36,776) and the tac promoter (Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, p. 412, 1982). A particularly useful bacterial expression system uses the phage A-PT promoter and the cl857ts thermolabile repressor. Plasmid vectors available from the American Type Culture Collection

which contain derivatives of the A-P promoter, include plasmid pHUB2 found in E. coli strain JMB9 (ATCC 37092), and pPLc28 found in E. coli RR1 (ATCC 53082).

Recombinant IL-4R proteins can also be expressed in yeast hosts, preferably from the Saccharomyces genus, such as S. cerevisiae. Yeasts from this genus, such as Pichia or Kluyveromyces, can also be used. Yeast vectors will generally contain an origin of replication from the 2u yeast plasmid or an autonomously replicating sequence (ARS), promoter, DNA encoding IL-4R, sequences for polyadenylation and transcription termination, and a selection gene. Preferably, yeast vectors will comprise an origin of replication and a selectable marker enabling transformation of both yeast and E. coli, e.g. the ampicillin resistance gene of E. coli and the S. cerevisiae trpl gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, and a promoter derived from a highly expressed yeast gene, to induce transcription of a downstream structural sequence. The presence of the trpl lesion in the yeast host cell genome then provides an efficient environment for detection of transformation by growth in the absence of tryptophan.

Suitable promoter sequences in yeast vectors include the promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem., 255, p. 2073, 1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. , 1_, p. 149, 1968 and Holland et al., Biochem. 17, p. 4900, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6 -phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in Hitzeman, EPA 73,657.

Preferred yeast vectors can be assembled using DNA sequences from pBR322 for selection and replication in E. coli (Amp gene and origin of replication) and yeast DNA sequences comprising a glucose-repressible ADH2 promoter and α-factor secretion leader. The ADH2 promoter has been described by Russell et al. (J. Biol. Chem. 258,

pp. 2674, 1982) and Beier et al. (Nature, 300, p. 724, 1982). The yeast α-factor leader that directs secretion of heterologous proteins can be inserted between the promoter and the structural gene to be expressed. See e.g. Kurjan et al., Cell, 30,

p. 933, 1982 and Bitter et al., Proe. Nati. Acad. Sei., USA,

81, p. 5330, 1984. The leader sequence can be modified so that near its 3' end it contains one or more useful restriction sites to facilitate fusion of the leader sequence to foreign genes.

Suitable yeast transformation procedures are known to those skilled in the art; an exemplary technique is described by Hinnen et al., Proe. Nati. Acad. Sei., USA, 75, p. 1929, 1978, where selection is made with regard to Trp<+->transformants in a selective medium consisting of 0.67% yeast nitrogen base, 0.5% casamino acids, 2% glucose, 10 ug/ ml adenine and 20 ug/ml uracil.

Host strains transformed by vectors comprising the ADH2 promoter can be grown for expression in a rich medium consisting of 1% yeast extract, 2% peptone and 1% glucose supplemented with 80 µg/ml adenine and 80 µg/ml uracil. Derepression of the ADH2 promoter occurs after depletion of medium glucose. Impure yeast supernatants are harvested by filtration and kept at 4°C before further purification.

Various mammalian or insect cell culture systems can be used to express recombinant protein. Baculovirus systems for the production of heterologous proteins

in insect cells is discussed by Luckow and Summers, Bio/Technology, j>, p. 47 (1988). Examples of suitable mammalian host cell lines include the C0S-7 line of monkey kidney cells described by Gluzman (Cell, 2_3, p. 175, 1981), and other cell lines such as

is able to express a suitable vector, includes e.g. L cells, C127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors may comprise non-transcribed elements, such as an origin of replication, a suitable promoter and enhancer linked

to the gene to be expressed, and other 5'- or 3'-flanking, non-transcribed sequences, and 5'- or 3'-non-translated sequences, such as required ribosome binding sites, a polyadenylation site, splice donor and acceptor sites , and transcription termination sequences.

The transcriptional and translational control sequences in expression vectors to be used in the transformation of vertebrate cells can be provided by means of viral sources. E.g. derived commonly used promoters and enhancers from polyoma, adenovirus 2, simian virus 40 (SV40) and human cytomegalovirus. DNA sequences derived from the SV40 virus genome, e.g. SV40 origin, early and late promoter, enhancer, splicing and polyadenylation sites can be used to provide the other genetic elements required for expression of a heterologous DNA sequence. The early and late promoters are particularly useful as both are readily obtained from the virus as a fragment which also contains the origin of replication of SV40 virus (Fiers et al., Nature, 273, p. 113, 1978). Smaller or larger SV40 fragments can also be used, provided that the approximately 250 bp sequence extending from the HindIII site toward the Bgll site located in the viral origin of replication is included. Furthermore, mammalian genome IL-4R promoter, control and/or signal sequences can be used, provided that such control sequences are compatible with the chosen host cell. Further details regarding the use of mammalian high expression vectors for the production of a recombinant mammalian IL-4 receptor are provided in Example 8 below. Exemplary vectors can be constructed as described by Okayama and Berg (Mol. Cell. Biol, _3,

p. 280, 1983).

A useful system for stable high-level expression of mammalian receptor cDNAs in C127 murine mammary epithelial cells can be constructed essentially as described by Cosman et al. (Mol. Immunol., 2_3, p. 935, 1986).

A particularly preferred eukaryotic vector for expression of IL-4R DNA is described below in Example 2. This vector, referred to as pCAV/NOT, was derived from the mammalian high expression vector pDC201 and contains regulatory sequences from SV40, adenovirus-2 and human cytomegalovirus. pCAV/NOT containing a human IL-7 receptor insert has been deposited at the American Type Culture Collection (ATCC) under accession no. 68014.

Purified mammalian IL-4 receptors or analogs are prepared by culturing suitable host and vector systems to express the recombinant translation products of the DNAs of the present invention, which are then purified from the culture media or cell extracts.

E.g. supernatants from systems that secrete recombinant protein into culture media can first be concentrated using a commercially available protein concentration filter, e.g. an "Amicon" or "Millipore Pellicon" ultrafiltration unit. After the concentration step, the concentrate can be applied to a suitable cleaning matrix. E.g. a suitable affinity matrix may comprise an IL-4 or lectin

or antibody molecule bound to a suitable carrier. Alternatively, an anion exchange resin can be used, e.g. a matrix or substrate with pendant diethylaminoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly used in protein purification. Alternatively, a cation exchange step can be used. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred.

Finally, one or more reverse-phase high-performance liquid chromatography steps (RP-HPLC) can be used where hydrophobic RP-HPLC media are used, e.g. silica gel with pendant methyl groups or other aliphatic groups, to further purify an IL-4R preparation. Some or all of the above-mentioned purification steps can also be used in different combinations to provide a homogeneous, recombinant protein.

Recombinant protein produced in bacterial culture is usually isolated by initial extraction from cell pellets, followed by one or more concentration, salting out, aqueous ion exchange or size exclusion chromatography steps. Finally, high-performance liquid chromatography (HPLC) can be used for the final purification steps. Microbe cells used in the expression of recombinant mammalian IL-4R can be disrupted by any suitable method, including alternate freezing and thawing, sonication, mechanical disruption, or the use of cell lysing agents.

Fermentation of yeast expressing mammalian IL-4R as a secreted protein greatly simplifies purification. Secreted recombinant protein resulting from a large-scale fermentation can be purified by methods analogous to those described by Urdal et al. (J. Chromatog., 296, p. 171, 1984). This reference describes two consecutive reverse-phase HPLC steps for the purification of recombinant human IL-2 on a preparative HPLC column.

