NL2033165B1 - METHOD FOR IMPROVING LIGATION EFFICIENCY OF TARGET FRAGMENT AND psiCHECK2 VECTOR - Google Patents

Abstract

The present disclosure provides a method for improving a ligation efficiency of a target fragment and a psiCHECKZ vector. The method includes the following steps: designing a vector homologous seguence primer using a bovine genomic DNA. as a template to replace a protection base in a traditional primer, and conducting PCR amplification on a target fragment; ligating a PCR amplification product with a psiCHECKZ vector and then introducing into competent cells, and determining a vector ligation efficiency of the target fragment and the psiCHECKZ vector. In the present disclosure, a homologous fragment experimental group has a ligation efficiency higher than that of a conventional primer experimental group and a bacterial endogenous homologous recombination experimental group. However, instead of homologous recombination, the method improves the ligation efficiency by changing a length of the protection. base (a vector homologous sequence) to increase a double—enzyme cleavage efficiency.

Description

METHOD FOR IMPROVING LIGATION EFFICIENCY OF TARGET FRAGMENT AND psiCHECK2 VECTOR

TECHNICAL FIELD

The present disclosure relates to a method for improving a ligation efficiency of a target fragment and a psiCHECK2 vector, and belongs to the technical field of molecular biology.

BACKGROUND

Genetic engineering research includes four steps: acquisition of a target gene, construction of a gene expression vector, trans- fer of the gene expression vector into recipient cells, and moni- toring and identification of the target gene. Among them, the con- struction of a gene expression vector is highly important and the most complicated step. Vector construction, as an important exper- imental technique in molecular biology and genetic engineering as well as a necessary means to study gene functions, generally re- quires high ligation efficiency and accuracy. At present, common- ly-used vectors include plasmid vectors, phage vectors, and cos- mids, among which the plasmid vectors are the most widely used in animal experiments. Plasmid vectors are derived from bacteria, ex- ogenous plasmids can be introduced into DH5a competent bacteria, and large-scale extraction of the plasmids can be achieved by cul- turing bacteria. Currently, there are a variety of commercial plasmid extraction kits. Plasmids can conduct self replication in the cells of other species, and their DNA sequences contain abun- dant endonuclease sites. As a result, the plasmid vectors are widely used in molecular biology and genetic engineering.

The psiCHECK2 vector is a plasmid vector that monitors chang- es in the expression of a target gene fused to a reporter gene.

The vector uses renilla luciferase as a main reporter gene, and the target fragment is cloned into a multiple cloning site down- stream of a translation stop codon of the renilla luciferase. An

RNAi process against the target gene, initiated by synthetic siR-

NAs or in vivo-expressed shRNAs, results in cleavage and subse-

quent degradation of fusion mRNAs. Whether there is a targeting relationship between the siRNAs or in vivo-expressed shRNAs and the target fragment can be determined by detecting changes of a renilla luciferase activity. The vector is of great significance in the study of interaction between the microRNA and gene 3'UTR.

The psiCHECK2 vector is currently constructed by a conventional primer method and a homologous recombination method. At present, the conventional primer method is generally used, including pro- tection base + restriction enzyme site + target fragment sequence.

However, due to a short protection base, the method may greatly reduce a double-enzyme cleavage efficiency of its PCR product, leading to an extremely-low ligation efficiency in practice. More- over, although having a relatively simple construction process to save a lot of time and effort, the homologous recombination method has a slightly high false positive rate. Even though there are currently commercial construction kits for homologous recombinant vector that can reduce the false positive rate, these kits have a high cost.

SUMMARY

In order to overcome the deficiencies of the prior art, an objective of the present disclosure includes but is not limited to providing a method for improving a ligation efficiency of a target fragment and a psiCHECK2 vector.

To achieve the above objective, the present disclosure adopts the following technical sclutions:

The present disclosure provides a method for improving a li- gation efficiency of a target fragment and a psiCHECK2 vector, in- cluding the following steps: designing a vector homologous se- quence primer using a bovine genomic DNA as a template to replace a protection base in a traditional primer, and conducting PCR am- plification on a target fragment; ligating a PCR amplification product with a psiCHECK2 vector and then introducing into compe- tent cells; conducting incubation on the cells at 37°C in an air shaker for 2 h, and coating on plates; conducting incubation on coated cells in a constant-temperature incubator at 37°C for 16 h, counting obtained single clones, and randomly selecting the single clones to conduct bacterial solution PCR and Sanger sequencing; and determining a vector ligation efficiency of the target frag- ment and the psiCHECK2 vector.

In the method of the present disclosure, the bovine genomic

DNA is used as a template, and the protection base in the conven- tional primer is replaced by the vector homologous sequence; the partial fragment of the bovine IGFBP3 gene is amplified by PCR, the PCR amplification product and the psiCHECK2 vector are treated with endonucleases Xho I and Not I, and then ligated with the T4 ligase; an obtained ligation product is introduced into the DH5a competent cells; and according to the number of bacterial clones, the agarose gel electrophoresis results, and the sequencing re- sults, the vector ligation efficiency of the target fragment and the psiCHECK2 vector is determined.

The present disclosure further improves this technical solu- tion as follows:

Preferably, the target fragment is a partial fragment located in a candidate region chr4: 76123453 to 76124382 of a bovine

IGFBP3 gene, and has a nucleotide sequence shown in SEQ ID NO: 1; and the psiCHECK2 vector has a nucleotide sequence shown in SEQ ID

NO: 2.

Preferably, the vector ligation efficiency refers to: deter- mining a ligation efficiency of the target fragment and the pPsicCHECK2 vector according to the number of bacterial monoclones, a positive rate of bacterial solution PCR, and an accuracy of se- quencing.

Preferably, a primer pair Pl for introducing a vector homolo- gous fragment and for amplifying the partial fragment of the bo- vine IGFBP3 gene includes: an upstream primer Fl (with a nucleotide sequence shown in

SEQ ID NO: 3): 3 -TAGGCGATCGCTCGAGGCACAAAAGACTGCCAAGGACA-3T, and a downstream primer Rl (with a nucleotide sequence shown in

SEQ ID NO: 4): 3 -TTGCGGCCAGCGGCCGCCACCAAGCAAGGGCGATT-3'; the conventional amplification primer pair P2 includes: an upstream primer F2 (with a nucleotide sequence shown in

SEQ ID NO: 5): 5"-CCGCTCGAGGCACAARAGACTGCCAAGGA-3', and a downstream primer R2 (with a nucleotide sequence shown in

SEQ ID NO: 6): 5'-ATAAGAATGCGGCCGCCACCAAGCAAGGGCGATTTT-3".

