NL2031676B1 - Gene therapy for Pompe Disease - Google Patents

Gene therapy for Pompe Disease Download PDF

Info

Publication number
NL2031676B1
NL2031676B1 NL2031676A NL2031676A NL2031676B1 NL 2031676 B1 NL2031676 B1 NL 2031676B1 NL 2031676 A NL2031676 A NL 2031676A NL 2031676 A NL2031676 A NL 2031676A NL 2031676 B1 NL2031676 B1 NL 2031676B1
Authority
NL
Netherlands
Prior art keywords
gaa
nucleic acid
acid molecule
amino acids
human
Prior art date
Application number
NL2031676A
Other languages
Dutch (nl)
Inventor
Tjitske Van Der Ploeg Antje
Catherina Vlaar Eva
Catalano Fabio
Wenceslaus Matthias Pijnappel Wilhelmus
Original Assignee
Univ Erasmus Med Ct Rotterdam
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Erasmus Med Ct Rotterdam filed Critical Univ Erasmus Med Ct Rotterdam
Priority to NL2031676A priority Critical patent/NL2031676B1/en
Priority to PCT/NL2023/050216 priority patent/WO2023204714A1/en
Application granted granted Critical
Publication of NL2031676B1 publication Critical patent/NL2031676B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors (Somatomedins), e.g. IGF-1, IGF-2
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/0102—Alpha-glucosidase (3.2.1.20)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The invention relates to nucleic acid molecules comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity With amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor ll (lGFll) gene sequence located 5’ of the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity With amino acids 28-952 of human GAA, to encoded fusion proteins, and uses thereof.

