NL2030094B1 - Snp molecular marker applicable to gender identification of silver arowana and application thereof - Google Patents

Snp molecular marker applicable to gender identification of silver arowana and application thereof Download PDF

Info

Publication number
NL2030094B1
NL2030094B1 NL2030094A NL2030094A NL2030094B1 NL 2030094 B1 NL2030094 B1 NL 2030094B1 NL 2030094 A NL2030094 A NL 2030094A NL 2030094 A NL2030094 A NL 2030094A NL 2030094 B1 NL2030094 B1 NL 2030094B1
Authority
NL
Netherlands
Prior art keywords
forkbeard
primer
snp
gender
sex
Prior art date
Application number
NL2030094A
Other languages
Dutch (nl)
Inventor
Liu Chao
Wang Xuejie
Yang Yexin
Liu Yi
Mu Xidong
Xu Meng
Fang Miao
Original Assignee
Pearl River Fisheries Res Institute Chinese Academy Of Fishery Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pearl River Fisheries Res Institute Chinese Academy Of Fishery Sciences filed Critical Pearl River Fisheries Res Institute Chinese Academy Of Fishery Sciences
Priority to NL2030094A priority Critical patent/NL2030094B1/en
Application granted granted Critical
Publication of NL2030094B1 publication Critical patent/NL2030094B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed is an SNP molecular marker applicable to gender identification of silver arowana 5 and an application thereof. A base sequence is shown as SEQ ID No.1; and the SNP molecular marker is located at the 85th locus in the SEQ ID No.1. Through high-throughput genome sequencing contrast, single nucleotide polymorphism (SNP) loci that have differences among male and female individuals of silver arowana and can characterize male and female genders are obtained; and in combination with primer amplification, an amplification sequence containing the 10 SNP loci is obtained. On the basis, PCR amplification and sequencing of to-be-tested samples are realized by primers; and SNP locus information of the samples is obtained, thereby identifying the gender of the to-be-tested samples. By utilizing the SNP loci in the present invention, accurate and rapid gender identification can be realized without dissecting the silver arowana. Moreover, when the SNP loci are applied to silver arowana farming, a mature artificial silver arowana farming technology is convenient to be realized, thereby achieving mass production.

