NL2030423B1 - Replication-deficient strain of canine distemper virus and construction method thereof - Google Patents

Abstract

The present disclosure relates to rescue and, verification. of a replication—deficient strain. of canine distemper virus (CDV). A system includes a transcription plasmid, one or more helper plasmids, and a Vero—SLAM—M cell line capable of stably expressing 5 a matrix (M) protein of SDl6F. The transcription plasmid, pCI—CDV— SDl6F, can express a full—length. cDNA. sequence of a genome of SDl6F, a CDV epidemic strain; a plasmid pCI—CDV—SDl6F—M subjected to site—directed mutation is a recombinant plasmid not expressing the M protein; the helper plasmids can express nucleoprotein (NP), lO phosphoprotein (P), and large polymerase protein (L) of the CDV epidemic strain, SDl6F. Through the foregoing reverse genetic manipulation system, recombinant replication—deficient CDV is successfully rescued. The replication—deficient strain of the CDV epidemic strain creates convenient conditions for developing a 15 novel genetically engineered biocontrol preparation for canine distemper and provides an excellent technology platform for the CDV—related basic research.

Description

P818/NLpd REPLICATION-DEFICIENT STRAIN OF CANINE DISTEMPER VIRUS AND

CONSTRUCTION METHOD THEREOF

TECHNICAL FIELD The present disclosure belongs to the technical field of vi- rus reverse genetic manipulation, and particularly relates to a replication-deficient strain of canine distemper virus (CDV) and a construction method thereof.

BACKGROUND ART Canine distemper (CD) is a highly contagious infectious dis- ease of a variety of animals, caused by infection of canine dis- temper virus (CDV) in the genus Morbillivirus of the family Para- myxoviridae. Under natural conditions, the most susceptible ani- mals are mainly carnivorous beasts such as canines, mustelids, and cats. The mortality rate is extremely high after infection. CDV is an enveloped, negative-sense, single-stranded RNA vi- rus, which mainly encodes six structural proteins: nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion pro- tein (F), hemagglutinin protein (H), and large polymerase protein {L). Immunization is currently the main means of preventing canine distemper. Inactivated vaccines do not provide complete protection against CDV virulent attacks. Therefore, attenuated live vaccines are widely used in controlling canine distemper in canines and economic animals. The vaccine strains of commercialized attenuated canine distemper vaccines are mostly attenuated by serial passage of isolated virulent strains by heterogeneous animals (ferrets and the like), chicken embryos or cells, such as CDV/R-20/8 strain and Onderstepoort strain. However, the attenuated strain obtained by this attenuation method has the risk of virulence reversion, and the vaccine strain has different degrees of pathogenicity to wild animals; a few vaccine strains of commercialized attenuated canine distemper vaccines are natural attenuated strains isolated and screened from nature. For example, CDV-11 strain used for foxes is isolated from dogs with transiently elevated body temperature, and is safe for dogs, raccoon dogs, minks, and foxes. However, the vaccine strain can be autonomously replicated in animals. Thus, there is the risk of spread of virus during vaccination, and the safety of wildlife is unknown.

Compared with the conventional attenuation method, based on reverse genetics, attenuated strains are obtained by means of point mutations in virulence gene-related loci and virus rescue, which have an advantage of clearer virus attenuation mechanism. A replication-deficient strain is obtained by gene deletion of a protein desired for replication in a viral genome. The strain can only be replicated on a replication-promoting cell that provides the protein, and is not replicable in other cells or animals. The immunity can be acquired by a single infection after vaccination of an animal, and neither replication nor detoxification is per- formed in the animal. Therefore, the strain is safer.

SUMMARY An objective of the present disclosure is to provide a repli- cation-deficient strain of a CDV epidemic strain and a construc- tion method thereof, thereby overcoming the problems existing in the prior art.

The present disclosure first provides a method for construct- ing a replication-deficient strain of a CDV epidemic strain, in- cluding the following steps: step 1, inserting a full-length cDNA sequence of a CDV genome not expressing matrix (M) protein into a transcription plasmid to obtain a recombinant plasmid; where the unexpressed M protein is acquired by site-directed mutation; one specific site-directed mutation is site-directed mutation of a base at an initiation codon of an M gene, and adenine (A) is mutated to cytosine (C); step 2, constructing helper plasmids, where the helper plas- mids are capable of expressing nucleoprotein (NP), phosphoprotein (P), and large polymerase protein (L) of the CDV; step 3, constructing a cell line expressing the M protein of the CDV, where the cell line is a Vero-SLAM-M cell line; and step 4, co-transfecting cells expressing the M protein of the CDV with the recombinant plasmid and the helper plasmids, and res- cuing a recombinant replication-deficient strain of the CDV epi- demic strain from a transfection cell suspension.

In still another aspect of the present disclosure, the pre- sent disclosure provides a product for preparing a replication- deficient strain of CDV, where the product includes: 1) a transcription plasmid, wherein the transcription plasmid is a recombinant plasmid inserted with a full-length cDNA sequence of a CDV genome not expressing M protein; 2) one or more helper plasmids, where the helper plasmids are capable of expressing nucleoprotein (NP), phosphoprotein (P), and large polymerase protein (L) of the CDV; and 3) a host cell line, where the cell line is capable of stably expressing the M protein of the CDV.

Another objective of the present disclosure is to provide use of a replication-deficient strain of a CDV epidemic strain in the preparation of a vaccine for preventing canine distemper.

The present disclosure further provides a Vero-SLAM-M cell line stably expressing canine distemper M protein.

The present disclosure constructs a full-length cDNA clone of a CDV genome, constructs a full-length cDNA clone of a recombinant genome not expressing M protein and helper plasmids expressing the CDV, NP, P, and L proteins according to the site-directed mutation technique, and newly constructs a cell line capable of expressing the M protein of the CDV epidemic strain, SD16F; a recombinant replication-deficient strain of the CDV epidemic strain was suc- cessfully rescued by using a reverse genetic manipulation tech- nique of a single-stranded negative-sense RNA virus. The present disclosure lays a foundation for the further development of new vaccines and biological products for preventing canine distemper and other studies of the CDV.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 illustrates a technology roadmap of the present dis- closure; FIG. 2 illustrates an insertion sequence in a pCI-CDV-SD16F-

