NL2025782B1

NL2025782B1 - Novel biomarkers for use in stroke diagnosis and prognosis

Info

Publication number: NL2025782B1
Application number: NL2025782A
Authority: NL
Inventors: Hubertus Andreas Quax Paulus; Yaël Nossent Anne; Leontien Van Der Bent Melanie; Truc My Nguyen Thy; Dalitso Kruyt Nyika
Original assignee: Academisch Ziekenhuis Leiden
Priority date: 2020-06-08
Filing date: 2020-06-08
Publication date: 2022-01-28
Also published as: WO2021251817A1

Abstract

The present invention provides novel biomarkers that can be used in stroke diagnosis and/or prognosis, and/or can be used to determine the risk of developing stroke in a subject. It especially provides novel biomarkers for distinguishing between hemorrhagic stroke and 5 ischemic stroke. Corresponding methods, kits, devices and uses are also provided.

Description

Novel biomarkers for use in stroke diagnosis and prognosis The present invention provides novel biomarkers that can be used in stroke diagnosis and/or prognosis, and/or can be used to determine the risk of developing stroke in a subject. It especially provides novel biomarkers for distinguishing between hemorrhagic stroke and ischemic stroke. Corresponding methods, kits, devices and uses are also provided. Background In the Western world, stroke is the most frequent cause of disability and the third leading cause of death. Each year, twice as many women die from stroke than from breast cancer. In Europe, the incidence of stroke is expected to increase from 1.1 million in 2000 to 1.5 million in 2025, largely due to ageing of the population. Only 2 out of 3 individuals survive stroke, and half of the survivors are permanently disabled. The quality of life of stroke survivors is markedly affected by neurological deficits and less overt signs such as depression, memory loss, and cognitive disabilities. Because 1 in 5 stroke patients require long-term care, the annual cost of stroke in Europe is €27 billion for the society and €11 billion for informal care. The causes of stroke can be subdivided into ischemic stroke (blocked artery) or hemorrhagic stroke (ruptured artery). These different subtypes of stroke need different acute treatment approaches. For ischemic stroke, treatment aims are recanalization and reperfusion. The occlusion is dissolved by intravenous administration of recombinant tissue plasminogen activator (IV-rtPA). For patients with ischemic stroke due to large vessel occlusion (LVO), endovascular thrombectomy (EVT) may also be performed to mechanically remove the blood clot, however, this is only available in comprehensive stroke centres. For hemorrhagic stroke, treatment is completely different and aims to control bleeding by intracranial pressure reduction with blood pressure management or neurosurgical interventions. Because treatments differ, it is important to immediately distinguish between ischemic and hemorrhagic stroke especially since administration of IV-rtPA in case of haemorrhage would severely deteriorate the prospects of a good clinical outcome.

The problem lies in the fact that while having a different pathophysiology and treatment, clinical symptoms of ischemic or hemorrhagic stroke are undistinguishable. Therefore additional work up with a CT scan is necessary. While a CT scan can confidently rule out hemorrhagic stroke, it cannot reliably establish ischemic stroke diagnosis. Diagnosis of ischemic stroke thus largely relies on clinical assessment. In practice this leads to a substantial number of misdiagnoses (so called stroke mimics, where stroke symptoms are due to another disease such as migraine or epilepsy) with consequent mal- or mistreatment. In case of suspected ischemic stroke, more elaborate work up with CT angiography is necessary to reveal stroke due to LVO. Importantly, the establishment of ischemic stroke diagnosis should be as quick as possible, as each minute approximately 2 million neurons die without treatment and clinical efficacy of reperfusion therapies declines sharply with the passing of time. Ideally diagnosis would be known in the ambulance, especially for ischemic stroke due to LVO since treatment with EVT is restricted to comprehensive stroke centres only. Establishing this diagnosis pre-hospital would save vital time by avoiding unnecessary between-hospital transfers. In an ideal world, the cause of stroke is diagnosed at home, at the GP or in the ambulance. Such early identification of hemorrhagic or ischemic stroke would allow for more rapid and accurate treatment (allocation), limit the amount of brain damage and greatly increase the prospects of a good clinical outcome. Furthermore, early diagnosis would significantly reduce health care costs associated with stroke since it is very costly to care for stroke disabled patients. See Figure 1 for more details on the current and ideal situation for treatment of stroke.

The time to treatment of a stroke is crucial and is limited by the time to diagnosis of the stroke cause. Novel and improved means for more rapidly determining the underlying cause of stroke are clearly needed. Brief summary of the disclosure Several studies have shown that circulating small non-coding RNAs (sncRNAs), and especially miRNAs, are promising biomarkers for a range of diseases, including stroke. Most studies have focused on detecting biomarkers for either ischemic stroke or hemorrhagic stroke, and comparing these with healthy controls. Many of these studies have focussed on miRNAs that are present within extracellular vesicles (EVs) in the blood. The invention is based on the surprising finding that a specific subset of freely circulating sncRNAs can be used to differentiate between patients with ischemic stroke, patients with hemorrhagic stroke, and patients with stroke mimics.

Upon acute tissue damage and stress, RNA molecules are released directly into the circulation, without encapsulation into EVs. Whereas longer RNA molecules are rapidly degraded outside the cells, sncRNAs escape degradation and remain stable in the circulation for longer periods of time. Advantageously, freely circulating RNAs are more accessible than RNAs in extracellular vesicles, enabling more rapid determination of the cause of stroke. Such freely circulating RNAs can therefore be detected in EV depleted samples such as plasma.

Detection of the biomarkers described herein may be performed using any suitable means and methodology. Advantageously, the biomarkers can be detected as freely circulating sncRNAs within blood samples obtained from a subject. Testing of blood samples may, for example, be advantageously performed using a point-of-care device that can easily be used within a primary care setting such as at home, in a GP surgery or in an ambulance. Such devices may detect one or more of the biomarkers described herein for providing a diagnosis and/or prognosis of stroke, determining the risk of developing stroke, or distinguishing between hemorrhagic stroke and ischemic stroke.

The biomarkers, methods, kits, devices and uses described herein enable early recognition of the underlying cause of stroke. This is particularly important, as different types of stroke require distinct forms of treatment.

Use of one or more biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii} miR-98-5p, let-7d-5p and miR-486-3p; as a biological fluid biomarker for stroke is therefore provided herein. Also provided is the use of one or more biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or ii) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p; as a biological fluid biomarker for distinguishing between hemorrhagic stroke and ischemic stroke.

Suitably, the biomarkers may comprise: (i) tRNA-AsnGTT and tRNA-SerGCT;

(ii) tRNA-AsnGTT and miR-660-5p; (iii) tRNA-SerGCT and miR-860-5p; or (iv) tRNA-AsnGTT, tRNA-SerGCT and miR-660-5p. Optionally the biomarkers may further comprise tRNA-ValTAC.

In one example, the biomarkers may comprise tRNA-SerGCT, tRNA-ArgTCG, SEQ ID NO: 39, SEQ ID NO:47, or fragments or variants thereof. The use of a tRNA or a fragment thereof as a biological fluid biomarker for hemorrhagic stroke is also provided herein. A method for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject is also provided, the method comprising the steps of: a) determining the level of one or more biomarker in a biological fluid sample from the subject, wherein the one or more biomarker is selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii} miR-98-5p, let-7d-5p and miR-486-3p; b) comparing the level of the one or more biomarker with the level of the same biomarker in a control sample or with a pre-determined reference level for the same biomarker, wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; and c) identifying a subject as having stroke or having an increased risk of developing stroke if the comparison in step b} indicates that the subject has one or more of the following: i} an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-LeuTAA, tRNA-ProAGG, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerGCT, tRNA-SerAGA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO:39 and SEQ ID NO:41; or a fragment or variant thereof; and/or ij a change in the level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA- GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-lleGAT, tRNA-GIyCCC, tRNA-LeuCAG,

tRNA-ArgTCG, tRNA-SerACT, tRNA-SupTTA, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, miR-98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or a fragment 5 or variant thereof.

Suitably, the stroke may be ischemic stroke or hemorrhagic stroke.

A method for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke is also provided, the method comprising the steps of: a) determining the level of one or more biomarker in a biological fluid sample from the subject, wherein the one or more biomarker is selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or ii MIR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p; b) comparing the level of the one or more biomarker with the level of the same biomarker in a control sample or with a pre-determined reference level for the same biomarker; and c) distinguishing between ischemic stroke and hemorrhagic stroke in the subject using the comparison in step b), wherein the subject is identified as having ischemic stroke or having an increased risk of developing ischemic stroke if the comparison indicates that the subject has one or more of i) to v}; or the subject is identified as having hemorrhagic stroke or having an increased risk of developing hemorrhagic stroke if the comparison indicates that the subject has one or more of vi} to x); wherein i) to x) are: i) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, MiR-106b-5p, MiR-107, miR-185-5p, miR-196b-5p, miR- 20a-5p, miR-378a-3p, miR-486-3p, miR-660-5p, miR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having hemorrhagic stroke;

ii) a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA- ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA- SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, and SEQ ID NO: 48, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having hemorrhagic stroke; iii) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, miR-196b-5p, miR-378a-3p, miR-98-5p, let- 7d-5p, tRNA-LeuTAA, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerGCT, tRNA-SerAGA and SEQ ID NO: 39, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; iv) a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-LysTTT, tRNA-SupTTA, tRNA-IleGAT, tRNA-SerACT, tRNA- lleAAT, tRNA-GlyGCC, tRNA-GIyCCC, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:45 and SEQ ID NO:46, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; or v) an equivalent level of biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA- GlyGCC, tRNA-lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA- SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA- LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG, miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p, miR-196b-5p, miR- 98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36 to 48, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having ischemic stroke; vi} a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-108b-5p, miR-107, miR-185-5p, miR-196b-5p, miR- 20a-5p, miR-378a-3p, miR-486-3p, miR-660-5p, miR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having ischemic stroke; vii) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA- ArgTCT, tRNA-GIyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIlyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA- SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, and SEQ ID NO: 48, or a fragment or variant thereof, and wherein the control sample or pre-determined reference level is from a subject having ischemic stroke; viii) a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-196-5p, miR-106b-5p, miR-107, miR-185-5p, miR-20a-5p, miR- 378a-3p, MiR-486-3p, MmiR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA- LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; ix) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA- ArgTCT, tRNA-GIyGCC, tRNA-lleAAT, tRNA-LeuTAA, tRNA-lleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, and SEQ ID NO: 48, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; and/or x) an equivalent level of biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA- GlyGCC, tRNA-lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-

SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA- LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG, miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p, miR-196b-5p, miR- 98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36 to 48, or a fragment or variant thereof and wherein the control sample or pre-determined reference level is from a subject having a hemorrhagic stroke.

Suitably, the biological fluid sample may be a blood sample.

Suitably, the blood sample may be an EV-depleted blood sample.

Suitably, step a) may comprise determining the level of at least two or three of the recited biomarkers in the biological fluid sample.

Suitably, step a) may comprise determining the level of: (i) tRNA-AsnGTT and tRNA-SerGCT; (ii) tRNA-AsnGTT and miR-660-5p; (iii) tRNA-SerGCT and miR-660-5p; or (iv) tRNA-AsnGTT, tRNA-SerGCT and miR-660-5p; optionally step a) further comprises determining the level of tRNA-ValTAC.

In one example, the biomarkers may comprise tRNA-SerGCT, tRNA-ArgTCG, SEQ ID NO: 39, SEQ ID NO:47, or fragments or variants thereof.

Suitably, the subject may be a human.

Suitably, the level of biomarker may be determined using PCR, RNA-SEQ or RT-PCR.

Suitably, the method may further comprise selecting a treatment regimen for the subject based on the comparison of the level of the biomarker with the control sample or with the pre- determined reference level.

Suitably, the method may further comprise administering the selected treatment regimen to the subject, optionally wherein the selected treatment regimen comprises: (i) intravenous administration of recombinant tissue plasminogen activator (IV-rtPA) and/or endovascular thrombectomy for treating ischemic stroke; or

(ii) administration of at least one antihypertensive and/or neurosurgical intervention for treating hemorrhagic stroke.

A method for monitoring stroke progression in a subject is also provided, the method comprising the steps of: i} determining the level of one or more biomarker in a biological fluid sample from the subject in accordance with steps a) to b) of the methods described above; and ii) repeating step i) for the same subject after a time interval; and ii) comparing the biomarker levels identified in i) with the biomarker levels identified in ii), wherein a change in the biomarker levels from i) to ii) is indicative of a change in stroke progression in the subject.

A Kit for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject is also provided, the kit comprising at least two detectably labelled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p.

A kit for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke is also provided, the kit comprising at least two detectably labelled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iil) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p.

Suitably: (i) the at least two detectably labelled agents may specifically bind to tRNA-AsnGTT and tRNA- SerGCT respectively; (ii) the at least two detectably labelled agents may specifically bind to tRNA-AsnGTT and miR- 660-5p respectively; (iii) the at least two detectably labelled agents may specifically bind to tRNA-SerGCT and miR- 660-5p respectively; or (iv) the kit may comprise at least three detectably labelled agents, wherein the at least three detectably labelled agents may specifically bind to tRNA-AsnGTT, tRNA-SerGCT and miR- 660-5p respectively; optionally wherein the kit further comprises an additional detectably labelled agent that specifically binds to tRNA-ValTAC.

Suitably, the kit may further comprise one or more reagents for detecting the detectably labelled agent(s). An assay device for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject is also provided, the device comprising a surface with at least two detectably labelled agents located thereon, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p.

An assay device for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke is also provided, the device comprising a surface with at least two detectably labelled agents located thereon, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-

SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iil) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-186b-5p, miR-98-5p, let-7d-5p and miR-486-3p. Suitably: (i) the at least two detectably labelled agents may specifically bind to tRNA-AsnGTT and tRNA- SerGCT respectively; (ii) the at least two detectably labelled agents may specifically bind to tRNA-AsnGTT and miR- 660-5p respectively; (iii) the at least two detectably labelled agents may specifically bind to tRNA-SerGCT and miR- 660-5p respectively; or (iv) the assay device may comprise at least three detectably labelled agents located on the surface, wherein the at least three detectably labelled agents may specifically bind to tRNA- AsnGTT, tRNA-SerGCT and miR-860-5p respectively; optionally wherein the assay device further comprises an additional detectably labelled agent located on the surface, wherein the additional detectably labelled agent specifically binds to tRNA-ValTAC.

Suitably, the at least two detectably labeled agents are located in separate zones on the surface. The provided methods, uses, devices or kits may be for stroke prognosis.

In another aspect, the invention provides a method of diagnosing and treating stroke in a subject, the method comprising the steps of: a) determining the level of one or more biomarker in a biological fluid sample from the subject, wherein the one or more biomarker is selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p;

b) comparing the level of the one or more biomarker with the level of the same biomarker in a control sample or with a pre-determined reference level for the same biomarker, wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; and c¢) identifying a subject as having stroke or having an increased risk of developing stroke if the comparison in step b) indicates that the subject has one or more of the following: i) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-LeuTAA, tRNA-ProAGG, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerGCT, tRNA-SerAGA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO:39 and SEQ ID NO:41; or a fragment or variant thereof; and/or ii) a change in the level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA- GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-lleGAT, tRNA-GIyCCC, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SupTTA, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, miR-98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or a fragment or variant thereof; and d) treating the subject for stroke.

Methods for diagnosing and treating ischemic stroke in a subject are also provided, comprising a) performing the method steps identified elsewhere herein to diagnose ischemic stroke; and b) treating the subject for ischemic stroke.

Methods for diagnosing and treating hemorrhagic stroke in a subject are also provided, comprising a) performing the method steps identified elsewhere herein to diagnose hemorrhagic stroke; and b) treating the subject for hemorrhagic stroke.

In another aspect, the invention provides a method of treating a subject with stroke (e.g. ischemic or hemorrhagic stroke), the method comprising treating the subject, wherein the patient has been diagnosed as having stroke (e.g. ischemic or hemorrhagic stroke) using a method described elsewhere herein.

Appropriate treatments are discussed elsewhere herein.

Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

Various aspects of the invention are described in further detail below.

Brief description of the Figures Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which: Figure 1 provides a schematic overview of the current and ideal situation for treatment of stroke. CSC: comprehensive stroke center; POC test: point-of-care test.

Figure 2 provides information on the current in-hospital work-up to final diagnosis of stroke.

Figure 3 shows the relative abundance of the miRNAs selected for validation, as determined by RNA-seq. TPM: tags per million; IS: ischemic stroke; HS: hemorrhagic stroke; M: stroke mimic.

