NL2035196B1 - Lactobacillus fermentum and applications of lactobacillus fermentum in preparation for alleviating alcoholic-induced gastric injury - Google Patents

Abstract

The present application belongs to the technical field of microorganism applications, and specifically relates to an application of a lactobacillus fermentum TY—W08 in alleviating acute alcoholic-induced gastric ulcer. The lactobacillus fermentum is assigned with the accession number of CGIVICC No. 24629. The lactobacillus fermentum TY—W08 has desirable 10 gastrointestinal fluid tolerance and intestinal colonization capability, may significantly improve bleeding and ulceration of alcoholic-induced gastric mucosa and effectively improve alcoholic-induced gastric ulcer, and has no side effects and high safety. Fig. 4

Description

LACTOBACILLUS FERMENTUM AND APPLICATIONS OF LACTOBACILLUS FERMENTUM IN

PREPARATION FOR ALLEVIATING ALCOHOLIC-INDUCED GASTRIC INJURY

TECHNICAL FIELD

The present application belongs to the technical field of microorganism applications, and specifically, relates to a lactobacillus fermentum and applications of the lactobacillus fermentum in a preparation for alleviating alcoholic-induced gastric injury.

BACKGROUND

Wine culture has a long history in our country and is part of our culture and life, and plays an even more important role in today's business and social activities. However, functions of a plurality of systems throughout a human body may be affected after the intaking of alcohol, which is likely to cause alcohol-related diseases. For example, drinking alcohol may harm the gastric mucosa (gastric mucosa tissue covers the inner surface of the stomach and secretes mucus to protect the stomach), causing gastric injury or inflammation. In addition, the fat-soluble nature of ethanol is very likely to cause gastric injury, and the ethanol may be metabolized into acetaldehyde in the human body, which can directly attack the gastric mucosa.

The alcohol may stimulate microcirculatory blood vessels of the mucosa, causing contraction of the microcirculatory blood vessels; and inflammatory mediators and cytokines are generated after mucosal ischemia and hypoxia, neutrophil aggregation and infiltration are caused, and injury progression is aggravated and promoted. The alcohol also causes microcirculation disturbance, and the existence form of xanthine dehydrogenase is also affected after tissue ischemia and hypoxia, generating large amounts of oxygen radicals such as superoxide anion, hydrogen peroxide and hydroxyl radicals, thus causing oxidative stress. In addition, inflammatory response and oxidative stress response may promote each other, thereby aggravating the degree of tissue injury.

Currently, some probiotics have been shown to have good antioxidant and free radical scavenging capabilities and beneficial functions such as enhancing the human immune; and the probiotics have no side effects and high safety. Therefore, it is necessary to discover a probiotic that may alleviate alcoholic-induced gastric injury.

SUMMARY

In view of the above problems, one of the objectives of the present application is to provide a lactobacillus fermentum TY-WO8 that is separated from Qula in Halama 1st Village,

Angu, Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province.

The lactobacillus fermentum may alleviate oxidative stress in the human body by improving the antioxidant capacity of the human body, so as to reduce inflammatory response of the human body, thereby alleviating alcoholic-induced gastric injury.

In order to achieve the above purpose, the present application may use the following technical solutions.

One aspect of the present application provides a lactobacillus fermentum. The lactobacillus fermentum is deposited with the China General Microbiological Culture

Collection Center (CGMCC) and is assigned with the accession number of CGMCC No. 24629.

Another aspect of the present application provides a composition. The composition may include one or a combination of a plurality of the following substances: (a) the lactobacillus fermentum; (b) lysate of the lactobacillus fermentum; {c) a culture of the lactobacillus fermentum; and (d} a fermentation broth of the lactobacillus fermentum.

Still another aspect of the present application provides a preparation. The preparation includes the lactobacillus fermentum or the composition, and a carrier. The carrier is a medicinal carrier or an edible carrier.

Still another aspect of the present application provides applications of the lactobacillus fermentum or the composition in preparation of preparations used for alleviating alcoholic-induced gastric injury.

The collection information of the lactobacillus fermentum in the present application includes the following. The lactobacillus fermentum is deposited with the CGMCC at No. 3,

Yard 1, BeiChen West Road, Chaoyang District, Beijing on April 1, 2022 and is assigned with the accession number of CGMCC No0.24629, with the classification name being lactobacilius fermentum.

The beneficial effects of the present application are as follows. The lactobacillus fermentum has desirable gastrointestinal fluid tolerance and intestinal colonization capability, may significantly improve bleeding and ulceration of alcoholic-induced gastric mucosa and effectively improve alcoholic-induced gastric ulcer, and has no side effects and high safety.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows colonial morphology of TY-WO8.

Fig. 2 shows a gram staining result of TY-WO8.

Fig. 3 is a cell adhesion map of TY-WO8.

Fig. 4 is an appearance observation diagram of gastric tissue of mice.

Fig. 5 shows gastric mucosa injury indexes of mice.

Fig. 6 shows the impact of TY-WO08 on the content of Glutathione (GSH) in gastric tissue of mice.

Fig. 7 shows the impact of TY-WO8 on the content of Malondialdehyde (MDA) in gastric tissue of mice.

Fig. 8 shows the impact of TY-WO8 on the activity of Superoxide Dismutase (SOD) in gastric tissue of mice.

Fig. 9 shows the impact of TY-W08 on mRNA relative expression of TNF-a in gastric tissue of mice.

Fig. 10 shows the impact of TY-WO8 on mRNA relative expression of IL-6 in gastric tissue of mice.

Fig. 11 shows the impact of TY-W08 on mRNA relative expression of {L-1Bin gastric tissue of mice.

Fig. 12 shows the impact of TY-WO8 on mRNA relative expression of COX-2 in gastric tissue of mice.

Fig. 13 shows the impact of TY-WO8 on mRNA relative expression of eNOS in gastric tissue of mice.

Fig. 14 shows the impact of TY-WO8 on mRNA relative expression of nNOS in gastric tissue of mice.

Fig. 15 shows the impact of TY-WO8 on mRNA relative expression of iNOS in gastric tissue of mice.

In the drawings: "*" represents that there is a statistical difference {p < 0.05) between two groups; "**" represents that there is a statistical difference {p < 0.01) between two groups; "***" represents that there is a statistical difference (p < 0.001) between two groups; and "****" represents that there is a statistical difference (p < 0.0001} between two groups.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The embodiments are given to better describe the present application, but the content of the present application is not limited only to the embodiments given. Therefore, non-essential improvements and adjustments to the embodiments made by a person skilled in the art in accordance with the content of the above present application still fall within the scope of protection of the present application.

The terms used herein are only intended to describe specific embodiments and are not intended to limit the present disclosure. Expressions in the singular form include those in the plural form unless the expressions have a distinctly different meaning in the context. As used herein, it is to be understood that terms such as "include", "have", "contain", and the like are intended to indicate the presence of features, figures, operations, components, parts, elements, materials, or combinations. The terms of the present application are disclosed in the specification and are not intended to exclude the possibility that one or more other features, figures, operations, components, parts, elements, materials, or combinations thereof may exist or may be added. As used here, "/" may be interpreted as "and" or "or", as appropriate,

A lactobacillus fermentum in the present application is also called a lactobacillus fermentum TY-WO8 or TY-WO8.

In the present application, the term "preparation" does not only refer to a pharmaceutical preparation for medicinal purposes, but also includes an edible food preparation or a health care product preparation.

An embodiment of the present application provides a lactobacilius fermentum TY-WOB8.