Preferably, in the vector homologous sequence primer, the vector homologous fragment includes: an upstream primer vector homologous fragment: TAGGCGATCG (

SEQ ID NO:7) ; and a downstream primer vector homologous fragment: TTGCGGCCA; in the conventional primers, the protection base includes: an upstream primer protection base: CCG; and a downstream primer protection base: ATAAGAAT.

Preferably, the PCR amplification product based on the primer pair Pl has a fragment size of 963 bp, and the PCR amplification product based on the primer pair P2 has a fragment size of 955 bp.

Preferably, the PCR amplification product based on the primer pair Pl and the psiCHECK2 vector are treated by endonucleases Xho

I and Not I, ligated with a T4 ligase, and introduced into DH5a competent cells, which is recorded as a homologous fragment exper- imental group.

The PCR amplification product based on the primer pair Pl and the psiCHECK2 vector treated with the endonucleases Xho I and Not

I are directly introduced into the DH5a competent cells, which is recorded as a bacterial endogenous homologous recombination test group.

The PCR amplification product based on the primer pair P2 and the psiCHECK2 vector are treated by the endonucleases Xho I and

Not I, ligated with the T4 ligase, and introduced into the DH5a competent cells, which is recorded as a conventional primer test group.

Preferably, a PCR amplification system includes: 1.0 pL of a 50 ng/pL template DNA, 1.0 pL of each of 10 mM upstream and down- stream primers corresponding to the primer pair Pl or P2, 12.5 pL of a 2xMaster Mix (Sangon), and 9.5 pL of deionized water; and a

PCR reaction program includes: initial denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 60 sec, conducting a total of 35 cycles.

The present disclosure further provides use of the method in 5 construction of a recombinant vector.

Preferably, a recombinant vector of the homologous sequence primer has the number of bacterial monoclones, the positive rate of bacterial solution PCR, and the accuracy of sequencing that are higher than those of a recombinant vector of a conventional primer and a recombinant vector of bacterial endogenous homology; that is, the homologous fragment experimental group has a higher liga- tion efficiency than that of the conventional primer test group and the bacterial endogenous homologous recombination test group, thus providing a technical basis for construction of other vec- tors.

In the present disclosure, chrd: 76123453 to 76124382 of the bovine IGFBP3 gene is used as an amplification region. PCR ampli- fication is conducted separately using the two sets of primers, where the homologous sequence primer includes vector homologous fragment + restriction enzyme site + target fragment sequence, and the conventional primer includes protection base + restriction en- zyme site + target fragment sequence. The amplification products are introduced into DH5a after different treatments, where the ho- mologous fragment experimental group includes double-enzyme- digested Pl PCR + double-enzyme-digested psiCHECKZ2 vector + T4 1i- gation; the bacterial endogenous homologous recombination test group includes Pl PCR + double-enzyme-digested psiCHECK2 vector; and the conventional primer test group includes double-enzyme- digested P2 PCR product + double-enzyme-digested psiCHECK2 vector + T4 ligation. The vector ligation efficiency refers to: determin- ing a ligation efficiency of the target fragment and the psiCHECK2 vector according to the number of bacterial monoclones, the posi- tive rate of bacterial solution PCR, and the accuracy of sequenc- ing.

In the present disclosure, instead of homologous recombina- tion, the method improves a ligation efficiency by changing a length of the protection base (a vector homologous sequence) to increase a double-enzyme cleavage efficiency. Currently, commer- cial endonucleases each have a restriction enzyme cleavage effi- ciency affected by the number of protection bases. The PCR product amplified by traditional primers has a 2-h digestion efficiency of

Xho I at only 10%, and a 2-h digestion efficiency of Not I at 25%.

In addition, there is a "barrel effect” in the double-enzyme cleavage: even if one enzyme has a cleavage efficiency reaching 100%, when the other enzyme has an extremely-low cleavage effi- ciency, there is also a low vector ligation efficiency. The psiCHECK2 vector is constructed using a homologous sequence primer method. Comparing with the ligation efficiency of the conventional primer method and the homologous recombination method (non-kit), it is found that the homologous sequence primer method has the number of bacterial monoclones, the positive rate of bacterial so- lution PCR, and the accuracy of sequencing that are higher than those of the other two methods.

Compared with the prior art, the present disclosure has the following advantages: (1) in the present disclosure, the homologous fragment exper- imental group has a higher ligation efficiency than that of the conventional primer test group and the bacterial endogenous homol- ogous recombination test group; (2) the method is accurate and reliable, simple to operate, and low-cost; and {3) the method can provide a technical basis for construction of other vectors.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows monoclonal pictures, bacterial solution PCR, and sequencing results of the homologous fragment experimental group in the present disclosure;

FIG. 2 shows monoclonal pictures, bacterial solution PCR, and sequencing results of the bacterial endogenous homologous recombi- nation test group in the present disclosure; and

FIG. 3 shows monoclonal pictures, bacterial solution PCR, and sequencing results of the conventional primer test group in the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

In the following, examples of the present disclosure will be described in detail. The examples are implemented on the premise of the technical solutions of the present disclosure, and detailed implementations and specific operation processes are provided, but the protection scope of the present disclosure is not limited to the following examples. The experimental methods in the following examples which are not specified with specific conditions are con- ducted according to conventional conditions or according to prod- uct instructions. In the following examples, the reagents and ma- terials involved each are commercially available, and are not listed here one by one.

In the present disclosure, involved PCR is conducted using a bovine genomic DNA as a template with a candidate region chrd: 76123453 to 76124382 of a bovine IGFBP3 gene as an amplification region. PCR amplification Design is conducted separately using the two sets of primers, where the homologous sequence primer includes vector homologous fragment + restriction enzyme site + target fragment sequence, and the conventional primer includes protection base + restriction enzyme site + target fragment sequence. The am- plification products are introduced into DH5a after different treatments, where the homologous fragment experimental group in- cludes double-enzyme-digested Pl PCR + double-enzyme-digested psiCHECK2 vector + T4 ligation; the bacterial endogenous homolo- gous recombination test group includes Pl PCR + double-enzyme- digested psiCHECK2 vector; and the conventional primer test group includes double-enzyme-digested P2 PCR product + double-enzyme- digested psiCHECK2 vector + T4 ligation. The vector ligation effi- ciency refers to: determining a ligation efficiency of the target fragment and the psiCHECK2 vector according to the number of bac- terial monoclones, the positive rate of bacterial solution PCR, and the accuracy of sequencing.

