NL2034796B1

NL2034796B1 - Preparation method and application of fluorescent-labeled exosomes

Info

Publication number: NL2034796B1
Application number: NL2034796A
Authority: NL
Inventors: Hu Dong; An Junling; Yang Ruyue; Liang Gaofeng; Du Jingxia; Li Tian; Mao Longfei
Original assignee: Univ Henan Science & Tech
Priority date: 2023-05-10
Filing date: 2023-05-10
Publication date: 2024-01-09

Abstract

The invention discloses a preparation method and application of a fluorescent-labelled exosome, and belongs to the field of biotechnology. The preparation method comprises transferring genes encoding green fluorescent protein EGFP and exosome marker protein LAMP into cells to obtain recombinant cells capable of stably expressing green fluorescent protein EGFP, separating exosomes from the culture supernatant of the recombinant cells, purifying the exosomes by density gradient centrifugation, and filtering by a filter membrane to obtain exosomes with fluorescence signals. According to the invention, the exosomes containing EGFP markers are extracted from the cultured supernatant of HEK293 cell strain by genetic engineering, the method is simple and convenient, and the exosomes do not contain fluorescent dyes; and by utilizing the unique function of the exosomes and the advantages of EGFP tracing in vivo and in vitro, the disadvantage that the conventional fluorescent dye-labelled exosomes interfere with fluorescence observation due to dye diffusion can be avoided, and a powerful tool is provided for studying the mechanism of substance transfer between cells.

Description

PREPARATION METHOD AND APPLICATION OF FLUORESCENT-LABELED EXOSOMES

TECHNICAL FIELD

The invention relates to the field of biotechnology, in particular to a preparation method and application of fluorescent-labelled exosomes.

BACKGROUND

Exosomes are a kind of microcapsules with the size of 30-120 nm secreted by cells to their surroundings, and the density ranges from 1.13 to 1.21 g/ml. Many cells in the body, such as B lymphocytes, T lymphocytes, dendritic cells, mast cells, platelets and tumour cells, can secrete exosomes. In recent years, it has been found that some abnormally expressed oncogenes or proteins in tumour cells are also highly expressed in exosomes secreted by them, and there is a certain correlation with tumours. Therefore, people pay more and more attention to exosomes as markers of disease diagnosis. At the same time, these nano-scale exosomes can also carry the mRNA, miRNA and protein of donor cells to shuttle between cells, and mediate the transfer of these substances between different cells to realize the information exchange between cells.

This exosomes shuttle RNA provides a new way for gene (or drug) delivery.

Because of the great application potential of exosomes in disease diagnosis and treatment, more and more scientific research and clinical research institutions at home and abroad have conducted in-depth research on exosomes. Despite the rapid development in this field in recent years, however, the problem of exosomes labelling is still not well solved, mainly because lipophilic dyes, such as PHK67 and DiO, are mainly used to dye exosomes. Although this method is simple and convenient, there are some problems that cannot be ignored in the experiment of using lipophilic dyes to dye exosomes as recipient cells to absorb exosomes: using lipophilic dyes to dye some components such as proteins and lipoproteins that do not contain vesicles. Then incubated with the recipient cells, the free dyes that cannot be completely removed can also be absorbed by the recipient cells, even more strongly than the samples containing vesicles, because it is difficult to avoid the inclusion of protein and lipid impurities by the current means of purifying exosomes.

SUMMARY

The invention aims to provide an exosome with a fluorescent signal and a preparation method thereof, so as to solve the problems existing in the prior art. According to the invention, the unique function of exosomes and the advantages of tracing green fluorescent protein in vivo and in vitro are utilized, so that the defect that the conventional method of marking exosomes with fluorescent dyes interferes with fluorescence observation due to dye diffusion is effectively avoided.

In order to achieve the above objectives, the present invention provides the following scheme.