The lactobacillus fermentum is deposited with the CGMCC and is assigned with the accession number of CGMCC No. 24629. it is to be noted that, the lactobacillus fermentum is derived from Qula in Halama 1st

Village, Angu, Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan

Province. After being detected by means of gram staining results, the lactobacillus fermentum is found to be in a rod-like shape, and is determined as gram-positive bacteria (G*). In addition, by means of PCR amplification of a 165rDNA sequence, the 16SrDNA sequence is detected to include a sequence shown as SEQIDNO.1, and by means of homology analysis, it indicates that the strain is the lactobacillus fermentum. In addition, the lactobacillus fermentum has strong gastric juice tolerance and bile salt tolerance; the survival rate of the lactobacillus fermentum in gastric juice may reach 98.66%; and the growth efficiency of the lactobacillus fermentum in bile salt may reach 28.45%. The number of TY-WO08 adhered by 100 cells is 256, and it indicates that the lactobacillus fermentum has desirable digestive tract resistance and good intestinal tract colonization capabilities.

Another embodiment of the present application provides a composition. The composition includes one or a combination of a plurality of the following substances: (a) the lactobacillus fermentum; (b) lysate of the lactobacillus fermentum; {c} a culture of the lactobacillus fermentum; and (d) a fermentation broth of the lactobacillus fermentum. it is to be noted that, in the composition, as described above, the lactobacillus fermentum TY-WO08 has desirable digestive tract resistance and good intestinal tract colonization capabilities, and may be prepared into an edible or medicinal composition. In addition, when the lactobacillus fermentum TY-WO8 is prepared into the composition, the lactobacillus fermentum may achieve an effect by being directly introduced into the composition in the form of viable bacteria, may achieve an effect by being introduced into the 5 composition in the form of inactivated bacteria after inactivation by means of the existing technology, may achieve an effect by introducing the lysate of the lactobacillus fermentum into the composition, may achieve an effect by introducing products such as proteins, peptides, secretions or metabolites obtained from the culture of the lactobacillus fermentum into the composition, or may achieve an effect by introducing the fermentation broth from the fermentation of the lactobacillus fermentum into the composition. In a specific use process, different forms of the lactobacillus fermentum may be selected for the preparation of the composition according to specific requirements.

In some specific embodiments, the composition may further include one or a combination of probiotics, prebiotics, dietary fiber and traditional Chinese drugs. it is to be noted that, the lactobacillus fermentum TY-WO8 and different forms thereof may also be used in combination with one or the combination of probiotics, dietary fiber and a pharmacologically active compound. For example, the lactobacillus fermentum TY-W08 may be used in combination with bacillus subtilis, bifidobacterium or lactobacillus, so as to cause the composition to simultaneously have the effects of the lactobacillus fermentum TY-WO08 and other probiotics. For another example, the lactobacillus fermentum TY-WO8 may be used in combination with the prebiotics, and the prebiotics may provide an energy source for the lactobacillus fermentum TY-WO8, such that the effect of the lactobacillus fermentum TY-W08 is improved. For another example, the lactobacillus fermentum TY-WO8 may be used in combination with the dietary fiber, and the dietary fiber may assist in colonization of the lactobacillus fermentum TY-WO8, such that the effect of the lactobacillus fermentum TY-WO8 is improved. For another example, the lactobacillus fermentum TY-W08 may also be used in combination with the traditional Chinese drugs to form the composition, such that the effects of the lactobacillus fermentum TY-WO8 and the traditional Chinese drugs are simultaneously achieved.

Still another embodiment of the present application provides a preparation. The preparation includes the lactobacillus fermentum or the composition, and a carrier. The carrier is a medicinal carrier or an edible carrier.

It is to be noted that, drugs or edible food or health care products may be prepared by adding the medicinal carrier or the edible carrier to the composition including the lactobacillus fermentum TY-WO8 and different forms thereof. The medicinal carrier or the edible carrier is known in the art and may be selected according to the dosage form as needed.

For example, the preparation of tablets mainly uses a diluent {such as starch, dextrin, sucrose or sugar), an absorbent (such as calcium sulfate, calcium hydrogen phosphate or light magnesium oxide), an adhesive {such as povidone, syrup or hydroxypropyl methylcellulose), a wetting agent (such as water), or a disintegrating agent (such as dry starch, sodium hydroxymethyl starch or cross-linked povidone). For example, the preparation of the liquid preparation mainly uses a bulking agent, a suspending agent, an emulsifying agent, a colorant, or the like.

In some specific embodiments, the preparation is tablets, pills, capsules, powder, gel, granules or a liquid preparation. It is to be noted that, solid dosage forms such as the tablets, the pills, the granules or the capsules may be product forms such as probiotic tablets, probiotic sugar pills, probiotic powder or probiotic capsules. The liquid preparation may be a product form such as a probiotic beverage. The gel may be product forms such as probiotic jelly, probiotic milk foam or solidified yogurt.

Still another aspect of the present application provides applications of the lactobacillus fermentum or the composition in preparation of preparations used for alleviating alcoholic-induced gastric injury.

In some specific embodiments, the applications include applications of one or a combination of a plurality of the following: {a} an application of the lactobacillus fermentum or the composition in preparation of preparations used for alleviating oxidative damage to alcoholic-induced gastric tissue; {b) an application of the lactobacilius fermentum or the composition in preparation of preparations used for alleviating inflammatory response of alcoholic-induced gastric tissue; and {c) an application of the lactobacillus fermentum or the composition in preparation of preparations used for improving the expression level of endothelial Nitric Oxide Synthase (eNOS) and/or neuronal NOS (nNOS) in gastric tissue and/or reducing the expression level of induced NOS (iNOS).

In some specific embodiments, the application (a) includes an application of the lactobacillus fermentum or the composition in preparation of preparations used for improving the activity of SOD and/or the content of GSH in the alcoholic-induced gastric tissue, and/or reducing the content of MDA in the alcoholic-induced gastric tissue; and the application (b) includes an application of the lactobacillus fermentum or the composition in preparation of preparations used for reducing the expression level of an inflammatory factor Tumor Necrosis

Factor a (TNF-a) and/or Leukin-1B (L-18) and/or Interleukin-6 (IL-6) and/or Cyclooxygenase-2 (COX-2) in the alcoholic-induced gastric tissue. it is to be noted that, the gastric mucosa generates large amounts of oxygen radicals under the stimulation of ethanol; the oxygen radicals may cause lipid peroxidation in the gastric mucosa or mucosal cells at both the overall and cellular levels, so as to generate lipid peroxide such as the MDA, resulting in gastric mucosa injury caused by gastric mucosa blood flow disorder. The SOD and the GSH are the most important antioxidants against free radicals in the human body, may directly eliminate the free radicals, block the chain reaction of the free radicals, and have the effect of repairing cells. Heavy drinking may cause a significant decrease in SOD activity, resulting in weakened oxygen radical scavenging and causing damage to the human body. The lactobacillus fermentum TY-WO8 in the present application may significantly increase the activity of the SOD having an antioxidant function and the content of the GSH in the gastric tissue in the human body, and reduce the content of the lipid peroxide

MDA. it is further to be noted that, the ethanol may activate the immune system of the human body to affect the level of proinflammatory factors, including TNF-a and IL-1B. As an important cytokine having various functions, the TNF-a is closely related to the activation of other inflammatory factors {such as IL-1B and IL-6), and is involved in the development of inflammatory diseases. The activation of the IL-18 and the IL-6 may further promote the expression of the TNF-a, aggravating an inflammatory response. The TNF-a is one of the most potent inflammatory factors, such that the TNF-a is usually used as an index for determining the degree of inflammation. The COX-2 is an important inflammatory factor; and gastric injury may be significantly alleviated by inhibiting the degree of inflammation in gastric injury, such that the effect of inhibiting gastric inflammation may be achieved by controlling the expression of the COX-2 in the gastric tissue. The lactobacillus fermentum TY-WO8 in the present application may significantly reduce mRNA expression levels of an inflammatory factors such as Tumor Necrosis Factor a (TNF-a), Interleukin-1B (IL-1B), Interleukin-6 (IL-6) and

Cyclooxygenase-2 {COX-2).

