NL2025851A - Method for identifying species of aedes based on pcr-ms - Google Patents
Method for identifying species of aedes based on pcr-ms Download PDFInfo
- Publication number
- NL2025851A NL2025851A NL2025851A NL2025851A NL2025851A NL 2025851 A NL2025851 A NL 2025851A NL 2025851 A NL2025851 A NL 2025851A NL 2025851 A NL2025851 A NL 2025851A NL 2025851 A NL2025851 A NL 2025851A
- Authority
- NL
- Netherlands
- Prior art keywords
- alla
- aedes
- coi5p
- calls
- annandalei
- Prior art date
Links
- 241000256111 Aedes <genus> Species 0.000 title claims abstract description 150
- 241000894007 species Species 0.000 title claims abstract description 43
- 238000000034 method Methods 0.000 title claims abstract description 27
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 22
- 238000004458 analytical method Methods 0.000 claims abstract description 17
- 238000007403 mPCR Methods 0.000 claims description 60
- 239000011347 resin Substances 0.000 claims description 35
- 229920005989 resin Polymers 0.000 claims description 35
- 108010000178 IGF-I-IGFBP-3 complex Proteins 0.000 claims description 33
- 239000000203 mixture Substances 0.000 claims description 27
- 239000003153 chemical reaction reagent Substances 0.000 claims description 17
- 238000006243 chemical reaction Methods 0.000 claims description 16
- 239000000523 sample Substances 0.000 claims description 13
- 229910001868 water Inorganic materials 0.000 claims description 11
- 239000011541 reaction mixture Substances 0.000 claims description 10
- 238000007789 sealing Methods 0.000 claims description 10
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 9
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 6
- 239000012807 PCR reagent Substances 0.000 claims description 6
- 238000000746 purification Methods 0.000 claims description 6
- 238000003892 spreading Methods 0.000 claims description 6
- 238000005119 centrifugation Methods 0.000 claims description 4
- 238000004128 high performance liquid chromatography Methods 0.000 claims description 4
- 238000002844 melting Methods 0.000 claims description 4
- 230000008018 melting Effects 0.000 claims description 4
- 238000002156 mixing Methods 0.000 claims description 4
- 108010062466 Enzyme Precursors Proteins 0.000 claims description 3
- 102000010911 Enzyme Precursors Human genes 0.000 claims description 3
- 108090000790 Enzymes Proteins 0.000 claims description 3
- 102000004190 Enzymes Human genes 0.000 claims description 3
- 238000003491 array Methods 0.000 claims description 3
- 238000003556 assay Methods 0.000 claims description 3
- 238000004140 cleaning Methods 0.000 claims description 3
- 238000007621 cluster analysis Methods 0.000 claims description 3
- 238000013507 mapping Methods 0.000 claims description 3
- 239000002773 nucleotide Substances 0.000 claims description 3
- 125000003729 nucleotide group Chemical group 0.000 claims description 3
- 102000002260 Alkaline Phosphatase Human genes 0.000 claims description 2
- 108020004774 Alkaline Phosphatase Proteins 0.000 claims description 2
- 241000238557 Decapoda Species 0.000 claims description 2
- 108010006785 Taq Polymerase Proteins 0.000 claims description 2
- 238000001035 drying Methods 0.000 claims description 2
- 230000008878 coupling Effects 0.000 claims 1
- 238000010168 coupling process Methods 0.000 claims 1
- 238000005859 coupling reaction Methods 0.000 claims 1
- UTSOXZIZVGUTCF-UHFFFAOYSA-N hydrate;hydroiodide Chemical compound O.I UTSOXZIZVGUTCF-UHFFFAOYSA-N 0.000 claims 1
- 238000003260 vortexing Methods 0.000 claims 1
- 238000001514 detection method Methods 0.000 abstract description 12
- 238000013461 design Methods 0.000 abstract description 6
- 108020004414 DNA Proteins 0.000 description 64
- 241000256173 Aedes albopictus Species 0.000 description 9
- 238000012163 sequencing technique Methods 0.000 description 8
- 241000256118 Aedes aegypti Species 0.000 description 7
- 241000255925 Diptera Species 0.000 description 6
- 238000002360 preparation method Methods 0.000 description 5
- 241000256176 Aedes vexans Species 0.000 description 4
- 241000566309 Ochlerotatus dorsalis Species 0.000 description 3
- 208000011312 Vector Borne disease Diseases 0.000 description 3
- 230000029087 digestion Effects 0.000 description 3
- 230000009977 dual effect Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 244000052769 pathogen Species 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 241000771191 Aedes annandalei Species 0.000 description 1
- 108700028369 Alleles Proteins 0.000 description 1
- 101100329008 Artemia franciscana COI gene Proteins 0.000 description 1
- 101150001086 COB gene Proteins 0.000 description 1
- 102100038710 Capping protein-inhibiting regulator of actin dynamics Human genes 0.000 description 1
- 241000711573 Coronaviridae Species 0.000 description 1
- 238000001712 DNA sequencing Methods 0.000 description 1
- 101000957909 Homo sapiens Capping protein-inhibiting regulator of actin dynamics Proteins 0.000 description 1
- 241001207270 Human enterovirus Species 0.000 description 1
- 241000701806 Human papillomavirus Species 0.000 description 1
- 101150053771 MT-CYB gene Proteins 0.000 description 1
- 102100023171 Nuclear receptor subfamily 1 group D member 2 Human genes 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 108091008770 Rev-ErbAß Proteins 0.000 description 1
- 101000585507 Solanum tuberosum Cytochrome b-c1 complex subunit 7 Proteins 0.000 description 1
- 101710136739 Teichoic acid poly(glycerol phosphate) polymerase Proteins 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 230000008094 contradictory effect Effects 0.000 description 1
- 101150006264 ctb-1 gene Proteins 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 244000000010 microbial pathogen Species 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 101150088166 mt:Cyt-b gene Proteins 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 230000000750 progressive effect Effects 0.000 description 1
- 238000010079 rubber tapping Methods 0.000 description 1
- 238000007790 scraping Methods 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 239000000758 substrate Substances 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 239000013598 vector Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
Disclosed herein is a method for identifying the species of Aedes based on PCR-MS, 5 including: establishing gene databases (COI, COII, 28s and Cth400) for the identification of the species of Aedes; establishing Aedes DNA two-dimensional codes; designing a primer for multiplex PCR-MS; and performing multiplex PCR-MS analysis. SNP sites specific to respective species of Aedes mosquitoes are obtained by analyzing thousands of sequences from nine species of Aedes mosquitoes. Two or more gene-specific SNP sites are selected for each 10 species, and the specific and non-specific sites of other species are used as exclusive references to design an analysis system, in which the species of an Aedes specimen can be determined through the base recognition at multiple sites, improving the identification accuracy for the species of Aedes and effectively avoiding the missing detection.
Description
TECHNICAL FIELD This application relates to genetic engineering, and more particularly to a method for identifying species of Aedes based on PCR-MS.
BACKGROUND Mosquitoes can carry and spread a variety of pathogenic microorganisms, and thus it is of great significance for the prevention and control of mosquito-borne diseases to accurately identify the species of mosquitoes. Aedes mosquitoes, such as Aedes albopictus and Aedes aegypti, are major vectors for the transmission of the mosquito-borne diseases. Aedes albopictus is widely distributed in China, and with the change of environmental conditions and the development of transportation and trade, the distribution range of Aedes aegypti also becomes wider and wider. Therefore, the accurate identification of Aedes mosquitoes, especially Aedes albopictus and Aedes aegypti, is conducive to the prevention and control of mosquito-borne diseases.
Currently, the mosquitoes are generally identified by morphological methods, but these methods still have difficulties in identifying broken specimens and larvae. DNA barcoding is regarded as another effective means for the identification of mosquitoes; however, it is greatly limited due to the laborious operation and high dependence on the DNA sequencing. Given the above, there is an urgent need to develop a novel method for identifying the species of mosquitoes.
PCR-MS technique has significant advantages not only in the sensitivity and detection limit (10 copies/reaction) but also in the dynamic range (=9 orders of magnitude), so it enables the simultaneous detection of dozens of biological targets in the single operation regardless of the load level (from single to hundreds of billion molecules). Moreover, considering the high detection throughout, a dual gene probe is applied to avoid the missing detection. Up to now, the PCR-MS technique has been successfully applied to the dual genotyping of human papillomaviruses and the typing of other pathogens such as coronaviruses and human enteroviruses, and if a typing method for Aedes mosquitoes can be developed, the subsequent simultaneous detection for mosquito-borne pathogens will be easy to implement.
Therefore, there is an urgent need for persons skilled in the art to develop a method for identifying the species of Aedes based on PCR-MS.
SUMMARY In view of this, thousands of gene sequences from nine species of Aedes mosquitoes are analyzed herein by PCR-MS and SNP sites specific to respective Aedes species are obtained. Two or more gene-specific SNP sites are selected for each species, and the specific and non-
specific sites of other species are used as exclusive references to design an analysis system, in which the species of an Aedes specimen can be determined through the base recognition at multiple sites, improving the identification accuracy for the species of Aedes and effectively avoiding the missing detection.
The technical solutions of this application are described as follows.