Description

SNP MOLECULAR MARKER APPLICABLE TO GENDER IDENTIFICATION OF SILVER
AROWANA AND APPLICATION THEREOF Technical Field The present invention relates to the technical field of gender identification of fishes, and particularly relates to an SNP molecular marker applicable to gender identification of silver arowana and an application thereof.
Background Silver arowana, also called Osteoglossum bicirrhosum, is an ancient “living fossil” fish, and has very important economic value while serving as a rare ornamental fish species. At present, the vast majority of domestic silver arowana is imported. Large-scale local farming of the silver arowana is difficult to be realized. Since the current silver arowana reproductive technology is limited, the large-scale artificial farming is difficult to be realized. A primary cause that limits the reproductive technology is the difficulty in male and female gender differentiation of the silver arowana.
The silver arowana has no bisexual specific characteristics; and thus, the silver arowana cannot be differentiated from external morphology, and even if in a breeding season, characteristics of male and female silver arowana are not obvious. Moreover, since the silver arowana has hard and thick scales, the gender cannot be determined through the scales by B- mode ultrasound or CT. At present, the gender can only be identified by dissecting and observing sexual glands; and a simple and accurate method for identifying the gender without dissection cannot be realized. Just because there is no means of accurately determining the gender, great trouble is brought to artificial farming of the silver arowana. Since the gender is difficult to be differentiated, only a semi-natural method can be used for reproduction in most of the farms, while efficient controllable artificial reproduction manners cannot be adopted, such as temporary culture of male and female fishes in different ponds and injection of aphrodisiacs or odinagogues, thereby greatly limiting the reproductive efficiency and success rate. To break the situation that the silver arowana is totally imported in China, the artificial reproduction of the silver arowana becomes a problem that urgently needs to be solved.
Therefore, an effective silver arowana gender identification method or marker is urgently needed for differentiating the male and female genders of the arowana gender, so as to solve the above problem.
Summary A purpose of the present invention is to provide an SNP molecular marker applicable to gender identification of silver arowana and an application thereof, for overcoming at least one deficiency in the prior art. Through SNP loci in the present invention, accurate and rapid gender identification can be realized without dissecting the silver arowana, so as not to affect normal growth and reproduction of the silver arowana. When the SNP loci are applied to silver arowana farming, the gender identification is conveniently provided for promoting maturity and development of the farming technology, thereby increasing reproductive efficiency and a success rate.
The present invention provides an SNP molecular marker used for gender identification of silver arowana. A base sequence of the SNP molecular marker is shown as SEQ ID NO.1 and is 299 bp long; and the SNP molecular marker is located at the 85" locus in the SEQ ID NO.1.
Further, when the 85!" base is a G/G homozygote, a sample is male; and when the 85" base is an A/G heterozygote, the sample is female.
The present invention further provides a primer pair used for gender identification or assistant gender identification of silver arowana. The primer pair includes a forward primer F and a reverse primer R; a nucleotide sequence of the forward primer F is shown as SEQ ID NO.2; and a nucleotide sequence of the reverse primer R is shown as SEQ ID NO.3.
The present invention further provides a kit used for gender identification or assistant gender identification of silver arowana. The kit includes the above primer pair, dNTP and DNA polymerase.
The present invention further provides a silver arowana gender identification method. The method includes the following steps: (1) extracting genome DNA of to-be-tested silver arowana; (2) taking the genome DNA of to-be-tested silver arowana as a template; and carrying out a PCR amplification reaction by utilizing the forward primer F and the reverse primer R of claim 3; (3) conducting analysis after the reaction is ended; determining a sample genotype; and identifying the gender.