Human IL-4R synthesized in recombinant culture is characterized by the presence of non-human cell components, including proteins, in amounts and of a nature that depends on the purification steps carried out to recover human IL-4R from the culture. These components will usually be of yeast, prokaryotic or non-human, higher eukaryotic origin and are preferably present in contaminating amounts that are harmless, on the order of less than about 1% by weight. Furthermore, recombinant cell culture enables the production of IL-4R that is free of proteins that may normally be associated with IL-4R as found in nature in its species of origin, e.g. in cells, cell exudates or body fluids. IL-4R preparations are prepared for administration by mixing IL-4R of the desired degree of purity with physiologically acceptable carriers. Such carriers will be non-toxic to recipients at the dosages and concentrations used. Usually, the production of such preparations involves mixing IL-4R with buffers, antioxidants such as ascorbic acid, low molecular weight polypeptides (less than about 10 residues), proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA , glutathione and other stabilizers and additives. IL-4R preparations can be used to regulate the function of B cells. E.g. soluble IL-4R (sIL-4R) inhibits the proliferation of B cell cultures induced by IL-4 in the presence of anti-Ig. sIL-4R also inhibits IL-4-induced IgG1 secretion by LPS-activated B cells, as determined by isotype-specific ELISA, and inhibits IL-4-induced Ia expression on murine B cells, as determined using EPICS analysis. sIL-4R also inhibits IL-4-induced IgE synthesis and can consequently be used to treat IgE-induced reactions with immediate hypersensitivity, such as allergic rhinitis (common high fever), bronchial asthma, atopic dermatitis and gastrointestinal food allergy. IL-4R preparations can also be used to regulate the function of T cells. E.g. IL-4R inhibits IL-4-induced proliferation of T cell lines, such as the CTLL T cell line. sIL-4R also inhibits functional activity mediated by endogenously produced IL-4. E.g. SIL-4R inhibits the generation of allo-reactive cytolytic T lymphocytes (CTL) in secondary mixed leukocyte culture when co-cultured with a monoclonal antibody against IL-2, such as S4B6. Neutralizing agents for both IL-2 and IL-4 are used to inhibit endogenous IL-2 and IL-4, which both regulate CTL generation and are produced in such cultures.

In therapeutic applications, a therapeutically effective amount of an IL-4 receptor preparation is administered to a mammal, preferably a human, together with a pharmaceutical carrier or diluent.

Examples

Example 1

Binding assays for IL-4 receptor

A. Radioactive labeling of IL-4. Recombinant, murine and human IL-4 was expressed in yeast and purified to homogeneity as described by, respectively. Park et al., Proe. Nati. Acad. Sei., USA, 84, p. 5267 (1987) and Park et al., J. Exp. Med., 166,

pp. 476 (1987). The purified protein was radiolabeled using a commercially available "enzymobead" radioiodination reagent. In this procedure, 2.5 µg of rIL-4 in 50 µl of 0.2 M sodium phosphate, pH 7.2, is mixed with 50 µl of Enzymobead reagent, 2 MCi of sodium iodide in 20 µl of 0.05 M sodium phosphate, pH 7.0, and 10 µl 2.5% b-D-glucose. After 10 minutes at 25°C, sodium azide (10 µl of 50 mM) and sodium metabisulfite (10 µl of 5 mg/ml) were added and incubation continued for 5 minutes at 25°C. The reaction mixture was fractionated by gel filtration on a 2 mL volume of "Sephadex" G-25 equilibrated in Roswell Park Memorial Institute (RPMI) 1640 medium containing 2.5% (w/v) bovine serum albumin (BSA), 0.2%

(w/v) sodium azide and 20 mM Hepes pH 7.4 (binding medium). The final amount of <125>I-IL-4 was diluted to a working solution of 2 x 10 - 8 Mi binding medium and stored for up to 1 month at 4°C without detectable loss of receptor binding activity. The specific activity is routinely in the range of 1-2 x 10 cpm/mmol IL-4.

B. Binding to adherent cells. Binding assays performed with cells grown in suspension culture (ie CTLL and CTLL-19.4) were performed using a phthalate oil separation method (Dower et al., J. Immunol., 132, p. 751, 1984) essentially as described by Park et al., J. Biol. Chem., 261,

pp. 4177, 1986 and Park et al., supra. Binding assays were also performed on COS cells transfected with a mammalian expression vector containing cDNA encoding an IL-4 receptor molecule. For Scatchard assay of binding to adherent cells, COS cells were transfected with plasmid DNA using the method of Luthman et al., Nucl. Acids. Res., 11, p. 1295, 1983 and McCutchan et al., J. Nat. Cancer Inst., 41, p. 351, 1968. 8 hours after transfection, cells were trypsinized and re-inoculated into 6-well plates ("Costar") at a density of 1 x 10<4> COS-IL-4 receptor -transfectants/well mixed with 5 x 10 <5>COS control trans-

fissured cells as carriers. Two days later, monolayers were assayed for 5I-IL-4 binding at 4°C essentially by the method described by Park et al., J. Exp. Med., 166, p. 476, 1987. Non- specific binding of <125>I-IL-4 was measured in the presence of a 200-fold or greater molar excess of unlabeled IL-4. Sodium azide (0.2%) was included in all binding assays to inhibit internalization of <125>I-IL-4 by cells at 37°C.

For analysis of binding inhibition of soluble IL-4R, supernatants from COS cells transfected with recombinant IL-4R constructs were harvested three days after transfection. 2-fold serial dilutions of conditioned media were preincubated with 3 x 10~<10> M 12<5>I-IL-4 (with a specific activity of about lx 10<16> cpm/mmol) for 1 hour at 3 7 °C before the addition of 2 x 10^ CTLL cells. Incubation was continued for 30 minutes at 37°C before separation of free and cell-125

bound, murine I-IL-4.

C. Fast-phase binding assays. The ability of IL-4 receptor to be stably adsorbed to nitrocellulose from detergent extracts of CTLL 19.4 cells while still retaining IL-4 binding activity provided a means to monitor purification.

1 ml aliquots of cell extracts (see Example 3), IL-4 affinity column fractions (see Example 4) or other samples are placed on dry BA85/21 nitrocellulose membranes and allowed to dry. The membranes are incubated in tissue culture dishes for 30 min in Tris (0.05 M) buffered saline (0.15 M)

pH 7.5 containing 3% w/v BSA, to block non-specific binding sites. The membrane is then covered with 4 x lO-^ M 125

I-IL-4 in PBS + 3% BSA with or without a 200-fold molar excess of unlabeled IL-4 and incubated for 2 hours at 4°C with shaking. At the end of this time, the membranes are washed 3 times in PBS, dried and placed on "X-0mat"-AR film in

18 hours at -70°C.

Example 2

Selection of CTLL cells with high IL-4 receptor expression by fluorescence-activated cell sorting (FACS)

The preferred cell line for achieving high IL-4 receptor/selection is CTLL, a murine IL-2 dependent cytotoxic T cell line (ATCC TIB 214). To obtain higher levels of IL-4 receptor expression, CTLL cells (progenitor cells) were sorted using fluorescence-activated cell sorting and fluorescein-conjugated recombinant murine IL-4 (rmIL-4) where the extensive attachment of carbohydrate to rmIL-4 of the yeast host is used to take advantage of coupling fluorescein hydrazide to periodate oxidized sugar residues. The fluorescein-conjugated IL-4 was prepared by combining aliquots of hyperglycosylated rmIL-4 (300 µg in 300 µl of 0.1 M citrate phosphate buffer, pH 5.5) with 30 µl of 10 mM sodium m-periodate, freshly prepared in 0.1 M citrate phosphate, pH 5.5, and the mixture was incubated at 4°C for 30 minutes in the dark. The reaction was stopped with 30 µl of 0.1 M glycerol and dialyzed for 18 hours at 4°C against 0.1 M citrate phosphate, pH 5.5. After dialysis, a 1/10 volume of 100 mM 5-(((2-(carbohydrazino)-methyl)thio)acetyl)-aminofluorescein dissolved in DMS0 was added to the sample, and it was incubated at 25°C for 30 minutes. IL-4-fluorescein was then thoroughly dialyzed at 4°C against PBS, pH 7.4, and protein concentration determined by amino acid analysis. The final product was stored at 4°C after addition of 1% (w/v) BSA and sterile filtration. To sort, CTLL cells (5 x 10<6> ) were incubated for 30 min at 37°C in 150 µl PBS + 1% BSA containing 1 x 10 - 9 M IL-4-fluorescein under sterile conditions. The mixture was then cooled to 4°C, washed once in a large volume of PBS + 1% BSA, and sorted using an "EPICS" C flow cytometer. The cells giving the highest fluorescence signal level (top 1.0%) were collected in bulk and the population diluted in liquid cell culture. For single-cell cloning, alternatively, cells exhibiting a fluorescence signal in the top 1.0% were sorted in 96-well tissue culture microtiter plates at 1 cell per well. The course was monitored by doing binding analyzes 12 5 with I-IL-4 after each round of FACS selection. Unsorted CTLL cells (CTLL origin) usually exhibited 1000-2000 IL-4 receptors per cell. cell. CTLL cells were subjected to 19 rounds of FACS selection. The final CTLL cells selected (CTLL-19) exhibited 5 x IO<5> to 1 x IO<6> to IL-4 receptors per cell. At this point, the CTLL-19 population was subjected to "EPICS" C-assisted single cell cloning, and individual clone populations were diluted and tested for <125>I-IL-4 binding. A single clone, designated CTLL-19.4, exhibited 1 x 10<6> IL-4 receptors per cell and was selected for purification and cloning studies. Although the calculated apparent K cl values are similar for the two lines, CTLL-19.4 expresses approximately 400-fold more receptors on its surface than does the CTLL parent.