This application provides a method for identifying species of Aedes based on PCR-MS, comprising: (1) establishment of an Aedes gene database obtaining Aedes gene sequences via BOLD Systems DNA barcode database and NCBI DNA database, wherein the Aedes gene sequences comprises COI, COII, 28s and CytB400 genes; (2) establishment of an Aedes DNA two-dimensional code performing cluster analysis on the Aedes gene sequences using Sequencher 5.3 software with a species-specific single nucleotide polymorphism (SNP) selected as a target to establish a typing image of the Aedes DNA two-dimensional code; (3) design of a specific primer for multiplex PCR-MS designing the specific primer and a probe for multiplex PCR based on the typing image of the Aedes DNA two-dimensional code using Sequenom®Mass ARRAY Assay Designer 4.0 software; and (4) multiplex PCR-MS analysis extracting a genome of an Aedes mosquito to be identified; and subjecting the genome sequentially to pre-PCR, shrimp alkaline phosphatase (SAP) treatment, single base extension and MS analysis to determine species of the Aedes mosquito to be identified.
The technical effects of the above-mentioned solutions are specifically described as follows.
SNP sites specific to respective species of Aedes mosquitoes are obtained by analyzing thousands of gene sequences from nine species of Aedes mosquitoes.
Then an extension primer for each target SNP is designed and undergoes single-base extension in a system using ddNTPs as the substrate.
The allele extension product of respective SNP are different only in the base at the terminal, the single base can be accurately determined in the use of molecular weight as a marker, thus identifying four different types of Aedes mosquitoes.
Compared to the conventional sequencing, the method provided herein has higher accuracy and less time consumption.
In an embodiment, in step (4), the pre-PCR is performed using a Complete PCR Reagent kit, where a pre-PCR system has a total volume of 3.0 pL and consists of 1.3 pL of HPLC-grade H20, 0.5 pL of 10xPCR Buffer containing 20 mM MgClz, 0.4 pL of 25 mM MgCl, 0.1 pL of 25 mM dNTP mix, 0.5 pL of 1 uM Primer mix (a mixture of all required primers) and 0.2 pL of 5 U/uL hot star Taq polymerase; and the pre-PCR is programmed as follows: 45°C for 2 min;
95°C for 4 min; 45 cycles with each consisting of 95°C for 30 s, 56°C for 30 s and 72°C for 1 min; and 72°C for 5 min. In an embodiment, in step (4), the SAP treatment is performed using the Complete PCR Reagent kit, and comprises steps of: i) collecting a PCR product and centrifuging the PCR product at 4,000 rpm for 1 min; ii} melting SAP reaction reagents; and shaking the melted SAP reaction reagents under vortex for 20 s followed by centrifugation in a palm-type centrifuge for 1 min; ii) preparing an SAP reaction MIX; wherein the SAP reaction MIX has a total volume of 2 HL and consists of 1.53 pL of H2O (autoclaved), 0.17 uL of 10xSAP Buffer and 0.30 pL of 1.7 U/uL SAP enzyme; iv) adding 2 pL of the SAP reaction MIX to each well of a 384-well microtiter plate followed by sealing and mixing; and centrifuging the 384-well microtiter plate at 4,000 rpm for 1 min; and v) incubating the 384-well microtiter plate sequentially at 37°C for 40 min and 85°C for 5 min to produce an SAP digested product; and storing the SAP digested product at 4°C for use. In an embodiment, the single base extension is performed using an iPLEX Pro Reagent kit and comprises steps of: iy centrifuging the SAP digested product at 4,000 rpm for 1 min; ii) melting IPLEX extension reagents followed by shaking for 20 s; and respectively centrifuging the melted iPLEX extension reagents using the palm-type centrifuge for 1 min; iii) preparing an iPLEX extension mixture; wherein the iPLEX extension system has a total volume of 2 uL and consists of 0.619 pL of HPLC-grade H2O, 0.2 pL of 10xiPLEX Buffer Plus,
0.2 pL of 5 pM iPLEX Termination mix, 0.94 pL of 33 U/pL iPLEX Extend Primer mix and 0.04 WL of PLEX Pro enzyme; iv) adding the iPLEX extension mixture to each well of the microtiter plate followed by sealing and mixing; and centrifuging the microtiter plate at 4,000 rpm for 1 min; and v) performing an extension reaction to produce an iPLEX extension product, wherein the extension reaction is programmed as follows: 94°C for 30 s; 40 cycles with each consisting of 94°C for 30 s, 52°C for 5 s and 5 cycles with each consisting of 80°C for 5 s and 72°C for 3 min; and 4°C for 12 min. In an embodiment, the step (4) further comprises: performing resin purification using Spectro CHIP Arrays and a Clean Resin kit through steps of: i) preparing a dimple plate, a scraper, a spoon, a resin and pure water for the resin purification; ii) spreading resin onto the dimple plate; iii) centrifuging the iIPLEX extension product at 4,000 rpm for 1 min; adding 16 uL of water to each well of the microtiter plate followed by sealing; and centrifuging the microtiter plate at 4,000 rpm for 30 s; and iv) placing the microtiter plate invertedly on the dimple plate to allow the resin to be poured into the microtiter plate and tapping the dimple plate to enable the resin to be completely transferred followed by rotation and centrifugation.
In an embodiment, the step of spreading resin onto the dimple plate comprises: i) transferring the resin to the 384-well dimple plate; ii} spreading the resin by the scraper into respective wells of the 384-well dimple plate; and iii) recovering excess resin and drying the 384-well dimple plate at room temperature.
In an embodiment, in step (4), the MS analysis is performed through steps of: i} cleaning instruments with 50% ethanol; ii) editing a mapping file according to usage of a chip and an edited position of the 384-well microtiter plate; iii) spotting the chip according to spotting conditions for the 384-well microtiter plate; iv) linking edited information of the reaction plate with information of a mass spectrometer (the MS-laser scanning-multiplex PCR technique refers to the combination of multiplex PCR, MS, chip technology and bioinformatics means, and the information correspondence between the reaction plate and the mass spectrometer is operated on a computer screen, which belongs to the SOP of an instrument); and v) performing MS analysis and outputting an analysis report. It can be seen from the above technical solutions that compared to the prior art, this application adopts two or more SNP sites to identify a species or a type during the single-base extension, and designs a probe, i.e., UEP primer, according to the SNP site of each species. In the case that the probe can be specifically bound to the SNP site, the single base at the SNP site can be extended. Moreover, the UEP primers designed herein are different from each other in length, which indicates that even if the amplification introduces the same base, the amplified sequences are still different in length, leading to the difference in molecular weight. Therefore, each species of Aedes mosquitoes corresponds to a specific primer sequence and molecular weight, and the molecular weight can be used as an indicator to distinguish different species of Aedes mosquitoes.
This application obtains the SNP sites specific to respective Aedes species by analyzing thousands of gene sequences from nine species of Aedes mosquitoes. Two or more gene- specific SNP sites are selected for each species, and the specific and non-specific sites of other species are used as exclusive references to design an analysis system, in which the species of an Aedes specimen can be determined through the base recognition at multiple sites, improving the identification accuracy for the species of Aedes and effectively avoiding the missing detection.
BRIEF DESCRIPTION OF THE DRAWINGS The drawings used in the following embodiments or in the description of the prior art will be briefly described below to make the technical solutions in the embodiments of the invention or in the prior art clearer. It is apparent that described below are merely preferred embodiments of 5 the invention, and those skilled in the art can obtain other drawings according to the drawings provided herein without sparing any creative effort. Fig. 1 is a typing image of the Aedes DNA two-dimensional code according to the application. Fig. 2 shows the determination results provided herein.
DETAILED DESCRIPTION OF EMBODIMENTS The invention will be clearly and fully described below with reference to the drawings and embodiments. It should be noted that these embodiments are merely a part of the embodiments of the invention and are not intended to limit the invention. Other embodiments obtained by those skilled in the art based on the embodiments disclosed herein without sparing any creative effort should fall within the scope of the invention. Example 1 Establishment of gene database The gene database of Aedes mosquitoes was established, specifically, a total of 14,158 related gene sequences were collected from BOLD Systems DNA barcode database and NCBI_DNA database, as shown in Table 1. Table 1 Relate gene sequences of Aedes mosquitoes Latin name Species BOLD | NCBI | BO | NCBI | NCBI | NCBI
LD Aedes aedine Col COl | COI | 28s | CytB | Actin- mosquitoes gene | gene | gen 400 5C e 2 Aedes albopictus Aedes 1146 | 1736 28 4 albopictus/Asian tiger mosquito
3 Aedes Aedes annandalei 5 1 2 annandalei 7 Aedes Aedes 14 2 lineatopennis lineatopennis 10 Aedes Aedes 1 notoscriptus notoscriptus 14 Aedes Aedes 205 201 74 excrucians/Ochl | excrucians/Ochler erotatus otatus excrucians excrucians Example 2 Establishment of Aedes DNA two-dimensional code The Aedes gene sequences were subjected to Cluster analysis using Sequencher 5.3 software with a species-specific single nucleotide polymorphism (SNP) selected as a target to establish a typing image of the Aedes DNA two-dimensional code, which was shown in Fig. 1.
