NL2033274A

NL2033274A - Drug-loaded hydrogel microspheres (hms) with self-renewable hydration lubrication layer and preparation method and use thereof

Info

Publication number: NL2033274A
Application number: NL2033274A
Authority: NL
Inventors: Luo Xiaoji; Huang Wei; Lei Yiting; Cui Wenguo; Hu Ning
Original assignee: First Affiliated Hospital Of Chongqing Medical Univ
Priority date: 2021-10-12
Filing date: 2022-10-11
Publication date: 2023-04-19
Also published as: CN113995891B; CN113995891A

Abstract

The present disclosure provides drug—loaded hydrogel microspheres (HMS) with a self—renewable hydration lubrication layer and a preparation method and use thereof. In the present disclosure, methacrylated hyaluronic acid (HAMA) is combined with a cationic liposome loaded with rapamycin through a non—covalent interaction, and then monodisperse lipid—based HMS with a uniform particle size, a "self—renewable" lubrication function, and a maintenance function of cellular homeostasis are obtained through a microfluidic technology and photoinitiated free radical polymerization. The microspheres have desirable biocompatibility and can encapsulate liposomes to form a "reservoir"; in addition, when a surface is worn, the microspheres continuously expose the liposomes wrapped inside, forming a "self—renewable" hydration lubrication layer, thereby conducting lubrication as a "rolling bearing".

Description

DRUG-LOADED HYDROGEL MICROSPHERES (HMS) WITH SELF-RENEWABLE

HYDRATION LUBRICATICN LAYER AND PREPARATION METHOD AND USE THEREOF

TECHNICAL FIELD

The present disclosure belongs to the technical field of in- jectable drug-loaded hydrogels, in particular to drug-loaded hy- drogel microspheres (HMs) with a self-renewable hydration lubrica- tion layer and a preparation method and use thereof.

BACKGROUND

Practices have proved that desirable lubrication is essential for the normal operation of biological friction interfaces (such as articular cartilages, eyelids, and eyeballs). However, changes in tissue structure and cell function caused by trauma or diseases generally lead to failure of lubrication, resulting in a series of complications (such as osteoarthritis and xerophthalmia). There- fore, improving the lubrication of biological friction interfaces while maintaining the cellular homeostasis with drugs can better treat local lesions.

Hydrogel microspheres (HMs) are micron-scale hydrogel spheri- cal particles made of hydrophilic polymers by crosslinking, with desirable biocompatibility and minimally-invasive injectability.

The HMs can convert sliding friction into rolling friction by a "rolling bearing" effect, so as to reduce the friction. Therefore,

HMs are generally used for improving biological lubrication. Ex- cellent surface lubrication is essential for the "bearing roll- ing".

A hydration lubrication layer is a hydration layer with a certain thickness formed by the mutual attraction between charged groups and water molecules. The hydration lubrication layer can withstand pressures without being squeezed out and maintain fluid properties under shear, thereby minimizing the friction coeffi- cient of the friction interface. Accordingly, forming a stable hy- dration lubrication layer on the surface of HMs is expected to ex- pand the prospects of HMs for use in the field of biological lu-

brication.

By combining polymers/vesicles with zwitterionic groups (such as polymer brushes and phospholipid liposomes) on a surface of the microspheres, a stable hydration lubrication layer can be formed to exert a lubrication effect. Liu et al. found that after PSPMK polymer brushes were grafted on a surface of PNIPAAm HMs, the friction could be reduced through hydration lubrication. In the present disclosure, researchers grafted pSBMA polymer brushes on a surface of GelMA HMs, and found that a lubrication effect was sig- nificantly better than that of pure GelMA microspheres. Zheng et al. found that binding DOPC liposomes to a surface of silk fibroin microspheres can improve microsphere rolling through the hydration lubrication, thereby reducing friction. However, the hydration lu- brication layer formed by surface bonding has a low resistance to friction and is easily damaged during the friction; moreover, an exposed surface of the microspheres may obviously affect lubricat- ing properties of the microspheres since the lubrication layer cannot be renewed and replenished. As a result, renewing and re- plenishing the hydration lubrication layer on the surface of the

HMs is currently a technical bottleneck that urgently needs to be broken through.

Articular cartilages are able to form a stable hydration lu- brication layer with lipids bound to hyaluronic acid (HA) on the surface, and the hydration lubrication layer can be renewed and replenished with the lipids in synovial fluid. Inspired by joint lubrication, Sorkin et al. placed the friction interface in a lip- osome suspension (liposome reservoir) and found that a stable lu- brication layer could be formed on a friction surface and repaired and renewed during the friction. However, compared with renewal of the lubrication layer by an exogenous "liposome reservoir”, a "liposome reservoir" is constructed and then directly applied to the interfacial lubrication, enabling self-renewal of the lubrica- tion layer during the friction, which brings a wider range of ap- plication scenarios.

Therefore, dispersing liposomes in HA HMs to form a "liposome reservoir" has enabled the formation of a "self-renewable® hydra- tion lubrication layer on the surface of the microspheres. This can greatly improve a resistance of the HMs to friction, thereby providing a stable and continuous lubrication effect in biological interfaces such as joints that require long-term relative fric- tion. However, researches in this field have not yet been conduct- ed.

SUMMARY

A purpose of the present disclosure is to solve the above technical problems, and to provide drug-loaded HMs with a self- renewable hydration lubrication layer and a preparation method and use thereof. In the present disclosure, the HMs have desirable bi- ocompatibility and can encapsulate liposomes to form a "reser- voir”; in addition, when a surface is worn, the microspheres con- tinuously expose the liposomes wrapped inside, forming a "self- renewable" hydration lubrication layer, thereby conducting lubri- cation as a "rolling bearing”.

The present disclosure provides a preparation method of drug- loaded HMs with a self-renewable hydration lubrication layer, in- cluding the following steps: (1) preparation of methacrylated hyaluronic acid (HAMA): conducting a reaction on hyaluronic acid and methacrylic an- hydride under an alkaline condition to obtain methacrylated hyalu- ronic acid (HAMA); (2) preparation of a liposome: dissolving hydrogenated soybean phosphatidylcholine (HSPC), cholesterol, stearylamine, and rapamycin in an organic solvent, and conducting a reaction by a film dispersion method to prepare a cationic liposome loaded with the rapamycin; and (3) preparation of liposome-HMs mixing the HAMA obtained in step (1) and the liposome ob- tained in step (2) with a photoinitiator, preparing microdroplets with a micro-fluidic splitter, and conducting crosslinking under ultraviclet light to obtain the drug-loaded HMs with a self- renewable hydration lubrication layer.

In the present disclosure, HAMA is combined with a cationic

HSPC liposome loaded with rapamycin (RAPA) through a charge-dipole interaction, and then monodisperse liposome-HMs with a uniform particle size, a "self-renewable" lubrication function, and a maintenance function of cellular homeostasis are obtained through a micro-fluidic technology and photoinitiated free radical polymerization. The microspheres have desirable biocompatibility and can encapsulate liposomes to form a "reservoir"; in addition, when a surface is worn, the microspheres continuously expose the liposomes wrapped inside, forming a "self-renewable”" hydration lu- brication layer, thereby conducting lubrication as a "rolling bearing". In addition, the cationic liposomes released from the microspheres can also target and bind to a negatively-charged car- tilage surface through electrostatic interaction, thereby releas- ing drugs.