The invention provides a preparation method of fluorescent-labelled exosomes, which comprises the following steps: transferring genes encoding green fluorescent protein EGFP and exosomes marker protein LAMP into cells to obtain recombinant cells capable of stably expressing green fluorescent protein EGFP, separating exosomes from the culture supernatant of the recombinant cells, purifying the exosomes by density gradient centrifugation method, and filtering by a filter membrane to obtain exosomes with fluorescence signals.

Further, transferring the genes encoding the green fluorescent protein EGFP and the exosome marker protein LAMP into cells includes constructing a recombinant plasmid capable of fusion expressing the green fluorescent protein EGFP and the exosome marker protein

LAMP and transfecting the cells.

Further, the construction method of the recombinant plasmid includes the following steps: using the cDNA of HEK293 cell as a template and the sequence shown in SEQ ID NO.1-2 as a primer to carry out PCR amplification to obtain the target gene fragment shown in SEQ ID NO.4, and transferring the target gene fragment into the plasmid with the sequence shown in SEQ ID

NO.3 to obtain the recombinant plasmid.

Further, the amplification system of PCR amplification is 10xPCR Mix 2 pl, 2.5 HM dNTPs 2

Hl, Forward primer 1 pl, Reverse Primer 1 pl, Tag enzyme 1 pl, cDNA 1 pl, and ddH2O water is added to 20 pl; the amplification conditions are 95°C for 5 min, pre-denatured at 95°C for 5 min, followed by the following cyclic reactions: denaturation at 94°C for 30 sec, annealing at 59°C for 30 sec, extension at 72°C for 60 sec, 30 cycles and extension at 72°C for 10 min.

Further, the density gradient centrifugation method is an iodixanol density gradient centrifugation method.

Further, the pore size of the filter membrane is 0.22. um.

The invention also provides fluorescent-labelled exosomes prepared by the preparation method.

The invention discloses the following technical effects: according to the invention, a recombinant plasmid containing green fluorescent protein

EGFP and transmembrane protein LAMP is constructed, and then the recombinant plasmid is transfected into HEK293 cells, so that the prepared genetically engineered HEK293 cell strain can stably secrete exosomes labelled with green fluorescent protein, and the exosomes labelled with green fluorescent protein are effectively separated and purified by a step-by-step centrifugation method, and the disadvantages that the conventional method of labelling exosomes with fluorescent dyes interferes with fluorescence observation due to dye diffusion are effectively avoided by utilizing the unique functions of exosomes and the advantages of tracing green fluorescent protein in vivo and in vitro.

BRIEF DESCRIPTION OF THE FIGURES

In order to explain the embodiments of the present invention or the technical scheme in the prior art more clearly, the drawings needed in the embodiments will be briefly introduced below.

Obviously, the drawings described below are only some embodiments of the present invention, and other drawings can be obtained according to these drawings without creative work for ordinary people in the field.

Fig. 1 is an electropherogram of the PCR product of LAMP gene prepared by the present invention, where A is PCR product and B is Marker;

Fig. 2 is an electropherogram of the LAMP fragment obtained after the recombinant plasmid prepared by the invention is digested by Bg/ll and Kpnl; among them, A and B are electropherograms of plasmid DNA extracted from different colonies of the same recombinant plasmid by double enzyme digestion, and C is Marker;

Fig. 3 is a fluorescence micrograph of HEK293 cell line successfully transfected with EGFP recombinant plasmid according to the invention; among them, A is the fluorescence imaging picture of untransfected HEK293 cells, and B is the fluorescence imaging picture of transfected recombinant plasmid,

Fig. 4 is a flow chart of the step-by-step centrifugal extraction process of successfully labelled

HEK293 cell exosomes according to the invention;

Fig. 5 is a Western blot detection map of the purified exosome membrane surface marker protein of the present invention, in which (A) and (B) are bands corresponding to unlabelled and EGFP-labelled exosome, respectively;

Fig. 6 is a particle size distribution diagram detected by a nano-particle size analyser after purification of exosomes in the present invention;

Fig. 7 is a TEM high-resolution transmission electron microscope diagram of the purified exosomes of the present invention;

Fig. 8 is a high-resolution fluorescence microscopic imaging of the purified exosomes of the present invention;

Fig. 9 is a mass spectrum diagram of the recombinant plasmid pEGFP-N2- LAMP of the present invention.