Example 3 Design of primers for multiplex PCR-MS Specific primers and probes for multiplex PCR were designed using Sequenom®Mass ARRAY Assay Designer 4.0 software, which were specifically shown in Table 2. Table 2 Specific primers and probes for multiplex PCR ATTAGGAGCYCCWGATATAG, CCAGTTCCTGCYCCARTTTC, as 139 TCTGAATATTACCTCCTTCAT, as 6306 as shown in SEQ ID NO:1 shown in SEQ ID NO:2 shown in SEQ ID NO:3 CGGTATTTGATCTGYAATAG, as AGTCAGTTTCCRAAYCCTCC, as 203 TTTTCCAAATCCTCCAATTA, as shown 6257.1 shown in SEQ ID NO:4 shown in SEQ ID NO:5 in SEQ ID NO:6 AGTACCGTGAGGGAAAGTTG, AATCGAGTTCAACGGGCTTG, as 110 GGAATAGAGAGTCAAAAAGTAC, as 6849.5 as shown in SEQ ID NO:7 shown in SEQ ID NO:8 shown in SEQ ID NO:9 GGATCAGGAACAGGATGAAC, GTAATAAAATTTACTGCTCC, as 157 | CTTTTTTTCTTTACATTTAGCTGGAG, as | 8170.3 as shown in SEQ ID NO:10 shown in SEQ ID NO:11 shown in SEQ ID NO:12 CGGTATTTGATCTGYAATAG, as | AGTCAGTTTCCRAAYCCTCC, as 203 CTTGATCATTTCCAATAAATATTC, as 7532 shown in SEQ ID NO:13 shown in SEQ ID NO:14 shown in SEQ ID NO:15 AGTCAGTTTCCRAAYCCTCC, as | CGGTATTTGATCTGYAATAG, as 203 TAACATGGGCTGTTACAA, as shown 5793.8 shown in SEQ ID NO:16 shown in SEQ ID NO:17 in SEQ ID NO:18 GGATCAGGRACAGGRTGAAC, GTAATAAAATTTACTGCCCC, as 157 TACAGTTTATCECECTC, as shown in 5327.5 as shown in SEQ ID NO:19 shown in SEQ ID NO:20 SEQ ID NO:21 ATTAGGAGCCCCTGATATAG, as CCAGTTCCAGAYCCRTTTTC, as 139 TAATGAAGGAGGTAATATTCAGA, as 7159.7 shown in SEQ ID NO:22 shown in SEQ ID NO:23 shown in SEQ ID NO:24 CTGGAATTACTTTAGACCG, as GCTCCAGCTAATACAGGGAG, 114 CGGAAGAGATAAAAGTAATAAAATAG | 8117.3 shown in SEQ ID NO:25 as shown in SEQ ID NO:26 , 8s shown in SEQ ID NO:27 TAGCAACAGGATTTTTAGG, as | AACTGCAGCCCCTCAGAATG, as 85 TACAGGATTTTTAGGATATGT, as 5490.2 shown in SEQ ID NO:28 shown in SEQ ID NO:29 shown in SEQ ID NO:30
ACAACTCGATCATGAAGTGC, as | GTGGTACCGCCGGATAATAC, as AACATCCGAAAGGATCTGT, asshown | 5820.8 shown in SEQ ID NO:31 shown in SEQ ID NO:32 in SEQ ID NO:33 TACTAATCGATATTTATTAC, as | GCAGGAAGAATTGTTCAAA, as TATCGATATTTATTACATGGACAAA, as | 7685.9 shown in SEQ ID NO:34 shown in SEQ ID NO:35 shown in SEQ ID NO:36 TTCATTCATGAACTGTTCC, as | TGCTCCACAAATTTCRGAAC, as | 155 CCCTGGTCGATTAAATCAAA, as 6085 shown in SEQ ID NO:37 shown in SEQ ID NO:38 shown in SEQ ID NO:39 TACTAATCGATATTRATTAC, as | GCAGGAAGAATTGTTCAAA, as AATCGATATTTATTACATGGACAA, as | 7358.8 shown in SEQ ID NO:40 shown in SEQ ID NO:41 shown in SEQ ID NO:42 CGGTATTTGATCTGYAATAG, as | AGTCAGTTTCCRAAYCCTCC, as | 203 | AAGCATGAGCTGTTACAAT, asshown | 5793.8 shown in SEQ ID NO:43 shown in SEQ ID NO:44 in SEQ ID NO:45 GGATTCCGTTTATTAGATG, as | TTAACTCCTAATGAGYGGAC, as | 140 ATAATTGCAACAGACGTTATTC, as 5717.4 shown in SEQ ID NO:46 shown in SEQ ID NO:47 shown in SEQ ID NO:48 GGACATCAATGATAYTGAAG, as | GTAGCWGTWACTAAAYTTCG, | 215 CTCTAATAATCGAAATCCATTTATAT, | 7887.2 shown in SEQ ID NO:49 as shown in SEQ ID NO:50 as shown in SEQ ID NO:51 TTCATTCATGAACTGTTCC, as | TGCTCCACAAATTTCRGAAC, as | 155 CAGAAGCATCAATTTTTACAC, as 6373.2 shown in SEQ ID NO:52 shown in SEQ ID NO:53 shown in SEQ ID NO:54 Example 4 PCR amplification before iPLEX The pre-PCR was performed using a Complete PCR Reagent kit.
1. Preparation (1) Sterilized double distilled water was used as a negative control. (2) Pre-PCR reaction reagents were melted, shaken under vortex for 20 s and centrifuged.
2. The MIX was prepared according to the order shown in Table 3. Table 3 Composition of the MIX Reagents Volume H,0 HPLC grade 1.3 pb 10xPCR Buffer containing 20mM MgCl» 0.5 uL
25mMMgh OA 25 mM dNTP mix 0.1 ul 1 uM Primer mix 0.5 put 5 U/uL hot star Tag polymerase 0.2 pt Total volume 3.0L
3. 3 pL of the PCR mixture was added to the bottom of each well of a 384-well microtiter plate.
4. 2 uL of each sample was pipetted and directly added to the bottom of each well of the 384-well microtiter plate.
5. After all samples were added, the 384-well microtiter plate was sealed with a sealing film.
6. The 384-well microtiter plate was shaken under vortex.
7. The 384-well microtiter plate was centrifuged at 4,000 rpm for 1 min.
8. The 384-well microtiter plate was subjected to the thermal cycle shown in Table 4 below.
9. The 384-well microtiter plate was centrifuged and stored at -20°C before use.
Table 4 Thermal cycle of PCR Temperature Time 45°C 2 min 95°C 4 min 95°C 30s 56°C 30s | 72°C 1 min 45 cycles 72°C 5 min Example 5 SAP digestion The SAP digestion was performed using a Complete PCR Reagent kit.
1. Preparation (1) The 384-well microtiter plate after the pre-PCR reaction was transferred from the -20°C refrigerator and centrifuged at 4,000 rpm for 1 min. (2) The SAP reaction reagents were melted, shaken under vortex for 20 s and centrifuged for 1 min using a palm-type centrifuge.
2. The SAP reaction MIX was prepared according to Table 5.
Table 5 Composition of the SAP reaction MIX © Reagents Volume HO (autoclaved) ~~ 153uL 10x SAP Buffer 0.17 pL
1.7 U/L SAP enzyme 0.30 uL Total volume 2 JL
3. 2 pL of the SAP reaction MIX was added to each well of the 384-well microtiter plate.
4. After the SAP reaction MIX was completely added, the 384-well microtiter plate was sealed with an Axygen sealing film and shaken under vortex.
5. The 384-well microtiter plate was centrifuged at 4,000 rpm for 1 min.
6. Then the 384-well microtiter plate was incubated at 37°C for 40 min and 85°C for 5 min and then stored at 4°C for use.
7. The 384-well microtiter plate was centrifuged and then stored at -20°C before use.
Example 6 iPLEX extension The extension was performed using an iPLEX Pro Reagent Kit.
1. Preparation (1) The 384-well microtiter plate after the SAP digestion was transferred from the -20°C refrigerator and centrifuged at 4,000 rpm for 1 min. (2) The iPLEX extension reagents were melted, shaken under vortex for 20 s and centrifuged in the palm-type centrifuge for 1 min.
2. The iPLEX extension mixture was prepared according to Table 6. Table 6 Composition of the iPLEX extension mixture Reagents Volume "HO (HPLC grade) 0619 10xiPLEX Buffer Plus 0.2 uL 5 HM iPLEX Termination mix 0.2 uL 33 U/pL iPLEX Extend Primer mix 0.94 uL iPLEX Pro enzyme 0.04 pL Total volume 2 ul
3. The iPLEX extension mixture was added to each well of the 384-well microtiter plate.
4. After the iPLEX extension mixture was completely added, the 384-well microtiter plate was sealed with a sealing film and shaken under vortex.
5. The 384-well microtiter plate was centrifuged at 4,000 rpm for 1 min.
6. The extension reaction was programmed according to Table 7.
Table 7 Program of the extension reaction Temperature Time 94°C 30s 94°C 5s 52°C 5s 80°C 5s 40 cycles 72°C 3 min } 5 cycles 4°C 12 min Example 7 Resin purification The resin purification was performed using Spectro CHIP Arrays and a Clean Resin kit.
1. Preparation (1) The 384-well microtiter plate after the iPLEX extension was transferred from the -20°C refrigerator and centrifuged at 4,000 rpm for 1 min. (2) A 384-well dimple plate, a scraper, a spoon, a resin and pure water for the resin purification were prepared.