Example 1 1. Collection of bovine samples

Taking cattle as a test object, blood samples from the jugu- lar vein of 2 cattle were collected from Shaanxi Kingbull Animal

Husbandry Co., Ltd. 2. Isolation, extraction, and purification of a genomic DNA

A method of Sambrock et al (2002) was adopted. 3. Amplification of a target sequence and an internal refer- ence sequence

Taking a sequence of a bovine IGFBPI gene published in the

NCBI database (http://www.ncbi.nlm.nih.gov/) as a reference se- quence, amplification primers of the IGFBP3 gene were designed us- ing Primer 5.0; and according to restriction enzyme sites Xho I and Not I, restriction sequences and protection bases or the re- striction sequences and vector homologous fragments were added at a 5'-end of the primers. The sequence information of the primer pairs was shown in Table 1.

Table 1 Information of PCR primers p1-F TAGGCGATCGCTCGAGGCACAAAAGACTGCCAAGGACAÍSEQ ID NO: 3} Xho t ee 955 bp

An amplification system for PCR was 25 pL, including: 1.0 pL of a 50 ng/uL template DNA, 1.0 pL of each of 10 mM upstream and downstream primers corresponding to the primer pair Pl or P2, 12.5 uL of a 2xMaster Mix (Sangon), and 9.5 pL of deionized water.

A PCR reaction program included: initial denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 60 sec, conducting a total of 35 cycles. 4. Treatment of PCR products

Homologous fragment experimental group: the PCR amplification product based on the primers Pl and the psicCHECK2 vector were treated with endonucleases Xho I and Not I, ligated with a T4 lig- ase, and introduced into DH5a competent cells.

Bacterial endogenous homologous recombination test group: the

PCR amplification product based on the primers Pl and the pPsiCHECK2 vector treated with the endonucleases Xho I and Not I were directly introduced into the DH5a competent cells.

Conventional primer test group: the PCR amplification product based on the primers P2 and the psiCHECK2 vector were treated by the endonucleases Xho I and Not I, ligated with the T4 ligase, and introduced into the DH5a competent cells. 5. Determination of a vector ligation efficiency

The DH5a cells transformed from the homologous fragment ex- perimental group, the bacterial endogenous homologous recombina- tion test group, and the conventional primer test group were coat- ed on plates, respectively, with 3 plates in each group; the num- ber of single clones was counted, and results were shown in FIG. 1 to FIG. 3. The differences in the number of monoclonal clones in each group were determined by one-way analysis of variance through

SPSS 18 software. 8 single clones were randomly selected from each plate, and all single clones were selected if there were less than 8; bacte- rial solution PCR amplification was conducted using the corre- sponding Pl or P2 primers; PCR positive rates of the bacterial so- lutions in the three groups were counted, and results were shown in FIG. 1 to FIG. 3. The differences of PCR positive rate in each group were determined by chi-square test of the SPSS 18 software.

Another 8 single clones were re randomly selected from each plate, and all single clones were selected if there were less than 8; sequencing was conducted to determine a sequence accuracy, and results were shown in FIG. 1 to FIG. 3. The differences in cor- rectness of the ligation sequences in each group were determined by chi-square test of the SPSS 18 software.

The analysis results were shown in Table 2, the homologous fragment experimental group and the bacterial endogenous homolo- gous recombination test group each had significantly-higher num- bers of single clones, bacterial solution PCR positive rate, and sequence correctness than those of the conventional primer test group; moreover, the sequence correctness of the homologous frag- ment experimental group was significantly higher than that of the bacterial endogenous homologous recombination test group, indicat- ing that the method could significantly improve a construction success rate of the recombinant vector.

Table 2 Analysis of ligation efficiency of IGFBP3 gene frag- ment and psiCHECK2 vector

Type Number of Number of positives in Number of correct eee een 173+155+161° | 16/24° 10/24° bination test group 6. Use of the vector construction method in molecular biology

In the present disclosure, the homologous fragment experi- mental group has a higher ligation efficiency than that of the conventional primer test group and the bacterial endogenous homol- ogous recombination test group; the method is accurate, reliable, simple to operate, and low-cost, which can also provide a tech- nical basis for construction of other vectors.

The foregoing are merely descriptions of the specific embodi- ments of the present disclosure, and the protection scope of the present disclosure is not limited thereto. Any modification or re- placement made within the technical scope of the present disclo- sure by a person skilled in the art shall fall within the protec- tion scope of the present disclosure.

Sequence Listing Information:

DTD Version: V1 3

File Name: HKJP20220901631.xml

Software Name: WIPO Sequence

Software Version: 2.1.2

Production Date: 2022-10-17

General Information:

Current application / Applicant file reference:

HKJP20220901631

Earliest priority application / IP Office: CN

Earliest priority application / Application number: 202111161574 .3

Earliest priority application / Filing date: 2021-09-30

Applicant name: Yangzhou University

Applicant name / Language: en

Invention title: METHOD FOR IMPROVING LIGATION EFFICIENCY OF

TARGET FRAGMENT AND psiCHECK2 VECTOR ( en)

Sequence Total Quantity: 7

Sequences:

Sequence Number (ID): 1

Length: 930

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..930 > mol type, other DNA > note, Nucleotide sequence of target fragment of a bovine IGFBP3 gene > organism, synthetic construct

Residues: gcacaaaaga ctgccaagga catgatcagc agctggctac agcctcaact tctatttctt 60 tttgtggtga attgattttt ttttttaaac caaagtttag aaagagatgt ttgaaatgce 120 tagttttctt ccacatggtg aacctggcat ctttccactt tccagtagtc agtgaaacge 180 agtttgattt ttctegttge ttcctataaa aatacttgta agctcaagca cggtgcagcec 240 gtaagctcat gctgccctgg gaccctcccc acccattcac cgcagccaac cctccacttc 300 atgccttagc aacgcgtgtg gctcatgtag acgcgcttcg tctgcacttg taagacgaga 360 caaggcctca tcaagaagag gaacgccctg tcctttaatg cctgcacatc ccgacacacc 420 cacccggggc taccggggcc agggtccctg gaccaaggag atattttgta tcttcaaggg 480 gcctgcactg cttggaaaca agtggagaga atcaagtgga atcttgtttg gaaaaaaaaa 540 aaaatgacaa gaatgttcta gggaactctg gaaaccgaca aaggcgggga tttctgacce 600 ttetttgteca ggcagctttc tgaagacacg ggctttgetg aagccccata gggcaggggg 660 gcagggcgac ttgccagagg catcacaagt aatagcctgg ctctccagat gactgcggaa 720 aacagtgttt tcccactcag ccattcaaga gcaagtttat tcttgaagat aagctcecttg 780 aaggcaaaaa aggtttcttt tcatttetcc ccttttgtece tccttggcac agtataaaaa 840 ataatcatcc tgtataacct ggaagacgag tggcttgttg gggagccggt cagggacgct 900 gggagcacag aaaatcgccc ttgcttggtg 930