Further, in step (1), the hyaluronic acid and the methacrylic anhydride have a molar ratio of 1:2.6.

Further, in step (1), the hyaluronic acid has a molecular weight (M,) of 74 kDa.

Further, in step (1), the reaction is conducted by stirring at a pH value of 8.0 in an ice bath for 24 h.

Further, in step (2), the HSPC, the cholesterol, the stea- rylamine, and the rapamycin have a mass ratio of 40:10:4:6.

Further, in step (2), the organic solvent is chloroform.

Further, in step (2), the film dispersion method includes the following steps: conducting a reaction on the HSPC, the cholester- ol, the stearylamine, and the rapamycin at 60°C for 30 min, drying an obtained product, conducting hydration, conducting sonication for 20 min to obtain a dispersed multilamellar liposome, and ex- truding the multilamellar liposome with a membrane filter.

Further, in step (3), the HAMA, the liposome, and the pho- toinitiator have a mass ratio of 40:6:4.

The present disclosure further provides drug-loaded HMs with a self-renewable hydration lubrication layer. In the HMs, HAMA is combined with a cationic liposome loaded with rapamycin through a charge-dipole interaction, and then lipid-based HMs with a "self- renewable” lubrication function and a maintenance function of cel- lular homeostasis are obtained through a microfluidic technology and photoinitiated free radical polymerization.

The present disclosure further provides use of the drug-

loaded HMs with a self-renewable hydration lubrication layer as a drug carrier in treating osteoarthritis.

The present disclosure has the following beneficial effects: (1) The present disclosure provides monodisperse lipid-based 5 HMs with a uniform particle size, a "self-renewable™ lubrication function, and a maintenance function of cellular homeostasis. The microspheres have desirable biocompatibility and can encapsulate liposomes to form a "reservoir"; in addition, when a surface is worn, the microspheres continuously expose the liposomes wrapped inside, forming a "self-renewable" hydration lubrication layer, thereby conducting lubrication as a "rolling bearing”. (2) In the present disclosure, the HMs can release cationic liposomes, which can target and bind to a negatively-charged car- tilage surface through electrostatic interaction, thereby releas- ing drugs. (3) In vitro experiments show that the HMs can specifically up-regulate an autophagy level of oxidative stress-damaged chon- drocytes, and down-regulate expression of matrix metalloproteinase 13 (MMP13} and the like through the slow and sustained release of an autophagy activator rapamycin (RAPA), thereby maintaining the homeostasis of chondrocytes. In vivo experiments show that after the lipid-based HMs are injected into a traumatic osteoarthritis model of rats in a minimally-invasive manner, it is found that the lipid-based HMs can significantly alleviate the wear of articular cartilage, inhibit the degeneration of cartilage tissues and the formation of osteophytes, and delay the development of ostecar- thritis.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a 'H NMR spectrum of HAMA;

FIG. 2 shows a characterization diagram of liposomes and

Lipo@HMs, where (A) is a transmission electron microscopy (TEM) image of the liposomes; (B) is a Zeta potential map of the lipo- somes; (C) is a particle size distribution image of the liposomes; (D) is a light microscope image of the Lipo@HMs; (E) is a particle size distribution image of the Lipo@HMs; (F) is a scanning elec- tron microscopy (SEM) image of the Lipo@HMs; and (G) is a confocal image of Dil-labeled Lipo@HMs;

FIG. 3 shows an incubation diagram of cartilage sections with

Dil-labeled liposomes;

FIG. 4 shows lubricating performance characterization of the

Lipo@HMs, where (A) is a photo and a schematic diagram of UMT-3; (B) is a COF-time curve of freshly-prepared Lipo@HMs; (C) is a SEM image of worn Lipo@HMs; (D) is COF-time curves and COF histograms of PBS, HMs, and the Lipo@HMs; (E) is a brightfield image of wear marks of a stainless steel plate;

FIG. 5 shows degradation, drug-loading, and release proper- ties of the LipolHMs, as well as biocompatibility characterization of RAPA@Lipc@HMs, where (A) is a degradation curve of the

Lipo@HMs; (B) is a schematic diagram of a mechanism of delaying the degradation; (C) is an encapsulation efficiency of RAPA in liposomes and the Lipo@HMs; (D) is drug release profiles of the liposomes and the Lipo@HMs for RAPA; (E}) is a graph of live (green) /dead (red) fluorescence results at 1 d, 2 d, and 3 d; (F) is a live cell count summarised by a live/dead cell staining anal- ysis; and (G) is cytotoxicity of different groups to chondrocytes detected by CCK-8;

FIG. 6 shows results of RAPAGLipc@HMs in maintaining intra- cellular homeostasis, where (A) is DCF measurement of intracellu- lar ROS generation; (B) is detection of apoptosis by TUNEL stain- ing; (C) is determination of apoptosis by live/dead cell staining; (D) is quantitative analysis of ROS expression based on a DCF flu- orescence intensity; (E) is a quantitative analysis of an apopto- sis rate based on a TUNEL fluorescence intensity; (F) is a per- centage of dead cells determined by the live/dead cell staining; and (G) is CCK-8 results on days 1, 3, and 5; (# and * represent

P<0.05 compared with a control group and a blank group, respec- tively):

FIG. 7 shows results of the RAPA@Lipo@HMs in enhancing au- tophagy, promoting anabolism, and inhibiting catabolism, where (A) is a representative immuncfluorescence image of an LC3B protein; (B) is fluorescence quantification of DAPI and LC3B; (C) is a rep- resentative immunofluorescence image of an MMP13 protein; (D) is fluorescence quantification of DAPI and MMP13; and (E) is an RT-

PCR result showing levels of Col2, LC3B, ATG5, and MMP13; (# and * represent P<0.05 compared with a control group and a blank group, respectively);

FIG. 8 shows results of the RAPA@Lipo@HMs in reducing joint space narrowing and osteophyte formation, where (A) are repre- sentative x-ray images of knee joint AP and LAT views; (B) is a representative MicroCT image in AP and LAT views of the knee

Joint; (C) is a relative joint space measured from the AP image; (D) is a relative joint space measured from the LAT image; and (E) is a relative osteophytes volume measured by the MicroCT image; (#, $, and * represent P<0.05 compared with the control group, a

RAPAGLipolHM group, and the blank group, respectively);

FIG. 9 shows results of histological staining, where (A) is a representative image of HE staining; (B) is a representative image of toluidine blue staining; (C) is a representative image of saf- ranin O-fast green staining; and (D) is a Mankin histological score of the articular cartilage; (#, $, and * represent P<0.05 compared with the control group, a RAPACLipolHM group, and the blank group, respectively):

FIG. 10 shows results of immunohistochemical staining, where (A) is a representative image of a Col2 protein by immunohisto- chemical staining; (B) is a representative image of an aggrecan protein by immunohistochemical staining; {C) is a quantitative analysis of a relative expression level of the Col12; and (D) is a quantitative analysis of a relative expression level of the aggre- can; (#, $, and * represent P<0.05 compared with the control group, a RAPAGLipolHM group, and the blank group, respectively).