2. Resin spreading (1) About 6 mg of the resin was transferred to the 384-well dimple plate with the spoon. (2) The resin was spread to each well of the 384-well dimple plate by scraping back and forth with the scraper. (3) The excess resin was recovered, and the resin in the 384-well dimple plate was dried at room temperature.
3. Water addition to the 384-well microtiter plate (1) The sealing film was peeled off, and 16 JL of water was added to each well of the 384- well microtiter plate in the middle between the tube and the wall. (2) Then the 384-well microtiter plate was sealed with a microplate sealer and centrifuged at 4,000 rpm for 30 s.
4. Transfer of the resin to the 384-well microtiter plate (1) The sealer was peeled off. (2) The 384-well microtiter plate was placed invertedly on the dimple plate, and then the two plates were fixed together and inverted gently to allow the resin to enter into the 384-well microtiter plate. (3) The dimple plate was tapped gently to enable the resin to be completely transferred.
5. Rotation and centrifugation of the iPLEX extension product (1) The 384-well microtiter plate was rotated by 360° along its long axis with a rotary mixer at room temperature for 60 min. (2) Then the 384-well microtiter plate was centrifuged at 3,200 rpm for 5 min.
Example 8 MS analysis
1. Preparation (1) The status of the mass spectrometer and the usage of the chip were checked.
(2) The analysis program was edited, specifically, the information of the pre-PCR and the primer sequences for the extension are inputted according to the requirements of Sequenom software.
(3) The information of the sample in each well of the 384-well microtiter plate was inputted.
2. Chip spotting (1) The instrument was cleaned with 50% ethanol. (2) The mapping file was edited according to the usage of the chip and the edited position of the 384-well microtiter plate. (3) The chip was spotted under suitable conditions.
3. The edited information of the 384-well microtiter plate was linked with the information of the mass spectrometer.
4. Then the MS analysis was performed, and an analysis report was outputted. Results Two or more genetic species-specific SNP sites were used in the identification of each species of Aedes mosquitoes, so the Aedes specimen can be double confirmed based on the difference in the bases at 2-3 sites, which was specifically shown in Fig. 3. Four species of Aedes mosquitoes (Aedes aegypti, Aedes albopictus, Aedes vexans and Aedes dorsalis) in a total number of 400 were collected with each species for 100. 48 samples from each species, i.e., a total of 192 samples, were selected for the first round of detection, where samples of Aedes aegypti and Aedes albopictus have been identified in laboratory, while samples of Aedes vexans and Aedes dorsalis are newly collected and have not been identified. In the first round of detection, the positive rate of the Aedes positive quality control 28s probe was 98.95% (190/192), and 2 cases (Aedes vexans CR 28 and 29) in the unidentified samples were not detected. Aedes aegypti had a positive rate of 97.9% (47/48), where 4 cases were identified as Aedes albopictus and further confirmed by sequencing {gold standard); and 1 case (AJ 19) was not detected and further identified by sequencing to be Aedes aegypti, where the detected sequence was the same as the designed sequence, so no modification was required. For the undetected sample, it was recommended to repeat the detection by adjusting the loading amount. Aedes albopictus had a positive rate of 100% (48/48), where 5 samples, which cannot be identified by original analysis software, were confirmed by sequencing, and the discrimination index was modified to allow them to be correctly classified. Aedes vexans had a positive rate of 79.2% (38/48), where 10 samples cannot be correctly typed. It can be seen from the sequencing of CO | that half of the sequences cannot be spliced, or no results were obtained.
The CO II sequence obtained by sequencing had a similarity of 98%, which was inconsistent with the sequencing results of CR 28 and 29, and the Aedes quality control 28s probe was not detected.
The reason for the contradictory results remained to be investigated.
Aedes dorsalis had a positive rate of 22.9% (11/48), where 37 samples cannot be typed.
The CO I sequence was verified by sequencing, and the PCR primers were improved.
For the CO II sequence, since there was only one original reference editing sequence, the primer was modified, which was specifically shown in Table 8. Table 8 Detection information of the Aedes mosquitoes Sample Tee [ew 5 28s_annandalei_T =T and 1 COI5P_122kojaT_allA#2 =A AJ-1 and "10 COIlI_486aeC_alkoT_andjltvA#2'=C and "7 Aedes 4 | en 5 28s_annandalei_T =T and '7 CytB_400aeC_alT =C and 2 AJ COI5P_281aeG_allA#2=G and "1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjlivA#2'=C "10 COII_486aeC_alkoT_andjltvA#2'=C and "1 NE COI5P_122kojaT_allA#2 =A and "2 Aedes 5 COI5P_281aeG_allA#2=G and "7 CytB_400aeC_alT =C and aegypti calls '5 28s annandalei_T'=T COIll_486aeC_alkoT_andjltvA#2'=C and 1 COI5P_122kojaT_allA#2 =A and "2 Aedes 5 Aa COI5P_281aeG_allA#2=G and 7 CytB_400aeC_alT =C and aegypti calls '5 28s_annandalei_T =T "10 COIll_486aeC_alkoT_andjltvA#2'=C and 1 COI5P_122kojaT_allA#2'=A and "2 Aedes 5 ALS COI5P_281aeG_allA#2=G and 5 28s_annandalei_T =T and aegypti calls ‘7 CytB_400aeC_alT =C 5_albopictus_C'=C and "5 28s_annandalei_T'=T albopictus | calls 10 COII_486aeC_alkoT_andjltvA#2'=C aegypti calls
28s_annandalei_T =T and '7 CytB_400aeC_alT =C and "2 ALS COI5P_281aeG_allA#2=G and "1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjlivA#2'=C "7 CytB_400aeC_alT =C and "1 COI5P_122kojaT_allA#2 =A Aedes 4 AJ-9 and "2 COI5P_281aeG_allA#2'=G and '5 aegypti calls 28s_annandalei_T =T '5 28s_annandalei_T'=T and 7 CytB_400aeC_alT =C and 1 Aedes 4 AJ-10 COI5P_122kojaT_allA#2 =A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C AJA "1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 3 5_albopictus_C'=C and "5 28s_annandalei_T'=T albopictus | calls '5 28s_annandalei_T'=T and "10 A42 COll_486aeC_alkoT_andjltvA#2'=C and "1 Aedes 5 COI5P_122kojaT_allA#2 =A and "2 aegypti calls COI5P_281aeG_allA#2'=G and "7 CytB_400aeC_alT =C A13 ‘5 28s_annandalei_T =T and "6 actin-5_albopictus_C'=C and Aedes 3 1 COISP_122kojaT_allA#2 =A albopictus | calls 5 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A Aed 4 edes AJ-14 and "10 COII_488aeC_alkoT_andjltvA#2 =C and °7 aegypti calls CytB_400aeC_alT =C ‘5 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A Aed edes AJ-15 and "10 COII_486aeC_alkoT_andjltvA#2=C and °7 ‚| 4calls aegypti CytB_400aeC_alT =C "7 CytB_400aeC_alT =C and "5 28s_annandalei_T =T and Aedes 4 AJ-16 "10 COIll_486aeC_alkoT_andjltvA#2'=C and 1 / aegypti calls COI5P_122kojaT_allA#2 =A COIll_486aeC_alkoT_andjltvA#2'=C and "5 Aedes 4 AJ-17 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A / aegypti calls and 7 CytB_400aeC_alT =C AUS 5 28s_annandalei_T =T and 1 COI5P_122kojaT_allA#2 =A Aedes 3 and 7 CytB_400aeC_alT =C aegypti calls 2 AJ-19 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A calls 10 COII_486aeC_alkoT_andjltvA#2'=C and "5 Aedes 4 AJ-20 28s_annandalei_T =T and "1 COI5SP_122kojaT_allA#2 =A / aegypti calls and "7 CytB_400aeC_alT =C