Description

P132001NL00
Title: Gene therapy for Pompe Disease
Field of the invention
The invention relates to the field of gene therapy, in particular to gene delivery vehicles and method of gene therapy for treatment of Pompe Disease.
Background of the invention
Pompe Disease, also known as acid maltase deficiency or glycogen storage disease type II, is an autosomal recessive metabolic disorder. It is caused by an accumulation of glycogen in the lysosome due to a deficiency of the lysosomal acid a-glucosidase enzyme. The build-up of glycogen occurs throughout the body and causes progressive skeletal muscle weakness (myopathy) and affects various body tissues, particularly in skeletal muscles, liver and, in the most severe classic infantile form also the heart and the nervous system. Symptoms arise from muscle weakness and wasting. Classic infantile patients who have complete enzyme deficiency present shortly after birth and become completely quadriplegic within 8 months. The natural course of Pompe's disease is invalidating by progressive loss of mobility and respiratory function and is lethal for severely affected infants in the first year of life. Older children and adults with residual activity show a more protracted course of disease and may become wheelchair bound, dependent on artificial ventilation and die from respiratory failure ranging from early childhood to late adulthood.
In Pompe Disease, the protein a-D-glucoside glucohydrolase or, in short, acid a-glucosidase (GAA, EC 3.2.1.20, also known as acid maltase), which is a lysosomal hydrolase, is defective. The protein is an enzyme that normally degrades the a-1,4 and a-1,6 linkages in glycogen, maltose and isomaltose and is required for the degradation of 1-3% of cellular glycogen. The deficiency of this enzyme results in the accumulation of structurally normal glycogen in lysosomes and cytoplasm in affected individuals. Excessive glycogen storage within lysosomes may interrupt normal functioning of other organelles and lead to cellular injury.
A defective acid a-glucosidase protein, or reduced amount or activity of acid a- glucosidase protein, is the result of mutations (or variants) within the Glucosidase,
alpha, acid (GAA) gene. The GAA gene is located on the long arm of chromosome 17 at 17925.2-925.3 (base pairs 80,101,556 to 80,119,879 in GRCh38.p 10). Severe mutations that completely abrogate GAA enzyme activity cause a classic infantile disease course with hypertrophic cardiomyopathy, general skeletal muscle weakness, and respiratory failure and result in death within 1 years of life. Milder mutations leave partial GAA enzyme activity which results in a milder phenotype with onset varying from childhood to adult. In general, a higher residual enzyme activity in primary fibroblasts is associated with later onset of Pompe Disease.
Some of the GAA mutations in Pompe Disease patients may lead to alternative splicing and thereby to absent or a reduced amount or activity of a-glucosidase protein. One of the most common mutations in Pompe Disease is the IVS1 mutation, c.-32-18T>G, a transversion (T to G) mutation which occurs among infants, children, juveniles and adults with this disorder (Huie ML, et al., 1994.
Hum Mol Genet. 3(12):2231-6). In childhood and adult Pompe Disease, 90% of the patients in the Caucasian population are affected by the common ¢.32-13T>G (IVS1) variant that results in aberrant splicing of exon 2, such that exon 2 is partially or completely skipped. Absence of exon 2 from the mRNA results in absence of the normal AUG translation start site of the protein, which results in mRNA decay and failure to generate (GAA protein.
Enzyme replacement therapy (ERT) has been developed for Pompe Disease, in which recombinant human GAA protein is administered intravenously. This treatment is aimed to increase the intracellular level of a-glucosidase activity in affected cells and tissues and thereby reduce or prevent glycogen accumulation and eventually symptoms of the disease. The treatment can rescue the lives of classic infantile patients and delay disease progression of later onset patients, but the effects are heterogeneous. Also, it appears that there is a gradual decrease of the effect of added enzyme, and doses needs to be increased over time to maintain normal glycogen levels.
ERT has been used for treatment of infantile (infantile-onset or ‘classic infantile’), childhood (delayed-onset) and adult (late onset) Pompe patients.
Targeting exogenous GAA protein to the main target tissues and cells is, however, a challenge. For example 15-40% of the body is composed of skeletal muscle and for the treatment to be effective each individual cell in the body needs to reached and loaded with exogenous (GAA protein. In addition, ERT has limitations because it does not pass the blood brain barrier, i.e. due to lack of enzyme penetration into the central nervous system (CNS). The cells must take up the enzyme via endocytosis, which seems most efficient when receptors on the cell surface such as the mannose 6-phosphate/IGFII receptor are targeted. The mannose 6-phosphate/IGFII receptor recognizes various ligands such as mannose 6-phosphate, IGFII and Gluc-NAC.
Finally, ERT is limited by immunogenicity against the recombinant GAA enzyme, in particular in cross-reactive immunological material (CRIM)-negative patients suffering from Pompe Disease characterized by a complete absence of GAA enzyme.
In addition, ERT requires life-long administration, does not provide cure, is not effective in all patients because it gives an heterogeneous response, and is extremely expensive.
For ERT, several attempts have been made with an insulin-like growth factor
IT (IGFII; also referred to as IGF2) based tag fused to GAA in an expression vector, allowing for improved cellular uptake by targeting the IGFII binding domain of the mannose 6-phosphate/IGFII receptor. In addition, Maga et al. (J Biol Chem. 2013
Jan 18;288(3):1428-38.) describe a fusion protein between IGF2 and GAA amino acids 70-952 for ERT. Modified IGFII, e.g. with a deletion of amino acids 30-40 (IGFIIdel) or containing mutations to remove furin cleavage sites and insulin receptor binding have also been described. For instance, the use of an IGFIIdel tag for GAA is described in WO 2009/137721 in an expression vector with the aim to produce a fusion protein for ERT.
Hematopoietic stem cell gene therapy is a promising form of gene therapy. It offers therapeutic efficacy in a wide range of tissues following a single intervention and has recently been approved for the lysosomal storage disorder (LSD) metachromatic leukodystrophy (MLD). Developments are underway for other disorders, including Pompe Disease. Several constructs for hematopoietic stem cell lentiviral gene therapy (HSC-LGT) have been described.
WO 2008/136670, Van Til et al. (Blood. 2010 Jul 1;115(26):5329-37) and
Wagemaker et al. (Mol Ther Methods Clin Dev. 2020 May 4;17:1014-1025) describe lentiviral constructs containing the GAA gene for transducing murine hematopoietic stem cells. Recently, Dogan et al. (https://doi.org/10.1101/2021.12.28.474352) described several constructs for hematopoietic stem cell gene therapy using constructs (see figure S1 of Dogan et la. 2021), among which untagged codon optimized GAA (GAAco) and GAA lacking the signal peptide tagged with several IGFII and modified IGFII tags.
However, several questions remain to be answered: First, it is unknown how the IGFII tag with a deletion of aa 30-40 performs in the context of lentiviral gene therapy. It was expected that this version will not pass the blood brain barrier. The reason for this idea is that the present inventors previously found unexpected efficiency of IGFII-tagged (GAA in lentiviral gene therapy for treating the central nervous system in mice with Pompe Disease (Liang et al unpublished). The anticipated mechanism is that IGFII has also affinity for the insulin receptor, which in contrast to the mannose 6-phosphate receptor is expressed at the blood brain barrier. The insulin receptor is therefore expected to be responsible for the improved efficacy of IGFII-GAA in treating the brain in lentiviral gene therapy. It is known that deleting aa 30-40 of IGFTI removes the insulin receptor binding domain. Hence, it is expected that this epitope tag with a deletion of aa 30-40 will fail to mediate improved treatment of the brain. It is also unknown how the aa30- 40 deletion in the IGFII epitope tag will affect efficacy in other target tissues such as heart and skeletal muscle.
Second, in all IGFII tagged GAA versions developed so far, a truncated form of the GAA protein has been used (aa 70-952 of GAA). This has potential consequences for the immunogenic properties as explained hereafter. In ERT, the 110 kD form of GAA is used (corresponding to aa 57-952). This implies that immune tolerance induced by lentiviral gene therapy will only be established against the aa 70-952 GAA product, leaving aa 28-69 potentially unprotected from immune responses induced by subsequently administered ERT.
Hence, there remains a need in the art for gene therapy strategies for Pompe
Disease which provide improved treatment and reduced immunogenicity.
Summary of the invention
It is an object of the present invention to overcome one or more problems that are associated with the above described therapies, in particular gene therapies, for treatment of Pompe Disease. It is a further object provide nucleic acid molecules, gene therapy vectors and viral particles for gene therapy of Pompe Disease.
In a first aspect, the invention therefore provides a nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5 of 5 the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA.
In preferred embodiments, the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA, and a human IGFII gene sequence located 5 of the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA.
In preferred embodiments, the invention provides a provides a nucleic acid molecule comprising a nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor U (IGFII) gene sequence located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA.
In a further aspect, the invention provides a viral particle comprising a nucleic acid molecule according to the invention.
In a further aspect, the invention provides a fusion protein encoded by the nucleic acid molecule according to the invention.
In a further aspect, the invention provides a fusion protein comprising amino acids 28-952 of human acid alpha glucosidase (GAA), or comprising an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human
GAA and comprising amino acids 70-952 of human GAA, fused to a human insulin- like growth factor II (IGFIT) amino acid sequence, optionally separated by a linking sequence, preferably wherein the human IGFII amino acid sequence is as defined herein.
In a further aspect, the invention provides a fusion protein comprising an amino acid sequence having at least 90% sequence identity with amino acids 28- 952 of human acid alpha glucosidase (GAA), fused to a human insulin-like growth factor II (IGFIT) amino acid sequence, optionally separated by a linking sequence, preferably wherein the human IGFII amino acid sequence is as defined herein.
In a further aspect, the invention provides a nucleic acid sequence encoding the fusion peptide according to the invention.
In a further aspect, the invention provides a cell population, preferably comprising hematopoietic stem cells (HSC), provided with a nucleic acid molecule or viral particle according to the invention.
In a further aspect, the invention provides a method for treating Pompe
Disease comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to an individual in need thereof.
In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating Pompe Disease.
In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for the treatment of Pompe Disease.
In a further aspect, the invention provides a method for central immune tolerance induction in an individual suffering from Pompe Disease, the method comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to said individual.
In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for central immune tolerance induction in an individual suffering from Pompe Disease.
In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for central immune tolerance induction in an individual suffering from Pompe Disease.
In a further aspect, the invention provides a method for preventing or halting loss of IG in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease, comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to the individual.
In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease.
In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe
Disease.
In a further aspect, the invention provides a method for treating brain, peripheral nervous system, smooth muscle and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease, comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to the individual.
In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe
Disease, in particular classic infantile Pompe Disease.
In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in a preparation of a medicament for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from
Pompe Disease, in particular classic infantile Pompe Disease.
Detailed description
As used herein, "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb “to consist” may be replaced by “to consist essentially of” meaning that a compound or adjunct compound as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
The articles “a” and “an” are used herein to refer to one or to more than one (i.e, to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
The word “approximately” or “about” when used in association with a numerical value (approximately 10, about 10) preferably means that the value may be the given value of 10 more or less 1% of the value.
The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives.
As used herein, a nucleic acid molecule of the invention comprises a chain of nucleotides of any length, preferably DNA and/or RNA. In other embodiments a nucleic acid molecule or nucleic acid sequence of the invention comprises other kinds of nucleic acid structures such as for instance a DNA/RNA helix, peptide nucleic acid (PNA), locked nucleic acid (LNA) and/or a ribozyme. Hence, the term “nucleotide sequence” also encompasses a chain comprising non-natural nucleotides, modified nucleotides and/or non-nucleotide building blocks which exhibit the same function as natural nucleotides. The term nucleic acid molecule includes recombinant and synthetic nucleic acid molecules as well as nucleic acid molecules which are isolated, e.g. in part, from a natural source. In preferred embodiments of the present invention a nucleic acid molecule is DNA or RNA. It may be single stranded or double stranded. A skilled person is well capable of preparing nucleic acid molecules and vector of the invention, for instance using standard molecular cloning techniques as for instance described in Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, Third Edition, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor (2001), which is incorporated herein by reference.
In amino acid sequences as defined or recited herein amino acids are denoted by single-letter symbols. These single-letter symbols and three-letter symbols are well known to the person skilled in the art and have the following meaning: A (Ala) is alanine, C (Cys) is cysteine, D (Asp) is aspartic acid, E (Glu) is glutamic acid, F (Phe) is phenylalanine, G (Gly) is glycine, H (His) is histidine, I (Ile) is isoleucine, K
(Lys) is lysine, L (Leu) is leucine, M (Met) is methionine, N (Asn) is asparagine, P (Pro) is proline, Q (Gln) is glutamine, R (Arg) is arginine, S (Ser) is serine, T (Thr) is threonine, V (Val) is valine, W (Trp) is tryptophan, Y (Tyr) is tyrosine.
As used herein with respect to an amino acid sequence of a peptide, protein or fusion protein, the terms “N- terminal” and “C-terminal” refer to relative positions in the amino acid sequence toward the N-terminus and the C-terminus, respectively. “N- terminus” and “C-terminus” refer to the extreme amino and carboxyl ends of the polypeptide, respectively. “Immediately N-terminal” and “immediately C-terminal” refers to a position of a first amino acid sequence relative to a second amino acid sequence where the first and second amino acid sequences are covalently bound to provide a contiguous amino acid sequence.
The percentage of identity of an amino acid sequence or nucleic acid sequence, or the term “% sequence identity”, is defined herein as the percentage of residues of the full length of an amino acid sequence or nucleic acid sequence that is identical with the residues in a reference amino acid sequence or nucleic acid sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for the alignment are well known in the art, for example "Align 2". Programs for determining nucleotide sequence identity are also well known in the art, for example, the BESTFIT, FASTA and GAP programs. These programs are readily utilized with the default parameters recommended by the manufacturer.
As used herein, the term “individual” encompasses humans. Preferably, a subject is a human, in particular a human suffering from Pompe Disease. In some embodiments, the individual is a child, e.g. up to 18 years of age. In other embodiments, the individual is an adult, e.g. from 18 year of age.
The term "therapeutically effective amount," as used herein, refers to an amount of an agent or composition being administered sufficient to relieve one or more of the symptoms of the disease or condition being treated to some extent. This can be a reduction or alleviation of symptoms, reduction or alleviation of causes of the disease or condition or any other desired therapeutic effect.
The term “treatment” refers to inhibiting the disease or condition, i.e., halting or reducing its development or at least one clinical symptom of the disease or disorder, and/or to relieving symptoms of the disease or condition. In some embodiments, treatment may be administered after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.
As demonstrated in the Examples herein, the present inventors have obtained very promising results using IGFII epitope tagged GAA cDNA in the mouse. The strategy used was shown to give full correction of glycogen accumulation in heart, skeletal muscles, and brain.
In particular, the full correction was obtained at exceptionally low vector copy number (VCN). For clinical use it is important to have an efficacy at a VCN (i.e. the number of lentiviral integrations in the DNA of the transplanted cells) of less than 5 copies per cell/genome. In the examples (see figure 7) it is demonstrated that with a lentiviral vector of the invention VCNs in bone marrow at which full correction of the Pompe Disease phenotype in mice was achieved for the most relevant tissues with low VCN, in particular the VCN is between 2-5, calculated using a standard curve made with 3T3 cells that were transduced with a low dose of lentiviruses {method 1). The standard curve relied on assumptions that the low lentiviral dose was close to a VCN of 1. However, more recent work has more accurately determined vector copy number. To calculate the VCNs using method 2, a lentiviral transfer sequence (pCCL.MND.GAAco) was used as a template to obtain the plasmid standard reference curve with known vector copies per ul of solution.
Using primers for the viral sequence PSI and the reference sequence albumin, the copy number of the sample were determined by comparing the CT cycles of the samples to those of the plasmid standard. It was found that using method 2, the obtained VCNs in bone marrow are 4 to 6 times lower than those measured with method 1 (ranging from 0,7 to 2,4), and that these levels are able to completely normalize glycogen levels in skeletal muscle, heart, and brain. With this strategy the present inventors have thus developed a lentiviral vector that is suitable for clinical use.
The use of a (GAA nucleotide sequence encoding amino acids 28-952 or a sequence having at least 90% identity therewith prevents anti-GAA antibody formation. In particular, the use of the GAA preprotein encoding aa 28-952 in lentiviral gene therapy prevents the formation of anti-GAA antibodies to all forms of GAA, including the full length GAA (FL-GAA), i.e. the GAA preproprotein consisting of amino acids 28-952 as shown in figure 1A, to the active forms of GAA and to potential intermediate forms and by-products. This is essential in order to combine HSC gene therapy with GAA ERT because in ERT, the 110 kD form of (GAA is used (corresponding to aa 57-952).
As demonstrated in the examples, the present inventors found that treatment with a method according to the present invention results in central immune tolerance to the transgene GAA product as well to recombinant human GAA (ERT).
In particular, full central immune tolerance is achieved using the GAA cDNA sequence encoding amino acids 28-952 or a sequence having at least 90% identity thereto, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA, comprised within a nucleic acid molecule or vector of the invention, i.e. to all forms of GAA, including the full length GAA, i.e. the GAA preproprotein consisting of amino acids 28-952 as shown in figure 1A, to the active forms of GAA and to potential intermediate forms and by-products. Immune tolerance to the transgene product is crucial to avoid a cytotoxic T cell response that would eliminate transduced HSC from the patient, and/or to avoid antibody formation that could neutralize the activity of the transgene product. Additionally, full immune tolerance is advantageous to combine HSC gene therapy with ERT, in which the 110 kD form of
GAA is used (corresponding to aa 57-952) is used, as indicated above. With the central immune tolerances to the transgene product, central immune tolerance to recombinant human GAA is achieved, which is of high importance to allow treatment of patients with ERT with recombinant GAA enzyme following HSC gene therapy without the risk of immune reactions raised to the recombinant human GAA used in ERT, e.g. in patients in which the HSC gene therapy showed insufficient efficacy. Before the present invention, any known gene therapy strategy was associated with this risk because in all (epitope tagged) lentiviral versions of GAA so far, a truncated form of the GAA cDNA has been used (aa 70- 952 of GAA). Immune tolerance induced by previously known lentiviral gene therapy constructs will only be established against the aa 70-952 GAA product, leaving aa 28-69 potentially unprotected from immune responses induced by subsequently administered ERT. The advantage of lentiviral gene therapy with respect to its immune tolerance induction properties would therefore not fully apply to subsequently administered ERT. This could pose a risk for developing anti-GAA antibodies that could neutralize the efficacy of ERT, when combined with previously known lentiviral gene therapy. Central immune tolerance acts via the thymus, which is the organ where T cells are selected and go into apoptosis when they recognize self-antigens. If central immune tolerance is established, it provides lifelong protection against an immunogenic reaction against the antigen. Central immune tolerance contrasts with peripheral immune tolerance. For example, AAV gene therapy directed towards the liver can give peripheral immune tolerance.
Peripheral immune tolerance acts via the liver and the formation of regulatory T cells, and which immune tolerance decreases after a certain period of time.
As described herein before, before the present invention the IGFII tag has been fused to a truncated form of GAA, namely aa 70-952, applied as ERT or as lentiviral gene therapy. GAA aa 70-952 represents an already partially processed form of GAA. However, in ERT, an aa 57-952 GAA protein is used. This implies that lentiviral gene therapy employing an aa 70-952 GAA transgene will only induce immune tolerance to epitopes within the 70-952 aa GAA protein, but not to epitopes within the aa 57-69 GAA protein. Here the present inventors include an
IGFII-GAA aa 28-952 fused gene into a lentiviral vector to achieve central immune tolerance to the complete sequence of GAA, including the transgene product and to
ERT.
In a first aspect, the invention therefore provides a nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5 of the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA.