Sequence Number (ID): 2

Length: 6273

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..6273 > mol type, other DNA > note, Nucleotide sequence of psicCHECK2 vector > organism, synthetic construct

Residues: agatctgcgc agcaccatgg cctgaaataa cctctgaaag aggaacttgg ttaggtacct 60 tctgaggcgg aaagaaccag ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag 120 gctcceccage aggcagaagt atgcaaagca tgcatctcaa ttagtcagea accaggtgtg 180 gaaagtccce aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag 240 caaccatagt cccgccccta actcecgccca tccegcccct aactccgccc agttccgccc 300 attectccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctegg 360 cctetgagect attccagaag tagtgaggag gcttttttgg aggectagge ttttgcaaaa 420 agcttgatte ttctgacaca acagtctcga acttaagctg cagaagttgg tcgtgaggca 480 ctgggcaggt aagtatcaag gttacaagac aggtttaagg agaccaatag aaactgggct 540 tgtcgagaca gagaagactc ttgcgtttct gataggcacc tattggtctt actgacatcc 600 actttgcctt tetctccaca ggtgtccact cccagttcaa ttacagctect taaggctaga 660 gtacttaata cgactcacta taggctagcc accatggctt ccaaggtgta cgaccccgag 720 caacgcaaac gcatgatcac tgggcctcag tggtgggcte gctgcaagca aatgaacgtg 780 ctggactcct tcatcaacta ctatgattcc gagaagcacg ccgagaacgc cgtgattttt 840 ctgcatggta acgctgccte cagctacctg tggaggcacg tegtgcctca catcgagccc 900 gtggctagat gcatcatccc tgatctgatc ggaatgggta agtccggcaa gagcgggaat 960 ggctcatatce gcctcctgga tcactacaag tacctcaccg cttggttecga gctgctgaac 1020 cttccaaaga aaatcatctt tgtgggccac gactgggggg cttgtctggc ctttcactac 1080 tcctacgagc accaagacaa gatcaaggce atcgtccatg ctgagagtgt cgtggacgtg 1140 ategagtcct gggacgagtg gcctgacate gaggaggata tecgccctgat caagagcgaa 1200 gagggcgaga aaatggtgct tgagaataac ttcttegteg agaccatgct cccaagcaag 1260 atcatgcgga aactggagcc tgaggagtte gctgcctacc tggagccatt caaggagaag 1320 ggcgaggtta gacggcctac cctctcctgg cctegcgaga tccctetegt taagggagge 1380 aagccegacg tcgtccagat tgtccgcaac tacaacgcct accttegggc cagcgacgat 1440 ctgcctaaga tgttcatcga gteccgaccect gggttectttt ccaacgctat tgtcgaggga 1500 gctaagaagt tccctaacac cgagttcgtg aaggtgaagg gcctccactt cagccaggag 1560 gacgctccag atgaaatggg taagtacatc aagagcttcg tggagcgcgt gctgaagaac 1620 gagcagtaat tctaggcgat cgctcgagcc cgggaattecg tttaaaccta gagcggecgec 1680 tggccgcaat aaaatatctt tattttcatt acatctgtgt gttggttttt tgtgtgagga 1740 tctaaatgag tcttcggacc tcgcgggggc cgcttaagcg gtggttaggg tttgtctgac 1800 gcggdggggag ggggaaggaa cgaaacactc tcattcggag gcggctcggg gtttggtett 1860 ggtggccacg ggcacgcaga agagcgcegc gatcctctta agcacccccc cgcccteegt 1920 ggaggcgggg gtttggtcgg cgggtggtaa ctggcgggce gctgactcgg gegggtegeg 1980 cgccccagag tgtgaccttt teggtetgct cgcagacccc cgggcggcge cgcegcggcg 2040 gegacgggect cgctgggtcc taggctccat ggggaccgta tacgtggaca ggctctggag 2100 catccgcacg actgcggtga tattaccgga gaccttctgc gggacgagce gggtcacgcg 2160 gctgacgcgg agcgtccgtt gggcgacaaa caccaggacg gggcacaggt acactatctt 2220 gtcaccegga ggcgcgaggg actgcaggag cttcagggag tggcgcagct gcttcatcce 2280 cgtggcccgt tgctegcgtt tgctggcggt gteccccggaa gaaatatatt tgcatgtectt 2340 tagttctatg atgacacaaa ccccgcccag cgtcttgtca ttggcgaatt cgaacacgca 2400 gatgcagtcg gggcggegeg gtcccaggte cacttcgcat attaaggtga cgcgtgtggc 2460 ctegaacacc gagcgaccct gcagcgacce gcttaaaagc ttggcattcc ggtactgttg 2520 gtaaagccac catggccgat gctaagaaca ttaagaaggg ccctgctccc ttctacccte 2580 tggaggatgg caccgctggec gagcagctgc acaaggccat gaagaggtat gccctggtge 2640 ctggcaccat tgccttcacc gatgcccaca ttgaggtgga catcacctat gccgagtact 2700 tegagatgtc tgtgegcctg gcegaggcca tgaagaggta cggcctgaac accaaccacc 2760 gcatcgtggt gtgctetgag aactctctge agttcttcat gccagtgctg ggcgcecctgt 2820 tcatcggagt ggccgtggce cctgctaacg acatttacaa cgagcgcgag ctgctgaaca 2880 gcatgggcat ttctcagcct accgtggtgt tegtgtctaa gaagggcctg cagaagatcc 2940 tgaacgtgca gaagaagctg cctatcatcc agaagatcat catcatggac tctaagaccg 3000 actaccaggg cttccagagc atgtacacat tcgtgacatc tcatctgcct cctggcttca 3060 acgagtacga cttcgtgcca gagtctttcg acagggacaa aaccattgcc ctgatcatga 3120 acagctctgg gtctaccggc ctgcctaagg gcgtggcecct gcctcatege accgcctgtg 3160 tgegcttcte tcacgcccgc gaccctattt tcggcaacca gatcatcccc gacaccgcta 3240 ttctgagcgt ggtgccatte caccacggct tcggcatgtt caccaccctg ggctacctga 3300 tttgeggett tegggtggtg ctgatgtacc gcttcgagga ggagctgtte ctgcgcagcc 3360 tgcaagacta caaaattcag tctgccctgc tggtgccaac cctgttcage ttettegcta 3420 agagcaccct gatcgacaag tacgacctgt ctaacctgca cgagattgcc tetggcggeg 3480 ccccactgtc taaggaggtg ggcgaagccg tggccaageg ctttcatetg ccaggcatcc 3540 gccagggcta cggcctgacc gagacaacca gcgccattct gattacccca gagggcgacg 3600 acaagcctgg cgccgtgggc aaggtggtgec cattcttcga ggccaaggtg gtggacctgg 3660 acaccggcaa gaccctggga gtgaaccagc gcggcgagct gtgtgtgcge ggccctatga 3720 ttatgtccgg ctacgtgaat aaccctgagg ccacaaacgc cctgatcgac aaggacggct 3780 ggctgcacte tggcgacatt gcctactggg acgaggacga gcacttctte atcgtggacc 3840 gcctgaagtc tctgatcaag tacaagggct accaggtggc cccagccgag ctggagtcta 3900 tectgctgca gcaccctaac attttcgacg ccggagtggc cggcectgccc gacgacgatg 3960 ccggcgagct gcctgccgcc gtegtegtge tggaacacgg caagaccatg accgagaagg 4020 agatcgtgga ctatgtggcc agccaggtga caaccgccaa gaagctgcgc ggcggagtgg 4080 tgttcgtgga cgaggtgccc aagggcctga ccggcaagct ggacgccegc aagatcegcg 4140 agatcctgat caaggctaag aaaggcggca agatcgccgt gtaataattc tagagteggg 4200 geggceggcec gcttcgagca gacatgataa gatacattga tgagtttgga caaaccacaa 4260 ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg tgatgctatt gctttatttg 4320 taaccattat aagctgcaat aaacaagtta acaacaacaa ttgcattcat tttatgtttec 4380 aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta aaacctctac aaatgtggta 4440 aaatcgataa ggatccaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 4500 tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc 4560 ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttecgtgte gcccttattec 4620 ccttttttge ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa 4680 aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg 4740 gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 4800 ttetgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa cteggtegcec 4860 gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 4920 cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 4980 cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 5040 acatggggga tcatgtaact cgccttgate gttgggaacc ggagctgaat gaagccatac 5100 caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 5160 taactggcga actacttact ctagcttcce ggcaacaatt aatagactgg atggaggcgg 5220 ataaagttgc aggaccactt ctgcgctegg cccttccggc tggctggttt attgctgata 5280 aatctggagc cggtgagcgt gggtctcgeg gtatcattgc agcactgggg ccagatggta 5340 agccetcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 5400 atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 5460 tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 5520 tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 5580 gagcgtcaga ccccgtagaa aagatcaaag gatcttecttg agatcetttt tttctgcgcg 5640 taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgceggatc 5700 aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 5760 ctgttettet agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 5820 catacctcge tctgctaatc ctgttaccag tggctgetgc cagtggcgat aagtcgtgte 5850 ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 5940 ggggttegtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 6000 agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 6060 taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 6120 atctttatag tcctgteggg tttegccacc tctgacttga gcgtcgattt ttgtgatgct 6180 cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcetgg 6240 ccttttgctg gccttttgct cacatggctc gac 6273