DESCRIPTION OF THE INVENTION

A number of exemplary embodiments of the present invention will now be described in detail, and this detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention.

It should be understood that the terminology described in the present invention is only for describing specific embodiments and is not used to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed.

Intermediate values within any stated value or stated range, as well as each smaller range between any other stated value or intermediate values within the stated range are also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention relates. Although the present invention only describes the preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In case of conflict with any incorporated document, the contents of this specification shall prevail.

It is obvious to those skilled in the art that many improvements and changes can be made to the specific embodiments of the present invention without departing from the scope or spirit of the present invention. Other embodiments will be apparent to the skilled person from the description of the invention. The description and example of that present invention are exemplary only.

Example 1

Obtaining the exosome marker protein LAMP gene 1. Cell culture

Adherent culture of HEK293 cells was carried out in DMEM medium containing 10% foetal bovine serum in a saturated humidity incubator at 37°C and 5% CO: until the cell density reached over 80%. 2. Total RNA extraction and cDNA preparation.

HEK293 cells with fusion density above 80% were washed twice in PBS, digested with trypsin digestive juice (0.25%Trypsin, 0.02% EDTA) for 1 - 2 min, and centrifuged at 1200 r/min for 5 min. Cell precipitates were collected, total RNA was extracted by guanidine isothiocyanate/phenol method (TRIZOL), and then Oligo-(dT) was 2 pl, Reverse Transcriptase 1 ul, template RNA 1 pl, add RNase-Free water to 20 pl. Amplification conditions: 37°C, 60 min; recovering cDNA from gel.

Using cDNA as template, LAMP gene containing restriction endonuclease BamHI, Hindlll site and linker sequence was amplified by upstream and downstream primers (see Fig. 1).

Amplification primers:

Forward Primer: 5-CGCAGATCTGCCACCAGTTCGTTGCAACAAATTGATGA-3 (SEQ ID NO. 1);

Reverse Primer: 5-CCCGGTACCCATCACCTCAATTTGTTGCAACGAAC-3’ (SEQ ID NO.2);

Amplification system: 10 x PCR Mix 2 pl, 2.5 HM dNTPs 2 pl, Forward primer 1 pl, Reverse

Primer 1 pl, Taq enzyme 1 pl, cDNA 1 pl, adding ddH2O water to 20 pl;

Amplification conditions: 5 min at 95°C, 5 min after pre-denaturation at 95°C, the following cyclic reactions were started, denaturation at 94°C for 30 sec, annealing at 59°C for 30 sec, 5 extension at 72°C for 60 sec, and extension at 72°C for 10 min after 30 cycles. After the reaction, 10 pl was taken from the reaction solution, and the amplification results were examined by electrophoresis.

The gel recovery product was connected with pMD-18T carrier at 16°C overnight to transform DH5a competent bacteria. The positive monoclonal bacteria were cultured in LB medium containing kanamycin for 16 h on a constant temperature shaker (200 r/min) at 37°C, and the plasmid was extracted. After being digested by Bam | and Hindlll, it was identified and sent to Shanghai Shenggong Bioengineering Technology Co., Ltd. for sequencing and comparison, and the correct target gene fragment LAMP-Linker was obtained.

Linker sequence: CCGGAATTCATG (SEQ ID NO.5).

Example 2

Construction and Identification of Recombinant Fusion Expression Plasmid Vector

The recombinant plasmid pEGFP-N2-Linker LAMP was constructed according to the standard molecular cloning method.