It is further to be noted that, NOS in the gastric mucosa is divided into two categories; one category is constitutive NOS {cNOS, including eNOS and nNOS), and one category is iNOS.

Less NO is catalyzed by the cNOS, and plays a role in protecting the gastric mucosa to a certain extent. In addition, through research, it is found that the occurrence of gastric ulcer is related to excessive inhibition of the eNOS and the nNOS. After appropriate stimulation by endotoxin, the iNOS of an inducible form is generated. Under a physiological condition, the eNOS and the nNOS continuously synthesize the NO, which plays an important role in regulating a gastric tissue function. The iNOS is not expressed in a normal state; and the iNOS is heavily activated after the gastric tissue is damaged, further aggravating gastric injury. During the alleviation of the gastric ulcer, the content of the eNOS and the nNOS is increased, and a positive effect may be effectively achieved by reducing the content of the iNOS. The lactobacillus fermentum

TY-WO08 in the present application may significantly increase the mRNA expression levels of the eNOS and the nNOS, and significantly reduce the mRNA expression level of the iNOS.

In order to make objectives, technical solutions, and advantages of the present application clearer, the preferred embodiments of the present application will be described in detail below with reference to the drawings.

Embodiment 1: Separation, purification and identification of TY-W08 (1) Experimental material

Qula in Halama 1st Village, Anqu, Hongyuan County, Aba Tibetan and Qiang Autonomous

Prefecture, Sichuan Province: the Qula was collected by using a sterile spoon, and was put into a 15 mL sterile capped centrifuge tube containing a proper amount of sterile calcium carbonate and soluble starch; and the tube is screwed up, and then refrigerated and transported back to a laboratory. (2) Separation and purification of the TY-W08 10-fold gradient dilution was performed on the retrieved sample, so as to successively obtain diluent with dilution degrees of 107, 102, 10%, 10%, 10°, 10% and 107; 200 ut of the diluent with proper dilution degrees (103, 10%, 105 and 10%) was coated on an MRS solid culture medium, and the culture medium was inverted and cultured for 48h at 37°C; and after culture is finished, colonial morphology on an MRS plate was observed, single colonies with different morphology were selected, a streak plate method was adopted to separate strains, and the above steps were repeated until purified strains were obtained. The colonial morphology was observed, and morphological observation was performed by means of gram staining.

The colonial morphology of the purified strains was shown in Fig. 1. The colonies were consistent in morphology, moist and smooth in surface, medium in size, neat in edge, hemispherical in shape, and milk white in color.

The cell morphology of the purified strains after gram staining was shown in Fig. 2 (grey processing was performed in Fig. 2, and an original drawing was purple). Purple cell morphology with a rod-like shape was observed under a microscope, which accorded with the characteristics of the lactobacillus, such that the strains were determined as gram-positive bacteria (G*). (3) PCR amplification of 16S rDNA sequence

PCR amplification was performed by using a 25 uL of a reaction system, including 1 uL of a template, 1 uL of an upstream primer (10 uM), 1 uL of a downstream primer (10 pM), and 12.5 ul of 2xTag PCR Master Mix, and making up to 25 ub with sterile ultrapure water. Primer sequences included an upstream primer sequence AGAGTTTGATCCTGGCTCAG (SEQIDNO.2) and a downstream primer sequence TACGACTTAACCCCAATCGC (SEQIDNO.3). PCR amplification conditions included: performing pre-denaturation at 94°C for 5 min, performing denaturation at 94°C for 30 s, performing annealing at 55°C for 30 s, and performing extension at 72°C for 1 min, where there was a total of 35 cycles; and performing end extension at 72°C for 10 min. After sequence amplification, Sangon Biotech {Shanghai) Co., Ltd.

Was entrusted to sequence qualified PCR amplification products, and the obtained sequence was shown as SEQIDNo.1; and searching and similarity comparison were performed in

GeneBank by using BLAST(http://www.ncbi.nim.nih.gov/BLAST). Results showed that the strain in the present application is the lactobacillus fermentum.

Embodiment 2 Measurement of gastric juice tolerance and cell adhesion capability of

TY-W08 (1) Experimental material

A lactobacillus fermentum TY-WO8: separated from the Qula in Halama 1st Village, Anqu,

Hongyuan County in Sichuan Province, deposited with the CGMCC and is assigned with the accession number of CGMCC No. 24629. (2) Measurement of the TY-WO8 tolerant to artificial gastric juice with pH being 3.0 10 mi of a culture solution that has been well activated was taken, and was centrifuged at 4000r/min for 10 min, so as to collect bacterial precipitation, and the bacterial precipitation was resuspended in isochoric sterile saline to prepare bacterial suspension; 1 ml of the bacterial suspension and 9 ml of artificial gastric juice {0.2%NaCl and 0.35% pepsin being 1:10000, pH being adjusted to be 3 by using 1mol/L of HCI, and filtration sterilization being performed for later use} were mixed, well agitated and placed in a constant temperature oscillator to culture for 3h at 37°C and 100r/min; and sampling was performed at Oh and 3h, respectively, and viable counts were measured respectively by using a pour plate method.

3h viable count/(CFU/mL J+ survival rate 4 — we 100

Oh viable count/{CFLU/mL)<

Before the probiotics entered the human intestinal tract to exert functions, the probiotics needed to pass through the stomach (generally, the pH value of gastric juice is about 3.0} and stayed for about 3h, but the strongly acidic stomach environment was not conducive to the 3 survival of the probiotics. Therefore, the viability of the probiotics in simulated gastric juice is crucial. From the above experimental results, it showed that when being cultured for 3h under the acidic condition of pH=3.0, the survival rate of the TY-WO8 is 98.66%, such that the

TY-WO08 has very strong viability. (3) Measurement of TY-WO8 tolerant to 0.3% bile salt 10 The culture solution that has been well activated was taken, and inoculated in MRS-THIO culture media respectively containing 0.0 and 0.3% bile salt (0.2% sodium mercaptoacetate being added to an MRS liquid culture medium); and after well mixing, the culture media were placed in the constant temperature oscillator to culture for 24h at 37°C and 100r/min, and growth efficiency was calculated. 0.3% bile salt containing culture medium ODeso0m- growth efficiency/%« … blank control QDsoeow wx 1H) 0.0% bile salt containing culture medium ODeovs--

B blank-control-QDeo0s

The survived probiotics were in contact with the bile salt in the small intestine after passing through the stomach, and the mass concentration of the bile salt in the human body fluctuated within the range of 0.03%-0.3%. From the above experimental results, it showed that the growth efficiency of the TY-WO8 in the bile salt with the concentration being 0.3% is 28.45%, such that the TY-WO08 has desirable bile salt tolerance. (4) Measurement of cell adhesion capability of TY-W08

HT-29 cells were resuspended by using a McCoy's 5A culture medium, and the number of cells was adjusted to 2x10° cell/mL; a 6-well culture plate was placed into cover glass which has been subjected to acid pickling and sterilization, and 2 mL of cell suspension was respectively added to each well; and culture was performed overnight at 37°C and 5% CO..

After the cells were attached to the wall of the cover glass, sterile PBS was used for washing for 3 times; the bacterial suspension was added {the TY-WO08 being resuspended by using the

McCoy's 5A culture medium {without adding penicillin-streptomycin and fetal bovine serum),

until the concentration of bacterial fluid was 108CFU/mL); incubation was performed for 2h, and then the culture solution was discarded; the sterile PBS was used for washing for 6 times; and 2 mL of methanol was added in each well, and was cured for 1h at room temperature for gram staining. The total number, that is, an adhesion value, of TY-W08 adhered by 100 cells was recorded under the microscope {20 views being randomly selected).