Also provided is a nucleic acid molecule comprising a nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA), or encoding an amino acid sequence having at least 90% sequence identity with amino acids 28- 69 of human GAA and encoding amino acids 70-952 of human GAA, and a human insulin-like growth factor II (IGFII) gene sequence located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA, or encoding the amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human
GAA and encoding amino acids 70-952 of human GAA.
Also provided is a nucleic acid molecule comprising a nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5 of the nucleotide sequence encoding amino acids 28-952 of human GAA.
The human GAA amino acid sequence encoded by the human GAA gene is shown in figure 1A. This sequence contains a signal peptide (amino acids 1-27) and a 110 kD preproprotein (amino acids 57-952) which is proteolytically further processed to generate multiple intermediate forms and the mature, active 76 kD and 70 kD forms of the GAA enzyme. The human GAA cDNA sequence, including the sequence encoding the signal peptide and the sequence encoding the preproprotein, is shown in figure 1B.
A nucleic acid molecule of the invention comprises a nucleotide sequence encoding amino acids 28-952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA. This means that amino acids 1-27, the GAA signal peptide, are lacking. Hence, a nucleotide sequence encoding amino acids 1-27 of GAA as depicted in figure 1A is lacking. Preferably, a nucleotide sequence encoding amino acids 1-27 of GAA as depicted in figure 1A or any part thereof encoding at least 15 consecutive amino acids is absent in a nucleic acid molecule of the invention.
Said amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, preferably comprises 90% sequence identity with at least amino acids 28-69 of human GAA as shown in figure 1A. In preferred embodiments, a nucleic acid molecule of the invention comprises a nucleotide sequence encoding amino acids 28-952 of human GAA, or an amino acid sequence having at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, sequence identity with amino acids 28-952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA.
In preferred embodiments, the variation in amino acid sequence is only in amino acids 28-69. Le. in preferred embodiments, the nucleic acid molecule encodes an amino acid sequence having at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, sequence identity with amino acids 28-69 of human GAA and encodes amino acids 70-952 of human GAA.
In one preferred embodiment, the nucleotide sequence encoding amino acids 28-952 of GAA comprises or consists of nucleotides 239-3013 of the human GAA cDNA as shown in figure 1B. However, the GAA nucleotide sequence may also be a codon-optimized sequence of the wild-type GAA amino acid sequence. Hence, in other preferred embodiments, the nucleotide sequence encoding amino acids 28-952 of GAA comprises or consists of a codon-optimized sequence of nucleotides 239-3013 of the human GAA cDNA as shown in figure 1B. Codon optimization of nucleotide sequences encoding proteins is a well-known and commonly used technique in the art and a skilled person is well capable of preparing and selecting suitable codon optimized sequences. Suitable codon optimized GAA nucleotide sequences is described in Stok et al., 2020 (Molecular Therapy - Methods & Clinical
Development 17: 1014-1025).
A nucleic acid molecule of the invention comprises a human insulin-like growth factor II (IGFII) gene sequence. Figure 2 shows the sequence of human mature IGFII, including its signal peptide. IGFII is synthesized as a pro-protein containing 180 amino acids which is processed ultimately into a 67-amino acid bioactive IGFII protein, which is referred to as mature IGFII. Firstly, a signal peptide of 24 amino acids is removed from the N terminus, generating pro-IGFTI (156 amino acids), followed by cleavage of pro-IGFII into a 104-amino acid protein product [IGFII(1-104)]. Subsequent endoproteolyzation generates IGFII(1-87) and the mature IGFII protein consisting of 67 amino acids.
In preferred embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the human IGFII signal peptide, indicated as amino acids -24 to -lin figure 2 MGIPMGKSMLVLLTFLAFASCCIA), or a sequence having at least 90% sequence identity therewith. Preferably, the IGFII gene sequence comprises a nucleotide sequence encoding the human IGFII signal peptide, indicated as amino acids -24 to -1 in figure 2.
In further preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 70% sequence identity with human, mature
IGFII, the sequence of which is shown in figure 2, and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 75% sequence identity with human mature [GFII and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In some embodiments, the IGFTI gene sequence encodes an amino acid sequence which has at least 80% sequence identity with human mature IGFII and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In other preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 83% sequence identity with human mature IGFII and the human IGFII signal peptide (amino acids -24 to -1), more preferably at least 85% sequence identity, more preferably at least 89% sequence identity with human mature IGFII and the human IGFTI signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith.
In some preferred embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the IGFII signal peptide and amino acids 1 and 8-67 of IGFII, as shown in figure 2. In some embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the IGFTI signal peptide and amino acids 1-67 of IGFII, as shown in figure 2. In other preferred embodiments, the IGFII sequence encodes an IGFII amino acid sequence which has a mutation that reduces binding affinity for the insulin receptor as compared to the wild-type human IGF-
II. In some preferred embodiments, the human IGFII gene sequence comprises a mutation within the nucleotide region encoding amino acids 30-40 of IGFII, preferably a deletion within the nucleotide region encoding amino acids 30-40 of
IGFII. This region of the IGFII sequence comprises the insulin receptor binding domain. Hence, the IGFII sequence preferably is mutated such that binding of the fusion protein to the insulin receptor is reduced with at least 50% or abolished. In preferred embodiments, the IGFII gene sequence comprises a deletion of the nucleotides encoding at least amino acids 30-40, 31-40, 32-40, 33-40, 34-40, 35-40, 36-40, 37-40, 30-39, 31-39, 32-39, 33-39, 34-39, 35-39, 36-39, 30-38, 31-38, 32-38, 33-38, 34-38, 35-38, 36-38, 30-37, 31-37, 32-37, 33-37, 34-37, 35-37, 30-36, 31-36, 32-36, 33-36, 34-36, 30-35, 31-35, 32-35, 33-35, 30-34, 31-34, 30-34, 30-33, 31-33 or 30-32 of human mature IGFII as shown in figure 2. In preferred embodiments, the
IGFII gene sequence comprises a deletion of the nucleotides encoding amino acids 30-40 of human mature IGFII. Hence, in preferred embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and encoding amino acids 1, 8-29 and 41- 67 of mature IGFII, as shown in figure 2. Further suitable IGFII mutants with reduced insulin receptor binding are described in WO 2009/137721, which is incorporated herein by reference.
In some preferred embodiments, the IGFII gene sequence consists of a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-67 of IGFII, as shown in figure 2.
In some preferred embodiments, the IGFII gene sequence consists of a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-29 and 41-67 of mature IGFII, as shown in figure 2.
The use of a vector comprising such IGFII sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor, preferably leaves binding to the IGFII/mannose 6 phosphate receptor (IGFIR/M6PR) intact.
As demonstrated in the examples, the present inventors show that effectivity of treatment while using such IGFII sequence comprising a deletion within the nucleotide sequence encoding the insulin receptor binding domain ("IGF2del.GAAco” construct) results in a higher efficacy in skeletal muscle as compared to the use of a vector comprising an IGFII sequence with intact insulin receptor binding domain. As demonstrated in figure 7, IGF2del.GAAco (construct 3) was more efficient compared to IGF2.GAAco in clearing glycogen content in tibialis anterior and quadriceps femoris.
The examples herein further show that with a vector comprising such IGFII sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor efficacy in the brain is also achieved. This is surprising, as the insulin receptor was believed to be important for crossing the blood brain barrier, as the insulin receptor is expressed at the blood brain barrier, while M6P/IGFTIR is not. It was therefore believed that, use of a vector comprising an IGFII gene sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor domain would not be efficacious in the brain, similarly as untagged GAA. However, despite this absence of insulin receptor binding properties of the IGFIIdeletion-GAA fusion protein, efficacy in improvement of glycogen levels in the brain was achieved. The fact that it still works in the brain is therefore surprising and points to another mechanism than anticipated.
In addition, it was found that the IGFII gene sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor domain improved safety with respect to glucose metabolism, which is of clinical relevance.
The IGFII gene sequence is located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28- 69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA, in a nucleic acid molecule or vector of the invention, specifically a gene therapy vector, more specifically a lentiviral gene therapy vector. Expression of nucleic acid sequences of the invention results in a fusion protein comprising a human IGFII epitope tag and a human GAA amino acid sequence, in particular of amino acids 28-952 of human acid alpha glucosidase (GAA), or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and an amino acid sequence comprising amino acids 70-952 of GAA, more in particular amino acids 28-952 of human GAA. With the 5 orientation of the IGFII gene sequence a fusion protein is expressed wherein the IGFII epitope tag is attached N-terminally to the
GAA sequence, optionally with a linking sequence between the IGFII epitope tag and the GAA sequence.
In preferred embodiments, a nucleic acid molecule of the invention comprises a linking sequence located between the human [GFII gene sequence and the nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA), or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of human (GAA, more in particular encoding amino acids 28-952 of human GAA. In preferred embodiments, the linking sequence is a nucleotide sequence that encodes an amino acid sequence of 2 — 20 amino acids, preferably of 2 — 10 amino acids, more preferably of 2 — 5 amino acids, such as 2, 3 or 4 amino acids. In preferred embodiments, the linking sequence is a nucleotide sequence that encodes an amino acid sequence of 3 amino acids. A preferred, but non- limiting linking sequence is a nucleotide sequence that encodes the amino acid sequence GAP.
A nucleic acid molecule of the invention may further comprise one or more regulatory sequences to direct expression of a nucleotide sequence, including a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence.
In preferred embodiments a nucleic acid molecule of the invention comprises a promoter operably linked to the human IGFII gene sequence and nucleotides 28- 952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of
GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA. A used herein “operably linked” means that a nucleotide sequence is functionally associated with one or more other nucleotide sequences. For instance, the promoter nucleotide sequence is functionally associated with the human IGFII gene sequence and nucleotides 28-952 of human
GAA, or an amino acid sequence having at least 90% sequence identity therewith, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA, such that the promoter sequence influences or directs the expression of the other nucleotide sequences. Various promoters, including inducible promoters, may be used to direct expression of nucleotide sequences included in a nucleic acid molecule of the invention, including viral promoter. Suitable promoters include a SV40 promoter, a
Rous Sarcoma Virus (RSV) promoter, a cytomegalovirus (CMV) promoter and a
MND promoter or derivatives of any of these promoters. In the case of Pompe
Disease glycogen accumulation and symptoms in several organs need to be corrected (heart, skeletal and smooth muscle, peripheral nervous system and brain) and the peripheral nervous system (see below). Therefore, in preferred embodiments the promoter is a ubiquitous promoter rather than a cell type specific promoter. In preferred embodiments the promoter is an MND promoter or derivatives thereof, such as the MND promoter with a 174bp deletion at the 5 end.
MND promoter is described in Robbins et al (Proc. Natl. Acad. Sci. USA 1994, Vol. 95, pp. 10182-10187) and Astrakhan et al (Blood. 2012; 119(19): 4395-4407), which are incorporated herein by reference.
In preferred embodiments, a nucleic acid molecule of the invention is or is part of a vector. In preferred embodiments, the nucleic acid molecule of the invention is a gene therapy vector. Also provided by the invention is therefore a vector, preferably a gene therapy vector comprising a nucleic acid molecule of the invention.
The gene therapy vector is preferably a vector that is suitable for ex vivo transduction of haematopoietic stem cells.
The vector can be a viral or non-viral vector. Non-limiting examples of suitable expression vectors include retroviral, adenoviral, adeno-associated and herpes simplex viral vectors, non-viral vectors and engineered vectors.
The vector, in particular gene therapy vector, preferably is a viral vector. Said viral vector preferably is a recombinant adeno-associated viral vector, a herpes simplex virus-based vector, or a lentivirus-based vector such as a human immunodeficiency virus-based vector. Said viral vector further preferably is a retroviral-based vector such as a lentivirus-based vector such as a human immunodeficiency virus-based vector, or a gamma-retrovirus-based vector.
Retroviruses can be packaged in a suitable complementing cell that provides Group
Antigens polyprotein (Gag)-Polymerase (Pol) and/or Envelop (Env) proteins.
Suitable packaging cells are human embryonic kidney derived 293T or 293 cells,
Phoenix cells (Swift et al., 2001. Curr Protoc Immunol, Chapter 10: Unit 10 170),
PG13 cells (Loew et al., 2010. Gene Therapy 17: 272-280) and FIp293A cells (Schucht et al., 2006. Mol Ther 14: 285-92). Methods for the generation of such non- viral expression vectors are well known in the art.
Non-viral expression vectors include nude DNA, and nucleic acids packaged into synthetic or engineered compositions such as liposomes, polymers, nanoparticles and molecular conjugates. Methods for the generation of such non- viral expression vectors are well known in the art.
As an alternative, a nucleic acid molecule used in accordance with the invention may be provided to a subject by gene editing technology, including
CRISPR/Cas, zinc-finger nucleases, and transcription activator-like effector nucleases-TALEN, in order to insert the receptor transgenes into specific loci with or without an exogenous promoter. Preferred genomic loci include the AAVSI locus and the PD-1 locus, as is known to a skilled person.
In preferred embodiments the vector, in particular gene therapy vector is a lentiviral vector.
In particularly preferred embodiments, the nucleic acid molecule or vector of the invention is a gene delivery vehicle of lentiviral origin. Typically, the term “gene delivery vehicle of lentiviral origin” refers to a gene delivery of any lentiviral origin. Gene delivery vehicles of lentiviral origin are all vehicles comprising genetic material and/or proteinaceous material derived from lentiviruses. Typically the most important features of such vehicles are the integration of their genetic material into the genome of a target cell and their capability to transduce stem cells. These elements are deemed essential in a functional manner, meaning that the sequences need not be identical to lentiviral sequences as long as the essential functions are present. The methods of the invention are however especially suitable for recombinant lentiviral particles, which have most if not all of the replication and reproduction features of a lentivirus, typically in combination with a producer cell having some complementing elements. Normally the lentiviral particles making up the gene delivery vehicle are replication defective on their own. In a preferred embodiment, the used “gene delivery vehicle of lentiviral origin” is a “gene delivery vehicle of HIV lentiviral origin” and even more preferred are HIV-1 derived self-inactivating lentiviral vectors.
The invention also provides a viral particle comprising a nucleic acid molecule according to the invention, preferably a lentiviral particle.
Methods and means (such as producer cells) for producing the desired lentiviral particles are well known in the art. Examples of preferred producer cells are 293T cells that are co-transfected with VSV-G (Vesicular stomatitis virus- G- protein envelope). Other pseudotypes used in this setting are RD114 (Feline- immunodeficiency virus).
In preferred embodiments of the invention, a nucleic acid molecule or vector of the invention is for use in transducing cells, in particular HSC, preferably ex vivo transducing cells, in particular HSC.
In one aspect, the invention therefore provides a method for transducing hematopoietic stem cells (HSC) with, a nucleic acid molecule or vector, preferably a gene delivery vehicle of lentiviral origin, according to the invention comprising contacting HSC with said with a relatively low amount of transducing units per cell of said gene delivery vehicle, In preferred embodiments, said HSC are human, more preferably isolated from an individual suffering from Pompe Disease.
As used herein, the term “transduction” refers to the stable transfer of genetic material from a viral particle to a hematopoietic stem cell genome.
Hematopoietic stem cells (HSC) are stem cells and the early precursor cells which give rise to all the blood cell types that include both the myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets and some dendritic cells) and lymphoid lineages (T-cells,
B-cells, NK-cells, some dendritic cells). The hematopoietic tissue has cells with long term and short term regeneration capacities and committed multipotent, oligopotent and unipotent progenitors.
HSC can be obtained from different sources and are, for example, found in the bone marrow of humans, which includes femurs, hip, ribs, sternum, and other bones. Cells can be obtained directly by removal from the hip using a needle and syringe, or from the blood following pre-treatment with cytokines, such as G-CSF (granulocyte colony stimulating factor), that induces cells to be released from the bone marrow compartment into the blood (mobilized peripheral blood).
In preferred embodiments, autologous HSC are transduced with a nucleic acid molecule or vector of the invention. In such embodiments, HSC are preferably isolated from an individual suffering from Pompe Disease, in particular the individual suffering from Pompe Disease to be treated, transduced with a nucleic acid molecule or vector of the invention ex vivo. After transducing, the transduced
HSC are preferably returned to the individual.
The invention also includes compositions obtainable by the methods of the invention. Thus included are compositions comprising HSC transduced with a nucleic acid molecule or vector, preferably a gene delivery vehicle of lentiviral origin, of the invention.
The invention further provides a composition comprising a viral particle, preferably, lentiviral particles, transduced with a nucleic acid molecule or vector of the invention. Preferable, said lentiviral particles are gene delivery vehicles and capable of transducing HSC and/or progenitor cells.
The invention further provides a cell population comprising hematopoietic stem cells (HSC) provided with a nucleic acid molecule, vector or viral particle according to the invention. In preferred embodiments, the cell population or HSC is/are transduced with a nucleic acid molecule, vector or viral particle according to the invention. The cell population or HSC is/are further preferably capable of expression a fusion protein comprising a human IGFII protein and amino acids 28- 952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and an amino acid sequence comprising amino acids 70-952 of GAA, more in particular amino acids 28-952 of human (GAA. Said human IGFII protein preferably comprises an amino acid sequence which has at least 75% sequence identity with human IGFII, more preferably at least 80% sequence identity with human [GFII, as shown in figure 2. In other preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 83% sequence identity with human IGFII, more preferably at least 85% sequence identity, more preferably at least 90% sequence identity, more preferably at least 95% sequence identity with human IGFII, as shown in figure 2.
A composition or HSC according to, or used in accordance with, the invention can be administered to an individual by a variety of routes, preferably by parenteral administration. Parenteral administration can include, for example, intraarticular, intramuscular, intravenous, intraventricular, intraarterial or intrathecal administration. In preferred embodiments, a composition or HSC of the invention may be administered to an individual via infusion or injection, in particular in hospital via infusion or via injection by a healthcare professional.
Compositions of the invention preferably comprise at least one pharmaceutically acceptable carrier, diluent and/or excipient. By "pharmaceutically acceptable" it is meant that the carrier, diluent or excipient must be compatible with the other ingredients of the composition and preferably not deleterious, e.g. toxic, to the recipient thereof. In general, any pharmaceutically suitable additive which does not interfere with the function of the active compounds can be used. A composition including the at least one pharmaceutically acceptable carrier, diluent and/or excipient according to the invention is preferably suitable for human use.
A composition or HSC for intravenous administration may for example be aqueous or non-aqueous sterile solutions of the HSC of the invention, for instance solutions in sterile isotonic aqueous buffer. Where necessary, the intravenous compositions may include for instance one or more buffers, solubilizing agents, stabilizing agents and/or a local anesthetic to ease the pain at the site of the injection.
Expression of nucleic acid sequences of the invention results in a fusion protein comprising a human IGFII amino acid sequence and a human GAA amino acid sequence, in particular of amino acids 28-952 of human acid alpha glucosidase (GAA), or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, preferably an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and an amino acid sequence comprising amino acids 70-952 of human GAA, more preferably amino acids 28-952 of human GAA.
Also provided is therefore a fusion protein encoded by the nucleic acid molecule according to the invention.
Further provided is a fusion protein comprising amino acids 28-952 of human
GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and an amino acid sequence comprising amino acids 70- 952 of human GAA, fused to a human IGFII amino acid sequence, optionally separated by a linking sequence.
In preferred embodiments, the fusion protein comprises amino acids 28-952 of human GAA.
In further preferred embodiments, the human IGFII amino acid sequence in a fusion protein of the invention is an amino acid sequence encoded by the IGFII gene sequence as defined herein above. In preferred embodiments, the human
IGFTI amino acid sequence comprises the human IGFII signal peptide (amino acids -24 to -1 in figure 2: MGIPMGKSMLVLLTFLAFASCCIA). In preferred embodiments, the human IGFII amino acid sequence comprises the human IGFII signal peptide and an amino acid sequence which has at least 70% sequence identity with human, mature IGFII.