Figure 4 shows relative abundance of the tRNA-derived fragments selected for validation, as determined by RNA-seq. Each graph shows a unique tRNA gene, denominated by the numbers that precede the hyphen (nomenclature from QIAGEN database, based on tRNAscan-SE). TPM: tags per million; IS: ischemic stroke; HS: hemorrhagic stroke; M: stroke mimic.

Figure 5 shows relative abundance of fragments from four additional tRNAs, determined using an alternative analysis method of the RNA-seq data. Here, the sum of the (multi-mapping adjusted) read counts corresponding to any of the genes that code for a specific anticodon was determined. RPM: reads per million. IS: ischemic stroke; HS: hemorrhagic stroke; M: stroke mimic.

Figure 6 shows Receiver Operating Characteristic (ROC) curves of four single tRNAs (dotted lines), as well as a model based on the combination of those tRNAs (solid line), as a measure of diagnostic accuracy for predicting hemorrhagic stroke. AUC: area under the curve (with 95% confidence intervals).

The patent, scientific and technical literature referred to herein establish knowledge that was available to those skilled in the art at the time of filing. The entire disclosures of the issued patents, published and pending patent applications, and other publications that are cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. In the case of any inconsistencies, the present disclosure will prevail.

Various aspects of the invention are described in further detail below. Detailed Description The present invention provides novel biomarkers that can be used in stroke diagnosis and/or prognosis and/or for determining the risk of developing stroke in a subject. It also provides novel biomarkers for distinguishing between hemorrhagic stroke and ischemic stroke. Corresponding methods, kits, devices and uses are also provided.

The biomarkers described herein are microRNAs, tRNAs, or fragments thereof.

The term “microRNA” or “miRNA” is well known in the art and refers to small non-coding RNA molecules of around 22 nucleotides in length which affect the regulation of gene expression. They are produced either from gene sequences or intron/exon sequences; many are encoded by intergenic sequences. The method provides new biomarkers for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject, wherein the biomarker is the specified miRNA. Examples of miRNAs of the invention are provided in Table 1. As would be known by a person of skill in the art, several miRNA sequence variants are also known. The terms miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR- 378a-3p, miR-125a-5p, miR-660-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p, miR- 486-3p etc as used herein encompass all variants that derive from the specified miRNA, including isomiRs and editing variants, as described in, for example miRBase (release 22.1).

miRNA sequence variants encompassed by each term are therefore easily identifiable by a person of skill in the art (see also van der Kwast et al., 2019). For the avoidance of doubt, reference herein to the biomarker hsa-miR-185-5p encompasses the miRNA of SEQ ID NO:1 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-let-7d-5p encompasses the miRNA of SEQ ID NO:2 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-20a-5p encompasses the miRNA of SEQ ID NO:3 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-660-5p encompasses the miRNA of SEQ ID NO:4 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-107 encompasses the miRNA of SEQ ID NO:5 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-486-3p encompasses the miRNA of SEQ ID NO:6 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-196b-5p encompasses the miRNA of SEQ ID NO:7 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-98-5p encompasses the miRNA of SEQ ID NO:8 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-106b-5p encompasses the miRNA of SEQ ID NO:9 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-101-3p encompasses the miRNA of SEQ ID NO:10 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-125a-5p encompasses the miRNA of SEQ ID NO:11 and variants, including isomiRs and editing variants thereof.

Reference herein to the biomarker hsa-miR-378a-3p encompasses the miRNA of SEQ ID NO:12 and variants, including isomiRs and editing variants thereof.

For appropriate variants see miRBase (release 22.1). Any one of SEQ ID NO: 1 to 12, or variants, including isomiRs and editing variants thereof, may therefore be used as biomarkers as described herein.

The term “tRNA” is also well known in the art and refers to a transfer RNA molecule that is used in translation and consists of a single RNA strand that is around 80 nucleotides long.

The method provides new biomarkers for diagnosis and/or prognosis of stroke or for determining the risk of developing stroke in a subject, wherein the biomarker may be the specified tRNA or a fragment thereof (also referred to herein as a “tRNA fragment”). Examples of tRNAs (and tRNA fragments) of the invention are provided in Table 1. As would be known by a person of skill in the art, several tRNA sequence variants are also known.

Such variants may be the result of single nucleotide polymorphisms, posttranscriptional modifications such as A-to-l editing, differential cleavage, or a combination of these processes.

The terms tRNA- ValTAC, tRNA-lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyGCC, tRNA- ArgTCT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-AsnGTT, tRNA-SerGCT, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerAGA, tRNA-supTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG etc as used herein encompass all variants (and fragments thereof) that derive from the specified tRNA.

For mature tRNAs (SEQ IDs 13-35), sequences of one gene per anticodon are provided in Table 1, including the corresponding gtRNAdb gene symbol (release 18.1), as examples.

As further examples, the most prevalent tRNA fragment that was identified herein using RNA- sequencing for each tRNA is also provided in Table 1 (SEQ IDs 36 to 48). tRNA sequence variants encompassed by each term are easily identifiable by a person of skill in the art.

For the avoidance of doubt, reference herein to the biomarker tRNA-ArgTCT encompasses the tRNA of SEQ ID NO:13, variants and fragments thereof (including SEQ ID NO: 36). The tRNA fragment of SEQ ID NO: 36 only aligns to tRNA-ArgTCT, therefore the terms “tRNA- ArgTCT”, SEQ ID NO:13 and SEQ ID NO:36 can be used interchangeably herein.

Reference herein to the biomarker tRNA-GlyCCC encompasses the tRNA of SEQ ID NO:14, variants and fragments thereof (including SEQ ID NO: 37). Reference herein to the biomarker tRNA-IleAAT encompasses the tRNA of SEQ ID NO: 15, variants and fragments thereof (including SEQ ID NO: 38). Reference herein to the biomarker tRNA-LeuTAA encompasses the tRNA of SEQ ID NO:186, variants and fragments thereof (including SEQ ID NO: 39). Reference herein to the biomarker tRNA-LysTTT encompasses the tRNA of SEQ ID NO:17, variants and fragments thereof (including SEQ ID NO: 40). Reference herein to the biomarker tRNA-ProAGG encompasses the tRNA of SEQ ID NO: 18, variants and fragments thereof (including SEQ ID NO: 41). Reference herein to the biomarker tRNA-ValTAC encompasses the tRNA of SEQ ID NO:19, variants and fragments thereof (including SEQ ID NO: 42). The tRNA fragment of SEQ ID NO: 42 only aligns to tRNA-ValTAC, therefore the terms “tRNA-ValTAC”, SEQ ID NO:19 and SEQ ID NO:42 can be used interchangeably herein.

Reference herein to the biomarker tRNA-AsnGTT encompasses the tRNA of SEQ ID NO:20, variants and fragments thereof (including SEQ ID NO: 43). The tRNA fragment of SEQ ID NO: 43 only aligns to tRNA- AsnGTT, therefore the terms “t(RNA-AsnGTT”, SEQ ID NO:20 and SEQ ID NO:43 can be used interchangeably herein.

Reference herein to the biomarker tRNA-SerGCT encompasses the tRNA of SEQ ID NO:21, variants and fragments thereof (including SEQ ID NO: 44). The tRNA fragment of SEQ ID NO: 44 only aligns to tRNA-SerGCT, therefore the terms “tRNA-SerGCT”, SEQ ID NO:21 and SEQ ID NO:44 can be used interchangeably herein.

Reference herein to the biomarker tRNA-lleGAT encompasses the tRNA of SEQ ID NO:22, variants and fragments thereof (including SEQ ID NO: 45). Reference herein to the biomarker tRNA-GlyGCC encompasses the tRNA of SEQ ID NO:23, variants and fragments thereof (including SEQ ID NO: 46). The tRNA fragment of SEQ ID NO: 46 only aligns to tRNA-GIyGCC, therefore the terms “tRNA-GlyGCC”, SEQ ID NO:23 and SEQ ID NO:46 can be used interchangeably herein.

Reference herein to the biomarker tRNA-LeuCAG encompasses the tRNA of SEQ ID NO:24, variants and fragments thereof (including SEQ ID NO: 47). Reference herein to the biomarker tRNA-ArgTCG encompasses the tRNA of SEQ ID NO:25, variants and fragments thereof (including SEQ ID NO: 48). The tRNA fragment of SEQ ID NO: 48 only aligns to tRNA- ArgTCG, therefore the terms “tRNA-ArgTCG”, SEQ ID NO:25 and SEQ ID NO:48 can be used interchangeably herein.

Reference herein to the biomarker tRNA-SerACT encompasses the tRNA of SEQ ID NO:26, variants and fragments thereof (including SEQ ID NO: 38 and, for example, SEQ ID NO: 45). Reference herein to the biomarker tRNA-SerTGA encompasses the tRNA of SEQ ID NO:27, variants and fragments thereof (including SEQ ID NO: 39). Reference herein to the biomarker tRNA-SerCGA encompasses the tRNA of SEQ ID NO:28, variants and fragments thereof (including SEQ ID NO: 39). Reference herein to the biomarker tRNA-SerAGA encompasses the tRNA of SEQ ID NO:29, variants and fragments thereof (including SEQ ID NO: 39). Reference herein to the biomarker tRNA-SupTTA encompasses the tRNA of SEQ ID NO:30, variants and fragments thereof (including SEQ ID NO: 40). Reference herein to the biomarker tRNA-ProTGG encompasses the tRNA of SEQ ID NO:31, variants and fragments thereof (including SEQ ID NO: 41). Reference herein to the biomarker tRNA-ProCGG encompasses the tRNA of SEQ ID NO:32, variants and fragments thereof (including SEQ ID NO: 41). Reference herein to the biomarker tRNA-LeuTAG encompasses the tRNA of SEQ ID NO:33, variants and fragments thereof (including SEQ ID NO: 47). Reference herein to the biomarker tRNA-LeuCAA encompasses the tRNA of SEQ ID NO:34, variants and fragments thereof (including SEQ ID NO: 47). Reference herein to the biomarker tRNA-LeuAAG encompasses the tRNA of SEQ ID NO:35, variants and fragments thereof (including SEQ ID NO: 47). A subset of the tRNA fragments described herein align with more than one tRNA (see table 1). For example, tRNA fragment of SEQ ID NO: 37 aligns to tRNA-GIyCCC and tRNA- GlyGCC.

The statements made herein in relation to SEQ ID NO: 37 equally apply to tRNA- GlyCCC or tRNA-GIyGCC.

Reference herein to use of SEQ ID NO: 37 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA-GlyCCC or tRNA- GlyGCC (including variants and fragments thereof) as a biomarker.

In another example, tRNA fragment of SEQ ID NO: 38 aligns to tRNA-IleAAT and tRNA- SerACT.

The statements made herein in relation to SEQ ID NO: 38 equally apply to tRNA- lleAAT or tRNA-SerACT.

Reference herein to use of SEQ ID NO: 38 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA-lleAAT or tRNA-SerACT (including variants and fragments thereof} as a biomarker.

In another example, tRNA fragment of SEQ ID NO: 39 aligns to tRNA-LeuTAA, tRNA-SerTGA, tRNA-SerGCT, tRNA-SerCGA and tRNA-SerAGA. The statements made herein in relation to SEQ ID NO: 39 equally apply to tRNA-LeuTAA, tRNA-SerTGA, tRNA-SerGCT, tRNA-SerCGA and tRNA-SerAGA. Reference herein to use of SEQ ID NO: 39 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA-LeuTAA, tRNA-SerTGA, tRNA-SerGCT, tRNA-SerCGA or tRNA-SerAGA (including variants and fragments thereof) as a biomarker.

In another example, tRNA fragment of SEQ ID NO: 40 aligns to tRNA-lysTTT and tRNA- SupTTA. The statements made herein in relation to SEQ ID NO: 40 equally apply to tRNA- lysTTT and tRNA-SupTTA. Reference herein to use of SEQ ID NO: 40 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA-lysTTT and tRNA- SupTTA (including variants and fragments thereof) as a biomarker.

In another example, tRNA fragment of SEQ ID NO: 41 aligns to tRNA-ProAGG, tRNA-ProTGG and tRNA-ProCGG. The statements made herein in relation to SEQ ID NO: 41 equally apply to tRNA-ProAGG, tRNA-ProTGG and tRNA-ProCGG. Reference herein to use of SEQ ID NO: 41 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA- ProAGG, tRNA-ProTGG or tRNA-ProCGG (including variants and fragments thereof) as a biomarker.

In another example, tRNA fragment of SEQ ID NO: 45 aligns to tRNA-lleGAT, tRNA-SerACT and tRNA-IleAAT. The statements made herein in relation to SEQ ID NO: 45 equally apply to tRNA-lleGAT, tRNA-SerACT and tRNA-lleAAT. Reference herein to use of SEQ ID NO: 45 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA- leGAT, tRNA-SerACT and tRNA-lleAAT (including variants and fragments thereof) as a biomarker.

In a final example, tRNA fragment of SEQ ID NO: 47 aligns to tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG. The statements made herein in relation to SEQ ID NO: 47 equally apply to tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG.

Reference herein to use of SEQ ID NO: 47 (or variants or fragments thereof) as a biomarker may also therefore apply to use of tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA or tRNA- LeuAAG (including variants and fragments thereof) as a biomarker.

Any one of SEQ ID NO: 13 to 48, variants or fragments thereof, may therefore be used as biomarkers as described herein. For simplicity, as used herein, the terms “miRNA” and “tRNA” (including the specified tRNA fragments provided in Table 1) encompass the specified RNA and fragments thereof. Typically, fragments are at least 15 nucleotides. For example, the fragments may be at least 15 nucleotides long, at least 20 nucleotides long, at least 25 nucleotides long etc. As would be clear a person of skill in the art, when discussing fragments, the specified number of nucleotides (e.g. at least 15 nucleotides long etc) are consecutive (i.e. are found immediately adjacent to each other within the miRNA or tRNA (or within the specified tRNA fragments provided in Table 1). For example, the fragments may be at least 15 nucleotides long, at least 16 nucleotides long, at least 17 nucleotides long, at least 18 nucleotides long, at least 19 nucleotides long, at least nucleotides long, at least 21 nucleotides long, at least 22 nucleotides long, at least 23 nucleotides long, at least 24 nucleotides long, at least 25 nucleotides long, at least 26 nucleotides long, at least 27 nucleotides long, at least 28 nucleotides long etc. A fragment may be any fragment that is detectable e.g. as a unique sequence for the RNA of 20 interest. Appropriate fragments for the specified miRNA and tRNA biomarkers provided herein can readily be identified by a person of skill in the art. Any methods for detecting the specified RNAs (e.g. by detecting the RNA in its entirety, or by detecting a fragment thereof) are encompassed by the methods, devices, kits and uses described herein. The biomarkers described herein therefore encompass the specified RNA as a whole, or a fragment thereof.

The methods, kits, devices and uses described herein are suitable for determining the level of at least one marker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIlyGCC, tRNA- IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or ii) MmiR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-660-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p. In this context, “determining the level” refers to any means for detecting the specified biomarker, including detecting fragments thereof.

In a particular example, the miRNA, tRNA or fragments thereof are of human origin.

Uses The inventors have identified that specific tRNAs (and/or tRNA fragments) freely circulating in blood may be used as biomarkers for stroke. In addition, they have identified certain freely circulating miRNAs as novel biomarkers for stroke.

The use of one or more biomarkers selected from the group consisting of: i} tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) MIR-98-5p, let-7d-5p and miR-486-3p as a biological fluid biomarker for stroke is therefore provided herein. These markers may be used as biomarkers for stroke generally. In this context “stroke generally” refers to all forms of stroke, including but not limited to ischemic and hemorrhagic stroke.

The inventors have also identified that a subset of miRNAs and tRNAs/tRNA fragments may be used as biomarkers to distinguish between ischemic and hemorrhagic stroke. The use of one or more biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iil) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p; as a biological fluid biomarker for distinguishing between hemorrhagic stroke and ischemic stroke is therefore also provided herein.

In an example, two or three or four of the specified biomarkers may be used.

For example, tRNA-AsnGTT and tRNA-SerGCT may be used.

Alternatively, tRNA-AsnGTT and miR-660-5p may be used.

In a further example, tRNA-SerGCT and miR-660-5p may be used. A combination of tRNA-AsnGTT, tRNA-SerGCT and miR-660-5p may also be used. In a further example, miR-101-3p and miR-108b-5p may be used. Alternatively, miR-101-3p and miR-107 may be used. In a further example, miR-106b-5p and miR-107 may be used.

A combination of miR-101-3p, miR-106b-5p and miR-107 may also be used. Any of the above combinations may also be combined with an additional tRNA marker, such as tRNA-ValTAC.