AM plasmid, where the italicized ends are inserted fragments cloned into the pCI restriction sites Nhe I and Not I; the under- lined region is a hammerhead ribozyme (Ham Rz) sequence added at the 5'-end and a hepatitis delta virus ribozyme (HDV Rz) sequence added at the 3' end; the middle region is a full-length sequence of a CDV gene; and the black bold font is a mutant M gene (initia- tion codon ATG is mutated to CTG); FIG. 3 illustrates digestion results of a recombinant plas- mid, where M1 represents DL10000 DNA Marker; M2 represents DL5000 DNA Marker; 1 represents a recombinant plasmid digested with Xho I/Not I; 2 represents a recombinant plasmid digested with Xho I; FIG. 4 illustrates an identification of stable expression of the M gene in Vero-SLAM-M cells (F10 generation) by indirect immu- nofluorescent assay, where A represents pCI-neo transfected cells; B represents pCI-neo-M transfected cells; FIG. 5 illustrates one-step growth curves of a Vero-SLAM-M cell line and a Vero-SLAM cell line; FIG. 6 illustrates a detection of rescued viruses by a CDV colloidal gold test strip; FIG. 7 illustrates the determination of neutralizing antibody titers in immunized mice.

DETAILED DESCRIPTION OF THE EMBODIMENTS The present disclosure will be described in detail below with reference to the examples. The examples are only intended to il- lustrate the present disclosure, but not to limit the scope of the present disclosure. Example 1 Construction of a replication-deficient strain sys- tem of a CDV epidemic strain

1. CDV epidemic strain SD16F (GenBank accession number MH337872) was isolated from CD-borne foxes in the inventors' la- boratory, and vaccination with the strain could cause deaths of puppies; Vero-SLAM cells (African green monkey kidney cells, ATCC No. CCL-81) were used; the culture medium was Dulbecco's Modified Eagle Medium (DMEM) supplemented with 8% fetal bovine serum (FBS); plasmid pCI was preserved by the laboratory; other restriction en- zymes, T4 DNA ligase and Ex Taq DNA Polymerase were purchased from

TaKaRa; Enodotoxin-Free Plasmid Mini Kit, DMEM, G418 sulfate solu- tion, and FBS were purchased from Sangon Biotech (Shanghai) Co., Ltd.; transfection reagent lipo3000 was purchased from Invitrogen; CDV N monoclonal antibody was purchased from Shandong Lvdu Bio- 5 sciences Technology Co., Ltd.; canine positive serum was preserved in the laboratory. Fluorescently labeled rabbit anti-dog IgG was purchased from Beijing Biosynthesis Biotechnology Co., Ltd.; HRP- conjugated secondary antibody (anti-mouse) was purchased from San- gon Biotech (Shanghai) Co., Ltd.

2 Cloning of a full-length cDNA of CDV SD16F strain genome and construction of helper plasmids In order to construct a full-length cDNA clone of the SD16F strain, the seamless ligation technique of the In-Fusion® HD Clon- ing Kit was used for cloning in three steps (FIG. 1). The first step was 3'-end cloning, and the entire sequence of hepatitis del- ta virus ribozyme (Hdv Rz) was added to the primers, and cloned into the pCI vector according to the Nhe I and Not I restriction sites, designated as pCI-CDV-3'; the second step was to amplify an intermediate sequence and insert into the pCI-CDV-3’ plasmid at the Sph I restriction site, designated as pCI-CDV-3'-Plus, the third step was 5'-end cloning, where the entire sequence of ham- merhead ribozyme (Ham Rz) was added to the primers and inserted into pCI-CDV-3'-Plus at the Sph I restriction site, and the clone of the recombinant plasmid was sent to TaKaRa for sequencing.

The reverse genetic manipulation system of CDV was mainly in- tended to construct a full-length cDNA clone of RNA virus genome and helper plasmids. The helper plasmids expressed three function- al proteins: N, P, and L, respectively, and amplified open reading frames (ORFs) of N, P, and L by RT-PCR assay. The amplified DNA fragment was ligated to a eukaryotic expressing vector pCI, and a recombinant plasmid was transfected into Vero-SLAM cells, where the expression thereof was verified by RT-PCR and IPMA.

3. Site-directed mutation of full-length cDNA of CDV genome Based on the foregoing full-length cDNA clone of CDV genome, pCI-CDV-SD16F, Sal I/Sac II restriction enzyme sites were intro- duced, and site-directed mutation of a base was performed at the initiation codon of the M gene, and A was mutated to C.

Table 1: Primer design PCI-CDV-SD16F-M Fl TACGGCAAATGTCGACATTAAC PCI-CDV-SD16F-M F2 TCTCCACAAAACTGACTGAGGTGTAC | 26 pPCI-CDV-SD16F-M R1 CTCAGTCAGTTTTGTGGAGAGGAC PCI-CDV-SD16F-M R2 TCCAATCGGGGGSTCCGCGGCTAT 23 The plasmid pCI-CDV-SD16F was amplified by PCR using the foregoing primers and PrimerSTARE HS (Premix), to obtain two PCR products, which were named pCI-CDV-SD16F-A (489 bp) and pCI-CDV- SD16F-B (221 bp), respectively. The foregoing PCR products were extracted by cutting gel using TaKaRa MiniBEST Agarose Gel DNA Ex- traction Kit Ver. 4.0. Plasmid pCI-CDV-SD16F was digested with SallI/SacII. A DNA fragment of about 19 kbp was extracted by cut- ting gel using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.

4.0, and designated as pcCI-CDV-SD16F-Vector. The fragment was sub- jected to an In-Fusion reaction with a vector using an In-Fusion® HD Cloning Kit. The reaction system is as shown in the table be- low. The reaction was conducted at 50°C for 15 min. pCI-CDV-SD16F-Vector (about 100 ng/pL) 3 uL pCI-CDV-SD16F-A (about 50 ng/uL) 1 uL PCI-CDV-SD16F-B (about 50 ng/uL) 1 pL 5xIn-Fusion HD Enzyme Premix 2 uL dH:0 Up to 10 uL

2.5 pL of the foregoing In-Fusion product was thermally transformed into E. coli HSTO08 Premium Competent Cells, plated, and cultured at 37°C overnight. Positive colonies were picked and plated, and the plasmid was designated as pCI-CDV-SD16F-AM. The foregoing plasmid was sequenced.