Sequence Number (ID): 3

Length: 38

Molecule Type: DNA

Features Location/Qualifiers: —- source, 1..38 > mol type, other DNA > note, Upstream primer F1 > organism, synthetic construct

Residues: taggcgatcg ctcgaggcac aaaagactgc caaggaca 38

Sequence Number (ID): 4

Length: 35

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..35 > mol type, other DNA > note, Downstream primer R1 > organism, synthetic construct

Residues: ttgcggccag cggccgccac caagcaaggg cgatt 35

Sequence Number (ID): 5

Length: 29

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..29 > mol type, other DNA > note, Upstream primer F2 > organism, synthetic construct

Residues: ccgctcgagg cacaaaagac tgccaagga 29

Sequence Number (ID): 6

Length: 36

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..36 > mol type, other DNA > note, Ddownstream primer R2 > organism, synthetic construct

Residues: ataagaatgc ggccgccacc aagcaagggc gatttt 36

Sequence Number (ID): 7

Length: 10

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..10 > mol type, other DNA > note, Upstream primer vector homologous fragment > organism, synthetic construct

Residues: taggcgatcg 10

END.

i Alum. overslon=T1.0" encoding=TUTF-Qn Tx 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST265equenceListing V1 3.dtd"> 3 <3T268equencelisting dtdVerazion="V1 3" filoName="HRJIPZ0Z2030LE31 ami” soïtwaceNems=*WIPO Sagueance? soitwareVersion="2.1.2% productions ie=vR023-10~-17">

A <ApplicentFileReferencs>HKJP202209018631-/4pnlivantFileRsfsrence> > <FariiestPricritvAppiicaticonidentification> 6 <IPOfficetoderCN</IPOfficeloder 7 <ApplicetionNumerTezt>202111161574 .3</AppliceticnNumerText> 8 <FilingDate>»2021-09-30</FilingDatex 3 </EarliestPriorityapplicationidentification»> <Applicantiame lenguagelode="en'>Yangzhou University</Applicantiame>

Ld <InventionTitle languagalode="an">METHOD FOR IMPROVING LIGATION EFFICIENCY OF

TARGET FRAGMENT AND psiCHECK2 VECTOR</InvantionTitle>

LE <SequenceTotalQuanrtity>7</SeguenceTotalQuantity> 13 <SequenceData seguantasibNunbayr="ins id <INSDSeg> in “INSDSeqg length>930</INSDSeg Lengih> ia <INSDSeq moltype>DNA</INSDSeq moltype>

Lj <IN3DSeq division»PAT</INSD3eq division» is <INSDSeq feature-table>

Le <INSDFeaturs> ay <INSDFeature key>source</INIDFeature key>

AL <INSDFeature location>l..930</INSDFeature location

GE <INSDFearure gualsr 23 <INSDQualifier»> 24d <INSDQualifier name>mol type</iNSDQualifier name> <INS3DQualifier value>other DNA</INSDQualifier valued 28 </INSDOQuali fier 2 <INSDQualifler ìid='g8 ">

ZB <INSDQualifier namernote</INSDQualifier named

LG <INSDQualifier valuerNucleotide sequence of target fragment of a bovine IGFBP3 gene“/INSDQuali fier valus> </INSDOualifier>