Details of the biomarkers, samples, methods, subjects, types of stroke etc are provided elsewhere and apply equally to this aspect. Methods for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject In one aspect, a method for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject is provided, the method comprising the steps of: a) determining the level of one or more biomarker in a biological fluid sample from the subject, wherein the one or more biomarker is selected from the group consisting of: i} tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p; b) comparing the level of the one or more biomarker with the level of the same biomarker in a control sample or with a pre-determined reference level for the same biomarker, wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; and c) identifying a subject as having stroke or having an increased risk of developing stroke based on the comparison in step b). The method is typically in vitro or ex vivo.

These markers may be used as biomarkers for stroke generally. In this context “stroke generally” refers to all forms of stroke, including but not limited to ischemic and hemorrhagic stroke.

The inventors have shown that the biomarkers described herein may be used to distinguish between a subject having or at increased risk of developing stroke and a subject that is not having stroke/is having a stroke mimic. In particular, it is possible to diagnose stroke in a subject or determine that the subject is at increased risk of developing stroke if the comparison in step b) indicates that the subject has one or more of the following: i} an increased level of a biomarker compared to the control sample or the pre-determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-LeuTAA, tRNA-ProAGG, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerGCT, tRNA-SerAGA, tRNA- ProTGG, tRNA-ProCGG, SEQ ID NO:39 and SEQ ID NO:41; or a fragment or variant thereof; and/or ii) a change in the level of a biomarker compared to the control sample or the pre-determined reference level, wherein the biomarker is selected from the group consisting of tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIlyGCC, tRNA-lleAAT, tRNA-LysTTT, tRNA-IleGAT, tRNA-GlyCCC, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SupTTA, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, miR-98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or a fragment or variant thereof.

In a further aspect, a method is provided for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke, the method comprising the steps of: a) determining the level of one or more biomarker in a biological fluid sample from the subject, wherein the one or more biomarker is selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-

SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iil) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-186b-5p, miR-98-5p, let-7d-5p and miR-486-3p; b) comparing the level of the one or more biomarker with the level of the same biomarker in a control sample or with a pre-determined reference level for the same biomarker; and c) distinguishing between ischemic stroke and hemorrhagic stroke in the subject based on the comparison in step b).

The method is typically in vitro or ex vivo. The inventors have shown that the biomarkers described above may be used to distinguish between ischemic stroke and hemorrhagic stroke.

In particular, it is possible to identify a subject as having ischemic stroke or having an increased risk of developing ischemic stroke when the comparison in step b) indicates that the subject has one or more of: i} an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, MiR-107, miR-185-5p, miR-196b-5p, miR- 20a-5p, miR-378a-3p, miR-486-3p, miR-660-5p, miR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having hemorrhagic stroke; ii) a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA- ArgTCT, tRNA-GIyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA- SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, and SEQ ID NO: 48, or a fragment or variant thereof, and wherein the control sample or pre-determined reference level is from a subject having hemorrhagic stroke; iii) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, miR-196b-5p, miR-378a-3p, miR-98-5p, let- 7d-5p, tRNA-LeuTAA, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerGCT, tRNA-SerAGA and SEQ ID NO: 39, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; iv) a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-LysTTT, tRNA-SupTTA, tRNA-IleGAT, tRNA-SerACT, tRNA- lleAAT, tRNA-GlyGCC, tRNA-GIyCCC, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:45 and SEQ ID NO:48, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; or v) an equivalent level of biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA- GlyGCC, tRNA-lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA- SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA- LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG, miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p, miR-196b-5p, miR- 98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36 to 48, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having ischemic stroke.

Furthermore, the inventors have shown that it is possible to identify a subject as having hemorrhagic stroke or having an increased risk of developing hemorrhagic stroke when the comparison in step b) indicates that the subject has one or more of: vi} a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-196b-5p, miR- 20a-5p, miR-378a-3p, miR-486-3p, miR-660-5p, miR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a subject having ischemic stroke; vii) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-

ArgTCT, tRNA-GIyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIlyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA- SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:

41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, and SEQ ID NO: 48, or a fragment or variant thereof, and wherein the control sample or pre-determined reference level is from a subject having ischemic stroke; viii) a decreased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-196-5p, miR-106b-5p, MiR-107, miR-185-5p, miR-20a-5p, miR- 378a-3p, MiR-486-3p, MmiR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA- LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic;

ix) an increased level of a biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA- ArgTCT, tRNA-GIyGCC, tRNA-lleAAT, tRNA-LeuTAA, tRNA-lleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-

SerAGA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 48, and SEQ ID NO: 48, or a fragment or variant thereof; and wherein the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic; and/or x) an equivalent level of biomarker compared to the control sample or the pre- determined reference level, wherein the biomarker is selected from the group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA- GlyGCC, tRNA-lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-

The term "subject" as used herein refers to, for example, humans, chimpanzees, Rhesus monkeys, dogs, cows, horses, cats, mice, rats, guinea pigs, pigs, chickens, etc. The subject is preferably a mammal, such as a human. The subject may be male or female.

The subject may be referred to herein as a patient. The terms “subject”, “individual”, and “patient” are used herein interchangeably. The subject can be symptomatic (e.g., the subject presents symptoms associated with stroke, for example ischemic stroke or hemorrhagic stroke), or the subject can be asymptomatic (e.g., the subject does not present symptoms associated with stroke, for example ischemic stroke or hemorrhagic stroke).

The subject may be diagnosed with, be at risk of developing or present with symptoms of stroke, for example ischemic stroke or hemorrhagic stroke. The subject may have, or be suspected of having (e.g. present with symptoms or a history indicative or suggestive of), stroke, for example ischemic stroke or hemorrhagic stroke.

Accordingly, in some examples, the subject has stroke (and the method diagnoses, identifies, (or detects) that the subject has stroke). In this context, the terms “diagnose” “identify”, and “detect” can be used interchangeably.

In particular examples, the subject has early stages of stroke. An example of an early stage of disease is when the subject has the initial symptoms of stroke but has not yet developed sufficient symptoms for diagnosis of disease. In such examples, the method may be considered as a method for determining the risk of developing stroke.

The term "prognosis" refers to the method by means of which a prediction of what will happen in the development or course of an illness, preferably stroke, is established. It is understood as the expected evolution of an illness and refers to the assessment of the probability according to which a subject suffers from an illness as well as the assessment of the onset thereof, state of development, evolution, or regression thereof, and/or the prognosis of the course of the illness in the future. As people skilled in the art will understand, this assessment, although it is preferred for it to be so, cannot normally be correct for 100% of the subjects that are to be diagnosed. However, the term requires a statistically significant part of the subjects to be identified as suffering from the illness or having predisposition to the same. The amount that is statistically significant can be established by a person skilled in the art by using different statistical tools, for example, but not limited to, by determining confidence intervals, determining the significant p value, Student's t test or Fisher's discriminant function, non- parametric Mann-Whitney measurements, Spearman's correlation, logistic regression, linear regression, area under the ROC curve (AUC). Preferably, the confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99%. Preferably, the p value is less than 0.1, than 0.05, than 0.01, than 0.005 or than 0.0001. Preferably, the present invention enables the illness to be correctly identified in a differential manner in at least 60%, more preferably in at least 70%, much more preferably in at least 80% or even more preferably in at least 90% of the subjects of a specific analyzed group or population. In particular examples, the subject has ischemic stroke. In other examples, the subject has hemorrhagic stroke.

The term “stroke” refers to or describes the pathophysiological condition that is typically characterized by rapidly developed clinical signs of focal (or global) disturbance of cerebral function with no apparent cause other than of vascular origin. Typically, the pathophysiology involves a reduced or interrupted blood supply to an area of the brain. This prevents cells in the area of the brain with reduced or interrupted blood supply from obtaining the oxygen and nutrients necessary for cell survival, ultimately leading to cell death. Examples of stroke include ischemic stroke and hemorrhagic stroke. In ischemic stroke the blood flow is reduced/interrupted by a blocked artery and in hemorrhagic stroke a ruptured artery is the cause. As used herein, the term “stroke” refers to all stages and all forms of stroke, unless the context specifies otherwise. Methods of diagnosing stroke are well known in the art (see figures 1 and 2). Typically, in hospitals, acute imaging is used as a first step to diagnosis. For example, a non-contrasted head computed tomography (CT) scan can be utilized to confirm the diagnosis of a hemorrhagic stroke. Alternatively, a combination of head CT, CT angiography, and CT perfusion imaging can be utilized to confirm the diagnosis but, especially in smaller strokes, can remain inconclusive. As an example, CT imaging from an individual having ischemic stroke typically shows a brain area that is hypodense {less dense=darker) than normal brain after about © hours of the ictus, whereas imaging from an individual having hemorrhagic stroke immediately shows a brain area that is hyperdense (more dense) and appear white on CT. Brain MRI may also be used in diagnosis of stroke, however, it is time consuming, costly and not always possible due to patient related contra-indications or the patient being restless.

Using currently available methods, final diagnosis of the type of stroke may therefore require several stages of clinical investigation, summarised in Figure 2.

The methods, kits, devices and uses described herein provide novel and improved means for stroke diagnosis and/or prognosis, and for distinguishing between ischemic and hemorrhagic stroke.

The methods described herein may be used to identify subjects that have stroke or that have an increased risk of developing stroke. In this context, the phrase “increased risk” indicates that the subject has a higher level of risk {or likelihood) that they will experience a particular clinical outcome. A subject may be classified into a risk group or classified at a level of risk based on the methods described herein, e.g. high, medium, or low risk. A “risk group” is a group of subjects or individuals with a similar level of risk for a particular clinical outcome.

In general, the methods described are in vitro or ex vivo methods that are performed using a sample that has already been obtained from the subject (i.e. the sample is provided for the method, and the steps taken to obtain the sample from the subject are not included as part of the method).

The methods may therefore include the step of providing a biological fluid sample from a subject.

As used herein, “provide”, "obtain" or "obtaining" can be any means whereby one comes into possession of the sample by "direct" or "indirect" means. Directly obtaining a sample means performing a process (e.g., performing a physical method such as extraction) to obtain the sample. Indirectly obtaining a sample refers to receiving the sample from another party or source (e.g., a third party laboratory that directly acquired the sample).

The methods provided herein comprise providing a biological fluid sample (for example a blood sample) from a subject. The samples being tested in the methods described herein are also referred to as “test samples”.

As used herein, the terms "biological sample”, “test sample”, "sample" and variations thereof refer to a sample obtained or derived from a subject. For the purposes described herein, the sample is, or comprises, a biological fluid (also referred to herein as a bodily fluid) sample. As used herein, the term “biological fluid sample” encompasses a blood sample, a saliva sample, a urine sample, a CSF sample etc. In a particular example, the biological fluid sample is a blood sample.

A blood sample may be a whole blood sample, or a processed blood sample e.g. serum, plasma etc. Methods for obtaining biological fluid samples (e.g. whole blood, serum, plasma, EV-depleted blood sample etc) from a subject are well known in the art. For example, methods for obtaining blood samples from a subject are well known and include established techniques used in phlebotomy. The obtained blood samples may be further processed using standard techniques to obtain e.g. a serum sample, or a plasma sample. Advantageously, methods for obtaining biological fluid samples from a subject are typically low-invasive or non-invasive. A whole blood sample is defined as a blood sample drawn from the human body and from which (substantially) no constituents (such as platelets or plasma) have been removed. In other words, the relative ratio of constituents in a whole blood sample is substantially the same as a blood in the body. In this context, “substantially the same” allows for a very small change in the relative ratio of the constituents of whole blood e.g. a change of up to 5%, up to 4%, up to 3%, up to 2%, up to 1% etc. Whole blood contains both the cell and fluid portions of blood. A whole blood sample may therefore also be defined as a blood sample with (substantially) all of its cellular components in plasma, wherein the cellular components (i.e. at least comprising the requisite white blood cells, red blood cells, platelets of blood) are intact. In a particular example, the blood sample is a plasma sample. Plasma is an example of an EV depleted blood sample. An EV-depleted blood sample refers to a blood sample that has been depleted of EVs. Methods to deplete EVs from a sample are well known in the art. For example, depletion of EVs is commonly achieved by high-speed centrifugation or ultracentrifugation.

In a particular example, the EV-depleted blood sample is an EV-depleted plasma sample. An EV-depleted sample is obtained from a blood sample. It is a processed sample that is depleted of EVs (i.e. it has a lower concentration of EVs compared to the concentration of EVs in the biological sample from which it was generated (e.g. whole blood, plasma etc). In this context, “depleted” refers to a sample or a process in which the proportion of EVs contained within a biological sample is decreased relative to other components of the sample. Depletion may be measured by comparing the number of EVs before and after the processing of the sample, where any decrease in the relative number of EVs compared to other components of the sample is considered depletion. Depletion may be measured in terms of concentration compared to the biological sample (e.g. the unprocessed sample, or the pre-cleared sample) from which the EV sample has been generated, wherein the concentration of EV's is at least

10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% etc lower than the concentration of EVs in the biological sample (e.g. the unprocessed sample, or the pre-cleared sample). Depletion may be measured in terms of the number EVs molecules such that a sample is depleted of about or at least about 2x, 3x, 4x, 5x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x. 50x. 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, 100x, 110x, 120x, 130x, 140x, 150x, 160x, 170x, 180x, 190x, 200x, 210x, 220x, 230x, 240x, 250x, 260x, 270x, 280x, 290x, 300x, 325x, 350%, 375x, 400x, 425x, 450x, 475%, 500x, 525%, 550x, 575x, 600x, 625x, 650x, 675x, 700x, 725x, 750x, 775%, 800x, 825%, 850x, 875x, 900x, 925x, 950x, 975x, 1000x, 1100x, 1200x, 1300x, 1400x, 1500x, 1600x, 1700x, 1800x, 1900x, 2000x (same as -fold) and all ranges derivable therein in EVs compared to the biological sample (e.g. the unprocessed sample, or the pre-cleared sample) from which the EV depleted sample has been generated. The level of depletion may be determined using EM and tunable resistive pulse sensing (TRPS). An EV depleted sample does not need to be 100% free from extracellular vesicles. Preferably, the EV depleted sample has a maximal amount of contaminating EVs. In other words, the EV depleted sample may be substantially depleted of EVs. In this context, a “maximal amount” may include up to 10% (by concentration) of EVs, up to 5%, up to 2%, up to 1%, up to 0.5%, up to 0.25%, up to 0.1% etc (by concentration) EVs. The level of EV contamination does not need to be 0%. The level of contamination may be determined using EM.

The EV-depleted sample may be substantially depleted from EVs. The term "substantially depleted" means the percentage of EVs in the population is significantly lower than that found in a biological sample (e.g. the unprocessed sample, or the pre-cleared sample) from which the EV-depleted sample has been generated {e.g., in a tissue or a blood stream of a subject). Typically, the percentage of EVs in a sample substantially depleted from EVs has a maximum 10% (by concentration), 5%, 2%, 1%, 0.5%, 0.25%, 0.1% etc of EVs (by concentration) in the total sample. Extracellular vesicles have been well characterised and have a well-defined meaning in the art (reviewed in Andaloussi et al., 2013; see also Van der Pol et al. 2012, and Sluijter et al. 2017). Extracellular vesicles have been isolated from several bodily fluids. They have been shown to play a key role in the regulation of physiological processes, including stem cell maintenance, immune surveillance and blood coagulation. They have also been shown to play a crucial role in the pathology underlying several diseases.

Methods for analysing (and optionally isolating, enriching for or extracting) biomarkers from blood, plasma, serum, etc samples have been described previously, see for example; Heitzer, E., Haque, I.S., Roberts, C.E.S. et al. Current and future perspectives of liquid biopsies in genomics-driven oncology. Nat Rev Genet 20, 71-88 (2019).

The methods provided herein include the step of determining the level of one or more biomarker in a biological fluid sample from the subject.

A biomarker is an organic biomolecule (e.g. miRNA, tRNA, protein, polypeptide, peptide, isomeric form thereof, immunologically detectable fragment thereof, corresponding nucleic acid molecule (e.g. mRNA, cDNA etc)) which is differentially present in a sample taken from a subject having a disease as compared with a subject not having the disease. A biomarker is differentially present if the mean or median level of the biomarker in the different groups is calculated to be statistically significant. Common tests for statistical significance include, among others, t-test (e.g., student t-test), ANOVA, Kruskal-Wallis, Wilcoxon, Mann- Whitney, Receiver Operating Characteristic (ROC curve), accuracy and odds ratio. Biomarkers, alone or in combination, provide measures of relative risk that a subject belongs to one phenotypic status or another. Therefore, they are useful as markers for disease (diagnostics), therapeutic effectiveness of a drug and drug toxicity.

