NL2024527B1

NL2024527B1 - On-flow cell three-dimensional polymer structures

Info

Publication number: NL2024527B1
Application number: NL2024527A
Authority: NL
Inventors: Rosàs-Canyelles Elisabet; Kumar Khurana Tarun; Wu Yir-Shyuan
Original assignee: Illumina Inc
Priority date: 2019-11-27
Filing date: 2019-12-20
Publication date: 2021-08-30

Abstract

A method comprising loading a polymer precursor solution onto a flow cell that includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polymer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper and lower surfaces of the at least one channel, and illuminating the polymer precursor solution through a pre-pattemed photomask to activate the photoinitiator and polymerize at least some of the polymer precursor solution underneath apertures in the photomask and form three-dimensional polymer structures that extend fiom the upper interior surface to the lower interior surfaces, and wherein the biological cells or colonies of biological cells are compartmentalized in the three-dimensional polymer structures.

Description

ON-FLOW CELL THREE-DIMENSIONAL POLYMER STRUCTURES BACKGROUND

[0001] Next-generation sequencing (NGS) is a high-throughput sequencing technology capable of sequencing entire genomes in a rapid and cost-effective manner. In at least one implementation, NGS begins with the creation of a sequencing library that includes genomic DNA that has been randomly fragmented, extracted, and purified. NGS processes such as sequencing-by-synthesis can then be utilized for massively parallel sequencing of the entire genomic library. Single-cell sequencing decodes variation in genomes and transcriptomes of single cells, helping to unravel the mechanisms underlying both health and disease. Many questions surrounding cell-to-cell variation require sequencing hundreds to thousands of cells. However, high-throughput single-cell sequencing is limited by difficulty in processing hundreds to thousands of single cells while achieving (i) efficient library preparation, (ii) indexing of library molecules, and (iii) minimal losses. Compartmentalization strategies can overcome these challenges by partitioning single cells in separate compartments that both: (i) isolate cells from one another and (ii) allow for efficient reagent exchange, such that library preparation can occur in parallel across hundreds to thousands of samples and free of cross-contamination.

SUMMARY

[0002] The following provides a summary of certain examples. This summary is not an extensive overview and is not intended to identify key or critical aspects or elements of the disclosed system, devices, and methods or to delineate their scope.

[0003] It 1s to be understood that any respective features/examples of each of the aspects of the disclosure as described herein may be implemented together m any combination to achieve the results as described herein. and that any features/examples from any one or more of these aspects may be implemented together with any of the features of the other aspect(s) as described herein in any combination to achieve the benefits as described here.

[0004] A method for making on-flow cell three-dimensional polymer structures. comprising loading a polymer precursor solution onto a flow cell, wherein the polymer precursor solution includes a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polymer precursor solution, and wherein the at least one channel has an upper interior surface and a lower interior surface; and illuminating the polvmer precursor solution through a patterned photomask using a light at a wavelength sufficient to activate the photoinitiator, wherein activation of the photoinitiator polymerizes at least some of the polymer precursor solution undemeath apertures in the patterned photomask and forms three-dimensional polymer structures that extend from the upper interior surface to the lower interior surface of the at least one channel. The method may further comprise washing unpolymerized polymer precursor solution out of the flow cell. The method may further comprise cleaving at least some of the three-dimensional polymer structures from the flow cell using heat, cleaving chemicals, or a combination of heat and cleaving chemicals.

[0005] The flow cell may have oligonucleotides of predetermined lengths on both the upper and lower surfaces of the at least one channel and the oligonucleotides may include primers. The polymer may be a hydrogel. The monomer may be acrylamide, the crosslinker may be N,N'- Bis(acryloyl)eystamine (BACy), and the photoinitiator may be lithium phenyl-2.4,6- trimethylbenzovlphosphinate (LAP). The polymer precursor solution may include polyethylene glycol (PEG)-thiol. PEG-acrylate, acrylamide. N,N'-Bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polvacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L- glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide. diacrylate, diallylamine, triallylamine, divinyl sulfone, diethyleneglycol diallyl ether, ethyleneglycol diacrylate, polymethyleneglycol diacrylate, polyethyleneglycol diacrylate, trimethvlopropoane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetracrylate, or combinations thereof. The polymer precursor solution may include polyethylene glycol (PEG)-thiol/PEG-acrylate: acrylamide/N N'-bis(acryloyl)cystamine (BACy): or PEG/polypropylene oxide (PPO) or combinations thereof. The photoinitiator may be a diazosulfonate initiator; a monoacylphosphineoxide (MAPO) salt; a bisacylphosphineoxide (BAPO) salt; or combinations thereof. The photomask may comprise polyethylene terephthalate, carbon ink, a chemically etched metal film, or combinations thereof. The photomask may be laminated to the upper exterior surface of the flow cell. The method may further comprise a light source to emit the light, wherein the light source is an ultraviolet light source. The three-dimensional polymer structures may be cylindrical. The three-dimensional polymer structures are reverse C-shaped.

[0006] In accordance with another implementation, another method for making on-flow cell three-dimensional polymer structures is disclosed. This method comprises loading a polymer precursor solution onto a flow cell, wherein the polymer precursor solution includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polymer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper and lower surfaces of the at least one channel; and illuminating the polymer precursor solution through a patterned photomask using a light source that emits light at a wavelength that activates the photoinitiator. and wherein activation of the photoinitiator polymerizes at least some of the polymer precursor solution underneath apertures in the photomask and forms three-dimensional polymer structures that extend from the upper interior surface to the lower interior surface of the at least one channel, and wherein the biological cells or colonies of biological cells are compartmentalized in the three-dimensional polymer structures. The method may further comprise washing unpolymerized polymer precursor solution out of the flow cell. The method may further comprise diffusing reagents into the three-dimensional polymer structures, wherein the reagents include lysis reagents that lyse the biological cells and release the genetic material therefrom, and wherein the genetic material includes nucleic acid. The method may further comprise fragmenting the released nucleic acid and ligating adapters to the ends of the nucleic acid fragments. The method may further comprise seeding the nucleic acid fragments on the upper and lower surfaces of the at least one sequencing channel by introducing a diffusion barrier mto the at least one channel, heating the flow cell to a temperature that cleaves the polymer structures and releases the nucleic acid fragments therefrom, hybridizing the nucleic acid fragments to the oligonucleotides on the upper and lower surfaces of the at least one channel, and washing the cleaved polymer structures out of the flow cell. The method may further comprise clonally amplifying the hybridized nucleic acid using bridge amplification to create clusters for nucleic acid.

[0007] The polymer may a hydrogel and the diffusion barrier may include a hydrophobic liquid or a viscous aqueous solution, wherein the hydrophobic liquid includes mineral oil, silicone oil, or perfluorinated oil, or combinations thereof, and wherein the viscous aqueous solution, includes polyethylene glycol (PEG). polyvinyl-pyrrolidone, pluronic dextran, sucrose, poly (N - isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polyethylene oxide, PEO-PPO- PEOviaponite, or combinations thereof. The photoinitiator may be a diazosulfonate initiator; a monoacylphosphineoxide (MAPO) salt; a bisacylphosphineoxide (BAPO) salt; or combinations thereof. The monomer is acrylamide, the crosslinker may be N.N'-Bis(acryloyl)cvstaming (BACy), and the photoinitiator may be lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP). The polymer precursor solution may include polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N.‚N'-Bis(acryloyDcystamine (BACy), PEG, polypropylene oxide (PPO), polvacrylic acid, polv(hvdroxvethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N- isopropylacrylamide) (PNIPAAm). poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA). polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallvlamine, triallvlamine,

divinyl sulfone, diethyleneglycol diallvl ether. ethvleneglycol diacrylate, polymethyleneglycol diacrylate, polyethyleneglycol diacrylate, trimethylopropoane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetracrylate, or combinations thereof. The polymer precursor solution may include polyethylene glycol (PEG)-thiol/PEG-acrylate; acrylamide/N N'-bis(acryloyljcystamine (BACy); PEG/polypropylene oxide (PPO). or combinations thereof. The photomask may be polyethylene terephthalate, carbon ink, or a chemically etched metal film. The photomask may be laminated to the upper exterior surface of the flow cell. The light source may be an ultraviolet light source. The three- dimensional polymer structures may be cylindrical. The three-dimensional polymer structures may be reverse C-shaped. The biological cells may be mammalian. The biological cells may be bacterial. The nucleic acid may be deoxyribonucleic acid. The nucleic acid may be ribonucleic acid.

[0008] In accordance with still another implementation, still another method for making on-flow cell three-dimensional polymer structures is disclosed. This method comprises loading a hydrogel precursor solution onto a flow cell, wherein the hydrogel precursor solution includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polymer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper interior surface and lower interior surface of the at least one channel; illuminating the hydrogel precursor solution through a patterned photomask using a light source that emits light at a wavelength that activates the photoinitiator, and wherein activation of the photoinitiator polymerizes at least some of the hydrogel precursor solution underneath apertures in the photomask and forms three-dimensional hydrogel structures that extend from the upper interior surface to the lower interior surface of the at least one channel, and wherein the biological cells or colonies of biological cells are compartmentalized m the three-dimensional hydrogel structures; diffusing a lysis reagent into the three-dimensional hydrogel structures, wherein the lysis reagent lyses the biological cells and releases the genetic material therefrom, and wherein the genetic material includes nucleic acid; fragmenting the released nucleic acid and ligating adapters to the ends of the fragments; and seeding the nucleic acid fragments on the upper interior surface and lower interior surface of the at least one channel by introducing a diffusion barrier into the at least one channel, wherein the diffusion barrier prevents cross- contamination between hydrogel structures, heating the flow cell to a temperature that cleaves the hydrogel structures and releases the nucleic acid fragments, hybridizing the nucleic acid fragments to the primers on the upper and lower interior surfaces of the at least one channel, and washing the cleaved hydrogel structures out of the flow cell; and clonally amplifying the hybridized nucleic acid fragments to create clusters for sequencing.

[0009] The photoinitiator may be a diazosulfonate initiator; a monoacylphosphineoxide (MAPO) salt; a bisacvlphosphineoxide (BAPO) salt; or combinations thereof. The monomer may be acrylamide, the crosslinker may be N.N'-Bis(acryloyl)cystamine (BACy). and the photoinitiator may be lithium 5 phenyl-2.4.6-trimethylbenzovlphosphinate (LAP). The hydrogel precursor solution may include polyethylene glycol (PEG)-thiol, PEG-acrylate. acrylanude, N‚N'-Bis{acryloyl)eystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxvethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly{lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), polv(L- aspartic acid), poly(L-glutamic acid). polylysine. agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin. carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethyleneglycol diallyl ether, ethyleneglycol diacrylate, polymethyleneglycol diacrylate, polyethyleneglycol diacrylate, trimethylopropoane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetracrylate, or combinations thereof. The hydrogel precursor solution may include polyethylene glycol (PEG)-thiol/PEG- acrylate;acrylamide/N ‚N'- bis(acryloyl)cvstamine (BACy); PEG/polypropylene oxide (PPO): or combinations thereof. The diffusion barrier may include a hydrophobic liquid or a viscous aqueous solution, wherein the hydrophobic liquid includes mineral oil, silicone oil, or perfluorinated oil, or combinations thereof. and wherein the viscous aqueous solution, includes polyethylene glycol (PEG), polyvinyl-pyrrolidone, pluronic dextran, sucrose, poly (N -isopropylacrylamide) or polyethylene oxide- polypropylene oxide-polyethylene oxide, PEO-PPO-PEOyiaponite, or combinations thereof. The photomask may be polyethylene terephthalate, carbon ink, or a chemically etched metal film. The photomask may be laminated to the upper exterior surface of the flow cell. The light source may be an ultraviolet light source. The hydrogel structures may be cvlindrical. The hydrogel structures may be reverse C-shaped. The biological cells may be mammalian. The biological cells may be bacterial. The nucleic acid may be deoxyribonucleic acid. The nucleic acid may be ribonucleic acid.