ZL <INSDOualifier id="g}"> 22 <IN3DQualifier namevorganism“/INSDQualifier name> 33 <INSDQualifier valuersynthetic construct</INSDQuallifier value» 34 </INSDQualifier> </INSDFeaturs quals> 55 </IN3DFeature> 37 “/INSDSeqg fesature-table> <iN3D3eq sequence>rgcacaaaagactgccaaggacatgatcagcagctggctacagcctcaacttctatt tcetttttgtggtgaattgatttttttttttaaaccaaagtttagaaagagatgtttgaaatgcctagttttett ccacatggtgaacctggcatcetttccactttccagtagtcagtgaaacgcagtttgatttttetegttgettce tataaaaatacttgtaagctcaagcacggtgcagccgtaagctcatgetgccctgggaccctccccacccattec accgcagccaaccctccacttcatgccttagcaacgegtgtggctcatgtagacgegettegtctgcacttgta agacgagacaaggcctcatcaagaagaggaacgccctgtcctttaatgcctgcacatcccgacacacccacccg gggctaccggggccagggtccctggaccaaggagatattttgtatcttcaaggggcctgcactgcttggaaaca agtggagagaatcaagtggaatcttgtttggaaaaaaaaaaaaatgacaagaatgttctagggaactctggaaa ccgacaaaggcggggatttctgacccttetttgtcaggcagctttctgaagacacgggctttgctgaagcccca tagggcaggggggcagggcgacttgccagaggcatcacaagtaatagcctggctctccagatgactgcggaaaa cagtgttttcccactcagccattcaagagcaagtttattcttgaagataagctccttgaaggcaaaaaaggttt cttttcatttctcceccttttgtcctcecttggcacagtataaaaaataatcatcctgtataacctggaagacgag tggettgttggggagccggtcagggacgctgggagcacagaaaatcgccettgettggtg/INSDSeq zegu ena 3% </INSDS=eo> </Seguencedata> 41 <SequenceData sequence lDNumben="2%> 42 <INSDSeq> 473 <INSDSeag length»>6273</INSDSeq length» 44 <INSDSeq moltype>DNA</INSDSeg moltype» <INSDSeq division>PAT</INSDSeg division» 445 <INSDSeq feature-table> 47 <INSDFeature> a8 <INSDFeature key>sourcec/INSDFeature key» 43 <IN3DFeature location>l..6273</INSDFeature locaticn> <INSDFeature guals> 51 <INSDOualifien>

DE <INSDQualifier name>mol type“/INSDQualifier name> 53 <INSDQualifier valuerother DNA</INSDQualifier value»

Sá </INSDOualiLfier»> 58 <INSDQualifler in="g8"> 54 <INSDQualifier name>note</INSDQualifier name> hi <IN5DQualifier value>Nucleotide sequence of psiCHECK2 vector“/INSDGualifier value> 58 </INSDQuali fier» 53 <INSDQuaiifler id="g2"> eee <INSDQualifier namerorganism</INSDQualifier name>

Sl <INSDgQualifier value>synthetic construct“/INSDGualifier value» az </INSDOualifier> 52 </INSDFeature gvals> a4 </INSDFealure> </INSDSegy featurs-table> <INSDSeg sequenceragatctgcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggt accttectgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagc aggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcag gcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtccegcccctaactccgcccatccegcce ctaactcegcccagttcegcccattctecgccccatggctgactaattttttttatttatgcagaggccgaggec cgccteggcctctgagctattccagaagtagtgaggaggettttttggaggcctaggecttttgcaaaaagcttg attcttctgacacaacagtctcgaacttaagctgcagaagttggtcgtgaggcactgggcaggtaagtatcaag gttacaagacaggtttaaggagaccaatagaaactgggcttgtcgagacagagaagactcttgegtttctgata ggcacctattggtettactgacatccactttgecctttectctccacaggtgtccactcccagttcaattacagct cttaaggctagagtacttaatacgactcactataggctagccaccatggecttccaaggtgtacgaccccgagca acgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactcecttcatca actactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctg tggaggcacgtegtgcctcacatcgagccegtggctagatgcatcatccctgatctgatcggaatgggtaagtc cggcaagagcgggaatggctcatategcctectggatcactacaagtacctcaccegcttggttcgagectgctga accttccaaagaaaatcatctttgtgggccacgactggggggettgtctggcectttcactactcctacgagcac caagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtecctgggacgagtggcctga catcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgecttgagaataacttcttegteg agaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttegctgcctacctggagccattcaag gagaagggcgaggttagacggcctaccctctcectggcctegegagatcecctetcgttaagggaggcaagcccga cgtecgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatectgcctaagatgttcatcgagt ccgaccctgggttecttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtg aagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttecgtggagcgegt gctgaagaacgagcagtaattctaggecgatcgctcgagcccgggaattegtttaaacctagagcggccgctgge cgcaataaaatatctttattttcattacatetgtgtgttggttttttgtgtgaggatctaaatgagtecttcgga cctcgcgggggccgcttaagcggtggttagggtttgtctgacgcggggggagggggaaggaacgaaacactcte attcggaggcggcteggggtttggtcttggtggccacgggcacgcagaagagcgcecgecgatcctcttaagcacc ccccegcectccgtggaggcgggggtttggtecggcgggtggtaactggecgggeccgetgactcgggcgggtcgeg cgccccagagtgtgaccttttcggtctgctegcagacccccgggcggegccgeccgeggcggcgacgggetegect gggtcctaggctccatggggaccgtatacgtggacaggctctggagcatcegcacgactgcggtgatattaccg gagaccttctgcgggacgagccgggtcacgecggctgacgcggagcgtcegttgggcgacaaacaccaggacggg gcacaggtacactatcttgtcacccggaggcgcgagggactgcaggagcttcagggagtggcgcagctgecttca tcccegtggccegttgctegegtttgctggeggtgtcccecggaagaaatatatttgcatgtctttagttctatg atgacacaaaccccgcccagegtcttgtcattggcgaattcgaacacgcagatgcagtcggggcggcgeggtce caggtccacttcgcatattaaggtgacgegtgtggcctcgaacaccgagcgaccctgcagcgaccecgcttaaaa gettggcattccggtactgttggtaaagccaccatggccgatgctaagaacattaagaagggccctgctcecctt ctaccctctggaggatggcaccgctggcgagcagctgcacaaggccatgaagaggtatgccctggtgecctggca ccattgcettcaccgatgcccacattgaggtggacatcacctatgccgagtacttecgagatgtctgtgegcctg gccgaggccatgaagaggtacggcctgaacaccaaccaccgcatcgtggtgtgetctgagaactctctgcagtt cttcatgccagtgctgggecgccctgttcateggagtggcecgtggcccctgectaacgacatttacaacgagcgcg agctgctgaacagcatgggcatttctcagcctaccgtggtgttegtgtctaagaagggcctgcagaagatcctg aacgtgcagaagaagctgcctatcatccagaagatcatcatcatggactctaagaccgactaccagggcttcca gagcatgtacacattcgtgacatctcatetgcectcectggcttcaacgagtacgacttegtgccagagtcttteg acagggacaaaaccattgccctgatcatgaacagctectgggtctaccggcctgcctaagggecgtggcectgcct catcgcaccgcctgtgtgegettctctcacgccegegaccctattttcggcaaccagatcatccccgacaccgc tattctgagecgtggtgccattccaccacggctteggcatgttcaccaccctgggctacctgatttgeggettte gggtggtgetgatgtaccgcttcgaggaggagectgttcctgegcagcctgcaagactacaaaattcagtctgce ctgctggtgccaaccctgttcagcttettegctaagagcaccctgatcgacaagtacgacctgtctaacctgca cgagattgcctctggecggegccccactgtctaaggaggtgggcgaagcecgtggccaagcgctttcatctgccag gcatccgccagggctacggcctgaccgagacaaccagcgccattctgattaccccagagggcgacgacaagcct ggcgccgtgggcaaggtggtgccattettcgaggccaaggtggtggacctggacaccggcaagaccctgggagt gaaccagcgcggcgagctgtgtgtgegcggccctatgattatgtceggctacgtgaataaccctgaggccacaa acgccctgatcgacaaggacggctggctgcactctggcgacattgcctactgggacgaggacgagcacttectte atcgtggaccgcctgaagtctctgatcaagtacaagggctaccaggtggccccagccgagctggagtctatcct getgcagcaccctaacattttcgacgccggagtggccggcctgccecgacgacgatgcecggcgagctgcctgcecg ccgtegtegtgctggaacacggcaagaccatgaccgagaaggagatcgtggactatgtggccagccaggtgaca accgccaagaagctgcgcggcggagtggtgttcgtggacgaggtgcccaagggcctgaccggcaagctggacge ccgcaagatccgcgagatcctgatcaaggctaagaaaggcggcaagatcgccgtgtaataattctagagtcggg geggccggcecgcttcgagcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtga aaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagt taacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttttttaaagcaagtaaa acctctacaaatgtggtaaaatcgataaggatccaggtggcacttttcggggaaatgtgcgcggaacccctatt tgtttatttttctaaatacattcaaatatgtatcecgctcatgagacaataaccctgataaatgcttcaataata ttgaaaaaggaagagtatgagtattcaacatttecegtgtegcccttattccettttttgeggcattttgectte ctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttac atcgaactggatctcaacagcggtaagatccttgagagttttegccccgaagaacgttttccaatgatgagcac ttttaaagttctgctatgtggecgcggtattatccegtattgacgccgggcaagagcaactcggtcgccgcatac actattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaaga gaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgeccttgatcgttgggaaccggagctga atgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactatta actggcgaactacttactctagcttcceggcaacaattaatagactggatggaggcggataaagttgcaggacc acttetgegcteggecccttceggctggectggtttattgctgataaatctggagcecggtgagcgtgggtctcgeg gtatcattgcagcactggggccagatggtaagccctccegtatcgtagttatctacacgacggggagtcaggca actatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagacca agtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcecttt ttgataatctcatgaccaaaatcccttaacgtgagttttegttccactgagcgtcagaccccgtagaaaagatc aaaggatcttcttgagatcctttttttetgegegtaatctgctgcttgcaaacaaaaaaaccaccgctaccagc ggtggtttgtttgccggatcaagagctaccaactctttttcegaaggtaactggcttcagcagagcgcagatac caaatactgttcttectagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacataccte getetgctaatcctgttaccagtggctgetgccagtggcgataagtcgtgtettaccgggttggactcaagacg atagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacga cctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggac aggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatct ttatagtcectgtegggtttegecacetetgacttgagegtegatttttgtgatgetegtcaggggggeggagee tatggaaaaacgccagcaacgecggecctttttacggttectggecttttgetggecttttgetcacatggetega c</INSDSeq seguence> ef </INSDSeg>