4. Construction of a Vero-SLAM-M cell line stably expressing the M protein of CDV SDI16F strain Primers were designed and synthesized, namely SD16F-M-F:

CCGCTCGAGGCCACCATGACTGAGGTGTACGACTTCG; SD16F-M-R: ATAA- GAATGCGGCCGCTTAGAGAATTTTGAAAAGACCCTG. The M gene was amplified from the CDV fox-derived epidemic strain SD16F, and cloned into the Xho I/Not I sites of the eukaryotic expression plasmid pCI- neo. The recombinant plasmid was amplified by PCR, digested with Xho I/Not I, sequenced, and transfected into Vero-SLAM cells. The expression of the M protein in the cell line was screened and identified by G418 resistance pressure, RT-PCR, and indirect immu- nofluorescent assay (IFA).

5. Virus rescue One day before transfection, the Vero-SLAM-M cells were seed- ed on a 6-well plate to achieve a cell density of 2 x 10° in the wells and transfected when the cells reached 85-90% confluence. The pCI-CDV-SD16F-AM recombinant vector was co-transfected with helper plasmids pCI-SD16F-N, pCI-SD16F-P, and pCI-SD16F-L into Vero- SLAM-M cells at a dose of 5 ng, 0.8 ug, 0.5 pg, and 0.8 ug, respectively. The Vero-SLAM-M cells were cultured in a 5% CO, incu- bator at 37°C. The specific procedures were carried out according to the user manual of the Lipofectamine™ 3000 Kit. After co- transfection for 6-8 h, the transfection mixture was discarded from the wells, replaced with serum-containing Vero-Slam-M whole medium, and cultured in a 5% CO: incubator at 237°C for 24 h, and then the medium was changed. After culture for 3-5 days, the cyto- pathic effect was observed under an inverted microscope; the cell suspension was harvested and stored in a -80°C refrigerator. The virus was inoculated into non-permissive cell (Vero- SLAM) as a control.

6. Pathogenicity and immunogenicity test of the replication- deficient strain of CDV 100 pL of SD6F replication-deficient strain and maternal strain were inoculated into 11-day-old non-immunized chicken em- bryos via the chorioallantoic membrane, respectively, and cultured at 37°C for 5 days. The conditions of the chicken embryos were ob- served every day, and the dead chicken embryos were discarded at 24 h. A chicken embryo was placed in a cold-shrunk blood vessel at 4°C to observe varioles on the chorioallantoic membrane at 5 days. 100 pL of SD6F replication-deficient strain and maternal strain were subcutaneously inoculated into 4-week-old Balb/c mice, re- spectively. The mice received a second immunization at an interval of one week and a third immunization at an interval of two weeks; at two weeks after the third immunization, the blood was collected by eyeball enucleation, and serum was separated to determine neu- tralizing antibodies. The results were as follows:

1. Cloning of full-length cDNA of CDV genome and construction of helper plasmids The results showed that the complete genome sequence of CDV in the recombinant plasmid was identical to the full-length gene sequence obtained during the whole genome amplification, and the recombinant final full-length cDNA clone plasmid was designated as pCI-CDV-8D16F. After identification by plasmid digestion and se- quencing, eukaryotic expression vectors of three helper protein genes were successfully constructed and designated as pCI-SD16F-N, pCI-SD16F-P, and pCI-SD16F-1, respectively. RT-PCR could detect the transcription product of the recombinant plasmid, and IPMA could observe helper protein-specific staining cells in the trans- fected cells. This lays the foundation for further virus rescue.

2. Site-directed mutation of full-length cDNA of CDV genome Based on the foregoing full-length cDNA clone of CDV genome, pCI-CDV-SD16F, Sal I/Sac II restriction enzyme sites were intro- duced, and site-directed mutation of a base was performed at 3,432 bp of CDV cDNA, and A was mutated to C to construct a full-length cDNA clone of the recombinant genome not expressing M protein, pCI-CDV-SD16F-AM. The foregoing plasmid was sequenced. The result was correctly shown (FIG. 2).

3. Construction of a Vero-SLAM-M cell line stably expressing the M protein of CDV In order to construct a cell line stably expressing the M protein of CDV, a recombinant plasmid pCI-neo-M was successfully constructed by RT-PCR (FIG. 3). After transient and stable trans- fection of Vero-SLAM cells, RT-PCR and IFA were able to detect the transcription and expression of the M gene (FIG. 4), and the growth characteristics of the cells after G418 screening were ba- sically identical to those of their parental Vero-SLAM cells (FIG.

5), indicating that a Vero-SLAM cell line stably expressing the M protein was obtained and designated as Vero-SLAM-M. Ordinary Vero cells or Vero-SLAM cells could not be used for the rescue and growth of CDV M protein-deficient virus. Therefore, the present disclosure constructed a Vero-SLAM cell line stably expressing the M protein of CDV.

4. Rescue of a recombinant replication-deficient strain of the CDV epidemic strain from a cDNA clone Significant cytopathic effect occurred after the plasmid was transfected into the cells, and the virus was harvested. After re- peated freezing-thawing and centrifugation, a cell suspension was collected as the Fl generation of the rescued replication- deficient strain. The rescued virus was further passed for 3 gen- erations as described above. Further RT-PCR and colloidal gold test strip test results showed that CDV could be detected in the Vero-SLAM-M, a replication-permissive cell of the deficient strain, indicating that the virus was rescued successfully, but the virus was not successfully proliferated in Vero-SLAM, a repli- cation-nonpermissive cell (FIG. 6). The results showed that the recombinant replication-deficient strain of the CDV epidemic strain was successfully rescued by site-directed mutation of the SD16F genome of the CDV epidemic strain using the reverse genetic manipulation technique, and designated as SD16F-M.

5. Pathogenicity and immunogenicity test of the replication- deficient strain of CDV After the recombinant virus SD16F-M and the parental strain SD16F were inoculated into chicken embryos, the recombinant virus did not cause lesions in chicken embryos, but the parental strain produced characteristic varioles in the chick embryo chorioallan- toic membrane. Throughout the immunization process, all of the mice in the recombinant virus SD16F-M and the parental SD16F groups survived without any clinical signs of CDV infection. Neu- tralizing antibodies were detected in the collected serum, and there was no significant difference in titer between both groups (FIG. 7). A novel vaccine and a biological product for CDV are devel- oped based on this deficient virus. The agent can cause transient immunity in animals, which can effectively reduce and even elimi- nate the risk of virulence reversion; meanwhile, because it can be merely replicated in cells stably expressing the M protein, it cannot cause virus infection in other recipient animals after the virus spreads in the environment.

Up to this day, CDV can still increasingly increase the range of animal infection naturally, and the harm it brings is increasing.

Infection of CDV in rare pro- tected animals (like panda) and primates increasingly highlights the pathogenetic position of CDV.

Although effective vaccines are available, CDV still leads to major animal death events.