The TY-WO8 could achieve the probiotic function on the host only by being adhered to human intestinal epithelial cells and finally colonized on the intestinal epithelium. Generally, if the number of strains adhered to 100 cells is less than 40, it indicates that the strain has no adhesion capability; if the number of strains adhered to 100 cells is between 41 and 100, it indicates that the strain is general in adhesion capability; and if the number of strains adhered to 100 cells exceeds 100, it indicates that the strain is strong in adhesion capability. The adhesion capability of the TY-W08 was evaluated by using the HT-29 cells to simulate human intestinal epithelial cells. An experimental result was shown in Fig. 3, the number of the

TY-WO08 adhered by 100 cells is 256, such that the TY-W08 has strong cell adhesion capabilities, indicating that the TY-WO8 has strong intestinal tract colonization capabilities.

Embodiment 3 Effect of TY-WO08 on alleviating acute alcoholic-induced gastric ulcer (1) Experimental material

A lactobacillus fermentum TY-WO08: separated from the Qula in Halama 1st Village, Anqu,

Hongyuan County in Sichuan Province, deposited with the CGMCC and is assigned with the accession number of CGMCC No. 24629.

Acute alcoholic-induced gastric ulcer model in mice: before a formal experiment, the mice were adaptively fed for a week. After an adaptive phase ended, the mice were randomly grouped into 3 groups (n=8) according to weights, which are Group Control, Group EtOH, and

Group TY-WO8. The Group TY-WO8 was intra-gastrically administered with 1.0x10° CFU/kg of

TY-WO08 bacterial fluid daily for 28 days, continuously; and Group Blank and the Group EtOH were intra-gastrically administered with equivalent amount of normal saline. At Day 29, the mice in each group were fasted for 12 hours before model building; and then the mice in the

Group EtOH and the Group TY-WO08 were intra-gastrically administered with an ethanol solution {12ml/kg) with volume fraction of 50% at one time, so as to prepare an acute alcoholic-induced gastric ulcer model in the mice; and the mice in the Group Blank is given equal amount of normal saline. The mice were sacrificed after 10 hours of intragastric administration with the ethanol solution. The gastric tissue was taken and cut along greater curvature of the stomach; stomach contents were washed; and the gastric mucosa was unfolded, and was photographed by a digital camera. (2) Measurement of gastric mucosa injury indexes of the mice

Situations of the gastric mucosa of the mice in each group were shown in Fig. 4. The gastric mucosa of the mice in the Group Control was compact in structure, normal in color and smooth in surface, and had no bleeding points and erosion. Compared with the Group Control, the gastric mucosa of the mice in the Group EtOH was seen with visible patchy tissue erosion, and obvious bleeding, tissue congestion and edema, and was reddish in color, The degree of injury of the gastric mucosa of the mice in the Group TY-WO8 is equivalent as that of the gastric mucosa of the mice in Group Control when being observed with naked eyes; and no obvious erosion or bleeding was seen, only tissue congestion was more pronounced than that in the gastric tissue of the Group Control, and the degree of injury was significantly less than that of the Group EtOH.

Gastric mucosa injury of the mice was observed with naked eyes, and the index of gastric mucosa injury was measured by using a straight scale (the index of gastric mucosa injury was calculated by using a Guth method: every three punctate ulcers {of which width of hemorrhagic erosive dots or mucosa defect is less than 1 mm) were recorded as 1 point; stripe hemorrhage: the maximum length diameter of the ulcer and the maximum width diameter perpendicular to the maximum length diameter were measured, and the product of the maximum length diameter and the maximum width diameter was an ulcer index; and the one with the width being 1 mm was 1 point per millimeter length, the one with the width being 2 mm was 2 points per millimeter length, the one with the width being 3 mm was 3 points per millimeter length, and so on). Measurement results of the mice in each group were shown in

Fig. 5. The ethanol (EtOH) obviously increased the index of gastric mucosa injury of the mice.

Compared with the Group EtOH, the index of gastric mucosa injury in the Group TY-W08 was significantly reduced {p<0.0001), and the results showed that the TY-W08 could effectively alleviate the gastric mucosa injury of the mice caused by alcohol. (3) Measurement of an oxidation index of gastric tissue in the mice

A BCA kit (which was purchased from Shanghai Beyotime Biotechnology Co., Ltd} was used to measure protein concentration of gastric tissue homogenate of the mice.

Kits (which were all purchased from Nanjing Jiancheng Bioengineering Institute) were respectively used to measure GSH content, MDA content and SOD activity of the gastric tissue in the mice.

Experimental results were shown in Fig. 6, Fig. 7 and Fig. 8. Compared with the Group

Control, the SOD activity (p<0.001) and the GSH content (p<0.001) of the mice in the Group

EtOH were significantly reduced, and the MDA content was significantly increased {p<0.0001}; and after TY-WO8 intervention, the SOD activity (p<0.0001), the GSH content (p<0.001} and the MDA content (p<0.0001) of the mice could all be recovered to normal levels. The results showed that the TY-WO8 had the effect of alleviating oxidative damage caused by the ethanol. (4) Measurement of mRNA expression level of gastric tissue in the mice

A TRizol reagent was used to extract the total RNA of the gastric tissue, and the total RNA was subjected to reverse transcription to cDNA by using a reverse transcription kit; and the

MRNA expression levels of target genes TNF-a, IL-6, IL-1B, COX-2, eNOS, nNOS and iNOS were detected by means of a fluorescence quantitative PCR instrument. A primer sequence was shown in Table 1, and the mRNA relative expression levels of the target genes were calculated by using a 224% method.

Table 1 Primer sequence

TNF-a-F CCTGTAGCCCACGTCGTAG(SEQIDNO.4)

TNF-a-R GGGAGTAGACAAGGTACAACCC(SEQIDNO.5)

IL-6-F TAGTCCTTCCTACCCCAATTTCC(SEQIDNO.6)

IL-6-R TTGGTCCTTAGCCACTCCTTC{SEQIDNO. 7)

IL-1B-F GAAATGCCACCTTTTGACAGTG(SEQIDNO.8)

IL-1B-R TGGATGCTCTCATCAGGACAG(SEQIDNO.9)

COX-2-F TTAAAATGAGATTGTCCGAA(SEQIDNO.10)

COX-2-R AGATCACCTCTGCCTGAGTA(SEQIDNO.11) eNOS-F GGAGAGGCTGCATGACATTG(SEQIDNO.12) eNOS-R GGTAGAGCCATAGTGGAATGAC(SEQIDNO.13) nNOS-F GAATACCAGCCTGATCCATGGAA(SEQIDNO.14) nNOS-R TCCTCCAGGAGGGTGTCCACCGCATG(SEQIDNO.15) iNOS-F AGAGAGATCGGGTTCACA(SEQIDNO.16)

INOS-R CACAGAACTGAGGGTACAÍSEQIDNO. 17)

GAPDH-F TGACCTCAACTACATGGTCTACA(SEQIDNO.18)

GAPDH-R CTTCCCATTCTCGGCCTTG(SEQIDNO.19)

The mRNA relative expression levels of the TNF-a, IL-6, IL-18 and COX-2 of the gastric tissue in the mice were respectively shown in Fig. 9, Fig. 10, Fig. 11 and Fig. 12. Compared with the Group EtOH, the mRNA relative expression levels of the TNF-a (p<0.05), IL-18 {(p<0.05), IL-6 (p<0.05) and COX-2 {p<0.05} of the gastric tissue in the mice in the Group

TY-WO08 were all significantly reduced. The results showed that the TY-W08 may alleviate an inflammatory response, and reduce the damage of the alcohol to the gastric mucosa, thereby achieving the effect of protecting the gastric mucosa.