DETAILED DESCRIPTION OF THE EMBODIMENTS

To make the objectives, technical solutions, and advantages of the present disclosure clearer and more comprehensible, the present disclosure is described in more detail with reference to the accompanying drawings and examples, but these examples should not be construed as a limitation to the present disclosure. There- fore, nonessential improvement and adjustment made by those skilled in the art based on the above contents of the present dis- closure still belong to the protection scope of the present dis-

closure.

I. Examples of implementation methods (I) Synthesis of HAMA 2 wt% of hyaluronic acid (HA, My=74 kDa; Bloomage Biotech

Co., Ltd., China) and methacrylic anhydride (2.6-fold molar excess of dosage, Aladdin, China) were added to deionized water and re- acted at pH=8.0; an obtained reaction solution was continuously stirred in an ice bath for 24 h, dialyzed for 3 d, and a purified product was lyophilized to obtain a white powder. A degree of sub- stitution of the HAMA was determined by 'H NMR (600 MHz). (II) Preparation and characterization of liposome

HSPC was purchased from AVT (Shanghai) Pharmaceutical Tech

Co., Ltd. (China), and the liposome was prepared by a film disper- sion method. The HSPC, cholesterol (Macklin, China), stearylamine (Aladdin, China), and rapamycin (or RAPA, Macklin, China) were dissolved in chloroform at a mass ratio of 40:10:4:6, and subject- ed to rotary evaporation at 60°C for 30 min. A formed lipid film was hydrated with deionized water, subjected to an ultrasonic treatment for 20 min, and passed through the film to obtain a dis- persed multilamellar liposome. A shape of the liposome was ob- served under a TEM. The particle size, polydispersity index (PDI), and Zeta potential of the liposome were measured by dynamic light scattering (DLS). To verify a cartilage-targeting ability of the cationic liposome, cartilage sections were obtained from pig knee joints and incubated with Dil (Beyotime, China)-labeled liposomes at 37°C for 1 h. After removing the liposomes and washing the sec- tions with PBS, the sections were observed by laser scanning con- focal microscopy (LSCM, Zeiss, Germany). (ITI) Preparation and characterization of liposome-containing

HMs (Lipo@HMs)

Emulsification was conducted on 5 wt% of a HAMA-liposome- photoinitiator mixture (40:6:4, w/w/w) in microfluidic oil con- taining 95 wt% of paraffin oil and 5 wt® of Span 80, thereby form- ing pregel droplets at the flow-convergence intersection of a mi- cro-fluidic splitter. The droplets were cross-linked by UV irradi- ation. The cross-linked HMs were washed sequentially with acetone and deionized water and kept in deionized water until use. The shape and size of the obtained Lipo@HMs were observed under an op- tical microscope. The surface morphology of the Lipo@HMs after freeze-drying was observed by a SEM. To confirm that the liposomes were successfully embedded into the microspheres, the Dil-labeled liposomes within the microspheres were observed under a laser- scanning confocal microscope (LSCM). (IV) Tribological test

In this study, the tribological test was conducted using a

UMT-3 multifunctional tribological tester. All tests used an 8 mm polyethylene (PE) sphere (modulus of elasticity: 1 GPa; Poisson's ratio: 0.4) as an upper friction surface and a stainless steel plate (modulus of elasticity: 194 GPa; Poisson's ratio: 0.3) as a lower friction surface, with the oscillation amplitude and oscil- lation frequency of 2 mm and 1 Hz, respectively. To simulate an intensity of pressure in the joint cavity (up to 25 MPa), a load of 1 N (equivalent to 25.68 MPa) was applied. 1 mL of the Lipo@HMs (1 mg/mL) were dropped on the lower friction surface and tested for 3,600 sec. After the test, the LipolHMs were collected for SEM observation and subsequent tribological tests. Under the same ex- perimental conditions, the lubricating properties of PBS, HMs without liposomes, and the Lipo@HMs were tested and compared for 600 sec. After each test, the wear of each group of stainless steel plates was observed under an optical microscope. (V) Degradation test mg of Lipo@HMs/HMs were immersed in 1 mL of a PBS (pH=7.4) containing 5 mg of hyaluronidase (Beijing Laibo Technology Co.,

Ltd., China), and then stirred at 37°C and 80 rpm, while a new hy- aluronidase solution was replaced and replenished every 2 d. At predetermined time points, a residual weight of the sample was 30 measured and compared to an initial weight of the sample. (VI) Drug encapsulation and release

An encapsulation efficiency of the RAPA was measured using a

UV-5100 UV-Vis spectrophotometer (Metash, China). A release pro- file of the RAPA was plotted by dialysis, including: Lipo@HMs con- taining RAPA (RAPA@LipotHMs)/liposomes containing RAPA (RA-

PAELipos) were added into dialysis bags, immersed in the PBS at 37°C and stirred at 80 rpm until drug release was complete. At specific time points, a release medium was collected for UV analy- sis and replaced with an equal volume of the PBS. (VII) Biocompatibility of cells

An immortalized human chondrocyte cell line C-28/I2 was pur- chased from Otwo Biotech Co., Ltd. (No. HTX2308) and used for in vitro experimental studies. To determine the cytocompatibility of

HMs, the C-28/I2 cells were inoculated in a lower chamber of a

Transwell (0.4 um well, Corning, USA), and microspheres were inoc- ulated in an upper chamber of the Transwell. After 1 d, 2 d, and 3 d of co-culture, a live/dead cell staining assay was conducted to distinguish live cells from dead cells, and cell proliferation was assessed using a Cell Counting Kit-8 (CCK-8) assay. In the live/dead cell staining assay, the cells were incubated with cal- cein-AM/propidium iodide (Beyotime, China) for 30 min and examined using a fluorescence microscope. In the CCK-8 assay, a CCK-8 solu- tion (Beyotime, China) was added to a medium, and an absorbance was measured using a microplate reader 2 h later. (VIII) Ostecarthritis cell model

To simulate post-traumatic ostecarthritis, the C-28/I2 cells were inoculated on the lower chamber (0.4 um well) of Transwell and exposed to 200 pM of hydrogen peroxide (Sigma, USA). To deter- mine a therapeutic effect of the microspheres on cell homeostasis, the PBS, Lipo@HMs, or RAPARLipo@HMs were added to the upper cham- ber of the Transwell. C-28/I2 cells without the HO; treatment were used as a control. (IX) ROS detection

ROS generation was determined using a ROS detection kit (Be- yotime, China). After 48 h of incubation, cells were stained with 10 uM of dichlorodihydrofluorescein diacetate (DCFH-DA) at 37°C for 20 min and observed under a fluorescence microscope. (X) Detection of cell viability

An apoptosis level of the cells was detected using a TUNEL staining kit (Beyotime, China). After 48 h of incubation, the cells were fixated in 4% paraformaldehyde (Servicebio, China) for 30 min, and then incubated with a permeabilization solution (P0097, Servicebio, China) for 5 min; the cells were incubated with a TUNEL staining solution (Servicebio, China) for 1 h, and then stained with DAPI (Servicebio, China) and observed under a fluorescence microscope. To assess a ratio of live/dead cells and cell proliferation, the live/dead cell staining and CCK-8 assay were conducted following a same procedure described above. (XI) Detection of mRNA expression

After 48 h of incubation, the cells were subjected to RT-PCR to detect mRNA expression. A total RNA was isolated from the C- 28/12 cells and reverse-transcribed using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA). RT-PCR was conducted us- ing an ABI 7300 Real Time PCR System (ABI, USA). The primer se- quences of Col2, LC3B, ATG5, MMP13, and GADPH were shown in Table 1. Relative mRNA expression was calculated using a comparative CT method (AACT method).