The re- combinant replication-deficient strain of the CDV epidemic strain obtained by the present study can be used as a suitable vector for constructing a novel vaccine.

On this basis, a novel gene vaccine can be developed, which truly realizes the safe and efficient pre- vention against CDV and brings up significant economic benefits to the society.

SEQUENCE LISTING <110> QINGDAO AGRICULTURAL UNIVERSITY <120> REPLICATION-DEFICIENT STRAIN OF CANINE DISTEMPER VIRUS AND

CONSTRUCTION METHOD THEREOF <130> HKJP202119329 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 15850 <212> DNA <213> Artificial Sequence <220> <223> Insertion sequence in a pCI-CDV-SD16F-M plasmid <400> 1 gctagctgtt aagcgtctga tgagtccgtg aggacgaaac tataggaaag gaattcctat 60 agtcaccaga caaagttggc taaggataga taaattattg gatattttat taaaaactta 120 gggtcaatga tcctacctta gggaacaagg tcagggttca gacctaccag tatggctagc 180 cttctcaaga gcctcacact gttcaagagg actcgggacc aacccccact tgcctcgggc 240 tccggaggag caataagagg gataaagcat gtcattatag tcctaatccc gggtgattca 300 agcattgtta caaggtctcg actattggac agacttgtta gattggtcgg tgatccggaa 360 atcaacggac ctaaattaac cgggatttta atcagtatcc tctccttgtt cgtggaatcc 420 cctggacagt tgatccaaag gatcatagac gaccctgatg tgagcatcaa gttagtagag 480 gtaatcccaa gcttcaactc tggttgtggt cttacatttg catccagagg agcaagtttg 540 gattctgagg cagatgagtt cttcaaaatt gtagacgaag ggtcgaaagc tcaaggacaa 600 ttaggctggt tggagaataa ggatattgta gacatagaag ttgatgatgc tgagcaattc 660 aatatattgc tagcttccat cttggcccaa atttggatcc tgctcgctaa agcagtgact 720 gctcctgata ctgcagccga ctcggaaatg aggagatgga ttaagtatac ccaacagaga 780 cgtgtggtcg gggaatttag aatgaacaaa atctggcttg atattgttag aaacaggatt 840 gctgaggact tatctttgag gcgattcatg gtggcactca tcttggacat caaacgatcc 900 ccagggaaca agcctagaat tgctgaaatg atttgtgata tagataacta cattgttgaa 960 gctggattag ctagtttcat cttaactatc aaatttggca ttgaaactat gtatccggct 1020 ctcgggttgc atgagttttc cggagagtta acaactattg aatcccttat gatgttatat 1080 caacagatgg gtgaaacagc accgtacatg gttattctgg aaaattctgt tcagaacaaa 1140 tttagtgcag gatcctaccc actgctctgg agttatgcta tgggagttgg tgttgaactt 1200 gaaaactcca tgggagggtt aaatttcggt agatcctact ttgatccggc ctatttcagg 1260 ctcgggcaag aaatggtgag aagatctgcc ggtaaagtaa gctctgcatt cgccgccgag 1320 cttggcatca ccaaggaaga ggctcagcta gtgtcagaaa tagcatccaa gacaacggag 1380 gaccggacga ttcgcactgc tggtcccaag caatctcaaa tcacttttct gcactcagaa 14409 agatccgaag tcactaatca acaaccccca actatcaaca agaggtccga aaacccagga 1500 ggagacaaat actccatcca cttcaatgat gaacgatttt cagggtacac ccctgatgtc 1560 aatagctccg aatggagtga atcacgctat gatacccaga ccattcaaga tgatggaaac 1620 gacgatgacc ggaaatcgat ggaagcaatc gccaagatga gaatgcttac taagatgctc 1680 agtcaaccta gaaccagtga agagagttct cctgtctata atgatagaga gctactcaat 1740 taaatattca agaccagtgt tacatcaatc accaattatc cttctaaact cattataaaa 1800 aacttaggac ccaggtccaa caatcccgat caaccattca tccgaccaac cgttctatct 1860 ctaaatggca gaagagcagg cctatcatgt caataaaggg ctggaatgcc tcaaagccct 1920 cagagagaat cctcctgaca ttgaggagat tcaagaggtc agcaatatca gagatcaaac 1980 ccgcaaccca ggccaagagg atggaaccgc aagcatgcaa gaagaagagg tctctcagga 2040 tctcgatgaa tcacacgagc cagcaaaagg atcaaactat gtcggccatg tactccaaaa 2100 taatccggga tgtggagaga gcaacactgc gcttgtggag gcagagcagc ccgctaacga 2160 tgatgtccaa ccaggacctg gaatacgatg ttatcatgtt tatgatcaca gtggtgaaga 2220 ggttaaggga atcgaagatg ctgacagtct cgtggtacct gcaggcgctg tcagtaatcg 2280 aggattcgag ggaggagaag gaagccttga tgatagcact gaggattctg gcgaagatta 2340 ttccgaggga aatgcttcat ctaactgggg atattctttc ggccttaaac cagacagagc 2400 ggctgatgtg agcatgctga tggaagagga attgagtgct ctgctcaaga caagcagaaa 2460 tgtagggatt aagaaaaggg atgggatgac cctgcagttc ccacacaatc ccgaaggtaa 2520 gacagaggat ccggagtgtg gatccattaa aaagggcaca ggagagaggt cagcctcaca 2580 tggaatgggg atagttgctg gatcgacaaa tggtgcaacc caatctgcac tcaagtcaac 2640 tggggaatca tcagggccaa gtgtgtctgc ggagaatgtc cgccaacctg caatgaatgc 2700 aaagatgacc cagaaatgca aacccgagtc tggtacgcaa ctccctccca ggacctcaaa 2760 tgaggctgaa tctgacagtg agtatgacga tgagcttttt tctgaaatac aagaaattcg 2820 atctgctatt actaagctaa cggaagataa tcaagcaata ctttctaaac tagataccct 2880 attactgctt aaaggagaga ctgattcaat taagaaacaa attagcaagc aaaatattgc 2940 tatttccacg attgaggggc atctatcaag cattatgata gctatacctg gttttgggaa 3000 ggacactgga gatcctacgg caaatgtcga cattaaccca gagctccgcc ctataatagg 3060 gagggattcg ggaagagcac tggcggaagt tctcaagcaa cccgcatcat cccgtggtaa 3120 tcggaaggac agtggtattg ccttgggctc aaaaggtcaa ctattgagag acctccaact 3180 gaaacctatt gacaaagagt ctagctcggc aatcggatac aaaccgaagg ataccgcacc 3240 ttccaaagct gtacttgcat cattgattag atcgagcaga attgatcaaa gtcacaaaca 3300 caacatgcta gcccttctca aaaatattaa gggggatgac aatctaaacg agttctacca 3360 gatgatcaag agtatcacac atgcttaatc tgtagcattt actaatccgc taacaggctc 3420 aaaaatgctt tcactatcgc ttaaaagcaa ttataaaaaa cttaggacac aagagcctaa 3480 gtcctctcca caaaactgac tgaggtgtac gacttcgatc agtcttcgtg ggacaccaaa 3540 ggttcattgg cccccatttt