Example 3

Detergent extraction of CTLL cells

CTLL 19.4 cells were maintained in RPMI 1640 containing 10% fetal calf serum, 50 U/ml penicillin, 50 µg/ml streptomycin and 10 ng/ml recombinant human IL-2. Cells were grown to 5 x 10 5 cells/ml in roller bottles, harvested by centrifugation, washed twice in serum-free DMEM and pelleted at 2000 x g for 10 min to form a packed pellet (approximately 2 x 10 o cells/ml) . To the pellet was added an equal volume of PBS containing 1% "Triton" X-100 and a mixture of protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 10 µM pepstatin, 10 µM leupeptin, 2 mM o-phenanthroline and 2 mM EGTA) . The cells were mixed with the extraction buffer by vigorous vortexing and the mixture incubated on ice for 20 minutes, after which the mixture was centrifuged at 12,000 x g for 20 minutes at 8°C to remove nuclei and other debris. The supernatant was either used immediately or stored at -70°C until use.

Example 4

IL-4 receptor purification using IL-4 affinity chromatography

To obtain sufficient amounts of murine IL-4R to determine the N-terminal sequence or to further characterize human IL-4R, protein obtained from detergent extraction of cells was further purified by affinity chromatography. Recombinant, murine or human IL-4 was coupled to "Affigel"-10 according to the manufacturer's suggestion. To a solution of IL-4 (3.4 mg/ml in 0.4 ml 0.1 M Hepes, pH 7.4) was e.g. added 1.0 ml of washed "Affigel"-10. The solution was shaken overnight at 4°C, and an aliquot of the supernatant was tested for protein using a "BioRad" protein assay according to the manufacturer's instructions using BSA as a standard. More than 95% of the protein had been coupled to the gel, indicating that the column had a final charge of 1.3 mg of IL-4 per ml of gel. Glycine ethyl ester was added to a final concentration of 0.05 M to block any unreacted sites on the gel. The gel was washed thoroughly with PBS-1% "Triton" followed by 0.1 glycine-HCl, pH 3.0. A 0.8 x 4.0 cm column was prepared with IL-4-coupled "Affigel" prepared as described (4.0 ml pack volume) and washed with PBS containing 1% "Triton" X-100 for purification of murine IL- 4R. Alternatively, 50 µl aliquots of a 20% suspension of IL-4-linked "Affigel" were incubated with <35>S-cysteine/methionine-labeled cell extracts for small-scale affinity purifications and gel electrophoresis.

Aliquots (25 ml) of detergent-extracted IL-4 receptor bearing CTLL 19.4 cells were slowly added to the murine IL-4 affinity column at 4°C (flow rate at 3.0 ml/hr). The column was then washed sequentially with PBS containing 1% "Triton" X-100, RIPA buffer (0.05 M Tris, 0.15 M NaCl, 1% NP-40, 1% deoxycholate and 0.1% SDS) , PBS containing 0.1% "Triton" X-100 and 10 mM ATP, and PBS with 1% "Triton" X-100 to remove all contaminating material except mIL-4R. The column was then eluted with pH 3.0 glycine-HCl buffer containing 0.1% "Triton" X-100 to remove IL-4R, and then washed with PBS containing 0.1%

"Triton" X-100. Fractions of 1 ml were collected for elution, and fractions of 2 ml were collected during washing. Immediately after elution, samples were neutralized with 80 µl of 1 M Hepes, pH 7.4. The presence of receptor in the fractions was demonstrated using the solid-phase binding assay

125

as described above using I-labeled IL-4. Aliquots were removed from each fraction for analysis by SDS-PAGE and the remainder frozen at -70°C until use. For SDS-PAGE, 40 µl of each column fraction was added to 40 µl of 2 X SDS sample buffer (0.125 M Tris HCl, pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol). The samples were placed in a boiling water bath for 3 minutes and 80 µl aliquots added to sample wells of a 10% polyacrylamide gel set up and run according to the method of Laemmli (Nature, 227, p. 680, 1970). After electrophoresis, gels were silver stained as previously described by Urdal et al. (Proe. Nati. Acad. Sei., USA, 81, p. 6481, 1984).

Purification by the above method enabled identification by silver staining of polyacrylamide gels of two mIL-4R protein bands averaging 45-55 kDa and 30-40 kDa which were present in fractions exhibiting IL-4 binding activity. Experiments in which the cell surface proteins on CTLL-19.4 cells were radioactively labeled and 125 I-labeled receptor was purified by affinity chromatography indicated that these two proteins were expressed on the cell surface. The ratio of the lower and higher molecular weight bands increased after storage of fractions at 4°C, suggesting a precursor product relationship, possibly due to slow proteolytic degradation. The mIL-4 receptor protein purified by the above method remains capable of binding IL-4, both in solution and when adsorbed to nitrocellulose.

Example 5

Sequencing of IL-4 receptor protein

CTLL 19.4 mIL-4 receptor containing fractions from the mIL-4 affinity column purification were prepared for amino-terminal protein sequence analysis by fractionation on an SDS-PAGE gel and then transferred to a PVDF membrane. Before the protein fractions were sent on polyacrylamide gels, it was first necessary to remove residual detergent from the affinity purification process. Fractions containing proteins bound to the mIL-4 affinity column from three preparations were thawed and concentrated separately in a speed vac under vacuum to a final volume of 1 ml. The concentrated fractions were then adjusted to pH 2 by the addition of 50% (v/v) TFA and injected onto a Brownlees RP-300 reverse-phase HPLC column (2.1 x 30 mm) equilibrated with 0.1 % (v/v) TFA in 1^0 at a flow rate of 200 µl/min on a "Hewlett Packard" model 1090M HPLC. The column was washed with 0.1% TFA in H 2 O for 20 minutes after injection. The HPLC column containing the bound protein was then developed with a gradient as follows:

Fractions of 1 ml were collected every five minutes and analyzed for the presence of protein by SDS-PAGE followed by silver staining.

Each fraction from the HPLC run was evaporated to dryness in a speed vac and then resuspended in Laemmli reducing sample buffer, prepared as described by Laemmli, U.K. Nature, 227, p. 680, 1970. Samples were loaded onto a 5-20% gradient Laemmli SDS gel and run at 45 niA until the dye front reached the bottom of the gel. The gel was then transferred to PVDF paper and stained as described by Matsudaira,

J. Biol. Chem., 262, pp. 10035, 1987. Colored bands were clearly identified in fractions from each of the three preparations at about 30,000 to 40,000 Mr.

The bands from the previous PVDF blot were excised and subjected to automated Edman digestion on an Applied Biosystems model 477A protein sequencer essentially as described by Maren et al. (Nature, 315, p. 641, 1985), except that PTH amino acids were injected automatically and analyzed on a coupled Applied Biosystems Model 120A HPLC using a gradient and detection system supplied by the manufacturer. The following amino-terminal sequence was determined from the sequencing results: NH 2 -Ile-Lys-Val-Leu-Gly-Glu-Pro-Thr-Cys/Asn-Phe-Ser-Asp-Tyr-Ile. The bands from the second preparation used for amino-end sequencing were treated with CNBr using the in situ technique described by March et al. (Nature, 315, p. 641, 1985) to cleave the protein for internal methionine residues. Sequencing of the resulting cleavage products yielded the following data, indicating that CNBr cleaved the protein after two internal methionine residues:

Compared to the protein sequences derived from clones 16 and 18 (see Figure 2), the sequences matched as follows:

Identical counterparts were found for all positions in sequence 1, except Asn(2) and sequence 2, except Arg in positions 8, 10 and 12, Ser in position 13 and Leu in position 16. The above sequences correspond to amino acid residues 137-154 and 169-187 in Figure 2.