The mRNA relative expression levels of the eNOS, nNOS and iNOS of the gastric tissue in the mice were shown in Fig. 13, Fig. 14 and Fig. 15. Compared with Group Control, the expression levels of the eNOS {p<0.05) and the nNOS (p<0.05) of the mice in the Group EtOH were obviously reduced, and the mRNA relative expression level of the INOS (p<0.05) was obviously increased; and after TY-WO08 intervention, the mRNA relative expression levels of the eNOS (p<0.05) and the nNOS (p<0.05)} of the mice were significantly increased, and the mRNA relative expression level of the iNOS (p<0.05) was significantly reduced. The results showed that the TY-WO8 had a certain protection effect on the gastric ulcer caused by the ethanol, and was related to the antioxidant capability of the TY-W08 in the human body.

To sum up, the lactobacilius fermentum TY-WO8 in the present application has desirable gastric juice tolerance and good intestinal tract colonization capabilities. The TY-WO8 can improve acute alcoholic-induced gastric mucosa bleeding and ulceration of the mice, and may significantly increase the activity of the SOD having an antioxidant function and the content of the GSH in the gastric tissue, reduce the content of the lipid peroxide MDA, reduce the mRNA expression levels of the inflammatory factors TNF-a, L-1B, IL-6 and COX-2, increase the mRNA expression levels of the eNOS and the nNOS, and reduce the mRNA expression level of the iNOS. Therefore, the lactobacillus fermentum TY-WO8 achieves the purpose of alleviating acute alcoholic-induced gastric ulcer by means of cooperation of simultaneously improving the antioxidant capabilities of the mice, alleviating oxidative stress of the human body and reducing the inflammatory response of the human body, and potential interventions are provided for the prevention of the alcoholic-induced gastric ulcer. it is finally to be noted that, the above embodiments are merely for describing and not intended to limit the technical solutions of the present application. Although the present application is described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present application can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present application, and shall all fall within the scope defined by the claims of the present application.

1 <?xml version="i 0" encoding=rUTE-8" 72 7 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "3T26Sequencelisting V1 3.dtd"> 3 <STZ6Sequenceldsting AtcdVersion="vi 3% {1lleName="T¥-20R2-11-24~1. aml? zoitwareName=

PHIRG Sequence" zoftwarsVersion="2, 3,09 produnhioniate=t2083-06-28"> 4 <ApplicapniFileRefersnce»TY-xuliebiao</AppliicantFileReferaenca> <ApplicaniNeme lencuagelcds="zh'"vChongqing Tianyou Dairy Co. Ltd.</ApplicantName> iS <ApplicanilNamelatin>Chongging Tianyou Dairy Co. Ltd.</ApplicantNameLatin> 7 <inventorNeme languagelcde="zh">Zhang Feng /InveniorName> a <“inventorNamelLetin>Zhang Feng</InventorNamelLatin» 3 <inventionTitie languagenode="zh">Lactobacillus Fermentum and Applications of

Lactobacillus Fermentum in Preparation for Alleviating Alcoholic-Induced Gastric

Injury /inventionTitle»> if <SeguenceTotalQuantity>l19</SeguenceTotelQuantity> ii <SequenceData semencelDNumber=Nij> 12 <INSDSeq> ij «<INSDSeg iength>1437</INSD3eqg length» 14 <INSDSeq moltype>DNA</INSDSeg moltyper

Lj <INSDSeq division>PAT</INSD3eg division» iE <INSDSeq featura-table>

Lj <INSDFeatura>

ES <IN3DFeature key>source</IN3DFeature key>

LG <IN3DFeature location>1..1437</INSDFeature locations» 240 <INSDFeature guals> 2 <INSDQualiifisr>

ZE <INSDQualifier name»mol type“/INSDCualifier name» 23 <INSDQualifier value>genomic DNA</InNSDRualifier value» 24 </INSDOualifiers aL <INSDQuaizifler ia="giN>

ZE <INSDQualifier namerorganism</INSDQualifier name>

LT <INSDQualifier valuerLactobacillus fermentans </INSDgualifier value» zó </INSDQualifiers» a </INSDFeaturs quals> </INSDFeature> 31 </INSD3eq feature-table>

Ss <INSDSeq sequencer ggctggectcctaaaaggttaccccaccgactttgggtgttacaaactctcatggtgtgacgggcggtgtgtaca aggcccgggaacgtattcaccgeggcatgctgatcegcgattactagcgattcegacttegtgcaggcgagttg cagcctgcagtccgaactgagaacggttttaagagatttgettgccctecgegagttegecgactecgttgtacegt ccattgtagcacgtgtgtagcccaggtcataaggggcatgatgatctgacgtegtccccaccttcctceggttt gtcaccggcagtctcactagagtgcccaacttaatgctggcaactagtaacaagggttgegctecgttgcgggac ttaacccaacatctcacgacacgagctgacgacgaccatgcaccacctgtcattgegttcccgaaggaaacgcc ctatctctagggttggcgcaagatgtcaagacctggtaaggttettecgegtagcttegaattaaaccacatgct ccaccgcttgtgegggcccecgtcaattcctttgagtttcaaccttgeggtecgtactccccaggcggagtgett aatgegttagctcecggcactgaagggcggaaaccctccaacacctagcactcatecgtttacggcatggactacc agggtatctaatcctgttegctacccatgetttegagtctcagegtcagttgcagaccaggtagcecgecttege cactggtgttettccatatatctacgcattccaccgctacacatggagttccactaccctcttctgcactcaag ttatccagtttecgatgcacttctceggttaagccgaaggctttcacatcagacttagaaaaccgcctgcactec tetttacgcccaataaatccggataacgecttgccacctacgtattaccgeggctgctggcacgtagttagcegt gactttetggttaaataccgtcaacgtatgaacagttactctcatacgtgttettetttaacaacagagcttta cgagccgaaacccttcttcactcacgeggtgttgectccatcaggcttgegcccattgtggaagattccctactg ctgcectceccgtaggagtatgggcecgtgtetcagtcccattgtggcecgatcagtctectcaactcggctatgcate atcgccttggtaggcecgttaccccaccaacaagctaatgcaccgcaggtccatccagaagtgatagcgagaagc catcttttaagcgttgttcatgcgaacaacgttgttatgeggtattagcatctgtttccaaatgttgtccceceg cttctgggcaggttacctacgtgttactcacccgtcegccactegttggecgaccaaaatcaatcaggtgcaagc accatcaatcaattgggccaacgegttegac:/INSDSeq sequence» </INSDSeg> 34 </Sequencelatal

BL <Seduencelsta seqvenceliNumber="d*> 36 <INSDSeq> 37 <INSDSeg length>20</INSD5eq length» 3G <INSDSeg moltype>DNA</INSDSeg moltype> 3 <INSDSeq division PAT</INSDSeq division>

AU <INSDSeq feature-tahle> u 41 <IN3DFeature> 4% “INSDFeature keyrsource</INSDFeaturs key» 43 “INSDFeature location>l..20</IN3DFeature location 44 <INSDFeature guals> <INSDQualifier> 46 <INSDQualifier name>mol type</INSDRualifier name>

47 <INSDOualifier valusrother DNA</INIDOualifier valuer 48 </INSDQualifier> u

A <INSDQualifler id="gg9>

LG <INSDQualifizr name>organism</INSDOualifier named

Sl <INSDQualifisr valus>synthetic construct </INSDGualifier value» 52 </INSDDualliier> 32 </INSDFeature quals>

Sd </TNEDFeature> 55 “/INSDSeg feature-table»