10 COII_486aeC_alkoT_andjltvA#2'=C and "5 Aedes 4 AJ-21 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A aegypti calls and 7 CytB_400aeC_alT =C 10 COII_486aeC_alkoT_andjltvA#2'=C and 5 Aedes 4 AJ-22 28s annandalei_T°=T and 1 COI5P_122kojaT_allA#2 =A aegypti calls and "7 CytB_400aeC_alT’=C NE 5 28s_annandalei_T =T and 1 COI5P_122kojaT_allA#2 =A Aedes 3 and "7 CytB_400aeC_alT=C aegypti calls "10 COIl_486aeC_alkoT_andjltivA#2'=C and 5 Aedes 4 AJ-24 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A aegypti calls and "7 CytB_400aeC_alT =C "10 COII_486aeC_alkoT_andjltvA#2'=C and "5 Aedes 4 AJ-25 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A aegypti calls and "7 CytB_400aeC_alT =C 10 COII_486aeC_alkoT_andjltvA#2'=C and 5 ALD 28s_annandalei_T =T and 1 COI5P_122kojaT_allA#2 =A Aedes 5 and "2 COI5P_281aeG_allA#2=G and ’7 aegypti calls CytB_400aeC_alT'=C "10 COII_486aeC_alkoT_andjltvA#2'=C and "5 Aedes 4 AJ-27 28s_annandalei_T'=T and "1 COI5P_122kojaT_allA#2 =A aegypti calls and "7 CytB_400aeC_alT =C 10 COIlI_486aeC_alkoT_andjltvA#2'=C and °5 AJ28 28s_annandalei_T'=T and 1 COI5P_122kojaT_allA#2 =A Aedes 5 and "2 COI5P_281aeG_allA#2'=G and ’7 aegypti calls CytB_400aeC_alT=C 28s_annandalei_T'=T and 7 CytB_400aeC_alT =C and "2 AJ29 COI5P_281aeG_allA#2=G and 1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C COIll_486aeC_alkoT_andjltvA#2'=C and °5 AJ-30 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A Aedes 5 and "2 COI5P_281aeG_allA#2=G and ’7 aegypti calls CytB_400aeC_alT=C NEY 5 28s_annandalei_T =T and 1 COI5P_122kojaT_allA#2 =A Aedes 3 and "6 actin-5_albopictus_C'=C albopictus | calls
7 CytB_400aeC_alT'=C and "10 Aedes 4 AJ-32 COll_486aeC_alkoT_andjltvA#2'=C and "5 aegypti calls 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A 28s_annandalei_T =T and '7 CytB_400aeC_alT =C and 2 AJ-33 COI5P_281aeG_allA#2=G and "1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjlivA#2'=C '5 28s_annandalei_T'=T and 7 CytB_400aeC_alT'=C and "2 NEY COI5P_281aeG_allA#2 =G and 1 Aedes 5 COI5P_122kojaT_allA#2 =A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C '528s_annandalei_T =T and "7 CytB_400aeC_alT'=C and "2 AJ.35 COI5P_281aeG_allA#2=G and "1 Aedes 5 COI5P_122kojaT_allA#2 =A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C 5 28s_annandalei_T =T and "7 CytB_400aeC_alT'=C and "2 Aedes 4 AJ-36 COI5P_281aeG_allA#2=G and "1 aegypti calls COI5P_122kojaT_allA#2 =A 5 28s_annandalei_T'=T and 7 CytB_400aeC_alT =C and "2 AJ.37 COI5P_281aeG_allA#2=G and 1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C 5 28s_annandalei_T =T and '7 CytB_400aeC_alT =C and 2 AL38 COI5P_281aeG_allA#2=G and "1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjlivA#2'=C 5 28s_annandalei_T =T and 7 CytB_400aeC_alT =C and "1 Aedes 4 AJ-39 COI5P_122kojaT_allA#2'=A and "10 / aegypti calls COII_488aeC_alkoT_andjltvA#2 =C ‘5 28s annandalei_T°=T and 7 CytB_400aeC_alT=C and 1 Aedes 4 AJ-40 COI5P_122kojaT_allA#2=A and "10 / aegypti calls COll_486aeC_alkoT_andjltvA#2'=C ‘5 28s_annandalei_T =T and "7 CytB_400aeC_alT =C and 1 Aedes 4 AJ-41 COI5P_122kojaT_allA#2 =A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C AJ-42 ‘5 28s_annandalei_T =T and "7 CytB_400aeC_alT=C and "2 Aedes 5 COI5P_281aeG_allA#2=G and "1 aegypti calls
COI5P_122kojaT_allA#2'=A and "10 COll_486aeC_alkoT_andjltvA#2'=C 28s_annandalei_T =T and '7 CytB_400aeC_alT =C and "2 NE COI5P_281aeG_allA#2'=G and "1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjlivA#2'=C 5 28s_ annandalei_T°=T and '7 CytB_400aeC_alT =C and 2 Add COI5P_281aeG_allA#2=G and 1 Aedes 5 COI5P_122kojaT_allA#2=A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C ‘5 28s_annandalei_T =T and "7 CytB_400aeC_alT'=C and "2 Nr COI5P_281aeG_allA#2=G and 1 Aedes 5 COI5P_122kojaT_allA#2 =A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C ‘5 28s_annandalei_T =T and "7 CytB_400aeC_alT'=C and "2 AJ-46 COI5P_281aeG_allA#2=G and "1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C 5 28s_annandalei_T'=T and 7 CytB_400aeC_alT =C and "2 AJdT COI5P_281aeG_allA#2=G and 1 Aedes 5 COI5P_122kojaT_allA#2'=A and "10 aegypti calls COll_486aeC_alkoT_andjltvA#2'=C ‘1 COISP_122kojaT_allA#2 =A and "10 Aedes 4 AJ-48 COll_486aeC_alkoT_andjltvA#2'=C and "5 aegypti calls 28s_annandalei_T =T and "7 CytB_400aeC_alT =C ‘5 28s_annandalei_T =T and "1 COI5P_173alC_allT#3=C Aedes 5 BW-1 and "1 COISP_122kojaT_allA#2'=A and "3 albopictus | calls COI5P_350IliA_allT#1 =T and "6 actin-5_albopictus_C'=C ‘5 28s_annandalei_T =T and "1 COI5P_173alC_allT#3=C Aedes 4 BW-2 and "1 COI5P_122kojaT_allA#2 =A and "6 actin- / albopictus | calls 5_albopictus_C’=C 5 28s_annandalei_T'=T and "1 COI5P_173alC_allT#3'=C Aedes 4 BW-3 and "1 COI5SP_122kojaT_allA#2 =A and "6 actin- albopictus | calls 5_albopictus_C'=C "6 actin-5_albopictus_C'=C and 1 Aedes 4 BW-4 COI5P_122kojaT_allA#2'=A and "1 albopictus | calls COI5P_173alC_allT#3'=C and "5 28s_annandalei_T'=T
"6 actin-5_albopictus_C'=C and “3 COI5P_350liA_allT#1 =T Aedes 5 BW-5 and "1 COISP_122kojaT_allA#2'=A and "1 albopictus | calls COI5P_173alC_allT#3'=C and "5 28s_annandalei_T'=T '6 actin-5_albopictus_C'=C and "1 Aedes 4 BW-6 COI5P_122kojaT_allA#2'=A and "1 albopictus | calls COI5P_173alC_allT#3'=C and "5 28s_annandalei_T'=T ‘8 actin-5_albopictus_C'=C and "3 COI5P_350liA_allT#1°=T Aedes 5 BW-7 and "1 COI5P_122kojaT_allA#2'=A and "1 albopictus | calls COI5P_173alC_allT#3'=C and "5 28s_annandalei_T =T '6 actin-5_albopictus_C'=C and 3 COI5P_350liA_allT#1'=T BW.8 and "1 COI5P_122kojaT_allA#2 =A and "11 Aedes 7 COII_546doA_allT#2'=T and 7 CytB_400aeC_alT =T and 1 | a/bopictus | calls COI5P_173alC_allT#3'=C and "5 28s_annandalei_T'=T BLS "6 actin-5_albopictus_C'=C and 1 Aedes 3 COI5P_122kojaT_allA#2 =A and 5 28s_annandalei_T =T albopictus | calls 28s_annandalei_T =T and 1 COI5P_173alC_allT#3'=C Aedes 4 BW-10 and "1 COI5P_122kojaT_allA#2 =A and "6 actin- albopictus | calls 5_albopictus_C'=C 5 28s_annandalei_T =T and 1 COI5P_173alC_allT#3'=C Aedes 4 BW-11 and "1 COI5P_122kojaT_allA#2 =A and "6 actin- albopictus | calls 5_albopictus_C'=C BW-412 ‘5 28s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A Aedes 3 and ‘6 actin-5_albopictus_C'=C albopictus | calls 5 28s_annandalei_T =T and 1 COI5P_173alC_allT#3'=C Aedes 5 BW-13 and "6 actin-5_albopictus_C'=C and "1 / albopictus | calls COI5P_122kojaT_allA#2 =A and "3 COI5P_350liA_allT#1 =T 5 28s_annandalei_T =T and 1 COI5P_173alC_allT#3'=C Aedes 5 BW-14 and "7 CytB_400aeC_alT'=C and "1 / albopictus | calls COI5P_122kojaT_allA#2 =A and 8 actin-5_albopictus_C’=C 5 28s annandalei_T'=T and 1 COI5P_173alC_allT#3 =C | | Aedes 4 BW-15 and "1 COI5SP_122kojaT_allA#2 =A and "6 actin- albopictus | calls 5_albopictus_C'=C ‘1 COISP_173alC_allT#3 =C and "6 actin-5_albopictus_C'=C Aedes 4 BW-16 and "1 COISP_122kojaT_allA#2'=A and 5 albopictus | calls 28s_annandalei_T'=T