In further preferred embodiments, the IGFII amino acid sequence comprises the human IGFII signal peptide and amino acids 1 and 8-67 of human IGFII, as shown in figure 2.
In further preferred embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and amino acids 1 and 8-67 of IGFII, as shown in figure 2.
In further embodiments, the IGFTI amino acid sequence comprises the IGFTI signal peptide and amino acids 1-67 of IGFII, as shown in figure 2.
In further preferred embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and human mature IGFII comprising a mutation within amino acids 30-40 of IGFII, preferably a deletion within amino acids 30-40 of
IGFI.
In further preferred embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and human mature IGFII comprising a deletion of amino acids 30-40, 31-40, 32-40, 33-40, 34-40, 35-40, 36-40, 37-40, 30-39, 31-39, 32-39, 33- 39, 34-39, 35-39, 36-39, 30-38, 31-38, 32-38, 33-38, 34-38, 35-38, 36-38, 30-37, 31- 37, 82-37, 33-37, 34-37, 35-37, 30-36, 31-36, 32-36, 33-36, 34-36, 30-35, 31-35, 32- 35, 33-35, 30-34, 31-34, 30-34, 30-33, 31-33 or 30-32 of human IGFII as shown in figure 2.
In preferred embodiments, the IGFII amino acid sequence comprises a deletion of amino acids 30-40 of IGFI. Hence, in preferred embodiments, the IGFII amino acid sequence comprises the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1, 8-29 and 41-67 of mature IGFII, as shown in figure 2. Further suitable IGFTI mutants with reduced insulin receptor binding are described in WO 2009/137721, which is incorporated herein by reference.
In some preferred embodiments, the IGFII amino acid sequence consists of the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-67 of IGFII, as shown in figure 2.
In some preferred embodiments, the IGFII amino acid sequence consists of the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-29 and 41-67 of mature IGFII, as shown in figure 2.
The fusion protein preferably comprises a linking sequence as defined herein between the IGFTI amino acid sequence and the GAA amino acid sequence. The linking sequence preferably consists of 2-10 amino acids, more preferably of 2-5 amino acids, such as 2, 3 or 4 amino acids. In preferred embodiments, the linking sequence is an amino acid sequence of 3 amino acids. A preferred, but non-limiting linking sequence is the amino acid sequence GAP.
Also provided is a nucleic acid sequence encoding the fusion peptide according to the invention.
After transplantation of HSC transduced with a nucleic acid molecule of the invention the cells express the fusion protein in vivo. This fusion protein contain an
IGFII-tagged GAA preproprotein, contrary to known IGFII-tagged GAA fusion proteins expressed after HSC transduction and transplantation. As demonstrated in the Examples herein, the present inventors have demonstrated that HEK293T cells stably transduced with a nucleic acid molecule of the invention were capable of expressing the preproprotein and processing it to the active 76 kDa form of the
GAA protein (see Figure 5 A and B). It was further demonstrated that GAA myotubes provided with conditioned medium containing the IGFIL.FL-GAAco protein show uptake and activity of the protein (Figures 5 C-E).
The present invention for the first time show that it is possible to direct expression of the full length GAA preproprotein (aa 28-952) using the IGFII signal peptide. This is surprising, because epitope tagging of proteins is known in the art for their ability to interfere with the function of these proteins. This is especially the case when important functions of the protein are located at the N-or C-termini, as is the case with the nucleic acid molecules and vectors of the present invention.
In the case of the GAA protein, the following functions needed to be preserved in the epitope tagged version: 1) cellular secretion, 2) intracellular processing, 3) glycogen hydrolysing activity. So far, IGFII tagging of GAA has only been tested for an already partially processed GAA protein, which is the aa70-952 GAA protein. In the present invention, it is shown that the full length GAA protein can successfully be epitope tagged with the IGFII tag at the C terminus. This was a priory not obvious, for example see Figure 8, wherein it is shown that epitope tagging using an ApoE2 tag with full length GAA preproprotein (aa 28-952) and a signal peptide of either IGFII or GAA did not result in active (GAA protein in the cells or secreted active GAA protein.
Before the present invention it was unknown whether or not this combination of nucleotide sequences included in a gene therapy vector results in correct mRNA and protein expression, secretion, and intracellular processing into the 95kD intermediate form (i.e. the GAA preproprotein) and the 76kD and 70kD active forms of GAA in vivo. This requires, inter alia, proteolytically processing of the fusion protein to generate the active form of the GAA enzyme. The present inventors have shown for the first time that this processing is correctly executed if the preproprotein is coupled to an IGFII tag.
The invention also provides uses of the nucleic acid molecules, vectors, fusion proteins, compositions and cell populations, in particular HSC populations, particularly in the treatment of Pompe Disease.
In one aspect, the invention therefore provides a method for treating Pompe
Disease comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to an individual in need thereof.
Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating Pompe
Disease.
Also provided is the use of a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for the treatment of Pompe Disease.
Typically the use of a composition comprising lentiviral particles involves the transduction of HSC such as bone marrow cells, umbilical cord blood cells or mobilized peripheral blood stem cells. Such transduced cells are preferably prepared ex vivo and are also part of the present invention. Thus the invention provides a composition for the treatment of Pompe Disease, comprising a plurality
HSC transduced with a composition of lentiviral vector or particles according to the invention.
In yet another embodiment, the invention provides the use of a composition as described above in the preparation of a medicament for the treatment of a
Pompe Disease.
In one aspect, the invention provides a method for treating Pompe Disease comprising administering the cell population comprising a cell population, in particular HSC, according to the invention to an individual in need thereof.
Also provided is a method for treating Pompe Disease comprising administering to an individual in need thereof a cell population, in particular HSC, that are transduced ex vivo with a nucleic acid molecule, a vector or viral particles, preferably a lentiviral vector or lentiviral particles, according to the invention. Also provided is a cell population, preferably HSC, transduced with a nucleic acid molecule or vector according to the invention for use in a method for the treatment of Pompe Disease in an individual. In preferred embodiments, the cells, in particular HSC, have been isolated from the individual and have been transduced ex vivo with a nucleic acid molecule or vector of the invention. I.e. in preferred embodiments individuals are treated with autologous transduced HSC. Hence, in preferred embodiments, a method of treatment of the invention comprises removing HSC from the individual, providing said HSC with a nucleic acid molecule, vector or viral particle according to the invention, preferably lentiviral vector or lentiviral particles, and administering said HSC provided with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. In preferred embodiments, a method or use comprises transducing said HSC with the nucleic acid molecule, vector or viral particle according to the invention, preferably a lentiviral vector or lentiviral particles, and administering said HSC transduced with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. However, allogenic HSC may also be used in the methods and uses of the invention.
As described herein above, the present inventors found that with the method and uses of the invention central immune tolerance for GAA is achieved. Central immune tolerance against GAA, in particular full central immune tolerance to all forms of GAA, is in particular important for Pompe Disease patients who are characterized by a complete lack of GAA enzyme activity. In particular Pompe
Disease patients suffering from classic infantile Pompe Disease are characterized by a complete lack of GAA enzyme activity. Pompe Disease patients who still have some residual GAA protein production and activity are indicated as cross-reactive immunological material (CRIM)-positive while those patients with a total absence of that protein are indicated as CRIM negative.
Hence, in some preferred embodiments the individual is an individual suffering from classic infantile Pompe Disease.
In other preferred embodiments the individual is an individual suffering from cross-reactive immunological material (CRIM)-negative classic infantile Pompe
Disease.
Also provided is a method for central immune tolerance induction in an individual suffering from Pompe Disease, the method comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to said individual.
Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for central immune tolerance induction in an individual suffering from Pompe Disease.
Also provided is a use of a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for central immune tolerance induction in an individual suffering from
Pompe Disease.
As described herein above, the present inventors have surprisingly found that the use of an IGFII sequence which has a mutation that reduces binding affinity for the insulin receptor as compared to the wild-type human mature IGF-II results in a higher efficacy in skeletal muscle as compared to the use of a vector comprising an IGFI sequence with intact insulin receptor binding domain. At the same time, efficacy in brain and heart was maintained, although not to the same extent, lower with such IGFII sequence which has a mutation that reduces binding affinity for the insulin receptor as compared to the wild-type human mature IGF-
II. Hence, the nucleic acid molecules, constructs, vectors, fusion proteins and cell populations, in particular HSC, that include an IGFII sequence with such mutation is in particular suitable for Pompe Disease patients that do not suffer from brain and/or heart pathology. These are Pompe Disease patients that have some residual
GAA enzyme activity. Such patients are further characterized by the absence of a hypertrophic cardiomyopathy. Classic infantile patients do have a hypertrophic cardiomyopathy, and therefore all other patients are labelled non-classic infantile.
Hence, patients that have residual GAA enzyme activity are in particular patients suffering from non-classic infantile Pompe Disease. Hence, in preferred embodiments, a method is provided for the treatment of an individual suffering from Pompe Disease who has residual GAA enzyme activity, in particular an individual suffering from non-classie infantile Pompe Disease, comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to an individual, wherein said nucleic acid molecule is a nucleic acid molecule according to the invention wherein the
IGFTI gene sequence comprises a mutation within the nucleotide region encoding amino acids 30-40 of IGFII, preferably comprises a deletion within the nucleotide region encoding amino acids 30-40 of IGFII, said fusion protein encoded by said nucleic acid molecule or said cell population, in particular HSC, is provided with said nucleic acid molecule. In preferred embodiments, the IGFII gene sequence comprises a deletion of the nucleotides encoding amino acids 30-40 of IGFII. In further preferred embodiments, the IGFII gene sequence consists of a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1, 8-29 and 41-67 of IGFII, as shown in figure 2.
As described herein above, the use of the GAA sequence encoding amino acids 28-952 in accordance with the present invention prevents the formation of anti-
GAA antibodies to all forms of GAA, including the full length GAA, i.e. the GAA preproprotein consisting of amino acids 28-952, to the active forms of GAA and to potential intermediate forms and by-products. The methods and uses of the invention are therefor particularly suitable for treatment of patients that are known to develop anti-GAA antibodies. Classic infantile Pompe Disease patients and/or CRIM-negative patients are characterized by the absence of GAA protein and are known to develop high antibody titers to ERT that renders the treatment ineffective. Hence, in preferred embodiments of any method or use of the invention, the individual that is treated is an individual suffering from classic infantile
Pompe Disease and/or an individual suffering from CRIM-negative classic infantile
Pompe Disease.
In further preferred embodiments the individual is an individual suffering from CRIM-positive (CRIM+) classic infantile Pompe Disease.
In further preferred embodiments the individual is an individual suffering from non-classic infantile Pompe Disease.
In further preferred embodiments the individual is an individual suffering from late onset Pompe Disease.
In further preferred embodiments the individual is an individual suffering from Pompe Disease with affected brain.
In further preferred embodiments the individual is an individual suffering from Pompe Disease with affected peripheral nervous system, affected smooth muscle and/or deafness.
In further preferred embodiments the individual is an individual suffering from Pompe Disease that is insufficiently responsive to GAA enzyme replacement therapy.
In preferred embodiments an individual is treated in accordance with the invention is an individual who has not developed anti-GAA antibodies. As described herein above, such antibodies could neutralize the activity of the transgene product or of ERT. Examples of such individuals are individuals that have not been treated with ERT previously, i.e. before being treated in accordance with the invention, and individuals who have been treated with ERT previously, i.e. before being treated in accordance with the invention, but that also received immune suppression (e.g. with rituximab) so that no anti-GAA antibodies have been formed yet.
Hence, in some preferred embodiments, the individual treated in accordance with the invention has not previously been treated with GAA enzyme replacement therapy. In preferred embodiments, central immune tolerance is induced.
In other preferred embodiments, the individual treated in accordance with the invention has previously been treated with GAA enzyme replacement therapy and preferably with immune suppression treatment, e.g. with rituximab.
In other preferred embodiments central immune tolerance is induced in individuals who have been treated with ERT previously, i.e. before being treated in accordance with the invention, and who have developed anti-GAA antibodies due to such ERT treatment. In preferred embodiments, central immune tolerance is induced.
The present inventors have demonstrated that the methods of the invention result in high efficacy in the brain, in particular high efficacy in the brain with low
VCN. Also provided is therefore a method for preventing or halting loss of IQ in an individual suffering from Pompe Disease, comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to the individual. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for preventing or halting loss of IQ in an individual suffering from Pompe
Disease, in particular classic infantile Pompe Disease. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe
Disease. In preferred embodiment, said individual is an individual suffering from
Pompe Disease with affected brain. Such methods are particularly suitable for
Pompe Disease patients who suffer from brain pathology, which are in particular patients with classic infantile Pompe Disease. Hence, in preferred embodiments, the individual is suffering from classic infantile Pompe Disease.
In preferred embodiments, the HSC have been isolated from the individual and have been transduced ex vivo with a nucleic acid molecule or vector of the invention. I.e. in preferred embodiments individuals are treated with autologous transduced HSC. Hence, in preferred embodiments, a method of treatment of the invention comprises removing HSC from the individual, providing said HSC with a nucleic acid molecule, vector or viral particle according to the invention, preferably lentiviral vector or lentiviral particles, and administering said HSC provided with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. In preferred embodiments, a method or use comprises transducing said HSC with the nucleic acid molecule, vector or viral particle according to the invention, preferably a lentiviral vector or lentiviral particles, and administering said HSC transduced with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. However, allogenic HSC may also be used in the methods and uses of the invention.
The method and uses of the invention are further particularly suitable for treating defects in several organs that are affected by Pompe Disease, in addition to the main affected organs, muscle, brain and heart, based on the high penetration of the gene therapy and high efficacy demonstrated. Such organs and symptoms include the peripheral nervous system and smooth muscle and hearing defects.
Also provided is therefore a method for treating brain, peripheral nervous system, smooth muscle and/or hearing defects in an individual suffering from Pompe
Disease comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to the individual. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular
HSC, according to the invention for use in a method for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. Also provided is a use of a nucleic acid molecule, fusion protein or cell population, in particular
HSC, according to the invention in a preparation of a medicament for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe
Disease. In preferred embodiments, said individual is an individual suffering from
Pompe Disease with affected peripheral nervous system, affected smooth muscle and/or deafness. Such methods are particularly suitable for Pompe Disease patients who suffer from pathology in the peripheral nervous system and smooth muscle and from hearing defects, which are in particular patients with classic infantile Pompe Disease. Hence, in preferred embodiments, the individual is suffering from classic infantile Pompe Disease.
In preferred embodiments, the HSC have been isolated from the individual and have been transduced ex vivo with a nucleic acid molecule or vector of the invention. Le. in preferred embodiments individuals are treated with autologous transduced HSC. Hence, in preferred embodiments, a method of treatment of the invention comprises removing HSC from the individual, providing said HSC with a nucleic acid molecule, vector or viral particle according to the invention, preferably lentiviral vector or lentiviral particles, and administering said HSC provided with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. In preferred embodiments, a method or use comprises transducing said HSC with the nucleic acid molecule, vector or viral particle according to the invention, preferably a lentiviral vector or lentiviral particles, and administering said HSC transduced with said nucleic acid molecule,
vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. However, allogenic HSC may also be used in the methods and uses of the invention.
In preferred embodiments, a method or use of the invention comprises providing the individual with myeloablative treatment prior to administering treatment, in particular transduced HSC, according to the invention. Myeloablative treatment is also referred to in the art as myeloablative conditioning or myeloablative preconditioning. The term refers to treatment, such as chemotherapy or irradiation that eliminate hematopoietic cells of the individual treated. Preferably, most (e.g. more than 80% of) hematopoietic cells are eliminated. In addition, reduced preconditioning regimens may be applied.
Myeloablative treatment is preferably performed by chemotherapy. Myeloablative treatment of human individuals is well known in the art and suitable chemotherapeutics are well known and can be selected by a person skilled in the art. Such agents are for instance used for allogeneic stem cell transplantation.
Suitable, but non-limiting examples of such myeloablative agents are busulfan, melphalan, treosulfan fludarabine, cyclophosphamide, and combinations thereof.
In preferred embodiments, the myeloablative treatment is with an agent selected from the group consisting of busulfan, treosulfan, fludarabine and combinations thereof.
In further preferred embodiments, the treatment, in particular HSC transplantation, in accordance with the present invention is combined with GAA enzyme replacement therapy (ERT).
In preferred embodiment, the enzyme used in ERT is an acid alpha- glucosidase (GAA) enzyme, optionally in combination with or fused to a chaperone, an agent or a peptide that facilitates passage across the blood brain barrier.
Optionally said enzyme is a modification, variant or fragment of GAA that has glucosidase activity, in particular that is capable of degrading the a-1,4 and a-1,6 linkages in glycogen, maltose and isomaltose, optionally in combination with or fused to a chaperone or an agent that facilitates passage across the blood brain barrier. Hence, as used herein said GAA enzyme in GAA enzyme replacement therapy is preferably comprises an acid alpha-glucosidase (GAA) enzyme or a modification, variant or fragment thereof that has glucosidase activity, in particular that is capable of degrading the a-1,4 and a-1,6 linkages in glycogen, maltose and isomaltose, optionally in combination with or fused to a chaperone or an agent that facilitates passage across the blood brain barrier. Suitable GAA enzymes include an enzyme selected from the group consisting of Myozyme,
Lumizyme, neo-GAA (carbohydrate (M6P groups) modified forms of alpha glucosidase-alpha), ATB200 (Amicus Therapeutics), BMN-701 (BioMarin: Gilt GAA for Pompe Disease, in which rhGAA is fused with an IGF-II peptide), recombinant human GAA (rhGAA), rgGGAA (Oxyrane: recombinant human acid alpha- glucosidase produced in genetically modified yeast cells and enriched in mannose 6-phosphate content), rhGAA modified by conjugation, for example to mannose-6- phosphate groups or to IGF-II peptides. Said enzyme is preferably selected from the group consisting of a recombinant human GAA, Myozyme, Lumizyme, neoGAA,
Gilt GAA (BMN-701), or rhGGAA.
In some embodiments, the individual is treated with ERT prior to treatment, in particular HSC transplantation, in accordance with the invention. In such cases,
ERT for instance serves to improve the condition of the patient prior to treatment, in particular HSC transplantation, in accordance with the invention. In some preferred embodiment, the individual is treated with an immune suppressive agent prior to or concomitant with ERT. Immune suppressive agents are well known in the art and suitable immune suppressive agent are well known and can be selected by a person skilled in the art. As used herein an immune suppressive agent refers to an agent is capable of suppressing immune reaction in an individual. In preferred embodiments, B cells are suppressed. In preferred embodiments, the immune suppressive agent is selected from the group consisting of a B cell depletion agent, such as an anti-CD20 antibody, a T cell depletion agent, such as an anti-CD3 antibody (such as OKT3, muronomab) or an anti T cell receptor antibody (such as Muromonab-CD3), an anti-IL-2 receptor antibody (such as basiliximab and daclizumab), azathioprine, a calcineurin inhibitor, a corticosteroid, cyclosporine, methotrexate, IVIG, mercaptopurine, mycophenolate mofetil, and combinations thereof. In further preferred embodiments the immune suppressive agent is a B cell depletory agent, such as an anti-CD20 antibody, in particular rituximab. As used herein, a B cell depletion agent is an agent that reduces the amount of B cells in the individual that is treated with the agent.