In the context of the uses, methods, kits, devices etc described herein, the biomarker referred to is an RNA (e.g. miRNA or tRNA or fragment thereof) and is measured at the RNA level.

Each of the biomarkers referred to herein is listed below, using the “designation” given by the inventors and by their unique identifier sequence (which may be the complete sequence of the biomarker, or a fragment thereof): Target Sequence Mature tRNA gene Designation symbol of example en SEQ ID hsa-miR-185-5p UGGAGAGAAAGGCAGUUCCUGA en A a oa [TT [EE NO: 2

SEQ ID hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG oy | SEQ ID hsa-miR-660-5p UACCCAUUGCAUAUCGGAGUUG wo [TT SEQ ID hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA or | SEQ ID hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU ou | SEQ ID hsa-miR-196b-5p | UAGGUAGUUUCCUGUUGUUGGG or TEE SEQ ID hsa-miR-98-5p UGAGGUAGUAAGUUGUAUUGUU oy [TOT Em SEQ ID hsa-miR-106b-5p | UAAAGUGCUGACAGUGCAGAU oo [TEE SEQ ID hsa-miR-101-3p UACAGUACUGUGAUAACUGAA a | TEL SEQ ID hsa-miR-125a-5p | UCCCUGAGACCCUUUAACCUGUGA on [TEE SEQ ID hsa-miR-378a-3p | ACUGGACUUGGAGUCAGAAGGC en i SEQ ID tRNA-ArgTCT GGCUCUGUGGCGCAAUGGAUAGCGC | tRNA-Arg-TCT-5-1 NO: 13 AUUGGACUUCUAGCCUAAAUCAAGAG

AUUCAAAGGUUGCGGGUUCGAGUCC

CUCCAGAGUCG SEQ ID tRNA-GlyCCC GCAUUGGUGGUUCAGUGGUAGAAUU | tRNA-Gly-CCC-1-1 NO: 14 CUCGCCUCCCACGCGGGAGACCCGG

GUUCAAUUCCCGGCCAAUGCAA SEQ ID tRNA-lleAAT GGCCGGUUAGCUCAGUUGGUUAGAG | tRNA-lle-AAT-5-1 NO: 15 CGUGGUGCUAAUAACGCCAAGGUCG

CGGGUUCGAUCCCCGUACGGGCCA SEQ ID tRNA-LeuTAA ACCAGAAUGGCCGAGUGGUUAAGGC | tRNA-Leu-TAA-3-1 NO: 16 GUUGGACUUAAGAUCCAAUGGAUUCA

UAUCGCGUGGGUUCGAACCCCACUU

CUGGUA SEQ ID tRNA-LysTTT GCCCGGAUAGCUCAGUCGGUAGAGC | tRNA-Lys-TTT-3-1 NO: 17 AUCAGACUUUUAAUCUGAGGGUCCAG

GGUUCAAGUCCCUGUUCGGGCG

SEQ ID tRNA-ProAGG GGCUCGUUGGUCUAGGGGUAUGAUU | IRNA-Pro-AGG-2-1 NO: 18 CUCGCUUAGGGUGCGAGAGGUCCCG

GGUUCAAAUCCCGGACGAGCCC SEQ ID tRNA-ValTAC GGUUCCAUAGUGUAGUGGUUAUCAC | tRNA-Val-TAC-1-1 NO: 19 GUCUGCUUUACACGCAGAAGGUCCU

GGGUUCGAGCCCCAGUGGAACCA SEQ ID tRNA-AsnGTT GUCUCUGUGGCACAAUCGGUUAGCG | tRNA-Asn-GTT-21-1 NO: 20 CGUUCGGCUGUUAAUCUAGAGGUUG

GUGGUUAGAGCCCACUGAGGGAUG SEQ ID tRNA-SerGCT GACGAGGUGGCCGAGUGGUUAAGGC | tRNA-Ser-GCT-4-1 NO: 21 GAUGGACUGCUAAUCCAUUGUGCUC

UGCACGCGUGGGUUCGAAUCCCAUC

CUCGUCG SEQ ID tRNA-IleGAT GGCCGGUUAGCUCAGUUGGUAAGAG | tRNA-lle-GAT-1-1 NO: 22 CGUGGUGCUGAUAACACCAAGGUCG

CGGGCUCGACUCCCGCACCGGCCA SEQ ID tRNA-GlyGCC GCAUUGGUGGUUCAGUGGUAGAAUU | tRNA-Gly-GCC-5-1 NO:23 CUCGCCUGCCAUGCGGGCGGCCGGG

CUUCGAUUCCUGGCCAAUGCA SEQ ID tRNA-LeuCAG GUCAGGAUGGCCGAGCGGUCUAAGG | tRNA-Leu-CAG-1-7 NO: 24 CGCUGCGUUCAGGUCGCAGUCUCCC

CUGGAGGCGUGGGUUCGAAUCCCAC

UCCUGACA SEQ ID tRNA-ArgTCG GGCCGCGUGGCCUAAUGGAUAAGGC | tRNA-Arg-TCG-1-1 NO: 25 GUCUGACUUCGGAUCAGAAGAUUGC

AGGUUCGAGUCCUGCCGCGGUCG SEQ ID tRNA-SerACT GGCCGGUUAGCUCAGUUGGUUAGAG | tRNA-Ser-ACT-1-1 NO: 26 CGUGCUGCUACUAAUGCCAGGGUCG | (possible AGGUUUCGAUCCCCGUACGGGCCU pseudogene) SEQ ID tRNA-SerTGA GCAGCGAUGGCCGAGUGGUUAAGGC | tRNA-Ser-TGA-1-1 NO: 27 GUUGGACUUGAAAUCCAAUGGGGUC

UCCCCGCGCAGGUUCGAACCCUGCU

CGCUGCG SEQ ID tRNA-SerCGA GCUGUGAUGGCCGAGUGGUUAAGGC | tRNA-Ser-CGA-1-1 NO: 28 GUUGGACUCGAAAUCCAAUGGGGUC

UCCCCGCGCAGGUUCGAAUCCUGCU

CACAGCG SEQ ID tRNA-SerAGA GUAGUCGUGGCCGAGUGGUUAAGGC | tRNA-Ser-AGA-1-1 on | eeteureansseen |

UCCCCGCGCAGGUUCGAAUCCUGCC ee SEQID | tRNA-SupTTA GCCCGGAUAGUUCAGUUGGUAGAGC | tRNA-Sup-TTA-1-1 NO: 30 AUCAGACUUAAUCAGAGGGUCCAGG

GUUCAAGUCCCUGUUUGGGUG SEQID | tRNA-ProTGG GGCUCGUUGGUCUAGGGGUAUGAUU | tRNA-Pro-TGG-2-1 NO: 31 CUCGGUUUGGGUCCGAGAGGUCCCG

GGUUCAAAUCCCGGACGAGCCC SEQID | tRNA-ProCGG GGCUCGUUGGUCUAGGGGUAUGAUU | tRNA-Pro-CGG-1-1 NO: 32 CUCGCUUCGGGUGCGAGAGGUCCCG

GGUUCAAAUCCCGGACGAGCCC SEQID | tRNA-LeuTAG GGUAGCGUGGCCGAGCGGUCUAAGG | tRNA-Leu-TAG-1-1 NO: 33 CGCUGGAUUUAGGCUCCAGUCUCUU

CGGAGGCGUGGGUUCGAAUCCCACC

GCUGCCA SEQID | tRNA-LeuCAA GUCAGGAUGGCCGAGUGGUCUAAGG | tRNA-Leu-CAA-1-1 NO: 34 CGCCAGACUCAAGUUCUGGUCUCCAA

UGGAGGCGUGGGUUCGAAUCCCACU

UCUGACA SEQ ID | tRNA-LeuAAG GGUAGCGUGGCCGAGCGGUCUAAGG | tRNA-Leu-AAG-1-1 NO: 35 CGCUGGAUUAAGGCUCCAGUCUCUU

CGGAGGCGUGGGUUCGAAUCCCACC

GCUGCCA SEQ ID | tRNA- fragment GAAGGUUGUGGGUUCG Aligns to tRNA- ow | [TEE ae SEQ ID | tRNA- fragment GCAUUGGUGGUUCAGUGGUAGAAUU | Aligns to tRNA- NO:37 CUCGC GlyCCC; also aligns to IRNA-GlyGCC SEQ ID | tRNA- fragment UGUUAGCUCAGUUGGUUAGAGCACU | Aligns to tRNA- NO:38 GUG IleAAT; also aligns to tRNA- SerACT SEQ ID | tRNA- fragment GCCGAGUGGUUAAGG Aligns to tRNA- NO:39 LeuTAA,; also aligns to tRNA- SerTGA, tRNA-SerGCT, tRNA-SerCGA and tRNA-SerAGA SEQ ID | tRNA- fragment GCCCGGAUAGCUCAGUUGGUAGAGC | Aligns to tRNA- NO:40 AGUG LysTTT,; also aligns to tRNA-SupTTA

SEQ ID tRNA- fragment UGGUCUAGGGGUAUGG Aligns to tRNA- NO:41 ProAGG; also aligns to tRNA-ProTGG and SEQ ID tRNA- fragment GGUUCCAUAGUGUAG Aligns to tRNA- ow | [TEE fe SEQ ID tRNA-fragment GUUAAUCGAGAGGUU Aligns to tRNA- es a = SEQ ID tRNA- fragment GACGACGUGGCCGAGUGGUUAAGG Aligns to tRNA- ee a a SEQ ID tRNA- fragment GGCCGGUUAGCUCAGUUGG Aligns to tRNA- NO:45 IleGAT,; also aligns to tRNA- SerACT and SEQ ID tRNA- fragment GCAUGGGUGGUUCAGUGGUAGAAUU | Aligns to tRNA- pd a SEQ ID tRNA-fragment GGAGGCGUGGGUUCG Aligns to tRNA- NO:47 LeuCAG; also aligns to tRNA-LeuTAG, tRNA-LeuCAA and SEQ ID tRNA-fragment ACUUCGAAUCAGAAGAUUGUAGGUUC | Aligns to tRNA- ow | [EEE ee Table 1: biomarkers — note that “hsa” is standard nomenclature to refer to miRNAs that are of human origin. The canonical miRNA sequences from miRBase (release 22.1) are given here; however, all variants that derive from the same miRNA, including isomiRs and editing variants, are also intended. For mature tRNAs (SEQ IDs 13-35), we give sequences of one gene per anticodon, including the corresponding gtRNAdb gene symbol (release 18.1), as examples. As further examples, we included a prevalent tRNA fragment that we identified using RNA- sequencing for each tRNA (SEQ IDs 36 - 48). As stated elsewhere herein, use of these markers as biomarkers includes detection of the complete sequence identified in this table, or a fragment thereof.

Conventional "determining" methods may include sending a clinical sample(s) to a commercial laboratory for measurement of the biomarker levels in the biological fluid sample, or the use of commercially available assay kits for measuring the biomarker levels in the biological fluid sample. Exemplary kits and suppliers will be apparent to a person of skill in the art. In various examples, biomarkers may be determined, detected and/or quantified using conventional methods used for detecting RNA. For example, the RNA biomarker may be detected using Southern or Northern blot analysis, PCR, RNA-SEQ or RT-PCR or probe assays. For example, a sample may be contacted with a nucleic acid molecule (i.e. a probe, such as a labelled probe) that can hybridise to the RNA marker. Such techniques are known in the art.

The level of biomarker present in the biological fluid sample is typically determined by assaying the amount of the biomarker present in the sample. Assays for measuring the amount of a specified RNA are well known in the art and include direct or indirect measures.

The level of biomarker in a sample may also be determined by determining the level of biomarker activity in a sample. Accordingly, “level” encompasses both the amount of biomarker per se (i.e. its concentration), or its level of activity.

In an example, the methods and uses described herein determine the level of two or three or four of the specified biomarkers.

For example, in the context of methods that are for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject, the level of two or three or four biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p; may be determined. For example, the level of two or three or four biomarkers selected from the sub-group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-ArgTCG, miR-98-5p, let-7d-5p and miR-486-3p may be determined. In another example, the level of two or three or four biomarkers selected from the sub-group consisting of: tRNA-SerGCT, tRNA-ArgTCG, SEQ ID NO: 39, SEQ ID NO:47, or fragments or variants thereof may be determined.

In another example, in the context of methods that are for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke, the level of two or three or four biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or ii) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p; may be determined. For example, the level of two or three or four biomarkers selected from the sub-group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA-ArgTCG, miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185- 5p and miR-378a-3p may be determined. In another example, the level of two or three or four biomarkers selected from the sub-group consisting of: tRNA-SerGCT, tRNA-ArgTCG, SEQ ID NO: 39, SEQ ID NO:47, or fragments or variants thereof may be determined.

In an alternative example, the methods described herein determine the level of at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten of the specified biomarkers.

In a preferred example, in the context of methods that are for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke, the level of: (i) tRNA-AsnGTT and tRNA-SerGCT; (ii) tRNA-AsnGTT and miR-660-5p; or (iii) tRNA-SerGCT and miR-680-5p; is determined.

For example, in the context of methods that are for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke, the level of tRNA-AsnGTT, tRNA-SerGCT and miR-660-5p may be determined.

In another preferred example, in the context of methods that are for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke, the level of: (i) miR-101-3p and miR-106b-5p;

(ii) miR-101-3p and miR-107; or (iii) miR-106b-5p and miR-107 is determined.

For example, in the context of methods that are for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke, the level of miR-101-3p, miR-106b-5p and miR-107 may be determined.

Any of the above specific miRNA combinations may also be combined with determining the level of a tRNA such as tRNA-ValTAC.

Methods described herein further comprise comparing the level of the at least one biomarker (i.e. its amount per se or its activity) in the biological fluid sample (“test sample”) with the level of the same biomarker in a control sample or with a predetermined reference level for the same biomarker.

In one example, the methods described may include contacting a control biological fluid sample with a compound or agent capable of detecting a specific biomarker and comparing the level of the biomarker in the control sample with the presence of the same biomarker in the test sample.

Methods described herein that are for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject compare the level of chosen biomarker(s) in the test sample with the level of the same biomarker(s) in a control sample or pre- determined reference level. Typically, for such methods, the control sample or pre-determined reference level is from a control subject that does not have stroke or has a stroke mimic.

Methods described herein that are for distinguishing between ischemic stroke and hemorrhagic stroke may compare the level of chosen biomarkers in the test sample with the level of these biomarkers in a control sample or pre-determined reference level, wherein the control sample or pre-determined reference level may be one of the following, as appropriate: (i) from a subject that does not have stroke or has a stroke mimic; (ii) from a subject having hemorrhagic stroke; or (iii) from a subject having ischemic stroke. The subject described in (i) to (iii) can be the same age, sex or in the same state or condition of health as the subject from which the test sample is obtained.

For the avoidance of doubt, the sample or pre-determined reference level of (i) to (iii) is referred to herein as the “control sample or pre-determined reference level” as it is the control against which the test sample is compared in order to make a diagnosis, prognosis or determine a risk factor. As would be clear to a person of skill in the art, the control can be a positive or negative control. As used herein, an individual that “does not have stroke” is an individual that does not have reduced or interrupted blood supply caused by an occlusion blocking an artery or a ruptured artery to an area of the brain which could result in an abnormal CT scan of the brain. As used herein, an abnormal CT scan encompasses a CT image showing a brain area that is less dense (darker) than normal brain (as per ischemic stroke) or a brain area that is more dense and appear white on a normal brain on CT (as per hamarrhagic stroke). Where necessary, an MRI may be performed at a later stage to establish a distinction between a suspected stroke vs. stroke mimic.

A control sample that is obtained from an individual that does not have stroke in this context therefore refers to a biological fluid sample (e.g. a blood sample) that has been obtained from an individual of the same species, where the individual does not have reduced or interrupted blood supply to an area of the brain which results in an abnormal CT scan of the brain. Examples of individuals that do not have stroke includes individuals having a stroke mimic. Stroke mimics are medical conditions that present with an acute neurological deficit simulating acute stroke. In other words, stroke mimics are conditions that have symptoms similar to stroke, for example hemiparesis or vertigo, but are caused by a different pathology, for example epilepsy, migraine or benign paroxysmal positional vertigo. Accordingly, as used herein, an individual that has “a stroke mimic” is an individual that has a medical condition that presents with an acute neurological deficit mimicking acute stroke. Methods for identifying whether an individual has a stroke mimic are well known in the art, but remain challenging (see Figure 2). A control sample that is obtained from an individual that has a stroke mimic in this context therefore refers to a biological fluid sample (e.g. a blood sample) that has been obtained from an individual of the same species, where the individual has a medical condition that presents with an acute neurological deficit simulating acute stroke.