[0010] In all implementations of the methods disclosed above, the monomer may be the compound of formula I:

IR wherein each R? is independently hydrogen or (C,.) alkyl.

[0011] In all implementations of the methods disclosed above, the crosslinker may be the compound of formula II: So UH

II wherein: each n is independently an integer from 1-6; and each R' is independently a hydrogen or (C,.) alkyl.

[0012] In still another implementation, a flow cell is disclosed. This flow cell comprises a channel, wherein the channel includes an upper interior surface having primers coated thereon and a lower interior surface having primers coated thereon; and reversible, permeable, three-dimensional polymer structures in the channel from a polymer precursor solution, wherein the three-dimensional polymer structures extend from the upper interior surface of the channel to the lower interior surface of the channel. The flow cell may further comprise a photomask placed over an outer exterior surface of the channel. The three-dimensional polymer structures may be cvlindrical, reverse C-shaped, tubular, or combinations thereof. The three-dimensional polymer structures may include hydrogels. The flow cell, polymer precursor solutions, and photomask may be provided in a kit.

[0013] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein and may be implemented to achieve the benefits as described herein. Additional features and aspects of the disclosed system, devices, and methods will become apparent to those of ordinary skill in the art upon reading and understanding the following detailed description of the example embodiments. As will be appreciated by the skilled artisan, further implementations are possible without departing from the scope and spirit of what is disclosed herein. Accordingly. the drawings and associated descriptions are to be regarded as illustrative and not restrictive in nature.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The details of one or more implementations are set forth in the accompanying drawings and the description below. Other features, aspects, and advantages will become apparent from the description, the drawings, and the claims, in which:

[0015] FIG. 1A is a perspective view of a flow cell in accordance with one implementation of the disclosed systems and methods;

[0016] FIG. 1B is a top view and close-up top view of the flow cell of FIG. 1A wherein arrays of hydrogel structures have been formed on the flow cell;

[0017] FIG. 1C depicts the flow cell of FIG. 1A properly mserted into a cartridge used in sequencing-by-synthesis processes;

[0018] FIG. 2A depicts an example of the disclosed systems and methods for forming polymer (e.g., hydrogel) structures on a flow cell such as the flow cell shown in FIG. 1A, wherein a polymer precursor solution has been introduced into a fluidics channel of the flow cell and a prepattemed photomask has been placed over the channel;

[0019] FIG. 2B depicts an example of the disclosed systems and methods for forming polymer (e.g., hydrogel) structures on a flow cell wherein ultraviolet light is directed into the channel of the flow cell though openings in the photomask for polymerizing the contents of the polymer precursor solution;

[0020] FIG. 2C depicts an array of hydrogel structures formed inside the channel of a flow cell wherein the hydrogel structures are cylindrical in shape and are attached to upper and lower internal surface of the channel;

[0021] FIG. 2D depicts an example method for cleaving hydrogel structures formed in the channel of a flow cell by introducing oil containing a cleaving agent into the channel of the flow cell;

[0022] FIG. 2E depicts an example method for removing cleaved hydrogel structures from the channel of a flow cell by washing the channel;

[0023] FIG. 3A depicts another example of the disclosed systems and methods for forming polymer (e.g., hydrogel) structures on a flow cell wherein a prepatterned photomask is placed on or attached to a flow cell that is then inserted into a cartridge;

[0024] FIG. 3B depicts another example of the disclosed systems and methods for forming polymer (e.g., hydrogel) structures on a flow cell wherein a polymer precursor solution containing biological cells is loaded into the flow cell of FIG. 3A and the flow cell is then loaded into a device or instrument using an extendable tray;

[0025] FIG. 3C depicts another example of the disclosed systems and methods for forming polymer (e.g., hydrogel) structures on a flow cell wherein the flow cell is exposed to ultraviolet light to form an array of hydrogel structures on the flow cell (which are shown in the bright field micrograph), and wherein the flow cell is then washed to remove unpolymerized material and unloaded from the instrument;

[0026] FIG. 4A depicts an example of the disclosed systems and methods for cell encapsulation and in sifu preparation of sequencing libraries wherein single cells or colonies or cells are mixed with a polymer precursor solution and loaded into a flow cell and illuminated with ultraviolet light through a photomask to create an array of cell-embedded hydrogel structures (e.g., pillars) on the flow cell, which is shown in the bright field micrograph;

[0027] FIG. 4B depicts an example of the disclosed systems and methods for cell encapsulation and in situ preparation of sequencing libraries wherein lysis and tagmentation reagents are diffused into the hydrogel structures of FIG. 4A, and wherein the cells are then lysed and tagmented within the hydrogel structures;

[0028] FIG. 4C depicts an example of the disclosed systems and methods for cell encapsulation and in situ preparation of sequencing libraries wherein the libraries of FIG. 4B are seeded onto the top and bottom surfaces of the flow cell by introducing oil into the flow cell and raising the temperature to release the library fragments contained m the hydrogel structures, which then hybridize to surface primers attached to the surfaces of the flow cell;

[0029] FIG. 4D depicts an example of the disclosed systems and methods for cell encapsulation and in sifu preparation of sequencing libraries wherein the hybridized library fragments of FIG. 4C are then clonally amplified using the bridge amplification process for cluster generation;

[0030] FIG. 5A is a side view of a group of hydrogel structures formed on a flow cell using an alternate version the disclosed systems and methods for on-flow cell capturing of cells for in sifu library preparation, wherein the hydrogel structures have a reverse C-shaped geometry;

[0031] FIG. 5B are several top views of the cell-trapping hydrogel features of FIG. SA, showing the reverse C-shaped geometry thereof,

[0032] FIG. 5C is a side view of the hydrogel structures of FIG. 5A showing an individual cell captured in each hydrogel structure;

[0033] FIG. 5D is a side view of one of the hydrogel structures of FIG. 5C showing an individual cell captured in the hydrogel structure and the direction of cell-containing fluid directed into and through the flow cell;

[0034] FIG. 6 is a flow chart depicting an example implementation of a method for making reversible, permeable three-dimensional polymer structures on a flow cell;

[0035] FIG. 7 is a flow chart depicting an example implementation of a method for sequencing library preparation using reversible, permeable three-dimensional polymer structures formed on a flow cell; and

[0036] FIG. 8 is a flow chart depicting an example implementation of a method for sequencing library preparation using reversible, permeable three-dimensional hvdrogel structures formed on a flow cell

DETAILED DESCRIPTION

[0037] Implementations of the disclosed systems and methods are useful for creating reversible hydrogel polvmer structures on flow cells used, which may be used as part of the workflow for sequencing-by-synthesis and other sequencing methodologies. The workflow may include library preparation and sequencing. These hydrogel structures are particularly useful for addressing challenges associated with high throughput single-cell or single-colony sequencing on flow cells due to low starting nucleic acid input from single cells and an inability to compartmentalize sequencing libraries on flow cells. The disclosed svstems and methods enable high-throughput single-cell or single-colony sequencing by providing on-flow cell entrapment or encapsulation of cells and genetic material in reversible hydrogel structures. These hydrogel structures entrap or compartmentalize individual cells or individual colonies while allowing efficient reagent exchange for cell lysis and ultimately #2 situ preparation of sequencing libraries.

[0038] As used herein, the term "hydrogel" refers to a substance formed when an organic polymer (natural or synthetic) is cross-linked by way of covalent, ionic, or hydrogen bonds to create a three-dimensional open-lattice structure that entraps water molecules to form a gel. In some versions, the hydrogel may be a biocompatible hydrogel, which refers to a polvmer that forms a gel that is not toxic to living cells and allows sufficient diffusion of oxygen and nutrients to entrapped cells to maintain viability.

In some versions, the hydrogel polymer includes 60-90% fluid. such as water, and 10-30% polymer, wherein in other versions, the water content of hydrogel is about 70-80%.

[0039] As used herein, the term “adapter” refers to a linear oligonucleotide that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. In some examples, the adapter is substantially non-complementary to the 3' end or the 5' end of any target sequence present in a sample. In some examples, suitable adapter lengths are in the range of about 10-100 nucleotides, about 12-60 nucleotides, or about 15-30 nucleotides in length. Generally, an adapter can include any combination of nucleotides and/or nucleic acids. An adapter can also include one or more cleavable groups at one or more locations. An adapter can also include a sequence that is complementary to at least a portion of a primer, for example a primer including a universal nucleotide sequence. An adapter can also include a barcode (also referred to as a tag or index) to assist with downstream error correction, identification, or sequencing. As used herein, the term “index” refers to a sequence of nucleotides that can be used as a molecular identifier or barcode to tag a nucleic acid, or to identify the source of a nucleic acid. An index can be used to identify a single nucleic acid, or a subpopulation of nucleic acids.

[0040] A flow cell herein may refer to a flow cell to be used during a sequencing workflow. For example, the flow cell may be used for library preparation, sequencing, or both. In one implementation, the same flow cell may be used for both the library preparation and sequencing. An example flow cell includes channel comprising a surface across which one or more fluid reagents can be flowed and to which adapted fragments of sequencing libraries can transport and bind. A flow cell includes a solid support having a surface on which sequencing libraries bind. In some examples, the solid surface is covered with a hydrogel layer. In some examples. the surface contains a lawn of capture nucleotides that can bind to adapted fragments of a sequencing library. In some examples, the surface is a patterned surface. A "patterned surface" refers to an arrangement (such as an array) of different regions (such as amplification sites) in or on an exposed surface of a solid support. For example, one or more of the regions can be features where one or more amplification and/or capture primers are present. The features can be separated by interstitial regions where primers are not present. In some examples, the flow cell device has a channel height of about 50 um, about 60 um, about 70 um, about 80 um, about 90 um, about 100 um, about 110 um, about 120 um, about 130 um, about 140 um, or about 150 um, or an amount within a range defined by any two of the aforementioned values.

[0041] As shown in FIG. 1A, an example flow cell 100 includes top layer of glass 110 having fluidic holes 112 formed therein; channel defining spacer 120, which includes a plurality of fluidic/sequencing channels 122 formed therein; and bottom layer of glass 130 on which array 150 is formed. Array 150 includes individual structures 152 formed thereon by the disclosed methods. An individual structure 152 may be a three-dimensional structure. The structure may comprise a polymer. In one implementation, the polymer is a hydrogel. It is noted while hydrogel is used to reference structure 152 in some instances herein, “hydrogel” is only used as a representative material in this implementation, and the structure need not comprise hvdrogel and instead can comprise any suitable polymer material. FIG. 1B depicts assembled flow cell 100 upon which an array 150 of individual three-dimensional hydrogel structures 152 has been fabricated in one of the channels 122 and FIG. 1C depicts flow cell 100 having multiple three-dimensional hydrogel structures 152 formed thereon inserted into cartridge 160, which is used with a sequencing-by-synthesis apparatus. Reversible, three-dimensional hydrogel IO structures having a specific, predetermined geometry may be formed on the flow cell by: (i) introducing a hydrogel precursor solution into a channel of the flow cell; (ii) placing a photomask having a specific pattern formed thereon over the channel on the flow cell, either before or after introducing the hydrogel precursor solution into the flow cell; and (iii) exposing the hydrogel precursor solution to light at a predetermined wavelength through the photomask, wherein the illumination of the hydrogel precursor solution polymerizes the contents thereof and forms three-dimensional structures on the flow cell that correspond to the pattern on the photomask. Once the hydrogel structures have served their purpose, they may be cleaved from the flow cell and washed away without affecting the overall functionality of the flow cell.