The correctly identified pMD-18T-LAMP plasmid was digested with Bgl II and Kpn I, and the target fragment was recovered by gel. Activate pEGFP-N2 plasmid at 4°C, transform

Escherichia coli DH5a competence, coat kanamycin-resistant plate, select positive monoclonal bacteria in kanamycin-resistant LB culture solution, culture on a constant temperature shaker at 37°C for 16 h at 200 r/min, and extract plasmid for later use. Identify the correct pEGFP-N2-

Linker LAMP plasmid, cut it with Bam | and Hindlll, and recover 4694bp fragment by gel. The target gene fragments of plasmid skeleton pEGFP-N2 (SEQ ID NO.3) and LAMP-Linker (SEQ

ID NO.4) (molar ratio of 1:3) were ligated at 16°C for 4 h and transformed into competent DH5a.

Positive clones were selected for amplification, and the plasmids were extracted and purified to obtain recombinant plasmids, which were subjected to electrophoresis after enzyme digestion (see Fig. 2). As shown in Fig. 9.

Example 3

Preparation of HEK293 cell line with stable expression of green fluorescent protein

Adherent culture of HEK293 cells (purchased from Shanghai Cell Bank of Chinese

Academy of Sciences) was carried out in a DMEM medium containing 10% foetal bovine serum, placed in a saturated humidity incubator at 37°C and 5% CO:2. When the confluent degree of cells reached more than 80%, the cells were digested and subcultured, and inoculated into 24-

well plates at the density of 1 x 10° cells per well by counting, and cultured at 37°C for 24 h until they adhered to the wall completely.

Plasmids were mixed with cationic transfection reagents, incubated at room temperature for 10 - 15 min, and then transfected into the adherent HEK293 cells at the ratio of copy number of recombinant plasmid/cell number of 5000. After 48 h, the expression of green fluorescent protein was detected by inverted fluorescence microscope, and then it was preliminarily screened by G418. After screening, it was cultured stably for 3 - 5 days, and then conventional

EGFP IS screened by flow cytometry. The screened single cells were cloned into a 96-well plate, and HEK293 cell line stably expressing EGFP was screened out. The results are shown in Fig. 3, which shows that the successfully transfected HEK293 cell membrane emits green fluorescence, and there is also green fluorescence where exosomes are produced or dense.

Example 4

Extraction of successfully labelled HEK293 cell exosomes

The exosomes were extracted by differential centrifugation (see Fig. 4 for the flow chart).

The specific extraction method of exosomes by step centrifugation is as follows: firstly, the supernatant of HEK293 cell line stably expressing green fluorescent protein was centrifuged at 300 g for 10 min, at 2,000 g for 10 min and at 12,000 g for 30 min at 4°C to remove cell debris, and the first supernatant was obtained.

Although most of the cell debris was removed from the obtained first supernatant, it still contained other impurities and toxins. Therefore, the iodixanol density gradient centrifugation method was used to purify impurities: the iodixanol centrifugal liquid was diluted with 30

MMHEPS buffer containing 0.85wt%NacCl to obtain 45%, 35%, 25% and 15% diluted liquid respectively, and then added into the centrifuge tube according to the concentration from large to small. Finally, the obtained first supernatant was added and centrifuged at 100000xg for 2 h at 4°C, divide into 12 groups from top to bottom, and SDS-PAGE protein electrophoresis experiment is performed, and it is observed that exosomes were mainly concentrated in 1 - 4 groups. Then, the 1-4 components are filtered by a membrane with a pore size of 0.22 um, and centrifuged for 120 min at 4°C at 100,000 g to obtain purified exosomes. The purified exosomes were resuspended with PBS solution and stored at -80°C for later use.