In addition, the amino-terminal sequence matched a sequence derived from the clone, with position 9 defined as a Cys residue.

The above data support the conclusion that clones 16 and 18 are derived from the message for the IL-4 receptor.

Example 6

Synthesis of hybrid subtracted cDNA probe

To screen a library for clones encoding a murine IL-4 receptor, a highly enriched IL-4 receptor cDNA probe was obtained using a subtraction hybridization strategy. Polyadenylated (polyA<+>) mRNA was isolated from two identical cell lines, the parent cell line CTLL

(expressing approximately 2,000 receptors per cell) and the sorted cell line CTLL 19.4 (expressing 1 x 10<6> receptors per cell). The mRNA content of these two cell lines is believed to be identical except for the relative level of IL-4 receptor mRNA. A radiolabeled, single-stranded cDNA preparation was then made from mRNA from the sorted cell line CTLL 19.4 by reverse transcription of polyadenylated mRNA from CTLL 19.4 cells using a method similar to that described by Maniatis et al., Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory, New York, 1982). Briefly, polyA<+->mRNA was purified as described by March et al. (Nature, 315, pp. 641-647, 1985) and

copied into cDNA by reverse transcriptase using oligo-dT as a primer. To achieve a high level 32 32

of P-labeling of cDNA, 100 µCi P-dCTP (s.a. = 3000 Ci/mmol) was used in a 50 µl reaction mixture with non-radioactive dCTP at 10 µM. After reverse transcription at 42°C for 2 h, EDTA was added to 20 mM, and the RNA was hydrolyzed by adding NaOH to 0.2 M and incubating the cDNA mixture at 68°C for 20 min. The single-stranded cDNA was extracted with a 50/50 mixture of phenol and chloroform previously equilibrated with 10 mM Tris-Cl, 1 mM EDTA. The water phase was transferred to a clean tube and made alkaline again by addition of NaOH to 0.5 M. The cDNA was then size fractionated by chromatography on a 6 ml "Sephadex" G50 column in 30 mM NaOH and 1 mM EDTA to remove impurities with low molecular weight.

The resulting size-fractionated cDNA generated from the sorted CTLL 19.4 cells was then hybridized with an excess of mRNA from the unsorted parent CTLL cells by ethanol precipitation of cDNA from CTLL 19.4 cells with 30 µg of polyA+ mRNA isolated from unsorted CTLL -cells, resuspended in 16 µl 0.25 M NaPO 4 , pH 6.8, 0.2% SDS, 2 mM

EDTA and incubation for 20 hours at 68°C. The cDNAs from the sorted CTLL 19.4 cells that are complementary to mRNAs from the unsorted CTLL cells form double-stranded cDNA/mRNA hybrids that can then be separated from the single-stranded cDNA

based on their different binding affinities on hydroxyapatite. The mixture was diluted with 30 volumes of 0.02 M NaPO 3 , pH 6.8, bound to hydroxyapatite at room temperature, and single-stranded cDNA was then eluted from the resin with 0.12 M NaPO 3 , pH 6.8, at 60° C, as described by Sims et al., Nature, 312, p. 541, 1984. Phosphate buffer was then removed by centrifugation over 2 ml "Sephadex" G50 spin columns in water. This hybrid subtraction procedure removes the bulk of common sequences in CTLL 19.4 and unsorted CTLL cells and leaves a single-stranded cDNA pool enriched for radiolabeled IL-4 receptor cDNA that can be used to screen a cDNA library (as described down-

under).

Example 7

cDNA library synthesis and plaque screening

A cDNA library was constructed from polyadenylated mRNA isolated from CTLL 19.4 cells using standard techniques (Gubler et al., Gene, 25_, p. 263, 1983; Ausubel et al., eds., Current Protocols in Molecular Biology, Vol. 1, 1987). After reverse transcription using oligo-dT as a primer, the single-stranded cDNA was made double-stranded with DNA polymerase I, blunt-ended with T4 DNA polymerase, methylated with EcoRI methylase to protect EcoRI cleavage sites within the cDNA, and ligated to EcoRI linkers. The resulting constructs were digested with EcoRI to remove all but one copy of the linkers at each end of the cDNA, ligated to an equimolar concentration of EcoRI cut and dephosphorylated "AZAP" arms, and the resulting ligation mixture packaged in vitro ( "Gigapack") according to the manufacturer's instructions. Other suitable methods and reagents for generating cDNA libraries in A phage vectors are described by Huynh et al., DNA Cloning Techniques: A Practical Approach, IRL Press, Oxford (1984), Meissner et al., Proe. Nati. Acad. Sei., USA, j34_, p. 4171

(1987) and Ausubel et al., supra. "AZAP" is a phage A cloning vector similar to Agt11 (US Patent 4,788,135) containing plasmid sequences from pUC19 (Norrander et al., Gene, 26, 101, 1987), a polylinker site located in a lacZ gene- fragment and a fl phage origin of replication that enables recovery of ssDNA when host bacteria are super-infected with fl helper phage. The DNA is excised in the form of a plasmid comprising the above-mentioned elements, termed "Bluescript". "Gigapack" is an ultrasonically treated E. coli extract used for packaging A-phage DNA.

The radiolabeled hybrid subtracted cDNA from Example 6 was then used as a probe to screen the cDNA library. The amplified library was plated onto BB4 cells at a density of 25,000 plaques in each of 20 150 mm plates and incubated overnight at 37°C. All manipulations of "AZAP" and excision of the "Bluescripf" plasmid were as described by Short et al., (Nucl. Acids Res., 16, pp. 7583, 1988) and Stratagene product literature. Plaque blotting filters in duplicate were incubated with hybrid subtracted cDNA probes from Example 6 in hybridization buffer containing 50% formamide, 5X SSC, 5X Denhardt's reagent and 10% dextran sulfate at 42°C for 48 hours as described by Wahl et al., Proe . Nati. Acad. Sci., USA, 76, p. 3683, 1979. Filters were then washed at 68°C in 0.2 X SSC. 16 positive plaques were purified for further analysis. "Bluescript" plasmids containing the cDNA inserts were excised from the phage as described by the manufacturer and transformed into E. coli. Plasmid DNA was isolated from single colonies, resolved with EcoRI to release the cDNA inserts and electrophoresed on standard 1% agarose gels. Four duplicate gels were blotted onto nylon filters to prepare identical Southern blots for analysis with different probes that were (1) radiolabeled cDNA from unsorted CTLL cells, (2) radiolabeled cDNA from CTLL 19.4 sorted cells, (3) hybrid subtracted cDNA from CTLL 19.4 sorted cells and (4) hybrid subtracted cDNA from CTLL 19.4 sorted cells after a second round of hybridization to polyA<+->mRNA from an IL-4 receptor-negative mouse cell line (LBRM 33 1A5B6). These probes were increasingly enriched for cDNA copies of mRNA specific for the sorted cell line CTLL 19.4. Of the 16 positive plaques isolated from the library, four clones (11A, 14, 16 and 18) showed a parallel increase in signal strength with enrichment of the probe.

Restriction mapping (shown in Figure 1) and DNA sequencing of the isolated CTLL clones indicated the existence of at least two distinct mRNA populations. Both mRNA types have homologous open reading frames over most of the coding region, but differ from each other at the 3' end and thus encode homologous proteins with different C00H end sequences. DNA sequence from within the open reading frames of both clones encodes protein sequence identical to protein sequence derived from sequencing of the purified IL-4 receptor described in more detail in Example 5. Clone 16 and clone 18 were used as the prototypes of these two distinct message types . Clone 16 contains an open reading frame encoding a 25 8-amino acid polypeptide comprising amino acids -25 to 233 of Figure 2A. Clone 18 codes for a 230-amino acid polypeptide of which the N-terminal 224 amino acids are identical to the N-end in clone 16, but differ at the 3' end with nucleotides CCAAGTAATGAAAATCTG which codes for the C-terminal 6 amino acids, Pro-Ser -Asn-Glu-Asn-Leu, followed by a termination codon TGA. Both clones were expressed in a mammalian expression system as described in Example 8.