The method is simple, rapid and high in accuracy rate.
Further, in the step (2), a reaction system used in the PCR amplification reaction has a total volume of 40 pl, and includes 20 pl of 2*Taq MasterMix(Dye), 1.6 pl of Primer F, 1.6 pl of Primer R, 15.8 pl of ddH2O and 1 pl of genome DNA.
Further, in the step (2), during the PCR amplification reaction, PCR amplification procedures are as follows: the temperature is maintained at 94°C or 2 min; then 35 cycles are conducted, including the temperature of 94°C for 30 s, a temperature of 58°C for 30 s and a temperature of 72°C for 20 s; and the temperature is maintained at 72°C for 5 min.
Further, in the step (3), the analysis is conducted in combination with Sanger sequencing; the sample genotype is determined; and the gender is identified.
The present invention further provides an application of the above SNP molecular marker applicable to gender identification of silver arowana, the primer pair, the kit and/or the method in the gender identification of silver arowana and/or silver arowana farming.
Compared with the prior art, the present invention has beneficial effects as follows: through high-throughput genome sequencing contrast, single nucleotide polymorphism (SNP) loci that have differences among male and female individuals of the silver arowana and can characterize male and female genders are obtained; and in combination with primer amplification, an amplification sequence containing the SNP loci is obtained.
On the basis, PCR amplification of to-be-tested samples is realized by primers; and SNP locus information of the samples is obtained, thereby identifying the gender of the to-be-tested samples according to the genotype of the SNP loci.
Moreover, in the present invention, the gender identification can be completed through the PCR amplification and the Sanger sequencing.
Compared with other molecular identification methods that are cumbersome in operation and high in time consumption, the present invention is more applicable to rapid identification of large-scale samples.
More importantly, the gender of the silver arowana can be simply, accurately and rapidly identified according to the SNP loci in the present invention.
Further, the silver arowana does not need to be dissected; health conditions of the tested samples are basically not affected; the application to the silver arowana farming technology is conveniently realized; gender matching of the silver arowana is realized; the reproductive efficiency, the reproductive success rate and the number of offspring of the silver arowana are greatly increased; and a major industrial problem of silver arowana breeding is solved.
The present invention has important economic value and social value.
Moreover, since the silver arowana is an ancient fish species, the silver arowana has important scientific research significances of researching gender differentiation and gender determination mechanisms and explaining gender evolution and gender determination mechanisms of the whole fish species.
Therefore, in addition to the above beneficial effects, the SNP molecular marker and the corresponding primers, kit and identification method provided in the present invention can further provide the basis for researches on fish evolution and gender determination mechanisms and promote development of the research direction.
Description of Drawings Fig. 1 is a representative diagram of an electrophoretic result of a PCR product of a to-be- tested sample; and Fig. 2 is a representative diagram of Sanger sequencing and a sequencing peak figure of an SNP marker locus (85!" locus), wherein the upper figure is male (a genotype of GG); and the lower figure is male (a genotype of AG). Detailed Description Drawings in the present invention are merely used for illustrative description, and shall not be understood as a limitation to the present invention.