gcccaccacc tatcccgatg gtaggctagt accccaagtc 3600 agagtgatag atccaggact cggagatcga aaagatgaat gtttcatgta tatttttcta 3660 ctgggtataa tagaagacaa cgatagccgc ggacccccga ttggaagaac atttggatcg 3720 ctgcctttag gtgttgggcg cactacagcc agacctgaag aattattgaa ggaagccacc 3780 ttgttggaca ttgtggtaag gcgaactgca ggtgtcaagg aacaactggt attttacaat 3840 aacaccccat tgcacatctt aactccgtgg aagaaggtcc ttacgagtgg gagtgtgttc 3900 agtgctaatc aagtctgtaa cgcggtcaat ttaataccat tggacatagc acagagattt 3960 agggtggtat atatgagcat cactcgacta tcagacgatg gaagttacag agtccctcgc 4020 gggatgtttg aattccgctc caggaatgct ttagcattta atattttagt caccattcaa 4080 gttgagggag atgtctgttc aagccgaggg aatttgagca tgttcaaaga tcaccaagtg 4140 acattcatgg tgcatatcgg caacttcagc cgtaagaaga accaagctta ctctgctgat 4200 tactgtaaac ttaaaattga aaagatggga ttagtgtttg ctctaggagg gataggggga 4260 accagtcttc acatacgatg tactggtaag atgagcaagg ctttgaatgc ccagctagga 4320 ttcaagaaaa tcctgtgtta cccgctcatg gagatcaacg aagatttgaa tcgatttcta 4380 tggaggttag agtgcaaaat agtaagaatc caagcagtct tgcaaccatc agtcccacaa 4440 gatttcagaa tttataatga tgttatcatt agtgatgatc agggtctttt caaaattctc 4500 taaatcatta gttcatgaac taaaactcaa atgccttggt ggcactgtcc aggatccctt 4560 aatctcctca aacaaggatt gaggctacaa gtgtcaattg tctcggtgtt gctcctgcat 4620 tttaagcatg ttctataggt ttcttaactg ctcattcgtg cctactattc tggtgactct 4680 gcaatatgaa tacagctgaa tcaaaccaat tcatgctcaa gagtaggttg atcattatcg 4740 gaccaagaaa tgtatggatg cttggggttt tgaaattcac ctctaggaat ctcacttgac 4800 caattatacc tccatgcgct tgcccgatct caaactatta ctagtagtcc tgtttcacga 4860 aattctaact gtctatattt ctatcaccaa tcgttaataa ttaatcaaaa cttaggatcc 4920 aggacgcagec aagccaacag accaaccaag tccaccaatc cgaggccagg caggaacccc 4980 cacaaacaga caagccccat gcacagcaaa accctcaaaa attccaaacc cctgccacac 5040 acccgacaag atcccctcca acaacacagc accagatccg ccgagaccaa gacctcccaa 5100 ggacgatata gcataacatc ggctcagcga tccacgtacc atggtcctcg aacatcggat 5160 aggtccgtcc actacataat gaacaggacc aggtcttgca agcaaactag ccacagatcg 5220 gataacatcc ctcctcacag ggaccacgag ggtatcatcc atcacacacc agagagtgtt 5280 acccgaggag cgagttcttg gttcaagagg cggcaatcca atgcaaccaa cgcaggctct 5340 caatacacct ggttagtcct gtggtgcatc ggaacagcca gtctctttct ttgttccaag 5400 gctcagatac attggaataa tttgtcaacg attgggatta tcggaactga cagtgtccat 5460 tataagatca tgactaggcc cagtcaccag tacttggtca taaaactaat gcctaatgtt 5520 tcacttatag ataattgtac caaagcagaa ttaggtgagt atgagaaatt attaaattca 5580 gtcctagagc caatcaacca agctttgact ctaatgacca ataatgtgaa gcccctacag 5640 tcagtagggt caggtaggag acaaaagcgg tttgcaggag tggtgcttgc aggtgcagct 5700 ttaggggtgg ccacagccgc acaaatcact gcagggatag ctttacacca gtcaaacctc 5760 aatgctcaag cgatccaatc tctgagaact agccttgaac agtccaacaa ggctatagaa 5820 gaaattaggg aggcaaccca ggaaaccgtc attgctgttc agggagtcca ggattacgtc 5880 aataatgaac tcgtccctgc tatgcaacat atgtcgtgtg agttagttgg gcagagatta 5940 gggttaaaac tgcttaggta ttacaccgag ttgttgtcaa tatttggccc gagtttacgt 6000 gaccctattt cagccgagat atcaattcaa gcactgagtt atgctcttgg gggagaaatt 6060 cataagatac ttgagaagtt ggggtattct ggtaatgata tgattgcaat tttggagagt 6120 cgggggataa agacaaaaat aacccatgtc gatctccccg ggaaactcat catattaagt 6180 atctcatacc caactttatc agaagtcaag ggggttatag tacacaggct ggaagcagtt 6240 tcttataaca tagggtcaca ggagtggtac accactgtcc cgaagtatgt tgcaactaat 6300 ggttacttaa tatctaactt tgatgagtca tcctgtgtat ttgtctcaga atcagctatt 6360 tgtagccaaa actctttata ccccatgagc ccgattctac aacaatgcat taggggcgac 6420 acttcatctt gtgctcggac cttggtgtct gggactatgg gcaacaagtt tattctgtca 6480 aaaggtaata tcgttgcaaa ttgtgcttct atattatgta agtgttatag cacaagcaca 6540 attatcaatc agagtcctga taagttgctg acatttattg cctccgatac ctgcccactg 6600 gttgaaatag atggtgtaac tattcaagtt ggagggaggc aataccctga tatggtatac 6660 gaaagcaaag ttgccttagg acctgctata tcacttgaga ggttagatgt aggtacaaat 6720 ttagggaacg cccttaagaa actggatgat gctaaagtac tgatagactc ctctaaccag 6780 atccttgaga cagttaagcg ctcttccttt aattttggca gtctcctcag cgttcccata 6840 ttaatctgta cagccctggc tttgttgttg ctaatttact gctgtaaaag acgctaccga 6900 cagacattca agcataatac taaggtcgat ccgacattta aacctgattt gactggaact 6960 tcaaaatcat atgtaagatc actctgaagc actctggtca caagtcttac ctgattgtca 7020 ggtttgaaat ccataagtct cgcctaattc ccttctaaag ctatcaaact gcaacaaata 7080 gtggcgagga ctgactccaa ttgttataat taaagaaaac ttagggctca ggtagtccaa 7140 caatgctctc ctaccaagac aaggtgggtg ccttctataa ggataatgca agagctaatt 7200 catccaagct gtccttagtg acagaagagc aagggggaag gagaccaccc tatttgctgt 7260 ttgtccttct catcctactg attggaatcc tgaccttgct tgccatcact ggagttcgat 7320 ttcaccaagt atcaactagc aatatggaat ttagcagatt gctgaaagag gatatggaga 7380 aatcagaggc cgtacatcac caagtcatag atgtcctgac accgctcttc aaaattattg 7440 gagatgagat tgggttgcgg ttgccacaaa aactaaacga gatcaaacaa tttatcctcc 7500 aaaagacaaa cttcttcaat ccgaacaggg aattcgactt ccgcgatctc cactggtgca 7560 ttaacccacc tagcaagatc aaggtgaatt ttaccaacta ctgtgataca gttggggtca 7620 aaaaatctat tgcatcggca gcaaatccca tcattttatc agcactctct ggagccagag 7680 gcgacatatt