[0042] The hydrogel precursor solution may include monomer solutions that can be photopolymerized by activation of a photoinitiator. An example of one such system includes at least one type of monomer, a reversible or cleavable crosslinker, and a photoinitiator. In one version, the monomer is acrylamide, the reversible crosslinker is N.N'-Bis(acryloyl)}cystamine (BAC), and the photoinitiator is lithium phenyl-2.4,6-trimethylbenzovlphosphinate (LAP), which is activated by ultraviolet (UV) light at a predetermined wavelength.

[0043] In other versions, the precursor solution may include polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine, PEG, polypropylene oxide (PPO), polyacrylic acid, polv(hydroxyethyvl methacrylate) (PHEMA), poly(methyl methacrylate} (PMMA), poly(N- isopropylacrylamide) (PNIPAAm). poly(lactic acid) (PLA), poly(lactic-co-glvcolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallvlamine, triallvlamine, divinyl sulfone, diethyleneglycol diallyl ether, ethyleneglycol diacrylate, polymethyleneglyvcol diacrylate, polyethyleneglycol diacrylate, trimethylopropoane trimethacrvlate, ethoxylated trimethylol triacrylate, or cthoxylated pentaerythritol tetracrylate, or combinations thereof. In other versions, the monomer may include PEG-thiol/PEG-acrylate, acrylamide/N ‚N'-bis(acryloyl)cystamine (BACy), or PEG/PPO.

[0044] In some examples, the monomer is the compound of formula I:

I wherein each R” is independently hydrogen or (C,) alkyl.

[0045] In some examples, the crosslinker 1s a compound of formula IT:

II wherein: each n is independently an integer from 1-6; and each R' is independently a hydrogen or (Co) alkyl.

[0046] A reversible or cleavable crosslinker is capable of reversibly crosslinking the polymer chains within the polymer. In one implementation, the polymer is a hydrogel. In some versions, a crosslinker can be cleaved, thereby unlinking the polymer chains, by the presence of a reducing agent: by elevated temperature; by an electric field; or by exposing the hydrogel structures to a wavelength of light that cleaves a photo-cleavable crosslinker that crosslinks polymer of the hydrogel. In some versions, the reducing agent may include phosphine compounds, water soluble phosphines, nitrogen containing phosphines and salts and derivatives thereof, dithioerythritol (DTE), dithiothreitol (DTT) (cis and trans isomers, respectively, of 2,3-dihydroxy-lL4-dithiolbutane). 2-mercaptoethanol or [p-mercaptoethanol (BME), 2-mercaptoethanol or aminoethanethiol, glutathione, thioglycolate or thioglycolic acid, 2.3- dimercaptopropanol, tris(2-carboxyethylphosphine (TCEP), tristhydroxymethyl)phosphine (THP), or P- [tris(hydroxymethyl)phosphme] propionic acid (THPP). In some versions, the crosslinker is cleaved by increasing the temperature to greater than about 50°C, about 55°C. about 60°C, about 65°C, about 70°C, about 75°C, about 80°C, about 85°C. about 90°C, about 95°C, or about 100°C. In some versions, the reducing agent is activated by ultraviolet light.

[0047] Other suitable photoinitiators include biocompatible photoinitiators for radical polymerization that do not damage nucleic acids such as, for example, a diazosulfonate initiator;

monoacylphosphineoxide (MAPO) salts such as. for example, NaUTPO and LiOTPO; and bisacvlphosphineoxide (BAPO) salts such as, for example, BAPOCIONa and BAPODOL.

[0048] In some examples, crosslinking the polymer chains of the hydrogel structure forms a hydrogel matrix having pores (i.e. a porous hydrogel matrix). In some versions, the size of the pores in the hydrogel structures are regulatable or tunable and may be formulated to encapsulate sufficiently large genetic material, such as cells or nucleic acids of greater than about 300 base pairs, but to allow smaller materials, such as reagents, or smaller sized nucleic acids of less than about 50 base pairs, such as primers, to pass through the pores, thereby passing in and out of the hydrogel structures. The hydrogels can have any pore size having a diameter sufficient to allow diffusion of reagents through the structure while retaining the encapsulated nucleic acid molecules. The term "pore size" can also refer to an average diameter or an average effective diameter of a cross-section of the pores, based on the measurements of a plurality of pores. The effective diameter of a cross-section that is not circular equals the diameter of a circular cross-section that has the same cross-sectional area as that of the non-circular cross-section. In some examples, the hydrogel structure can be swollen when the hydrogel is hydrated. The sizes of the pores can then change depending on the water content in the hydrogel of the hydrogel structure. In some examples, the pores have a diameter of from about 10 nm to about 100 nm.

[0049] In some examples, the pore size of the hydrogel structures is tuned bv varying the ratio of the concentration of polymer to the concentration of crosslinker. In some examples, the ratio of polymer to crosslinker is about 30:1, about 25:1, about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:15, about 1:20, or about 1:30, or about any one of these ratios. or a ratio within a range defined by any two of the aforementioned ratios.

[0050] FIGS. 2A-2E depict example method 200 for fabrication and subsequent removal of three-dimensional hydrogel structures on flow cell 210. Flow cell 210 includes upper internal surface 212 and lower internal surface 214 which together define flow cell channel 216. Pre-pattemed photomask 218 has been laminated or otherwise attached to the upper surface of flow cell 210. FIG. 2A depicts introducing hydrogel precursor solution 230 containing: {i) monomer (¢.g., acrylamide), (ii) crosslinker (e.g., BAC), and (iii) photo-initiator (¢.g., LAP) into flow cell 210. FIG. 2B depicts exposing hydrogel precursor solution 230 to UV light at a predetermined wavelength through pre-patterned photomask 218, which has multiple apertures 200 formed therein. Exposing hydrogel precursor solution 230 to UV light activates the photoinitiator (LAP), thereby generating radicals that lead to controlled polymerization of the monomer (acrvlamide) into hydrogel structures 232 containing disulfide bonds. FIG. 2C depicts the formation of hydrogel features 232, which are anchored to top and bottom surfaces 212 and 214 of channel(s) 216 of flow cell 210, which is adapted to be inserted into cartridge 260. FIG. 2C includes bright field micrograph 250 showing cylindrical hydrogel structure 232 (100-150 um in diameter) having dense gel walls with a less dense core. FIG. 2D depicts cleaving hydrogel features 232 from flow cell 210 using heat or a combination of heat and chemical cleavage of the crosslinker. For example, incubating hydrogel structures 232 with a reducing agent, such as an oil containing DTT, cleaves the structures by reducing the disulfide bonds in the hydrogel crosslinker to thiols, thereby permitting the hydrogel to be washed out of flow cell 210 as shown in FIG. 2E. The surfaces of flow cell 210 remain functional after the cleaved hydrogel structures have been washed out of the flow cell, ie, removing the hydrogel structures from flow cell 210 does not affect the functionality of primers that have been bound to the flow cell prior to fabrication and subsequent removal of the hydrogel gel features.

[0051] Fabrication of hydrogel structures such as those previously described can be accomplished in both a factory environment and in a laboratory environment. However, known hydrogel fabrication techniques typically involve the use of expensive and unwieldy equipment such as, for example, a photomask aligner with a collimated UV light source and a chrome mask. Accordingly. to facilitate the fabrication of hydrogel structures on flow cells directly by consumers of sequencing products, a relatively small-scale, low-cost instrument for on-flow cell hydrogel fabrication is provided. By way of example, a generic implementation of this instrument includes: (1) a collimated LED UV light source such as, for example, Thor Labs model M385LP1-C1; (ii) a housing that is adapted to receive a flow cell (and flow cell cartridge) therein and that supports and properly positions the light source relative to the flow cell; (iii) a prepatterned Mylar® photomask that is adapted to be laminate adhered on the upper surface of a particular flow cell; and (iv) a shielding enclosure for containing the light source and housing. An opening in the shielding enclosure allows the flow cell to be inserted into the housing for UV illumination of the flow cell through the prepatterned photomask. The housing may include a movable or adjustable stage apparatus for replicating patterns along the length and width of a flow cell if the illumination zone of the housing is smaller than the area of on the flow cell that is to be photopatterned. In addition to operating as a wide-field illuminator, different versions of the disclosed instrument also perform various reagent exchanges and provide thermal control for facilitating automated library preparation. As described in greater detail below, certain implementations of the disclosed instrument operate as stand-alone library preparation devices that output a ready to cluster or ready to sequence library. The photomask may include Mylar® (polyethylene terephthalate); a screen-printed light absorbing material such as carbon ink; or a chemically etched metal film; such aluminum, chrome. gold, or platinum, and other light absorbing materials

[0052] FIGS. 3A-3C depict an example implementation of the disclosed system and method for fabricating hydrogel structures on a flow cell, wherein the hydrogel structures contain a sample to sequenced or otherwise analyzed. In this implementation, the disclosed instrument is automated, and the housing includes a processor that executes various algorithms installed thereon for illuminating the flow cell and for performing reagent exchange and other functions in an automated manner. As shown in FIG. 3A, a customer (or other user) orders flow cell 310 on which photomask 318 (having a region that includes a customer-specified pattern formed therein) has been laminated to form assembly 320. The patterned region of photomask 318 is placed over and aligned with channel(s) 312 on flow cell 310. Flow cell 310 is then inserted into an appropriate flow cell cartridge 360. As shown in FIG. 3B, the customer then mixes a sample of interest (e.g., biological cells or genomic DNA) with a hydrogel precursor solution that includes, for example, a monomer, a cross linker, and a photoinitiator, and loads the solution onto flow cell 310. As shown in FIG. 3C, assembly 320 and cartridge 360 are then loaded into housing 370 on which a UV light source has been mounted using moveable tray 372. Based on the layout or geometric pattern of photomask 318, the customer chooses an appropriate illumination program and exposes flow cell 310 to UV light for polymerizing the solution and patterning the desired hydrogel structures on flow cell 310. FIG. 3C includes a bright field micrograph of hydrogel pillars fabricated on a flow cell using the disclosed system and method. Flow cell 310 is then washed to remove unpolymerized solution and excess sample and photomask 318 can be removed from flow cell 310. In one implementation, more than half of each of the unpolymerized solution, the excess sample, and the photomask is removed. In one implementation, all of each of the unpolymerized solution, the excess sample. and the photomask is removed. Flow cell 310 can then be placed into a sequencer or fluid handler for automated downstream processing such as lysis, tagmentation, bridge amplification, clustering, etc.