De “INSDSeg sequencs>agagtttgatcctggctcag</INSDSeq sequence» 57 </INSDSeg> he </Seguencebata> 5g <Sequencedata sagiencelDlumber="37> “0 <INSDSeg> ad <IN3DSeq length»20</INSDSeq lengith> a2 <INSDSeg moltype>DNA</INSDSeq moltype> a3 <INSDSeq division>PAT</INSD3eg division» a4 <INSDSeg feature-table>

Gh <INSDFeature> a8 <IN3DFeature hey>source</IN3DFeature hey» 7 <INSDFeature location>1..20</INSDFeature Location» en <INSDFeature guals> a <INSDQualiifisr>

GG <IN3DQualifier name>mol type</INSDQualifier name>

TL <INSDQualifier valuelother DNA“/INSDQualifier values

FE </INSDOualifiers

EN <INSDQuaizifier ia=tglilv>

Fd <INSDQualifier namerorganism</INSDCualiifier name>

TE <INSDQualifier valuersynthetic construct </INSDgualifier value» 7E </INSDQualifiers» 77 </INSDFeature quals> 78 </INSDFeatures 7 <{INSDSeg feature-takle>

GU <INSDSeq sequence>tacgacttaacceccaatege</INSDSeq sequsnce> 41 </INSDSeg>

G3 </SaequenceData a3 <SedgquenceData seguanceliNumbaer="47>

Gd CINSDSeg> a5 <INSDSeq length>19</INSDSeq length

Sa <INsSDfeq moltyperDNA</INSDSeg moitype> 27 <INSDSeq divigion>PAT</INSDSeg division» ga <INSDSeqg featurertabie» 8a <INSDFeatures <IN3DFeature keyrsource</IN3DFeature key» il <INSDFeature location>1..19</INSDFeature iccation> 32 <INSDFeature guals> 33 <INSDQualifier>

G4 <INSDgualifier name mol type</INSDQualifier nama> 95 <INSDQualiifier valuevother DNA</INSDQualifier value» zE </INSDGuaiifien> 37 <INSDQualifier 1d4=TgR2%>

SG <IN3DQualifier namevorganism</INSDQualifier name>

GG <INSDQualifler valuessynthetic construct </INSDRualifier values 100 </INSDCualifiern

LOL </INSDFeature quals»

TOE </INSDFeature»

LOS </INSDSeu feature-table> 104 <INSDSeq sequence»eetgtagcccacgtegtag:/INSDSeg sequence 105 </INSDSeg>

LOE </Sequencebatad>

LOT <Sequencebata zsegvencellNvumbec="5*z> ids <INSDSeqg>

Li <INSDSeq length>22</INSDSeq length>

LLG <INSDSeq moliype>DNA</INEDIag moliypa> 11d <INSDSeq division»PAT</INIDSzqg division>

LE <INSDSeq feature-table> lij <INSDFeature>

Lid “INSDFeature keyrsource</INSDFeaturs key»

Lis <INSDFeature location>l..22</IN3DFeature location»

Lie <INSDFeature cquals> u

LLT <INSDOuelijler»>

Lis <INSDQualifizr name>mol type</INSDoualifier named

Ti: <INSDQvalifier valus>other DNA</INSDQualifiern value>

LEG </INSDDualliier>

LEL <INSDQualiiler id="gg3r> 122 <INSDQualifier nams>organism</INSDRualifier named

LEZ <INSDQualiflisr valus>synthetic construct </INBDCualifier value» 12d </INSDDOualifier»> 125 </INSDFeature quals> 128 </INSDFeature»> 127 </INBDSeqg feature-table> ize <IN3DSeq =zequence>gggagtagacaaggtacaacce</IN3DSeqg sequenced 128 </INSDBeg> 130 </SeguenceData> 13% <SeguenceData seauencelDNumber="&N> 132 <INSDSeg> 133 <INSDSeq lengih>23</INSDSeq lengch> 134 <INSDSeq moltype>DNA</INSDSeg moltyper 13% <IN3DSeq divisilon>PAT</INSDEeq division> 138 <INSDSeq feabure-table>

TRE <INSDFeaturse> 138 <IN3DFeature key>source</IN3DFeature key>

L3G <INSDFeature location>l..23</IN3SDFeature location»

LAG <INSDFeature guals> u

LAD <INSDQualifier>

Laz <INSDQualifier namedmol type</INSDCualiifier name>

LAS <INSDQualifier valuerother DNA</INSDQualifier values

Láá </INSDQualifiers»

HE <INSDQualifiler id=tgddd>

LAE <INSDQualifier namerorganism</INSDQualifier name> 147 <INSDQualifisr valus>synthetic construct </INSDQualifier valued 148 </INSDOQualifiers

Tal </INSDFeaturs quals> 159 </TNEDFeature> ini </INSDEeq feaature-table> 152 <INSDSeq sequence>tagteetteetaccccaatttee:/INSISeq ssguenca> 152 </INSDSaeg> 154 </Seguencebata> 155 “SequenceData seaguencelDNumber="7F7> 15a <INSDSeq> 157 <INSDSeq length>21</INSDSeq length> ihe <INSDSeg moltype>DNA</INSDSeq moltype> 188 <INSDSeq division>PAT</INSDSeg division» ien <INSDSeq feature-table> 1A <INSDPeature> 182 <IN3DFeature hey>source</IN3DFeature hey» 183 <INSDFeature location>l..21</INSDFeature location» 164 <INSDFeature guals> 18s <INSDQualifiec> ied <IN3DQualifier name>mol type“/INSIQualifier name> iej <INSDoualiiler valuevother DNA“ /INSDQvalifier value 1a8 </INSDCualifiern ies <INSDQualifier id=Vg25nx>

LEG <INSDQualifier namerorganism</INSDCualiifier name>

LL <INSDQualifier value»synthetic construct </INSDQualifier valued

EE </INSDOualifiers

LS </INSDFeature dquals> 174 </INSDFeature>

HN </INSDSeg feature-table> iG <INSDSeg sequencerttggtecttagecactectte</iNSDSeq sequencer 177 </INSDSag>

LS </SequenceData>

BARE. <HGegquenceData seguanceTLNugbhao="8">

Lol AINSDSeq 181 <INSDSeq length>22</INSDSeq Lengih> 182 <INSDSeq moltyperDNA</INSDSag moliypex

LTE <INSDSeq division PAT</INSDSeq division>

Lod <INSDSeq feature-table> u

Lon <INSDFeature»

LOE “INSDFeature keyrsource</INSDFeaturs key»

Lan “INSDFeature location>l..22</IN3DFeature location 188 <INSDFealure guals>

Las <INSDQualifier>

Ze <INSDQualifier nams>»mol1 type</INSDRualifier named ee <INSDQualifler valussother DNA</INSDQualifier value> 102 </INSDDOualifier»> 153 <INSDOualifier id="g28%> ijd <INsSDQualifiler name>organism</INSDQualifier named 135 <INSDQualifier value>synthetic construct </INSDQualifier value» 188 </INSDOualifier> 187 </INSDFeature guals> 139 </INSDFeatura> 18% </TN3DSag feature-tablex 200 <INSDSeg seguence>rgaaatgccaccttttgacagtg/INSDSag sequence 2071 </INSDSeg> u 202 </SegvenceDalar 207% <Seqgquencebata zagquencallDNumber=ngns 204 <INSDSeq> 20% <INSDSeg Lengih>21</INSDSeq length» 206 <INSDSeg moltype>DNA</INSDSeq moltype> 247 <INSDSeg division>»PAT</INSDSeg division»

ZUS <INSDSeq feature-tables u

ZOU <INSDFeature>

ZEG <INSD¥eature key>source</INSDFeature key»