Table 1 Primer sequences for real-time PCR

Gene | Primer Sequence

Bl — a

LC3B Forward primer CGAACAAAGAGTAGAAGATGTCCGA

Ee eee ee aen ie ramen (XII) Immunofluorescence staining

The protein levels of LC3B and MMP13 in C-28/I2 cells were determined by immunofluorescence staining. The cells were fixated with 4% paraformaldehyde for 15 min and treated with 2% BSA for 30 min to reduce background; the cells were labeled with rabbit anti-

LC3B/MMP13 primary antibody (Servicebio, China) overnight at 4°C, and then incubated with Cy3-conjugated goat anti-rabbit IgG (Ser- vicebio, China) for 50 min. Nuclei were stained with DAPI (Sevier,

China) for 10 min. The samples were observed under LSCM. (XIII) Osteoarthritis rat model

Animal experiments were approved by the Research Ethics Com-

mittee of the First Affiliated Hospital of Chongging Medical Uni- versity. Male SD rats (12 weeks old) were randomly divided into a sham operation group (5 rats) and an osteoarthritis group (25 rats). The rats in the ostecarthritis group underwent knee anteri- or cruciate ligament transection and medial meniscectomy (ACLT+MMx) after anesthesia. One week after the operation, the rats in the ostecarthritis group were further randomly divided in- to 5 subgroups (with 5 rats in each group), which were injected intra-articularly with PBS, HMs, RAPA@Lipos, Lipo@HMs, and RA-

PARLipo@HMs, respectively. The injections were repeated every four weeks. (XIV) Radiological assessment 8 weeks after the operation, X-ray images of the knee joints of the rats were obtained using a Faxitron X-ray machine (Faxitron

X-Ray, USA) at 10 sec and 32 kV. An articular space width was measured in anteroposterior (AP) and lateral (LAT) views. For fur- ther examination, knee joints were harvested and subjected to ex vivo micro-CT analysis (SkyScan 1172, Belgium). (XV) Histological and immunohistochemical examinations 8 weeks after the operation, the ex vivo knee joints were fixated with paraformaldehyde, decalcified, embedded in paraffin, and then sectioned at a thickness of 5 um. For histological analy- sis, sagittal planes were stained with HE, safranin O-fast green, and toluidine blue. A pathological status of the knee joint was assessed by two observers using a modified Mankin scoring system.

For immunohistochemical staining, sections were incubated with rabbit polyclonal anti-Col2/aggrecan {Servicebio, China} antibody overnight at 4°C, followed by incubation with a secondary antibody for 1 h. Paraffin sections were stained with a DAB substrate. The relative expression levels of Col2 and aggrecan were quantified using Image J software. (XVI) Statistical analysis

Statistical analysis was conducted using SPSS software. The differences between groups were detected by one-way ANOVA and Tuk- ey's post-hoc analysis, and a significance level was p=0.05.

IT. Example of experimental results 1. Preparation and characterization of drug-loaded HMs with a

"self-renewable" lubrication layer

In the present disclosure, hyaluronic acid is selected as a main material constituting the drug-loaded HMs with a "self- renewable" lubrication layer. As one of the main components of ex- tracellular matrix, hyaluronic acid has desirable biocompatibil- ity. The hyaluronic acid is capable of binding to liposomes through charge-dipole interactions, forming a liposome "reservoir" and exposing its hydrophilic phosphorylcholine head, thereby form- ing a stable hydration lubrication layer. In order to give hyalu- ronic acid photocurable cross-linking properties, acrylic modifi- cation of the hyaluronic acid is required. The results of hydrogen nuclear magnetic resonance (‘H-NMR) showed that methacrylic anhy- dride had been successfully grafted on a molecular chain of the hyaluronic acid, with a substitution degree of 52.91% (FIG. 1).

Through TEM observation, the liposomes prepared by the film dispersion method showed a multi-layer utricle-like structure (part A in FIG. 2). Determination of the liposomes by a dynamic light scattering (DLS) laser particle size analyzer showed that the liposomes had a zeta potential of (47.4+17.4} mV (part B in

FIG. 2). This positively-charged property helped the liposomes to bind to the negatively-charged glycosaminoglycans (GAGs) on the cartilage surface through electrostatic interactions, thereby act- ing as cartilage targeting.

However, there are a large amount of type II collagen on the cartilage surface, which are cross-linked with each other to form a dense three-dimensional grid (pore size: 50 nm to 200 nm), hin- dering the binding of liposomes to GAGs. Therefore, better carti- lage targeting can only be achieved by controlling the particle size of liposomes. In the present disclosure, the liposomes had an average particle size of (102.3435.2) nm and a polydispersity co- efficient (PDI) of 0.132 (part C in FIG. 2), indicating that the liposomes had desirable dispersibility, and were easier to bind to

GAGs due to a smaller particle size. Dil (a lipophilic fluorescent dye) -labeled liposomes were further incubated with cartilage sec- tions and observed by confocal microscopy. It was found that red punctate fluorescence was widely distributed on the surface of cartilage sections (FIG. 3), suggesting that the cationic liposome could target and bind to the cartilage surface.

In this example, the lipid-based HMs with a "self-renewable" lubrication function are made by forming water-in-oil droplets at the intersection with an aqueous phase (HAMA and HSPC liposomes) and an oil phase (paraffin oil and Span 80) by a micro-fluidic splitter, and then cross-linking with ultraviolet light. Through light microscope observation, the lipid-based HMs prepared by mi- cro-fluidic technology had a desirable dispersion, a uniform par- ticle size, and a complete shape (part D in FIG. 2), which was helpful for the rolling lubrication of microspheres. The particle size detection showed that the microspheres had a narrow unimodal distribution of particle sizes, with an average particle size of (208.36+7.37) um (part E in FIG. 2).

In order to observe the surface morphology of lipid-based

HMs, the freeze-dried microspheres were further observed by SEM.

As shown in part F in FIG. 2, the microspheres had an obvious po- rous structure; since the microspheres shrank during drying, a particle size thereof was significantly smaller than that of the microspheres dispersed in water. Notably, only a very small amount of liposomes were observed on the surface of the microspheres.

This might be because most of the liposomes were encapsulated in- side the microspheres during the preparation of the microspheres; moreover, due to a lack of microsphere protection, the liposomes bound to the most outer layer were easily damaged and removed dur- ing washing the spheres. To prove that the liposomes were success- fully encapsulated in the HMs, the liposomes were further labeled with Dil and observed by confocal microscopy. The results showed that the red punctate fluorescence was scattered in the micro- spheres, indicating that the liposomes had been successfully en- capsulated in the HMs (part G in FIG. 2}. 2. Determination of "self-renewable" lubrication ability of lipid-based HMs

In this example, the friction test was conducted by a multi- functional micro-friction and wear tester (UMT-3).

In order to observe a whole process of lipid-based HMs lubri- cation, a friction experiment was conducted on the lipid-based HMs for up to 3,600 sec (part A in FIG. 4). As shown in part B in FIG.