[0053] Several other implementations are provided regarding the assembly of the photomask and the flow cell. In one implementation, a user first inserts a flow cell into the housing and then inserts the photomask, which is separate from the flow cell (e.g.. the photomask is not laminated to the flow cell). Because various photomask patterns and designs are possible, a user may select different photomasks based on required pitch or on specific applications or specific uses for the flow cell. In this and other implementations, the housing of the instrument is adapted to receive a variety of different flow cells including HiSeq™, NextSeq™, NovaSeq™. MiniSeq™, iSeq™, and MiSeq™ flow cells, or other suitable flow cells available from Illumina Inc, USA. In another implementation, the flow cell is provided pre-assembled with the photomask already applied to the exterior surface of the flow cell. Depending on the resolution, the photomask can be either printed on the flow cell using screen printing or laminated to the surface of the flow cell using an opaque adhesive film patterned to create structures on the flow cell. The photomask may be peeled off the flow cell after it has been used, if desired. In another implementation, the photomask may be fabricated from aluminum, or another metal deposited inside a fluidic channel, during a microfabrication process used to create the flow cell. The photomask may then be etched away with a high pH buffer after creation of hydrogel structures on the flow cell is complete. Cell Compartmentalization and In Sifu Sequencing Library Preparation

[0054] The disclosed systems and methods may have a benefit of high-throughput single-cell or single-colony sequencing by providing on-flow cell compartmentalization of biological cells (and genetic material contained therein) that is achieved by encapsulating single cells or single cell colonies in reversible hydrogel structures that allow for efficient reagent exchange for cell lysis and sequencing library preparation. fn situ library preparation and spatial indexing of clusters is accomplished using the following example implementation, which includes on-flow cell biological cell encapsulation, library preparation, library seeding, and bridge amplification. The flow cell is provided with two types of oligonucleotides (e.g., P5 and P7), referred to as surface primers or sequencing primers, bound to the upper and lower surfaces of the flow cell. The sequences of these surface primers are complimentary to library adapters, and the fragments of a DNA library are captured by these oligonucleotides. As used herein, PS and P7 refer to a universal P5 or P7 sequence or P5 or P7 primer for capture and/or amplification purposes. A P5 sequence comprises a sequence defined by SEQ ID NO: 1 (AATGATACGGCGACCACCGA) and a P7 sequence comprises a sequence defined by SEQ ID NO: 2 (CAAGCAGAAGACGGCATACGA).

[0055] “Genetic material”, as used herein, refers to cells, microbiomes, or nucleic acids. In some versions, the cell is a single cell, including a prokaryotic or a eukaryotic cell. In some versions, the cell is a mammalian cell. In some versions, the cell is a human cell. In some versions, the cell is a bacterial cell. In some versions, the genetic material is a viral particle. In some versions, the nucleic acid is a long DNA molecule, genomic DNA, viral nucleic acid, bacterial nucleic acid, or mammalian nucleic acid. Any genetic materials of interest may be encapsulated within the disclosed hydrogel structures.

[0056] Genetic material encapsulated with the disclosed hydrogel structure is of sufficient size that it is entrapped within the hydrogel structure such that it cannot pass through the pores of the hydrogel structure. In some examples, the target nucleic acid molecule encapsulated within the hydrogel structure 1s at least about 100 nucleotides in length, at least about 150 nucleotides in length, at least about 200 nucleotides in length, at least about 300 nucleotides in length, at least about 300 nucleotides in length, at least about 1.000 nucleotides in length. at least about 5,000 nucleotides in length, at least about 10,000 nucleotides in length, at least about 20,000 nucleotides in length, at least about 50,000 nucleotides in length, at least about 100,000 nucleotides in length, or more nucleotides in length. In several examples, the nucleic acid molecules encapsulated within the hydrogel structures are genomic DNA fragments of from about 1,000 to about 10,000 nucleotides in length, from about 10,000 to about 20,000 nucleotides in length, from about 10,000 to about 50,000 nucleotides in length. from about 50,000 to about 100,000 nucleotides in length, or about 300, about 500, about 1000, about 10,000, about 20,000, about 30,000 or about 100,000 nucleotides in length, or a range between any two of the foregoing sizes, or a length longer than the foregoing sizes. In some examples, the encapsulated nucleic acid molecules are up to about 3 IO Mbases in length.

[0057] Some versions of the disclosed systems and methods relate to processing genetic material within a hydrogel structure to create a sequencing library, which can be defined as a collection of fragments of one or more target nucleic acid molecules, or amplicons of the fragments. In some versions, genetic material encapsulated within a hydrogel structure is contacted with one or more reagents for nucleic acid processing. In some versions, the genetic material is retained within the hydrogel structures, and reagents pass through the pores of the hydrogel structures. Reagents can include lysis reagents, nucleic acid purification reagents, DNA amplification reagents, tagmentation reagents, PCR agents, or other reagents used in processing of genetic materials (e.g., lysozyme, proteinase K, random hexamers, polymerase (for example, ® 29 DNA polymerase. Taq polymerase, Bsu polymerase), transposase (e.g.. Tn5), primers (e.g, P5 and P7 adaptor sequences), ligase, catalyzing enzyme, deoxynucleotide triphosphates, buffers, or divalent cations. Thus, the hydrogel structures provide a microenvironment for controlled reactions of genetic materials within the hydrogel structures by allowing a barrier for reagents to pass in and out of the hydrogel structures, while retaining the genetic material itself within the structures. This has the benefit of enabling single cell processing for rapid and efficient processing of a target nucleic acid. In some versions, the encapsulated nucleic acids are sequenced in full or in part within the hydrogel structures. The encapsulated nucleic acids can be sequenced according to any suitable sequencing methodology, such as direct sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, nanopore sequencing and the like.

[0058] For cell encapsulation, as shown in FIG. 4A, single cells or colonies are mixed with a polymer precursor solution that includes a monomer, a cleavable crosslinker, and a photoinitiator. The cell-containing solution is then loaded into a flow cell and illuminated with UV light through a photomask in the manner previously described to create an array of cell-embedded hvdrogel structures (e.g. pillars) on the flow cell. Excess precursor solution is washed away to obtain a clear interstitial space between the hydrogel structures. A merged bright field and fluorescence micrograph showing a hydrogel structure with £. coli cells encapsulated therein and a bright field image of hydrogel pillars formed on a flow cell appear at the bottom of FIG. 4A. Alternately, as shown in FIGS. 5A-5D, an array of hydrogel structures 532 having cell-trapping features formed therein may be created on flow cell 510 first, and single cells or colonies may then be flowed through cell-trapping hydrogel features 532 such that the single cells or colonies become entrapped in the hydrogel features. FIG. 5A is a side-view depiction of example cell-trapping hydrogel features 532 that are attached to upper surface 512 and lower surface 514 of channel 516. FIG. 3B is a top view of the cell-trapping hydrogel feature of FIG. 5A. FIG. 5C is a side- view depiction an example cell-trapping hydrogel array in which cells 550 have become entrapped and FIG. 5D is a top view of one of the cell-trapping hydrogel features of FIG. 5C showing cell 550 trapped therein. As shown in FIG. 5D, hydrogel features 532 may include beveled edges and various channels and passages formed therein to facilitate the flow of fluid through and around the features.

[0059] In one implementation, for library preparation, as shown in FIG. 4B, lysis and tagmentation reagents are diffused into the hydrogel structures. Tuning or otherwise modifying the pore size of the hydrogel may allow optimization of buffer exchanges and efficient diffusion of reagents into and out of the hydrogel structures. Cells captured in the hydrogel structures are lysed with an enzymatic or chemical lysis buffer. DNA released by lvsing the cells is then tagmented. Tagmentation involves modification of a nucleic acid molecule by a transposome complex to fragment the nucleic acid molecule and ligate adapters to the 5' and 3' ends of the fragments in a single step. Tagmentation reactions may combine random DNA fragmentation and adapter ligation into a single step to increase the efficiency of the sequencing library preparation process. Once the adapters have been ligated to the fragments, additional motifs such as indices, barcodes, and other kinds of molecular modifications that act as reference points during amplification, sequencing, and analysis may be added. Indices and barcodes are unique DNA sequences ligated to fragments within a sequencing library for downstream in silico sorting and identification. A bright field micrograph showing an array of hydrogel structures appears at the bottom of FIG. 4B.

[0060] As previously indicated, adaptors can include sequencing primer sites, amplification primer sites, and indexes. For example, an adaptor can include a P5 sequence, a P7 sequence, or a complement of either. As previously indicated, an "index" can include a sequence of nucleotides that can be used as a molecular identifier and/or barcode to tag a nucleic acid, and/or to identify the source of a nucleic acid. In some versions, an index can be used to identify a single nucleic acid, or a subpopulation of nucleic acids.

[0061] For library seeding, as shown in FIG. 4C, to seed the libraries resulting from library preparation onto the top and bottom surfaces of the flow cell while maintaining spatial compartmentalization, a liquid diffusion barrier is introduced into the flow cell. The liquid diffusion barrier may contain a cleaving agent such as DTT, which degrades the hydrogel structures. The temperature of the flow cell is raised, and the hydrogel structures are cleaved to release the library fragments contained therein, which then hybridize to the surface primers attached to the surfaces of the flow cell at areas 250. In this implementation, a wash step with an aqueous buffer is used to remove the cleaved hydrogels from the flow cell. A bright field micrograph showing melted hydrogel structures in mineral oil appears at the bottom of FIG. 4C.

[0062] The hydrogel structures are degraded while surrounded by a liquid diffusion barrier to release the sequencing libraries from the structures and seed the sequencing libraries on the flow cell. The liquid diffusion barrier is loaded onto the flow cell to fill the void volume between the hydrogel structures and to surround the hydrogel structures. Surrounding the captured hydrogel structures with the liquid diffusion barrier inhibits diffusion of the sequencing libraries outside of the structure volume when the structure is degraded, thereby reducing, and in some instances even preventing, cross-contamination between hydrogel structures. After structure degradation, the encapsulated sequencing libraries transport to the surface of the flow cell, where they are captured. Thus, in the presence of the liquid diffusion barrier, seeding on the flow cell occurs in close proximity to the footprint of each hydrogel structure. It should be noted that a diffusion barrier is used in certain implementations wherein discrete compartmentalization of library fragments generated within the hydrogel structures is desired. However, in implementations in which compartmentalization is not desired, a diffusion barrier may not be used. Accordingly, the diffusional barrier may be referred to as “optional”.

[0063] In some examples, the liquid diffusion barrier can be a hydrophobic liquid such as an oil. examples of which include mineral oil, silicone oil, or perfluorinated oil, or a combination of two or more thereof. In some examples, the liquid diffusion barrier is a viscous aqueous solution, for example, containing polyethylene glycol (PEG). polyvinyl-pyrrolidone, pluronic dextran, sucrose, poly(N - isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polvethylene oxide (PEO-PPO- PEOviaponite, or a combination of two or more thereof. In some examples, a temperature responsive material can be used as the liquid diffusion barrier. The temperature responsive material is a non-viscous liquid at non-seeding temperature and can be easily loaded onto the flow cell to occupy the interstitial space between hydrogel structures. Upon heating to seeding temperature, the material solidifies to form a physical barrier and prevent library diffusion. In some examples, the temperature responsive material can be a poly(N-isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-

PPO-PEO)aponite nanoparticle composite material. In some examples, the liquid diffusion barrier used in the disclosed implementations is composed of a combination of any two or more of the liquid diffusion barriers discussed above.

[0064] The hydrogel structures can be degraded using any appropriate method that does not substantially reduce the effectiveness of the liquid diffusion barrier for inhibiting diffusion of the sequencing libraries beyond the diameter of the hydrogel structures. The hydrogel structures do not need to be completely degraded to release the sequencing libraries from the hydrogel structures and seed the sequencing libraries on the flow cell. Sufficient degradation includes an increase in porosity of the hydrogel structures to allow for diffusion of the encapsulated sequencing libraries and transport of the sequencing libraries to the surface of the flow cell.