E85 </SegusnceData»> oo <Sequencebata seguenasibNumbar=sn3vs

TG <IN3DSeq>

Ti <INSDSeq length>38</IN3DSeq length» 72 <INSDSeq moltype>DNA</INSDSeq moltype> il <IN3DSeq division»PAT</INSD3eq division»

Fa <INSDSeq feature-table> in <INSDFeaturs>

TE <INSDFeature key>source</INIDFeature key> 77 <INSDFeature location»l..38</INSDFeature lozation>

FE <INSDFearure gualsr

Th <INSDQualifier»> £0 <INSDQualifier name>mol type</iNSDQualifier name>

SL <IiNSDgualifier value>other DNA-/INSDguelifier value» a2 </INSDOQuali fier 53 <INSDQualifier id="gi0nx> 54 <INSDQualifier name»note</INSDQualifier named 85 <INSDQualifier valuerUpstream primer

Fl</INSDGuelifier value 26 </INSDOualifier> 87 <INSDOQualifier id="q3"> 88 <IN3DQualifier namerorganism</INSDQualifiesr name> 28 <INSDgvelifier valuersynthetic construct</INSDQuallifier value»

SD <{INSDQualifier» 1 </INSDFeaturs quals>

GE </IN3DFaature>

EN “/INSDSeqg fesature-table> <INSDSeq sequencs>taggegategetegaggcacaaaagactgecaaggaca</iNSDSeg zeguence 95 </INSDSeg>

SE </Zequencelata> 7 <SequenceData zegvencelnNumber="4N>

GH <IN3DSeq> 54 <INSDSeq length>35</IN3DSeq length» 1440 <INSDSeq moltype>DNA</INSDSeq moltype> 101 <IN3DSeq division»PAT</INSD3eq division» 192 <INSDSeq feature-table> 143 <INSDFeaturs>

Lod <INSDFeature key>source“/INSDFeature key>

Lon <INSDFeature location»l..35</INSDFeature lozation>

108 <INSDFeaturs qualsy 107 <INSDQualifier»> oe <INSDQualifier name>mol type</iNSDQualifier name> 143 <INSDuuelifier value>other DNA</INSDOualifier valued iin </TNSDQualifisc> u

LEL <INSDQualifier id="giljx>

Li <INSDQualifier namernote</INSDQualifier named

LLS <INSDQualifier valuerDownstream primer

R1</INSDGualifier valuex 114 </INSDQualifiers> ils <INSDOualifier id="qd4"> ijs <IN3DQualifier namevorganism“/INSDQualifier name>

Li <INSDQualifier valuersynthetic construct</INSDQuallifier value»

LLS <{INSDQualifier» 11% </INSDFeature quals>

Lal </INSDFeature> u zl “/INSDSeqg fesature-table> 127 <INSDSeq sequence>ttgeggeccageggecgccaccaagcaagggegatt</INSDSeyg sequences 123 </INSDSeq> u 124 </SeguencaData> 12% <SequenceData zaquencaldDNumben=nin> ize <INSDSeqr nz <INSDSeq length»>29</INSDSeqg length»