4, the whole lubrication process was roughly divided into 4 stag- es: 1. In a first stage (gray area; 0 sec to 300 sec), the fric- tion coefficient showed a slow decline trend, indicating that the microspheres could self-renew during friction and continuously ex- posed more liposomes to form a hydration lubrication layer. 2. In a second stage (blue area; 300 sec to 1,200 sec), the friction co- efficient was roughly stable at about 0.03, indicating that the microspheres had exposed enough liposomes and were playing a sta- ble lubricating role. 3. In a third stage (purple area; 1,200 sec to 2,700 sec), the friction coefficient increased slowly, indicat- ing that the microspheres were gradually squeezed out of the fric- tion area during the continuous reciprocating friction. 4. In a fourth stage (green area; 2,700 sec to 3,600 sec), the friction coefficient showed a rapid upward trend, indicating that moisture in a friction interface was decreasing, and a friction mode was gradually changing to dry friction.

On the other hand, unlike the continuous contact friction in this experiment, a lower limb gait changed periodically during walking. During a swing phase of the lower limb, there was a brief separation of the upper and lower articular surfaces, allowing the microspheres and synovial fluid to re-enter the friction area.

Therefore, a lubrication process of microspheres in the joint mainly included the first two stages.

In order to verify the "self-renewable" lubrication ability of lipid-based HMs, the lipid-based HMs in the above experiments were lyophilized and observed under SEM. Different from as- prepared lipid-based HMs, more liposomes were exposed on the sur- face of the microspheres subjected to the friction experiment (part C in FIG. 4). This suggested that the microspheres could continuously expose the liposomes wrapped inside when the surface was worn, thereby forming a "self-renewable"” hydration lubrication layer. Friction experiments were conducted on PBS, pure HMs, and the HMs with exposed liposomes under the same conditions. As shown in part D in FIG. 4, a friction coefficient obtained by using PBS for hydration lubrication was 0.06, while the simple HMs could re- duce the friction coefficient to 0.04 through the "rolling bear- ing” effect. Unlike the previous friction experiments, the HMs that had exposed enough liposomes did not show the first stage, but directly reduced and stabilized the friction coefficient at 0.03. The stainless steel plates used in the three groups of fric- tion experiments were further observed and compared under a light microscope. It was found that the scratches caused by the lipid- based HMs group were significantly lighter than those of the PBS group and the pure HMs group (part E in FIG. 4).

In conclusion, these results demonstrated that the HMs could encapsulate liposomes to form "liposome reservoirs" and form a "self-renewable” hydration lubrication layer on the surface, which in turn exerted a stable lubrication effect during friction. 3. Degradation determination of drug-loaded HMs with a "self- renewable” lubrication layer

For biolubricating materials, slower degradation can prolong a residence time of the material at the biofrictional interface, thereby exerting a more durable lubrication effect. The results of degradation experiments showed that under the action of hyaluroni- dase, compared with lipid-based HMs, pure HMs showed a relatively fast degradation trend, and the degradation was complete on the 42nd day. Lipid-based HMs showed a similar degradation trend to the pure HMs in the first 7 d, then gradually slowed down, and were almost completely degraded by day 63 (part A in FIG. 5). This two-stage degradation trend might be because the early degradation of microspheres was an outward-inward process, while the lipid- based HMs could gradually expose encapsulated liposomes during the degradation, and formed a "self-renewable” hydration lubrication layer on the surface. The hydration layer had a certain barrier effect on hyaluronidase, which could delay the degradation of the microspheres, thereby prolonging a lubrication time of the micro- spheres (part B in FIG. 5). 4. HMs with a 'self-renewable" lubrication layer for drug leading and release

Rapamycin (RAPA) is a lipid-soluble small molecule drug, with a poor solubility, narrow therapeutic window, and easy removal in the joint cavity. Loading the RAPA into cationic liposomes can in- crease the drug solubility and improve cartilage targeting; in ad- dition, encapsulating the caticnic liposomes in HMs can further improve a stability of the system to facilitate local delivery.

In this example, the results of drug loading experiments showed that the loading efficiencies of liposomes alone and lipid- based HMs on the RAPA were (87.55126.49)% and (67.391+4.06)%, re- spectively (part C in FIG. 5). This difference in loading effi- ciency might be caused by drug leakage and partial removal of lip- osomes during microsphere preparation. In the subsequent release experiments, lipid-based HMs showed a relatively fast release trend in the first 3 d, then gradually slowed down, and were al- most completely released on the 28th day. However, unlike the re- lease profile of lipid-based HMs, the liposomes alone had a cumu- lative release rate of over 80% on day 3 and were completely re- leased on day 14 (part D in FIG. 5). This distinct release charac- teristic showed that encapsulating liposomes into HMs to form a "reservoir" could protect the liposomes and improve a stability, so as to achieve long-lasting sustained release. 5. Biocompatibility testing of HMs with a "self-renewable” lubrication layer

The HMs with a "self-renewable" lubrication layer, as an in- jectable biolubricant, required desirable biocompatibility. To this end, in this example, an effect of the microspheres on cells were detected by the live/dead cell staining and CCK-8 assay.

The results of live/dead cell staining showed that the vast majority of cells survived during the 3-day culture, and there was no statistical difference between groups (parts E and F in FIG. 5). Consistently, the results of CCK-8 assay showed that cells in each group continued to proliferate during the 3-day culture, and there was no statistical difference between groups (section G in

FIG. 5).

Taken together, these results demonstrated that the HMs with a "self-renewable" lubrication layer had desirable biocompatibil- ity and could act as a bio-lubricant to improve the lubrication of a bio-friction interface. 6. HMs with a "self-renewable"” lubrication layer in maintain- ing cell homeostasis

It has been shown that cartilage produces a large amount of

ROS when damaged, and that overproduction of ROS can impair chon-

drocyte function through excess oxidation, protein carbonylation, and DNA damage. Autophagy is a cellular catabolic mechanism capa- ble of maintaining cellular homeostasis by removing dysfunctional organelles and macromolecules. By increasing a level of autophagy, the production of ROS can be reduced, thereby alleviating the dam- ages caused by oxidative stress to cells.

In the present disclosure, an intracellular ROS level was de- tected by a DCFH-DA fluorescent probe. The results showed that a

ROS level of the RAPAGLipolMG group was significantly lower than that of the Lipo@MG group and the blank group (parts A and D in

FIG. 6). This suggested that RAPAGLipo@MG could increase the level of autophagy by releasing an autophagy activator (RAPA), thereby reducing the generation of ROS. The elevation of ROS is one of the key factors in inducing apoptosis. Apoptosis was detected by TUNEL staining. The results showed that apoptotic cells in the RA-

PACLipo@MG group were significantly less than those in the Lipo@MG group and the blank group (parts B and E in FIG. 6), suggesting that RAPA@Lipo@MG could maintain cell homeostasis by releasing the

RAPA, thereby reducing apoptosis. Further, effects of the RA-

PAQLipo@MG on cell survival and proliferation were examined by live/dead cell staining and CCK-8 assay. It was found that a pro- portion of dead cells in the RAPA@Lipo@MG group was significantly lower than that in the Lipo@MG group and the blank group, while a cell proliferation rate was significantly higher than that in the

Lipol@MG group and the blank group (parts C, F, and G in FIG. 6).

This indicated that the RAPARLipo@MG could enhance a survival rate of cells damaged by oxidative stress and promote cell prolifera- tion by releasing the RAPA.