Example 5

Identification of exosomes separated from HEK293 cell culture supernatant successfully transfected with EGFP recombinant plasmid 10 ug and 5 ug of the secreta purified in Example 4 were taken respectively, and the membrane surface marker proteins of the purified exosomes were detected by rabbit anti- human CD9, CD81, LAMP and GAPDH monoclonal antibodies (purchased from Abcam

Company, USA) in the Western blot test, and the unlabelled HEK293 cell exosomes were used as the control. The results are shown in Fig. 5: Specific bands of CD9, CD81, LAMP and

GAPDH proteins were detected, in which (A) and (B) in Fig. 5 were brands corresponding to 10 ug of unlabelled and EGFP-labelled exosome purified by the method in Example 4, respectively.

In addition, by nanometre particle size analyser detection, the particle size distribution of purified exosomes is mainly concentrated between 30 -80 nm (see Fig. 6).

The structure of exosomes was observed by transmission electron microscope (TEM), and it was found that round vesicles with the size of 30 - 120 nm were evenly distributed on the copper mesh (see Fig. 7).

The purified exosomes were observed by high-resolution laser confocal microscope, and it was found that the purified exosomes gave off a strong green fluorescence signal (see Fig. 8).

Because the size of exosomes is less than the optical diffraction limit (about 200 nm), the shape and internal structure of exosomes cannot be clearly seen by conventional optical means. Optical diffraction will produce Airy disk, and combined with systematic error, the projection of a point light source on the CCD chip presents a diffused patch occupying multiple pixels, and the image of exosomes on the fluorescent picture reflects its fluorescence characteristics.

The above-mentioned embodiments only describe the preferred mode of the invention, and do not limit the scope of the invention. Under the premise of not departing from the design spirit of the invention, various modifications and improvements made by ordinary technicians in the field to the technical scheme of the invention shall fall within the protection scope determined by the claims of the invention.

<?xml version="1.0" encoding="UTF-8"?> <IDOCTYPE ST26Sequencelisting PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST26Sequencelisting V1 3.dtd"> <ST26SequenceListing dtdVersion="V1 3" fileName="Exosome NL SeqlList.xml" softwareName="WIPO Sequence" softwareVersion="2.3.0" productionDate="2023-05-09"> <ApplicationIdentification> <IPOfficeCode>NL</IPOfficeCode> <ApplicationNumberText></ApplicationNumberText> <FilingDate></FilingDate> </ApplicationIdentification> <ApplicantFileReference>HENAN UNIVERSITY OF SCIENCE AND

TECHNOLOGY</ApplicantFileReference> <ApplicantName languageCode="en">HENAN UNIVERSITY OF SCIENCE AND

TECHNOLOGY</ApplicantName> <InventorName languageCode="en">LIANG Gaofeng</InventorName> <InventionTitle languageCode="en">Preparation method and application of fluorescent-labeled exosomes</InventionTitle> <SequenceTotalQuantity>5</SequenceTotalQuantity> <SequenceData sequenceIDNumber="1"> <INSDSeq> <INSDSeq_length>38</INSDSeq length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq division» <INSDSeq_feature-table> <INSDFeature> <INSDFeature key>source</INSDFeature_key> <INSDFeature location>1..38</INSDFeature location> <INSDFeature quals> <INSDQualifier> <INSDQualifier_name>mol type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier value> </INSDQualifier> <INSDQualifier id="q2"> <INSDQualifier_name>organism</INSDQualifier_ name> <INSDQualifier_value>synthetic construct</INSDQualifier value> </INSDQualifier> </INSDFeature quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>cgcagatctgccaccagttcgttgcaacaaattgatga</INSDSeq sequence» </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber="2"> <INSDSeq> <INSDSeq_length>35</INSDSeq length> <INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq division» <INSDSeq_feature-table> <INSDFeature> <INSDFeature key>source</INSDFeature_key> <INSDFeature location>1..35</INSDFeature location> <INSDFeature quals> <INSDQualifier> <INSDQualifier_name>mol type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier value> </INSDQualifier> <INSDQualifier id="g4"> <INSDQualifier_name>organism</INSDQualifier_ name> <INSDQualifier_value>synthetic construct</INSDQualifier value> </INSDQualifier> </INSDFeature quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>cccggtacccatcacctcaatttgttgcaacgaac</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber="3"> <INSDSeq> <INSDSeq_length>4737</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq division» <INSDSeq_feature-table> <INSDFeature> <INSDFeature key>source</INSDFeature_key> <INSDFeature location>1..4737</INSDFeature_location> <INSDFeature quals> <INSDQualifier> <INSDQualifier_name>mol type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier value> </INSDQualifier> <INSDQualifier id="q6"> <INSDQualifier_name>organism</INSDQualifier_ name> <INSDQualifier_value>synthetic construct</INSDQualifier value> </INSDQualifier> </INSDFeature quals> </INSDFeature> </INSDSeq_feature-table>