As used herein, an individual that is having “hemorrhagic stroke” is an individual that has an accumulation of blood in brain tissue resulting from a ruptured or leaking blood vessel. In other words, an individual that is having “hemorrhagic stroke” is an individual that has intracerebral hemorrhage.

The term “hemorrhagic stroke” encompasses all forms and stages including, for example, hemorrhagic stroke caused by lobar, basal ganglia and posterior fossa hematoma (see table 2). Methods for identifying whether an individual has an accumulation of blood in brain tissue resulting from a ruptured or leaking blood vessel are well known in the art, see Figure 2. For example, CT imaging from an individual having hemorrhagic stroke shows a brain area that is more dense (white) on CT compared to normal brain.

A sample that is obtained from an individual that is having hemorrhagic stroke this context therefore refers to a biological fluid sample (e.g. a blood sample) that has been obtained from an individual of the same species, where the individual has an accumulation of blood in brain tissue resulting from a ruptured or leaking blood vessel (e.g. has a CT scan showing a brain area that is more dense (white) on CT compared to normal brain). As used herein, an individual that is having “ischemic stroke” is an individual that has a loss of blood supply to an area of the brain, this can be caused by, for example, thrombotic or embolic occlusion of a cerebral artery.

The term “ischemic stroke” encompasses all forms and stages including, for example, ischemic stroke caused by a large vessel occlusion, small vessel occlusion, or cryptogenic stroke and cardioembolic stroke (see table 2). Methods for identifying whether an individual has a loss of blood supply to an area of the brain are well known in the art, see for example Figure 2. For example, CT imaging from an individual having ischemic stroke shows a brain area that is less dense (darker) on CT compared to normal brain.

CT-angiography may also/alternatively be used to diagnose ischemic stroke patients with a LVO.

A sample that is obtained from an individual that is having ischemic stroke this context therefore refers to a biological fluid sample (e.g. a blood sample) that has been obtained from an individual of the same species, where the individual has a loss of blood supply to an area of the brain (e.g. has a CT scan showing a brain area that is less dense (darker) on CT compared to normal brain). A table summarizing the different subtypes of ischemic and hemorrhagic stroke is provided below.

Gemeen

Table 2. Different subtypes of ischemic and hemorrhagic stroke.

The control sample may be assayed at the same time, before or after, separately or simultaneously with the test sample. The control value that is used in the comparison with the test sample may be a value that is calculated as an average or median of more than one (e.g.

two or more, five or more, ten or more, a group etc) of control samples. Alternatively, the control sample may be a sample that originated from (i.e. is a mix of) more than one (e.g. two or more, five or more, ten or more, a group etc) individual.

In one example, the control sample is therefore obtained from a control subject that does not have stroke or has a stroke mimic. In a further example, the control sample is obtained from a subject that has hemorrhagic stroke. Alternatively, the control sample is obtained from a subject that has ischemic stroke.

Alternatively, the level of biomarker in the biological fluid sample may be compared to a pre- determined reference level for the biomarker of interest.

As used herein, a “predetermined reference level” refers to a biomarker level obtained from a reference database, which may be used to generate a pre-determined cut off value, i.e. a score that is statistically predictive of stroke (e.g. hemorrhagic stroke or ischemic stroke). In one example, the predetermined reference level is the average or median level of the biomarker in at least one individual not suffering from stroke from the same species. The predetermined reference value may be calculated as the average or median, taken from a group or population of individuals that are not suffering from stroke. For example, the predetermined reference value may be calculated as the average or median, taken from a group or population of individuals that have a stroke mimic. The individual or the population of individuals can be the same age, sex or in the same state or condition of health as the subject from which the test sample is obtained.

In one example, the pre-determined reference level is therefore the average level of the biomarker in a control subject that does not have stroke. In a further example the pre- determined reference level is the average level of the biomarker in a subject that has a stroke mimic.

Typically, in methods for providing a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject {or distinguishing between hemorrhagic and ischemic stroke, where appropriate), the control sample or predetermined reference are obtained from an individual or group of individuals that are distinct from the subject that is being tested (i.e. the subject from which the test sample is obtained/provided). In such examples, the control or predetermined reference are used as a bench line to determine whether the tested subject has or is at risk of having stroke (or to distinguish between whether the tested subject has or is at risk of having ischemic stroke or hemorrhagic stroke). In an alternative example, the control or predetermined reference value may be obtained from the same individual as the test sample, but at an earlier time point.

This is particularly relevant for the methods described herein that monitor stroke progression in a subject.

In such examples, the control sample or predetermined reference level is used to determine any changes in the level of the biomarker(s) over a time interval for the same subject.

The pre-determined reference level or control sample can therefore be from the same subject that the test sample is obtained from, for example obtained at an earlier time point.

This earlier time point can be before they were diagnosed with or known to be at risk of developing stroke (e.g. ischemic or hemorrhagic stroke). A pre-determined level can be single cut-off value, such as a median or mean.

It can be a range of cut-off (or threshold) values, such as a confidence interval.

It can be established based upon comparative groups, such as where the risk in one defined group is a fold higher, or lower, (e.g., approximately 2-fold, 4-fold, 8-fold, 18-fold or more) than the risk in another defined group.

It can be a range, for example, where a population of subjects (e.g., control subjects) is divided equally (or unequally) into groups, such as a low-risk group, a medium- risk group and a high-risk group, or into quartiles, the lowest quartile being subjects with the lowest risk and the highest quartile being subjects with the highest risk, or into n-quantiles (i.e, n regularly spaced intervals) the lowest of the n-quantiles being subjects with the lowest risk and the highest of the n-quantiles being subjects with the highest risk.

Moreover, the reference could be a calculated reference, most preferably the average or median, for the relative or absolute amount of a biomarker of a population of individuals comprising the subject to be investigated.

How to calculate a suitable reference value, preferably, the average or median, is well known in the art.

The population of subjects referred to before shall comprise a plurality of individuals, preferably, at least 5, 10, 50, 100, 1,000 subjects.

Thus, in some cases the level of the biomarker in a subject being greater than or equal to the level of the biomarker of the control sample or pre-determined reference level is indicative of a clinical status (e.g., indicative of stroke, e.g. ischemic or hemorrhagic stroke, as appropriate).

In other cases the level of the biomarker in a subject being less than or equal to the level of biomarker of the control sample or predetermined reference level is indicative of a clinical status (e.g. indicative of stroke, e.g. ischemic or hemorrhagic stroke, as appropriate). The amount of the greater than and the amount of the less than is usually of a sufficient magnitude to, for example, facilitate distinguishing a subject from a control subject using the methods described herein. Typically, the greater than, or the less than, that is sufficient to distinguish a subject from a control subject is a statistically significant greater than, or a statistically significant less than. In cases where the level of the biomarker in a subject being equal to the level of the biomarker in a control subject is indicative of a clinical status, the "being equal” refers to being approximately equal (e.g., not statistically different).

The pre-determined value can depend upon a particular population of subjects (e.g., human subjects) selected. For example, an apparently healthy population will have a different 'normal’ range of the biomarker than will a population of subjects which have, or are likely to have, stroke. Accordingly, the pre-determined values selected may take into account the category (e.g., healthy, at risk, diseased) in which a subject (e.g., human subject) falls. Appropriate ranges and categories can be selected with no more than routine experimentation by those of ordinary skill in the art.

Suitably, the level of the specific biomarker detected in a sample (e.g. a test sample, a control sample etc) may be normalized by adjusting the measured level (amount or activity) of the biomarker using the level of a reference RNA in the same sample, wherein the reference RNA is not a marker itself (it is e.g., an RNA that is constitutively expressed). This normalization allows the comparison of the biomarker level in one sample to another sample, or between samples from different sources. This normalized level can then optionally be compared to a reference value or control.

For example, when measuring a biomarker in a whole blood sample the biomarker may be expressed as an absolute concentration or, alternatively, it may be normalized against a known RNA constitutively expressed in the biological sample of interest. Such RNAs can readily be identified by a person of skill in the art. For example, in the context of plasma (e.g. an EV depleted plasma sample), an RNA selected from the group consisting of. let-7i-5p, miR-30e-5p, miR-93-5p, MiR-425-5p or combinations thereof may be used (see for example Faraldi, et al. 2019).

The biomarker level(s) in the test sample may be compared to the level of the same biomarker in a control sample or with a pre-determined reference level for the same biomarker to identify an increase or decrease in a level of the one or more biomarker in the sample of the subject. In a particular example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an increased level of SEQ ID NO: 38 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 39 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an increased level of SEQ ID NO: 41 (or a fragment or variant thereof)in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 41 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of tRNA-ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of SEQ ID NO: 38 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV- depleted blood sample obtained from them) compared to the level of SEQ ID NO: 38 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of SEQ ID NO: 40 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV- depleted blood sample obtained from them) compared to the level of SEQ ID NO: 40 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of SEQ ID NO: 45 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV- depleted blood sample obtained from them) compared to the level of SEQ ID NO: 45 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of tRNA-GIyGCC (e.g. SEQ ID NO: 23 or 46, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-GIyGCC (e.g. SEQ ID NO: 23 or 48, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of miR-98-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-98-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of miR-486-3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-486-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of let-7d-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of let-7d-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of tRNA-ArgTCT (e.g. SEQ ID NO: 13 or 36, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ArgTCT (e.g. SEQ ID NO: 13 or 36, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of SEQ ID NO: 37 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV- depleted blood sample obtained from them) compared to the level of SEQ ID NO: 37 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of SEQ ID NO: 47 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV- depleted blood sample obtained from them) compared to the level of SEQ ID NO: 47 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In another example, the subject may be identified as having stroke or as having an increased risk of developing stroke when they have an changed level (e.g. increased or decreased level) of tRNA-ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

The methods described herein can also be used to distinguish between hemorrhagic and ischemic stroke. In other words, the methods described herein can be used to identify that a subject has ischemic stroke or has an increased risk of developing ischemic stroke. In this context, the markers may also be used to provide a prognosis for a patient identified as having an ischemic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-101- 3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-101-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-106b- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-106b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-107 in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-107 in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-185- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-185-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-198b- Sp in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-196b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-20a- Sp in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-20a-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-378a- 3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-378a-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-486- 3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-486-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-660- Sp in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-660-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-98-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-98-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of let-7d-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of let-7d-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of SEQ ID NO: 47 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 47 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- ValTAC (e.g.

SEQ ID NO: 19 or 42, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ValTAC (e.g.

SEQ ID NO: 19 or 42, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of miR-125a- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level miR-125a-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 39 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 39 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 45 (or a fragment or variant thereof} in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 45 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- GlyGCC (e.g. SEQ ID NO: 23 or 46, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-GIyGCC (e.g. SEQ ID NO: 23 or 48, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 38 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 38 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 40 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 40 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- ArgTCT (e.g. SEQ ID NO: 13 or 36, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ArgTCT (e.g. SEQ ID NO: 13 or 38, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 37 (or a fragment or variant thereof} in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 37 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 41 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 41 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA- SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having hemorrhagic stroke.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-101-

3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-101-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-106b- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-106b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-196b- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-196b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-378a- 3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level miR-378a-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of miR-98-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level miR-98-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of let-7d-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level let-7d-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have an increased level of SEQ ID NO: 39 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level SEQ ID NO: 39 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 40 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level SEQ ID NO: 40 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 45 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 45 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of tRNA- GlyGCC (e.g.

SEQ ID NO: 23 or 46, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-GIyGCC (e.g.

SEQ ID NO: 23 or 48, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having ischemic stroke or as having an increased risk of developing ischemic stroke when they have a decreased level of SEQ ID NO: 37 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 37 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

As stated previously, the methods may also be used to identify that a subject has hemorrhagic stroke or has an increased risk of developing hemorrhagic stroke.

In this context, the markers may also be used to provide a prognosis for a patient identified as having a hemorrhagic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 101-3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-101-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 106b-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-106b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 107 in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-107 in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 185-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-185-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 196b-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-196b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 20a-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-20a-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 378a-3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-378a-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 486-3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-486-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 660-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-660-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of miR- 98-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-98-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of let-7d- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of let-7d-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an decreased level of SEQ ID NO: 47 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 47 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of miR- 125a-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-125a-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in a control sample or pre- determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 39 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 39 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 45 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 45 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- GlyGCC (e.g. SEQ ID NO: 23 or 48, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-GIyGCC (e.g. SEQ ID NO: 23 or 46, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 38 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 38 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 40 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 40 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- ArgTCT (e.g. SEQ ID NO: 13 or 36, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ArgTCT (e.g. SEQ ID NO: 13 or 36, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 37 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 37 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 41 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 41 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA- SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals having ischemic stroke. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 106b-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-106b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 107 in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-107 in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR-

185-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-185-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 196b-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-196b-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 20a-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-20a-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 378a-3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-378a-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 486-3p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-486-3p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of miR- 98-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-98-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of let-7d- 5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of let-7d-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have a decreased level of SEQ ID NO: 47 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 47 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of miR- 125a-5p in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of miR-125a-5p in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- ArgTCT (e.g. SEQ ID NO: 13 or 36, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ArgTCT (e.g. SEQ ID NO: 13 or 38, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 37 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 37 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic. In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 45 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 45 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- GlyGCC (e.g. SEQ ID NO: 23 or 48, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-GIyGCC (e.g. SEQ ID NO: 23 or 46, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 38 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 38 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 39 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 39 (or a fragment or variant thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of SEQ ID NO: 41 (or a fragment or variant thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of SEQ ID NO: 41 (or a fragment or variant thereof} in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of tRNA- SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in their blood/plasma (e.g. in an EV-depleted blood sample obtained from them) compared to the level of tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) in a control sample or pre-determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

In one example, a subject may be identified as having hemorrhagic stroke or as having an increased risk of developing hemorrhagic stroke when they have an increased level of ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in their blood/plasma (e.g.

in an EV-depleted blood sample obtained from them) compared to the level of ArgTCG (e.g. SEQ ID NO: 25 or 48, including fragments or variants thereof) in a control sample or pre- determined reference sample that has been obtained from an individual or individuals without stroke or with a stroke mimic.

The term “change” refers in this context to a statistically significant difference in the biomarker level for the sample obtained from the test subject compared to the biomarker levels obtained from the control sample or predetermined reference level. The difference (or change) may be an increase or decrease in biomarker levels compared to the control sample or predetermined reference level.

The terms "decrease", "decreased", "reduced", "reduction" or 'down- regulated”, “lower” are all used herein generally to mean a decrease by a statistically significant amount. However, for the avoidance of doubt, "reduced", "reduction", "decreased" or "decrease" means a decrease by at least 10% as compared to a reference level/control, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. absent level as compared to a reference/control sample), or any decrease between 10-100% as compared to a reference level/control, or at least about a 0.5-fold, or at least about a 1.0-fold, or at least about a 1.2-fold, or at least about a 1.5-fold, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold decrease, or any decrease between 1.0-fold and 10-fold or greater as compared to a reference level/control. The terms "increased", "increase" or "up-regulated", “higher” are all used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms "increased" or "increase" means an increase of at least 10% as compared to a reference level/control, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level/control, or at least about a 0.5-fold, or at least about a 1.0-fold, or at least about a 1.2-fold, or at least about a 1.5-fold, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5 -fold or at least about a 10-fold increase, or any increase between 1.0-fold and 10-fold or greater as compared to a reference level/control.

The methods can further comprise selecting, and optionally administering, a treatment regimen for the subject based on the diagnosis and/or prognosis (i.e., based on the comparison of the levels of the biomarkers with the reference levels/controls). However, in some cases, immediate treatment may not be required, and the subject may be selected for active surveillance.

As used herein, the terms “active surveillance”, “monitoring” and “watchful waiting” are used interchangeably herein to mean closely monitoring a patient's condition without giving any treatment until symptoms appear or change.

As used herein, the terms “treat”, “treating” and "treatment" are taken to include an intervention performed with the intention of preventing the development or altering the pathology of a condition, disorder or symptom (i.e. in this case stroke, e.g. hemorrhagic or ischemic stroke as appropriate). Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted condition, disorder or symptom. “Treatment” therefore encompasses a reduction, slowing or inhibition of the symptoms of the stroke in question, for example of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% when compared to the symptoms before treatment.

The type of treatment will vary depending on the particular form of stroke that the subject has, is suspected of having, is at risk of developing, or is suspected of being at risk of developing.