As an important component in the extracellular matrix of hya- line cartilage, type II collagen is a marker of chondrocyte pro- liferation. As key proteins of autophagy, the expression of LC3B and ATG5 is closely related to the level of autophagy activity.

MMP13, as a key enzyme in the cleavage of type II collagen, plays a major role in the degradation of cartilage matrix in ostecar- thritis. In the present disclosure, to verify an influence of the

RAPARLipo@MG on the autophagy level and the synthesis and catabo- lism activities of chondrocytes, RT-PCR was conducted to detect gene expression levels of Col2, LC3B, ATG5, and MMP13. The results showed that the gene expression levels of Col2, LC3B, and ATG: in the RAPARLipolMG group were significantly higher than those in the

Lipo@MG group and the blank group, while the gene expression level of MMP13 was significantly lower than that in the Lipo@MG group and the blank group (part E in FIG. 7).

Further, protein expression levels of LC3B and MMP13 were de- tected by immuncfluorescence. It was found that the results were consistent with those of RT-PCR. The expression level of LC3B pro- tein in the RAPAQ@Lipo@MG group was significantly higher than that in the Lipo@MG group and the blank group (parts A and B in FIG. 7), while the expression level of MMP13 was significantly lower than that in the Lipo@MG group and the blank group (parts C and D in FIG. 7).

These results suggested that the RAPACLipo@MG could increase the autophagy level of chondrocytes, promote the secretion of ex- tracellular matrix of chondrocytes, and reduce the production of

MMP13 by releasing the RAPA. 7. Evaluation of therapeutic effect of HMs with a "self- renewable" lubrication layer on osteoarthritis

In the present disclosure, to verify whether the HMs with a "self-renewable" lubrication layer could alleviate the wear of os- teoarthritis cartilage and inhibit the degeneration of cartilage tissues, a rat traumatic osteoarthritis model was established by

ACLT+MMx, intervention was conducted by injecting microspheres in- to the joint cavity, and an effect of the HMs with a "self- renewable” lubrication layer was evaluated by in vivo experiments.

Osteoarthritis generally has obvious X-ray manifestations, in which the joint space can reflect the wear of articular cartilage to a certain extent. Therefore, knee joints of the rats 8 weeks after modeling were observed by X-ray. The results showed that compared with the sham operation group, the joint space of the simple modeling group (PBS group) was significantly narrowed, in- dicating that the surgical modeling was successful and obvious cartilage damage occurred. However, due to the injection of HMs with a "self-renewable” lubrication layer, the cartilage damage in the RAPARLipol@MG group was significantly improved, and the joint space was significantly higher than that in the PBS group, with no statistical difference compared with the sham operation group (parts A, D, and D in FIG. 8).

As a compensatory manifestation of joint damage, osteophyte is another characteristic manifestation of ostecarthritis. In this example, an amount of the osteophytes in each group was measured by MicroCT, and it was found that a large number of osteophytes were formed in the PBS group, while no obvious osteophyte for- mation was found in the sham operation group. In contrast, joint damages in the RAPARLipolMG group were significantly improved, with an amount of osteophyte formation significantly lower than that in the PBS group (parts B and E in FIG. 8).

In addition, HE staining, safranin O-fast green staining, to- luidine blue staining, and immunchistochemical detection were fur- ther conducted on the knee joint specimens 8 weeks after modeling.

The results showed that in the sham operation group, the articular cartilage was intact and smooth, cells were evenly distributed, and the type II collagen and aggrecan were stained obviously in the periphery of cells. However, in the PBS group, the articular cartilage was severely worn, a cartilage layer became thinner, the number of cells decreased, the expression levels of type II colla- gen and aggrecan decreased, and the Mankin score was significantly lower than that in the sham operation group. In contrast, in the

RAPACLipo®@MG group, the articular cartilage was more complete and smooth, the cells were distributed evenly, there was a certain ex- pression of type II collagen and aggrecan in the periphery of cells, and the Mankin score was significantly higher than that of the PBS group and had no statistical difference compared with the sham operation group (FIG. 9 and FIG. 10).

In summary, these results demonstrate that the HMs with a "self-renewable" lubrication layer is able to exert lubrication while releasing liposomes to target cartilage by the "self- renewable" hydration lubrication layer and the "rolling bearing" effect. The HMs with a 'self-renewable" lubrication layer main- tains chondrocyte homeostasis by slowly releasing RAPA, thereby reducing the wear of articular cartilage, inhibiting the cartilage degeneration, and delaying the development of osteoarthritis.

i xml versicn=Nl, ON encoding=TUTFE-8" 7 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST26Sequencelisting V1 3.dtd"> 3 <3T26%squencelisting dudVersion=svi_an T11aName="0RIP20Z210000LT mln soïtwaceNems=*WIPO Sagueance? soitwareVersion="2.1.2% productions ie=vR0233-02~03">

A <ApplicentFileReferencs>HKJP20221000017/4ApplivantFileRsfsrence> > <ApplicantName languagelode="an">The First Affiliated Hospital of Chongqing

Medical University</ApplicantiName> & <IpventicnTitle lanmwugelcds='en"sDRUG-LOADED HYDROGEL MICROSPHERES (HMs) WITH

SELF-RENEWABLE HYDRATION LUBRICATION LAYER AND PREPARATION METHOD AND USE

THEREOF<« /inventionTitle» i <Sequencelotalfuantity>10</Seguencel otal Quantity 8 <SeguenceData semuenceIDNumber=Nln> ö <INSDSeq>

LO <INSDSeq length>24</INSD3eq lengths

Ll <INSDSeq moltype>DNA</INSDSegq moltype>

Le <INSDSeq division>PAT</INSDSeq divisicn> 13 <INSDSeq feature-iable> 14 <INSDFeature> <IN3DFeature key>source</IiN3DFeature key» ia <IN3DFeature lowation>l..24</INSDFeaturs location» i <INSDFeature guals> 18 <INSDOualifier> ii <INSDQualifier name>mol type</INSDQualifier name> “4 <INSDQualifler valverother DNA</INSDQualifier value» a </INSDOualifier> 22 <INSDOQualifier id="q2"> 22 <IN3DQualifier name>note</INSDQualifier name> 24 <INSDQualifier value>Forward primer of

GAPDH</INSDCualifier value» </INSDQualifier> 26 <INSDQualifier id="gi*> wi CINSDQualifisr namerorganism</INsSDQualifier name> 28 <INSDQualifier valus>synthetic construct /INSDGualifier value 23 </INSDQualifier> u </INSDFeature guals> 3 </INSDFeaturs>

SE </INSDSeu feature-table> 33 <INSDSeg sequencerggaagcttgtcatcaatggaaatc-/IN3D5eq sequencer 34 </IN3SDSaq> </SaquenceData>

Ia “SequenceData seguencellNMumber="27> 27 <INSDSeg> 38 <INSDSeg length>»20</INSDSeq length> 39 <IN3DSeq moltype>DNA</INSDSeq moltyper <INSDSeq division>PAT</INSDSeg division» 41 <INSDSeq feature-table> 4% <INSDFeature> 43 <INSDFeaturs keyrsource</INSDFeaturs key» 44 <INSDFeature locaction»l1..20</INSDFeature location» <INSDFeature guals> 448 <INSDOQualifier> 477 <IN3DQualifier name>mol type“/INSDQuali fier name> 45 <INSDQualifier valuerother DNA</INSDQualifier value» 4% </INSDOualifier> <INSDQualifler ia=’gs"> 51 <INSDQualifier name>note</INSDQualifisr name> 52 <IN3DQualifier value>Reverse primer of