cccgccgtac agatgcagtg gagctactac ttcagtaggc agagtattct 7740 ccctatccgt gtcattatcc atgtctttaa tatcaagaac atcagagata atcaatatgc 7800 taaccgctat ctcagacgga gtgtatggta aaacttattt gctagtgcct gattatattg 7860 aaggggagtt cgactcgcaa aagattcgag tctttgagat agggtttatc aaacggtggc 7920 tgaataacat acctttactc cagacaacca actatatggt cctcccggaa acttccaaag 7980 ccaaggtatg tactatagca gtgggcgagc tgacactagc ttccttgtgt gtagatgaga 8040 gcaccgtatt gttatatcat gacagcaatg gttcacaaaa tggtattcta gtagtgacat 8100 tgggaatatt tggggcaaca cctatggatc aagttgaaga ggtgatacct atcgctcacc 8160 catcagtgga gagaatacat ataacaaatc accgtgggtt cataaaagat tcagtagtaa 8220 cctggatggt gcctgtattg gtctctggga aacaagagga gcaaaaaaac tgtctggagt 8280 ctgcttgtca aagaaaatcc tacccgatgt gtaaccaaac gtcatgggaa ccctttggag 8340 gaggacagtt gccctcttat gggcggttga cattacctct agatccaagc gttgaccttc 8400 aacttaacat atcatttaca tatggtccgg ttatactgaa cggagacggt atggattatt 8460 atgaaagccc acttttggaa tccggatggc taaccgtacc ccctaagaac ggaacagtcc 8520 ttggattgat aaacaaagca agtagaggag accagttcac tgtgaccccc tatgtgttga 8580 catttgcgcc cagggaatca agtggaaatt gttatttgcc tattcaaaca tcccagatta 8640 tggataaaga tgtccttact gagtccaatt tagtggtgtt acctacacag aattttagat 8700 atgtcatagc aacatatgat atatcccggg gcgatcatgc aattgtttat tatgtttatg 8760 accctaaccg gacgatttct tatacacacc catttagact aactaccaag ggtagacctg 8820 atttcctaag gattgaatgt tttgtgtggg atgacgatct gtggtgtcat caattttacc 8880 gattcgaggc taacatcact aactctacaa ccagtgttga gaatttagtc cgtataagat 8940 tctcatgtaa ccgttcaaaa ccttgatggt atgatgatac acatctcaat tgaactgagt 9000 gatgatgacc gtggtaagaa atcccttacc gacgattgaa ttaaaccatc tccagcatta 9060 taaaaaaact aaggatccag gatcctttta gtcatggact ctgtttcggt gaaccagatt 9120 ctataccctg aggtccatct agatagccca attgtgacca ataagctagt ggctatttta 9180 gaatatgcaa gaattagaca taactatcga ctccttgaca caacgttagt gcgtaatatc 9240 aaagagagaa tttcagaagg gttatcaaac cagatgatca ttaactgtat cgaaattggg 9300 agcattgtta atcagacctt gttatcttat ccaaaacaca accatgtgat atatccaaat 9360 tgcaacaaac ttctgtttca tgcacaagat cgagtcatct ctctgaggtt gagaaatata 9420 ttcaaaagag gaaatagcat ctatagtaaa ataacagacg gggtcaaaaa atgcttaaac 9480 gatattaatc ttagtattgg tttaggaggt gcattggata agaccattgg ggccaaaatt 9540 gatgaagcag gcataattat gcagagctca cagtggttcg aacctttcct tctgtggttt 9600 acaattaaga cagaaatgag atcagtgatt aaatcctcta ctcacaactg tcgcaaacga 9660 aggcagaatc ctgtctttgt aagaggtgaa tcatttaatg tgctagtgtc tcgggatctt 9720 gtatgtatca ttgacctctc cagtcacaat gtttattacc taacatttga aatggtcctg 9780 atgtattgtg atgtgataga agggagatta atgactgata ctgctatggc aattgatcac 9840 cgttactcaa ctttacatgt cagagtaagg tatctttggg atctaattga tggatttttc 9900 ccggacttag gaaattcgac ctatcaactg gtagctctgc ttgagcctct ttcattggct 9960 tacttgcaat taaaagacat caccttctcc ctcaggggtg cttttttgag tcactgcttt 10020 gctgaaatcc aggagatttt acaggacaat ggcttctata ctgaagagac attccaaacc 10080 ttaacccagg ctctagactt tgttttcatc acagaggata tacatataac aggagagatc 10140 ttttectttt ttaggagttt cggtcaccca agattagaag caataacagc agcagaaaat 10200 gtacggaaac acatgaatca acccaaagtt gtctcctatg agaccatgat gaagggacac 10260 gctattttct gtgggataat cattaacggt tatcgggata gacatggagg aacctggcct 10320 ccaatggatc ttcctgtcca tgcatctcct atcatcagga atgctcaagc ctcaggagag 10380 ggaatcacct atagtcaatg tatagaaaat tggaaatcct ttgcaggaat tcgatttaaa 10440 tgctttatgc ccctcagcct agatagtgat ctgaccatgt atttaaaaga taaggcttta 190500 gcagccctta aaaaagagtg ggattcagtg tacccaaaag aattcctcag gtacaaccca 10560 cctcgctcca ctgaatctcg gagacttgtt aatgtgtttc tagaggactc tcagtttgac 10620 ccttataata tgattatgta cgtcatctca ggacaatatc tagacgatcc tgactttaac 10680 ctatcataca gtcttaaaga gaaagagatt aaagaggtgg ggaggttatt cgctaaaatg 10740 acatacaaaa tgcgagcctg tcaagtcata gcagaaaact taatatctaa tggaattggg 10800 aagtacttca aggacaatgg gatggcaaag gatgaacacg atctcactaa agcattgcac 10860 actctggctg tgtcgggggt tcccaaagac aagaaagact cccatcgcgg cctcactaat 10920 cagtgtatgt ctaaaaaacc gacaccttat cgaggagccc ttcactccgt ctcttctcca 10980 agtagtagat atatggaccc aaacccaaat ttttgcacca gtagaagaga agacaatgac 11040 atagagatct atgagaccgt aagtgcattt ataactacag atctcaaaaa gtactgtctg 11100 aattggcgat atgagaccat tagtatattt gctcagagat taaatgaaat ctacggtctc 11160 ccctcatttt ttcaatggtt gcacagaaga ttggaacagt cgatcctata cgtaagtgac 11220 ccccactgcc ctccagatct cgatcgccat gtggatttga acacagcccc taactctcaa 11280 atattcatca aatacccaat gggaggagta gagggatact gtcagaagtt atggactatt 11340 agcacaatac cttatctgta tttggcagca catgaaagcg gtgtcagaat tgcatcactt 11400 gttcaaggtg ataaccaaac cattgctgtc actaaaagag ttccaagcac ctggtcatat 11460 gccttgaaga agtctgaagc cagtcgagtc accacagaat actttatagc cttaagacag 11520 agactacatg atgtcggaca tcatttgaaa gcaaatgaaa caataatatc ttcccacttt 11580 tttgtatact caaaaggaat ctattatgat gggatgttaa tttcgcaatc cttgaaaagt 11640 atagctaggt gcgtattttg gtcagaaacg atagtggatg agacccgagc cgcctgtagc 11700 aacatttcaa caacattggc aaaagccatt gagaaagggt ttgaccggta cttagcctat 11760 gcgctgaata ttttaaaaat cattcaacaa