Example 8

Expression of IL-4R in mammalian cells

A. Expression in COS-7 cells. A eukaryotic expression vector pCAV/NOT, shown in Figure 3, was derived from the high-expression mammalian vector pDC201 described by Sims et al., Science, 241, p. 585, 1988). pDC201 is a derivative of pMLSV previously described by Cosman et al., Nature, 312, p. 768, 1984. pCAV/NOT is designed to express cDNA sequences inserted into its multiple cloning site (MCS) when transfected into mammalian cells , and comprises the following components: SV40 (shaded box) contains SV40 sequences from coordinates 5171-270 including the origin of replication, the "enhancer" sequences and the early and late promoters. The fragment is oriented so that the direction of transcription from the early promoter is shown by the arrow. CMV contains the promoter and enhancer regions of human cytomegalovirus (nucleotides -671 to +7 of the sequence published by Boshart et al., Cell, 4_1, pp. 521-530, 1985). The tripartite leader (dashed box) contains the first exon and part of the intron between the first and second exons of the adenovirus-2 tripartite leader, the second exon and part of the third exon of the tripartite leader and a multiple cloning site (MCS) containing the sites for Xhol, Kpnl, Smal, Noti and Bglll. pA (shaded box) contains the SV40 sequences from 4127-4100 and 2770-2533 that comprise the polyadenylation and termination signals for early transcription. Clockwise from pA are the adenovirus-2 sequences 10532-11156 containing the VAI and VAII genes (indicated by black bars), followed by the pBR322 sequences (solid line) from 4363-2486 and 1094-375 containing the ampicillin resistance gene and the origin of replication. The resulting expression vector was designated pCAV/NOT.

The inserts in clone 16 and clone 18 were both released from "Bluescript" plasmid by digestion with Asp718 and Noti. The 3.5 kb insert from clone 16 was then ligated directly into the expression vector pCAV/NOT, also cut in Asp718-

and the Notl seats in the polylinker region. The insert from clone 18 was blunt-ended with T4 polymerase followed by ligation into the vector pCAV/NOT, cut with SmaI and dephosphorylated.

Plasmid DNA from both IL-4 receptor expression plasmids was used to transfect a subconfluent layer of monkey COS-7 cells using DEAE-dextran followed by chlorquine treatment, as described by Luthman et al. (Nucl. Acids Res., 11, p. 1295, 1983) and McCutchan et al. (J. Nat. Cancer Inst., 4_1, p. 351, 1968). The cells were then grown in culture for three days to allow transient expression of the inserted sequences. After three days, cell culture supernatants and cell monolayers were analyzed (as described in Example 1), and IL-4 binding was confirmed.

B. Expression in CHO cells. IL-4R was also expressed

in the mammalian CHO cell line by first ligating an Asp718/NotI restriction fragment from clone 18 into the pCAV/NOT vector as described in Example 8. The pCAV/NOT vector containing the insert from clone 18 was then co-transfected using by a standard calcium phosphate method in CHO cells with the dihydrofolate reductase (DHFR) cDNA selectable marker under the control of the SV40 early promoter. The DHFR sequence enables methotrexate selection for mammalian cells containing the plasmid. DHFR sequence amplification events in such cells were selected using elevated methotrexate concentrations. In this way is also amplified

the adjacent DNA sequences, and enhanced expression is thus achieved. Bulk cell cultures of the transfectants actively secreted soluble IL-4R at approximately 100 ng/ml.

C. Expression in HeLa cells. IL-4R was expressed in the human HeLa-EBNA cell line 653-6 which expresses EBV core antigen-1 constitutively driven from the CMV immediate-early enhancer/promoter. The expression vector used was pHAV-EO-NEO described by Dower et al., J. Immunol., 142, p. 4314, 1989), a derivative of pDC201 which contains the EBV origin of replication and which enables high-level expression in 653-6 - the cell line. pHAV-EO-NEO is derived from pDC201 by replacing the major adenovirus late promoter with synthetic sequences from HIV-1 extending from -148 to +78 relative to the cap site of viral mRNA, and comprising the HIV-1-tat- the gene under the control of the SV40 early promoter. It also contains a BglII-SmaI fragment containing the neomycin resistance gene in pSV2NE0 (Southern & Berg, J. Mol. Appl. Genet., 1, p. 332, 1982) inserted into the BglII and HpaI sites and subcloning downstream from the SalI the cloning site. The resulting vector enables selection of transfected cells for neomycin resistance.

A 760 bp IL-4R fragment was released from the "Bluescript" plasmid by digestion with EcoNI and SSt1 restriction enzymes. This fragment of clone 18 corresponds to nucleotides 1-672 in Figure 2A with the addition of a 5<*-> end nucleotide sequence GTGCAGGCACCTTTTGTGTCCCCA, a TGA stop codon following nucleotide 672 in Figure 2A, and a 3' end nucleotide sequence CTGAGTGACCTTGGGGGCTGCGGTGGTGAGGAGAGCT. This fragment was then blunt-ended using T4 polymerase and subcloned into the SalI site of pHAV-EO-NEO. The resulting plasmid was then transfected into the 653-6 cell line using a modified polybrene transfection method as described by Dower et al. (J. Immunol., 142,

pp. 4314, 1989), except that the cells were trypsinized 2 days after transfection and split at a ratio of 1:8 in medium containing G418 at a concentration of 1 mg/ml. Culture media were changed twice weekly until neo-

mycin-resistant colonies had been established. Colonies were so

either picked out individually using cloning rings, or pooled together to produce several different cell lines. These cell lines were maintained under drug selection at

a G418 concentration of 250 ug/ml. After the cells reached confluency, supernatants were collected and tested in the inhibition assay according to Example IB. The cell lines produced from 100 ng/ml to 600 ng/ml soluble IL-4R protein.

Example 9

Expression of IL-4R in yeast cells

For expression of mIL-4R, a yeast expression vector derived from pIXY120 was constructed as follows. pIXY120 is identical to pYaHuGm (ATCC 53157), except that it contains no cDNA insert and comprises a polylinker/multiple cloning site with an NcoI site. This vector comprises DNA sequences from the following sources: (1) a large SphI (nucleotide 562) to EcoRI (nucleotide 4361) fragment excised from plasmid pBR3 22 (ATCC 3 7017) comprising the origin of replication and the ampicillin resistance marker for selection in E .coli; (2) S. cerevisiae DNA comprising the TRP-1 marker, 2 u origin of replication, ADH2 promoter; and (3) DNA encoding a signal peptide of 85 amino acids derived from the gene encoding the secreted peptide-a-

factor (see US Patent No. 4,546,082). An Asp718 restriction site was introduced at position 237 in the α-factor signal peptide to facilitate fusion to heterologous genes.

This was accomplished by changing the thymidine residue in nucleotide 241 to a cytosine residue by oligonucleotide-directed in vitro mutagenesis as described by Craik, BioTechniques, January 1985, pp. 12-19. A synthetic oligonucleotide containing multiple cloning sites and with the following sequence was inserted from the Asp718 site in amino acid 79 near the 3' end of the oc factor signal peptide to a SpeI site in the 2 u sequence:

PBC120 also differs from pYaHuGM by the presence of a 514 bp DNA fragment derived from single-stranded phage fl containing the origin of replication and the intergenic region, which has been inserted into the Nrul site of the pBR322 sequence. The presence of an fl origin of replication enables the generation of single-stranded DNA copies of the vector when transformed into appropriate strains of E. coli and super-infected with bacteriophage fl, facilitating DNA sequencing of the vector and providing a basis for in vitro mutagenesis. To insert a cDNA, pIXY120 is digested with Asp718 cleaving near the 3<1> end of the α-factor leader peptide (nucleotide 237), and e.g. BamHI which cleaves the polylinker. The large vector fragment is then purified and ligated to a DNA fragment that codes for the protein to be expressed. To create a secretion vector for expression of mIL-4R, a cDNA fragment encoding mIL-4R was excised from the "Bluescripf plasmid of Example 8 by digestion with Ppuml and Bglll to release an 831 bp fragment from Ppuml- site (see figure) to a Bglll site located 3' to the open reading frame containing the mIL-4R sequence minus the first two 5' codons encoding Ile and Lys. pIXY120 was resolved with Asp718 near 3<1 ->end of the α-factor leader and BamHI The vector fragment was ligated to the Ppuml/Bglll hIL-4R cDNA fragment and the following fragment created by "annealing" a pair of synthetic oligonucleotides to recreate the last 6 amino acids of α-factor -the leader and the first two amino acids in fully finished mIL-4R.