[0065] For bridge amplification, as shown in FIG. 4D, the hybridized library fragments are then clonally amplified using the bridge amplification process for cluster generation. During bridge amplification, polymerases move along a single stranded DNA fragment (polynucleotide) bound to the flow cell, creating its complementary polynucleotide. The original polynucleotide is washed away, leaving only the reverse polynucleotide. At the top of the reverse polynucleotide there is an adapter sequence (e.g., P5 or P7). The DNA fragment bends and attaches to an oligonucleotide on the flow cell surface that is complementary to the top adapter sequence. Polymerases attach to the reverse polynucleotide, and its complementary polynucleotide (which is identical to the original) is made. The now double stranded DNA is denatured so that each polynucleotide can separately attach to an oligonucleotide sequence anchored to the flow cell. One will be the reverse strand; the other, the forward. The process is then repeated over and over and may occur simultaneously for millions of clusters resulting in clonal amplification of all the fragments in the DNA library. Following bridge amplification, resulting clusters 260 are localized to the top and bottom surfaces of the flow cell where the hydrogel structures had previously been anchored. A fluorescence micrograph at the bottom of FIG. 4D shows the presence of sequencing clusters 260 after staining with SYTOX™ intercalator dye. commercially available from ThermoFisher Scientific.

[0066] FIG. 6 is a flowchart depicting an example implementation of a method for making three- dimensional polymer structures on a flow cell. Method 600 mcludes loading a polymer precursor solution into a flow cell at block 602, wherein the polymer precursor solution includes a monomer, a crosslinker, and a photoinitiator, wherein the flow cell includes at least one channel for receiving the polymer precursor solution, and wherein at least one channel has an upper interior surface and a lower interior surface; placing a photomask over the at least one channel at block 604, wherein the photomask includes a series of apertures formed therein: and illuminating the polymer precursor solution through the photomask with light at a wavelength sufficient to activate the photoinitiator at block 606. Activation of the photoinitiator polymerizes at least some of the polymer precursor solution underneath the apertures in the photomask and forms three-dimensional polymer structures that extend from the upper interior surface to the lower interior surface of the at least one channel. In other implementations, the photomask is integrated with the flow cell rather than being placed on or attached thereto.

[0067] FIG. 7 is a flowchart depicting another example implementation of a method for making three-dimensional polymer structures on a flow cell. Method 700 includes loading a polymer precursor solution into a flow cell at block 702, wherein the polymer precursor solution includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, wherein the flow cell includes at least one channel for receiving the polymer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper and lower interior surfaces of the at least one channel; placing a photomask over the at least one channel at block 704, wherein the photomask includes a series of apertures formed therein; and illuminating the polymer precursor solution through the photomask with a light at a wavelength that activates the photoinitiator at block 706, wherein activation of the photoinitiator polymerizes at least some of the polymer precursor solution underneath the apertures in the photomask and forms three-dimensional polymer structures that extend from the upper interior surface to the lower interior surface of the at least one channel; and wherein the biological cells or colonies of biological cells are compartmentalized in the three-dimensional polymer structures. In other implementations, the photomask is integrated with the flow cell rather than being placed on or attached thereto.

[0068] FIG. 8 1s a flowchart depicting vet another example implementation of a method for making three-dimensional hydrogel structures on a flow cell. Method 800 includes loading a hydrogel precursor solution onto a flow cell at 802, wherein the hydrogel precursor solution includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, wherein the flow cell includes at least one channel for receiving the polymer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper and lower interior surfaces of the at least one channel: placing a photomask over the at least one channel at block 804, wherein the photomask includes a series of apertures formed therein; illuminating the hydrogel precursor solution through the photomask with light at a wavelength that activates the photoinitiator at block 806, wherein activation of the photoinitiator polymerizes the hydrogel precursor solution underneath the apertures in the photomask and forms three- dimensional hydrogel structures that extend from the upper interior surface to the lower interior surface of the at least one channel, and wherein the biological cells or colonies of biological cells are compartimentalized in the three-dimensional hydrogel structures; diffusing a lysis reagent into the three- dimensional hydrogel structures at block 808, wherein the lysis reagent lyses the biological cells and releases the genetic material therefrom, and wherein the genetic material includes nucleic acid; fragmenting the released nucleic acid and ligating adapters to the end of the nucleic acid fragments at block 810; seeding the nucleic acid fragments on the upper and lower surfaces of the channel at block 812 by introducing a diffusion barrier into the at least one channel to prevent cross-contamination between hydrogel structures at 814, heating the flow cell to a temperature that cleaves the hydrogel structures and releases the nucleic acid fragments at 816, hybridizing the nucleic acid fragments to the primers on the upper and lower interior surfaces of the at least one channel at 818, and washing the cleaved hydrogel structures out of the flow cell at 820; and clonally amplify the hybridized nucleic acid to create clusters for sequencing at block 822. In other implementations, the photomask is integrated with the flow cell rather than bemg placed on or attached thereto.

[0069] The methods and systems described herein provide certain benefits. Versions of the "spatial indexing" methods and techniques described herein shorten data analysis and simplify the process of library preparation from single cells and long DNA molecules. Existing protocols for smgle cell sequencing involve efficient physical separation of the cells and uniquely barcoding each isolated cell and pooling cells back together for sequencing. Current protocols for synthetic long reads also involve cumbersome barcoding, pooling barcoded fragments together for sequencing, and performing data analysis to distinguish genetic information derived from each barcoded cell. During these long processes, there is also loss of genetic material which causes dropouts m the nucleotide sequences. Versions described herein not only shorten the entire sequencing process but also increase data resolution for single cells. NON-LIMITING WORKING EXAMPLES

[0070] The following examples are provided to illustrate particular features of certain examples, but the scope of the claims should not be limited to those features exemplified. EXAMPLE 1: On-flow cell integration of library preparation from genomic DNA

[0071] This example illustrates sequencing of genomic DNA trapped in hydrogel structures, wherein library preparation though sequencing is integrated and performed directly on a flow cell.

[0072] A hydrogel precursor solution of 10%T was prepared from a 40% (w/v) acrylamide/ N,N'bis(acryloyl)cystamine (BA Cy) (19:1) monomer stock solution (3.8 g of acrylamide, 0.2 g of BACy, and 6 mL of double distilled (dd) H20), with 1 mg/mL of LAP photoinitiator and E. coli genomic DNA

(0.008 ng/uL). Solution was introduced into a MiSeq' flow cell and the flow cell was exposed to collimated UV light (OAI mask aligner, power in the range of ~30-40 mW/cm’) through a chrome mask (HTA Photomasks) patterned with 200 um circular features to form the hydrogel structures.

[0073] Precursor solution containing excess genomic DNA was washed out with PR-2. The flow cell was incubated with tagmentation enzyme solution for 15 minutes at 55°C, followed by a PR-2 wash and an incubation with Tagmentation Stop buffer (10 minutes at 37°C). The flow cell was then washed with PR-2 and AMS-1 enzyme was incubated at 50°C for 5 minutes. The library was denatured with an NaOH 0.1 M wash, followed by an HT-2 wash. The flow cell was incubated with HT-1 for 5 minutes and then loaded with mineral oil with surfactants and DTT (312.5 pL of mineral oil + 4.5% Span 80, 0.4% Tween 20, and 0.05% Triton X-100 and 0.5 pL of 12 mg DTT/400 uL EtOH). Seeding was achieved by incubating flow cell at a temperature ramp of 60°C, 40°C and 20°C.

[0074] The flow cell was then washed with HT-1 and the seeded library was extended with AMS-1 (50°C for 5 minutes). Remaining hydrogel was then melted with CLM (40°C for 5 minutes) and the flow cell was washed with PR-2. The flow cell was then inserted into a sequencer for bridge amplification (24 cycles) and sequencing. This method demonstrates that genomic DNA may be trapped within on-flow cell hydrogel structures and that library preparation and sequencing of the library may be performed directly on the flow cell.

EXAMPLE 2: On-flow cell integration of library preparation for mini metagenomic sequencing

[0075] The following example illustrates direct integration of microbial cell sequencing, from lysis and library preparation of microbes encapsulated in on-flow cell hydrogel structures, to seeding, clustering and sequencing of library molecules.

[0076] A hydrogel solution of 10%T was prepared from a 40% (w/v) acrylamide/ N‚N'bis(acryloyl)cystamine (BA Cy) (19: 1) monomer stock solution (3.8 g of acrylamide, 0.2 g of BACy, and 6 mL of double distilled (dd) H20), with 1 mg/mL of LAP photoinitiator and 0.01 M Tris/HCI and a mix of 10 microbes (ZYMOMICS Microbial Community Standard D6300) and the solution was introduced into a MiSeq™ flow cell. The flow cell was exposed to collimated UV light (OAT mask aligner, power in the range of ~30-40 mW/cm?) through a chrome mask (HTA Photomasks) patterned with 200 um circular features to form the hydrogel structures.

[0077] Excess precursor solution was washed out with PR-2 and microbes are lysed using a ChargeSwitch gDNA mini bacteria kit (Thermo Fisher CS11301); a first incubation with lysozyme and lysostaphin, followed by a second incubation with proteinase K. The flow cell was washed with PR-2 and tagmentation enzyme solution was introduced and incubated at 55°C for 15 minutes, followed by a PR-2 wash and an incubation with Tagmentation Stop buffer (10 minutes at 37°C). The flow cell was then washed with PR-2 and AMS-1 enzyme was incubated at 50°C for 5 minutes. Library was then denatured with an NaOH 0.1 M wash, followed by an HT-2 wash. The flow cell was incubated with HT-1 for 5 minutes, and then loaded with mineral oil with surfactants and DTT (312.5 uL of mineral oil + 4.5% Span 80, 0.4% Tween 20, and 0.05% Triton X-100 and 0.5 uL of 12 mg DTT/400 uL EtOH). Seeding was achieved by incubating flow cell at a temperature ramp of 60°C, 40°C and 20°C.

[0078] The flow cell was then washed with HT-1 and seeded library was extended with AMS-1 (50°C for 5 minutes). Remaining hydrogel was then melted with CLM (40°C for 5 minutes) and flow cell was washed with PR-2. The flow cell was then inserted into a sequencer for bridge amplification (24 cycles) and sequencing. This method demonstrates that microbes may be trapped within on-flow cell hydrogel structures and that genomic library preparation and sequencing of the library may be performed directly on the flow cell.

EXAMPLE 3: On-flow cell integration of library preparation from mammalian cells

[0079] The following example demonstrates on-flow cell encapsulation, lysis, library preparation and sequencing of genomic material from mammalian cells.

[0080] A hydrogel solution of 10%T was prepared from a 40% (w/v) acrylamide/ N‚N'bis(acryloyl)cystamine (BA Cy) (19: 1) monomer stock solution (3.8 g of acrylamide, 0.2 g of BACy, and 6 mL of PBS), with 1 mg/mL of LAP photoinitiator and mammalian cells (GM 12878 cells).

The solution was introduced into a MiSeq™ flow cell and the flow cell was exposed to collimated UV light (OAI mask aligner, power in the range of ~30-40 mW/cm®) through a chrome mask (HTA Photomasks) patterned with 200-500 um circular features to form the hydrogel structures encapsulating the cells. The flow cell was then washed with PBS.

[0081] Cells are lysed with ChargeSwitch Lysis Buffer and proteinase K (10 minutes, 50°C).