“1 COISP_122kojaT_allA#2 =A and "6 actin- Aedes 5 BW-17 | 5_albopictus_C'=C and "1 COI5P_173alC_allT#3'=C and ’7 albopictus | calls CytB_400aeC_alT=T and '5 28s_annandalei_T =T 1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 4 BW-18 | 5_albopictus_C'=C and "1 COI5P_173alC_allT#3'=C and '5 albopictus | calls 28s_annandalei_T'=T BW-19 “1 COI5P_122kojaT_allA#2 =A and °6 actin- Aedes 3 5_albopictus_C'=C and "5 28s_annandalei_T =T albopictus | calls BW.20 “1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 3 5_albopictus_C'=C and "5 28s_annandalei_T =T albopictus | calls BW.21 “1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 3 5_albopictus_C'=C and "5 28s_annandalei_T'=T albopictus | calls 1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 5 BW-22 | 5_albopictus_C'=C and "1 COI5P_173alC_allT#3'=C and '7 albopictus | calls CytB_400aeC_alT =T and "5 28s_annandalei_T =T “1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 4 BW-23 5_albopictus_C’=C and "7 CytB_400aeC_alT'=T and '5 / albopictus | calls 28s_annandalei_T =T BW.24 “1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 3 5_albopictus_C'=C and "5 28s_annandalei_T =T albopictus | calls “1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 5 BW-25 | 5_albopictus_C'=C and "1 COI5P_173alC_allT#3'=C and '7 albopictus | calls CytB_400aeC_alT =T and '5 28s_annandalei_T =T “1 COI5P_122kojaT_allA#2 =A and "6 actin- Aedes 5 BW-26 | 5_albopictus_C'=C and 1 COI5P_173alC_allT#3'=C and '7 / albopictus | calls CytB_400aeC_alT’=T and 5 28s_annandalei_T =T 3 COI5P_350liA_allT#1=T and "1 BW.27 COI5P_122kojaT_allA#2°=A and "6 actin-5_albopictus_C'=C Aedes 5 and "1 COI5P_173alC_allT#3'=C and 5 albopictus | calls 28s_annandalei_T =T 3 COI5SP_350liA_allT#1'=T and 1 BW.28 COI5P_122kojaT_allA#2 =A and '6 actin-5_albopictus_C'=C Aedes 5 and "1 COI5P_173alC_allT#3 =C and 5 albopictus | calls 28s_annandalei_T'=T BW.29 “1 COISP_122kojaT_allA#2 =A and 5 28s_annandalei_T'=T Aedes 3 and "6 actin-5_albopictus_C’=C albopictus | calls
3 COI5P_350liA_allT#1'=T and "1 COI5P_122kojaT_allA#2 =A and "6 actin-5_albopictus_C'=C Aedes 7 BW-30 and "1 COI5P_173alC_allT#3 =C and 7 albopictus | calls CytB_400aeC_alT =T and '5 28s_annandalei_T =T and "10 COll_486aeC_alkoT_andjlivA#2'=C “1 COI5P_122kojaT_allA#2 =A and "6 actin- BW.31 5_albopictus_C'=C and "1 COI5P_173alC_allT#3'=C and "7 Aedes 6 CytB_400aeC_alT=T and 5 28s_annandalei_T'=T and "10 | albopictus | calls COII_486aeC_alkoT_andjltvA#2 =C ‘1 COI5P_173alC_allT#3 =C and "6 actin-5_albopictus_C'=C and "1 COI5P_122kojaT_allA#2°=A and "3 Aedes 7 BW-32 COI5P_350liA_allT#1'=T and “10 albopictus | calls COll_486aeC_alkoT_andjltvA#2'=C and "5 28s_annandalei_T =T and '7 CytB_400aeC_alT =T BW.33 ’6 actin-5_albopictus_C'=C and "1 Aedes 3 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls BW.34 ’6 actin-5_albopictus_C'=C and "1 Aedes 3 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls BV.35 ’6 actin-5_albopictus_C'=C and "1 Aedes 3 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls “1 COISP_173alC_allT#3'=C and "6 actin-5_albopictus_C'=C Aedes 4 BW-36 and "1 COI5P_122kojaT_allA#2°=A and 5 albopictus | calls 28s_annandalei_T'=T BW.37 '6 actin-5_albopictus_C'=C and 1 Aedes 3 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls BW.38 ’6 actin-5_albopictus_C'=C and "1 Aedes 3 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls “1 COI5P_173alC_allT#3'=C and "6 actin-5_albopictus_C'=C Aedes 4 BW-39 and "1 COI5P_122kojaT_allA#2°=A and 5 albopictus | calls 28s_annandalei_T'=T 3 COI5P_350liA_allT#1'=T and "1 COI5P_173alC_allT#3'=C and "6 actin-5_albopictus_C'=C Aedes 6 BW-40 and “1 COI5P_122kojaT_allA#2 =A and "10 albopictus | calls COll_486aeC_alkoT_andjltvA#2'=C and 5 28s_annandalei_T =T BW.41 °3 COI5P_350liA_allT#1'=T and "1 Aedes 5 COI5P_173alC_allT#3'=C and "6 actin-5_albopictus_C'=C albopictus | calls and "1 COI5P_122kojaT_allA#2°=A and 5 28s_annandalei_T'=T COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls '6 actin-5_albopictus_C'=C and 1 Aedes 3 28s_annandalei_T =T and "6 actin-5_albopictus_C'=C and Aedes 3 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T albopictus | calls "1 COISP_122kojaT_allA#2 =A and 5 28s_annandalei_T'=T | a/bopictus | calls ‘5 28s_annandalei_T =T and "4 COI5P_527veT_allA’=T and CR1 ‘11 COIll_504doveT_noC_allA#1'=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls ‘4 COISP_527veT_allA’=T and "5 28s_annandalei_T =T and CR2 “11 COIll_504doveT_noC_allA#1'=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls ‘4 COISP_527veT_allA’=T and "5 28s_annandalei_T =T and CR3 “11 COIll_504doveT_noC_allA#1'=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls 4 COI5P_527veT_allA’=T and 5 28s_annandalei_T =T and CR4 "11 COIll_504doveT_noC_allA#1'=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls "11 COIll_504doveT_noC_allA#1'=T and "5 CRS 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and vexans 5 ‘11 COII_546doA_allT#2'=T and "1 calls COI5P_122kojaT_allA#2 =A “11 COIlI_504doveT_noC_allA#1'=T and 5 GRS 28s annandalei_T'=T and ‘4 COI5P_527veT_allA’=T and vexans 5 ‘11 COII_546doA_allT#2'=T and "1 calls COI5P_122kojaT_allA#2 =A
‘11 COIlI_504doveT_noC_allA#1'=T and "5 CR7 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls ‘11 COIlI_504doveT_noC_allA#1'=T and "5 CR9 28s annandalei_T'=T and 4 COI5P_527veT_allA =T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls 28s_annandalei_T =T and "4 COI5P_527veT_allA’=T and CR10 "11 COII_504doveT_noC_allA#1'=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls "11 COIll_504doveT_noC_allA#1'=T and "1 CR11 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T vexans 5 and "4 COI5P_527veT_allA’=T and "11 calls COIl_546doA_allT#2'=T ‘1 COI5P_122kojaT_allA#2 =A and "5 28s_annandalei_T =T 4 CR12 and "4 COI5P_527veT_allA’=T and "11 vexans mm el 5 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and CR13 ‘11 COIll_504doveT_noC_allA#1'=T and "11 vexans 9 COII_546doA_allT#2'=T and "1 COI5P_122kojaT_allA#2 =A calls ‘5 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and CR14 “11 COIll_504doveT_noC_allA#1'=T and "1 Vexans 5 COI5P_122kojaT_allA#2'=A and "11 calls COII_548doA_allT#2'=T ‘11 COII_504doveT_noC_allA#1=T and "5 CR17 28s_annandalei_T'=T and ‘4 COI5P_527veT_allA =T and vexans 5 "11 COIl_546doA_allT#2'=T and "1 calls COI5P_122kojaT_allA#2 =A ‘11 COIll_546doA_allT#2'=T and "11 calls
COII_504doveT_noC_allA#1'=T and "1 COI5P_122kojaT_allA#2 =A ‘11 COIll_546doA_allT#2'=T and 5 28s_annandalei_T =T and "4 COISP_527veT_allA’=T and "11 5 CR20 vexans COIl_504doveT_noC_allA#1'=T and 1 calls COI5P_122kojaT_allA#2 =A 1 CR21 “1 COI5P_122kojaT_allA#2 =A >1match calls ‘11 COIll_546doA_allT#2'=T and "1 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T 5 CR22 vexans and "4 COI5P_527veT_allA’=T and "11 calls COIl_504doveT_noC_allA#1'=T 28s_annandalei_T =T and '4 COI5P_527veT_allA’=T and 5 CR23 “11 COIll_504doveT_noC_allA#1'=T and "11 vexans 1 calls COll_546doA_allT#2'=T and "1 COI5P_122kojaT_allA#2'=A '528s_annandalei_T =T and 4 COI5P_527veT_allA =T and ‘11 COIll_504doveT_noC_allA#1'=T and "1 5 CR24 vexans COI5P_122kojaT_allA#2 =A and "11 calls COll_546doA_allT#2'=T ‘5 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and 3 CR25 vexans "1 COISP_122kojaT_allA#2 =A calls '5 28s_annandalei_T'=T and "4 COI5P_527veT_allA’=T and 5 CR26 "11 COIl_504doveT_noC_allA#1'=T and "11 vexans 1 calls COII_546doA_allT#2'=T and "1 COI5P_122kojaT_allA#2 =A ‘11 COII_504doveT_noC_allA#1'=T and '5 28s_annandalei_T'=T and 4 COI5P_527veT_allA’=T and 5 CR27 vexans “11 COIll_546doA_allT#2'=T and "1 calls COI5P_122kojaT_allA#2 =A 7 CytB_400aeC_alT =C and "11 3 CR28 COII_504doveT_noC_allA#1'=C and "11 unknown 1 calls COII_546doA_allT#2 =A ‘11 COIll_546doA_allT#2 =A and "11 2 CR29 unknown COIl_504doveT_noC_allA#1'=C calls ‘11 COIll_546doA_allT#2'=T and "5 28s_annandalei_T =T and "4 COISP_527veT_allA’=T and "11 5 CR30 vexans COIl_504doveT_noC_allA#1'=T and 1 calls COI5P_122kojaT_allA#2 =A