Embodiment 1 In the present embodiment, a high-throughput sequencing strategy is adopted; 5 female silver arowana samples and 5 male silver arowana samples are selected for DNA extraction; according to lllumina library construction process requirements, a double-ended genome DNA library having an insert fragment size of 500 bp is constructed; and then the genome is subjected to high-throughput sequencing by adopting an Illumina NovaSeq sequencing platform. A sequencing amount of each sample is 30 Gb; and the sequencing strategy is Pair-End 150bp. With the adoption of a high-throughput sequencing sequence alignment strategy, single nucleotide polymorphism (SNP) loci of sequenced female samples and SNP loci of the male samples are detected; and SNP loci that are identical among the female samples, are identical among the male samples but different among the male and female samples are screened as gender identification molecular markers. The female samples and the male samples are subjected to specific DNA molecular marker screening according to the high-throughput sequencing. It is discovered that, gene sequences of the samples contain SNP molecular markers for differentiating the gender. On the basis, amplification is conducted in combination with primers according to the high-throughput sequencing so as to obtain a sequence that contains the SNP loci and can be used for PCR and Sanger sequencing to identify the male and female genders of the silver arowana. Specifically, the primers include a forward primer F of which the sequence is shown as SEQ ID NO.2 and a reverse primer R of which the sequence is shown as SEQ ID NO.3; and the obtained sequence that contains the SNP loci is shown as SEQ ID NO.1. Moreover, the SNP molecular marker is located at the 85" locus in the SEQ ID NO. 1. Specifically, the sequence is shown as follows: GCTGTGGGCATCGAGTCAGtcctttgttgaggcttgtgeggtgcaggcctcttcaggtgtggctatgatgcgtgatgg gatctc[G/A]ctcacttgtgttcctgtggttgtcaccatcatgaccccaaatgaccttcagggagcaggttgcacctgagccactcttgcg agctgcgcagctcaatctgtttgcagtttaagggcagggccgcaaccaaacagcgggggtgggagagaaagagaaagaaaaag agagacgtctctcctggtgaaaatgaatatSTCCCATTGCTGTCCGCCTT. For convenience of representation, a specific locus is highlighted with a capital letter; and in the above sequence, the capital letters are the primer sequence or the SNP loci. Primer information is as shown in the following table:
PCR Primer Primer Amplified Primer length annealing type (bp) e (°C)
EE primer [| CE [a | / AAGGCGGACAGCAATGGGAC 20 primer
Further, in the above sequence containing the SNP loci, a corresponding relation between the SNP loci and the male and female genders is as shown in the following table: genotype Thus, the SNP molecular marker can be used for differentiating the male and female genders 5 of the silver arowana. Embodiment 2 To verify accuracy of the SNP loci in gender identification of the silver arowana, the SNP molecular marker in embodiment 1 is verified in the present embodiment. Whether the molecular marker for silver arowana detection is accurate is verified by PCR and Sanger sequencing methods. Specifically, genome DNA is extracted from non-high-throughput sequencing samples; specificity of primers is verified in PCR and Sanger sequencing manners; the primers are mutually contrasted with physiological genders of the silver arowana samples; and whether the SNP molecular marker and the primers in embodiment 1 can be used for gender identification of the silver arowana is confirmed.
1. Sample preparation 60 parts of silver arowana samples were selected and included 30 parts of female samples and 30 parts of male samples; the samples were verified; and sample information was shown in the following table: Experimental verification samples name (dissection) 6 [R[F | Ramee | 9 | F6 [Remake | Rams | 9 [OR [Remake | Panman |
14 F14 Female Random sample eer eee ee eee ee ee LEN. | Peon | CS We [wee | demen CSW [Wee | ademen
A A LL EW ee eee
I A LL EW ee | Re ee LL Ewe ee | Ewe ee | Re ere Re ee LL Ewe ee | Ewe ee | Re ere LL ee LL Ew ee | Re Ewe ee | Re Ew Ee Re eee
54 M24 Male Random sample EE | Reese | © | wm [wee | Rawse | F7 wer [wee | Rams | | ME [wee | Rams | CE | we [wee | Ramee | I | MG [Mee LC
2. Genome DNA extraction The genome DNA was extracted by a universal columnar genome DNA extraction kit; the DNA extraction kit was purchased from Beijing CW Biotechnology Co., Ltd. and had an item number of CW2298M; and the extraction process was conducted by referring to the instruction of the kit.