<INSDSeq_sequence>tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgc gttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatg ttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagt acatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccag tacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggtttt ggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggag tttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtagg cgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgtcagatccgctagcgctaccggactcagatct cgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatccaccggccggtcgccaccatggtgagcaa gegcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtg tccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgc cctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacga cttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacc cgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggca acatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcat caaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacaccccc atcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgaga agcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaag cggccgcgactctagatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctcc ccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaag caatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgta tcttaaggcgtaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaac caataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttgga acaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacg tgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccga tttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgc tggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtgg cacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgaga caataaccctgataaatgcttcaataatattgaaaaaggaagagtcctgaggcggaaagaaccagctgtggaatgtgtg tcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacc aggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcc cgcccctaactccgcccatcccgcccctaactcegcccagttccgcccattctccgccccatggctgactaattttttt tatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggc ttttgcaaagatcgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccg gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggc tgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagc gcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactgg ctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctg atgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagc acgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactg ttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatca tggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgtt ggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctccc gattcgcagcgcatcgccttctatcgccttettgacgagttcttctgagcgggactctggggttcgaaatgaccgacca agcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttc cgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccctagggggaggctaactg aaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacggtgttgg gtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaa tacgcccgcgtttettecttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcgggg cggcaggccctgccatagcctcaggttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggat ctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacccc gtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagat accaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgct ctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttac cggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaact gagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcc acctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctt tttacggttcctggccttttgctggccttttgctcacatgttctttcetgcgttatcccctgattctgtggataaccgt attaccgccatgcat</INSDSeq sequence» </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber="4"> <INSDSeq> <INSDSeq_length>1416</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq division» <INSDSeq_feature-table> <INSDFeature> <INSDFeature key>source</INSDFeature_key> <INSDFeature location>1..1416</INSDFeature_ location» <INSDFeature quals> <INSDQualifier> <INSDQualifier_name>mol type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier value> </INSDQualifier> <INSDQualifier id="qg8"> <INSDQualifier_name>organism</INSDQualifier_ name> <INSDQualifier_value>synthetic construct</INSDQualifier value> </INSDQualifier> </INSDFeature quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>cgcagatctgccaccagttcgttgcaacaagttcgttgcaacaaattgatgagcaatgctt ttttataatgccaactttgtacaaaaaagttggcatggtgtgcttccgcctcttcccggttccgggctcagggctcgtt ctggtctgcctagtcctgggagctgtgcggtcttatgcattggaacttaatttgacagattcagaaaatgccacttgcc tttatgcaaaatggcagatgaatttcacagttcgctatgaaactacaaataaaacttataaaactgtaaccatttcaga ccatggcactgtgacatataatggaagcatttgtggggatgatcagaatggtcccaaaatagcagtgcagttcggacct ggcttttcctggattgcgaattttaccaaggcagcatctacttattcaattgacagcgtctcattttcctacaacactg gtgataacacaacatttcctgatgctgaagataaaggaattcttactgttgatgaacttttggccatcagaattccatt gaatgacctttttagatgcaatagtttatcaactttggaaaagaatgatgttgtccaacactactgggatgttcttgta caagcttttgtccaaaatggcacagtgagcacaaatgagttcctgtgtgataaagacaaaacttcaacagtggcaccca ccatacacaccactgtgccatctcctactacaacacctactccaaaggaaaaaccagaagctggaacctattcagttaa taatggcaatgatacttgtctgctggctaccatggggctgcagctgaacatcactcaggataaggttgcttcagttatt aacatcaaccccaatacaactcactccacaggcagctgccgttctcacactgctctacttagactcaatagcagcacca ttaagtatctagactttgtctttgctgtgaaaaatgaaaaccgattttatctgaaggaagtgaacatcagcatgtattt ggttaatggctccgttttcagcattgcaaataacaatctcagctaccgggatgcccccctgggaagttcttatatgtgc aacaaagagcagactgtttcagtgtctggagcatttcagataaatacctttgatctaagggttcagcctttcaatgtga cacaaggaaagtattctacagcccaagagtgttcgctggatgatgacaccattctaatcccaattatagttggtgctgg tctttcaggcttgattatcgttatagtgattgcttacgtaattggcagaagaaaaagttatgctngatatcagactctg tacccaactttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaaccccggtacccac ccggaattcatg</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber="5"> <INSDSeq> <INSDSeq_length>12</INSDSeq length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq division» <INSDSeq_feature-table> <INSDFeature> <INSDFeature key>source</INSDFeature_key> <INSDFeature location>1..12</INSDFeature location> <INSDFeature quals> <INSDQualifier> <INSDQualifier_name>mol type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier value> </INSDQualifier> <INSDQualifier id="ql0"> <INSDQualifier_name>organism</INSDQualifier_ name> <INSDQualifier_value>synthetic construct</INSDQualifier value> </INSDQualifier> </INSDFeature quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>ccggaattcatg</INSDSeq sequence» </INSDSeq> </SequenceData> </ST26SequenceListing>