‘11 COIll_504doveT_noC_allA#1'=T and "1 CR31 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T vexans 5 and "4 COISP_527veT_allA’=T and "11 calls COII_546doA_allT#2'=T 28s_annandalei_T =T and '4 COI5P_527veT_allA =T and CR33 “11 COIl_504doveT_noC_allA#1'=T and "11 vexans ° COlI_546doA_allT#2'=T and "1 COI5P_122kojaT_allA#2'=A calls 5 28s_annandalei_T =T and '4 COI5P_527veT_allA’=T and CR34 11 COIlI_504doveT_noC_allA#1'=T and 1 vexans 5 COI5P_122kojaT_allA#2 =A and "11 calls COIl_546doA_allT#2'=T '528s_annandalei_T =T and 4 COI5P_527veT_allA =T and CR36 “11 COIll_504doveT_noC_allA#1'=T and "11 vexans 9 COII_546doA_allT#2=T and "1 COI5P_122kojaT_allA#2’=A calls ‘5 28s annandalei_T’=T and 4 COI5P_527veT_allA’=T and CR37 “11 COIll_504doveT_noC_allA#1'=T and "11 vexans 9 COII_546doA_allT#2'=T and "1 COI5P_122kojaT_allA#2 =A calls ‘5 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and CR38 “11 COII_504doveT_noC_allA#1=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls "11 COIll_546doA_allT#2'=T and °5 28s_annandalei_T =T RSG and "4 COI5P_527veT_allA’=T and "11 vexans 5 COII_504doveT_noC_allA#1'=T and "1 calls COI5P_122kojaT_allA#2 =A ‘11 COIll_546doA_allT#2'=T and "5 28s_annandalei_T =T CRAD and "4 COISP_527veT_allA’=T and "11 vexans 5 COIl_504doveT_noC_allA#1'=T and 1 calls COI5P_122kojaT_allA#2 =A "11 COIll_504doveT_noC_allA#1'=T and "1 CR41 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T vexans 4 and "4 COISP_527veT_allA’=T calls COI5P_122kojaT_allA#2°=A and 5 28s_annandalei_T'=T calls and "4 COISP_527veT_allA’=T and "11 COIl_504doveT_noC_allA#1'=T 28s_annandalei_T =T and 4 COI5P_527veT_allA’=T and CR43 “11 COIll_504doveT_noC_allA#1'=T and "1 vexans 4 COI5P_122kojaT_allA#2 =A calls 5 28s_annandalei_T =T and ‘4 COI5P_527veT_allA’=T and CR44 "11 COIll_504doveT_noC_allA#1'=T and "1 vexans 5 COI5P_122kojaT_allA#2 =A and "11 calls COII_546doA_allT#2'=T 5 28s_annandalei_T =T and '4 COI5P_527veT_allA’=T and CRS "11 COIll_546doA_allT#2'=T and "11 vexans 5 COII_504doveT_noC_allA#1=T and 1 calls COI5P_122kojaT_allA#2 =A ‘4 COISP_527veT_allA’=T and "3 COI5P_350IiA_allT#1'=T and 11 COII_548doA_allT#2'=T and °5 CR47 28s_annandalei_T'=T and "11 vexans ° COII_504doveT_noC_allA#1=T and 1 calls COI5P_122kojaT_allA#2 =A ‘11 COIll_546doA_allT#2'=T and 5 28s_annandalei_T =T CRAB and "4 COISP_527veT_allA’=T and "11 vexans 5 COII_504doveT_noC_allA#1'=T and "1 calls COI5P_122kojaT_allA#2 =A calls ‘11 COIll_504doveT_noC_allA#1'=T and "1 BD53 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T dorsalis 6 and "3 COISP_419doA_allCT#2 =A and "2 calls COI5P_281aeG_allA#2 =A and "11 COIll_546doA_allT#2 =A ‘2 COI5P_281aeG_allA#2'=A and "11 COII_546doA_allT#2 =A and 1 COI5SP_122kojaT_allA#2 =A BD54 | and ‘8 COII_178jaT_anallC’=C and °5 28s_annandalei_T =T dorsalis ! and "3 COISP_419doA_allCT#2 =A and "11 calls COll_504doveT_noC_allA#1'=T
BD55 5 28s annandalei_T°=T and 1 COI5P_122kojaT_allA#2'=A | >1match I calls 2 BD56 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A calls 2 BD57 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2' =A calls 2 BD58 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD59 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD60 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A calls 1 BD61 ‘1 COI5SP_122kojaT_allA#2 =A >1match calls “11 COIll_504doveT_noC_allA#1'=T and "1 3 BD62 >1match COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T calls 2 BD63 | "1 COI5P_122kojaT_allA#2 =A and °5 28s_annandalei_T =T calls 2 BD64 | '528s_annandalei_T =T and ‘1 COI5P_122kojaT_allA#2 =A calls 2 BD65 | "1 COISP_122kojaT_allA#2 =A and '5 28s_annandalei_T =T calls ‘5 28s_annandalei_T =T and 3 COI5P_419doA_allCT#2 =A 3 BD66 dorsalis and "1 COI5P_122kojaT_allA#2 =A calls 2 BD67 | '528s_annandalei_T =T and ‘1 COI5P_122kojaT_allA#2 =A calls "3 COI5P_419doA_allCT#2'=A and "11 COII_546doA_allT#2 =A and "5 28s_annandalei_T =T and 5 BD68 dorsalis ‘11 COIll_504doveT_noC_allA#1'=T and "1 calls COI5P_122kojaT_allA#2 =A 2 BD69 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD70 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls ‘3 COI5P_419doA_allCT#2 =A and "5 28s_annandalei_T'=T 3 BD71 dorsalis and "1 COI5P_122kojaT_allA#2 =A calls
‘11 COIll_504doveT_noC_allA#1'=T and "1 COI5P_122kojaT_allA#2'=A and 5 28s_annandalei_T =T 6 BD72 dorsalis and "3 COISP_419doA_allCT#2 =A and "2 calls COI5P_281aeG_allA#2 =A and "11 COII_546doA_allT#2 =A 2 BD73 ‘1 COI5P_122kojaT_allA#2 =A and "5 28s_annandalei_T =T calls 2 BD74 | 1 COI5P_122kojaT_allA#2'=A and °5 28s_annandalei_T'=T calls 2 BD75 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD76 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD77 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD78 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD79 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A calls 2 BD80 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A calls 2 BD81 5 28s annandalei_T°=T and 1 COI5P_122kojaT_allA#2 =A calls 2 BD82 "1 COISP_122kojaT_allA#2 =A and °5 28s_annandalei_T'=T calls 2 BD83 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2 =A calls 2 BD84 | "1 COISP_122kojaT_allA#2 =A and "5 28s_annandalei_T'=T calls 2 BD85 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD86 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD87 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls 2 BD88 | '528s_annandalei_T =T and "1 COI5P_122kojaT_allA#2'=A calls
3 COI5P_419doA_allCT#2 =A and "11 COll_546doA_allT#2 =A and "5 28s_annandalei_T =T and 5 BD89 dorsalis "11 COIll_504doveT_noC_allA#1'=T and "1 calls COI5P_122kojaT_allA#2 =A "11 COIll_546doA_allT#2 =A and 5 28s_annandalei_T'=T and 3 COI5P_419doA_allCT#2 =A and "2 5 BD90 COI5P_281aeG_allA#2'=A and 11 dorsalis i calls COII_504doveT_noC_allA#1=T and 1 COI5P_122kojaT_allA#2 =A 2 BD91 ‘1 COI5SP_122kojaT_allA#2'=A and "5 28s_annandalei_T =T calls '5 28s_annandalei_T=T and "11 COIl_504doveT_noC_allA#1'=T and "1 4 BD92 dorsalis COI5P_122kojaT_allA#2°=A and "3 calls COI5P_419doA_allICT#2 =A 2 BD93 | "1 COISP_122kojaT_allA#2 =A and '5 28s_annandalei_T =T calls ‘1 COI5P_122kojaT_allA#2 =A and "11 COIl_504doveT_noC_allA#1'=T and "11 5 BD94 COll_546doA_allT#2 =A and 2 COISP_281aeG_allA#2 =A dorsalis 1 calls and "3 COISP_419doA_allCT#2'=A and 5 28s_annandalei_T'=T 2 BD985 | "1 COI5P_122kojaT_allA#2'=A and "5 28s_annandalei_T'=T calls 2 BD96 | "1 COISP_122kojaT_allA#2 =A and "5 28s_annandalei_T'=T calls ‘1 COISP_122kojaT_allA#2 =A and "11 4 BD97 COIl_504doveT_noC_allA#1'=T and °3 dorsalis I calls COI5P_419doA_allCT#2'=A and '5 28s_annandalei_T =T 2 BD98 | "1 COI5P_122kojaT_allA#2 =A and "5 28s_annandalei_T =T calls The embodiments in this specification are described in a progressive manner.
Each embodiment focuses on the differences from other embodiments.
Like and similar parts of various embodiments may refer to each other.
The devices used in the embodiments correspond to the methods, and thus are described in a brief manner.
The methods can be referred to for the details of the devices.
The above embodiments are merely illustrative of the invention and are intended to enable those skilled in the art to implement and use the invention.