3. PCR amplification 1) Reagent consumption materials DNA polymerase: 2*Taq MasterMix(Dye) (purchased from Beijing CW Biotechnology Co., Ltd. having an item number of CW0682L); genome DNA of the to-be-tested samples extracted in the step 2; Primer: including Primer F and Primer R, wherein the Primer F and Primer R respectively had nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.3 and were synthesized by Beijing Genomics Institute; and ddH20. 2) PCR reaction system (as shown in the following table) Reagent ~~ Dose(u) ~~ 2*TaqMasterMix(Dye) 20 PrimerF 1.6 PrimerR 1.6 ddH:20 15.8 Genome DNA 1 Tota a0 3) PCR reaction conditions (as shown in the following table) Temperature °C) Time (min) - e%4 o0200 94 00:30 58 00:30 | x35 cycles 72 00:20 72 05:00
4. Agarose gel map Whether PCR amplification was successful was detected; and agarose gel electrophoresis was conducted. Specifically, conditions were as follows: a gel concentration of 1%; a voltage of
180V; time of 20 min; Marker: M was DM2000, purchased from Beijing CW Biotechnology Co., Ltd., having an item number of CW0832M. An electrophoretic result of the PCR product was shown as Fig. 1.
5. Sanger sequencing identification result Sanger sequencing analysis was conducted after the PCR amplification. The results were shown as the following table. The male and female gender information reflected according to the SNP loci was consistent with gender information confirmed by physiological dissection, i.e., accurate male and female gender identification of the silver arowana can be realized through the above primers F and R and the sequence containing the SNP loci. Further, compared with the traditional male and female identification, biological dissection is not needed. Result contrast of sample sequencing genotype gender determination and dissectional genotype gender determination Gender Female AG/male GG Gender Sample No. om | we | ee we oe | wee | wwe we [we |e we we [we |e we we | we | we ow [we | we we | wee | ee we [we |e wae we | me |e we we [we | we
M14 Male GG Male (ww [we [wwe (ww [we [ww (wr [we [ww (ww [we [ww (ww [we [wwe [ww [we [ww (ww [ww (ww [we [ww [ww [we [wwe (ww [ww (ww [ww |e (ww [ww (ww [we [ww [ww [ww (ww [we [ww (ww [ww
F5 Female AG Female
F26 Female AG Female Embodiment 3 The present embodiment provides a silver arowana gender identification method. The method includes the following steps: (1) Genome DNA of to-be-tested silver arowana was extracted.
(2) The genome DNA of the to-be-tested silver arowana was taken as a template; and a PCR amplification reaction was carried out by utilizing the forward primer F and the reverse primer R of which sequences were respectively shown as SEQ ID NO.2 and SEQ ID NO.3.
(3) Analysis was conducted in combination with Sanger sequencing after the reaction was ended; a sample genotype was determined; and the gender was identified according to the 85" loci in the SEQ ID NO. 1.
Specifically, in the step (2), the reaction system and amplification procedures adopted during the PCR amplification reaction were the same as those in embodiment 2. Embodiment 4 The present embodiment provides an application of the SNP molecular marker having the sequence shown as SEQ ID NO.1, the forward primer F and the reverse primer R of which sequences are respectively shown as SEQ ID NO.2 and SEQ ID NO.3, the kit including the primers F and R and/or the identification method in embodiment 3 in silver arowana gender identification and/or silver arowana farming.
Apparently, the above embodiments of the present invention are merely for clearly describing examples in technical solutions of the present invention, rather than limiting specific implementation modes of the present invention. Any modifications, equivalent replacements and improvements made within the spirit and principles of claims in the present invention shall be included in the protection scope of the claims of the present invention.
SEQUENCE LISTING <110> Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences <120> SNP MOLECULAR MARKER APPLICABLE TO GENDER IDENTIFICATION OF
SILVER AROWANA AND APPLICATION THEREOF <130> SNP Marker NL <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 299 <212> DNA <213> Osteoglossum bicirrhosum <400> 1 gctgtgggca tcgagtcagt cctttgttga ggcttgtgcg gtgcaggcct cttcaggtgt 60 ggctatgatg cgtgatggga tctcgctcac ttgtgttcct gtggttgtca ccatcatgac 120 cccaaatgac cttcagggag caggttgcac ctgagccact cttgcgagct gcgcagctca 180 atctgtttgc agtttaaggg cagggccgca accaaacagc gggggtggga gagaaagaga 240 aagaaaaaga gagacgtctc tcctggtgaa aatgaatatg tcccattgct gtcegcctt 299 <210> 2 <211> 19 <212> DNA <213> artificial <220> <223> Primer sequence <400> 2 gctgtgggca tcgagtcag 19 <210> 3 <211> 20 <212> DNA <213> Unknown <220> <223> Primer sequence <400> 3 aaggcggaca gcaatgggac 20