For example, if the subject has, is suspected of having, is at risk of having, or is suspected of being at risk of having ischemic stroke, the subject may benefit from treatment with for example intravenous administration of recombinant tissue plasminogen activator (IV-rtPA) and/or endovascular thrombectomy.

Accordingly, the method may include the step of administering one or more of these treatments to the subject.

Other suitable treatments are well known to a person of skill in the art and depend on the specific symptoms of the subject.

As a further example, if the subject has, is suspected of having, is at risk of having, or is suspected of being at risk of having hemorrhagic stroke, the subject may benefit from treatment with for example antihypertensives (to control the blood pressure} and/or neurosurgical intervention {to remove (a part of) the hemorrhage if the intercranial pressure is too high). Suitable antihypertensives are well known in the art.

When a therapeutic agent or other treatment is administered, it is administered in an amount and/or for a duration that is effective to treat the stroke in question or to reduce the likelihood (or risk) of stroke developing in the future.

An effective amount is a dosage of the therapeutic agent sufficient to provide a medically desirable result.

The effective amount will vary with the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration and the like factors within the knowledge and expertise of the health care practitioner.

For example, an effective amount can depend upon the degree to which a subject has abnormal levels of certain analytes (e.g., biomarkers as described herein} that are indicative of stroke.

It should be understood that the therapeutic agents described herein are used to treat and/or prevent stroke.

Thus, in some cases, they may be used prophylactically in subjects at risk of developing stroke.

Thus, in some cases, an effective amount is that amount which can lower the risk of, slow or perhaps prevent altogether the development of stroke.

It will be recognized when the therapeutic agent is used in acute circumstances, it is used to prevent one or more medically undesirable results that typically flow from such adverse events.

Methods for selecting a suitable treatment, an appropriate dose thereof and modes of administration will be apparent to one of ordinary skill in the art.

The medications or treatments described herein can be administered to the subject by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be by infusion or by intramuscular, intravascular, intracavity, intracerebral, intralesional, rectal, subcutaneous, intradermal, epidural, intrathecal, percutaneous administration. The medications may also be given in e.g. tablet form or in solution. Several appropriate medications and means for administration of the same are well known for treatment of stroke.

Methods for monitoring stroke progression A method for monitoring stroke progression in a subject is also provided herein, the method comprising the steps of: i) determining the level of one or more biomarker in a biological fluid sample from the subject in accordance with steps a) to b) of the methods for providing a diagnosis and/or prognosis of stroke or distinguishing between ischemic and hemorrhagic stroke described above; and ii} repeating step i) for the same subject after a time interval; and iii) comparing the biomarker levels identified in i) with the biomarker levels identified in ii), wherein a change in the biomarker levels from i) to ii) is indicative of a change in stroke progression in the subject.

The method is typically in vitro or ex vivo.

The method may be used to monitor the progression of stroke in general, ischemic stroke or hemorrhagic stroke, as appropriate.

Typically, such monitoring methods are performed on subjects that have not yet been treated for the stroke that they are being monitored for (i.e. stroke in general, ischemic stroke or hemorrhagic stroke, as appropriate). Such subjects are described as “naive” subjects herein. However, such monitoring methods also encompass methods performed on subjects that have already been treated for stroke previously.

Monitoring the progression of stroke (and specifically ischemic or hemorrhagic forms of stroke) in a subject over time assists in the earliest possible identification of disease progression (e.g. a worsening in disease status or disease symptoms). Such monitoring naturally involves the taking of repeated samples over time. The method may therefore be repeated at one or more time intervals for a particular subject and the results compared to monitor the development, progression or improvement in the stroke (and specifically of the ischemic or hemorrhagic forms of stroke) of that subject over time, wherein a change in the amount of level of the one or more biomarker tested for in the biological fluid sample (e.g. blood) is indicative of a change in the progression of the stroke (and specifically the ischemic or hemorrhagic forms of stroke) in the subject.

Disease progression (e.g. stroke progression, including the progression of ischemic and hemorrhagic forms of stroke) may be indicated by an increase in the level of SEQ ID NO:39 or SEQ ID NO: 41 (or fragments or variants thereof) detected over time when the results of two or more time intervals are compared for the same subject. In other words, if the method is performed a plurality of times, disease progression may be indicated when the level of SEQ ID NO:39 or SEQ ID NO: 41 (or fragments or variants thereof)detected at the later time interval(s) is higher than that detected at the earlier time interval(s). An “increase” in the level of SEQ ID NO: 39 (or SEQ ID NO:41) encompasses detection of SEQ ID n0O:39 (or SEQ ID NO:41) at a later time interval when no SEQ ID NO:39 (or SEQ ID NO:41) was detected (i.e. it was not present at detectable levels) when the method was performed previously (i.e. at an earlier time interval) on the same subject (and an equivalent biological fluid sample type). This is particularly relevant when monitoring the progression of stroke in naive subjects. The above examples are given for illustration only. A person of skill in the art would readily be able to identify the appropriate biomarker levels that correlate with disease progression (for general stroke, ischemic stroke and/or hemorrhagic stroke) for any of the markers identified herein using the data and information provided herein. Suitable time intervals for monitoring disease progression can easily be identified by a person of skill in the art and will depend on the specific form of stroke being monitored. As a non- limiting example, the method may be repeated at least every 6 hours, or whenever clinically needed, i.e. in case of a significant change in stroke symptoms. Details of the biomarkers, combinations, samples, methods steps, subjects, types of stroke etc are provided elsewhere and apply equally to this aspect. Kits and assay devices In another aspect, kits are provided for the diagnosis and/or prognosis of stroke or for determining the risk of developing stroke in a subject, or for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke. The kits include reagents suitable for determining levels of a plurality of analytes in a test sample (e.g., reagents suitable for determining levels of the biomarkers disclosed herein).

The kits for the diagnosis and/or prognosis of stroke or determining the risk of developing stroke described herein typically comprise at least two detectably labelled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p. The kits for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke typically comprise at least two detectably labelled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or ii) MIR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-488-3p.

In one example, the Kit for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke may comprise: (i) at least two detectably labelled agents that specifically bind to tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) and tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) respectively; (ii) at least two detectably labelled agents that specifically bind to tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) and miR-680-5p respectively; (iii) tat least two detectably labelled agents that specifically bind to tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) and miR-660-5p respectively; or (iv) at least three detectably labelled agents, wherein the at least three detectably labelled agents specifically bind to tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof), tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) and miR-660-5p respectively. In one example, the kit for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke may comprise: (i) at least two detectably labelled agents that specifically bind to miR-101-3p and miR-106b- 5p respectively; (iy at least two detectably labelled agents that specifically bind to miR-101-3p and miR-107 respectively; (iii) at least two detectably labelled agents that specifically bind to miR-106b-5p and miR-107 respectively; or (iv) least three detectably labelled agents, wherein the at least three detectably labelled agents specifically bind to miR-101-3p, miR-106b-5p and miR-107 respectively. Any of the above kits may further comprise a detectably labelled agent that specifically binds to tRNA-ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof). The kits described herein can take on a variety of forms. Typically, the kits will include reagents suitable for determining levels of a plurality of biomarkers in a sample.

Optionally, the kits may contain one or more control samples or references. Typically, a comparison between the levels of the biomarkers in the subject and levels of the biomarkers in the control samples is indicative of a clinical status (e.g., diagnosis of stroke, stroke prognosis or risk of developing stroke etc.). Also, the kits, in some cases, will include written information (indicia) providing a reference (e.g., pre-determined values), wherein a comparison between the levels of the biomarkers in the subject and the reference (pre- determined values) is indicative of a clinical status {e.g., diagnosis of stroke, stroke prognosis or risk of developing stroke etc.). In some cases, the kits comprise software useful for comparing biomarker levels or occurrences with a reference (e.g., a prediction model). Usually the software will be provided in a computer readable format such as a compact disc, but it also may be available for downloading via the internet. However, the kits are not so limited and other variations will be apparent to one of ordinary skill in the art. The components of the kit may be housed in a container that is suitable for transportation. Details on the biomarkers is given above and apply equally here. Suitably, the biomarker may be RNA.

The term “detectably labelled agent” refers to a binding partner that interacts (i.e. binds) specifically with the biomarker of interest and is also capable of being detected e.g. directly {such as via a fluorescent tag) or indirectly (such as via a labelled secondary antibody). The detectably labelled agent is therefore a selective binding partner for the biomarker of interest (and does not substantially bind to other RNA sequences). Selective binding partners may include antibodies that selectively bind to one of the biomarker of interest. As used herein, a binding partner that “specifically binds to biomarker x” refers to a partner with selective binding of the biomarkers RNA sequence which will not bind in a significant amount to other RNA sequences. Thus the binding partner may bind to the selected biomarker with at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 fold more affinity than it binds to a control RNA sequence. In some examples the kits include the detectably labelled agent(s) on a continuous (e.g. solid) surface, such as a lateral flow surface. Alternatively, in examples comprising more than one detectably labelled agent, the detectably labelled agent(s) may be located in distinct (i.e. spatially separate) zones on a (e.g. solid) surface, such as a multiwall micro-titre plate (e.g. for an ELISA assay). Other appropriate surfaces and containers that are well known in the art may also form part of the kits described herein.

In one example, the Kit further comprises one or more reagents for detecting the detectably labelled agent. Suitable reagents are well known in the art and include but are not limited to standard reagents and buffers required to perform any one of the appropriate detection methods that may be used (and are well known in the art). In one example, the kit comprises one or more of the following: a multi-well plate, ball bearing(s), extraction buffer, extraction bottle and a lateral flow device lateral flow device. An assay device is also provided for determining a diagnosis and/or prognosis for stroke or for determining the risk of developing stroke in a subject. An assay device is also provided for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke. Typically, the device for the diagnosis and/or prognosis of stroke or for determining the risk of developing stroke described herein typically comprises at least two detectably labelled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of:

i} tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ij SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-98-5p, let-7d-5p and miR-486-3p. The device for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke typically comprises at least two detectably labelled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIyGCC, tRNA- leAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA- LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or ii MIR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR- 125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p. In one example, the device for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke may comprise: (i) at least two detectably labelled agents that specifically bind to tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) and tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) respectively; (ii) at least two detectably labelled agents that specifically bind to tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof) and miR-660-5p respectively; (iii) at least two detectably labelled agents that specifically bind to tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) and miR-660-5p respectively; or (iv) least three detectably labelled agents, wherein the at least three detectably labelled agents specifically bind to tRNA-AsnGTT (e.g. SEQ ID NO: 20 or 43, including fragments or variants thereof), tRNA-SerGCT (e.g. SEQ ID NO: 21 or 44, including fragments or variants thereof) and miR-660-5p respectively.

In one example, the device for distinguishing between ischemic stroke and hemorrhagic stroke in a subject having stroke or having an increased risk of developing stroke may comprise:

(i) at least two detectably labelled agents that specifically bind to miR-101-3p and miR-108b- 5p respectively; (ii) at least two detectably labelled agents that specifically bind to miR-101-3p and miR-107 respectively; (iii) at least two detectably labelled agents that specifically bind to miR-106b-5p and miR-107 respectively; or (iv) least three detectably labelled agents, wherein the at least three detectably labelled agents specifically bind to miR-101-3p, miR-106b-5p and miR-107 respectively. Any of the above devices may further comprise a detectably labelled agent that specifically binds to tRNA-ValTAC (e.g. SEQ ID NO: 19 or 42, including fragments or variants thereof). The at least two detectably labeled agents may be located in separate zones on the surface. In other words, the at least two detectably labelled agents may be located in distinct (i.e. spatially separate) zones on a (e.g. solid) surface, such as a multiwell micro-titre plate.

Detectably labelled agent(s) that specifically bind to the biomarker(s) of interest are described in detail elsewhere herein. The assay device comprises a surface upon which the detectably labelled agents are located. Appropriate surfaces include a continuous (e.g. solid) surface, such as a lateral flow surface. Other appropriate surfaces include microtitre plates, multi-well plates etc. Other appropriate surfaces that are well known in the art may also form part of the assay device described herein. Data storage aspects Biomarker levels and/or reference levels may be stored in a suitable data storage medium (e.g., a database) and are, thus, also available for future diagnoses or prognoses. This also allows efficiently diagnosing prevalence for a disease because suitable reference results can be identified in the database once it has been confirmed (in the future) that the subject from which the corresponding reference sample was obtained did have stroke (e.g. hemorrhagic stroke or ischemic stroke). As used herein a "database" comprises data collected (e.g., analyte and/or reference level information and /or patient information) on a suitable storage medium. Moreover, the database, may further comprise a database management system. The database management system is, preferably, a network-based, hierarchical or object-oriented database management system. Furthermore, the database may be a federal or integrated database. More preferably, the database will be implemented as a distributed (federal) system, e.g. as a Client-Server-System. More preferably, the database is structured as to allow a search algorithm to compare a test data set with the data sets comprised by the data collection.

Specifically, by using such an algorithm, the database can be searched for similar or identical data sets being indicative of stroke (e.g. hemorrhagic stroke or ischemic stroke) (e.g. a query search). Thus, if an identical or similar data set can be identified in the data collection, the test data set will be associated with stroke (e.g. hemorrhagic stroke or ischemic stroke). Consequently, the information obtained from the data collection can be used to diagnose stroke (e.g. hemorrhagic stroke or ischemic stroke) or based on a test data set obtained from a subject. More preferably, the data collection comprises characteristic values of all analytes comprised by any one of the groups recited above.

The methods described herein may further include communication of the results or diagnoses (or both} to technicians, physicians or patients, for example. In certain examples, computers will be used to communicate results or diagnoses (or both) to interested parties, e.g., physicians and their patients.

In some examples, the results or diagnoses (or both) are communicated to the subject as soon as possible after the diagnosis is obtained. The results or diagnoses (or both) may be communicated to the subject by the subject's treating physician. Alternatively, the results or diagnoses (or both) may be sent to a subject by email or communicated to the subject by phone. A computer may be used to communicate the results or diagnoses by email or phone.

In certain examples, the message containing results or diagnoses may be generated and delivered automatically to the subject using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications.

Companion diagnostic The methods kits, assay devices and uses provided herein may be used as part of a companion diagnostic e.g. as part of a medical device, often an in vitro device, which provides information that is essential for the safe and effective use of a corresponding drug or biological product (wherein the corresponding drug or biological product is for treating or preventing stroke, e.g. hemorrhagic stroke or ischemic stroke).

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d Ed., John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide those of skill in the art with a general dictionary of many of the terms used in the invention. Although any methods and materials similar or equivalent to those described herein find use in the practice of the present invention, the preferred methods and materials are described herein. Accordingly, the terms defined immediately below are more fully described by reference to the Specification as a whole. Also, as used herein, the singular terms "a", "an," and "the" include the plural reference unless the context clearly indicates otherwise. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art. Aspects of the invention are demonstrated by the following non-limiting examples.

EXAMPLES Background The inventors aimed to discover novel, early biomarkers to diagnose stroke. Specifically, they aimed to identify early and easily accessible biomarkers that can, for example, be measured using a point-of-care test in an ambulance. Furthermore, the inventors aimed to find biomarkers that allow patients with ischemic stroke, patients with hemorrhagic stroke and so- called stroke mimics to be distinguished. Stroke mimics present with stroke-like symptoms such as hemiparesis or vertigo, but these symptoms are caused by a different pathology, for example epilepsy, migraine or benign paroxysmal positional vertigo. Several studies have shown that circulating small RNAs, and especially miRNAs, are promising biomarkers for a range of diseases, including acute stroke. Most studies have focused on either ischemic stroke or hemorrhagic stroke, and compared these with healthy controls. The inventors instead include both ischemic and hemorrhagic stroke patients, and compare these to stroke mimics, as this is the most relevant group from a clinical point of view. Furthermore, most studies published so far focus on complete serum, plasma or blood, or on extracellular vesicles (EVs) that are present in blood. The inventors hypothesized that the acute damage caused by a stroke leads to passive release of small RNAs into the bloodstream, and therefore focused on small RNAs that are not contained in vesicles. Materials and Methods Patient material Patients suspected of stroke were included at the emergency department of the LUMC, where venous blood was collected in two 9 mL 3.2% sodium citrate tubes. Blood was processed within one hour, centrifuging twice for 15 minutes at 2,500 x g to isolate platelet-poor plasma. Plasma aliquots were snap frozen in liquid nitrogen, then stored at -80°C.