It should be noted that these embodiments are not intended to limit the invention, and any modifications, replacements and variations made by those skilled in the art without departing from the spirit of the invention should still fall within the scope of the invention..
SEQUENCE LISTING <110> Chinese Academy of Inspection and Quarantine <120> METHOD FOR IDENTIFYING SPECIES OF AEDES BASED ON PCR-MS <130> Aedes NL <150> CN202010956713.5 <151> 2020-01-19 <160> 54 <170> SIPOSequenceListing 1.0 <2105 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer in multiplex PCR <400> 1 attaggagcy ccwgatatag 20 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer in multiplex PCR <400> 2 ccagttcctg cyccartttc 20 <2105 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> UEP primer in multiplex PCR <400> 3 tctgaatatt acctccttca t 21 <2105 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer in multiplex PCR
<400> 4 cggtatttga tctgyaatag 20 <216> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 5 agtcagtttc craaycctcc 20 <210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 6 ttttccaaat cctccaatta 20 <210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 7 agtaccgtga gggaaagttg 20 <2105 8
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 8 aatcgagttc aacgggcttg 20 <216> 9
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 9 ggaatagaga gtcaaaaagt ac 22 <210> 10
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 10 ggatcaggaa caggatgaac 20 <21e> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 11 gtaataaaat ttactgctcc 20 <21e> 12
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 12 ctttttttct ttacatttag ctggag 26 <2105 13
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 13 cggtatttga tctgyaatag 20 <210> 14
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 14 agtcagtttc craaycctcc 20
<21e> 15
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 15 cttgatcatt tccaataaat attc 24 <210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 16 agtcagtttc craaycctcc 20 <21e> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 17 cggtatttga tctgyaatag 20 <21e> 18
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 18 taacatgggc tgttacaa 18 <210> 19
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 19 ggatcaggra caggrtgaac 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 20 gtaataaaat ttactgcccc 20 <21e> 21
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 21 tacagtttat ccccctc 17 <210> 22
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 22 attaggagcc cctgatatag 20 <21e> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 23 ccagttccag ayccrttttc 20 <210> 24
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 24 taatgaagga ggtaatattc aga 23 <21e> 25
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 25 ctggaattac tttagaccg 19 <210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 26 gctccagcta atacagggag 20 <21e> 27
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 27 cggaagagat aaaagtaata aaatag 26 <210> 28
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 28 tagcaacagg atttttagg 19 <210> 29
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 29 aactgcagcc cctcagaatg 20 <210> 30
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 30 tacaggattt ttaggatatg t 21 <21e> 31
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 31 acaactcgat catgaagtgc 20 <210> 32
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 32 gtggtaccgc cggataatac 20 <210> 33
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 33 aacatccgaa aggatctgt 19 <210> 34
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 34 tactaatcga tatttattac 20 <21e> 35
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 35 gcaggaagaa ttgttcaaa 19 <210> 36
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 36 tatcgatatt tattacatgg acaaa 25 <21e> 37
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 37 ttcattcatg aactgttcc 19 <210> 38
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 38 tgctccacaa atttcrgaac 20 <210> 39
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 39 ccctggtcga ttaaatcaaa 20 <210> 40
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 40 tactaatcga tattrattac 20 <210> 41
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 41 gcaggaagaa ttgttcaaa 19 <210> 42
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 42 aatcgatatt tattacatgg acaa 24 <210> 43
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 43 cggtatttga tctgyaatag 20 <210> 44
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 44 agtcagtttc craaycctcc 20 <210> 45
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 45 aagcatgagc tgttacaat 19 <210> 46
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 46 ggattccgtt tattagatg 19 <21e> 47
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 47 ttaactccta atgagyggac 20 <210> 48
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 48 ataattgcaa cagacgttat tc 22 <210> 49
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 49 ggacatcaat gataytgaag 20 <210> 50
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 50 gtagcwgtwa ctaaayttcg 20 <21e> 51
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 51 ctctaataat cgaaatccat ttatat 26 <210>5 52
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer in multiplex PCR
<400> 52 ttcattcatg aactgttcc 19 <2105 53
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer in multiplex PCR
<400> 53 tgctccacaa atttcrgaac 20 <210> 54
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> UEP primer in multiplex PCR
<400> 54 cagaagcatc aatttttaca c 21
Claims (7)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010056713.5A CN111334583B (en) | 2020-01-19 | 2020-01-19 | Method for identifying aedes species based on PCR-MS mass spectrometry scanning |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| NL2025851A true NL2025851A (en) | 2021-09-01 |
| NL2025851B1 NL2025851B1 (en) | 2022-07-25 |
Family
ID=71177835
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NL2025851A NL2025851B1 (en) | 2020-01-19 | 2020-06-17 | Method for identifying species of aedes based on pcr-ms |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN111334583B (en) |
| NL (1) | NL2025851B1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029906B (en) * | 2020-08-27 | 2021-06-11 | 中国检验检疫科学研究院 | Two-dimensional code detection method for distinguishing SARS-CoV and SARS-CoV2 virus based on SNP |
| CN112820349B (en) * | 2020-12-31 | 2023-05-23 | 融智生物科技（青岛）有限公司 | Single nucleotide polymorphism genotyping method |
| CN113308464A (en) * | 2021-06-02 | 2021-08-27 | 怀化职业技术学院 | Primer group and kit for amplifying aedes albopictus nad1 gene and sequencing method using primer group and kit |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1176212A1 (en) * | 2000-07-24 | 2002-01-30 | Centre National de Genotype | Method for haplotyping by mass spectrometry |
| CN105039364A (en) * | 2015-08-14 | 2015-11-11 | 珠海国际旅行卫生保健中心 | Sequence of standard gene of DNA (deoxyribonucleic acid) barcode of aedes and application thereof |
| CN105483124B (en) * | 2015-12-22 | 2018-08-28 | 福建国际旅行卫生保健中心 | Mosquito Rapid identification DNA chip and its identification method |
| US11618928B2 (en) * | 2017-04-12 | 2023-04-04 | The Broad Institute, Inc. | CRISPR effector system based diagnostics for malaria detection |
| CN108165642B (en) * | 2018-03-29 | 2021-05-04 | 山东国际旅行卫生保健中心 | Aedes albopictus and Aedes aegypti CYTB gene identification kit based on high-resolution melting curve and identification method thereof |
| CN108977515A (en) * | 2018-06-26 | 2018-12-11 | 苏州道尔盾基因科技有限公司 | A kind of methods of genotyping and its application based on SNP site nucleic acid Mass Spectrometer Method |
-
2020
- 2020-01-19 CN CN202010056713.5A patent/CN111334583B/en active Active
- 2020-06-17 NL NL2025851A patent/NL2025851B1/en not_active IP Right Cessation
Also Published As
| Publication number | Publication date |
|---|---|
| NL2025851B1 (en) | 2022-07-25 |
| CN111334583A (en) | 2020-06-26 |
| CN111334583B (en) | 2023-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| NL2025851B1 (en) | Method for identifying species of aedes based on pcr-ms | |
| Bastien et al. | Quantitative real-time PCR is not more sensitive than “conventional” PCR | |
| Gardner et al. | Limitations of TaqMan PCR for detecting divergent viral pathogens illustrated by hepatitis A, B, C, and E viruses and human immunodeficiency virus | |
| CA2450479A1 (en) | Method for detecting diseases caused by chromosomal imbalances | |
| CN110577990B (en) | Kit for detecting thalassemia gene mutation | |
| Deregt et al. | A multiplex DNA suspension microarray for simultaneous detection and differentiation of classical swine fever virus and other pestiviruses | |
| CN110853708B (en) | Design method of nucleic acid capture probe for HLA typing | |
| CN113718063A (en) | Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses | |
| WO2001073134A2 (en) | Gene profiling arrays | |
| JP3789317B2 (en) | Isometric primer extension method and kit for detecting and quantifying specific nucleic acids | |
| WO2013162109A1 (en) | Polymerase chain reaction primer and probe for detecting hepatitis b virus, and detection kit and method using same | |
| US7504209B2 (en) | Method and device for integrated nucleic acid integrity assessment and analysis | |
| Kawaguchi et al. | Detection of hepatitis B virus DNA in sera from patients with chronic hepatitis B virus infection by DNA microarray method | |
| CN110607381B (en) | Mycobacterium tuberculosis detection kit and method | |
| CN102212621B (en) | Detection kit and detection method for hepatitis B virus genotyping | |
| JP2001245698A (en) | Method for detecting nucleic acid | |
| EP1668158A2 (en) | Rna detection and quantitation | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| WO2022221605A2 (en) | Detection of sars-cov-2 variant | |
| WO2021039777A1 (en) | Method for examining rheumatoid arthritis | |
| CN111961763A (en) | Novel gene chip for detecting coronavirus | |
| Zehnder et al. | Cross-linking hybridization assay for direct detection of factor V Leiden mutation | |
| WO2004050906A1 (en) | Methylation dna detecting method | |
| WO2003093501A2 (en) | Ssh based methods for identifying and isolating unique nucleic acid sequences | |
| RU2762759C1 (en) | METHOD FOR SAMPLE PREPARATION OF SARS-CoV-2 CORONAVIRUS ISOLATES AND OLIGONUCLEOTIDE PRIMERS FOR ITS IMPLEMENTATION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MM | Lapsed because of non-payment of the annual fee |
Effective date: 20230701 |