GAPDH</INSDQualifier value» 53 </INSDOQuali fier u 54 <INSDQualifler ìd='qg3"> 25 <INSDQualifier namerorganism</INSDQualiifier name>

SE <INSDQualifier valuersynthetic construct“/INSDQualifien value» 57 </INSDOualifier> 58 </INSDFearure quals> 53 </INSDFearure» ai </INSDSeg features table» el <INSDSeg seguence>rtgatgaccecttttggetcce/INSISeq sequenced

GZ </INSDSeg> £3 </Zequencebata>

G4 <SequernceData seguancaiDNunbhao="3%> a5 <INSDSeqg> aa <INSDSeq length>23</INSDSeq length> ad <INSDSeq moltype>DNA-/INSDSeg moltype> an ZINSDSeq division>PAT</INSDSeq division» eo <INSDSeq feabure-table>

TO <INSDfeature>

TL <INSDFeature key>source</INSDFeature key>

FE <INSDFeature location>l..23</INSDFeature locations 73 <INSDFealurse guals> jd <INSDOQualifier» jh <IN3DQualifier name>mol type“/INSDQualifier name> ia <INSDQualifier value>other DNA</IN3DGualifier value>

TE </INSDQuali fier»

TE <INSDQuaiifler id="g6">

Ta <INSDOQualifier namernote</INSDQualifiesr name> ai <INSDQualiflisr value>Forward primer of

Col2</INgDoualifier value»

SL </INSDOualifier> 82 CINSDOualifier id="gBr> 23 <IN3DQualifier name>organism</INSDQualifisr name> 54 <INSDQualifier valuersynthetic construct</INSDQualifier valued

SL «</INSDOQualifier»>

G8 </THSDFeaturs guals> a7 </INSDFeaturer a8 </IN3DSeqg feature-table> £23 <IN3DBeq sequencereactcaagtccctcaacaaccag“/INSDSeq sequenced 3D </INSDSeg>

SL </SeguenceDala>

SE <SequenceData sequencelDNumer="4">

Gs <INSDSeq>

G4 <INSDSeq length>23</INSDSeq lengths <INSDSeq moltype>DNA</INSDSea moliype> 3a <INSDSeq divislon»PAT</INSDSey division 37 <IN3D3eq feature-table> 38 <INSDFearturex 38 <IN3DFeature key>source</IN3DFeature key»

LOD <INSDFeature location>l..23</INSDFeature Location»

LOL <INSDFeature quals> u [Re <IN3DQualifiers 103 <INSDQualifier name>mol type</INSDQualifier name> 104 <INSDOualifier wvalue>other DNA</INSDCualifier value» 105 </INSDQualifier> u 13a <INSDQualifier 1d=VgRu>

LO <IN3DQualifier name>note</INSDQualifier name>

LOB <INSDQualifier valuerReverse primer of

Col2«/iNsDgualifier walue> 10s </INSDOualifiers

LAG <INSDQuelifler in="g7">

Lil <INSDQualifier name>organism</INSDQualifier name> 112 <IN3DQualifier value>synthetic construct</INSDoualifier value» iis </INSDQuali fier» u

Liá </INSDFearure quals>

LLS «/INSDFeaturer

LLS </INSDSeg feature-table> 17 <INSDSeq sequsncerggggtcaatccagtagtctccac/INSDSeq sequences ig </TNSDSeg> iis </SeguenceData> 120 <SeguenceData semuenceIDNumber="Bn>

La <INSDSedg> 122 <INSDSeq length>25</IN3SD3eq lengths

Las <INSDSeq moltype>DNA</INSDSegq moltype> 124 <INSDSeq division>PAT</INSDSeq division» 125 <INSDSeq feature-iable> 1a <IMNSDFeature> 1a <IN3DFeature key>source</IiN3DFeature key» 128 <IN3DFeature lovation>l..25</INSDFeature location» 12% <INSDFeature guals> 130 <INSDOualifier>

TEL <INSDQualifier name>mol type“/IN5DQualifier name>

Ls <INSDgualifier valuerother DNA</INSDQualifier value» 133 </INSDOualifier> 134 <INSDOualifier id="qL0%> ijb <IN3DQualifier namesnote</1NSDQualifier name> 128 <INSDQualifier value>Forward primer of

LC3B</INSDQualifier value» 137 </INSDQualifier>

RYE <INSDQualifier id="g5"> ss <INSDoualifier namerorganism</INsSDQualifier name> 140 <INSDQualifier valus>synthetic construct /INSDGualifier value id </INSDQualifiers> u 142 </INSDFeature guals> 143 </INSDFeature> 144 </INSDSey feature-tabled

TAL <INSDSeqg sequencevegaacaaagagtagaagatgtcega“/INSD5eq sequence

AG </IN3SDSaq> 147 </SaquenceData> 148 “SequenceData seguencellNumbear="8§"> 149 <INSDSeg> 150 <INSDSeg length>»22</INSDSeq length»

Ls <IN3DSeq moltype>DNA</INSDSeq moltyper 152 <INSDSeq division>PAT</INSDSeg division 1a <INSDSeq feature-table>

Lid <IN3DFeature> iss <INSDFeaturs keyrsource</INSDFeaturs key 15a <INSDFeature locaction»1..22</INSDFeature location» isd <INSDFeature guels> i158 <INSDOQualifier> 15% <IN3DQualifier name>mol type“/INSDQuali fier name>

Lag <INSDQualifier valuerother DNA</INSDQualifier value»

TEL </INSDOualifier>

Led <INSDQualifler ia="gia> 163 <INSDQualifier name>note</INSDQualifisr name> iSd <IN3DQualifier value>Reverse primer of

LC3B-/INSDQualifier value> iah </INSDOQuali fier u lag <INSDQualifier id="giljx>

Lay <INSDQualifier namerorganism</INSDQualiifier name>

LEB <INSDQualifier valuersynthetic construct“/INSDQualifien value»

LES </INSDQualifiers> 1740 </IN3DFeature gualsd 17d </INSDFeatures 17a </INSDSeg features table» 173 <IN3DSeqy sequence>getgettetecacccttgtateg</INSDSay zeguencex>

Ld </INSDSeg>

LL </SequenceData>

Li <SequernceData sequenceliNuDec="N?>

EE <INSDSeqg> iis <INSDSeq length>24</INSDSeq length> 179 <INSDSeq moltype>DNA-/INSDSeg moltype>

LED ZINSDSeq division>PAT</INSDSeq division»

LSL <INSDSeq feabure-table>

LEE <INSDFeature>

Las <INSDFeature key>source</INSDFeature key>

Lad <INSDFeature location>l..24</INSDFeature locations 185 <INSDFealurse guals>

Ea <INSDOQualifier» ind <IN3DQualifier name>mol type“/INSDQualifier name> ins <INSDQualifier value>other DNA</IN3DGualifier value> 189 </INSDQuali fier»