L2G <INSDSeq moltype>DNA</INSDSeg moltype> 140 <INSDSeq divislion»PAT</INSDSeqg division» ijd <INSDSeg Iearturertabie» ijl <INSDPsaturer i122 <IN3DFeature key>source</IN3DFeature key> 1373 <IN3DFeature location»l..29</INSDFeaturs locations 134 <INSDFsature qualsg>

LEE <INSDuuelifier> 136 <INSDoualifier name>mol type“ /INSDQualifier name> 137 <INSDQualifisr value>other DNA</INSDQualifier valuer 138 </INSDOualifier> ijs <INSDOualifier id="qgiar> 148 <IN3DQualifier name>note</INSDQualifier name>

Lal <INSDQualifiler valuerUpstream primer

F2</INSDQuelifier value>

LAZ «</INSDOQualifier»>

LAS <INSDQualifler ia="g5">

Ladd <INSDQualifier name>organism</INSDQualifier name> 14s <IN3DQualifier value>synthetic construct /INSDQualifier values 148 </INSDOQuali fier u 147 </INSDFesature duals» 148 </INSDFeature> 14% </INSDSeg feature-table> 130 <INSDSeq sequsnceveegetegaggcacaaaagactgccaagga“/INSDSeq sequance> 151 </INSDSeg> 152 </Seguencedata> is <SequenceData semiencelDNunbern=N8#> 154 <INSDSeq> 155 <IN3DSeqy Leng:th>36</IN5DSeq length 158 <INSDSeq moltype>DNA</INSDSeg moltype» aT <INSDSeq division>PAT</INSDSeg division»

Led <INSDSeq feature-table> 150 <INSDFeature> ian <INSDFeature key>sourcec/INSDFeature key» 161 <INSDFearure location>l..36</INSDFeature location» 182 <INSDFeature guals> 183 <INSDOualifier>

Lad <INSDQualifier name>mol type</INSDQualiifier name>

LEE <INSDQualifier valuerother DNA</INSDQualifier value» 186 </INSDOualifiers 167 <INSDQualiifler id="g13r> 158 <INSDQualifier name>note</INSDQualifier name> 183 <IN3DQualifier value>Ddownstream primer

R2</INSDQuallfier value»

LIE </INSDQuali fier»

LL <INSDogualifier id="g8*> jd <INSDQualifier namerorganism</INSDQualifier name>

LIS <INSDgQualifier value>synthetic construct“/INSDGualifier value» 174 </INSDOualifier> 17h </IN3DFeature guala> ia </INSDFeaturer u

Li </INSDSegy featurs-table> 178 <INSDSeq segquencerataagaatgcggccgccaccaagcaagggegatttt/INS2Seq sequence

LEG </INSDSe d>

LE </SequenceData> iel “<SequenceData segusnceliNumec=MN}N> 182 <INSDSeq> isa <IN3DSeq length>10</INSDSeq length»

Led ZINSDSegq moltype>DNA</INSDSeg moltyper> 185 <IN3DSeq divisior>PAT</INSDIeqg division» ise <INSDSeq feature-table>

Lev <INS3DFesature>

Lad <INSDFeaturs keyrsource</INSDFeaturs Key» län <INSDFeature location>l..10</IN3DFeature location» 184 <INSDhFeature quels» ijl <INSDQualifier> 182 <IN3DQualifier name>mol type</INSDQualifisr name> 183 <INSDQualifiler valuerother DNA</INGDGualifier value»

Led <{INSDQualifier»

Lan <INSDQualifier id="gij>

Lan CINSDQualifisr name>note</INSDQvali fier name> 197 <INSDQualifier valus>Upstream primer vector homologous fragment«</IN3DQualifier value> 138 </INSDQualifier> u 158 <INSDOualifier Ld=Ygldn> 200 <IN3DQualifier namerorganism“/INSDQuali fier name>

ZOL <INSDQualifier valuersynthetic construct</INSDQualifier values»

AO </INSDOualiLfier»> 203 </INSDFeaturs guals> 204 </TNSDFeaturer 205 </INBDSeq feature-table> 208 ZINSDSeq seguencertaggegateg“/INSDSeg sequencer 207 </INSDSeg> 208 </Zequencebatar

ZG </STi6SeguenceListing>

Claims (10)

CONCLUSIONS A method for improving the ligation efficiency of a target fragment and a psiCHECK2 vector, comprising the steps of: designing a primer with a vector homologous sequence using a bovine genomic DNA as a template - clone to replace a protection base in a traditional primer, and perform PCR amplification on a target fragment; ligating a PCR amplification product with a psiCHECK2 vector and then introducing into competent cells, and determining a vector ligation efficiency of the target fragment and the psiCHECK2 vector. A method for improving a ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 1, wherein the target fragment is a partial fragment located in a candidate region chr4: 76123453 to 76124382 of a bovine IGFBP3 gene. The method for improving a ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 1, wherein the vector ligation efficiency refers to: determining a ligation efficiency of the target fragment and the psiCHECK2 vector according to the number of bacterial monoclones, a positive rate of bacterial solution PCR, and an accuracy of sequencing. A method for improving the ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 2, wherein a primer pair for introducing a vector homologous fragment and amplifying the partial fragment of the bovine IGFBP3 gene includes: an upstream primer F1:5! -TAGGCGATCGCTCGAGGCACAAAAGACTGCCAAGGACA-3' (SEQ ID NO:3), and a downstream primer R1: St-TTGCGGCCAGCGGCCGCCACCAAGCAAGGGSCGATT-3! (SEQ ID NO:4). A method for improving the ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 4, wherein in the primer the vector homologous fragment comprises: an upstream vector homologous fragment of the primer: TAGGCGATCG (SEQ ID NO:7); and a downstream vector homologue fragment of the primer: TTGCGGCCA. The method for improving a ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 1, wherein the PCR amplification product has a fragment size of 963 bp. A method for improving the ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 1, wherein the PCR amplification product and the psiCHECK2 vector are treated with endonucleases Xho I and Not I ligated with a T4 ligase, and introduced into DH5a competent cells. A method for improving the ligation efficiency of a target fragment and a psiCHECK2 vector according to claim 1, wherein a PCR amplification system comprises: 1.0 pL of a 50 ng/uL template DNA, 1.0 pL of each of 10 mM upstream and downstream primers in a primer pair, 12.5 µL of a 2 x Master Mix (Sangon) and 9.5 µL of deionized water; and a PCR reaction program includes: initial denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and elongation at 72°C for 60 sec, performing a total of 35 cycles. Use of the method according to any one of claims 1 to 8 in the construction of a recombinant vector. Use according to claim 9, wherein a recombinant vector of the homologous sequence primer increases the number of bacterial monoclones, the positive rate of bacterial solution PCR, and the accuracy has sequencing capabilities higher than that of a recombinant vector of a conventional primer and a recombinant vector of bacterial endogenous homology.