Zi <INSDFeature location>l..21</IN3DFeature location» die <INSDFeature quals> u

ALS <INBDQualiifier>

Sh <INSDQualifier namermol type</INSDQualifier name>

PAA] <INSDQualifier valus>other DNA</INSDQualifisr valuer

ZL </INSDOQualifiers u “17d <INSDQualifler id="gs7>

SLE <INSDQualifizr name>organism</INSDOualifier named

Zij <INSDgualifier valus>synthetic construct </INSDGualifier value»

Ei) </INSDOualLliier»

Zed </INSDFeature quals> 222 </INSDFeature»> zal “/INSDSeg feature-table» zz “INSDSeg sequencs>tggatgctetcatcaggacag:/INSDSeq sequenced 228 </INSD3Sec> 228 </SeguenceData> 227 <Sequencedata saquencellumber="10"> 228 <INSDSeg> 228 <IN3DSeq length»20</INSDSeq lengith> 230 <INSDSeq moltype>DNA</INSDSeg moltyper 23 <INSDSeq division>PAT</INSD3eg division» 232 <INSDSeg feature-table> 233 <INSDFeature> 2734 <IN3DFeature key>source</IN3DFeature key> 23% <IN3DFeature location>1..20</INSDFeature Location» 236 <INSDFeature guals> 2 <INSDQualiifisr> 233 <INSDQualifier namedmol type</INSDCualiifier name> 23% <INSDQualifier valuelother DNA“/INSDQualifier values 240 </INSDOualifiers

ZAL <INSDQuaizifier ia="gl89>

ZAL <INSDQualifier namerorganism</INSDQualifier name>

EAS <INSDQualifier valuersynthetic construct </INSDgualifier value»

ZÂAÂ </INSDQualifiers»

Aas </TNSDFeaturs quals>

AAG </INSDFaatures> u wan <{INSDSeg feature-takle>

AAG “INSDSeq sequencerttaaaatgagattgtccgaa“/INSDSeq sequsnce> 2A </INSDSaeg> £50 </SaequenceData nl <Sequencebata segvencelbNumbec="1ljx>

PA <INSDSag>

PAIN <INSDSeq length>20</INSDSeqy length» ald <INSDSeq moliype>DNA</INEDIag moliypa>

Ass <INSDSeq division»PAT</INIDSzqg division> £58 <INSDSeq feature-tablex £57 <INSDFeature> 258 “INSDFeature keyrsource</INSDFeaturs key» £53 “INSDFeature location>l..20</IN3DFeature location? 250 <INSDFeature guals> aL <INSDOQualifier>

Zal <INsSDQualifiler name>mol type</INSDQualifier named al <INSDQualifier value>other DNA</INSDQualifier value»

Jad </INSDOualifier> 255 <INSDQualifier ld="gR®">

En <iNsSDQualifier namerorganism</INSDQualifier name> 2a <INSDQualifier value>synthetic construct </INSDQualifier value»

DEA </INSDQualifier> 288 </INSDFeature quals> 250 </TNSDFeatura>

ZL </INSDSeg feature-tabla>

ZE <INSDSeyq sequenceragatcacctetgectgagta</INIDSaeq sequence 275 </INSDSeg> u 274 </Seqguencelatal>

Zj <SeduencelDeta secqvencsliNumber="ig!» 27E <“INSDSeq> <INSDSeq length>20</INSLSeq length 29a <INSDSeq molitype>DNA</INSDSeq moltype»> 2 <INSDSeq division PAT</INSDSeq division>

ZOU <INSDSeq feature-tahle> u el <INSDFeature>

ZOE <INSDFeature keyrsource</INSDFeature key>

PATI <INSDFeatvure location>l..20</IN3DFeature locations

PRE: <INSDFeature quals> IJ

Zes <INSDOuelijler»>

ZES <INSDQualifizr name>mol type</INSDoualifier named a <INSDQualifler valussother DNA</INSDQualifier value>

ZEE </INSDOualLliier»

Zin <INSDQualiiler id="g39%> ii) <INSDQualifier nams>organism</INSDRualifier named

Zal <INSDQualifier value>synthetic construct </INBDCualifier value» ze </INSDDOualifier»> za “/INSDFearure quals> 234 </INSDFeatura> 235 </INBDSeqg feature-table> 238 <IN3DSeq =zequence>ggagaggctgecatgacattg</IiN3DSeg sequence» 257 </INSDBeg> 288 </SegvenceDalar 238 <SeguenceData seauencelDNumber="ijN> 200 <INSDSeq>

GEL <INSDSeq lengih>22</INSDSeq lengch> <IN3DSeq moltype>DNA</INSDSeq moltype> 3073 <IN3DSeq divisilon>PAT</INSDEeq division> 304 <INSDSeq feabure-table> 30% <“INSDFeacure> 306 <INSD¥eature key>source</INSDFeature key» 307 <INSDFeature location>l..22</IN3SDFeature location» 303 <INSDFeature guals> u

BOG <INSDQualifier>

SLE <INSDQualifier namermol type</INSDQualifier name>

IL <INSDQualifier valuerother DNA</INSDQualifier values

Zil </INSDQualifiers»

SLS <iNSDQvuelifier ia="gSlx> sLá <INSDQualifizr namerorganism</INSDQualifier name>

SLS <INSDQualifisr valus>synthetic construct </INSDGualifier value» 418 </INSDOQualifiers

Si </INSDFeature quals> sim </TNEDFeature>

SLS </INSDSeq Zeature-table>

IE <INSDSeq sequencevggtagagccatagtggaatgac-“/INSDSeq sequences

SEL </INSDSag>

SAE <{SeguenceDela>

SED <sSequenceDeta sequence lUNumhzr="14">

RYE CINSDSeg> sen <INSDSeq length>23</INSDSeq Lengih>

En <INSDSeq moltyperDNA</INSDSag moliypex

SE <INSDSeq division»>PAT</INSDSeg division» 329 <INSDSeqg featurertabie» 523 <INSDFPeature> 324 <INSDFeature keyrsource</INSDFeature key> 321 <INSDFeature location>»l..23</IiNSDFeature location» 222 <INSDFeature guals> 232 <INSDQualifier> 234 <iNsSDQualifier name>mol type“/INSDQualifier name> 235 <INSDQualifier value>other DNA</IN3DQualifier value» 226 </INSDGuaiifien> 237 <INSDQualifier 1d4="gl2%> 238 <INSDgualifier name>organism</INSDQualifier nama> 238 <INSDQualiiler valuersynthetic construct </INSDRualifier values 340 </INSDCualifiern 340 </INSDFzature duals» 345 </INSDFealurex

GAS </INSDSeu feature-table> 44 <INSDSeq sequencergaataccagectgatccatggaa</INSDSeg sequences 14% </INSDSeq> u 346 </Sequencelatal 347 <Sequencebata seguenasiliNombhar="189s 4G <INSDSeqg>

Fh <INSDSeg length>26</INSD5eq length»

FLU <INSDSeg moltype>DNA</INSDSeg moltype>

SLE <INSDSeq division»PAT</INIDSzqg division>

SLE <INSDSeq feature-table>

SLS <INSDFeature»

Sid “INSDFeature keyrsource</INSDFeaturs key» 355 “INSDFeature location>l..26</IN3DFeature location? 358 <INSDFealure guals> 57 <INSDQualifier>

LE <INSDQualifier nama>mol type</INSDRualifier named 358 <INSDQualifier value>other DNA</INSDQualifier value»

SA </INSDDOualifier»>

Sal <INSDOualifier id="g33%> 482 <INsSDQualifiler name>organism</INSDQualifier named

San <INSDQualifier value>synthetic construct </INSDQualifier value» 263 </INSDOualifier> 285 </INSDFeature guals> 288 </TNSDFeatura> 267 </INSDSeag feature-table>

Ian <INSDSeg gequencerteetccaggagggtgtccaccgcatg:/INSDSeg saguencea 26e </INSDSeg> IJ 3G </Beguencelata