The flow cell was washed with PR-2 and tagmentation enzyme solution was added to the flow cell (55°C for 15 minutes) followed by a PR-2 wash and an incubation with Tagmentation Stop buffer (10 minutes at 37°C). The flow cell was washed with PR-2 and AMS-1 enzyme was incubated at 50°C for 5 minutes.

The library was then denatured with an NaOH 0.1 M wash, followed by an HT-2 wash and an incubation with HT-1 for 5 minutes. The flow cell was loaded with mineral oil with surfactants and DTT (312.5 uL of mineral oil + 4.5% Span 80, 0.4% Tween 20, and 0.05% Triton X-100 and 0.5 pL of 12 mg DTT/400 uL EtOH) and incubated at a temperature ramp of 60°C, 40°C and 20°C.

[0082] The flow cell was washed with HT-1. followed by an incubation with AMS-1 (50°C for 5 minutes). Any remaining hydrogel was cleaved with CLM (40°C for 5 minutes) and the flow cell was washed with PR-2. The flow cell was inserted into a MiSeq™ sequencer for bridge amplification (24 cycles) and subsequent sequencing. This method demonstrates that mammalian cells may be trapped within on-flow cell hydrogel structures and that genomic library preparation and sequencing of the library may be performed directly on the flow cell. EXAMPLE 4: On-flow cell integration of amplicon sequencing from genomic DNA

[0083] This example illustrates on-flow cell integration of amplicon sequencing, wherein genomic DNA was encapsulated in hydrogel structures for subsequent amplification of target regions, addition of sequencing primers, seeding and sequencing.

[0084] Genomic DNA was encapsulated in hydrogel structures by first mixing genomic DNA with a hydrogel solution of 10%T was prepared from a 40% (w/v) acrylamide/ N.N'bis(acrvlovl)cystamine (BA Cy) (19: 1) monomer stock solution (3.8 g of acrylamide, 0.2 g of BACy, and 6 mL of PBS), with 1 mg/mL of LAP photoinitiator. This hydrogel precursor solution was introduced into a MiSeq™ flow cell. The flow cell was exposed to collimated UV light (OAI mask aligner, power in the range of ~30-40 mW/cm®) through a chrome mask (HTA Photomasks) patterned with 200 um circular features, resulting in the formation of hydrogel pillars containing genomic DNA. Excess solution and DNA was washed out with PR-2.

[0085] 10 uL of 1 uM oligo pair (forward and reverse primer pairs containing target sequence and Illumina adapter sequence overhang) was mixed with 25 pL of KAPA HiFi 2X mix (Roche) and 5 uL Resuspension Buffer and introduced into the flow cell. PCR was performed on a thermal cycler using the following program: 92°C for 5 minutes, 25 cycles of: (i) 92°C 30 seconds, (ii) 55°C 30 seconds and (iii) 72°C for 2 minutes, 72°C for 5 minutes. The flow cell was then washed with PR-2.

[0086] Next, 8 cycles of PCR are run using the thermal cycler program described in the previous paragraph, this time with 5 uL of Nextera XT Primer 1, 5 pL of Nextera XT Primer 2, 25 uL KAPA HiFi 2X mix, 15 pL PCR grade water. The flow cell was then washed with PR-2.

[0087] Library molecules are denatured with an NaOH 0.1 M wash, followed by an HT-2 wash and an incubation with HT-1 for 5 minutes. The flow cell was loaded with mineral oil with surfactants and DTT (312.5 pL of mineral oil + 4.5% Span 80, 0.4% Tween 20, and 0.05% Triton X-100 and 0.5 pL of 12 mg DTT/400 uL EtOH) and incubated at a temperature ramp of 60°C, 40°C and 20°C. The flow cell was washed with HT-1, followed by an incubation with AMS-1 (50°C for 5 minutes). Any remaining hydrogel was cleaved with CLM (40°C for 5 minutes) and the flow cell was washed with PR-2. The flow cell was then inserted into a MiSeq™ sequencer for bridge amplification (24 cycles) and subsequent sequencing. This method demonstrates that genomic DNA may be encapsulated within on-flow cell hydrogel structures and that subsequent amplification of target regions, addition of sequencing primers, seeding and sequencing may be performed on the flow cell.

[0088] In the examples disclosed herein, each individual hydrogel structure contains a sequencing library produced from the genetic material or nucleic acid contained within the hydrogel structure. Accordingly, a sequencing library seeded from a single hydrogel structure corresponds to the nucleic acid that was encapsulated within that hydrogel structure. Because seeding occurs in close proximity to the footprint on the flow cell of each hydrogel structure, the seeded sequencing library from cach structure is spatially segregated (or "indexed") on the flow cell based on the location of the structure.

[0089] The foregoing description is provided to enable a person skilled in the art to practice the various configurations described herein. While the subject technology has been particularly described with reference to the various figures and configurations, it should be understood that these are for illustration purposes only and should not be taken as limiting the scope of the subject technology.

[0090] All literature and similar material cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and web pages, regardless of the format of such literature and similar materials, are expressly incorporated by reference in their entirety. In the event that one or more of the incorporated references and similar materials differs from or contradicts this application, including but not limited to defined terms, term usage, described techniques, or the like, this application controls.

[0091] As used herein, the singular forms "a," "an," and "the," refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term "comprising" as used herein is synonymous with “including,” "containing," or "characterized by." and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described herein. Unless context indicates otherwise, the recitations of numerical ranges by endpoints include all numbers subsumed within that range. Furthermore, references to “one implementation” are not intended to be interpreted as excluding the existence of additional implementations that also incorporate the recited features. Moreover, unless explicitly stated to the contrary, implementations “comprising” or “having” an element or a plurality of elements having a particular property may include additional elements whether or not they have that property.

[0092] The terms “substantially” and “about” used throughout this specification are used to describe and account for small fluctuations, such as due to variations in processing. For example, they can refer to less than or equal to £5%, such as less than or equal to £2%, such as less than or equal to

+1%, such as less than or equal to 0.5%, such as less than or equal to £0.2%, such as less than or equal to +0. 1%, such as less than or equal to £0.05%, and/or 0%.

[0093] There may be many other ways to implement the subject technology. Various functions and elements described herein may be partitioned differently from those shown without departing from the scope of the subject technology. Various modifications to these implementations may be readily apparent to those skilled in the art. and generic principles defined herein may be applied to other implementations. Thus, many changes and modifications may be made to the subject technology, by one having ordinary skill in the art, without departing from the scope of the subject technology. For instance, different numbers of a given module or unit may be employed, a different type or types of a given module or unit may be emploved, a given module or unit may be added, or a given module or unit may be omitted.

[0094] Underlined and/or italicized headings and subheadings are used for convenience only, do not limit the subject technology, and are not referred to in connection with the interpretation of the description of the subject technology. All structural and functional equivalents to the elements of the various implementations described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and intended to be encompassed by the subject technology. Moreover, nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the above description.

[0095] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein.

[0096] The disclosure also includes the following clauses: 1 A method for making on-flow cell three-dimensional polymer structures, comprising: loading a polymer precursor solution onto a flow cell, wherein the polymer precursor solution includes a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polymer precursor solution, and wherein the at least one channel has an upper interior surface and a lower interior surface; and illuminating the polymer precursor solution through a patterned photomask using a light at a wavelength sufficient to activate the photoinitiator, wherein activation of the photoinitiator polymerizes at least some of the polymer precursor solution underneath apertures in the patterned photomask and forms three-dimensional polymer structures that extend from the upper interior surface to the lower interior surface of the at least one channel.

2. The method of clause 1, further comprising washing unpolymerized polymer precursor solution out of the flow cell.

3. The method of any of clauses 1-2, further comprising cleaving at least some of the three- dimensional polymer structures from the flow cell using heat, cleaving chemicals, or a combination of heat and cleaving chemicals.

4. The method of any of clauses 1-3, wherein the flow cell has oligonucleotides of predetermined lengths on both the upper and lower surfaces of the at least one channel, and wherein the oligonucleotides include primers.

5. The method of any of clauses 1-4, wherein the polymer is a hydrogel.

6. The method of any one of clauses 1-5, wherein the monomer is the compound of formula I:

WS

I wherein each R? is independently hydrogen or (Cy) alkyl.

7. The method of any one of clauses 1-6. wherein the crosslinker is a compound of formula IT: RY a 0 wherein: each n is independently an integer from 1-6; and each R! is independently hydrogen or (C.) alkyl.

8. The method of any one of clauses 1-7, wherein the photoinitiator is a diazosulfonate initiator; a monoacylphosphineoxide (MAPO) salt: a bisacylphosphineoxide (BAPO) salt; or combinations thereof.

9. The method of any of clauses 1-8, wherein the monomer is acrylamide, the crosslinker is N,N'- Bis(acryloyl)cystamine ~~ (BACy), and the photomitiator 1s lithium phenyl-2.4,6- trimethylbenzoylphosphinate (LAP).

10. The method of any of clauses 1-9, wherein the polymer precursor solution includes polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N‚N'- Bis(acryloyl)cystamine (BACy), PEG. polypropylene oxide (PPO). polyacrylic acid, poly(hydroxvethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co- glycolic acid) (PLGA), polycaprolactone (PCL), poly (vinylsulfonic acid) (PVSA), poly(L- aspartic acid), poly(L- glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate. dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose. collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethyleneglycol diallyl ether, ethyleneglycol diacrylate, polymethyleneglycol diacrylate, polyethyleneglycol diacrylate, trimethylopropoane trimethacrylate, ethoxylated trimethylol triacrylate, ethoxylated pentaerythritol tetracrylate, or ~~ combinations thereof.

11. The method of any of clauses 1-9, wherein the polymer precursor solution includes polvethylene glveol (PEG)-thiol/PEG-acrylate; acrylamide/N,N'-bis(acrylovl)eystamine (BACy); PEG/polypropylene oxide (PPO), or combinations thereof.

12. The method of any of clauses 1-11, wherein the photomask comprises polyethylene terephthalate, carbon ink, a chemically etched metal film, or combinations thereof.

13. The method of any of clauses 1-12 wherein the photomask is laminated to the upper exterior surface of the flow cell.

14. The method of any of clauses 1-13, further comprising a light source to emit the light, ~~ wherein the light source is an ultraviolet light source.

15. The method of any of clauses 1-14, wherein the three-dimensional polymer structures are cylindrical.

16. The method of any of clauses 1-14, wherein the three-dimensional polymer structures are reverse C-shaped.

17. A method for making on-flow cell three-dimensional polymer structures, comprising: loading a polymer precursor solution onto a flow cell, wherein the polymer precursor solution includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polvmer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper and lower surfaces of the at least one channel; and illuminating the polymer precursor solution through a patterned photomask using a light source that emits light at a wavelength that activates the photoinitiator, and wherein activation of the photoinitiator polymerizes at least some of the polymer precursor solution underneath apertures in the photomask and forms three-dimensional polymer structures that extend from the upper interior surface to the lower interior surface of the at least one channel, and wherein the biological cells or IO colonies of biological cells are compartmentalized in the three-dimensional polymer structures.

18. The method of clause 17, further comprising washing unpolymerized polymer precursor solution out of the flow cell.

19. The method of any of clauses 17-18, further comprising diffusing reagents into the three- dimensional polymer structures. wherein the reagents include lysis reagents that lyse the biological cells and release the genetic material therefrom, and wherein the genetic material includes nucleic acid.

20. The method of clause 19, further comprising fragmenting the released nucleic acid and ligating adapters to the ends of the nucleic acid fragments.