For each patient, 2.5 mL of plasma was thawed and diluted once with PBS. The plasma was then depleted of EVs by two rounds of ultracentrifugation. Samples were first centrifuged for 70 minutes at 4°C at 17,500 x g to remove large vesicles. The upper 4.5 mL was transferred to a new tube and filled up to 5 mL with PBS. In the second step, samples were centrifuged for 70 minutes at 4°C at 166,400 x g to remove small vesicles. Three fractions were separated: the top 1 mL, the middle 3 mL and the bottom 1 mL. These fractions, as well as the bottom

0.5 mL after the first round of ultracentrifugation, were aliquotted, snap-frozen on dry ice and stored at -80°C. Depletion of EVs was monitored using dynamic light scattering. Small RNA sequencing EV-depleted plasma of 27 patients (9 ischemic strokes, 8 hemorrhagic strokes and 10 stroke mimics) was sent to QIAGEN for small RNA sequencing (RNA-seq). Briefly, RNA was isolated using the miRNeasy Serum/Plasma Kit (QIAGEN) according to the manufacturer's instructions. 5 uL of total RNA per sample was used for library preparation using the QlAseq miRNA Library Kit (QIAGEN). Adapters containing unique molecular identifiers (UMIs) were ligated to the RNA, followed by reverse transcription. cDNA was amplified by 22 cycles of PCR and indices were added during the PCR. PCR samples were purified and libraries were pooled in equimolar ratios. These pools were quantified using qPCR and sequenced on a NextSeg500 instrument according to the manufacturer's instructions. Raw data was de- multiplexed and FASTQ files were generated using the bcl2fastq software. Data quality was assessed using the FastQC tool. RNA-seq data were analyzed by QIAGEN. Briefly, Cutadapt was used to extract adapter and UMI sequences, and UMIs were used to correct for PCR bias. Bowtie2 was used to map the reads, allowing single mismatches for genome-mapping reads. Differential expression analysis was performed using EdgeR and trimmed mean of M-values (TMM) normalization. isomiRs and putative miRs were analyzed using in-house scripts with the MiRPara tool. Additional analyses of tRNA fragments were performed using sRNAtoolbox (Aparicio-Puerta et al. 2019).

Results Based on the RNA-seq results, 12 miRNAs (Fig 3) and 11 tRNA-derived fragments (Fig 4 and 5) were selected for validation (Table 3).

hsa-miR-185-5p Ischemic stroke (Jin and Xing et al 2018, Jin and Xing 2017), (gestational) diabetes mellitus, preterm birth, multiple sclerosis, acute coronary syndrome, dilated cardiomyopathy, asthma, liver fibrosis, Parkinson's disease, Alzheimer’s disease,

WEEE EEE hsa-let-7d-5p Epilepsy (Wang et al 2015), traumatic brain injury, diabetes, ADHD, Alzheimer’s disease, Parkinson's disease, multiple sclerosis, tuberculosis, fetal Down syndrome, endometriosis, idiopathic pulmonary fibrosis, anti-NMDAR encephalitis, obstructive Eme hsa-miR-20a-5p Different subtypes of ischemic stroke (Chen and Jiang 2018, Sepramaniam et al TT cm hsa-miR-660-5p Thrombotic vs. embolic stroke (Li et al 2015), multiple sclerosis: wet age-related macular degeneration, Alzheimer’s disease, ST-segment elevation myocardial pm i hsa-miR-107 Ischemic stroke (also suggested as therapeutic target) (Yang et al 2018, Li et al 2015, Wang et al 2014, Tiedt et al 2017) thrombotic vs. embolic stroke (Li et al 2015), Ischemic vs hemorrhagic stroke (Kalani et al 2020), insulin sensitivity, Emmen hsa-miR-486-3p Pre-eclampsia, Parkinson's disease, ST-segment elevation myocardial infarction, an hsa-miR-196b-5p Ischemic stroke (animal model) (Takuma et al 2017), Pre-eclampsia, relapsing— | at sas. rs sss am. hsa-miR-98-5p Atherosclerosis (also suggested as therapeutic target) (Dai et al 2018), Alzheimer’s

EE hsa-miR-106b-5p Ischemic stroke (Wang et al 2014, Tian et al 2016), Ischemic vs hemorrhagic stroke mam hsa-miR-101-3p Ischemic stroke (Jin and Xiang 2017, Tiedt et al 2017), Ischemic vs hemorrhagic na oe oe na hsa-miR-378a-3p Ischemic stroke (Jin and Xiang 2017), Ischemic vs hemorrhagic stroke (Kalani et al TT memo er TTT ii ee TTT a

A a fi in er TTT i ii Table 3: Overview of targets selected from RNA-seq. Most of the selected miRNAs showed a similar pattern, being upregulated in plasma from IS patients compared to HS patients and stroke mimics, while downregulated in plasma from HS patients compared to IS patients and stroke mimics (Figure 3). The most notable exception to this pattern was miR-125a-5p, which was upregulated in HS compared to IS, and both in IS and HS compared to mimics. Levels of two miRNAs (miR-101-3p and miR-660-5p) did not appear different between HS and mimics, while six miRNAs (miR-107, miR-185-5p, miR-125a- 5p, miR-660-5p, miR-20a-5p and miR-486-3p) did not appear to differ between IS and mimics.

The selected tRNAs generally showed the opposite pattern compared to the miRNAs, being downregulated in plasma from IS patients compared to HS patients, but equivalent to mimics, while upregulated in plasma from HS patients compared to both IS patients and stroke mimics (Figure 4). Exceptions were tRNA-LeuTAA, which was higher in IS compared to mimics; tRNA- LysTTT, which was not different between HS and mimics; and tRNA-GIyCCC, which was lower in IS compared to mimics. Using an additional approach to the analysis, the inventors identified four additional potential tRNAs: tRNA-SerGCT, tRNA-AsnGTT and tRNA-ArgTCG, were increased in the hemorrhagic stroke group compared to mimics and ischemic strokes, while tRNA-LeuCAG was decreased in hemorrhagic stroke compared to mimics and ischemic strokes (Figure 5). Finally a region under operating curve (ROC) analysis was performed to assess the potential diagnostic potential of using combinations of the here described biomarkers, which showed that a panel of biomarkers clearly outperforms the single biomarkers (Figure 6).

The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

Each feature disclosed in this specification (including any accompanying claims, abstract and drawings}, may be replaced by alternative features serving the same, equivalent, or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

Sequences The sequences are listed in Table 1. References Aparicio-Puerta E, Lebrón R, Rueda A, Gómez-Martin C, Giannoukakos S, et al. Nucleic Acids Research, Jul 2019; 47(W1): W530-W535. sRNAbench and sRNAtoolbox 2019: intuitive fast small RNA profiling and differential expression. Van der Pol E, Böing AN, Harrison P, Sturk A, Nieuwland R, Pharmacological Reviews, Jul 2012; 64(3):676-705. Classification, functions, and clinical relevance of extracellular vesicles. Sluijter JPG, Davidson SM, Boulanger CM, Buzas El, de Kleijn DPV, et al., Cardiovascular Research, Jan 2018; 114(1):19-34. Extracellular vesicles in diagnostics and therapy of the ischaemic heart: Position Paper from the Working Group on Cellular Biology of the Heart of the European Society of Cardiology. EL Andaloussi S, Mager |, Breakefield XO, Wood MJ, Nature Reviews Drug Discovery, May 2013; 12(5): 347-357. Extracellular vesicles; biology and emerging therapeutic opportunities.

Chen LT, Jiang CY, BioMed Research International, Dec 2018; 2018:4514178 . MicroRNA Expression Profiles Identify Biomarker for Differentiating the Embolic Stroke from Thrombotic Stroke. DaiY, Wu X, Dai D, Li J, Mehta JL, Redox Biology, Jun 2018; 16:255-262. MicroRNA-98 regulates foam cell formation and lipid accumulation through repression of LOX-1.

Faraldi M, Gomarasca M, Sansoni V, Perego S, Banfi G, Lombardi G, Scientific Reports, Feb 2019; 9(1):1584. Normalization strategies differently affect circulating miRNA profile associated with the training status. Heitzer E, Haque IS, Roberts CES, Speicher MR, Nat Rev Genet, Feb 2019; 20(2):71-88.

Current and future perspectives of liquid biopsies in genomics-driven oncology. Hogg MC, Raoof R, El Naggar H, Monsefi N, Delanty N, ef al. The Journal of Clinical Investigation, June 2019; 129(7):2946-2951. Elevation of plasma tRNA fragments precedes seizures in human epilepsy. Jin F, Xing J, Neurological Sciences, Oct 2018; 39(10):1757-1765. Circulating miR-126 and miR-130a levels correlate with lower disease risk, disease severity, and reduced inflammatory cytokine levels in acute ischemic stroke patients. Jin F, Xing J, Neurological Sciences, Nov 2017; 38(11):2015-2023. Circulating pro- angiogenic and anti-angiogenic microRNA expressions in patients with acute ischemic stroke and their association with disease severity.

Kalani MYS, Alsop E, Meechovet B, Beecroft T, Agrawal K, et a/., Journal of Extracellular Vesicles, Jan 2020; 9(1):1713540. Extracellular microRNAs in blood differentiate between ischaemic and haemorrhagic stroke subtypes.

LiY, Mao L, Gao Y, Baral S, Zhou Y, Hu B, Scientific Reports, Aug 2015; 5(1): 13316. MicroRNA-107 contributes to post-stroke angiogenesis by targeting Dicer-1. Sepramaniam S, Tan JR, Tan KS, DeSilva DA, Tavintharan S, et af, International Journal of Molecular Sciences, Jan 2014; 15(1):1418-1432. Circulating MicroRNAs as Biomarkers of Acute Stroke. Stather PW, Sylvius N, Sidloff DA, Dattani N, Verissimo A, et al., British Journal of Surgery, Jun 2015; 102(7), pp.755-766. Identification of microRNAs associated with abdominal aortic aneurysms and peripheral arterial disease.

Takuma A, Abe A, Saito Y, Nito C, Ueda M, et al., International Journal of Molecular Sciences, Nov 2017; 18(11):E2335. Gene Expression Analysis of the Effect of Ischemic Infarction in Whole Blood.

Tian C, Li Z, Yang Z, Huang Q, Liu J, Hong B, PLoS One, Nov 2016; 11(11):e0166688. Plasma MicroRNA-16 Is a Biomarker for Diagnosis, Stratification, and Prognosis of Hyperacute Cerebral Infarction.

Tiedt S, Prestel M, Malik R, Schieferdecker N, Duering M, ef af, Circulation Research, Sep 2017; 121(8):970-980. RNA-Seq Identifies Circulating miR-125a-5p, miR-125b-5p, and miR- 143-3p as Potential Biomarkers for Acute Ischemic Stroke. van der Kwast RVCT, Quax PHA, Nossent AY. Cells. 2019 Dec 25;9(1). An Emerging Role for isomiRs and the microRNA Epitranscriptome in Neovascularization.

Wang J, Yu JT, Tan L, Tian Y, Ma J, et al., Scientific Reports, Mar 2015; 5: 9522. Genome- wide circulating microRNA expression profiling indicates biomarkers for epilepsy. Wang W, Sun G, Zhang L, Shi L, Zeng Y, Journal of Stroke and Cerebrovascular Diseases, Nov-Dec 2014; 23(10):2607-2613. Circulating MicroRNAs as Novel Potential Biomarkers for Early Diagnosis of Acute Stroke in Humans. Yang ZB, Li TB, Zhang Z, Ren KD, Zheng ZF, Peng J, Luo XJ, Internal Medicine, 2018; 55(10):1279-1286. The Diagnostic Value of Circulating Brain-specific MicroRNAs for Ischemic Stroke.

SEQLTXT

SEQUENCE LISTING <110> Academisch Ziekenhuis Leiden (h.o.d.n. LUMC) <120> Novel biomarkers for use in stroke diagnosis and prognosis <130> P295422NL <160> 48 <170> PatentIn version 3.5 <21e> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 uggagagaaa ggcaguuccu ga 22 <2105 2 <211> 22 <212> RNA <213> Homo sapiens <400> 2 agagguagua gguugcauag uu 22 <2105 3 <211> 23 <212> RNA <213> Homo sapiens <400> 3 uaaagugcuu auagugcagg uag 23 <2105 4 <211> 22 <212> RNA <213> Homo sapiens <400> 4 uacccauugc auaucggagu ug 22 <216> 5 <211> 23 <212> RNA <213> Homo sapiens Pagina 1

SEQLTXT <400> 5 agcagcauug uacagggcua uca 23 <210> 6 <211> 21 <212> RNA <213> Homo sapiens <400> 6 cggggcragcu caguacagga U 21 <210> 7 <211> 22 <212> RNA <213> Homo sapiens <400> 7 uagguaguuu ccuguuguug gg 22 <210> 8 <211> 22 <212> RNA <213> Homo sapiens <400> 8 ugagguagua aguuguauug uu 22 <210> 9 <211> 21 <212> RNA <213> Homo sapiens <400> 9 uaaagugcug acagugcaga U 21 <210> 10 <211> 21 <212> RNA <213> Homo sapiens <400> 10 uacaguacug ugauaacuga a 21 <210> 11 <211> 24 Pagina 2

SEQLTXT <212> RNA <213> Homo sapiens <400> 11 ucccugagac ccuuuaaccu guga 24 <210> 12 <211> 22 <212> RNA <213> Homo sapiens <400> 12 acuggacuug gagucagaag gc 22 <210> 13 <211> 87 <212> RNA <213> Homo sapiens <400> 13 BECUCUgUgg cgcaauggau agcgcauugg acuucuagcc uaaaucaaga gauucaaagg 60 UUgCggEUUC gagucccucc agagucg 87 <210> 14 <211> 72 <212> RNA <213> Homo sapiens <400> 14 gcauuggugg uucaguggua gaauucucge CUCCCaCgCg ggagacccgg guucaauucc 60 cggccaauge aa 72 <210> 15 <211> 74 <212> RNA <213> Homo sapiens <400> 15 ggccgguuag cucaguuggu uagagcgugg ugcuaauaac gccaaggucg cggguucgau 60 cceccguacgg gcca 74 <210> 16 <211> 82 <212> RNA Pagina 3

SEQLTXT <213> Homo sapiens <400> 16 accagaaugg ccgagugguu aaggcguugg acuuaagauc caauggauuc auaucgcgug 60 gguucgaacc ccacuucugg ua 82 <210> 17 <211> 73 <212> RNA <213> Homo sapiens <400> 17 gCCCggauag cucagucggu agagcaucag acuuuuaauc ugagggucca ggguucaagu 60 cccuguucgg gCg 73 <210> 18 <211> 72 <212> RNA <213> Homo sapiens <400> 18 ggcucguugg ucuaggggua ugauucucge uuagggugeg agaggucccg gguucaaauc 60 ccggacgage CC 72 <210> 19 <211> 73 <212> RNA <213> Homo sapiens <400> 19 gguuccauag uguagugguu aucacgucug cuuuacacgc agaagguccu ggguucgage 60 cccaguggaa cca 73 <210> 20 <211> 74 <212> RNA <213> Homo sapiens <400> 20 gucucugugg cacaaucggu uagcgcguuc ggcuguuaau cuagagguug gugguuagag 60 cccacugagg gaug 74 Pagina 4

SEQLTXT <210> 21 <211> 82 <212> RNA <213> Homo sapiens <400> 21 gacgaggugg CCgagugguu aaggcgaugg acugcuaauc cauugugcuc UgCaCgCgUg 60 gguuCgaauc ccauccucgu cg 82 <210> 22 <211> 74 <212> RNA <213> Homo sapiens <400> 22 ggccgguuag cucaguuggu aagagecgugg ugcugauaac accaaggucg cgggeucgac 60 ucccgcaccg gcca 74 <210> 23 <211> 71 <212> RNA <213> Homo sapiens <400> 23 gcauuggugg uucaguggua gaauucucge cugccaugeg BECgECCgEE cuucgauucce 60 uggccaaugc a 71 <210> 24 <211> 83 <212> RNA <213> Homo sapiens <400> 24 gucaggaugg CCgagCgguc uaaggegecug cguucagguc gcagucuccc cuggaggegu 60 ggguucgaau cccacuccug aca 83 <210> 25 <211> 73 <212> RNA <213> Homo sapiens <400> 25 ggcegegugg ccuaauggau aaggecgucug acuucggauc agaagauugc agguucgagu 60 Pagina 5