It has been found by the present inventors that treatment with an immune suppressing agent reduces or prevents the formation of anti-GAA antibodies, which is associated with GAA enzyme replacement treatment. Therefore such treatment optimizes combination treatment with ERT and treatment, in particular HSC transplantation, in accordance with the invention. In particular, Pompe Disease patients that are characterized by a completed absence of the GAA enzyme are susceptible to the development of anti-GAA antibodies. Such patients are also referred to as cross-reactive immunological material (CRIM)-negative patients and are by definition classic infantile Pompe Disease patients. Also CRIM positive patients can develop anti-GAA antibodies. CRIM positive patients may be either be classic infantile patients (expressing GAA protein with zero enzymatic activity), or late onset patients (expressing GAA protein with some residual GAA enzyme activity; onset of symptoms varies between the age of 0 to 70 years). Hence, in preferred embodiments of a method or use of the invention wherein an individual is treated with ERT prior to treatment, in particular HSC transplantation, and with an immune suppressive agent prior to or concomitant with ERT, said individual is an individual suffering from classic infantile Pompe Disease, in particular an individual suffering from cross-reactive immunological material (CRIM)-negative classic infantile Pompe Disease.
In some embodiments, the individual is treated with ERT during and/or subsequent to treatment, such as HSC transplantation, in accordance with the invention. In some embodiments, the individual is treated with ERT both prior to and during and/or subsequent to treatment, such as HSC transplantation, in accordance with the invention. In some embodiments, the individual is not treated with ERT but only with treatment, in particular HSC transplantation, in accordance with the invention.
Features may be described herein as part of the same or separate aspects or embodiments of the present invention for the purpose of clarity and a concise description. It will be appreciated by the skilled person that the scope of the invention may include embodiments having combinations of all or some of the features described herein as part of the same or separate embodiments.
The invention will be explained in more detail in the following, non-limiting examples.
Brief description of the drawings
Figure 1: GAA sequences. A. Human GAA amino acid sequence (NP_000143.2; GenPept). B. Human GAA mRNA sequence (NM_001079803.3;
GenBank).
Figure 2: Human IGFII amino acid sequence (based on P01344; UniProt).
Figure 3: Overview of constructs. Schematic overview of the normal processing of GAA and IGFII eonstruets 1, 2, 3 and 4. Abbreviations used: GAAco - codon optimized acid alpha glucosidase (GAA); IGF2 - Insulin like growth factor 2;
SpG — Signal peptide GAA; Spl — Signal peptide IGF2; GAP — amino acids glycine alanine proline. Numbering refers to amino acids. A) Normal processing of GAA into the final 76 and 70 kDa form. B) Normal processing of IGF2 into mature IGF2.
C) Overview of natural human GAA, myozyme, reveglucosidase alfa as published and the constructs used here. Construct 1 consists of the complete amino acid (aa) sequence of human GAA, including the signal peptide (aa 1-27). In construct 2, an
IGF2 peptide consisting of aa 1 and 8-67 of mature human IGF2 is fused to a truncated form of GAA (aa70-952), preceded by the human IGF2 signal peptide (indicated as aa -24 to -1). Construct 3 is similar to construct 2, but lacks aa 30-40 of mature human IGF2. In construct 4, the truncated version of GAA as present in construct 2 and 3 is replaced by the full length GAA sequence excluding the GAA signal peptide (aa 28-952).
Figure 4: Uptake of GAAco, IGF2.GAAco and IGF2del.GAAco proteins in GAA" myotubes. Conditioned medium containing the proteins GAAco,
IGF2.GAAco and IGF2del.GAAco were produced by incubating stably transduced
HEK293T cells with cell culture medium for 24 hours. After this period, medium was harvested and enzyme activity was assessed. The medium was diluted to an enzyme concentration of 600 or 300nmol/hr/ml, which was then incubated in triplo on differentiated GAA“ mouse myotubes for 24 hours to assess the uptake of the proteins by 4MU assays or western blot analysis using a GAA antibody. A) GAA protein levels in medium after 24 hours incubation on GAA myotubes. B) GAA protein levels in (GAA myotubes after uptake. A similar amount of total protein was loaded for all samples as determined by a BCA assay. C) Percentage of GAA uptake for the different GAA proteins. GAA protein levels were determined by western blot analysis in input medium before uptake (not shown) as well as in
GAA“ myotubes after uptake (B). Please note that loading in B was adjusted for total protein levels and therefore do not exactly match with the percentage of uptake as shown in C. Data is indicated as mean + SD. n=3. D) Western blot analysis of serial dilutions (3, 6 and 12x) made of input medium to asses specific activity (F). E) Western blot analysis of serial dilutions (1, 2 and 4x) from (GAA myotubes after incubation with the conditioned medium containing one of the three proteins. Triplos were pooled before dilution. F, G) Specific activity in medium (F) and cells after uptake (G) was assessed by expressing enzyme activity (nmol/hr/ml) against the protein level determined by western blot analysis (D, E) in the same serial dilutions as described in D and E.
Figure 5: Uptake GAAco, IGF2.GAAco and IGF2.FL-GAAco proteins in
GAA" myotubes. Conditioned medium containing the proteins GAAco,
IGF2.GAAco and IGF2.FL-GAAco were produced by incubating stably transduced
HEK293T cells with cell culture medium for 24 hours. After this period, medium was harvested and enzyme activity and protein levels were assessed by 4AMU assays and western blot analysis using a GAA antibody. The medium was diluted to an enzyme concentration of 800, 400 or 200nmol/hr/ml, which was then incubated in duplo on differentiated GAA” mouse myotubes for 24 hours to assess the uptake of the proteins. A) GAA protein levels in medium after incubation with
GAA myotubes. B) GAA protein levels in GAA” myotubes after incubation with conditioned medium (800 nmol/hr/ml). A similar amount of total protein was loaded for all samples as determined by BCA assay. €) Percentage of GAA uptake for the different GAA proteins. GAA protein levels were determined by western blot analysis in input medium before uptake (not shown) as well as in GAA-/- myotubes after uptake (B). Please note that loading in B was adjusted for total protein levels and therefore do not exactly match with the percentage of uptake as shown in C.
Data is indicated as mean + SD. n=2. D, E) Specific activity in medium was assessed by expressing enzyme activity (nmol/hr/ml) against the protein level determined by western blot analysis (E) in the serial dilutions of the input medium (3x, 6x and 12x),
Figure 6: Competition with IGF2 during uptake of lentiviral expressed GAA proteins in GAA-+ myotubes. Conditioned media containing the proteins GAAco, IGF2.GAAco, IGF2del. GAAco (A, B) and IGE2.FL-GAAco (C, D) were prepared as described before. Uptake experiments were performed using conditioned medium containing the indicated proteins at an input concentration of 600 nmol/hr/ml in the presence or absence of IGF2 (2.5 ug/ml; 0.37 uM). After 24 hours, cells were harvested and the enzyme activity in cells was assessed (A) as well as the percentage of uptake which is expressed as a percentage relatively to the ‘no IGF2 condition (B). Data are indicated as mean + SD. Statistics indicate the difference per construct in the absence or presence of IGF2. ****P < 0,0001 by one-way ANOVA with Tukey multiple comparison testing. ns, not significant. n=3.
Figure 7: In vivo glycogen content after treatment using different vectors. Six months after lentiviral gene therapy with one of the constructs, mice were starved overnight and tissues were harvested. Glycogen content was measured in the skeletal muscles tibialis anterior (A) and quadriceps femoris (B), heart (C) and cerebrum (D). Correlation between vector copy number (VCN) and glycogen content (ug/mg) is shown by plotting VCN in bone marrow against glycogen content in tibialis anterior (E), quadriceps femoris (F), heart (G) and cerebrum (H). Data are indicated as mean + SD. Statistics indicate the difference compared to untreated KO mice or as indicated. * P< 0.05, ** P<0,01, ** P< 0,001, ****P<0,0001 by one-way ANOVA with Tukey multiple comparison testing. ns, not significant. n=9 except for the GFP group(n=8).
Figure 8: Overview of constructs for which epitope tagging interfered with the function of GAA. Schematic overview of constructs 5-9. Abbreviations used: GAAco - codon optimized acid alpha glucosidase (GAA); 1GF2 - Insulin like growth factor 2; SpG — Signal peptide GAA; Spl — Signal peptide IGF2; S — amino acids glycine alanine proline (GAP), L — flexible linker, ApoE2 - Apolipoprotein E2.
Numbering refers to amino acids. Construct 5 consists of the complete amino acid (aa) sequence of human GAA, excluding the signal peptide (aa 1-27). This sequence is N-terminally fused to a sequence consisting of 2x ApoE2 peptide fused to the aa 1-27 signal peptide of GAA. Construct 6 is similar to construct 5, but here the signal peptide of IGF2 is used instead of the signal peptide of GAA. Construct 7 is similar to construct 5, but the signal peptide and ApoE2 sequence are separated by a 3 amino acid spacer (GAP). In construct 8 and 9, either GAA or IGF2.GAA is C- terminally tagged to a sequence consisting of 2x an Apok2 peptide.
Figure 9: Transient transfection of HEK293T cells with construct 5-7.
HEK293T cells were transient transfected with construct 1, 2 and 5-7. A control was included where the same procedure was performed without DNA. After 24 hours, medium was refreshed and t the next day cells and medium were harvested for analysis. A) GAA protein levels in cells after transient transfection. Protein patterns indicate normal processing of all proteins. B) (GAA protein levels in medium after 24 hours incubation on transient transfected HEK293T cells. No
GAA protein could be observer for construct 5-7. C, D) Enzyme activity in medium (C) and cells (D) indicate that even though the processing inside the cells appears to be normal, no active enzyme can be observed inside the cells, and neither in the medium indicating no secretion of the protein.
Figure 10: Transient transfection of HEK293T cells with construct 8-9.
HEK293T cells were transient transfected with construct 1, 2, 8 and 9. A control was included where the same procedure was performed without DNA. After 24 hours, medium was refreshed and t the next day cells and medium were harvested for analysis. A) GAA protein levels in cells after transient transfection. Protein patterns indicate an abnormal processing of construct 8 and 9. B) GAA protein levels in medium after 24 hours incubation on transient transfected HEK293T cells, No GAA protein could be observer for construct 8 and 9. C, D) Enzyme activity in medium (C) and cells (D) indicate that the protein produced by construct 8 and 9 are not active.
Figure 11: Protein expression and enzyme activity in thymus. Thymi of mice were assessed for transgene expression to assess the potential involvement of central immune tolerance induction. Groups include mice receiving lentiviral GAA (LV-SF-GAA) with or without subsequent ERT injections. LV-SF-GAAco treated mice that received weekly PBS injections were included to evaluate the effect of gene therapy alone. Age-matched untreated Gaa and wildtype mice served as controls. (A) Schematic representation of the experimental setup of mice receiving gene therapy in combination with ERT at the indicated intervals. (B) Western blot analysis of human GAA and GAPDH at different total protein amounts (ug) as indicated (2.5 ug not shown in WT mice). (€) Western blot quantification of human
GAA relative to GAPDH expression, normalized to the GAA expression of LV-SF- (GAA in combination with ERT at a 6-week interval. (D) GAA enzyme activity measured using the 4-methylumbelliferone (4-MU) assay, normalized for total protein levels. (E, F) Vector copy number (VCN) in thymus (KE) and bone marrow (F) as described above. Data are represented as means + SEM; n = 3 per group, tissue of the same mice were used for VCN, western blot and enzyme activity analysis. Asterisks indicate comparison to LV-SF-GAAco treated mice with subsequent ERT injections after a 4-week interval. *p <0.05; ** p <0.01; *** p <0.001; ns, not significant.
Figure 12: Schematic representation of the lentiviral vectors. The figure shows self-inactivating (SIN) lentiviral vectors expressing codon optimized
GAA (GAAco) driven by different internal promoters. (A) pRRL.PPT.SF.GAAco.bPRE4* SIN (referred as LV-SF) contains the spleen focus- forming virus (SF) promoter. (B) pRRL.PPT.MND.GAAco.bPRE4*.SIN (referred as
LV-MND) contains the murine leukemia virus-derived MND promoter (C) pRRL.PPT.MND_ short. GAAco.bPRE4* SIN (referred as LV-MND-S) contains the above MND promoter with a 174bp deletion at the 5 end. (D) The MND promoter was derived from 3’ LTR of myeloproliferative sarcoma virus (MPSV). The difference between the MND and MND-S promoter is a 174bp upstream fragment including sequences encoding the gp 70 envelope protein, the primary binding site (PBS) and the beginning of 3 LTR of MPSV. LTR indicates long terminal repeat;
RSV, enhancer and promoter from the U3 region of Rous sarcoma virus; SD, splice donor site; YW, packaging signal; RRE, rev response element; SA, splice acceptor site; cPPT, central polypurine tract; bPRE4*, a modified woodchuck posttranslational regulatory element devoid of the Woodchuck hepatitis X-protein sequence and ATG sites deleted; AU3, deletion in the U3 region of 3’ LTR to create
SIN vector.
Examples
Materials and methods
Uptake experiment in GAA-/- mouse myotubes
HEKZ293T cells were grown in Ham’s F-10 medium (Lonza) supplemented with 10% fetal bovine serum (FBS, Biowest) and 1% penicillin-streptomycin (PS, Gibeo) and transduced with GAAco, IGFII.GAAco, IGFIIdel.GAAco or IGFIL FL-GAAco. For production of conditioned media, HEK293T producer cells were grown at 90% confluency in Ham’s F-10 medium supplemented with 10% FBS, 1% penicillin- streptomycin, and 3mM PIPES (Sigma). After 24 hours, cells and media were collected. Conditioned medium containing secreted IGF2.GAA or GAA was filtered (0.22 pm filter, Millipore) and used for uptake assays. Where indicated, conditioned medium was supplemented with IGF2 (Cell Sciences, #MU 100) for competitive inhibition.
Uptake experiments were performed on primary myoblasts isolated from Gaa” mice as previously described.’ Myoblasts were cultured in growth medium (1% PS and 20% FBS (Biowest) in Ham’s F-10 medium (Lonza) to 90% confluency on extracellular matrix-coated plates (ECM, Sigma, 5%) and differentiated into myotubes in differentiation medium (1% PS and 2% horse serum (Gibco) in high- glucose Dulbecco's modified Eagle's medium (DMEM, Lonza)) at 37°C with 5% COs.
Enzyme activity was determined in conditioned medium collected from HEK 293T cells (described above), and GAA protein with an activity between 200 and 800 nmol/hr/ml (as indicated in figures) was incubated on myotubes for 24 hrs. Media and cells were harvested after 24 hours and GAA enzyme assay and Western blotting were performed.
Animals and Procedures
All animal procedures in this study conformed to Dutch law for the protection and use of animals for scientific procedures and were approved by the Animal
Experiments Committee (DEC) in the Netherlands. Immunocompetent (aa: knockout mice in an FVB/N background were used for all experiments (Bijvoet et al. 1998, Hum Mol Genet 7: 53-62). Gaa:’: mice are completely deficient of GAA enzymatic activity and were generated as previously described (Bijvoet et al. 1998,
Hum Mol Genet 7: 53-62). Age-matched FVB/N mice were purchased from Charles
River (Wilmington, MA) as wildtype controls. All mice were housed under specific pathogen-free (SPF) conditions in the Animal Experimental Center at the Erasmus
MC (EDC) according to standard procedures, which included a 12-hour light-dark cycle and ad libitum diet. Mice were deprived of food 15 hours pre-sacrifice to deplete cytoplasmic glycogen (Bijvoet et al. 1999. Hum Mol Genet 8: 2145-2153).
Subsequently, mice were anesthetized with ketamine (10%, Alfasan, Woerden, the
Netherlands) and Sedator (1mg/ml, Eurovet, Bladel, the Netherlands) and sacrificed by intracardiac perfusion with 50 ml phosphate buffered saline (PBS) to remove blood. Relevant tissues which included cerebrum, heart, tibialis anterior, quadriceps femoris, bone marrow and thymus were harvested, snap-frozen in liquid nitrogen and stored at -80°C until further analysis.
Lentiviral vector construction and production
Codon-optimized human GAA (GAAco; GenScript, Piscataway, Ne) or IGF2.GAAco was cloned into the third generation self-inactivating (SIN) lentiviral vector pCLL.PPT.MND.RAG1.WPRE.SIN (pCCL.MND.coRAG]1, kindly provided by Dr.
Frank Staal) by replacing the RAG I gene using BamHI and Sall restriction sites to generate pCLL.PPT.MND.GAAco. WPRE.SIN (GAAco) (Stok et al., 2020. Molecular
Therapy - Methods & Clinical Development 17: 1014-1025). A codon-optimized insulin-like growth factor 2 (IGF2) cassette (GenScript, Piscataway, NJ) was subcloned into the GAAco backbone after double digestion using BamHI and SgrAl.
The resultant lentiviral vector pCLL.PPT.MND.IGF2co.GAAco.WPRE.SIN (MND.IGF2c0.GAAco) encodes the IGF2 signal peptide, residues 1 and 8-67 of human IGF2, a three amino acid spacer, and residues 70-952 of codon-optimized human GAA (Figure 3A) (as described in Maga et al. 2013 (J Biol Chem. 2013 Jan
18;288(3):1428-38)). In addition, IGF2del. GAA and IGF2.FL-GAA were constructed via Gibson assembly using overhang primers into the MND. IGF2.GAAco backbone.
MND.IGF2del. GAAco was constructed using the following primers: gegaategtegaggaatgetgtttte (fw primer) and cagcattcetegacgattecagaaaagtagaagccgeggtec (reverse primer) resulting in a lentiviral vector pCLL.PPT MND.IGF2del. GAAco. WPRE.SIN (MND.IGF2del.(GAAco) encoding the IGF2 signal peptide, residues 1 and 8-29 and 41-67 of human IGF2, a three amino acid spacer, and residues 70-952 of codon- optimized human GAA (Figure 3A). MND.IGF2.FL-GAA was constructed using the
MND.IGF2.GAAco construct as a template for the vector and the MND.GAAco as a template for the insert using the following primers: tcttectgggacctgagcec (vector forward), tegtgcagcaggatgtgcectggggctcetteggaecttgg (vector reverse), geggcacateetgetgeacg (insert forward) and gcccccagtagggtggcata (insert reverse) resulting in a lentiviral vector pRRL.PPT.MND.IGF2.FL-GAAco.bPRE4*.SIN (MND.IGF2.FL-GAAco) encoding the IGF2 signal peptide, residues 1 and 8-67 of human IGF2, a three amino acid spacer, and residues 28-952 of codon-optimized human GAA (Figure 3A). Transgene expression was driven by the MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, d1587rev primer-binding site substituted) promoter. For promoter comparison studies, MND or MND-S promoters have been cloned into the lentiviral vector pRRL.PPT.SF.GAAco.bPRE4* SIN (LV-SF, Figure 12A, previously described previously by van Til et al. (Blood. 2010 Jul 1;115(26):5329-37). The LV-SF harbors an internal spleen focusing-forming virus (SF) promoter (SF). The SF promoter was then substituted by the Moloney murine leukemia virus-derived MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, d1587rev primer-binding site substituted) promoter (MND) (Cartier N. et al;
Science. 2009;326(5954):818-823) (kindly provided by Dr. Laure Caccavelli) and its modified version with a 174bp deletion upstream (MND-Short; MND-S) (kindly provided by Dr. FT Staal) respectively, through Xhol/Agel restriction sites, thus generating, pRRL.PPT.MND.GAAco.bPRE4* SIN (LV-MND, Figure 12C) and pRRL.PPT.MND-S.GAAco.bPRE4* SIN (LV-MND-S, Figure 12B). The difference between the MND and MND-S promoters is depicted in Figure 12D. Lentivirus was generated in HEK 293T cells by calcium phosphate transfection with the third generation lentiviral vector packaging plasmids pMDL-g/pRRE, pMD2-VSVg, and
PRSV-Rev (Dull et al. 1998 J. Virol. 72, 8463; Zufferey et al. 1998 J. Virol. 72, 9873-9880). Virus concentration was performed by ultracentrifugation (Beckman,
SW32Ti rotor) at 20,000 rpm for 2 hours at 4°C and titration was performed in
Hela cells by quantitative polymerase chain reaction (qPCR) with primers targeting the U3 and Psi sequences of HIV. A standard curve was prepared using transduced HeLa with on average 1 copy of integrated lentiviral vector per genome.
Final titers were determined as the average VCNs multiplied by the cell number and fold dilution.
Lentiviral hematopoietic stem cell transduction and transplantation procedures
Bone marrow cells were extracted from the tibiae and femora of 8-week-old male
Gaa’ donor mice and enriched through lineage depletion (Lin) using the Mouse
Hematopoietic Progenitor Cell Enrichment Set (BD Sciences, San Jose, CA). After enrichment, Lin’ cells were seeded in 6-well plates at a density of 105cells/m]l in
Stem Span medium, supplemented with the following growth factors: recombinant murine thrombopoietin (10 ng/ml), recombinant murine stem cell factor (100 ng/ml) and recombinant mouse FMS-like tyrosine kinase 3 murine ligand (50 ng/ml). The following day, cells were transduced overnight with concentrated lentivirusses pCCL.MND.GAAco, pCCL.MND.IGF2.GAAco, pCCL.MND.IGF2del .(GAAco, pCCL.MND.IGF2.FL-GAAco or pCCL.MND.GFP at multiplicity of infection 5 (MOI 5), and incubated at 37°C with 5% CO:. After 24 hours, 1x105 transduced Lin cells were transplanted intravenously through the tail vein into 8-week-old female Gaa’ recipients, previously subjected to 6 Gy sublethal total body irradiation using the
Gammacell 40 irradiator (Atomic Energy of Canada LTD., Ontario, Canada).
GAA enzymatic activity and glycogen content assays
Tissue aliquots were homogenized completely in 300 nl Milli-Q water (Merck,
Millipore) supplemented with protease inhibitors (Complete Protease Inhibitor
Cocktail, Roche) using 5 mm stainless steel beads (Qiagen) in the TissueLyser II (Qiagen, Venlo, the Netherlands) for 5 minutes at 30 Hz. Debris was pelleted by centrifugation at 10,000 rpm for 5 minutes and the supernatant was used for GAA enzymatic activity and glycogen content measurements. GAA enzymatic activity was determined in a fluorimetric assay using 4-methylumbelliferyl-a-D-glucoside (Sigma-Aldrich, St. Luis, MO) as substrate, as previously described (Okumiya et al. 2006. Mol Genet Metab 88: 22-28). Glycogen content was quantified by the amount of glucose released from glycogen after conversion by amyloglucosidase and amylase (Roche Diagnostics, Basel, Switzerland) as previously detailed (Bijvoet et al. 1999. Hum Mol Genet 8: 2145-2153). Both GAA enzymatic activity and glycogen content were normalized to total protein levels determined with the Pierce BCA
Protein Assay Kit (Thermo Scientific, Waltham, MA).
Western blotting
Protein extracts from cells were obtained in lysis buffer (100 mM NaCl, 50 mM Tris (pH 7.5), 1% Triton X-100) or milliQ water supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, Roche). Tissue samples were obtained as indicated before. Protein concentration was determined using a Pierce*M BCA
Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. A similar total protein amount was used for the different conditions within the same blot. Samples were denaturated with 5x Laemmli sample buffer (62.5 mM Tris-HCL pH 6.8, 2% SDS, 25% glycerol, 0.01% bromophenol blue, 5% B- mercaptoethanol) and heated at 95°C for 5 minutes. Protein exacts were separated by SDS-PAGE on a 4-15% polyacrylamide gel (Criterion TGX, Bio-Rad). Proteins were transferred to nitrocellulose blotting membranes (GE Healthcare) and blocked with Odyssey blocking buffer (TBS) or 5% non-fat milk powder in PBS and probed by overnight incubation at 4°C with rabbit anti-GAA (1:1000, Abcam, clone
EPR4716(2)) and mouse anti-GAPDH (1:1000, Millipore) in blocking buffer. Proteins of interest were detected with IRDye 800 CW and IRDye 680 RD secondary antibodies (1:10000; LI-COR Biosciences, Lincoln, NE) and were imaged using the Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE).
Protein content was quantified using Fiji and used to normalize for total protein.
Treatment of Gaa-” mice with recombinant human GAA