The oligonucleotide also comprises a change from the nucleotide sequence TGG ATA to CTA GAT which introduces an XbaI restriction site without changing the amino acid sequence for which it is encoded.

The above expression vector was then purified and used to transform a diploid yeast strain of S. cerevisiae (XV2181) using standard techniques, such as those described in EPA 165,654, which select for tryptophan prototrophs. The resulting transformants were cultured for expression of a secreted mIL-4R protein. Cultures to be analyzed for biological activity were grown in 20-50 ml of YPD medium (1% yeast extract, 2% peptone,

1% glucose) at 37 o C until a cell density of 1-5 x 10<8 >cells/ml. To separate cells from medium, cells were removed by centrifugation, and the medium was filtered through a 0.45 µm cellulose acetate filter before analysis. Supernatants prepared using the transformed yeast strain, or crude extracts prepared from disrupted yeast cells transformed with the plasmid, were analyzed to confirm expression of a biologically active protein.

Example 10

Isolation of full-length and truncated forms of murine IL-4 receptor cDNAs from unsorted 7B9 cells

Polyadenylated RNA was isolated from 7B9 cells, an antigen-dependent helper T cell clone derived from C57Bl/6 mice, and used to construct a cDNA library in AZAP, as described in Example 7. The AZAP library was amplified one times, and a total of 300,000 plaques were screened as described in Example 7, with the exception that the probe was an arbitrarily primed <32>P-labeled 700 bp EcoRI fragment isolated from CTLL 19.4 clone 16. 13 clones were isolated and characterized by restriction analysis.

Nucleic acid sequence analysis of clone 7B9-2 revealed that it contains a polyadenylated tail, a putative polyadenylation signal and an open reading frame of 810 amino acids (shown in Figure 2), the first 258 of which are identical to those encoded by CTLL 19.4 clone 16, including the putative signal peptide sequence of 25 amino acids. 7B9-2 cDNA was subcloned into the eukaryotic expression vector pCAV/NOT, and the resulting plasmid was transfected into COS-7 cells as described in Example 8. COS-7 transfectants were analyzed as indicated in Example 12.

A second cDNA form similar to clone 18 in the CTLL 19.4 library was isolated from the 7B9 library and subjected to sequence analysis. This cDNA, clone 7B9-4, is 376 bp shorter than clone 7B9-2 at the 5' end and lacks the first 47 amino acids encoded by 7B9-2, but encodes the remaining N-terminal amino acids 23-199 (Figure 2). At position 200, clone 7B9-4 (like clone 18 from CTLL 19.4) has a 114 bp insertion that changes the amino acid sequence to Pro Ser Asn Glu Asn Leu, followed by a termination codon. The 114 bp inserts found in both clone 7B9-4 and CTLL 19.4 clone 18 have an identical nucleic acid sequence. The fact that this cDNA form, which produces a secreted form of the IL-4 receptor when expressed in COS-7 cells, was isolated from these two different cell lines indicates that it is neither a cloned artifact nor a mutant form that is distinctive for the sorted CTLL cells.

Example 11

Isolation of human IL-4 receptor cDNAs from PBL and T22 libraries by cross-species hybridization

Polyadenylated RNA was isolated from pooled human peripheral blood lymphocytes (PBL) obtained by standard Ficoll purification, cultured in IL-2 for 6 days followed by stimulation with PMA and Con-A for 8 hours. An oligo-dT-primed cDNA library was constructed in AgtlO using techniques described in Example 7. A probe was prepared by synthesizing an unlabeled RNA transcript of the 7B9-4 cDNA insert using T7 RNA- polymerase, followed by 3 2 P-labeled cDNA synthesis with reverse transcriptase using arbitrary primers. This murine single-stranded cDNA probe was used to screen 50,000 plaques from the human cDNA library in 50% formamide/0.4 M NaCl at 42°C, followed by washing in 2 X SSC at 55°C. Three positive plaques were purified and the EcoRI inserts were subcloned into the Bluescripf plasmid vector. Nucleic acid sequencing of a portion of clone PBL-1, a 3.4 kb cDNA, indicated that the clone was approximately 67% homologous to the corresponding sequence in the murine IL-4 receptor However, a 68 bp insert containing a termination codon and bearing no homology to the mouse IL-4 receptor clones was found 45 amino acids downstream of the predicted N-terminus in the full-length protein , suggesting that clone PBL-1 encodes a nonfunctional, truncated form of the receptor.Nine additional human PBL clones were obtained by screening the

32

same library (under stringent conditions) with a P-labeled, arbitrarily primed probe made from clone PBL-1 (the 3.4 kb EcoRI cDNA insert). Two of these clones, PBL-11 and PBL-5, encompassed the 5' region containing it

68 bp insert in PBL-1, but lacked the 68 bp insert and does not fully extend into 3*, as evidenced by its size and thus precludes functional analysis using mammalian expression. To obtain a construct expressible in COS-7 cells, the 5' NotI-HincII fragment of clones PBL-11 and PBL-5 was separately ligated to the 3' HincII-BamHI end of clone PBL-1 and subcloned into the pCAV/NOT expression vector cut with Noti and Bglll described in Example 8. These chimeric human IL-4R cDNAs containing PBL-11/PBL-1 and PBL-5/PBL-1 DNA sequences , have been called respectively clone A5 and clone B4 as further described in Example 12. These constructs were transfected into COS-7 cells and analyzed for IL-4 binding in a plate binding assay essentially as described in Sims et al. (Science, 241, p. 585, 1988). Both composite constructs encoded protein that exhibited IL-4 binding activity. The nucleotide sequence and the predicted amino acid sequence of the assembled A5 construct correspond to the sequence information set forth in Figures 4A-4C, with the exception that a GTC codon encodes the amino acid Val at position 50

instead of Ile. No other clones that were sequenced contained this change. The consensus codon from clones PBL-1,

50

However, PBL-5 and T22-8 are ATC and encode Ile, as indicated in Figure 4A. The nucleotide and predicted amino acid sequence in the composite B4 construct also shows that the 25 amino acid leader sequence in PBL-11 is replaced by the sequence Met-Gln-Lys-Asp-Ala-Arg-Arg-Glu-Gly-Asn.

Constructs expressing a soluble form of the human IL-4 receptor were made by excising a 5'-terminal 0.8 kb SmaI-DraIII fragment from PBL-5 and the corresponding 0.8 kb Asp718-DraIII- fragment from PBL-11, of which the DralII overhangs were blunt-ended with T4 polymerase. The PBL-5 and PBL-ll fragments were separately subcloned into CAV/NOT cut with resp. Smal or Asp718 plus Smal; these are called respectively soluble hIL-4R-5 and soluble hIL-4R-11.

A second library made from a CD4+/CD8- human T-cell clone, T22, (Acres et al., J. Immunol., 138, p. 2132, 1987) was screened (using filters in duplicate) with two different probes synthesized as described above. The first probe was obtained from a 220 bp PvuII fragment from the 5' end in clone PBL-1, and the second probe was obtained from a 300 bp PvuII-EcoRI fragment from the 3' end in clone PBL-1. Five additional cDNA clones were identified using these two probes. Two of these clones spanned the 5' region containing the 6 8 bp insert, but neither contained the insert. The third of these clones, T22-8, was approximately 3.6 kb in size and contained an open reading frame of 825 amino acids, including a leader sequence of 25 amino acids, a complete external region of 207 amino acids, a transmembrane region of 24 amino acids, and a cytoplasmic region of 569 amino acids. The sequence of clone T22-8 is shown in Figures 4A-4C. Figures 5A-5B compare the predicted human IL-4R amino acid sequence with the predicted murine IL-4R sequence and show approximately 53% sequence identity between the two proteins.