Claims (9)

CONCLUSIESCONCLUSIONS 1. Een moleculaire SNP merker voor het bepalen van het geslacht van de vorkbaardvis, met een basensequentie weergegeven als SEQ ID NO.1 met een lengte van 299 bp, waarbij de moleculaire SNP merker is gelegen op positie 85 in SEQ ID NO.1.A molecular SNP marker for determining the sex of the forkbeard fish having a base sequence shown as SEQ ID NO.1 of 299 bp in length, wherein the molecular SNP marker is located at position 85 in SEQ ID NO.1. 2. De moleculaire SNP merker voor het bepalen van het geslacht van de vorkbaardvis volgens conclusie 1, waarbij wanneer de 85ste base een G/G homozygoot is, het monster mannelijk is en wanneer de 85ste base een A/G heterozygoot is, het monster vrouwelijk is.The molecular SNP marker for determining the sex of the forkbeardfish according to claim 1, wherein when the 85th base is a G/G homozygous, the sample is male and when the 85th base is an A/G heterozygous, the sample is female is. 3. Een primerpaar voor toepassing voor het bepalen van het geslacht van de vorkbaardvis of voor het ondersteunen daarvan, omvattende een voorwaartse primer F en een achterwaartse primer R, waarbij de nucleotidevolgorde van de voorwaartse primer F wordt weergegeven als SEQ ID NO.2; en de nucleotidevolgorde van de achterwaartse primer R wordt weergegeven als SEQ ID NO.3.A pair of primers for use in determining or aiding the sex of the forkbeard fish, comprising a forward primer F and a reverse primer R, wherein the nucleotide sequence of the forward primer F is shown as SEQ ID NO.2; and the nucleotide sequence of the reverse primer R is shown as SEQ ID NO.3. 4. Een set voor toepassing voor het bepalen van het geslacht van de vorkbaardvis of voor het ondersteunen daarvan, omvattende het primerpaar volgens conclusie 3, dNTP en DNA- polymerase.A kit for use in determining or supporting the sex of the forkbeardfish comprising the primer pair of claim 3, dNTP and DNA polymerase. 5. Een werkwijze voor het bepalen van het geslacht van de vorkbaardvis, welke werkwijze de volgende stappen omvat: (1) het extraheren van genomisch DNA van te testen vorkbaardvis; (2) het nemen van het genomisch DNA van de te testen vorkbaardvis als een matrijs; en het uitvoeren van een PCR vermeerderingsreactie door gebruik te maken van de voorwaartse primer F en de achterwaartse primer R van claim 3; (3) het uitvoeren van een analyse nadat de reactie is beëindigd; het bepalen van het monstergenotype; en het identificeren van het geslacht.A method for determining the sex of the forkbeard fish, the method comprising the steps of: (1) extracting genomic DNA from forkbeard fish to be tested; (2) taking the genomic DNA of the forkbeard fish to be tested as a template; and performing a PCR amplification reaction using the forward primer F and the reverse primer R of claim 3; (3) performing an analysis after the reaction has ended; determining the sample genotype; and identifying the sex. 6. De werkwijze voor het bepalen van het geslacht van de vorkbaardvis volgens conclusie 5, waarbij in stap (2) het reactiesysteem dat in de PCR vermeerderingsreactie wordt toegepast een totaal volume heeft van 40 ul, en 20 ul van 2*Taq MasterMix{Dye), 1,6 HI Primer F, 1,6 Hi Primer R, 15,8 pl ddH20 en 1 pl genoom-DNA omvat.The method for determining the sex of the forkbeard fish according to claim 5, wherein in step (2), the reaction system used in the PCR amplification reaction has a total volume of 40 µl, and 20 µl of 2*Taq MasterMix{Dye ), 1.6 HI Primer F, 1.6 Hi Primer R, 15.8 µl ddH20 and 1 µl genomic DNA. 7. De werkwijze voor het bepalen van het geslacht van de vorkbaardvis volgens conclusie 5, waarbij in stap (2) tijdens de PCR vermeerderingsreactie de PCR vermeerderingsprocedures als volgt zijn: de temperatuur wordt gehandhaafd op 94°C gedurende 2 min; vervolgens worden 35 cycli uitgevoerd, omvattende een temperatuur van 94°C gedurende 30 s, een temperatuur van 58°C gedurende 30 s en een temperatuur van 72°C gedurende 20 s; en het handhaven van de temperatuur op 72°C gedurende 5 min.The method for determining the sex of the forkbeard fish according to claim 5, wherein in step (2) during the PCR amplification reaction, the PCR amplification procedures are as follows: the temperature is maintained at 94°C for 2 minutes; then 35 cycles are performed, comprising a temperature of 94°C for 30 s, a temperature of 58°C for 30 s and a temperature of 72°C for 20 s; and maintaining the temperature at 72°C for 5 min. 8. De werkwijze voor het bepalen van het geslacht van de vorkbaardvis volgens conclusie 5, waarbij in stap (3) de analyse wordt uitgevoerd in combinatie met een sequentiebepaling volgens Sanger; het monster genotype wordt bepaald; en het geslacht wordt geidentificeerd.The method for determining the sex of the forkbeard fish according to claim 5, wherein in step (3) the analysis is performed in combination with a sequencing according to Sanger; the sample genotype is determined; and the gender is identified. 9. Een toepassing van de moleculaire SNP marker voor het identificeren van het geslacht van de vorkbaardvis volgens conclusie 1 of 2, het primer paar volgens conclusie 3, de set volgens conclusie 4 en/of de werkwijze volgens willekeurig welke van conclusies 5 - 8 voor het identificeren van het geslacht van de vorkbaardvis geslachtsidentificatie of voor het kweken van de vorkbaardvis.A use of the molecular SNP marker for identifying the genus of the forkbeardfish according to claim 1 or 2, the primer pair according to claim 3, the set according to claim 4 and/or the method according to any one of claims 5 - 8 for identifying the genus of the forkbeard gender identification or for breeding the forkbeard.
NL2030094A 2021-12-10 2021-12-10 Snp molecular marker applicable to gender identification of silver arowana and application thereof NL2030094B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NL2030094A NL2030094B1 (en) 2021-12-10 2021-12-10 Snp molecular marker applicable to gender identification of silver arowana and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
NL2030094A NL2030094B1 (en) 2021-12-10 2021-12-10 Snp molecular marker applicable to gender identification of silver arowana and application thereof