SEQLTXT CCUgCCgCgg ucg 73 <210> 26 <211> 74 <212> RNA <213> Homo sapiens <400> 26 ggccgguuag cucaguuggu uagagecguge ugcuacuaau gccagggucg agguuucgau 60 cceccguacgg gecu 74 <210> 27 <211> 82 <212> RNA <213> Homo sapiens <400> 27 gcagcgaugg Ccgagugguu aaggcguugg acuugaaauc Caaugggguc uccccgegea 60 gguucgaacc cugcucgcug cg 82 <210> 28 <211> 82 <212> RNA <213> Homo sapiens <400> 28 gcugugaugg Ccgagugguu aaggcguugg acucgaaauc Caaugggguc uccccgegea 60 gguucgaauc cugcucacag cg 82 <210> 29 <211> 82 <212> RNA <213> Homo sapiens <400> 29 guagucgugg Ccgagugguu aaggcgaugg acuagaaauc Cauugggguu uccccgegea 60 gguucgaauc cugccgacua cg 82 <210> 30 <211> 71 <212> RNA <213> Homo sapiens Pagina 6

SEQLTXT <400> 30 gCCCggauag uucaguuggu agagcaucag acuuaaucag aggguccagg guucaagucc 60 CUgUUUggEgUu g 71 <210> 31 <211> 72 <212> RNA <213> Homo sapiens <400> 31 ggcucguugg ucuaggggua ugauucucgg uuuggguccg agaggucccg gguucaaauc 60 ccggacgage CC 72 <210> 32 <211> 72 <212> RNA <213> Homo sapiens <400> 32 ggcucguugg ucuaggggua ugauucucge uucgggugeg agaggucccg gguucaaauc 60 ccggacgage CC 72 <210> 33 <211> 82 <212> RNA <213> Homo sapiens <400> 33 gguagcgugg CCgagCggUC uaaggegaug gauuuaggeu ccagucucuu cggaggegug 60 gguucgaauc CCaCCgCUgC ca 82 <210> 34 <211> 83 <212> RNA <213> Homo sapiens <400> 34 gucaggaugg CCcgagugguc Uaaggcgcca gacucaaguu cuggucucca auggaggegu 60 ggguucgaau cccacuucug aca 83 <210> 35 <211> 82

Pagina 7

SEQLTXT

<212> RNA

<213> Homo sapiens

<400> 35 gguagcgugg CCgagCggUuC uaaggcgeug gauuaaggcu ccagucucuu cggaggegug 60 gguucgaauc CCaCCgCUgC ca 82

<210> 36

<211> 16

<212> RNA

<213> Homo sapiens

<400> 36 gaagguugug gguucg 16

<21e> 37

<211> 30

<212> RNA

<213> Homo sapiens

<400> 37 gCcauuggugg uucaguggua gaauucucgc 30

<210> 38

<211> 28

<212> RNA

<213> Homo sapiens

<400> 38 uguuagcuca guugguuaga gcacugug 28

<210> 39

<211> 15

<212> RNA

<213> Homo sapiens

<400> 39 gCccgaguggu uaagg 15

<210> 40

<211> 29

<212> RNA

<213> Homo sapiens

<400> 40 gcccggauag cucaguuggu agagcagug 29 Pagina 8

SEQLTXT <210> 41 <211> 16 <212> RNA <213> Homo sapiens <400> 41 uggucuaggg guaugg 16 <210> 42 <211> 15 <212> RNA <213> Homo sapiens <400> 42 gguuccauag uguag 15 <210> 43 <211> 15 <212> RNA <213> Homo sapiens <400> 43 guuaaucgag agguu 15 <210> 44 <211> 24 <212> RNA <213> Homo sapiens <400> 44 gacgacgugg Cccgagugguu aagg 24 <210> 45 <211> 19 <212> RNA <213> Homo sapiens <400> 45 ggccgguuag cucaguugg 19 <210> 46 <211> 30 <212> RNA <213> Homo sapiens Pagina 9

SEQLTXT

<400> 46 gcaugggugg uucaguggua gaauucucgc 30

<210> 47

<211> 15

<212> RNA

<213> Homo sapiens

<400> 47 g8aggcgugg guucg 15

<210> 48

<211> 27

<212> RNA

<213> Homo sapiens

<400> 48 acuucgaauc agaagauugu agguucg 27 Pagina 10

Claims

Conclusions

Use of one or more biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerAGA, tGG-RNA-SupTTA ProC GG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) MIR-98-5p, let-7d-5p and miR-486-3p; as a biomarker for a biological fluid for a stroke (cerebrovascular accident).

2. Use of one or more biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerAGA, tGG-RNA-SupTTA ProCGG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p; as a biomarker for a biological fluid for distinguishing between a hemorrhagic stroke and an ischemic stroke.

Use according to claim 2, wherein the biomarkers comprise: (i) tRNA-AsnGTT and tRNA-SerGCT; (ii) tRNA-AsnGTT and miR-660-5p;

(iil) tRNA-SerGCT and miR-660-5p; or (iv) tRNA-AsnGTT, tRNA-SerGCT and miR-660-5p; optionally wherein the biomarkers additionally comprise tRNA-ValTAC.

Use of a tRNA or a fragment thereof as a biomarker for a biological fluid for a hemorrhagic stroke.

A method for diagnosing and/or making a prognosis for the occurrence of a stroke, or for determining the risk of developing a stroke in a subject, the method comprising the steps of : a) determining the level of one or more biomarkers in a biological fluid sample from the subject, wherein the one or more biomarkers is or are selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA- ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgRNA-SerTRNAt, tRNA-SerTRNA tRNA-SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProC GG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) MIR-98-5p, let-7d-5p and miR-486-3p; b) comparing the level of the one or more biomarkers with the level of the same biomarker or biomarkers in a control sample or with a predetermined reference level for the same biomarker or biomarkers, wherein the control sample or predetermined reference level is from a control subject does not have a stroke or is experiencing a stroke mimic; and c) identifying that a subject has a stroke, or that the subject is at increased risk of developing a stroke, if the equation in (b) indicates that the subject has one or more has several of the following:

i) an increased level of a biomarker compared to the control sample or to the predetermined reference level, where the biomarker is selected from the group consisting of: tRNA-LeuTAA, tRNA-ProAGG, tRNA-SerTGA, tRNA-SerCGA, tRNA- SerGCT, tRNA-SerAGA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO:39 and SEQ ID NO:41; or a fragment or a variant thereof; and/or il) a change in the level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA- ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-IleGAT, tRNA-GIyCCC, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SupTTA, tRNA-LeuTAGRNAuLe and tRNA- miR-98-5p, let-7d-5p, miR-486-3p, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO. : 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or a fragment or a variant thereof.

The method of claim 5, wherein the stroke is an ischemic stroke or a hemorrhagic stroke.

A method for distinguishing between an ischemic stroke and a hemorrhagic stroke in a subject experiencing a stroke or at increased risk of developing a stroke, the method comprising the steps of: a) determining the level of one or more biomarkers in a biological fluid sample from the subject, wherein one is or is a plurality of biomarkers selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA -GIlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA,

tRNA-SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p; b) comparing the level of the one or more biomarkers with the level of the same biomarker or biomarkers in a control sample or with a predetermined reference level for the same biomarker or biomarkers; and c) distinguishing between an ischemic stroke and a hemorrhagic stroke in the subject, using the equation of step (b), identifying the subject as having an ischemic stroke or as at risk of developing an ischemic stroke if the comparison indicates that the subject has one or more of i) through v); whether the subject is identified as having a hemorrhagic stroke or as at risk of developing a hemorrhagic stroke if the comparison indicates that the subject has one or more of vi) to x); where i) to x) are as follows: i} an elevated level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-196b-5p, miR-20a-5p, miR-378a-3p, miR-486-3p, miR-660-5p, miR-98- 5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or predetermined reference level is from a subject experiencing a hemorrhagic stroke; il) a reduced level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-

lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerAGA, TAtGG-Sup tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO. : 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, and SEQ ID NO: 48, or a fragment or variant thereof; and wherein the control sample or predetermined reference level is from a subject experiencing a hemorrhagic stroke; ii) an elevated level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, miR-196b-5p, miR-378a-3p, miR-98-5p, let-7d-5p, tRNA-LeuTAA, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerGCT, tRNA-SerAGA and SEQ ID NO: 39, or a fragment or a variant thereof; and wherein the control sample or the predetermined reference level is from a control subject who is not experiencing a stroke or who is experiencing a stroke mimic; iv) a reduced level of a biomarker as compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: tRNA-LysTTT, tRNA-SupTTA, tRNA-IleGAT, tRNA-SerACT, tRNA- IleAAT, tRNA-GlyGCC, tRNA-GlyCCC, SEQ ID NO:37, SEQ ID NO:40, SEQ ID NO:45 and SEQ ID NO:46, or a fragment or variant thereof; and wherein the control sample or the predetermined reference level is from a control subject who is not experiencing a stroke or who is experiencing a stroke mimic; or v) an equivalent level of a biomarker as compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA -GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTRNA-CGAtRNA

SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG, miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR- 185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p, miR-486-3p, SEQ ID NO. : 36 to 48, or a fragment or variant thereof; and wherein the control sample or predetermined reference level is from a subject experiencing an ischemic stroke; vi} a reduced level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: miR-101-3p, miR-106b-5p, miR-107, miR- 185-5p, miR-196b-5p, miR-20a-5p, miR-378a-3p, miR-486-3p, miR-660-5p, miR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or predetermined reference level is from a subject experiencing an ischemic stroke; vi) an increased level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-lleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-GAtRNA-SerTGA, tRNA-SerTGA, SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID No: 41, SEQ ID No: 42, SEQ ID No: 43, SEQ ID No: 44, SEQ ID No: 45, SEQ ID No: 48, and SEQ ID No: 48, or a fragment or a variant thereof; and wherein the control sample or predetermined reference level is from a subject experiencing an ischemic stroke; viii) a reduced level of a biomarker compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: miR-196-5p, miR-106b-Sp, miR-107, miR- 185-5p, miR-20a-5p, miR-378a-3p, miR-486-3p, miR-98-5p, let-7d-5p, tRNA-LeuCAG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG and SEQ ID NO:47, or a fragment or variant thereof; and wherein the control sample or predetermined reference level is from a control subject who is not experiencing a stroke or who is experiencing a stroke mimic; iX) an increased level of a biomarker compared to the control sample or to the predetermined reference level, where the biomarker is selected from the group consisting of: miR-125a-5p, tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerCGA, ProTGG, tRNA-ProCGG, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID No: 43, SEQ ID No: 44, SEQ ID No: 45, SEQ ID No: 46, and SEQ ID No: 48, or a fragment or variant thereof; and wherein the control sample or predetermined reference level is from a control subject who is not experiencing a stroke or who is experiencing a stroke mimic; and/or x) an equivalent of a biomarker as compared to the control sample or to the predetermined reference level, wherein the biomarker is selected from the group consisting of: tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SertSerC, SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA-LeuCAA, tRNA-LeuAAG, miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR- 185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p, miR-196b-5p, miR-98-5p, let-7d-5p, miR-486-3p, SEQ ID NO. : 36 to 48, or a fragment or a variant thereof, and wherein the control sample or predetermined reference level is from a subject experiencing a hemorrhagic stroke.

The method of any preceding claim, wherein the biological fluid sample is a blood sample.

The method of claim 8, wherein the blood sample is an EV poor blood sample.

The method of any preceding claim, wherein step a) comprises determining the level of at least two or three of said biomarkers in the biological fluid sample.

The method of claim 10, wherein step a) comprises determining the level of: (i) tRNA-AsnGTT and tRNA-SerGCT; (ii) tRNA-AsnGTT and miR-660-5p; (iil) tRNA-SerGCT and miR-660-5p; or (iv) tRNA-AsnGTT, tRNA-SerGCT and miR-660-5p; optionally wherein step a) further comprises determining the level of tRNA-ValTAC.

A method according to any preceding claim, wherein the subject is a human.

The method of any preceding claim, wherein the level of the biomarker is determined using PCR, RNA-SEQ or RT-PCR.

The method of any preceding claim, further comprising selecting a treatment regimen for the subject based on the comparison of the level of the biomarker to the control sample or to the predetermined reference level.

The method of claim 14, further comprising administering the selected treatment regimen to the subject, optionally wherein the selected treatment regimen comprises: (I) administering recombinant tissue plasminogen activator (IV-rtPA) and/or endovascular thrombectomy intravenously to treat a ischemic stroke; or (ii) administering at least one antihypertensive agent and/or a neurosurgical intervention for treating a hemorrhagic stroke.

A method for monitoring the progression of a stroke in a subject, the method comprising the steps of: i) determining the level of one or more biomarkers in a biological fluid sample from the subject, in accordance with steps a to b) according to any one of claims 5 to 13; and ii) repeating step i) for the same subject after a specified time interval, and iii) comparing the levels identified in i) with the levels of the biomarkers identified in ii), whereby an alteration of the levels of the biomarkers between i) and ii) is indicative of an alteration in the progression of a stroke in the subject.

A kit for diagnosing and/or prognosing a stroke, or for determining the risk of developing a stroke in a subject, the kit comprising at least detectably labeled agents, wherein each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC,

tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, AA LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) MIR-98-5p, let-7d-5p and miR-486-3p.

A kit for distinguishing between an ischemic stroke and a hemorrhagic stroke in a subject undergoing a stroke or at risk of developing a stroke, the kit comprising at least two detectably labeled agents, each agent specifically binds to a different target biomarker selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA -LeuTAA, tRNA-IleGAT, tRNA-GlyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-SerAGA, tRNA-SupTRNA-TGGC, t tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p , miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p.

The kit of claim 18, wherein: (i) the at least two detectably labeled agents bind specifically to tRNA-AsnGTT and to tRNA-SerGCT, respectively; (i) the at least two detectably labeled agents bind to tRNA-AsnGTT and to miR-660-5p, respectively; (ii) the at least two detectably labeled agents bind specifically to tRNA-SerGCT and to miR-660-5p, respectively; or (iv) the kit comprises at least three detectably labeled agents, wherein the at least three detectably labeled agents bind specifically, respectively, to tRNA-AsnGTT, on tRNA-SerGCT and on miR-660-5p;

optionally wherein the kit additionally comprises an additional detectably labeled agent that specifically binds to tRNA-ValTAC.

A kit according to any one of claims 17 to 19, further comprising one or more reagents for detecting the detectably labeled agent or agents.

A testing device for providing a diagnosis and/or prognosis for a stroke, or for determining the risk of developing a stroke in a subject, the device comprising a surface having thereon at least two detectably labeled agents, each agent specifically binding to a different target biomarker each selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIlyGCC, tRNA-IleAAT, tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA, tRNA-SerCGA, tRNA-TAtRNA-tSup, ProTGG, tRNA-ProC GG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) MIR-98-5p, let-7d-5p and miR-486-3p.

A test device for distinguishing between an ischemic stroke and a hemorrhagic stroke in a subject experiencing a stroke or at risk of developing a stroke, the device comprising a surface having at least two detectable thereon labeled agents, each agent specifically binding to a different target biomarker each selected from the group consisting of: i) tRNA-AsnGTT, tRNA-SerGCT, tRNA-ValTAC, tRNA-ArgTCT, tRNA-GIlyGCC, tRNA-IleAAT , tRNA-LysTTT, tRNA-LeuTAA, tRNA-IleGAT, tRNA-GIyCCC, tRNA-ProAGG, tRNA-LeuCAG, tRNA-ArgTCG, tRNA-SerACT, tRNA-SerTGA,

tRNA-SerCGA, tRNA-SerAGA, tRNA-SupTTA, tRNA-ProTGG, tRNA-ProCGG, tRNA-LeuTAG, tRNA-LeuCAA and tRNA-LeuAAG, or a fragment thereof; ii) SEQ ID NO: 36 to 48, or a fragment or variant thereof; and/or iii) miR-660-5p, miR-101-3p, miR-106b-5p, miR-107, miR-185-5p, miR-378a-3p, miR-125a-5p, miR-20a-5p , miR-196b-5p, miR-98-5p, let-7d-5p and miR-486-3p.

The test device of claim 22, wherein: (i) the at least two detectably labeled agents bind specifically to tRNA-AsnGTT and to tRNA-SerGCT, respectively; (ij) the at least two detectably labeled agents bind specifically to tRNA-AsnGTT and to miR-660-5p, respectively; (i) the at least two detectably labeled agents bind specifically to tRNA-SerGCT and to miR-660-5p, respectively; or (iv) the test device comprises at least three detectably labeled agents located on the surface, wherein the at least three detectably labeled agents bind specifically to tRNA-AsnGTT, to tRNA-SerGCT and to miR-660-5p, respectively; optionally the test device further comprising an additional detectably labeled agent located on the surface, wherein the additional detectably labeled agent specifically binds to tRNA -ValTAC.

The test device of any one of claims 21 to 23, wherein the at least two detectably labeled agents are located in discrete regions on the surface.

A method, use, device, or kit according to any one of the preceding claims, wherein the method, use, device, or kit is for making a prognosis for a stroke.