Depending on the experimental design, enzyme replacement therapy (ERT) was applied following lentiviral gene therapy. GAA lentivirus (LV-SF-GAAco) and control lentivirus (LV-SF-GFP) treated mice were divided into two groups: one group receiving ERT (marked as “+ ERT” in figures) with recombinant human acid a-glucosidase (rhGAA, Myozyme, Genzyme corporation, Cambridge, MA) intravenously at doses of either 20 mg/kg or 100 mg/kg; while the other group was subjected to phosphate-buffered saline (PBS) alone (marked as “-ERT” in figures).
Plasma was collected at baseline and every other week during the course of ERT to monitor antibody titers. Mice were sacrificed 1 week after the last injection to evaluate the therapeutic effect.
Results
The native full length human GAA sequence (van Til et al. 2010. Blood 115: 5329-5337), including the endogenous GAA signal peptide (spG), has previously been codon optimized, resulting in construct 1 (Stok et al., 2020. Molecular
Therapy - Methods & Clinical Development 17: 1014-1025). An IGF2 peptide including the IGF2 signal peptide (spl) was fused to the N-terminus of a truncated version of GAA (aa 70-952; this truncated version also lacks the GAA signal peptide), resulting in construct 2. This IGF2-GAA fusion protein has been described previously by Maga et al. 2013 (J Biol Chem. 2013 Jan 18;288(3):1428- 38), and here has been tested in a lentivirus. In the present invention, two variations of construct 2 were made and tested in a lentivirus: 1) the insulin receptor binding site (aa 30-40) was deleted as shown previously in patent US20120213762A1 (construct 3; IGF2.del. GAAco); or 2) the truncated version of GAAco (a.a 70-952) was replaced by the full length sequence of GAA, excluding its signal peptide (a.a. 28-952; construct 4 IGF2.FL-
GAAco).
A schematic overview of the normal processing of GAA and IGF2 as well as the used constructs are shown in Figure 3.
Construct 1-3
An uptake experiment in GAA mouse myotubes was performed using conditioned media containing the protein GAAco (construct 1), IGE2.GAAco (construct 2) or IGF2del.GAAco (construct 3) with an enzyme activity of 600 or 300 nmol/hr/ml. In the medium, GAA proteins are present as 110 kD precursors to which the epitope tags are attached as indicated (Fig. 4A). After cellular uptake, proteolytic cleavage at both the N and C termini processes the precursor 110kD forms to the intermediate 95 kD form and finally to the mature 76 kD (GAA form, resulting in removal of the epitope tag. Western blot analysis of GAA protein levels in GAA-- myotubes after uptake shows normal processing of the 110 kD form to the 95 kD and 76 kD forms of GAA (Fig. 4B). The percentage of uptake was calculated by dividing the amount of GAA enzyme in the myotubes after cellular uptake by the amount of GAA protein in the input medium, both assessed by western blot.
For both input concentrations, IGF2.GAAco was taken up most efficiently, while [GF2del.(GAAco showed an uptake which was higher than GAAco but lower than
IGF2.GAAco (Fig. 4C). To determine specific activity, serial dilutions were prepared of medium or cell extracts after uptake. GAA protein levels were determined by western blot (Fig. 4D, E) and GAA enzyme activity was measured using a 4-methylumbelliferone (4-MU) assay. It can be seen in Fig. 4F that the specific activity of IGF2del.GAAco in the medium is lower compared to the specific activity of GAAco and IGF2.GAAco, most likely caused by interference of the epitope tag with the enzyme activity. Fig. 4G shows that after removal of the epitope tag and processing to the active form in cells, the specific activities derived from all constructs are similar.
Assays were performed as described above. Uptake was performed using conditioned medium containing the proteins GAAco (construct 1), IGF2.GAAco (construct 2) and IGF2.FL-GAA (construct 4). For all three proteins, GAA enzyme activity of 800, 400 and 200nmol/hr/ml was used. Western blot analysis of medium and GAA“ myotubes after 24 hour incubation show a normal pattern of processing (Fig. 5A, B). The percentage of uptake was calculated as described above (Fig. 5C).
The percentages of GAAco and IGF2.GAAco were higher in this experiment compared with the previous experiment due to different experimental conditions (different cell numbers, plates and total volume of media). It can be observed that the uptake of IGF2.FL-GAAco was almost half of that of IGF2.GAAco, however it still shows an improved uptake relative to GAAco. Specific activity was assessed by expressing protein levels using western blot (Fig. 5D) and enzyme activity
(expressed as nmol/hr/ml) using serial dilutions of input medium (Fig. 5E). A similar specific activity was observed for all three proteins, indicating that replacing the truncated version of GAAco for the full length version is not intervening with its activity. Because the IGF2.FL-GAA protein was correctly processed to the active 76 kDa form, it was not necessary to assess the specific activity in cells.
In addition, a competition experiment was performed to see whether the uptake of the proteins is indeed mediated via the IGF2-binding site of the mannose-6-phosphate receptor/insulin-like growth factor 2 receptor, and whether the modifications we made are not interfering with this binding. To this end, another uptake experiment was performed in the presence or absence of excess
IGF2. As expected, the uptake of GAAco (construct 1) was not inhibited by the presence of IGF2 (Fig. 6A, B). However, uptake of both IGF2.(GAAco (construct 2) and IGF2del.GAAco (construct 3) were inhibited by IGF2 to ~4-8% of input.
IGF2.FL-GAAco (construct 4) was inhibited to ~22% of input by IGF2. Please note that all these proteins are expected to be also dependent on uptake via mannose 6- phosphate residues that bind to the same M6P/IGF2 receptor but with lower affinity compared to IGF2, explaining why there is no complete inhibition by IGF2 excess.
In vivo experiments
GAA“ mice were treated with gene therapy at two months of age using a lentivirus containing one of the constructs GAAco, IGF2.GAAco or IGF2del.GAAco under subtherapeutic conditions (6 Gy irradiation preconditioning, 1x10°%5 cells,
MOI 5 as determined in van Til et al. (Blood. 2010 Jul 1;115(26):5329-37) to be able to detect different efficacies compared to IGF2.GAAco. Mice treated with a vector expressing GFP (mock) or untreated GAA or untreated wildtype (WT) mice were used as control. After 6 months, mice were starved overnight, sacrificed and tissues were harvested for analysis. Glycogen content was determined in tibialis anterior (Fig. TA), quadriceps femoris (Fig. 7B), heart (Fig. 7C) and cerebrum (Fig. 7D).
GAAco (construct 1) was able to decrease the glycogen content in quadriceps and heart to some extend compared to untreated KO levels, but did not reduce glycogen levels in the cerebrum. IGF2.GAAco (construct 2) was more efficient in clearing the glycogen content in all tissues compared to GAAco and also reduced glycogen content in the cerebrum. IGF2del.GAAco (construct 3) was more efficient compared to IGF2.GAAco in clearing glycogen content in tibialis anterior and quadriceps femoris, but was less efficient than IGF2.GAAco in heart and cerebrum. The same conclusion was reached when glycogen content was expressed against vector copy number (VCN), in which a possible bias based on the efficieney of transduction or integration was excluded (Fig. 7E-H).
Epitope tagging resulting in interference with the function of GAA
In contrast to the results shown above, not all our tagging strategies resulted in an active enzyme. One of the constructs we tried to produce was GAA N- terminally tagged with ApoE2. Since the sequence of ApoE2 used does not have a signal peptide itself, the signal peptide of GAA or IGF2 was fused to ApoE2 (schematic overview in figure 8). Even though normal processing occurred inside
HEKZ293T cells after transient transfection (Fig. 9a), no protein was secreted (Fig. 9b). In addition, no active protein could be observed either in the medium or inside the cells (Fig. 9C, D).
In addition, Apok2 was tagged C-terminally to GAA separated by a three amino acid spacer (GAP) or a flexible linker (L-(GGGGS)x4). Even though both constructs resulted in the production of the protein, the processing pattern shows an extra band above the 76 kDa form which is not observed in the original constructs (Fig. 10A, C) and the proteins produced did not show any enzymatic acitivity (Fig. 10E). However, the production of the protein inside cells did not result in protein secretion into the medium (Fig. 10B, D).
Central immune tolerance via the expression of GAA in the thymus
In previous studies, we and others pointed to the potential of lentiviral gene therapy to induce immune tolerance to rhGAA (van Til et al. 2020. Blood 115: 5329-5337; Stok et al. 2020. Molecular Therapy - Methods & Clinical Development 17: 1014-1025; Douillard-Guilloux et al. 2009. J Gene Med 11: 279-287). To test whether HSC-mediated lentiviral gene therapy could induce central immune tolerance, we tested whether GAA transgene was expressed in the thymus. Central immune tolerance to endogenous proteins is established in the thymus via negative selection of T cells that are able to interact with endogenous antigens to distinguish self from foreign antigens. Endogenous expression of proteins in the thymus is therefore a prerequisite for the establishment of immune tolerance for these proteins. We assessed GAA protein expression and enzyme activity in the thymus of lentiviral GAA (LV-SF-GAAco) treated mice, that did or did not receive additional ERT treatment (Fig. 11A). Western blot analysis (Fig. 11B, C) and enzyme activity assays (Fig. 11D) indicated the presence of human GAA in the thymus of mice treated with lentiviral GAA. No significant differences in either
GAA protein level or GAA enzyme activity could be observed in mice treated with or without 10 additional ERT injections starting 6 weeks after gene therapy with lentiviral GAA (Fig. 11C, D). Reducing the interval between gene therapy and ERT tol week, which was not sufficient to establish a complete immune tolerance, resulted in a 4-fold reduction of GAA levels and activity. No human GAA protein was detected in the thymus of control lentivirus (LV-SF-GFP) treated mice after 2 injections of ERT, and also not in untreated KO mice or WT mice (Fig. 11C, D).
VCNs in the thymus and bone marrow (Fig. 11E, F; both a VCN of 6 copies per genome) indicated successful engraftment of GAA-corrected cells into both tissues, suggesting that the observed GAA expression in the thymus resulted from the migration of GAA-corrected HSCs from the bone marrow into the thymus.
Together, these data suggest that the immune tolerance obtained via lentiviral gene therapy is a result of transgene expression in the thymus, inducing central tolerance against GAA.
Promoter comparisons
Figure 13 shows the results of the comparison of lentiviral constructs with different promoters, the SF promoter, the MND promoter and a shorter version of the MND promoter with a 174bp deletion at the 5 end (MND-S). See figure 12 for the different self-inactivating (SIN) lentiviral vectors expressing codon optimized
GAA (GAAco) driven by different internal promoters.
Figures 13E and 13F show that the efficiency in muscles and brain is comparable when the original MND promoter and MND-S are used.
The enzyme activity levels in BM are also comparable when normalized by VCN (figures 13C and 13D). Both the original MND promoter and MNC-S promoter are working as efficient as the SF promoter (figures 13C-F).
SEQUENCE LISTING
<110> Erasmus University Medical Center Rotterdam <120> Gene therapy for Pompe Disease <130> P132001NL6O <140> NL 2031676 <141> 2022-04-22 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 952 <212> PRT <213> Homo sapiens <400> 1
Met Gly Val Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Val Cys 1 5 10 15
Ala Leu Val Ser Leu Ala Thr Ala Ala Leu Leu Gly His Ile Leu Leu
His Asp Phe Leu Leu Val Pro Arg Glu Leu Ser Gly Ser Ser Pro Val
Leu Glu Glu Thr His Pro Ala His Gln Gln Gly Ala Ser Arg Pro Gly 60
Pro Arg Asp Ala Gln Ala His Pro Gly Arg Pro Arg Ala Val Pro Thr 65 70 75 80
Gln Cys Asp Val Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys 85 90 95
Ala Ile Thr Gln Glu Gln Cys Glu Ala Arg Gly Cys Cys Tyr Ile Pro 100 105 110
Ala Lys Gln Gly Leu Gln Gly Ala Gln Met Gly Gln Pro Trp Cys Phe 115 120 125
Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Ser 130 135 140
Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr Thr Pro Thr Phe Phe 145 150 155 160
Pro Lys Asp Ile Leu Thr Leu Arg Leu Asp Val Met Met Glu Thr Glu 165 170 175
Asn Arg Leu His Phe Thr Ile Lys Asp Pro Ala Asn Arg Arg Tyr Glu 180 185 190
Val Pro Leu Glu Thr Pro His Val His Ser Arg Ala Pro Ser Pro Leu 195 200 205
Tyr Ser Val Glu Phe Ser Glu Glu Pro Phe Gly Val Ile Val Arg Arg 210 215 220
Gln Leu Asp Gly Arg Val Leu Leu Asn Thr Thr Val Ala Pro Leu Phe 225 230 235 240
Phe Ala Asp Gln Phe Leu Gln Leu Ser Thr Ser Leu Pro Ser Gln Tyr 245 250 255
Ile Thr Gly Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser 260 265 270
Trp Thr Arg Ile Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly 275 280 285
Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly 290 295 300
Gly Ser Ala His Gly Val Phe Leu Leu Asn Ser Asn Ala Met Asp Val 305 310 315 320
Val Leu Gln Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly Ile 325 330 335
Leu Asp Val Tyr Ile Phe Leu Gly Pro Glu Pro Lys Ser Val Val Gln 340 345 350
Gln Tyr Leu Asp Val Val Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly 355 360 365
Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala Ile Thr 370 375 380
Arg Gln Val Val Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Val 385 390 395 400
Gln Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe 405 410 415
Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met Val Gln Glu Leu His 420 425 430
Gln Gly Gly Arg Arg Tyr Met Met Ile Val Asp Pro Ala Ile Ser Ser 435 440 445
Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg 450 455 460
Gly Val Phe Ile Thr Asn Glu Thr Gly Gln Pro Leu Ile Gly Lys Val 465 470 475 480
Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu 485 490 495
Ala Trp Trp Glu Asp Met Val Ala Glu Phe His Asp Gln Val Pro Phe 500 505 510
Asp Gly Met Trp Ile Asp Met Asn Glu Pro Ser Asn Phe Ile Arg Gly 515 520 525
Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Val 530 535 540
Pro Gly Val Val Gly Gly Thr Leu Gln Ala Ala Thr Ile Cys Ala Ser 545 550 555 560
Ser His Gln Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly 565 570 575
Leu Thr Glu Ala Ile Ala Ser His Arg Ala Leu Val Lys Ala Arg Gly 580 585 590
Thr Arg Pro Phe Val Ile Ser Arg Ser Thr Phe Ala Gly His Gly Arg 595 600 605
Tyr Ala Gly His Trp Thr Gly Asp Val Trp Ser Ser Trp Glu Gln Leu 610 615 620
Ala Ser Ser Val Pro Glu Ile Leu Gln Phe Asn Leu Leu Gly Val Pro 625 630 635 640
Leu Val Gly Ala Asp Val Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu 645 650 655
Leu Cys Val Arg Trp Thr Gln Leu Gly Ala Phe Tyr Pro Phe Met Arg 660 665 670
Asn His Asn Ser Leu Leu Ser Leu Pro Gln Glu Pro Tyr Ser Phe Ser 675 680 685
Glu Pro Ala Gln Gln Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala 690 695 700
Leu Leu Pro His Leu Tyr Thr Leu Phe His Gln Ala His Val Ala Gly 705 710 715 720
Glu Thr Val Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser 725 730 735
Thr Trp Thr Val Asp His Gln Leu Leu Trp Gly Glu Ala Leu Leu Ile 740 745 750
Thr Pro Val Leu Gln Ala Gly Lys Ala Glu Val Thr Gly Tyr Phe Pro 755 760 765
Leu Gly Thr Trp Tyr Asp Leu Gln Thr Val Pro Val Glu Ala Leu Gly 770 775 780
Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala Ile His Ser 785 790 795 800
Glu Gly Gln Trp Val Thr Leu Pro Ala Pro Leu Asp Thr Ile Asn Val 805 810 815
His Leu Arg Ala Gly Tyr Ile Ile Pro Leu Gln Gly Pro Gly Leu Thr 820 825 830
Thr Thr Glu Ser Arg Gln Gln Pro Met Ala Leu Ala Val Ala Leu Thr 835 840 845
Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser 850 855 860
Leu Glu Val Leu Glu Arg Gly Ala Tyr Thr Gln Val Ile Phe Leu Ala 865 870 875 880
Arg Asn Asn Thr Ile Val Asn Glu Leu Val Arg Val Thr Ser Glu Gly 885 890 895
Ala Gly Leu Gln Leu Gln Lys Val Thr Val Leu Gly Val Ala Thr Ala 900 905 910
Pro Gln Gln Val Leu Ser Asn Gly Val Pro Val Ser Asn Phe Thr Tyr 915 920 925
Ser Pro Asp Thr Lys Val Leu Asp Ile Cys Val Ser Leu Leu Met Gly 930 935 940
Glu Gln Phe Leu Val Ser Trp Cys 945 950 <2105 2 <211> 3566 <212> DNA <213> Homo sapiens <400> 2 cgaccccgga gtctccgcgg gcggccaggg cgcgcgtgcg cggaggttct cctcgtccgc 60 ccgttgttca gcgagggagg ctctgcgcgt gccgcagctg acggggaaac tgaggcacgg 120 agcgggcctg taggagctgt ccaggccatc tccaaccatg ggagtgaggc acccgccctg 180 ctcccaccgg ctcctggccg tctgcgccct cgtgtccttg gcaaccgctg cactcctggg 240 gcacatccta ctccatgatt tcctgctggt tccccgagag ctgagtggct cctccccagt 300 cctggaggag actcacccag ctcaccagca gggagccagc agaccagggc cccgggatgc 360 ccaggcacac cccggccgtc ccagagcagt gcccacacag tgcgacgtcc cccccaacag 420 ccgcttcgat tgcgcccctg acaaggccat cacccaggaa cagtgcgagg cccgcggctg 480 ttgctacatc cctgcaaagc aggggctgca gggagcccag atggggcagc cctggtgctt 540 cttcccaccc agctacccca gctacaagct ggagaacctg agctcctctg aaatgggcta 600 cacggccacc ctgacccgta ccacccccac cttcttcccc aaggacatcc tgaccctgcg 660 gctggacgtg atgatggaga ctgagaaccg cctccacttc acgatcaaag atccagctaa 720 caggcgctac gaggtgccct tggagacccc gcatgtccac agccgggcac cgtccccact 780 ctacagcgtg gagttctccg aggagccctt cggggtgatc gtgcgccggc agctggacgg 840 ccgcgtgctg ctgaacacga cggtggcgcc cctgttcttt gcggaccagt tccttcagct 900 gtccacctcg ctgccctcgc agtatatcac aggcctcgcc gagcacctca gtcccctgat 960 gctcagcacc agctggacca ggatcaccct gtggaaccgg gaccttgcgc CCacCgcccgg 1020 tgcgaacctc tacgggtctc accctttcta cctggcgctg gaggacggcg ggtcggcaca 1080 cggggtgttc ctgctaaaca gcaatgccat ggatgtggtc ctgcagccga gccctgccct 1140 tagctggagg tcgacaggtg ggatcctgga tgtctacatc ttcctgggcc cagagcccaa 1200 gagcgtggtg cagcagtacc tggacgttgt gggatacccg ttcatgccgc catactgggg 1260 cctgggcttc cacctgtgcc gctggggcta ctcctccacc gctatcaccc gccaggtggt 1320 ggagaacatg accagggccc acttccccct ggacgtccag tggaacgacc tggactacat 1380 ggactcccgg agggacttca cgttcaacaa ggatggcttc cgggacttcc cggccatggt 14409 gcaggagctg caccagggcg gccggcgcta catgatgatc gtggatcctg ccatcagcag 1500 ctcgggccct gccgggagct acaggcccta cgacgagggt ctgcggaggg gggttttcat 1560 caccaacgag accggccagc cgctgattgg gaaggtatgg cccgggtcca ctgccttccc 1620 cgacttcacc aaccccacag ccctggcctg gtgggaggac atggtggctg agttccatga 1680 ccaggtgccc ttcgacggca tgtggattga catgaacgag ccttccaact tcatcagggg 1740 ctctgaggac ggctgcccca acaatgagct ggagaaccca ccctacgtgc ctggggtggt 1800 tggggggacc ctccaggcgg ccaccatctg tgcctccagc caccagtttc tctccacaca 1860 ctacaacctg cacaacctct acggcctgac cgaagccatc gcctcccaca gggegetggt 1920 gaaggctcgg gggacacgcc catttgtgat ctcccgctcg acctttgctg gccacggccg 1980 atacgccggc cactggacgg gggacgtgtg gagctcctgg gagcagctcg cctcctccgt 2040 gccagaaatc ctgcagttta acctgctggg ggtgcctctg gtcggggccg acgtctgcgg 2100 cttcctgggc aacacctcag aggagctgtg tgtgcgctgg acccagctgg gggccttcta 2160 ccccttcatg cggaaccaca acagcctgct cagtctgccc caggagccgt acagcttcag 2220 cgagccggec cagcaggcca tgaggaaggc cctcaccctg cgctacgcac tcctccccca 2280 cctctacaca ctgttccacc aggcccacgt cgcgggggag accgtggccc ggcccctctt 2340 cctggagttc cccaaggact ctagcacctg gactgtggac caccagctcc tgtgggggga 2400 ggccctgctc atcaccccag tgctccaggc cgggaaggcc gaagtgactg gctacttccc 2460 cttgggcaca tggtacgacc tgcagacggt gccagtagag gcccttggca gcctcccacc 2520 cccacctgca gctccccgtg agccagccat ccacagcgag gggcagtggg tgacgctgcc 2580 ggcccccctg gacaccatca acgtccacct ccgggctggg tacatcatcc ccctgcaggg 2640 ccctggcctc acaaccacag agtcccgcca gcagcccatg gccctggctg tggccctgac 2700 caagggtggg gaggcccgag gggagctgtt ctgggacgat ggagagagcc tggaagtgct 2760 ggagcgaggg gcctacacac aggtcatctt cctggccagg aataacacga tcgtgaatga 2820 gctggtacgt gtgaccagtg agggagctgg cctgcagctg cagaaggtga ctgtcctggg 2880 cgtggccacg gcgccccagc aggtcctctc caacggtgtc cctgtctcca acttcaccta 2940 cagccccgac accaaggtcc tggacatctg tgtctcgctg ttgatgggag agcagtttct 3000 cgtcagctgg tgttagccgg gcggagtgtg ttagtctctc cagagggagg ctggttcccc 3060 agggaagcag agcctgtgtg cgggcagcag ctgtgtgcgg gcctgggggt tgcatgtgtc 3120 acctggagct gggcactaac cattccaagc cgccgcatcg cttgtttcca cctcctgggc 3180 cggggctctg gcccccaacg tgtctaggag agctttctcc ctagatcgca ctgtgggccg 3240 gggccctgga gggctgctct gtgttaataa gattgtaagg tttgccctcc tcacctgttg 3300 ccggcatgcg ggtagtatta gccacccccc tccatctgtt cccagcaccg gagaaggges 3360 tgctcaggtg gaggtgtggg gtatgcacct gagctcctgc ttcgcgcctg ctgctctgcc 3420 ccaacgcgac cgctgcccgg ctgcccagag ggctggatgc ctgccggtcc ccgagcaagc 3480 ctgggaactc aggaaaattc acaggacttg ggagattcta aatcttaagt gcaattattt 3540 ttaataaaag gggcatttgg aatcag 3566 <2105 3 <211> 180 <212> PRT <213> Homo sapiens <400> 3
Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu 1 5 10 15
Ala Phe Ala Ser Cys Cys Ile Ala Ala Tyr Arg Pro Ser Glu Thr Leu
Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys Gly Asp Arg
Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg Arg Ser Arg 60
Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu 65 70 75 80
Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Arg Asp Val Ser Thr 85 90 95
Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys 100 105 119
Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu Arg Arg 115 120 125
Gly Leu Pro Ala Leu Leu Arg Ala Arg Arg Gly His Val Leu Ala Lys 130 135 140
Glu Leu Glu Ala Phe Arg Glu Ala Lys Arg His Arg Pro Leu Ile Ala 145 150 155 160
Leu Pro Thr Gln Asp Pro Ala His Gly Gly Ala Pro Pro Glu Met Ala 165 170 175
Ser Asn Arg Lys 180 <2105 4 <211> 24 <212> PRT <213> Homo sapiens <400> 4
Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu 1 5 10 15
Ala Phe Ala Ser Cys Cys Ile Ala <216> 5 <211> 67 <212> PRT <213> Homo sapiens <400> 5
Ala Tyr Arg Pro Ser Glu Thr Leu Cys Gly Gly Glu Leu Val Asp Thr 1 5 10 15
Leu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Ser Arg Pro Ala 20 25 30
Ser Arg Val Ser Arg Arg Ser Arg Gly Ile Val Glu Glu Cys Cys Phe
Arg Ser Cys Asp Leu Ala Leu Leu Glu Thr Tyr Cys Ala Thr Pro Ala 60
Lys Ser Glu 65
<210> 6 <211> 91 <212> PRT <213> Artificial Sequence <220> <223> IGF2 sequence as used in several constructs (Signal peptide IGF2, aa 1 to 67) <400> 6
Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu 1 5 10 15
Ala Phe Ala Ser Cys Cys Ile Ala Ala Tyr Arg Pro Ser Glu Thr Leu
Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys Gly Asp Arg
Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg Arg Ser Arg 60
Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu 65 70 75 80
Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu 85 90 <210> 7 <211> 85 <212> PRT <213> Artificial Sequence <220> <223> IGF2 sequence as used in several constructs (Signal peptide IGF2, aa 1, 8 to 67) <400> 7
Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu 1 5 10 15
Ala Phe Ala Ser Cys Cys Ile Ala Ala Leu Cys Gly Gly Glu Leu Val 20 25 30
Asp Thr Leu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Ser Arg 35 40 45
Pro Ala Ser Arg Val Ser Arg Arg Ser Arg Gly Ile Val Glu Glu Cys 50 55 60
Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu Glu Thr Tyr Cys Ala Thr 65 70 75 80
Pro Ala Lys Ser Glu 85 <210> 8 <211> 74 <212> PRT <213> Artificial Sequence <220> <223> IGF2deletion as used in several constructs (aa 1, 8 to 29, 41 to 67): <400> 8
Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu 1 5 10 15
Ala Phe Ala Ser Cys Cys Ile Ala Ala Leu Cys Gly Gly Glu Leu Val
Asp Thr Leu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Ser Gly
Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu Glu 60
Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu 65 70 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> fw primer
<400> 9 ggaatcgtcg aggaatgctg ttttc 25 <210> 10
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> reverse primer
<400> 10 cagcattcct cgacgattcc agaaaagtag aagccgcggt cc 42 <210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> primer vector forward
<400> 11 tcttcctggg acctgagccc 20 <210> 12
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> primer vector reverse
<400> 12 tcgtgcagca ggatgtgccc tggggctcct tcggacttgg 40 <210> 13
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> primer insert forward
<400> 13 gggcacatcc tgctgcacg 19 <210> 14
<211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer insert reverse <400> 14 gcccccagta gggtggcata 20 <21e> 15 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> flexible linker <400> 15
Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15
Gly Gly Gly Gly Ser