21. The method of clause 20, further comprising seeding the nucleic acid fragments on the upper and lower surfaces of the at least one sequencing channel by: introducing a diffusion barrier into the at least one channel, heating the flow cell to a temperature that cleaves the polymer structures and releases the nucleic acid fragments therefrom, hybridizing the nucleic acid fragments to the oligonucleotides on the upper and lower surfaces of the at least one channel, and washing the cleaved polymer structures out of the flow cell.

22. The method of clause 21, further comprising clonally amplifying the hybridized nucleic acid using bridge amplification to create clusters for nucleic acid.

23. The method of any of clauses 21-22, wherein the polymer is a hydrogel and wherein the diffusion barrier includes a hydrophobic liquid or a viscous aqueous solution, wherein the hydrophobic liquid includes mineral oil, silicone oil, or perfluorinated oil, or combinations thereof, and wherein the viscous aqueous solution, includes polyethylene glycol (PEG), polyvinyl-pyrrolidone, pluronic dextran, sucrose, poly (N -isopropylacrylamide) or polyethylene oxide-polypropvlene oxide-polyethylene oxide, PEO-PPO- PEOyiaponite or combinations thereof.

24. The method of any one of clauses 17-23, wherein the monomer is the compound of formula I: ; ì wherein each R? is independently hydrogen or (Cy) alkyl.

25. The method of any one of clauses 17-24, wherein the crosslinker is a compound of formula II:

I wherein: each n is independently an integer from 1-6; and each R' is independently a hydrogen or (C1.<) alkyl.

26. The method of any one of clauses 17-25, wherein the photoinitiator 1s a diazosulfonate initiator; a monoacylphosphineoxide (MAPO) salt; a bisacylphosphineoxide (BAPO) salt: or combinations thereof.

27. The method of any of clauses 17-25, wherein the monomer is acrylamide, the crosslinker is N,N'-Bis(acrvloyl)evstamine (BACy), and the photoinitiator is lithium ~~ phenyl-2,4.6- trimethylbenzoylphosphinate (LAP).

28. The method of any of clauses 17-26, wherein the polymer precursor solution includes polvethylene glycol (PEG)-thiol, PEG-acrylate. acrylamide, N.N'-Bis(acrylovl)eystamine (BAC), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), polv(methyl methacrylate) (PMMA), poly{N- isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly{lactic-co-glycolic acid) (PLGA). polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid). poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethvleneglycol diallyl ether, ethyleneglycol diacrvlate, polymethyleneglycol diacrylate, polvethyleneglvcol diacrylate, trimethylopropoane trimethacrylate, cthoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetracrylate. or combinations thereof.

29. The method of any of clauses 17-26, wherein the polymer precursor solution includes polyethylene glycol (PEG)-thiol/PEG-acrylate; acrylamide/N,N'-bis(acryloyl)cystamine (BACy): PEG/polypropylene oxide (PPO): or combinations thereof.

30. The method of any of clauses 17-29, wherein the photomask is polyethylene terephthalate, carbon ink, or a chemically etched metal film.

31. The method of any of clauses 17-30 wherein the photomask is laminated to the upper exterior surface of the flow cell.

32. The method of any of clauses 17-31, wherein the light source is an ultraviolet light source.

33. The method of any of clauses 17-32, wherein the three-dimensional polymer structures are cylindrical.

34. The method of any of clauses 17-32, wherein the three-dimensional polymer structures are reverse C-shaped.

35. The method of any of clauses 17-34, wherein the biological cells are mammalian.

36. The method of any of clauses 17-34, wherein the biological cells are bacterial.

37. The method of clause 17-36, wherein the nucleic acid is deoxyribonucleic acid.

38. The method of clause 17-36, wherein the nucleic acid is ribonucleic acid.

39. A method for making on-flow cell three-dimensional polymer structures, comprising: loading a hydrogel precursor solution onto a flow cell, wherein the hydrogel precursor solution includes biological cells or colonies of biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell includes at least one channel for receiving the polymer precursor solution, wherein the at least one channel has an upper interior surface and a lower interior surface, and wherein primers are bound to both the upper interior surface and lower interior surface of the at least one channel; illuminating the hydrogel precursor solution through a patterned photomask using a light source that emits light at a wavelength that activates the photoinitiator, and wherein activation of the photoinitiator polymerizes at least some of the hydrogel precursor solution underneath apertures in the photomask and forms three-dimensional hydrogel structures that extend from the upper interior surface to the lower interior surface of the at least one channel, and wherein the biological cells or colonies of biological cells are compartmentalized in the three-dimensional hydrogel structures;

diffusing a lysis reagent into the three-dimensional hydrogel structures, wherein the lysis reagent lyses the biological cells and releases the genetic material therefrom. and wherein the genetic material includes nucleic acid; fragmenting the released nucleic acid and ligating adapters to the ends of the fragments; and seeding the nucleic acid fragments on the upper interior surface and lower interior surface of the at least one channel by: introducing a diffusion barrier into the at least one channel, wherein the diffusion barrier prevents cross-contamination between hydrogel structures, heating the flow cell to a temperature that cleaves the hydrogel structures and releases the nucleic acid fragments, hybridizing the nucleic acid fragments to the primers on the upper and lower mterior surfaces of the at least one channel, and washing the cleaved hydrogel structures out of the flow cell; and clonally amplifying the hybridized nucleic acid fragments to create clusters for sequencing.

40. The method of clause 39, wherein the monomer is the compound of formula I:

Q 82

I wherein each R? is independently hydrogen or (C,) alkyl. 4]. The method of any one of clauses 39-40, wherein the crosslinker is a compound of formula II: In wherein: cach n is independently an integer from 1-6: and each R' is independently a hydrogen or (C1.£) alkyl. 42, The method of any one of clauses 39-41, wherein the photoinitiator is a diazosulfonate initiator; a monoacylphosphineoxide (MAPO) salt; a bisacylphosphineoxide (BAPO) salt; or combinations thereof.

43. The method of any of clauses 39-42, wherein the monomer is acrylamide, the crosslinker 1s N.N'-Bis(acrvloyl)cystamine (BACYy). and the photoinitiator is lithium phenyl-2,4,6- trimethylbenzoylphosphinate (LAP).

44. The method of any of clauses 39-42, wherein the hydrogel precursor solution includes polyethylene glvcol (PEG)-thiol, PEG-acrylate, acrylamide, N‚N'- Bis(acryloyl}cystamme (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA). poly(lactic-co- glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L- glutamic acid), polvlysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethyleneglycol diallyl ether, ethyleneglycol diacrylate, polvmethyleneglycol diacrylate, polyethyleneglycol diacrylate, trimethylopropoane trimethacrvlate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetracrylate, or combinations thereof.

45. The method of any of clauses 39-42, wherein the hydrogel precursor solution includes polyethylene glveol (PEG)-thiol/PEG-acrylate:acrylamide/N,N'-bis(acryloyl)cystamine (BACy): PEG/polvpropvlene oxide (PPO); or combinations thereof.

46. The method of any of clauses 33-36, wherein the diffusion barrier includes a hydrophobic liquid or a viscous aqueous solution, wherein the hydrophobic liquid includes mineral oil, silicone oil, or perfluorinated oil, or combinations thereof, and wherein the viscous aqueous solution, includes polyethylene glycol (PEG), polyvinyl-pyrrolidone, pluronic dextran, sucrose, poly (N -isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polyethylene oxide, PEO-PPO- PEOviaponite, or combinations thereof.

47. The method of any of clauses 39-46, wherein the photomask is polvethylene terephthalate, carbon ink, or a chemically etched metal film, and wherein the photomask is laminated to the upper exterior surface of the flow cell.

48. The method of any of clauses 39-47, wherein the light source is an ultraviolet light source.

49. The method of any of clauses 39-48, wherein the hydrogel structures are cylindrical.

50. The method of any of clauses 39-48, wherein the hydrogel structures are reverse C- shaped.

51. The method of any of clauses 39-50, wherein the biological cells are mammalian.

52. The method of any of clauses 39-50, wherein the biological cells are bacterial.

53. The method of any of clauses 39-32, wherein the nucleic acid is deoxyribonucleic acid.

54. The method of any of clauses 39-52, wherein the nucleic acid is ribonucleic acid.

55. A flow cell. comprising: a channel, wherein the channel includes an upper interior surface having primers coated thereon and a lower interior surface having primers coated thereon; and reversible, permeable, three-dimensional polymer structures in the channel from a polymer precursor solution, wherein the three-dimensional polymer structures extend from the upper interior surface of the channel to the lower interior surface of the channel.

56. The flow cell of clause 55, further comprising a photomask placed over an outer exterior surface of the channel.

57. The flow cell of any of clauses 55-36, wherein the three-dimensional polymer structures are cylindrical, reverse C-shaped, tubular, or combinations thereof.

58. The flow cell of any of clauses 55-57, wherein the three-dimensional polymer structures include hydrogels.

59. The flow cell of any of clauses 55-38, wherein the flow cell, polymer precursor solutions, and photomask are provided in a kit.

20200127 Sequence listing.txt

SEQUENCE LISTING <110> Illumina, Inc, San Diego, California, US <120> On-flow cell three-dimensional polymer structures <130> P168532NL00/36/JED <140> NL2024527 <141> 2019-12-20 <160> 2 <170> BiSSAP 1.3.6 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide P5 <400> 1 aatgatacgg cgaccaccga 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide P7 <400> 2 caagcagaag acggcatacg a 21 Page 1

Claims

CONCLUSIONS

A method for manufacturing flow cell three-dimensional polymer structures comprising: - loading a polymer precursor solution into a flow cell, wherein the polymer precursor solution comprises a monomer, a crosslinker, and a photoinitiator, and wherein the flow cell has at least one receiving channel of the polymer precursor solution, and wherein the at least one channel has an upper inner surface and a lower inner surface; and - exposing the polymer precursor solution through a patterned photomask using a light at a wavelength sufficient to activate the photoinitiator, wherein activation of the photoinitiator at least partially polymerizes the polymer precursor solution below openings in the patterned photomask and three-dimensional polymer structures which extend from the upper inner surface to the lower inner surface of the at least one channel.

The method of claim 1, additionally comprising washing unpolymerized polymer precursor solution from the flow cell.

The method of any one of claims 1 to 2, additionally comprising cleaving at least some of the three-dimensional polymer structures from the flow cell using heat, cleavage chemicals, or a combination of heat and cleavage chemicals.

The method of any one of claims 1 to 3, wherein the flow cell has oligonucleotides of predetermined lengths on both the upper and lower faces of the at least one channel, and wherein the oligonucleotides have primers.

A method according to any one of claims 1 to 4, wherein the polymer is a hydrogel.

A method according to any one of claims 1 to 5, wherein the monomer is the substance of the formula I:

I where each R? independently hydrogen or (C1) alkyl.

A method according to any one of claims 1 to 6, wherein the crosslinker is a substance 1s of the formula IT: #0 or

II where: each n is independently an integer from 1 —61s; and each R! independently hydrogen or (C 1 ) alkyl.

The method of any one of claims 1 to 7, wherein the photoinitiator is a diazosulfonate initiator, a monoacylphosphine oxide (MAPO) salt; a bisacylphosphine oxide (BAPO) salt; or combinations thereof.

The method of any one of claims 1 to 8, wherein the monomer is acrylamide, the crosslinker is N,N'-bis(acryloyl)cystamine (BACy), and the photoinitiator is lithium phenyl 2,4,6-trimethylbenzoylphosphinate (LAP).