gtattaattt cattaggatt cactatcaat 11820 tcagccatga cgcgggatgt gatagaaccc cttttacaag atcactgtct cttgactaag 11880 atggcaattc ttcctgcacc cataggtggt cttaattacc ttaatatgag taggcttttt 11940 gtcaggaaca tcggggatcc cgtgacatct tctattgctg acctcaaacg aatgatccga 12000 tcaggccttc tcggagtaga gattttacat caagtcatga cccaataccc aggtgactct 12060 tcgtacttag attgggcaag tgacccttat tctgctaatc tgccctgtgt ccagagcata 12120 acccggctcc ttaaaaatat tacggccagg catgtcctta tcaacagtcc aaatcccatg 12180 ctgaaaggat tgttccatga tgagagtcag gatgaggatg aagctttagc tgctttcttg 12240 atggatagga aaattattat cccaagagct gcacatgaaa ttctagataa cacgatcact 12300 ggtgcgaggg aggcaattgc tggaatgcta gataccacaa aggggttgat aagagcaagc 12360 atgaaaagag gagggctaac ccctaggata ataaaccgtc tatcaactta tgattatgag 12420 caattcaggg caggtatcag actattgtca gggaagggac atgacccgct catcgatcaa 12480 gactcatgct ctgtccagtt agcgagagca ttaaggaatc acatgtgggc taagttggcg 12540 aagggtcgtc ctatttatgg tctagaagtc ccggatatcc ttgaatcgat gaagggccat 12600 atgataagaa gacatgagtc ctgtttgctt tgcgcatcag gctctcataa ctatggttgg 12660 ttttttgtac cggcaaattg ccaattagat agtattacag agggaacatc tgcactgagg 12720 gtaccataca ttgggtctac aacagaagaa agaacagaca tgaaattagc attcgtcaaa 12780 tctcctagta ggtctctaaa atcagcagtg agaatagcaa ctgtgtactc atgggcctat 12840 ggtgatgatg acgaatcttg gcaagaggct tggactttag caaaacagag agcgaacatc 12900 tcacttgaag aattacggat gattacccca atttctacct ccactaatct agctcaccga 12960 ctcagggaca agagtactca agtcaaatac tcagggacct ctcttatcag agtagcacgt 13020 tatgcaacaa tctcgaatga taatctttct tttgtgatag ctgacaagaa agtggacacg 13080 aactttattt atcagcaagg tatgctcctg gggctgggga ttctcgagca cttgtttaga 13140 ctgtcttcaa ccaccggcga caccaacacc gtactgcatt tacatgttga aacagattgt 13200 tgcgtaatac ccatgagcga ccatccaagg gtcccagggg tcagaaaggt cgttatacca 13260 agaaatattt gtacaaatcc tttgatctat gacagtaacc ctattattga gaaagatgca 13320 gtcaggcttt ataaccagag tcacaggaag cacattgtag agtttgccac atggacaacg 13380 gggcagcttt atcatgtact agctaaatct actgccatgt ctatggttga gatgattaca 13440 aagtttgaaa aagaccacct aaatgaagtc tccgcgttaa ttggcgatga cgatatcaat 13500 agctttatca ctgagtttct tctcgttgag cccaggttat ttactgtgta tctaggtcaa 13560 tgtgctgcaa tcaactgggg ctttgaaatt cattatcacc gaccttctgg gaagtatcaa 13620 atgggtgaat tgttgttttc tttcttgagt agaatgagta aaggagtctt caaaatttta 13680 accaatgcat tgagtcatcc caaagtatat agacgatttt gggacagtgg gatgattgaa 13740 cctgttcacg gaccctctct tgactcccag aacctacaca taactgtatg caacctgatc 13800 tataactgtt acatgattta cctagacctt ctgttaaatg atgaggtaga tgatttctca 13860 ttcattttat gcgaaagtga tgaggatgtc atacctgaaa gatttgataa catacaagct 13920 aggcacctat gcatcctgtc tgacctttat tgtaaccctc gtgattgtcc ccagattcgt 13980 gggttgacac caacacagaa atgtgctgtg ttatcgaggt acttaaaatc acaagctctc 14040 gagtcccatg ttggtctgac atggaatgac aaacctatcc tgatagatca gtattcatgt 14100 tccctgacat atctaagaag aggctcaatc aagcagataa gattgagagt ggaccccggg 14160 ttcatcactg atgctgttgg atgcttagaa aagcgacctc tgaggaaaag tcctatctct 14220 aaagcctcag aattaaaatc agaatttgac ccacctaaag atgacctggt caaactcctg 14280 agtcagctat caacaaggac acataactta cctattacag gattgggagt ccgaaactat 14340 gaggttcact cattcagaag aattgggatc aactcaacgg catgttacaa ggcagttgaa 14400 atagtctctg ttattaagaa cgaattcacg tctgaagaac atggattatt cctaggagag 14460 ggttcaggtg caatgctgac agtatataaa gagctactga ggttgtcaag atgttattat 14520 aacagtggtg tgtcggcaga gtctagaact ggacaacgag agatttcacc ttacccttct 14580 gaggtcagcc ttgtggaaca tcaattagga ctcgataaat tggtgactgt gcttttcaat 14640 gggagaccag aggtaacttg ggttgggagt gttgattgtt acaagtacat actaagtcag 14700 atatctgcta gcagtcttgg attgattcac tcggatatcg agtcactacc tgataaggac 14760 ataattgaaa aattggaaga actgtccgcc atattatcga tgactttgat attagggaag 14820 gtagggtcag tgttagtaat caagatcatg cccgctagtg gcgactgggt tcaaggattt 14880 attctgtatg cactcccaca ttttcttaga agttacataa tttacccaag atatagcaat 14940 tttgtgtcaa cagaggccta cctcgttttt actggtctta gagcagggag actagtcaat 15000 ccggaaggga ttaaacaaca gattttgcga gtcggtattc gaacttcacc cggtttggta 15060 gggcacatcc tttcatcaaa gcagacagca tgtgtgcaat ctttgcatgg acctccattt 15120 caagctaaat cttttaatcc ttacctccag ggtttaacaa gtattgagaa gattttgatt 15180 aattgtgggc ttacaattaa cggtcttaaa gtatgcaaaa acctgcttca ccatgatatc 15240 tcgtcaggcg aggaagggct gaaaggatct atcacaatcc tttacaggga actcgcacgg 15300 ttcaaggata accaccaatt ttcacatgga atgttccatg catacccagt tttaatcgca 15360 agtcaggaaa gggagctcgt atccatcatt gcaaggaagt attgtggtta tattttgctt 15420 tactcgggag acttatacga aattaccaag atagttcgag acctgaaagc caaccacata 15480 atttttgact tacaccgtaa tttatttatg aataacctat ccagatctga ccggtctcta 15540 atcctgacga caatcccaaa aaggaattgg ctctttcaac ttgagacaaa agaaataaaa 15600 gagtggttca aattgttggg gtatagtgca ctgattagaa atcactgacg agttgatctg 15660 gctcctgacc ctctgccatt cattgttatt aaatttaatt atacgaaaaa aaacaacgat 15720 tattaataag ttatcatacc cagctttgtc tggtgggtcg gcatggcatc tccacctcct 15780 cgcggtccga cctgggcatc cgaaggagga cgcacgtcca ctcggatggc taagggaggg 15840 CBECgECCgC 15850 <210> 2