Claims (33)

ConclusiesConclusions 1. Nucleinezuurmolecuul omvattende een nucleotidesequentie coderend voor een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan zure alfa glucosidase (GAA) en coderend voor aminozuren 70-952 van humaan GAA, en een humaan insuline-achtig groeifactor II (IGFII) gensequentie die 5 is gelokaliseerd van de nucleotidesequentie coderend voor een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan zure GAA en coderend voor aminozuren 70-952 van humaan GAA.A nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to amino acids 28-69 of human acid alpha glucosidase (GAA) and encoding amino acids 70-952 of human GAA, and a human insulin-like growth factor II (IGFII) gene sequence located 5 from the nucleotide sequence encoding an amino acid sequence that has at least 90% sequence identity to amino acids 28-69 of human acid GAA and encoding amino acids 70-952 of human GAA. 2. Nucleinezuurmolecuul volgens conclusie 1, waarbij genoemde nucleotidesequentie coderend voor een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan zure GAA en coderend voor aminozuren 70-952 van humaan GAA omvat nucleotiden 239-3013 van het humane GAA gen of een codon-geoptimaliseerd sequentie daarvan.The nucleic acid molecule of claim 1, wherein said nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to amino acids 28-69 of human acid GAA and encoding amino acids 70-952 of human GAA comprises nucleotides 239-3013 of human GAA gene or a codon-optimized sequence thereof. 3. Nucleinezuurmolecuul volgens een van de voorgaande conclusies, waarbij genoemde humane IGFII sequentie een nucleotidesequentie omvat coderend voor het IGFII signaalpeptide, en bij voorkeur coderend voor aminozuren 8-29 en 41-67 van matuur IGFII, bij voorkeur aminozuren 1, 8-29 en 41-67 van matuur IGFII.Nucleic acid molecule according to any of the preceding claims, wherein said human IGFII sequence comprises a nucleotide sequence encoding the IGFII signal peptide, and preferably encoding amino acids 8-29 and 41-67 of mature IGFII, preferably amino acids 1, 8-29 and 41-67 from mature IGFII. 4. Nucleinezuurmolecuul volgens een van de voorgaande conclusies, waarbij de IGFII gensequentie een mutatie omvat in de nucleotideregio coderend voor aminozuren 30-40 van IGFII, bij voorkeur omvattende een deletie in de nucleotideregio coderend voor aminozuren 30-40 van IGFII.Nucleic acid molecule according to any of the preceding claims, wherein the IGFII gene sequence comprises a mutation in the nucleotide region encoding amino acids 30-40 of IGFII, preferably comprising a deletion in the nucleotide region encoding amino acids 30-40 of IGFII. 5. Nucleïnezuurmolecuul volgens een van de voorgaande conclusies, waarbij de IGFTI gensequentie een deletie omvat van de nucleotiden coderend voor aminozuren 30-40 van IGFII.A nucleic acid molecule according to any one of the preceding claims, wherein the IGFTI gene sequence comprises a deletion of the nucleotides encoding amino acids 30-40 of IGFII. 6. Nucleïnezuurmolecuul volgens een van de voorgaande conclusies, verder omvattende: - een promoter functioneel gekoppeld aan de humane IGFII gensequentie en de nucleotidesequentie coderend voor een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan GAA en coderend voor aminozuren 70-952 van humaan GAA, bij voorkeur een MND promoter of een afgeleide daarvan, en - een koppelsequentie gelokaliseerd tussen de humane IGFTI gensequentie en de nucleotidesequentie coderend voor een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan GAA en coderend voor aminozuren 70-952 van humaan GAA, bij voorkeur waarde koppelsequentie bestaat uit 2 tot en met 10 aminozuren, bij meer voorkeur uit 2 tot en met 5 aminozuren.6. Nucleic acid molecule according to any of the preceding claims, further comprising: - a promoter operably linked to the human IGFII gene sequence and the nucleotide sequence encoding an amino acid sequence that has at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA, preferably an MND promoter or a derivative thereof, and - a linking sequence located between the human IGFTI gene sequence and the nucleotide sequence encoding an amino acid sequence that has at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA, preferably the linking sequence consists of 2 to 10 amino acids, more preferably of 2 to 5 amino acids. 7. Nucleïnezuurmolecuul volgens een van de voorgaande conclusies, waarbij het nucleïnezuurmolecuul een DNA of RNA molecuul is.7. Nucleic acid molecule according to any of the preceding claims, wherein the nucleic acid molecule is a DNA or RNA molecule. 8. Nucleïnezuurmolecuul volgens een van de voorgaande conclusies, welke een gentherapievector is, bij voorkeur een lentivirale vector.8. Nucleic acid molecule according to any of the preceding claims, which is a gene therapy vector, preferably a lentiviral vector. 9. Viraal deeltje omvattende een nucleinezuurmolecuul volgens een van de voorgaande conclusies.9. Viral particle comprising a nucleic acid molecule according to any of the preceding claims. 10. Fusie-eiwit gecodeerd door een nucleinezuurmolecuul volgens een van de conclusies 1 tot en met 8.A fusion protein encoded by a nucleic acid molecule according to any one of claims 1 to 8. 11. Fusie-eiwit omvattende een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan GAA en omvattend aminozuren 70-952 van humaan GAA, gefuseerd aan een humaan insuline-achtige groeifactor II (IGFII) aminozuursequentie, optioneel gescheiden door een koppelingssequentie, bij voorkeur waarbij de humane IGFII aminozuursequentie is zoals gedefinieerd in een van de conclusies 3 tot en met 5.11. Fusion protein comprising an amino acid sequence having at least 90% sequence identity to amino acids 28-69 of human GAA and comprising amino acids 70-952 of human GAA, fused to a human insulin-like growth factor II (IGFII) amino acid sequence, optional separated by a linking sequence, preferably wherein the human IGFII amino acid sequence is as defined in any of claims 3 to 5. 12. Nucleïnezuursequentie coderend voor het fusie-peptide volgens conclusie12. Nucleic acid sequence encoding the fusion peptide of claim 11.11. 13. Celpopulatie, bij voorkeur omvattende hematopoietische stamcellen (HSC), voorzien van een nucleinezuurmolecuul of viraal deeltje volgens een van de conclusies 1 tot en met 9, bij voorkeur waarbij de cellen zijn getransduceerd met genoemde nucleinezuurmolecuul of viraal deeltje.A cell population, preferably comprising hematopoietic stem cells (HSC), provided with a nucleic acid molecule or viral particle according to any one of claims 1 to 9, preferably wherein the cells have been transduced with said nucleic acid molecule or viral particle. 14. Celpopulatie volgens conclusie 13 welke een fusie-eiwit tot expressie brengt omvattende een humaan IGFII eiwit en een aminozuursequentie die ten minste 90% sequentie-identiteit heeft met aminozuren 28-69 van humaan GAA en aminozuren 70-952 van humaan GAA, bij voorkeur een fusie-eiwit volgens conclusie 10 of 11.The cell population of claim 13 expressing a fusion protein comprising a human IGFII protein and an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and amino acids 70-952 of human GAA, preferably a fusion protein according to claim 10 or 11. 15. Nucleïnezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 voor toepassing in een werkwijze voor het behandelen van de Ziekte van Pompe.Nucleic acid molecule according to any one of claims 1 to 8 or 12, viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 for use in a method for treating Pompe disease . 16. Werkwijze voor het behandelen van de Ziekte van Pompe omvattende het toedienen van een nucleinezuurmolecuul volgens een van de conclusies 1 tot en met 8of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 aan een individu die daar behoefte aan heeft.A method of treating Pompe disease comprising administering a nucleic acid molecule according to any one of claims 1 to 8 or 12, viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 to an individual who needs it. 17. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 15 of 16, waarbij het individu lijdt aan de Ziekte van Pompe en resterende GAA-enzymactiviteit heeft, in het bijzonder een individu die lijdt aan niet-klassieke infantiele Ziekte van Pompe, en waarbij genoemd nucleinezuurmolecuul volgens conclusie 4 of 5 is, genoemd fusie-eiwit wordt gecodeerd door genoemd nucleinezuurmolecuul volgens conclusie 4 of 5 of genoemde celpopulatie voorzien is van genoemd nucleinezuurmolecuul volgens conclusie 4 of 5.A nucleic acid molecule, fusion protein or cell population for use or method according to claim 15 or 16, wherein the individual suffers from Pompe disease and has residual GAA enzyme activity, in particular an individual suffering from non-classical infantile Pompe disease and wherein said nucleic acid molecule is according to claim 4 or 5, said fusion protein is encoded by said nucleic acid molecule according to claim 4 or 5 or said cell population is provided with said nucleic acid molecule according to claim 4 or 5. 18. Nucleïnezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 voor toepassing in een werkwijze voor het induceren van centrale immuun tolerantie in een individu dat lijdt aan de Ziekte van Pompe.18. Nucleic acid molecule according to any one of claims 1 to 8 or 12, viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 for use in a method for inducing central immune tolerance in an individual suffering from Pompe's disease. 19. Werkwijze voor het induceren van centrale immuun tolerantie in een individu dat lijdt aan de Ziekte van Pompe, de werkwijze omvattende het toedienen van het nucleinezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 aan genoemd individu.A method of inducing central immune tolerance in an individual suffering from Pompe disease, the method comprising administering the nucleic acid molecule of any one of claims 1 to 8 or 12, viral particle of claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 to said individual. 20. Nucleïnezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 voor toepassing in een werkwijze voor het voorkomen of stoppen van IQ-verlies bij een individu die lijdt aan de Ziekte van Pompe, in het bijzonder klassiek infantiele Ziekte van Pompe.20. Nucleic acid molecule according to any one of claims 1 to 8 or 12, viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 for use in a method for preventing or stopping IQ loss in an individual suffering from Pompe disease, especially classical infantile Pompe disease. 21. Werkwijze voor het voorkomen of stoppen van IQ-verlies bij een individu die lijdt aan de Ziekte van Pompe, in het bijzonder klassiek infantiele Ziekte van Pompe, omvattende het toedienen van het nucleïnezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 aan het individu.A method of preventing or arresting IQ loss in an individual suffering from Pompe disease, in particular classical infantile Pompe disease, comprising administering the nucleic acid molecule according to any one of claims 1 to 8 or 12 , viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 to the individual. 22. Nucleinezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 voor toepassing in een werkwijze voor het behandelen van hersen-, perifeer zenuwstelstel-, glad spierweefsel- en/of gehoordefecten in een individu dat lijdt aan de Ziekte van Pompen, in het bijzonder klassiek infantiele Ziekte van Pompe.22. Nucleic acid molecule according to any one of claims 1 to 8 or 12, viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 for use in a method for treating brain, peripheral nervous system, smooth muscle and/or hearing defects in an individual suffering from Pompe disease, especially classical infantile Pompe disease. 23. Werkwijze voor het behandelen van hersen-, perifeer zenuwstelstel-, gladde spier- en/of gehoordefecten in een individu dat lijdt aan de Ziekte van Pompen, in het bijzonder klassiek infantiele Ziekte van Pompe, omvattende het toedienen van het nucleinezuurmolecuul volgens een van de conclusies 1 tot en met 8 of 12, viraal deeltje volgens conclusie 9, fusie-eiwit volgens conclusie 10 of 11 of celpopulatie volgens conclusie 13 of 14 aan het individu.23. Method of treating brain, peripheral nervous system, smooth muscle and/or hearing defects in an individual suffering from Pompe disease, in particular classical infantile Pompe disease, comprising administering the nucleic acid molecule according to any of claims 1 to 8 or 12, viral particle according to claim 9, fusion protein according to claim 10 or 11 or cell population according to claim 13 or 14 to the individual. 24. Nucleinezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens een van de conclusies 15 tot en met 23 omvattende het verwijderen van cellen, bij voorkeur HSC, van het individu, het voorzien van genoemde cellen, bij voorkeur HSC, met het nucleinezuurmolecuul of viraal deeltje volgens een van de conclusies 1 tot en met 9, bij voorkeur het transduceren van genoemde cellen, bij voorkeur HSC, met het virale deeltje volgens conclusie 9, en het toedienen van genoemde cellen, bij voorkeur HSC, voorzien van genoemd nucleinezuurmolecuul of viraal deeltje aan genoemd individu.A nucleic acid molecule, fusion protein or cell population for use or method according to any one of claims 15 to 23 comprising removing cells, preferably HSC, from the individual, providing said cells, preferably HSC, with the nucleic acid molecule or viral particle according to any one of claims 1 to 9, preferably transducing said cells, preferably HSC, with the viral particle according to claim 9, and administering said cells, preferably HSC, provided with said nucleic acid molecule or viral particle to said individual. 25. Nucleinezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 24, waarbij genoemde behandeling verder omvat het voorzien van het individu van myeloablatieve behandeling voorafgaand aan het toedienen van genoemde HSC voorzien van genoemd nucleinezuurmolecuul of viraal deeltje aan genoemd individu.The nucleic acid molecule, fusion protein or cell population for use or method according to claim 24, wherein said treatment further comprises providing the individual with myeloablative treatment prior to administering said HSC provided with said nucleic acid molecule or viral particle to said individual. 26. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 25, waarbij genoemde myeloablatieve preconditionering omvat myeloablatieve chemotherapie, bij voorkeur behandeling met een middel gekozen uit de groep bestaande uit busulfan, treosulfan, melfalan, fludarabine, eyclofosfamide, en combinaties daarvan, bij voorkeur een middel gekozen uit de groep bestaande uit busulfan, treosulfan, fludarabine en combinaties daarvan.A nucleic acid molecule, fusion protein or cell population for use or method according to claim 25, wherein said myeloablative preconditioning comprises myeloablative chemotherapy, preferably treatment with an agent selected from the group consisting of busulfan, treosulfan, melphalan, fludarabine, eyclophosphamide, and combinations thereof , preferably an agent selected from the group consisting of busulfan, treosulfan, fludarabine and combinations thereof. 27. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens een van de conclusies 15, 16 en 18 tot en met 26, waarbij het individu is gekozen uit de groep bestaande uit: - een individu dat lijdt aan klassiek infantiele Ziekte van Pompe, - een individu dat lijdt aan kruisreactief immunologisch materiaal (CRIM)- negatieve klassiek infantiele Ziekte van Pompe, - een individu dat lijdt aan niet-klassiek infantiele Ziekte van Pompe, - een individu dat lijdt aan laat optredende Ziekte van Pompe, - een individu dat lijdt aan de Ziekte van Pompe met aangetaste hersenen / centraal zenuwstelsel, - een individu dat lijdt aan de Ziekte van Pompe met aangetast perifeer zenuwstelsel aangetast glad spierweefsel en/of doofheid, en/of - een individu dat lijdt aan de Ziekte van Pompe welke onvoldoende responsief is op GAA enzym vervangingstherapie.A nucleic acid molecule, fusion protein or cell population for use or method according to any one of claims 15, 16 and 18 to 26, wherein the individual is selected from the group consisting of: - an individual suffering from classical infantile Pompe disease , - an individual suffering from cross-reactive immunological material (CRIM)-negative classical infantile Pompe disease, - an individual suffering from non-classical infantile Pompe disease, - an individual suffering from late-onset Pompe disease, - an individual suffering from Pompe disease with affected brain/central nervous system, - an individual suffering from Pompe disease with affected peripheral nervous system, affected smooth muscle tissue and/or deafness, and/or - an individual suffering from Pompe disease who is insufficiently responsive to GAA enzyme replacement therapy. 28. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 27, waarbij het individu eerder behandeld is met GAA enzym vervangingstherapie.The nucleic acid molecule, fusion protein or cell population for use or method according to claim 27, wherein the individual has previously been treated with GAA enzyme replacement therapy. 29. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 27, waarbij het individu niet eerder behandeld is met GAA enzym vervangingstherapie.The nucleic acid molecule, fusion protein or cell population for use or method according to claim 27, wherein the individual has not previously been treated with GAA enzyme replacement therapy. 830. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens een van de conclusies 15 tot en met 29, waarbij het individu behandeld wordt met GAA enzym vervangingstherapie tijdens or na behandeling met lentivirale gentherapie.A nucleic acid molecule, fusion protein or cell population for use or method according to any one of claims 15 to 29, wherein the individual is treated with GAA enzyme replacement therapy during or after treatment with lentiviral gene therapy. 31. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 30, waarbij het individu wordt behandeld met GAA enzym vervangingstherapie, gevold door myeloablatieve preconditionering en toediening van de HSC voorzien van genoemd nucleinezuurmolecuul of viraal deeltje, en optioneel gevolgd door verder GAA enzym vervangingstherapie.A nucleic acid molecule, fusion protein or cell population for use or method according to claim 30, wherein the subject is treated with GAA enzyme replacement therapy, followed by myeloablative preconditioning and administration of the HSC provided with said nucleic acid molecule or viral particle, and optionally followed by further GAA enzyme replacement therapy. 32. Nucleïnezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 30 of 31, waarbij het individu wordt behandeld met (GAA enzym vervangingstherapie voorafgaand aan de toediening van de HSC voorzien van genoemd nucleinezuurmolecuul of viraal deeltje en waarbij het individu wordt behandeld met een immunosuppressief middel voorafgaand aan of gelijktijdig met (GAA enzym vervangingstherapie.A nucleic acid molecule, fusion protein or cell population for use or method according to claim 30 or 31, wherein the subject is treated with (GAA enzyme replacement therapy) prior to administration of the HSC provided with said nucleic acid molecule or viral particle and wherein the subject is treated with an immunosuppressive agent prior to or concurrently with (GAA enzyme replacement therapy. 33. Nucleinezuurmolecuul, fusie-eiwit of celpopulatie voor toepassing of werkwijze volgens conclusie 32, waarbij genoemd immunosuppressief middel is gekozen uit de groep bestaande uit een B cel depletiemiddel, zoals een anti-CD20 antilichaam (zoals rituximab), een T cel depletiemiddel, zoals een anti-CD3 antilichaam (zoas OKT3, muronomab) or een anti T cel receptor antilichaam (zoals Muromonab-CD3), een anti-1L-2 receptor antilichaam (zoals basiliximab en daclizumab), azathioprine, een calcineurineremmer, een corticosteroid, cyclosporine, methotrexaat, IVIG, mercaptopurine, mycofenolaat mofetil, en combinaties daarvan.The nucleic acid molecule, fusion protein or cell population for use or method according to claim 32, wherein said immunosuppressive agent is selected from the group consisting of a B cell depleting agent, such as an anti-CD20 antibody (such as rituximab), a T cell depleting agent, such as an anti-CD3 antibody (such as OKT3, muronomab) or an anti T cell receptor antibody (such as Muromonab-CD3), an anti-1L-2 receptor antibody (such as basiliximab and daclizumab), azathioprine, a calcineurin inhibitor, a corticosteroid, cyclosporine, methotrexate, IVIG, mercaptopurine, mycophenolate mofetil, and combinations thereof.
NL2031676A 2022-04-22 2022-04-22 Gene therapy for Pompe Disease NL2031676B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
NL2031676A NL2031676B1 (en) 2022-04-22 2022-04-22 Gene therapy for Pompe Disease
PCT/NL2023/050216 WO2023204714A1 (en) 2022-04-22 2023-04-21 Gene therapy for pompe disease