Claims

CONCLUSIONS

1. A method for preparing a fluorescently labeled exosome, comprising the following steps: — transferring genes encoding green fluorescent EGFP protein and exosome LAMP marker protein into cells to obtain recombinant cells capable of green to stably express fluorescent EGFP protein, — separating exosomes from the supernatant of the recombinant cells, and — purifying the exosomes by a density gradient centrifugation method and filtration through a filter membrane to obtain exosomes with fluorescent signals.

The method of preparation according to claim 1, wherein the step of transferring the genes encoding the green fluorescent EGFP protein and the exosome marker protein LAMP into cells comprises: - constructing a recombinant plasmid capable of expression of the fusion of the green fluorescent EGFP protein and the exosome-LAMP marker protein and - transfecting the cells.

The method of preparation according to claim 2, wherein the construction of the recombinant plasmid comprises the following steps: - performing PCR amplification using the cDNA of HEK293 cells as template and the sequence shown in SEQ ID NO.1 - 2 as a primer to obtain the target gene fragment shown in SEQ ID NO.4, and — transferring the target gene fragment into the plasmid having the sequence shown in SEQ ID NO.3 to obtain the recombinant plasmid.

The preparation method according to claim 3, wherein: - the PCR amplification system is: 10 x PCR Mix 2 µl, 2.5 µM dNTPs 2 µl, forward primer 1 µl, reverse primer 1 µl, Tag enzyme 1 µl , cDNA 1 µl, and ddH 2 O water is added to 20 µl; — the amplification conditions are: 95°C for 5 min, pre-denatured at 95°C for 5 min, followed by the following cycling reactions: denaturation at 94°C for 30 sec, annealing at 59°C for 30 sec, chain extension at 72°C for 60 sec, 30 cycles and chain extension at 72°C for 10 min.

The method of preparation according to claim 1, wherein the density gradient centrifugation method is the iodixanol density gradient centrifugation method.

The preparation method according to claim 1, wherein the pore size of the filter membrane is 0.22 µm.

A fluorescently labeled exosome prepared according to the method of any one of claims 1 to 6.