<211> 22

<212> DNA

<213> ArtificiAl Sequence

<220>

<223> Forward primer 1 for PCR of pCI-CDV-SD16F

<400> 2 tacggcaaat gtcgacatta ac 22 <210> 3

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer 1 for PCR of pCI-CDV-SD16F

<400> 3 tctccacaaa actgactgag gtgtac 26 <210> 4

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward primer 2 for PCR of pCI-CDV-SD16F

<400> 4 ctcagtcagt tttgtggaga ggac 24 <210> 5

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer 2 for PCR of pCI-CDV-SD16F

<400> 5 tccaatcggg ggtccgcggc tat 23 <210> 6

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward primer SD16F-M-F

<400> 6 ccgctcgagg ccaccatgac tgaggtgtac gacttcg 37 <210> 7

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer SD16F-M-F

<400> 7 ataagaatgc ggccgcttag agaattttga aaagaccctg 40

Claims (7)

CONCLUSIONS A method of constructing a replication deficient strain of an epidemic strain of distemper virus (CDV), the method comprising the steps of: step 1, inserting a full-length cDNA sequence from a CDV genome that does not contain expresses matrix (M) protein in a transcription plasmid to obtain a recombinant plasmid; step 2, constructing helper plasmids, wherein the helper plasmids are capable of expressing nucleoprotein (NP), phosphoprotein (BP) and large polymerase protein (L) of the CDV; step 3, constructing a cell line expressing the CDV M protein, wherein the cell line is a Vero-SLAM-M cell line; and step 4, co-transfecting cells expressing the CDV M protein with the recombinant plasmid and helper plasmids, and rescuing a recombinant replication deficient strain of the CDV epidemic strain from a transfection cell suspension. The method of claim 1, wherein the unexpressed M protein in step 1 is subjected to site-directed mutation of a base at an initiation codon of an M gene, and adenine (A) is mutated to cytosine (C) . A product for preparing a replication deficient strain of CDV, wherein the product comprises: 1) a transcription plasmid, wherein the transcription plasmid is a recombinant plasmid inserted with a full-length cDNA sequence of a CDV genome containing does not express M protein; 2) one or more helper plasmids, wherein the one or more helper plasmids are capable of expressing CDV nucleoprotein, phosphoprotein and large polymerase protein; and 3) a host cell line, wherein the cell line is capable of expressing the M- stable expression of the CDV protein. A replication-deficient strain of a CDV epidemic strain, wherein the replication-deficient strain has been prepared by the method of claim 1. Use of the replication deficient strain according to claim 4 in the preparation of a vaccine for the prevention of canine distemper. A vaccine, wherein an antigen used in the vaccine comprises the replication deficient strain of claim 4. 7. A cell line, wherein the cell line is a Vero-SLAM-M cell line stably expressing distemper M protein.