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
NL2031676A NL2031676B1 (en) 2022-04-22 2022-04-22 Gene therapy for Pompe Disease

Publications (1)

Publication Number Publication Date
NL2031676B1 true NL2031676B1 (en) 2023-11-07

Family

ID=82943382

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2031676A NL2031676B1 (en) 2022-04-22 2022-04-22 Gene therapy for Pompe Disease

Country Status (2)

Country Link
NL (1) NL2031676B1 (en)
WO (1) WO2023204714A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008136670A2 (en) 2007-05-02 2008-11-13 Erasmus University Medical Center Rotterdam Improved methods and means for lentiviral gene delivery
WO2009137721A2 (en) 2008-05-07 2009-11-12 Zystor Therapeutics, Inc. Lysosomal targeting peptides and uses thereof
WO2020223356A1 (en) * 2019-04-30 2020-11-05 The Trustees Of The University Of Pennsylvania Compositions useful for treatment of pompe disease
CN112225793A (en) * 2020-10-14 2021-01-15 舒泰神（北京）生物制药股份有限公司 Lysosome targeting peptide, fusion protein thereof, adeno-associated virus vector carrying fusion protein coding sequence and application thereof
US20220054656A1 (en) * 2018-11-16 2022-02-24 Asklepios Biopharmaceutical, Inc. Therapeutic adeno-associated virus for treating pompe disease

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4243855A1 (en) * 2020-11-16 2023-09-20 Avrobio, Inc. Compositions and methods for treating pompe disease

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008136670A2 (en) 2007-05-02 2008-11-13 Erasmus University Medical Center Rotterdam Improved methods and means for lentiviral gene delivery
WO2009137721A2 (en) 2008-05-07 2009-11-12 Zystor Therapeutics, Inc. Lysosomal targeting peptides and uses thereof
US20120213762A1 (en) 2008-05-07 2012-08-23 Biomarin Pharmaceutical Inc. Lysosomal targeting peptides and uses thereof
US20220054656A1 (en) * 2018-11-16 2022-02-24 Asklepios Biopharmaceutical, Inc. Therapeutic adeno-associated virus for treating pompe disease
WO2020223356A1 (en) * 2019-04-30 2020-11-05 The Trustees Of The University Of Pennsylvania Compositions useful for treatment of pompe disease
CN112225793A (en) * 2020-10-14 2021-01-15 舒泰神（北京）生物制药股份有限公司 Lysosome targeting peptide, fusion protein thereof, adeno-associated virus vector carrying fusion protein coding sequence and application thereof

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
ASTRAKHAN ET AL., BLOOD, vol. 119, no. 19, 2012, pages 4395 - 4407
BIJVOET ET AL., HUM MOL GENET, vol. 7, 1998, pages 53 - 62
BIJVOET ET AL., HUM MOL GENET, vol. 8, 1999, pages 2145 - 2153
CARTIER N. ET AL., SCIENCE, vol. 326, no. 5954, 2009, pages 818 - 823
DOUILLARD-GUILLOUX ET AL., J GENE MED, vol. 11, 2009, pages 279 - 287
HUIE ML ET AL., HUM MOL GENET., vol. 3, no. 12, 1994, pages 2231 - 6
LOEW ET AL., GENE THERAPY, vol. 17, 2010, pages 272 - 280
MAGA ET AL., J BIOL CHEM, vol. 288, no. 3, 18 January 2013 (2013-01-18), pages 1428 - 38
MAGA ET AL., J BIOL CHEM., vol. 288, no. 3, 18 January 2013 (2013-01-18), pages 1428 - 38
OKUMIYA ET AL., MOL GENET METAB, vol. 88, 2006, pages 22 - 28
ROBBINS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1994, pages 10182 - 10187
SCHUCHT ET AL., MOL THER, vol. 14, 2006, pages 285 - 92
STOK ET AL., MOLECULAR THERAPY - METHODS & CLINICAL DEVELOPMENT, vol. 17, 2020, pages 1014 - 1025
SWIFT ET AL., CURR PROTOC IMMUNOL, vol. 10, 2001
VAN TIL ET AL., BLOOD, vol. 115, 2010, pages 5329 - 5337
VAN TIL ET AL., BLOOD, vol. 115, 2020, pages 5329 - 5337
VAN TIL ET AL., BLOOD, vol. 115, no. 26, 1 July 2010 (2010-07-01), pages 5329 - 37
WAGEMAKER ET AL., MOL THER METHODS CLIN DEV., vol. 17, 4 May 2020 (2020-05-04), pages 1014 - 1025
ZUFFEREY ET AL., J. VIROL., vol. 72, 1998, pages 9873 - 9880

Also Published As

Publication number Publication date
WO2023204714A1 (en) 2023-10-26

Similar Documents

Publication Publication Date Title
US10022405B2 (en) IL-12 immunotherapy for cancer
US10137205B2 (en) Thymidylate kinase fusions and uses thereof
JP5332064B2 (en) Treatment of diseases characterized by inflammation
AU2012321102B2 (en) Vectors encoding rod-derived cone viability factor
RU2734678C2 (en) Genetic construct
US20060198833A1 (en) Compositions and methods for targeting a polypeptide to the central nervous system
JP2022153418A (en) Treatment of ocular diseases with fully human post-translationally modified anti-vegf fab
CA3106010A1 (en) Gene therapy vectors for treatment of danon disease
JP2020511470A (en) How to treat lysosomal disorders
EP2281047B1 (en) Methods to produce rod-derived cone viability factor (rdcvf)
NL2031676B1 (en) Gene therapy for Pompe Disease
US20230414725A1 (en) Compositions and methods for treating pompe disease
US20220218844A1 (en) Gene therapy vectors for infantile malignant osteopetrosis
US20060142219A1 (en) Pharmaceutical compositions comprising an hiv envelope protein and cd4
WO2024010067A1 (en) Nuecleic acid molecule, vector, recombinant cells, and drug for treating central nervous system diseases
US20240067942A1 (en) Lysosomal acid lipase variants and uses thereof