SE <Seqguencebata sequencelDNumber="i&nx

SEE <INSDSeq> 33 <INSDSeg lengith>18</INSDSeq length»

IVA <INSDSeq molitype>DNA</INSDSeq moltype»>

IL <INSDSeg division>»PAT</INSDSeg division»

IEG <INSDSeq feature-table> u 3 <INSDFeature>

Gig <INSDFeature keyrsource</INSDFeature key>

Ra <INSDFeature location>l..18</IN3DFeature location»

IHU <INSDFeature quals> u

BEL <INBDQualiifier> sal <INSDQualifizr name>mol type</INSDoualifier named

Sol <INSDQualifier valus>other DNA</INSDQualifisr valuer sad </INSDOQualifiers u sos <INSDQualifler id="g34> 388 <INSDQualifier nams>organism</INSDRualifier named

Snij <INSDgualifier valus>synthetic construct

</INSDQualifier value» 168 </INSDQualifier> so </TNSDFeaturs quals> sel </INSDFaatures> u

Sei <{INSDSeg feature-takle> 302 <INSDSeq segquenceragagagatcgggttcaca</INESDSay sequence»

REICH </INSDSaeg>

RIERS </SaequenceData 305 <SegquenceDalta seguanceliNunbaer="17%> 256 <INSDSeqg> 307 <INSDSeq length>18</INSDSeq length> 339 <INsSDfeq moltyperDNA</INSDSeg moitype> 523 <INSDSeq divigion>PAT</INSDSeg division» 400 <INSDSeq feature-tablex 401 <INSDFeature> 402 <IN3DFeature keyrsource</IN3DFeature key» 4072 <INSDFeature locationrl..18</INSDFeature location> 404 <INSDFeature guals> 40% SINSDOualifiar> 40a <INSDgualifier name mol type</INSDQualifier nama> 4407 <INSDQualiifier valuevother DNA</INSDQualifier value» 308 </INSDGualifier:

JOS <INSDQualifier id="g35nx>

JLG <IN3DQualifier namevorganism</INSDQualifier name>

JL <INSDQualifler valuessynthetic construct </INSDQualifier valued

Alk </INSDQGualifier»

ALS </INSDFeature quals» 414 </INSDFeature»

A15 </INSDSeq Zeature-table> 414 <INSDSeg sequencercacagaactgagggtaca</INSDSeq sequenced 417 </INSDSeg>

Als </SequenceDala>

Ain <sSequenceDeta sequence lUNumhzr="18">

AED AINSDSeq dal <INSDSeq length>23</INSDSeqy lengtub> dz <INSDSeq mltype>DNA</INSDSeg moliypa> £432 <INSDSeq division»>PAT</INSDSeg division» dad <INSDSeq featurertablex £450 <INSDFeature>

AEG “INSDFeature keyrsource</INSDFeaturs key» 427 <INSDFeature location>»l..23</IiNSDFeature location» 429 <INSDFeature guals> 409 <INSDOQualifier> 420 <INsSDQualifiler name>mol type</INSDQualifier named 453 <INSDQualifier value>other DNA</IN3DQualifier value» 422 </INSDQualifier> 437 <INSDOualifier 1d=Vgl38"> 454d <iNsSDQualifier namerorganism</INSDQualifier name> 435 <INSDQualiiler valuersynthetic construct </INSDQualifier value» 436 </INSDQualifier> 437 </INSDFeature quals> 335 </INSDFealurex 339 </INSDSeg feature-tabla> 440 <INSDSeyg sequence>tgacectecaactacatggtetaca</INSDSag sequence dal </INSDSeg> IJ 44% </Sequencelatal 4473 <SeduencelDeta seguencelilNunbhar=vr189> 444 <INSDSeg> 44% <INSDSeq length>19</INSLSeq length 444 <INSDSeg moltype>DNA</INSDSeg moltype> 447 <INSDSeq division PAT</INSDSeq division> 44 <INSDSeq feature-tahle> u dát <INSDFeature>

G50 “INSDFeature keyrsource</INSDFeaturs key»

ALL <INSDFeatvure location>l..19</IN3DFeature locations

ALE <INSDFeature quals> IJ 453 <IN3DQualifier> 454 <INSDQualifier nama>mol type</INSDRualifier named 455 <INSDQualifler valussother DNA</INSDQualifier value>

ARE </INSDOualifiers 457 <INSDQualifler id="g37> 458 <INSDQualifizr name>organism</INSDOualifier named 457 <INSDQualifisr valus>synthetic construct </INSDQualifier value» 460 </INSDDualliier>

ASL </INSDFeature quals> 4672 </INSDFeaturex> £632 </INSDEeq feaature-table> ind <INSDSeq zegquence>ettcccatteteggcecttg</INSD3eq sequence» 455 </INSDSeg> 488 </Seguencebata> 487 </&T253eguencelisting> 489

Claims (9)

CONCLUSIONS 1. Lactobacillus fermentum (Lactobacillus fermentum), characterized in that it has collection number CGMCC No. 24629 has been submitted to the General Microbiological Center of the Chinese Microbiological Culture Collection Management Committee. Lactobacillus fermentum according to claim 1, characterized in that a 16SrDNA sequence contains a sequence as shown in SEQ ID No. 1. 3. Composition, characterized in that the composition contains one or a combination of a plurality of the following substances: {a} the lactobacillus fermentum according to claim 1 or 2; (b) a lysate of the lactobacilius fermentum according to claim 1 or 2; (c) a culture of the lactobacillus fermentum according to claim 1 or 2; and (d) a fermentation broth of the lactobacillus fermentum according to claim 1 or 2. Composition according to claim 3, characterized in that the composition further contains one or combinations of probiotics, prebiotics, dietary fiber and traditional Chinese medicine. 5. Preparation, characterized in that the preparation comprises the lactobacillus fermentum according to claim 1 or 2, or the composition according to claim 3 or 4, and a carrier, wherein the carrier is a medicinal carrier or an edible carrier. Preparation according to claim 5, characterized in that the preparation is tablets, pills, capsules, powders, gels, granules or liquids. Use of the lactobacillus fermentum according to claim 1 or 2 or the compositions according to claim 3 or 4 in the preparation of preparations that can alleviate alcohol-induced gastric damage. Use according to claim 7, characterized in that the use comprises one or more of the following combined uses: (a) a use of the lactobacillus fermentum according to claim 1 or 2, or the composition according to 3 or 4 in the preparation of the preparation that can alleviate the oxidative damage induced by alcohol to stomach tissue; (b) a use of the lactobacillus fermentum according to claim 1 or 2 or the composition according to 3 or 4 in the preparation of the preparation that can reduce the inflammatory response of alcoholic gastric tissue; (c} a use of the lactobacillus fermentum according to claim 1 or 2 or the composition according to 3 or 4 in the preparation of the preparation that can reduce the endothelial Nitric Oxide Synthase (eNOS) and/or neuronal NOS (nNOS) expression levels in gastric tissue and/or may reduce induced NOS (iNOS) expression levels. Use according to claim 8, characterized in that the use {a} comprises: the use of the lactobacillus fermentum according to claim 1 or 2, or the composition according to 3 or 4 in the preparation of the preparation that increases the SOD activity and /or can improve GSH content in alcohol-induced gastric tissue, and/or reduce the MDA content in alcohol-induced gastric tissue; the use (b) includes: the use of the lactobacitlus fermentum according to claim 1 or 2, or the composition according to claim 3 or 4 in the preparation of the preparation that reduces the expression levels of Tumor Necrosis Factor a (TNF-a) and/or Leukin -1 B (L-1B) and/or Interleukin-6 (IL-6) and/or Cyclooxygenase-2 {COX-2) may reduce inflammatory factors in alcohol-induced gastric tissues,