Example 12

Analysis and purification of IL-4 receptor in COS transfectants

Equilibrium binding studies were performed for COS cells transfected with murine IL-4 receptor clones 16 and 18 from the CTLL 19.4 library. In all cases, analysis of the data in the Scatchard coordinate system (Scatchard, Ann. N.Y. Acad. Sei., 5_1, pp. 660-672, 1949) gave a straight line, indicating a single class of high affinity receptors for murine IL-4. For COS pCAV-16 cells, the calculated, to-9 -1 was 5

visible K& 3.6 x 10 M with 5.9 x 10 specific binding seats per cell. A similar apparent K became

9-1 a calculated for COS pCAV-18 cells at 1.5 x 10 M , but receptor number expressed on the cell surface was 4.2 x 10<4>. Equilibrium binding studies performed on COS cells transfected with IL-4R DNA clones isolated from the 7B9 cell library also showed high affinity binding of the receptor to IL-4. Specifically, studies using COS cells transfected with pCAV-7B9-2 showed that the full-length murine IL-4 receptor bound <125>I-IL-4 with an apparent K& of approx. 1.4 x 10"^ M ^ with 4.5 x 10<4> specific binding sites per cell. The apparent K for CAV-7B9-4 IL-4R was calculated to be approximately 1.7 x 10 9 M - 1. Although absolute values of K clog binding sites per cell were different for the transfections, the binding affinities were generally similar (1 x 10^ - 1 x 10"*"° M "*") and fit well with previously published affinity constants for IL-4 binding.

125

Inhibition of I-mIL-4 binding to CTLL cells by conditioned media from COS cells transfected with plasmid pCAV, pCAV-18, or pCAV-7B9-4 was used to determine whether these cDNAs encoded functional , soluble receptor molecules. Approximately 1.5 µl of COS pCAV-18 conditioned medium in a final assay volume of 150 µl provides approximately 50% inhibition of <125>I-IL-4 binding to the IL-4 receptor on CTLL cells. <125> I-IL-4 receptor-competitive activity is not detected in control pCAV-transfected COS supernatants. From quantitative analysis of the dilution of pCAV-18 supernatant required to inhibit <1>25I-IL-4 binding by 50%, it is estimated that approximately 60-100 ng/ml of soluble IL-4 receptor has been secreted by COS -cells harvested three days after transfection. Similar results were obtained using supernatants from COS cells transfected with pCAV-7B9-4.

Conditioned medium from COS cells transfected with pCAV-18 or pCAV-7B9-4 (see Example 8) and grown in DMEM containing 3% FBS was harvested three days after transfection. Supernatants were centrifuged at 3,000 cpm for 10 minutes and frozen until needed. 200 ml of conditioned medium was loaded onto a column containing 4 ml of muIL-4 "Affigel" prepared as described above. The column was washed thoroughly with PBS and IL-4 receptor eluted with 0.1 M glycine, and 0.15 M NaCl, pH 3.0. Immediately after elution, samples were neutralized with 80 µl of 1 M Hepes, pH 7.4. Samples were tested for their ability to inhibit

125

binding of I-muIL-4 to CTLL cells as indicated in Example IB. Additional samples were tested for purity by analysis on SDS-PAGE and silver staining as previously described. Alternative methods for testing activity of functional, soluble receptor or inhibition of IL-4 binding include solid-phase binding assays as described in example 1C, or other similar cell-free assays where either radioactive iodinated or colorimetrically developed IL-4 can be used binding, such as RIA or ELISA. The protein analyzed by SDS-PAGE under reducing conditions has a molecular weight of about 37,500 and appears to be about 90% pure by silver staining of gels.

Purified recombinant soluble murine IL-4 receptor protein can also be tested for ability to inhibit IL-4-induced <3>H-thymidine incorporation in CTLL cells. According to such methods, soluble IL-4 receptor has been found to block IL-4-stimulated proliferation but does not affect IL-2-driven mitogen response.

Molecular weight estimates were performed on mIL-4 receptor clones transfected into COS cells. Using M2 monoclonal antibody raised against murine CTLL 19.4 cells (see Example 13), IL-4 receptor is immunoprecipitated from COS cells transfected with CAV-16, CAV-7B9-2 and CAB-7B9-4 and

35 35 labeled with S-cysteine and S-methionine. Cell-associated receptor from CAV-7B9-4 shows molecular weight heterogeneity ranging from 32-39 kDa. Secreted CAV-7B9-4 receptor has a molecular weight between 36 and 41 kDa. Cell-associated receptor from CAV-16-transfected COS cells is approx. 40-41 kDa. This is significantly less than molecular weight calculations from cross-linking studies described by Park et al., J. Exp. Med., 166, p. 476, 1987, J. Cell. Biol., Suppl., 12A, 1988. Immunoprecipitation of COS-CAV-7B9-2 cell-associated receptor showed a molecular weight of 130-140 kDa similar to the estimates of Park et al., J. Cell. Biol., Suppl. 12A, 1988, calculated to be the full-length IL-4 receptor. Similar molecular weight estimates of cell-associated CAV-16 and CAV-7B9-2 IL-4 receptor have also been made based on cross-linking of 125 IL-4 to COS cells transfected with these cDNAs. Heterogeneity of molecular weight in the individual clones can be partially attributed to glycosylation. These data, together with DNA sequence analysis, suggest that the 7B9-2 cDNA encodes the full-length cell surface IL-4 receptor, whereas both 7B9-4 and clone 18 constitute soluble forms of the murine IL-4 receptor .

Receptor characterization studies were also done on COS cells transfected with hIL-4R containing expression plasmids. The two chimeric human IL-4R molecules A5 and B4 (defined in Example 11) were transfected into COS cells and equilibrium studies performed. The COS monkey cell itself has receptors capable of binding hIL-4; therefore, the binding calculations performed on COS cells transfected with and overexpressing hIL-4R cDNAs represent background binding from endogenous monkey IL-4R molecules subtracted from total binding. COS cells transfected with hIL-4R-A5 had 5.3 x 10 hIL-4 binding sites with a calculated K of

9-1

3.4 8 x 10 M . Similarly, hIL-4R-B4 expressed in COS cells bound <125>I-hIL-4 with an affinity of 3.94 x 109 M*"1

4

and showed 3.2 x 10 receptors per cell.

Molecular weight estimates of human IL-4R expressed in COS cells were also performed. COS cells transfected with clones A5 or B4 in pCAV/NOT were labeled with <35>S-cysteine/methionine and lysed. Human IL-4R was affinity purified from the resulting lysates with hIL-4-linked "Affigel" (as described in Example 4). hIL-4R-A5 and -B4 eluted from this affinity carrier migrated at ca. 140,000 daltons on SDS-PAGE, which is in good agreement with previous estimates of hIL-4R molecular weight upon cross-linking (Park et al., J. Exp. Med. 166, p. 476, 1987), as well as with estimates of full- full-length mIL-4R as indicated herein.

As no soluble human IL-4R cDNA has so far been found to occur naturally as was the case with the murine receptor (clones 18 and 7B9-4), a truncated form was constructed as described in Example 11. After expression in COS cells supernatants were harvested three days after transfection with soluble hIL-4R-11 and soluble hIL-4R-5 and tested for inhibition of 12<5>I-hIL-4 binding to the human B cell line Raji. Supernatants from two of the soluble hIL-4R-11 and one of the soluble hIL-4R-5 transfected plates contained 29-149 ng/ml IL-4R competitive activity in the medium. In addition, the truncated protein could be detected in <35>S-methionine/cysteine-labeled COS cell transfectants by affinity purification on hIL-4-coupled "Affigel" as an approximately 44 kDa protein by SDS-PAGE.

Example 13

Production of monoclonal antibodies against IL-4R

Preparations of purified, recombinant IL-4 receptor, e.g. human or murine IL-4 receptor, transfected COS cells expressing high levels of IL-4 receptor or CTLL 19.4 cells are used to generate monoclonal antibodies against IL-4 receptor using standard techniques, such as those which is described in US Patent No. 4,411,993. Such antibodies are likely to be useful for interfering with IL-4 binding to IL-4 receptors, e.g. to ameliorate toxic or other undesirable effects of IL-4.