Publications (1)

Publication Number Publication Date
NL2030094B1 true NL2030094B1 (en) 2022-12-30

Family

ID=81928007

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2030094A NL2030094B1 (en) 2021-12-10 2021-12-10 Snp molecular marker applicable to gender identification of silver arowana and application thereof

Country Status (1)

Country Link
NL (1) NL2030094B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014129982A1 (en) * 2013-02-19 2014-08-28 Agricultural Research Development Agency (Public Organization) A method of determining the sex of indonesian red arowanas
WO2022134451A1 (en) * 2020-12-25 2022-06-30 中国水产科学研究院珠江水产研究所 Snp molecular marker for identification of sex of osteoglossum bicirrhosum, and use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014129982A1 (en) * 2013-02-19 2014-08-28 Agricultural Research Development Agency (Public Organization) A method of determining the sex of indonesian red arowanas
WO2022134451A1 (en) * 2020-12-25 2022-06-30 中国水产科学研究院珠江水产研究所 Snp molecular marker for identification of sex of osteoglossum bicirrhosum, and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
UE GHY ET AL: "A strain-specific and a sex-associated STS marker for Asian arowana (Scleropages formosus, Osteoglossidae)", 12 September 2003 (2003-09-12), pages 951 - 957, XP055976461, Retrieved from the Internet <URL:https://onlinelibrary.wiley.com/doi/full/10.1046/j.1365-2109.2003.00949.x> [retrieved on 20221031] *

Similar Documents

Publication Publication Date Title
Bonin et al. Explorative genome scan to detect candidate loci for adaptation along a gradient of altitude in the common frog (Rana temporaria)
US9309570B2 (en) Method and device for genetic map construction, method and device for haplotype analysis
CN108504749B (en) 29 micro haplotype sites, screening method, composite amplification system and application
WO2022134451A1 (en) Snp molecular marker for identification of sex of osteoglossum bicirrhosum, and use thereof
CN102337345B (en) Medicolegal composite assay kit based on twenty triallelic SNP (single nucleotide polymorphism) genetic markers
Wilton DNA methods of assessing dingo purity
KR101716314B1 (en) A method for discriminating of shank color of korean native chicken
CN105385763B (en) The kit of fluorescence labeling composite amplification that is a kind of while analyzing 24 locus of human gene group DNA and its application
JP7007710B2 (en) Bluefin tuna hereditary sex marker and hereditary sex discrimination method
CN105441536A (en) SNP markers for discriminating the sex in the olive flounder
CN107988385B (en) Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof
Liehr Cytogenomics
CN107475414B (en) Method for screening parent oysters with high glycogen content
NL2030094B1 (en) Snp molecular marker applicable to gender identification of silver arowana and application thereof
CN105671170B (en) It is a kind of for identify chicken crawl character primer combination and its application
Janes et al. Sex chromosome evolution in amniotes: applications for bacterial artificial chromosome libraries
CN114686594B (en) SNP molecular marker suitable for sex identification of silver dragon fish and application thereof
CN114686595B (en) SNP molecular marker for sex identification of silver dragon fish and application thereof
CN114686596B (en) SNP molecular marker for sex identification of silver dragon fish and application thereof
CN106434642B (en) Primer and molecular biological method for identifying coilia ectenes and coilia brachypomus
CN106244713B (en) Method for detecting five-toe characters of Beijing fatty chicken and application thereof
CN111979333B (en) Rapid visual detection method for sheep multiple-fetus major gene FecB
ES2257139B1 (en) METHOD AND KIT FOR GENOTIPIFICATION OF HLA-DRB BASED ON REAL-TIME PCR.
Yang et al. A new strategy for the discrimination of mitochondrial DNA haplogroups in Han population
KR100901817B1 (en) A primer sets for constructing traceability in hanwoo and method of selecting hanwoo by using the said primer set same