The method of any one of claims 1 to 9, wherein the polymer precursor solution is polyethylene glycol (PEG) thiol, PEG acrylate, acrylamide, N,N'°-bis(acryloyl}cystamine (BACYy), PEG, propylene glycol (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), polylactic acid (PLA), poly(lactic-co-glycolic acid), polycaprolactone (PCL), poly(vinylsulfonic acid ) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin,

carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylol propane trimethacrylate, ethoxylated trimethyl ethacrylate or combination thereof.

The method of any one of claims 1 to 9, wherein the polymer precursor solution is polyethylene glycol (PEG) thiol / PEG acrylate, acrylamide / N, N'-bis(acryloyl/cystamine (BACY), PEG/propylene glycol (PPO), or combinations thereof includes.

The method of any one of claims 1 to 11, wherein the photomask comprises polyethylene terephthalate, carbon ink, a chemically etched metal film, or combinations thereof.

The method of any one of claims 1 to 12, wherein the photomask is laminated to the top outer surface of the flow cell.

A method according to any one of claims 1 to 13, additionally comprising a light source for emitting the light, the light source being an ultraviolet light source.

A method according to any one of claims 1 to 14, wherein the three-dimensional polymer structures are cylindrical.

A method according to any one of claims 1 to 14, wherein the three-dimensional polymer structures are inverted C-shaped.

A method of manufacturing flow cell three-dimensional polymer structures comprising: - loading a polymer precursor solution into a flow cell,

— wherein the polymer precursor solution comprises biological cells or colonies or biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and — wherein the flow cell comprises at least one channel for receiving the polymer precursor solution, and wherein the at least one channel has an upper inner surface and a lower inner surface, and wherein primers are bonded to both the upper and lower surfaces of the at least one channel, and — exposing the polymer precursor solution through a patterned photomask using a light source emitting light with a wavelength which activates the photoinitiator, and wherein activation of the photoinitiator at least partially polymerizes the polymer precursor solution below openings in the patterned photomask and forms three-dimensional polymer structures extending from the upper inner surface to the lower inner surface of the at least one channel, and wherein the biological cells or colonies or biological cells are compartmentalized in the three-dimensional polymer structures.

The method of claim 17, additionally comprising washing unpolymerized polymer precursor solution from the flow cell.

The method of any one of claims 17 to 18, additionally allowing reagents to diffuse into the three-dimensional polymer structures, the reagents comprising lysis reagents which lyse the biological cells and release the genetic material thereof, and wherein the genetic material comprises nucleic acid.

The method of claim 19, additionally comprising fragmenting the released nucleic acid and coupling adapters to the ends of the nucleic acid fragments.

The method of claim 20, additionally depositing the nucleic acid fragments on the upper and lower faces of the at least one sequence channel by: introducing a diffusion barrier into the at least one channel,

- heating the flow cell to a temperature which cleaves the polymer structures and releases the nucleic acid fragments thereof, - hybridizing the nucleic acid fragments to the oligonucleotides on the upper and lower faces of the at least one channel; and — washing the cleaved polymer structures from the flow cell.

The method of claim 21, further comprising cloned amplification of the hybridized nucleic acid using bridging amplification to form nucleic acid clusters.

The method of any one of claims 21 to 22, wherein the polymer is a hydrogen and wherein the diffusion barrier comprises a hydrophobic liquid or a viscous aqueous solution, the hydrophobic liquid being mineral oil, silicone oil, or perfluorinated oil, or combinations thereof. and wherein the viscous aqueous solution comprises polyethylene glycol (PEG), polyvinylpyrrolidone, Pluronic dextran, sucrose, poly(N-isopropylacrylamide) or polyethyleneoxide-polypropyleneoxide-polyethyleneoxide, 'PEO-PPO-PEOyiaponite', or combinations thereof.

Process according to any one of claims 17 to 23, wherein the monomer is the substance 1s of the formula I:

I where each R? independently hydrogen or (C16)alkyl.

A method according to any one of claims 17 to 24, wherein the crosslinker is a substance of the formula II:

TI where: each n is independently an integer from 1-6; and every R! independently hydrogen or (C 1 ) alkyl.

A method according to any one of claims 17 to 25, wherein the photoinitiator is a diazosulfonate initiator; a monoacylphosphine oxide (MAPO) salt; a bisacylphosphine oxide (BAPO) salt; or combinations thereof.

The method of any one of claims 17 to 25, wherein the monomer is acrylamide, the crosslinker is N,N'-bis(acryloyl)cystamine (BACy), and the photoinitiator is lithium phenyl 2,4,6-trimethylbenzoylphosphinate (LAP).

The method of any one of claims 17 to 26, wherein the polymer precursor solution is polyethylene glycol (PEG) thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, propylene glycol (PPO), polyacrylic acid , poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), polylactic acid (PLA), poly(lactic-co-glycolic acid), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, ethoxylated pentaerythritol tetraacrylate, or combinations thereof.

A method according to any one of claims 17 to 26, wherein the polymer precursor solution is polyethylene glycol (PEG) thiol / PEG acrylate, acrylamide / N, N'-bis(acryloyl) cystamine (BACy), PEG / propylene glycol (PPO), or combinations thereof.

A method according to any one of claims 17 to 29, wherein the photomask comprises polyethylene terephthalate, carbon ink, or a chemically etched metal film.

The method of any one of claims 17 to 30, wherein the photomask is laminated to the top outer surface of the flow cell.

A method according to any one of claims 17 to 31, wherein the light source is an ultraviolet light source 1s.

The method of any one of claims 17 to 32, wherein the three-dimensional polymer structures are cylindrical.

The method of any one of claims 17 to 32, wherein the three-dimensional polymer structures are inverted C-shaped.

The method of any one of claims 17 to 34, wherein the biological cells are mammalian cells.

The method of any one of claims 17 to 34, wherein the biological cells are bacteria.

The method of any one of claims 17 to 36, wherein the nucleic acid is deoxyribonucleic acid.

The method of any one of claims 17 to 36, wherein the nucleic acid IS ribonucleic acid.

A method of manufacturing flow cell three-dimensional polymer structures comprising: — loading a hydrogel precursor solution into a flow cell, — wherein the hydrogel precursor solution comprises biological cells or colonies or biological cells containing genetic material, a monomer, a crosslinker, and a photoinitiator, and — wherein the flow cell comprises at least one channel for receiving the polymer precursor solution, and wherein the at least one channel has an upper inner surface and a lower inner surface, and wherein primers are bound to both the upper and lower surfaces of the at least one channel, — exposing the hydrogel precursor solution through a patterned photomask using a light source which emits light of a wavelength which activates the photoinitiator, and wherein activation of the photoinitiator at least partially activates the hydrogel starting material solution down openings in the cartridge rd photomask polymerizes and forms three-dimensional polymer structures extending from the upper inner surface to the lower inner surface of the at least one channel, and wherein the biological cells or colonies or biological cells are compartmentalized in the three-dimensional polymer structures; - diffusing a lysis reagent into the three-dimensional hydrogel structures, wherein the lysis reagent lyses the biological cells and releases the genetic material thereof, and wherein the genetic material comprises nucleic acid.

- fragmenting the released nucleic acid and coupling adapters to the ends of the nucleic acid fragments; and - depositing the nucleic acid fragments on the upper and lower inner surfaces of the at least one channel by: - introducing a diffusion barrier into the at least one channel, the diffusion barrier preventing cross-contamination between hydrogel structures, - heating the flow cell to a temperature which cleaves the hydrogel structures and releases the nucleic acid fragments, — hybridizing the nucleic acid fragments to the primers on the upper and lower inner surfaces of the at least one channel, and

— washing the split hydrogel structures from the flow cell; and - cloning amplifying the hybridized nucleic acid fragments to form clusters for sequencing.

The method of claim 39, wherein the monomer is the substance of the formula I: 9 Re WN ay jr?

ON

I where each R? independently hydrogen or (C 1-6 ) alkyl.

A method according to any one of claims 39 to 40, wherein the crosslinker is a substance of the formula IT: R or ECE EE SN i 53 JEN

II where: each n is independently an integer from 1-6 1s; and every R! independently hydrogen or (C1) alkyl.

The method of any one of claims 39 to 41, wherein the photoinitiator is a diazosulfonate initiator; a monoacylphosphine oxide (MAPO) salt; a bisacylphosphine oxide (BAPO) salt; or combinations thereof.

The method of any one of claims 39 to 42, wherein the monomer is acrylamide, the crosslinker is N,N'-bis(acryloyl)cystamine (BACy) 1s, and the photoinitiator is lithium phenyl-2,4,6-trimethylbenzoylphosphinate. (LAP).

The method of any one of claims 39 to 42, wherein the polymer precursor solution is polyethylene glycol (PEG) thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, propylene glycol (PPO), polyacrylic acid , poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPA Am), polylactic acid (PLA), poly(lactic-co-glycolic acid), polycaprolactone (PCL), poly(vinylsulfonic acid ) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate , diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, ethoxylated pentaerythritol tetraacrylate, or combinations thereof.

The method of any one of claims 39 to 42, wherein the polymer precursor solution is polyethylene glycol (PEG) thiol/PEG-acrylate, acrylamide/N, N'-bis(acryloyl)cystamine (BACy), PEG/propylene glycol (PPO), or combinations thereof.

The method of any one of claims 33 to 36, wherein the diffusion barrier comprises a hydrophobic liquid or a viscous aqueous solution, wherein the hydrophobic liquid comprises mineral oil, silicone oil, or perfluorinated oil, or combinations thereof, and wherein the viscous aqueous solution comprises polyethylene glycol (PEG), polyvinylpyrrolidone, Pluronic dextran, sucrose, poly(N-isopropylacrylamide) or polyethyleneoxide-polypropyleneoxide-polyethyleneoxide, 'PEO-PPO-PEQyiaponite', or combinations thereof.

The method of any one of claims 39 to 46, wherein the photomask comprises polyethylene terephthalate, carbon ink, or a chemically etched metal film, and wherein the photomask is laminated to the upper outer surface of the flow cell.

The method of any one of claims 39 to 47, wherein the light source is an ultraviolet light source.

The method of any one of claims 39-48, wherein the three-dimensional hydrogel structures are cylindrical.

A method according to any one of claims 39-48, wherein the three-dimensional hydrogel structures are inverted C-shaped.

The method of any one of claims 39 to 50, wherein the biological cells are mammalian cells.

The method of any one of claims 39 to 50, wherein the biological cells are bacteria.

The method of any one of claims 39 to 52, wherein the nucleic acid is deoxyribonucleic acid.

The method of any one of claims 39 to 52, wherein the nucleic acid IS ribonucleic acid.

A flow cell comprising: a channel, the channel having an upper inner surface covering primers thereon and having a lower inner surface covering primers thereon comprising: and reversible. permeable, three-dimensional polymer structures in the channel from a polymer precursor solution, wherein the three-dimensional polymer structures extend from the upper inner surface of the channel to the lower inner surface of the channel.

The flow cell of claim 55, additionally comprising a photomask disposed over an outer outer surface of the channel.

The flow cell of any one of claims 55 to 56, wherein the three-dimensional polymer structures are cylindrical, inverted C-shaped, tubular, or a combination thereof.

The flow cell of any one of claims 55 to 57, wherein the three-dimensional polymer structures comprise hydrogels.

A flow cell according to any one of claims 55 to 58, wherein the flow cell, polymer precursor solutions and photomask are provided in a kit.