To immunize rats, IL-4 receptor-bearing CTLL 19.4 cells were used as immunogen emulsified in complete Freund's adjuvant and injected in amounts ranging from

10 - 100 µl, subcutaneously in Lewis rats. Three weeks later, the immunized animals were injected with additional immunogen emulsified in incomplete Freund's adjuvant, and they received injections every three weeks thereafter. Serum samples were obtained periodically by retro-orbital bleeding or tail-tip excision for testing by dot-blot assay, ELISA (enzyme-linked immunosorbent assay), or inhibition of binding of 125

I-IL-4 to extracts of CTLL cells (as described in Example 1). Other analytical methods are also suitable. After detection of an appropriate antibody titer, positive animals were given a final intravenous injection of antigen in saline. Three to four days later, the animals were sacrificed, splenocytes were harvested and fused to the murine myeloma cell line AG8653. Hybridoma cell lines generated by this method were plated in multiple microtiter plates in a HAT selective medium (hypoxanthine, aminopterin and thymidine) to inhibit proliferation of non-fused cells, myeloma hybrids and spleen cell hybrids.

Hybridoma clones thus produced were screened for reactivity with IL-4 receptor. In the initial screening of hybridoma supernatants, an anti-125 substance capture and binding of partially purified I-mIL-4 receptor was used. Two out of over 400 hybridomas that were screened were positive by this method. These two monoclonal antibodies, M1 and M2, were tested using a modified antibody capture to detect blocking antibody. Only Ml was

125

able to inhibit I-rmIL-4 binding to intact CTLL cells. Both antibodies are able to immunoprecipitate naturally occurring mIL-4R protein from CTLL cells or

35 COS-7 cells transfected with IL-4R clones labeled with S-cysteine/methionine. M1 and M2 were then injected into the peritoneal cavities of nude mice to produce ascites containing high concentrations (>1 mg/ml) of anti-IL-4R monoclonal antibody. The resulting monoclonal antibody was purified by ammonium sulfate precipitation followed by gel exclusion chromatography and/or affinity chromatography based on binding of antibody to protein G.

Example 14

Use of soluble IL-4R to suppress immune responses in vivo

Experiments were performed to determine the effect of soluble IL-4R on the allogeneic host versus graft (HVG) response in vivo using a popliteal lymph node assay. In this model, mice are injected into the footpad with irradiated, allogeneic spleen cells. Irradiated, healthy cells are then injected

in the contralateral pad. An alloreactive response occurs in the pad which receives the allogeneic cells, the extent of which can be measured by means of the relative increase in size and weight of the popliteal lymph node that drains the site of antigen deposition.

On day 0, three BALB/C mice were injected in the footpad with irradiated allogeneic spleen cells from c57BL/6 mice and in the contralateral footpad with irradiated syngeneic spleen cells.

On days -1, 0 and +1, three mice were injected (intravenously on days -1 and 0, and subcutaneously on day +1) with 100 ng of purified, soluble IL-4R (sIL-4R) in phosphate-buffered saline,

three mice were injected intravenously with 1 µg sIL-4R, three mice were injected with 2 µg SIL-4R, and three mice were injected with MSA (control). The mean difference in weight of the lymph nodes from the sites of allogeneic and syngeneic spleen cells was approximately 2.5 mg for the mice treated with MSA, 1 mg for the mice treated with 100 ng sIL-4R, and 0.5 mg for the mice treated with 1 ug sIL-4R. No detectable difference in lymph node weight could be reliably demonstrated for the mice treated with 2 µg sIL-4R. Thus, IL-4R suppressed significantly

(p < 0.5 in all groups using the two-tailed T-test) the in vivo lymphoproliferative response in a dose-dependent manner compared to control mice.

Claims (23)

1. Isolated DNA sequence encoding a mammalian IL-4 receptor (IL-4R), characterized in that the DNA sequence is selected from: (a) a DNA sequence comprising nucleotides -75-2355 in Figures 2A-2C, nucleotides 1-2355 in Figures 2A-2C, nucleotides -75-2400 in Figures 4A-4C or nucleotides 1-2400 in Figures 4A-4C, (b) DNA sequences which can hybridize to a DNA according to (a) under medium stringency conditions, and which encode an IL-4R polypeptide which can bind IL-4, and (c) DNA sequences which have degenerated as a result of the genetic code, into a DNA defined in (a) or (b), and which encode an IL-4R polypeptide capable of binding IL-4. 2. DNA sequence according to claim 1, characterized in that said IL-4R consists mainly of murine IL-4R or human IL-4R. 3. DNA sequence according to claim 2, characterized in that said IL-4R is a murine or human IL-4R which lacks the transmembrane region and the intracellular domain in the naturally occurring IL-4R. 4. DNA sequence according to claim 1, characterized in that it codes for a soluble IL-4R comprising an amino acid sequence that is more than 80% similar to an amino acid sequence selected from residues -25-207 or 1-207 shown in Figures 4A- 4C. 5. DNA sequence according to claim 4, characterized in that it codes for an amino acid sequence selected from the sequence of residues -25 to 207 or 1 to 207 shown in Figure 4A. 6. DNA sequence according to claim 2, characterized in that the DNA sequence codes for a human IL-4R polypeptide comprising an amino acid sequence selected from sequence residues -25 to 800 or 1 to 800 in Figures 4A-4C. 7. DNA sequence according to claim 2, characterized in that it codes for a murine IL-4R polypeptide comprising an amino acid sequence selected from the sequence of residues -25 to 785 or 1 to 785 in Figures 2A-2C. 8. DNA sequence according to claim 4, characterized in that it codes for nucleotides -75 to 621 or 1 to 621 in Figure 4A. 9. Isolated DNA sequence, characterized in that it codes for a soluble fragment of the human IL-4R protein according to figures 4A-4C, in which the fragment has the ability to bind IL-4. 10. Isolated DNA sequence, characterized in that it codes for an immunogenic polypeptide comprising at least 20 consecutive amino acids in the amino acid sequence shown in Figures 2A-2C or Figures 4A-4C. 11. Recombinant expression vector, characterized in that it comprises a DNA sequence according to any one of claims 1-9. 12. Method for producing a mammalian IL-4 receptor polypeptide (IL-4R polypeptide), characterized by a suitable host cell comprising a vector according to claim 11, cultured under conditions that promote expression of the IL-4R polypeptide, followed by purification of the IL-4R polypeptide. 13. Method according to claim 12, characterized in that said IL-4R consists mainly of murine IL-4R or human IL-4R. 14 . Method according to claim 13, characterized in that the IL-4R is a murine or human IL-4R that lacks the transmembrane region and the intracellular domain of the naturally occurring IL-4R. 15. Method according to claim 12, characterized in that said IL-4R is a soluble IL-4R comprising an amino acid sequence that is more than 80% similar to the sequence of residues 1-207 shown in Figures 4A-4C. 16. Method according to claim 15, characterized in that the soluble IL-4R comprises the amino acid sequence of residues 1 to 207 as indicated in Figure 4A. 17. Method according to claim 12, characterized in that IL-4R polypeptides comprise the amino acid sequence of residues 1 to 800 in Figures 4A-4C. 18. Method according to claim 12, characterized in that the IL-4R polypeptide comprises the amino acid sequence of residues 1-785 in Figures 2A-2C. 19. Method according to claim 15, characterized in that the vector contains a DNA sequence comprising the sequence of nucleotides -75-621 or 1-621 in Figure 4A. 20. Method for producing a soluble human IL-4R polypeptide, characterized in that a suitable host cell containing a recombinant expression vector comprising a DNA sequence according to claim 9 is cultivated under conditions which promote expression of the IL-4R polypeptide, followed by purification of the IL-4R polypeptide. 21. Antibodies that are immunologically reactive with a mammalian IL-4 receptor protein (IL-4R protein), characterized in that the IL-4R protein comprises an amino acid sequence selected from residues 1-785 shown in Figures 2A-2C or residues 1 -800 shown in Figures 4A-4C. 22. Antibody according to claim 21, characterized in that the antibody is a monoclonal antibody. 23. Use of IL-4R for the detection of IL-4 or IL-4 receptor molecules (IL-4R molecules) or their interaction in vitro, by binding purified IL-4R molecules to IL-4 molecules and bound or unbound IL-4 or IL-4R molecules are measured or detected, where said IL-4R is selected from; a) an IL-4R comprising the amino acid sequence of residues 1-785 shown in Figures 2A-2C, b) an IL-4R comprising the amino acid sequence of residues 1-800 shown in Figures 4A-4C, c) a fragment of IL-4R according to (a) or (b), wherein the fragment can bind IL-4, and d) an IL-4R which can bind IL-4, and which comprises an amino acid sequence which is more than 80% similar to the sequence indicated in (a) or (b).