Lag <INSDQuaiifier id="gid’x>

LOL <INSDOQualifier namernote</INSDQualifiesr name>

LG <INSDgQualifier value>Forward primer of

ATG5</INSDQualifier value» 183 </INSDOualifier> 154 <INSDOualifier id="qgijt> 1585 <IN3DQualifier name>organism</INSDQualifisr name> 188 <INSDQualifier valuersynthetic construct</INSDQualifier valued 1a </INSDOualifier>

Les </THSDFeaturs guals> 198 </INSDFeatures 200 </IN3DSeqg feature-table> 201 <INSDSeq sequencs>ggatgagataactgaaagggaage</INSDSeq sequences 202 </TNSDSeg> 2073 </SeguenceDaia> 204 <Sequencebata zedquencelDNumser="8N>

ZOL <INSDSeq> ae <“INSDSeqg length>2l</INSDSeq Length> 207 <INSDSeq moltype>DNA</INSDSea moliype> 208 <INSDSeq divislon»PAT</INSDSey division 203 <INSDSeq feature-table> 210 <INSDFeature> 214 <IN3DFeature key>source</IN3DFeature key» 21 <INSDFeature location»1..21</INSDFeature location> 213 <INSDFeature quals> u gid <IN3DQualifiers “#15 <INSDQualifier name>mol type</INSDQualifier name>

ZR <INSDOualifier wvalue>other DNA</INSDCualifier value» 217 </INSDQualifier> u

Z2i8 <INSDOualifier ld="gisn> 218 <IN3DQualifier name>note</INSDQualifier name> 220 <INSDQualifier valuerReverse primer of

ATG5</INSDQualifier wvalue>

HE </INSDOualifiers

HEE <INSDQualiifler id="g15r>

PP <INSDQualifier name>organism</iNSDQualifier name> zld <IiNSDgualifier value>synthetic construct</INSDgualifier value» 225 </INSDQuali fier» u 224 </INSDFearure quals> 227 </INSDFeature>

JE </INSDSeg feature-table> aE <INSDSeq sequencerccatttecagtggtgtgectte</INSDSeq sequences 2340 </TNSDSeg> 221 </SeguenceData> 232 <SeguenceData semuenceIDNumber="Bn> 233 <INSDSeq> 2734 <INSDSeq length>25</IN3SD3eq lengths 235 <INSDSeq molitype>DNA</IN3DSeq moltype>

ACES <INSDSeq division>PAT</INSDSeq division» 257 <INSDSeq [eatureriabie> ae <INSDFeature>» 223 <IN3DFeature keyrsource</INSDFeature key> 240 <IN3DFeature lovation>l..25</INSDFeature location» 241 <INSDFeature guals> 242 <INSDOualifier>

SAS <INSDOQualifier name>mol type</INSDQualifier name> 244 <INSDQualifler valverother DNA</INSDQualifier value»

Zan </INSDOualifier>

Za <INSDOualifier id="qL8%> 247 <IN3DQualifier name>note</INSDQualifier name> 248 <INSDQualifier value>Forward primer of

MMP13</INSDGualilfier value» 24% </INSDQualifier> 200 <INSDQualifier id="gijx> 251 CINSDQualifisr namerorganism</INsSDQualifier name>

HEE <INSDQualifier valus>synthetic construct /INSDGualifier value 252 </INSDQualifier> u 254 </INSDFeature guals> 25% </INSDFealure> 7 258 </INSDSeu feature-table>

Zn <INSDSeq sequance>ggtgatgaagatgatttgtetgagg</ilNsDSeq sequence

PATE </IN3SDSaq>

ZED </SaquenceData> zón “SequenceData seguencellMNumber="107> 261 <INEDSeg> 282 <INSDSeg length>»21</INSDSeq length» 2873 <IN3DSeq moltype>DNA</INSDSeq moltyper

Zed <INSDSeq division>PAT</INSDSeg division» zes <INSDSeq feature-table>

PAS <IN3DFeature> 267 <INSDFeaturs keyrsource</INSDFeaturs key zes <INSDFeature locaction»l1..21</INSDFeature location» 243 <INSDFeature guels> 270 <INSDOQualifier>

ATL <INSDQualifier name>mol type“/INSDQuali fier name>

ZIE <INSDQualifier valuerother DNA</INSDQualifier value»

ZS «</INSDOQualifier»>

PAE <INSDQualifler io=vgdlv> dis <INSDQualifier name>note</INSDQualifisr name>

ZR <IN3DQualifier value>Reverse primer of

MMP13</INSDQualifier value>

Dj </INSDouali fier 298 <INSDQualifier id="gi9nx> 278 <INSDQualifier namerorganism</INSDQualiifier name> 230 <INSDQualifier valuersynthetic construct“/INSDQualifien value»

ZE: </INSDOualifier> 282 </IN3DFeature gualsd 283 </INSDFeaturer u 284 </INSDSeg features table» 285 <INSDSeg sequence>cgtcaagtttgecagtecacet</IN3LSeqy sequenca> 28a </IN3D3e or 257 </Zequencebata> “55 </8T265aquencellating>

Claims

CONCLUSIONS

A method for preparing drug-loaded hydrogel microspheres (HMs) with a self-renewable hydration smear layer, comprising the steps of: (1) performing a reaction of hyaluronic acid and methacrylic anhydride under alkaline conditions to form methacrylated hyaluronic acid ( HAMA); (2) dissolving hydrogenated soybean-derived phosphatidylcholine (HSPC), cholesterol, stearylamine and rapamycin in an organic solvent, and conducting a reaction by a film dispersion method to prepare a cationic liposome loaded with the rapamycin ; and (3) mixing the HAMA obtained in step (1) and the liposome obtained in step (2) with a photoinitiator, preparing microdroplets with a microfluidic splitter, and performing crosslinking under ultraviolet light to obtain of the drug-loaded HMs with a self-renewable hydration smear layer.

The preparation method according to claim 1, wherein in step (1) the hyaluronic acid and the methacrylic anhydride have a molar ratio of 1:2.6.

The preparation method according to claim 1, wherein in step (1) the hyaluronic acid has a molecular weight (Mw) of 74 kDa.

The preparation method according to claim 1, wherein in step (1) the reaction is carried out by stirring at a pH value of 8.0 in an ice bath for 24 hours.

The preparation method according to claim 1, wherein in step (2) the HSPC, the cholesterol, the stearylamine and the rapamycin have a mass ratio of 40:10:4:6.

The preparation method according to claim 1, wherein in step (2)

the organic solvent is chloroform.

The preparation method according to claim 1, wherein in step (2) the film dispersion method comprises the following steps: performing a reaction on the HSPC, the cholesterol, the stearylamine, and the rapamycin at 60°C for 30 minutes, drying a obtained product, perform hydration, perform sonication for 20 minutes to obtain a dispersed multilamellar liposome, and extrude the multilamellar liposome with a membrane filter.

The preparation method according to claim 1, wherein in step (3) the HAMA, the liposome and the photoinitiator have a mass ratio of 40:6:4.

Drug-loaded HMs with a self-renewable hydration lubrication layer prepared by the preparation method according to any one of claims 1 to 8.

Use of the drug-loaded HMs with a self-renewable hydration lubrication layer prepared by the preparation method according to any one of claims 1 to 8 or the drug-loaded HMs with a self-renewable hydration lubrication layer according to claim 9 as a drug carrier in the treatment of osteoarthritis.